Sample records for base pair probability

  1. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs

    PubMed Central

    2017-01-01

    Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package. PMID:29107980

  2. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    NASA Astrophysics Data System (ADS)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  3. Distribution of Base Pair Alternations in a Periodic DNA Chain: Application of Pólya Counting to a Physical System

    NASA Astrophysics Data System (ADS)

    Hillebrand, Malcolm; Paterson-Jones, Guy; Kalosakas, George; Skokos, Charalampos

    2018-03-01

    In modeling DNA chains, the number of alternations between Adenine-Thymine (AT) and Guanine-Cytosine (GC) base pairs can be considered as a measure of the heterogeneity of the chain, which in turn could affect its dynamics. A probability distribution function of the number of these alternations is derived for circular or periodic DNA. Since there are several symmetries to account for in the periodic chain, necklace counting methods are used. In particular, Polya's Enumeration Theorem is extended for the case of a group action that preserves partitioned necklaces. This, along with the treatment of generating functions as formal power series, allows for the direct calculation of the number of possible necklaces with a given number of AT base pairs, GC base pairs and alternations. The theoretically obtained probability distribution functions of the number of alternations are accurately reproduced by Monte Carlo simulations and fitted by Gaussians. The effect of the number of base pairs on the characteristics of these distributions is also discussed, as well as the effect of the ratios of the numbers of AT and GC base pairs.

  4. Lesser scaup breeding probability and female survival on the yukon flats, Alaska

    USGS Publications Warehouse

    Martin, K.H.; Lindberg, M.S.; Schmutz, J.A.; Bertram, M.R.

    2009-01-01

    Information on the ecology of waterfowl breeding in the boreal forest is lacking, despite the boreal region's importance to continental waterfowl populations and to duck species that are currently declining, such as lesser scaup (Aythya affinis). We estimated breeding probability and breeding season survival of female lesser scaup on the Yukon Flats National Wildlife Refuge, Alaska, USA, in 2005 and 2006. We captured and marked 93 lesser scaup with radiotransmitters during prelaying and nesting periods. Although all marked lesser scaup females were paired throughout prelaying and incubation periods, we estimated breeding probability over both years as 0.12 (SE = 0.05, n = 67) using telemetry. Proportion of lesser scaup females undergoing rapid follicle growth at capture in 2006 was 0.46 (SE = 0.11, n = 37), based on concentration of yolk precursors in blood plasma. By combining methods based on telemetry, yolk precursors, and postovulatory follicles, we estimated maximum breeding probability as 0.68 (SE = 0.08, n = 37) in 2006. Notably, breeding probability was positively related to female body mass. Survival of female lesser scaup during the nesting and brood-rearing periods was 0.92 (SE = 0.05) in 2005 and 0.86 (SE = 0.08) in 2006. Our results suggest that breeding probability is lower than expected for lesser scaup. In addition, the implicit assumption of continental duck-monitoring programs that all paired females attempt to breed should be reevaluated. Recruitment estimates based on annual breeding-pair surveys may overestimate productivity of scaup pairs in the boreal forest. ?? The Wildlife Society.

  5. Natal and breeding philopatry in a black brant, Branta bernicla nigricans, metapopulation

    USGS Publications Warehouse

    Lindberg, Mark S.; Sedinger, James S.; Derksen, Dirk V.; Rockwell, Robert F.

    1998-01-01

    We estimated natal and breeding philopatry and dispersal probabilities for a metapopulation of Black Brant (Branta bernicla nigricans) based on observations of marked birds at six breeding colonies in Alaska, 1986–1994. Both adult females and males exhibited high (>0.90) probability of philopatry to breeding colonies. Probability of natal philopatry was significantly higher for females than males. Natal dispersal of males was recorded between every pair of colonies, whereas natal dispersal of females was observed between only half of the colony pairs. We suggest that female-biased philopatry was the result of timing of pair formation and characteristics of the mating system of brant, rather than factors related to inbreeding avoidance or optimal discrepancy. Probability of natal philopatry of females increased with age but declined with year of banding. Age-related increase in natal philopatry was positively related to higher breeding probability of older females. Declines in natal philopatry with year of banding corresponded negatively to a period of increasing population density; therefore, local population density may influence the probability of nonbreeding and gene flow among colonies.

  6. New Common Proper-Motion Pairs with R.A. Between 00h and 01h

    NASA Astrophysics Data System (ADS)

    Caballero, Rafael

    2015-07-01

    This paper presents 37 new common proper-motion pairs. The new pairs have been obtained employing a semi-automatic procedure based on the inspection of images using the tool Aladin, completed with information obtained from the catalogs available at VizieR. All the pairs fulfill the Halbwachs criteria, employed to increase the probability of a physical bond between the two components.

  7. Analysis of HIV-1 intersubtype recombination breakpoints suggests region with high pairing probability may be a more fundamental factor than sequence similarity affecting HIV-1 recombination.

    PubMed

    Jia, Lei; Li, Lin; Gui, Tao; Liu, Siyang; Li, Hanping; Han, Jingwan; Guo, Wei; Liu, Yongjian; Li, Jingyun

    2016-09-21

    With increasing data on HIV-1, a more relevant molecular model describing mechanism details of HIV-1 genetic recombination usually requires upgrades. Currently an incomplete structural understanding of the copy choice mechanism along with several other issues in the field that lack elucidation led us to perform an analysis of the correlation between breakpoint distributions and (1) the probability of base pairing, and (2) intersubtype genetic similarity to further explore structural mechanisms. Near full length sequences of URFs from Asia, Europe, and Africa (one sequence/patient), and representative sequences of worldwide CRFs were retrieved from the Los Alamos HIV database. Their recombination patterns were analyzed by jpHMM in detail. Then the relationships between breakpoint distributions and (1) the probability of base pairing, and (2) intersubtype genetic similarities were investigated. Pearson correlation test showed that all URF groups and the CRF group exhibit the same breakpoint distribution pattern. Additionally, the Wilcoxon two-sample test indicated a significant and inexplicable limitation of recombination in regions with high pairing probability. These regions have been found to be strongly conserved across distinct biological states (i.e., strong intersubtype similarity), and genetic similarity has been determined to be a very important factor promoting recombination. Thus, the results revealed an unexpected disagreement between intersubtype similarity and breakpoint distribution, which were further confirmed by genetic similarity analysis. Our analysis reveals a critical conflict between results from natural HIV-1 isolates and those from HIV-1-based assay vectors in which genetic similarity has been shown to be a very critical factor promoting recombination. These results indicate the region with high-pairing probabilities may be a more fundamental factor affecting HIV-1 recombination than sequence similarity in natural HIV-1 infections. Our findings will be relevant in furthering the understanding of HIV-1 recombination mechanisms.

  8. Approved Methods and Algorithms for DoD Risk-Based Explosives Siting

    DTIC Science & Technology

    2007-02-02

    glass. Pgha Probability of a person being in the glass hazard area Phit Probability of hit Phit (f) Probability of hit for fatality Phit (maji...Probability of hit for major injury Phit (mini) Probability of hit for minor injury Pi Debris probability densities at the ES PMaj (pair) Individual...combined high-angle and combined low-angle tables. A unique probability of hit is calculated for the three consequences of fatality, Phit (f), major injury

  9. Accelerating calculations of RNA secondary structure partition functions using GPUs

    PubMed Central

    2013-01-01

    Background RNA performs many diverse functions in the cell in addition to its role as a messenger of genetic information. These functions depend on its ability to fold to a unique three-dimensional structure determined by the sequence. The conformation of RNA is in part determined by its secondary structure, or the particular set of contacts between pairs of complementary bases. Prediction of the secondary structure of RNA from its sequence is therefore of great interest, but can be computationally expensive. In this work we accelerate computations of base-pair probababilities using parallel graphics processing units (GPUs). Results Calculation of the probabilities of base pairs in RNA secondary structures using nearest-neighbor standard free energy change parameters has been implemented using CUDA to run on hardware with multiprocessor GPUs. A modified set of recursions was introduced, which reduces memory usage by about 25%. GPUs are fastest in single precision, and for some hardware, restricted to single precision. This may introduce significant roundoff error. However, deviations in base-pair probabilities calculated using single precision were found to be negligible compared to those resulting from shifting the nearest-neighbor parameters by a random amount of magnitude similar to their experimental uncertainties. For large sequences running on our particular hardware, the GPU implementation reduces execution time by a factor of close to 60 compared with an optimized serial implementation, and by a factor of 116 compared with the original code. Conclusions Using GPUs can greatly accelerate computation of RNA secondary structure partition functions, allowing calculation of base-pair probabilities for large sequences in a reasonable amount of time, with a negligible compromise in accuracy due to working in single precision. The source code is integrated into the RNAstructure software package and available for download at http://rna.urmc.rochester.edu. PMID:24180434

  10. Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)

    NASA Astrophysics Data System (ADS)

    Risqi, A. M.; Yudiarsah, E.

    2017-07-01

    Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.

  11. Conflict Probability Estimation for Free Flight

    NASA Technical Reports Server (NTRS)

    Paielli, Russell A.; Erzberger, Heinz

    1996-01-01

    The safety and efficiency of free flight will benefit from automated conflict prediction and resolution advisories. Conflict prediction is based on trajectory prediction and is less certain the farther in advance the prediction, however. An estimate is therefore needed of the probability that a conflict will occur, given a pair of predicted trajectories and their levels of uncertainty. A method is developed in this paper to estimate that conflict probability. The trajectory prediction errors are modeled as normally distributed, and the two error covariances for an aircraft pair are combined into a single equivalent covariance of the relative position. A coordinate transformation is then used to derive an analytical solution. Numerical examples and Monte Carlo validation are presented.

  12. Estimation of occupancy, breeding success, and predicted abundance of golden eagles (Aquila chrysaetos) in the Diablo Range, California, 2014

    USGS Publications Warehouse

    Wiens, J. David; Kolar, Patrick S.; Fuller, Mark R.; Hunt, W. Grainger; Hunt, Teresa

    2015-01-01

    We used a multistate occupancy sampling design to estimate occupancy, breeding success, and abundance of territorial pairs of golden eagles (Aquila chrysaetos) in the Diablo Range, California, in 2014. This method uses the spatial pattern of detections and non-detections over repeated visits to survey sites to estimate probabilities of occupancy and successful reproduction while accounting for imperfect detection of golden eagles and their young during surveys. The estimated probability of detecting territorial pairs of golden eagles and their young was less than 1 and varied with time of the breeding season, as did the probability of correctly classifying a pair’s breeding status. Imperfect detection and breeding classification led to a sizeable difference between the uncorrected, naïve estimate of the proportion of occupied sites where successful reproduction was observed (0.20) and the model-based estimate (0.30). The analysis further indicated a relatively high overall probability of landscape occupancy by pairs of golden eagles (0.67, standard error = 0.06), but that areas with the greatest occupancy and reproductive potential were patchily distributed. We documented a total of 138 territorial pairs of golden eagles during surveys completed in the 2014 breeding season, which represented about one-half of the 280 pairs we estimated to occur in the broader 5,169-square kilometer region sampled. The study results emphasize the importance of accounting for imperfect detection and spatial heterogeneity in studies of site occupancy, breeding success, and abundance of golden eagles.

  13. A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities.

    PubMed

    Bastien, Olivier; Ortet, Philippe; Roy, Sylvaine; Maréchal, Eric

    2005-03-10

    Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons) and be the basis for a novel method of consistent and stable phylogenetic reconstruction. We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space) and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP) allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.

  14. A Framework for Final Drive Simultaneous Failure Diagnosis Based on Fuzzy Entropy and Sparse Bayesian Extreme Learning Machine

    PubMed Central

    Ye, Qing; Pan, Hao; Liu, Changhua

    2015-01-01

    This research proposes a novel framework of final drive simultaneous failure diagnosis containing feature extraction, training paired diagnostic models, generating decision threshold, and recognizing simultaneous failure modes. In feature extraction module, adopt wavelet package transform and fuzzy entropy to reduce noise interference and extract representative features of failure mode. Use single failure sample to construct probability classifiers based on paired sparse Bayesian extreme learning machine which is trained only by single failure modes and have high generalization and sparsity of sparse Bayesian learning approach. To generate optimal decision threshold which can convert probability output obtained from classifiers into final simultaneous failure modes, this research proposes using samples containing both single and simultaneous failure modes and Grid search method which is superior to traditional techniques in global optimization. Compared with other frequently used diagnostic approaches based on support vector machine and probability neural networks, experiment results based on F 1-measure value verify that the diagnostic accuracy and efficiency of the proposed framework which are crucial for simultaneous failure diagnosis are superior to the existing approach. PMID:25722717

  15. Pair Production Induced by Ultrashort and Ultraintense Laser Pulses in Plasmas

    NASA Astrophysics Data System (ADS)

    Luo, Yue-E.; Wang, Xue-Wen; Wang, Yuan-Sheng; Ji, Shen-Tong; Yu, Hong

    2018-06-01

    The probability of Schwinger pair production is calculated, which is induced by an ultraintense and ultrashort laser pulse propagating in a plasma. The dependence of the probability on the amplitude of the laser pulse and the frequency of plasmas is analyzed. Particularly, the effect of the pulse duration on the probability is discussed, by introducing a pulse-shape function to describe the temporal shape of the laser pulse. The results show that a laser with shorter pulse is more efficient in pair production. The probability of pair production increases when the order of the duration is comparable to the period of a laser.

  16. Application of Archimedean copulas to the impact assessment of hydro-climatic variables in semi-arid aquifers of western India

    NASA Astrophysics Data System (ADS)

    Wable, Pawan S.; Jha, Madan K.

    2018-02-01

    The effects of rainfall and the El Niño Southern Oscillation (ENSO) on groundwater in a semi-arid basin of India were analyzed using Archimedean copulas considering 17 years of data for monsoon rainfall, post-monsoon groundwater level (PMGL) and ENSO Index. The evaluated dependence among these hydro-climatic variables revealed that PMGL-Rainfall and PMGL-ENSO Index pairs have significant dependence. Hence, these pairs were used for modeling dependence by employing four types of Archimedean copulas: Ali-Mikhail-Haq, Clayton, Gumbel-Hougaard, and Frank. For the copula modeling, the results of probability distributions fitting to these hydro-climatic variables indicated that the PMGL and rainfall time series are best represented by Weibull and lognormal distributions, respectively, while the non-parametric kernel-based normal distribution is the most suitable for the ENSO Index. Further, the PMGL-Rainfall pair is best modeled by the Clayton copula, and the PMGL-ENSO Index pair is best modeled by the Frank copula. The Clayton copula-based conditional probability of PMGL being less than or equal to its average value at a given mean rainfall is above 70% for 33% of the study area. In contrast, the spatial variation of the Frank copula-based probability of PMGL being less than or equal to its average value is 35-40% in 23% of the study area during El Niño phase, while it is below 15% in 35% of the area during the La Niña phase. This copula-based methodology can be applied under data-scarce conditions for exploring the impacts of rainfall and ENSO on groundwater at basin scales.

  17. Robust prediction of consensus secondary structures using averaged base pairing probability matrices.

    PubMed

    Kiryu, Hisanori; Kin, Taishin; Asai, Kiyoshi

    2007-02-15

    Recent transcriptomic studies have revealed the existence of a considerable number of non-protein-coding RNA transcripts in higher eukaryotic cells. To investigate the functional roles of these transcripts, it is of great interest to find conserved secondary structures from multiple alignments on a genomic scale. Since multiple alignments are often created using alignment programs that neglect the special conservation patterns of RNA secondary structures for computational efficiency, alignment failures can cause potential risks of overlooking conserved stem structures. We investigated the dependence of the accuracy of secondary structure prediction on the quality of alignments. We compared three algorithms that maximize the expected accuracy of secondary structures as well as other frequently used algorithms. We found that one of our algorithms, called McCaskill-MEA, was more robust against alignment failures than others. The McCaskill-MEA method first computes the base pairing probability matrices for all the sequences in the alignment and then obtains the base pairing probability matrix of the alignment by averaging over these matrices. The consensus secondary structure is predicted from this matrix such that the expected accuracy of the prediction is maximized. We show that the McCaskill-MEA method performs better than other methods, particularly when the alignment quality is low and when the alignment consists of many sequences. Our model has a parameter that controls the sensitivity and specificity of predictions. We discussed the uses of that parameter for multi-step screening procedures to search for conserved secondary structures and for assigning confidence values to the predicted base pairs. The C++ source code that implements the McCaskill-MEA algorithm and the test dataset used in this paper are available at http://www.ncrna.org/papers/McCaskillMEA/. Supplementary data are available at Bioinformatics online.

  18. Information Theoretic Studies and Assessment of Space Object Identification

    DTIC Science & Technology

    2014-03-24

    localization are contained in Ref. [5]. 1.7.1 A Bayesian MPE Based Analysis of 2D Point-Source-Pair Superresolution In a second recently submitted paper [6], a...related problem of the optical superresolution (OSR) of a pair of equal-brightness point sources separated spatially by a distance (or angle) smaller...1403.4897 [physics.optics] (19 March 2014). 6. S. Prasad, “Asymptotics of Bayesian error probability and 2D pair superresolution ,” submitted to Opt. Express

  19. Exact calculation of loop formation probability identifies folding motifs in RNA secondary structures

    PubMed Central

    Sloma, Michael F.; Mathews, David H.

    2016-01-01

    RNA secondary structure prediction is widely used to analyze RNA sequences. In an RNA partition function calculation, free energy nearest neighbor parameters are used in a dynamic programming algorithm to estimate statistical properties of the secondary structure ensemble. Previously, partition functions have largely been used to estimate the probability that a given pair of nucleotides form a base pair, the conditional stacking probability, the accessibility to binding of a continuous stretch of nucleotides, or a representative sample of RNA structures. Here it is demonstrated that an RNA partition function can also be used to calculate the exact probability of formation of hairpin loops, internal loops, bulge loops, or multibranch loops at a given position. This calculation can also be used to estimate the probability of formation of specific helices. Benchmarking on a set of RNA sequences with known secondary structures indicated that loops that were calculated to be more probable were more likely to be present in the known structure than less probable loops. Furthermore, highly probable loops are more likely to be in the known structure than the set of loops predicted in the lowest free energy structures. PMID:27852924

  20. PARTS: Probabilistic Alignment for RNA joinT Secondary structure prediction

    PubMed Central

    Harmanci, Arif Ozgun; Sharma, Gaurav; Mathews, David H.

    2008-01-01

    A novel method is presented for joint prediction of alignment and common secondary structures of two RNA sequences. The joint consideration of common secondary structures and alignment is accomplished by structural alignment over a search space defined by the newly introduced motif called matched helical regions. The matched helical region formulation generalizes previously employed constraints for structural alignment and thereby better accommodates the structural variability within RNA families. A probabilistic model based on pseudo free energies obtained from precomputed base pairing and alignment probabilities is utilized for scoring structural alignments. Maximum a posteriori (MAP) common secondary structures, sequence alignment and joint posterior probabilities of base pairing are obtained from the model via a dynamic programming algorithm called PARTS. The advantage of the more general structural alignment of PARTS is seen in secondary structure predictions for the RNase P family. For this family, the PARTS MAP predictions of secondary structures and alignment perform significantly better than prior methods that utilize a more restrictive structural alignment model. For the tRNA and 5S rRNA families, the richer structural alignment model of PARTS does not offer a benefit and the method therefore performs comparably with existing alternatives. For all RNA families studied, the posterior probability estimates obtained from PARTS offer an improvement over posterior probability estimates from a single sequence prediction. When considering the base pairings predicted over a threshold value of confidence, the combination of sensitivity and positive predictive value is superior for PARTS than for the single sequence prediction. PARTS source code is available for download under the GNU public license at http://rna.urmc.rochester.edu. PMID:18304945

  1. Assessing relative abundance and reproductive success of shrubsteppe raptors

    USGS Publications Warehouse

    Lehman, Robert N.; Carpenter, L.B.; Steenhof, Karen; Kochert, Michael N.

    1998-01-01

    From 1991-1994, we quantified relative abundance and reproductive success of the Ferruginous Hawk (Buteo regalis), Northern Harrier (Circus cyaneus), Burrowing Owl (Speotytoc unicularia), and Short-eared Owl (Asio flammeus) on the shrubsteppe plateaus (benchlands) in and near the Snake River Birds of Prey National Conservation Area in southwestern Idaho. To assess relative abundance, we searched randomly selected plots using four sampling methods: point counts, line transects, and quadrats of two sizes. On a persampling-effort basis, transects were slightly more effective than point counts and quadrats for locating raptor nests (3.4 pairs detected/100 h of effort vs. 2.2-3.1 pairs). Random sampling using quadrats failed to detect a Short-eared Owl population increase from 1993 to 1994. To evaluate nesting success, we tried to determine reproductive outcome for all nesting attempts located during random, historical, and incidental nest searches. We compared nesting success estimates based on all nesting attempts, on attempts found during incubation, and the Mayfield model. Most pairs used to evaluate success were pairs found incidentally. Visits to historical nesting areas yielded the highest number of pairs per sampling effort (14.6/100 h), but reoccupancy rates for most species decreased through time. Estimates based on all attempts had the highest sample sizes but probably overestimated success for all species except the Ferruginous Hawk. Estimates of success based on nesting attempts found during incubation had the lowest sample sizes. All three methods yielded biased nesting snccess estimates for the Northern Harrier and Short-eared Owl. The estimate based on pairs found during incubation probably provided the least biased estimate for the Burrowing Owl. Assessments of nesting success were hindered by difficulties in confirming egg laying and nesting success for all species except the Ferruginous hawk.

  2. Quantum correlation of fiber-based telecom-band photon pairs through standard loss and random media.

    PubMed

    Sua, Yong Meng; Malowicki, John; Lee, Kim Fook

    2014-08-15

    We study quantum correlation and interference of fiber-based telecom-band photon pairs with one photon of the pair experiencing multiple scattering in a random medium. We measure joint probability of two-photon detection for signal photon in a normal channel and idler photon in a channel, which is subjected to two independent conditions: standard loss (neutral density filter) and random media. We observe that both conditions degrade the correlation of signal and idler photons, and depolarization of the idler photon in random medium can enhance two-photon interference at certain relative polarization angles. Our theoretical calculation on two-photon polarization correlation and interference as a function of mean free path is in agreement with our experiment data. We conclude that quantum correlation of a polarization-entangled photon pair is better preserved than a polarization-correlated photon pair as one photon of the pair scatters through a random medium.

  3. Application of Monte Carlo cross-validation to identify pathway cross-talk in neonatal sepsis.

    PubMed

    Zhang, Yuxia; Liu, Cui; Wang, Jingna; Li, Xingxia

    2018-03-01

    To explore genetic pathway cross-talk in neonates with sepsis, an integrated approach was used in this paper. To explore the potential relationships between differently expressed genes between normal uninfected neonates and neonates with sepsis and pathways, genetic profiling and biologic signaling pathway were first integrated. For different pathways, the score was obtained based upon the genetic expression by quantitatively analyzing the pathway cross-talk. The paired pathways with high cross-talk were identified by random forest classification. The purpose of the work was to find the best pairs of pathways able to discriminate sepsis samples versus normal samples. The results found 10 pairs of pathways, which were probably able to discriminate neonates with sepsis versus normal uninfected neonates. Among them, the best two paired pathways were identified according to analysis of extensive literature. Impact statement To find the best pairs of pathways able to discriminate sepsis samples versus normal samples, an RF classifier, the DS obtained by DEGs of paired pathways significantly associated, and Monte Carlo cross-validation were applied in this paper. Ten pairs of pathways were probably able to discriminate neonates with sepsis versus normal uninfected neonates. Among them, the best two paired pathways ((7) IL-6 Signaling and Phospholipase C Signaling (PLC); (8) Glucocorticoid Receptor (GR) Signaling and Dendritic Cell Maturation) were identified according to analysis of extensive literature.

  4. Feedback-Driven Trial-by-Trial Learning in Autism Spectrum Disorders

    PubMed Central

    Solomon, Marjorie; Frank, Michael J.; Ragland, J. Daniel; Smith, Anne C.; Niendam, Tara A.; Lesh, Tyler A.; Grayson, David S.; Beck, Jonathan S.; Matter, John C.; Carter, Cameron S.

    2017-01-01

    Objective Impairments in learning are central to autism spectrum disorders. The authors investigated the cognitive and neural basis of these deficits in young adults with autism spectrum disorders using a well-characterized probabilistic reinforcement learning paradigm. Method The probabilistic selection task was implemented among matched participants with autism spectrum disorders (N=22) and with typical development (N=25), aged 18–40 years, using rapid event-related functional MRI. Participants were trained to choose the correct stimulus in high-probability (AB), medium-probability (CD), and low-probability (EF) pairs, presented with valid feedback 80%, 70%, and 60% of the time, respectively. Whole-brain voxel-wise and parametric modulator analyses examined early and late learning during the stimulus and feedback epochs of the task. Results The groups exhibited comparable performance on medium- and low-probability pairs. Typically developing persons showed higher accuracy on the high-probability pair, better win-stay performance (selection of the previously rewarded stimulus on the next trial of that type), and more robust recruitment of the anterior and medial prefrontal cortex during the stimulus epoch, suggesting development of an intact reward-based working memory for recent stimulus values. Throughout the feedback epoch, individuals with autism spectrum disorders exhibited greater recruitment of the anterior cingulate and orbito-frontal cortices compared with individuals with typical development, indicating continuing trial-by-trial activity related to feedback processing. Conclusions Individuals with autism spectrum disorders exhibit learning deficits reflecting impaired ability to develop an effective reward-based working memory to guide stimulus selection. Instead, they continue to rely on trial-by-trial feedback processing to support learning dependent upon engagement of the anterior cingulate and orbito-frontal cortices. PMID:25158242

  5. Exact calculation of loop formation probability identifies folding motifs in RNA secondary structures.

    PubMed

    Sloma, Michael F; Mathews, David H

    2016-12-01

    RNA secondary structure prediction is widely used to analyze RNA sequences. In an RNA partition function calculation, free energy nearest neighbor parameters are used in a dynamic programming algorithm to estimate statistical properties of the secondary structure ensemble. Previously, partition functions have largely been used to estimate the probability that a given pair of nucleotides form a base pair, the conditional stacking probability, the accessibility to binding of a continuous stretch of nucleotides, or a representative sample of RNA structures. Here it is demonstrated that an RNA partition function can also be used to calculate the exact probability of formation of hairpin loops, internal loops, bulge loops, or multibranch loops at a given position. This calculation can also be used to estimate the probability of formation of specific helices. Benchmarking on a set of RNA sequences with known secondary structures indicated that loops that were calculated to be more probable were more likely to be present in the known structure than less probable loops. Furthermore, highly probable loops are more likely to be in the known structure than the set of loops predicted in the lowest free energy structures. © 2016 Sloma and Mathews; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  6. Analyzing survival curves at a fixed point in time for paired and clustered right-censored data

    PubMed Central

    Su, Pei-Fang; Chi, Yunchan; Lee, Chun-Yi; Shyr, Yu; Liao, Yi-De

    2018-01-01

    In clinical trials, information about certain time points may be of interest in making decisions about treatment effectiveness. Rather than comparing entire survival curves, researchers can focus on the comparison at fixed time points that may have a clinical utility for patients. For two independent samples of right-censored data, Klein et al. (2007) compared survival probabilities at a fixed time point by studying a number of tests based on some transformations of the Kaplan-Meier estimators of the survival function. However, to compare the survival probabilities at a fixed time point for paired right-censored data or clustered right-censored data, their approach would need to be modified. In this paper, we extend the statistics to accommodate the possible within-paired correlation and within-clustered correlation, respectively. We use simulation studies to present comparative results. Finally, we illustrate the implementation of these methods using two real data sets. PMID:29456280

  7. Exact one-sided confidence limits for the difference between two correlated proportions.

    PubMed

    Lloyd, Chris J; Moldovan, Max V

    2007-08-15

    We construct exact and optimal one-sided upper and lower confidence bounds for the difference between two probabilities based on matched binary pairs using well-established optimality theory of Buehler. Starting with five different approximate lower and upper limits, we adjust them to have coverage probability exactly equal to the desired nominal level and then compare the resulting exact limits by their mean size. Exact limits based on the signed root likelihood ratio statistic are preferred and recommended for practical use.

  8. Scalar pair production in a magnetic field in de Sitter universe

    NASA Astrophysics Data System (ADS)

    Băloi, Mihaela-Andreea; Crucean, Cosmin; Popescu, Diana

    2018-05-01

    The production of scalar particles by the dipole magnetic field in de Sitter expanding universe is analyzed. The amplitude and probability of transition are computed using perturbative methods. A graphical study of the transition probability is performed obtaining that the rate of pair production is important in the early universe. Our results prove that in the process of pair production by the external magnetic field the momentum conservation law is broken. We also found that the probabilities are maximum when the particles are emitted perpendicular to the direction of magnetic dipole momentum. The total probability is computed and is analysed in terms of the angle between particles momenta.

  9. Triple helical DNA in a duplex context and base pair opening

    PubMed Central

    Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra

    2014-01-01

    It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466

  10. Study of a New CPM Pair 2Mass 14515781-1619034

    NASA Astrophysics Data System (ADS)

    Falcon, Israel Tejera

    2013-04-01

    In this paper I present the results of a study of 2Mass 14515781-1619034 as components of a common proper motion pair. Because PPMXL catalog's proper motion data not provide any information about secondary star, I deduced it independently, obtaining similar proper motions for both components. Halbwalchs' criteria indicates that this is a CPM ystem. The criterion of Francisco Rica, which is based on the compatibility of the kinematic function of the equatorial coordinates, indicates that this pair has a 99% probability of being a physical one (Rica, 2007). Also other important criteria (Dommanget, 1956, Peter Van De Kamp, 1961, Sinachopoulus, 1992, Close, 2003), indicate a physical system. With the absolute visual magnitude of both components, I obtained distance modulus 7.29 and 7.59, which put the components of the system at a distance of 287.1 and 329.6 parsecs. Taking into account errors in determining the magnitudes, this means that the probability that both components are situated at the same distance is 96%. I suggest that this pair be included in the WDS catalog.

  11. N-H Stretching Excitations in Adenosine-Thymidine Base Pairs in Solution: Base Pair Geometries, Infrared Line Shapes and Ultrafast Vibrational Dynamics

    PubMed Central

    Greve, Christian; Preketes, Nicholas K.; Fidder, Henk; Costard, Rene; Koeppe, Benjamin; Heisler, Ismael A.; Mukamel, Shaul; Temps, Friedrich; Nibbering, Erik T. J.; Elsaesser, Thomas

    2013-01-01

    We explore the N-H stretching vibrations of adenosine-thymidine base pairs in chloroform solution with linear and nonlinear infrared spectroscopy. Based on estimates from NMR measurements and ab initio calculations, we conclude that adenosine and thymidine form hydrogen bonded base pairs in Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen configurations with similar probability. Steady-state concentration- and temperature dependent linear FT-IR studies, including H/D exchange experiments, reveal that these hydrogen-bonded base pairs have complex N-H/N-D stretching spectra with a multitude of spectral components. Nonlinear 2D-IR spectroscopic results, together with IR-pump-IR-probe measurements, as also corroborated by ab initio calculations, reveal that the number of N-H stretching transitions is larger than the total number of N-H stretching modes. This is explained by couplings to other modes, such as an underdamped low-frequency hydrogen-bond mode, and a Fermi resonance with NH2 bending overtone levels of the adenosine amino-group. Our results demonstrate that modeling based on local N-H stretching vibrations only is not sufficient and call for further refinement of the description of the N-H stretching manifolds of nucleic acid base pairs of adenosine and thymidine, incorporating a multitude of couplings with fingerprint and low-frequency modes. PMID:23234439

  12. Secondary structure of the 3'-noncoding region of flavivirus genomes: comparative analysis of base pairing probabilities.

    PubMed

    Rauscher, S; Flamm, C; Mandl, C W; Heinz, F X; Stadler, P F

    1997-07-01

    The prediction of the complete matrix of base pairing probabilities was applied to the 3' noncoding region (NCR) of flavivirus genomes. This approach identifies not only well-defined secondary structure elements, but also regions of high structural flexibility. Flaviviruses, many of which are important human pathogens, have a common genomic organization, but exhibit a significant degree of RNA sequence diversity in the functionally important 3'-NCR. We demonstrate the presence of secondary structures shared by all flaviviruses, as well as structural features that are characteristic for groups of viruses within the genus reflecting the established classification scheme. The significance of most of the predicted structures is corroborated by compensatory mutations. The availability of infectious clones for several flaviviruses will allow the assessment of these structural elements in processes of the viral life cycle, such as replication and assembly.

  13. Sauter-Schwinger pair creation dynamically assisted by a plane wave

    NASA Astrophysics Data System (ADS)

    Torgrimsson, Greger; Schneider, Christian; Schützhold, Ralf

    2018-05-01

    We study electron-positron pair creation by a strong and constant electric field superimposed with a weaker transversal plane wave which is incident perpendicularly (or under some angle). Comparing the fully nonperturbative approach based on the world-line instanton method with a perturbative expansion into powers of the strength of the weaker plane wave, we find good agreement—provided that the latter is carried out to sufficiently high orders. As usual for the dynamically assisted Sauter-Schwinger effect, the additional plane wave induces an exponential enhancement of the pair-creation probability if the combined Keldysh parameter exceeds a certain threshold.

  14. Design of an activity landscape view taking compound-based feature probabilities into account.

    PubMed

    Zhang, Bijun; Vogt, Martin; Bajorath, Jürgen

    2014-09-01

    Activity landscapes (ALs) of compound data sets are rationalized as graphical representations that integrate similarity and potency relationships between active compounds. ALs enable the visualization of structure-activity relationship (SAR) information and are thus computational tools of interest for medicinal chemistry. For AL generation, similarity and potency relationships are typically evaluated in a pairwise manner and major AL features are assessed at the level of compound pairs. In this study, we add a conditional probability formalism to AL design that makes it possible to quantify the probability of individual compounds to contribute to characteristic AL features. Making this information graphically accessible in a molecular network-based AL representation is shown to further increase AL information content and helps to quickly focus on SAR-informative compound subsets. This feature probability-based AL variant extends the current spectrum of AL representations for medicinal chemistry applications.

  15. End-to-end distance and contour length distribution functions of DNA helices

    NASA Astrophysics Data System (ADS)

    Zoli, Marco

    2018-06-01

    I present a computational method to evaluate the end-to-end and the contour length distribution functions of short DNA molecules described by a mesoscopic Hamiltonian. The method generates a large statistical ensemble of possible configurations for each dimer in the sequence, selects the global equilibrium twist conformation for the molecule, and determines the average base pair distances along the molecule backbone. Integrating over the base pair radial and angular fluctuations, I derive the room temperature distribution functions as a function of the sequence length. The obtained values for the most probable end-to-end distance and contour length distance, providing a measure of the global molecule size, are used to examine the DNA flexibility at short length scales. It is found that, also in molecules with less than ˜60 base pairs, coiled configurations maintain a large statistical weight and, consistently, the persistence lengths may be much smaller than in kilo-base DNA.

  16. Camera trap placement and the potential for bias due to trails and other features

    PubMed Central

    Forrester, Tavis D.

    2017-01-01

    Camera trapping has become an increasingly widespread tool for wildlife ecologists, with large numbers of studies relying on photo capture rates or presence/absence information. It is increasingly clear that camera placement can directly impact this kind of data, yet these biases are poorly understood. We used a paired camera design to investigate the effect of small-scale habitat features on species richness estimates, and capture rate and detection probability of several mammal species in the Shenandoah Valley of Virginia, USA. Cameras were deployed at either log features or on game trails with a paired camera at a nearby random location. Overall capture rates were significantly higher at trail and log cameras compared to their paired random cameras, and some species showed capture rates as much as 9.7 times greater at feature-based cameras. We recorded more species at both log (17) and trail features (15) than at their paired control cameras (13 and 12 species, respectively), yet richness estimates were indistinguishable after 659 and 385 camera nights of survey effort, respectively. We detected significant increases (ranging from 11–33%) in detection probability for five species resulting from the presence of game trails. For six species detection probability was also influenced by the presence of a log feature. This bias was most pronounced for the three rodents investigated, where in all cases detection probability was substantially higher (24.9–38.2%) at log cameras. Our results indicate that small-scale factors, including the presence of game trails and other features, can have significant impacts on species detection when camera traps are employed. Significant biases may result if the presence and quality of these features are not documented and either incorporated into analytical procedures, or controlled for in study design. PMID:29045478

  17. Camera trap placement and the potential for bias due to trails and other features.

    PubMed

    Kolowski, Joseph M; Forrester, Tavis D

    2017-01-01

    Camera trapping has become an increasingly widespread tool for wildlife ecologists, with large numbers of studies relying on photo capture rates or presence/absence information. It is increasingly clear that camera placement can directly impact this kind of data, yet these biases are poorly understood. We used a paired camera design to investigate the effect of small-scale habitat features on species richness estimates, and capture rate and detection probability of several mammal species in the Shenandoah Valley of Virginia, USA. Cameras were deployed at either log features or on game trails with a paired camera at a nearby random location. Overall capture rates were significantly higher at trail and log cameras compared to their paired random cameras, and some species showed capture rates as much as 9.7 times greater at feature-based cameras. We recorded more species at both log (17) and trail features (15) than at their paired control cameras (13 and 12 species, respectively), yet richness estimates were indistinguishable after 659 and 385 camera nights of survey effort, respectively. We detected significant increases (ranging from 11-33%) in detection probability for five species resulting from the presence of game trails. For six species detection probability was also influenced by the presence of a log feature. This bias was most pronounced for the three rodents investigated, where in all cases detection probability was substantially higher (24.9-38.2%) at log cameras. Our results indicate that small-scale factors, including the presence of game trails and other features, can have significant impacts on species detection when camera traps are employed. Significant biases may result if the presence and quality of these features are not documented and either incorporated into analytical procedures, or controlled for in study design.

  18. Facebook dethroned: Revealing the more likely social media destinations for college students’ depictions of underage drinking

    PubMed Central

    Boyle, Sarah C.; Earle, Andrew M.; LaBrie, Joseph W.; Ballou, Kayla

    2016-01-01

    Studies examining representations of college drinking on social media have almost exclusively focused on Facebook. However, recent research suggests college students may be more influenced by peers’ alcohol-related posts on Instagram and Snapchat, two image-based platforms popular among this demographic. One potential explanation for this differential influence is that qualitative distinctions in the types of alcohol-related content posted by students on these three platforms may exist. Informed by undergraduate focus groups, this study examined the hypothesis that, of the three platforms, students tend to use Instagram most often for photos glamourizing drinking and Snapchat for incriminating photos of alcohol misuse and negative consequences. Undergraduate research assistants aided investigators in developing hypothetical vignettes and photographic examples of posts both glamorizing and depicting negative consequences associated with college drinking. In an online survey, vignette and photo stimuli were followed by counterbalanced paired comparisons that presented each possible pair of social media platforms. Undergraduates (N=196) selected the platform from each pair on which they would be more likely to see each post. Generalized Bradley-Terry models examined the probabilities of platform selections. As predicted, Instagram was seen as the most probable destination (and Facebook least probable) for photos depicting alcohol use as attractive and glamorous. Conversely, Snapchat was selected as the most probable destination (and Facebook least probable) for items depicting negative consequences associated with heavy drinking. Results suggest researchers aiming to mitigate the potential influences associated with college students’ glamorous and consequential alcohol-related photos posted social media posts should shift their focus from Facebook to Instagram and Snapchat. PMID:27776267

  19. DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds

    PubMed Central

    Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.

    2008-01-01

    We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765

  20. Pairs of Asteroids Probably of a Common Origin

    NASA Astrophysics Data System (ADS)

    Vokrouhlický, David; Nesvorný, David

    2008-07-01

    We report the first observational evidence for pairs of main-belt asteroids with bodies in each pair having nearly identical orbits. The existence of ~60 pairs identified here cannot be reconciled with random fluctuations of the asteroid orbit density and rather suggests a common origin of the paired objects. We propose that the identified pairs formed by (i) collisional disruptions of km-sized and larger parent asteroids, (ii) Yarkovsky-O'Keefe-Radzievski-Paddack (YORP)-induced spin-up and rotational fission of fast-rotating objects, and/or (iii) splitting of unstable asteroid binaries. In case (i), the pairs would be parts of compact collisional families with many km- and sub-km-size members that should be found by future asteroid surveys. Our dynamical analysis suggests that most identified pairs formed within the past lsim1 Myr, in several cases even much more recently. For example, paired asteroids (6070) Rheinland and (54827) 2001 NQ8 probably separated from their common ancestor only 16.5-19 kyr ago. Given their putatively very recent formation, the identified objects are prime candidates for astronomical observations. The title paraphrases that of Hirayama's 1918 paper "Groups of asteroids probably of a common origin," where the first evidence was given for groups of asteroid fragments produced by disruptive collisions.

  1. Virial Coefficients for the Liquid Argon

    NASA Astrophysics Data System (ADS)

    Korth, Micheal; Kim, Saesun

    2014-03-01

    We begin with a geometric model of hard colliding spheres and calculate probability densities in an iterative sequence of calculations that lead to the pair correlation function. The model is based on a kinetic theory approach developed by Shinomoto, to which we added an interatomic potential for argon based on the model from Aziz. From values of the pair correlation function at various values of density, we were able to find viral coefficients of liquid argon. The low order coefficients are in good agreement with theoretical hard sphere coefficients, but appropriate data for argon to which these results might be compared is difficult to find.

  2. Nonrandom network connectivity comes in pairs.

    PubMed

    Hoffmann, Felix Z; Triesch, Jochen

    2017-01-01

    Overrepresentation of bidirectional connections in local cortical networks has been repeatedly reported and is a focus of the ongoing discussion of nonrandom connectivity. Here we show in a brief mathematical analysis that in a network in which connection probabilities are symmetric in pairs, P ij = P ji , the occurrences of bidirectional connections and nonrandom structures are inherently linked; an overabundance of reciprocally connected pairs emerges necessarily when some pairs of neurons are more likely to be connected than others. Our numerical results imply that such overrepresentation can also be sustained when connection probabilities are only approximately symmetric.

  3. Probability of coincidental similarity among the orbits of small bodies - I. Pairing

    NASA Astrophysics Data System (ADS)

    Jopek, Tadeusz Jan; Bronikowska, Małgorzata

    2017-09-01

    Probability of coincidental clustering among orbits of comets, asteroids and meteoroids depends on many factors like: the size of the orbital sample searched for clusters or the size of the identified group, it is different for groups of 2,3,4,… members. Probability of coincidental clustering is assessed by the numerical simulation, therefore, it depends also on the method used for the synthetic orbits generation. We have tested the impact of some of these factors. For a given size of the orbital sample we have assessed probability of random pairing among several orbital populations of different sizes. We have found how these probabilities vary with the size of the orbital samples. Finally, keeping fixed size of the orbital sample we have shown that the probability of random pairing can be significantly different for the orbital samples obtained by different observation techniques. Also for the user convenience we have obtained several formulae which, for given size of the orbital sample can be used to calculate the similarity threshold corresponding to the small value of the probability of coincidental similarity among two orbits.

  4. Covariance Based Pre-Filters and Screening Criteria for Conjunction Analysis

    NASA Astrophysics Data System (ADS)

    George, E., Chan, K.

    2012-09-01

    Several relationships are developed relating object size, initial covariance and range at closest approach to probability of collision. These relationships address the following questions: - Given the objects' initial covariance and combined hard body size, what is the maximum possible value of the probability of collision (Pc)? - Given the objects' initial covariance, what is the maximum combined hard body radius for which the probability of collision does not exceed the tolerance limit? - Given the objects' initial covariance and the combined hard body radius, what is the minimum miss distance for which the probability of collision does not exceed the tolerance limit? - Given the objects' initial covariance and the miss distance, what is the maximum combined hard body radius for which the probability of collision does not exceed the tolerance limit? The first relationship above allows the elimination of object pairs from conjunction analysis (CA) on the basis of the initial covariance and hard-body sizes of the objects. The application of this pre-filter to present day catalogs with estimated covariance results in the elimination of approximately 35% of object pairs as unable to ever conjunct with a probability of collision exceeding 1x10-6. Because Pc is directly proportional to object size and inversely proportional to covariance size, this pre-filter will have a significantly larger impact on future catalogs, which are expected to contain a much larger fraction of small debris tracked only by a limited subset of available sensors. This relationship also provides a mathematically rigorous basis for eliminating objects from analysis entirely based on element set age or quality - a practice commonly done by rough rules of thumb today. Further, these relations can be used to determine the required geometric screening radius for all objects. This analysis reveals the screening volumes for small objects are much larger than needed, while the screening volumes for pairs of large objects may be inadequate. These relationships may also form the basis of an important metric for catalog maintenance by defining the maximum allowable covariance size for effective conjunction analysis. The application of these techniques promises to greatly improve the efficiency and completeness of conjunction analysis.

  5. Solvent effect on the intermolecular proton transfer of the Watson and Crick guanine-cytosine and adenine-thymine base pairs: a polarizable continuum model study.

    PubMed

    Romero, Eduardo E; Hernandez, Florencio E

    2018-01-03

    Herein we present our results on the study of the double proton transfer (DPT) mechanism in the adenine-thymine (AT) and guanine-cytosine (GC) base pairs, both in gas phase and in solution. The latter was modeled using the polarizable continuum method (PCM) in different solvents. According to our DFT calculations, the DPT may occur for both complexes in a stepwise mechanism in condensate phase. In gas phase only the GC base pair exhibits a concerted DPT mechanism. Using the Wigner's tunneling corrections to the transition state theory we demonstrate that such corrections are important for the prediction of the rate constants of both systems in gas and in condensate phase. We also show that (i) as the polarity of the medium decreases the equilibrium constant of the DPT reaction increases in both complexes, and (ii) that the equilibrium constant in the GC complex is four orders of magnitude larger than in AT. This observation suggests that the spontaneous mutations in DNA base pairs are more probable in GC than in AT.

  6. Pair production in low-energy collisions of uranium nuclei beyond the monopole approximation

    NASA Astrophysics Data System (ADS)

    Maltsev, I. A.; Shabaev, V. M.; Tupitsyn, I. I.; Kozhedub, Y. S.; Plunien, G.; Stöhlker, Th.

    2017-10-01

    A method for calculation of electron-positron pair production in low-energy heavy-ion collisions beyond the monopole approximation is presented. The method is based on the numerical solving of the time-dependent Dirac equation with the full two-center potential. The one-electron wave functions are expanded in the finite basis set constructed on the two-dimensional spatial grid. Employing the developed approach the probabilities of bound-free pair production are calculated for collisions of bare uranium nuclei at the energy near the Coulomb barrier. The obtained results are compared with the corresponding values calculated in the monopole approximation.

  7. Discrete-time moment closure models for epidemic spreading in populations of interacting individuals.

    PubMed

    Frasca, Mattia; Sharkey, Kieran J

    2016-06-21

    Understanding the dynamics of spread of infectious diseases between individuals is essential for forecasting the evolution of an epidemic outbreak or for defining intervention policies. The problem is addressed by many approaches including stochastic and deterministic models formulated at diverse scales (individuals, populations) and different levels of detail. Here we consider discrete-time SIR (susceptible-infectious-removed) dynamics propagated on contact networks. We derive a novel set of 'discrete-time moment equations' for the probability of the system states at the level of individual nodes and pairs of nodes. These equations form a set which we close by introducing appropriate approximations of the joint probabilities appearing in them. For the example case of SIR processes, we formulate two types of model, one assuming statistical independence at the level of individuals and one at the level of pairs. From the pair-based model we then derive a model at the level of the population which captures the behavior of epidemics on homogeneous random networks. With respect to their continuous-time counterparts, the models include a larger number of possible transitions from one state to another and joint probabilities with a larger number of individuals. The approach is validated through numerical simulation over different network topologies. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  8. Microscopic description of pair transfer between two superfluid Fermi systems: Combining phase-space averaging and combinatorial techniques

    NASA Astrophysics Data System (ADS)

    Regnier, David; Lacroix, Denis; Scamps, Guillaume; Hashimoto, Yukio

    2018-03-01

    In a mean-field description of superfluidity, particle number and gauge angle are treated as quasiclassical conjugated variables. This level of description was recently used to describe nuclear reactions around the Coulomb barrier. Important effects of the relative gauge angle between two identical superfluid nuclei (symmetric collisions) on transfer probabilities and fusion barrier have been uncovered. A theory making contact with experiments should at least average over different initial relative gauge-angles. In the present work, we propose a new approach to obtain the multiple pair transfer probabilities between superfluid systems. This method, called phase-space combinatorial (PSC) technique, relies both on phase-space averaging and combinatorial arguments to infer the full pair transfer probability distribution at the cost of multiple mean-field calculations only. After benchmarking this approach in a schematic model, we apply it to the collision 20O+20O at various energies below the Coulomb barrier. The predictions for one pair transfer are similar to results obtained with an approximated projection method, whereas significant differences are found for two pairs transfer. Finally, we investigated the applicability of the PSC method to the contact between nonidentical superfluid systems. A generalization of the method is proposed and applied to the schematic model showing that the pair transfer probabilities are reasonably reproduced. The applicability of the PSC method to asymmetric nuclear collisions is investigated for the 14O+20O collision and it turns out that unrealistically small single- and multiple pair transfer probabilities are obtained. This is explained by the fact that relative gauge angle play in this case a minor role in the particle transfer process compared to other mechanisms, such as equilibration of the charge/mass ratio. We conclude that the best ground for probing gauge-angle effects in nuclear reaction and/or for applying the proposed PSC approach on pair transfer is the collisions of identical open-shell spherical nuclei.

  9. Conformation of viroids.

    PubMed Central

    Henco, K; Riesner, D; Sanger, H L

    1977-01-01

    Viroids are uncoated infectious RNA molecules (MW 107 000-127 000) known as pathogens of certain higher plants. Thermodynamic and kinetic studies were carried out on highly purified viroid preparations by applying UV-absorption melting analysis and temperature jump methods. The thermal denaturation of viroids is characterized by high thermal stability, high cooperativity and a high degree of base pairing. Two relaxation processes could be resolved; a process in the sec range could be evaluated as an independent all-or-none-transition with the following properties: reaction enthalpy= 550 kcal/mol, activation enthalpy of the dissociation = 470 kcal/mol; G : C content = 72 %. These data indicate the existence of an uninterrupted double helix of 52 base pairs. A process in the msec range involves 15 - 25 base pairs which are most probably distributed over several short double helical stretches. A tentative model for the secondary structure of viroids isproposed and the possible functional implications of their physicochemical properties are discussed. PMID:866174

  10. Operation of the PAVE PAWS Radar System at Beale Air Force Base, California. Part 2. Public Comment & AF Response.

    DTIC Science & Technology

    1980-07-01

    trip next month to Europe , and when I come back. It’s for this reason that I was not able to have it all typed and prepared, and the Air Force was...millimeter of culture medium. A mutational event such as a change in a single base pair in the bacterial DNA, which is impossible to detect by standard...100) bacteria, a rare single mutation event with a probability of say I in 100,000,000, the probability of 10-8, will thus be amplified by a factor of

  11. Facebook dethroned: Revealing the more likely social media destinations for college students' depictions of underage drinking.

    PubMed

    Boyle, Sarah C; Earle, Andrew M; LaBrie, Joseph W; Ballou, Kayla

    2017-02-01

    Studies examining representations of college drinking on social media have almost exclusively focused on Facebook. However, recent research suggests college students may be more influenced by peers' alcohol-related posts on Instagram and Snapchat, two image-based platforms popular among this demographic. One potential explanation for this differential influence is that qualitative distinctions in the types of alcohol-related content posted by students on these three platforms may exist. Informed by undergraduate focus groups, this study examined the hypothesis that, of the three platforms, students tend to use Instagram most often for photos glamourizing drinking and Snapchat for incriminating photos of alcohol misuse and negative consequences. Undergraduate research assistants aided investigators in developing hypothetical vignettes and photographic examples of posts both glamorizing and depicting negative consequences associated with college drinking. In an online survey, vignette and photo stimuli were followed by counterbalanced paired comparisons that presented each possible pair of social media platforms. Undergraduates (N=196) selected the platform from each pair on which they would be more likely to see each post. Generalized Bradley-Terry models examined the probabilities of platform selections. As predicted, Instagram was seen as the most probable destination (and Facebook least probable) for photos depicting alcohol use as attractive and glamorous. Conversely, Snapchat was selected as the most probable destination (and Facebook least probable) for items depicting negative consequences associated with heavy drinking. Results suggest researchers aiming to mitigate the potential influences associated with college students' glamorous and consequential alcohol-related photos posted social media posts should shift their focus from Facebook to Instagram and Snapchat. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. A hybrid double-observer sightability model for aerial surveys

    USGS Publications Warehouse

    Griffin, Paul C.; Lubow, Bruce C.; Jenkins, Kurt J.; Vales, David J.; Moeller, Barbara J.; Reid, Mason; Happe, Patricia J.; Mccorquodale, Scott M.; Tirhi, Michelle J.; Schaberi, Jim P.; Beirne, Katherine

    2013-01-01

    Raw counts from aerial surveys make no correction for undetected animals and provide no estimate of precision with which to judge the utility of the counts. Sightability modeling and double-observer (DO) modeling are 2 commonly used approaches to account for detection bias and to estimate precision in aerial surveys. We developed a hybrid DO sightability model (model MH) that uses the strength of each approach to overcome the weakness in the other, for aerial surveys of elk (Cervus elaphus). The hybrid approach uses detection patterns of 2 independent observer pairs in a helicopter and telemetry-based detections of collared elk groups. Candidate MH models reflected hypotheses about effects of recorded covariates and unmodeled heterogeneity on the separate front-seat observer pair and back-seat observer pair detection probabilities. Group size and concealing vegetation cover strongly influenced detection probabilities. The pilot's previous experience participating in aerial surveys influenced detection by the front pair of observers if the elk group was on the pilot's side of the helicopter flight path. In 9 surveys in Mount Rainier National Park, the raw number of elk counted was approximately 80–93% of the abundance estimated by model MH. Uncorrected ratios of bulls per 100 cows generally were low compared to estimates adjusted for detection bias, but ratios of calves per 100 cows were comparable whether based on raw survey counts or adjusted estimates. The hybrid method was an improvement over commonly used alternatives, with improved precision compared to sightability modeling and reduced bias compared to DO modeling.

  13. The preference of probability over negative values in action selection.

    PubMed

    Neyedli, Heather F; Welsh, Timothy N

    2015-01-01

    It has previously been found that when participants are presented with a pair of motor prospects, they can select the prospect with the largest maximum expected gain (MEG). Many of those decisions, however, were trivial because of large differences in MEG between the prospects. The purpose of the present study was to explore participants' preferences when making non-trivial decisions between two motor prospects. Participants were presented with pairs of prospects that: 1) differed in MEG with either only the values or only the probabilities differing between the prospects; and 2) had similar MEG with one prospect having a larger probability of hitting the target and a higher penalty value and the other prospect a smaller probability of hitting the target but a lower penalty value. In different experiments, participants either had 400 ms or 2000 ms to decide between the prospects. It was found that participants chose the configuration with the larger MEG more often when the probability varied between prospects than when the value varied. In pairs with similar MEGs, participants preferred a larger probability of hitting the target over a smaller penalty value. These results indicate that participants prefer probability information over negative value information in a motor selection task.

  14. Universal fingerprinting chip server.

    PubMed

    Casique-Almazán, Janet; Larios-Serrato, Violeta; Olguín-Ruíz, Gabriela Edith; Sánchez-Vallejo, Carlos Javier; Maldonado-Rodríguez, Rogelio; Méndez-Tenorio, Alfonso

    2012-01-01

    The Virtual Hybridization approach predicts the most probable hybridization sites across a target nucleic acid of known sequence, including both perfect and mismatched pairings. Potential hybridization sites, having a user-defined minimum number of bases that are paired with the oligonucleotide probe, are first identified. Then free energy values are evaluated for each potential hybridization site, and if it has a calculated free energy of equal or higher negative value than a user-defined free energy cut-off value, it is considered as a site of high probability of hybridization. The Universal Fingerprinting Chip Applications Server contains the software for visualizing predicted hybridization patterns, which yields a simulated hybridization fingerprint that can be compared with experimentally derived fingerprints or with a virtual fingerprint arising from a different sample. The database is available for free at http://bioinformatica.homelinux.org/UFCVH/

  15. A short walk in quantum probability

    NASA Astrophysics Data System (ADS)

    Hudson, Robin

    2018-04-01

    This is a personal survey of aspects of quantum probability related to the Heisenberg commutation relation for canonical pairs. Using the failure, in general, of non-negativity of the Wigner distribution for canonical pairs to motivate a more satisfactory quantum notion of joint distribution, we visit a central limit theorem for such pairs and a resulting family of quantum planar Brownian motions which deform the classical planar Brownian motion, together with a corresponding family of quantum stochastic areas. This article is part of the themed issue `Hilbert's sixth problem'.

  16. Ni2+-binding RNA motifs with an asymmetric purine-rich internal loop and a G-A base pair.

    PubMed Central

    Hofmann, H P; Limmer, S; Hornung, V; Sprinzl, M

    1997-01-01

    RNA molecules with high affinity for immobilized Ni2+ were isolated from an RNA pool with 50 randomized positions by in vitro selection-amplification. The selected RNAs preferentially bind Ni2+ and Co2+ over other cations from first series transition metals. Conserved structure motifs, comprising about 15 nt, were identified that are likely to represent the Ni2+ binding sites. Two conserved motifs contain an asymmetric purine-rich internal loop and probably a mismatch G-A base pair. The structure of one of these motifs was studied with proton NMR spectroscopy and formation of the G-A pair at the junction of helix and internal loop was demonstrated. Using Ni2+ as a paramagnetic probe, a divalent metal ion binding site near this G-A base pair was identified. Ni2+ ions bound to this motif exert a specific stabilization effect. We propose that small asymmetric purine-rich loops that contain a G-A interaction may represent a divalent metal ion binding site in RNA. PMID:9409620

  17. The interval between cancer diagnosis among mothers and offspring in a population-based cohort.

    PubMed

    Paltiel, Ora; Friedlander, Yehiel; Deutsch, Lisa; Yanetz, Rebecca; Calderon-Margalit, Ronit; Tiram, Efrat; Hochner, Hagit; Barchana, Micha; Harlap, Susan; Manor, Orly

    2007-01-01

    Familial cancers may be due to shared genes or environment, or chance aggregation. We explored the possibility that ascertainment bias influences cancer detection in families, bearing upon the time interval between diagnosis of affected mothers and offspring. The Jerusalem Perinatal Study (JPS) comprises all mothers (n = 39,734) from Western Jerusalem who gave birth 1964 -1976 and their offspring (n = 88,829). After linking identification numbers with Israel's Cancer Registry we measured the absolute time interval between initial cancer diagnoses in affected mother-offspring pairs. We tested the probability of obtaining intervals as short as those observed by chance alone, using a permutation test on the median interval. By June 2003 cancer had developed in 105 mother-offspring pairs within the cohort. Common sites among mothers were breast (47%), colorectal (9%), non-Hodgkin lymphoma (NHL) (8%) and cervix (7%), while for offspring in affected pairs common cancers were leukemia (12.4%), thyroid (13.3%), NHL (10.5%), breast (10.5%) and melanoma (7.6%). The median interval between diagnoses was 5.9 years, but for 33% of affected pairs the interval was < or =3 years. The probability of this occurring by chance alone was 0.03. This held true whether the offspring's or mother's diagnosis was first (P < 0.01). In a population-based cohort followed for three decades, the absolute interval between the diagnosis of cancer in mothers and their offspring is shorter than expected by chance. Explanations include shared environmental exposures or the possibility that cancer ascertainment in one pair member affects health behaviors in the other resulting in early diagnosis. The latter may bias the estimation of anticipation and survival in familial cancers.

  18. A dynamical study of the multiple system 17 Cygni ABFG

    NASA Astrophysics Data System (ADS)

    Romanenko, L. G.

    2017-03-01

    Adynamical study of the relative motions of the components of the inner pairs AB (ADS 12913) and FG (ADS 12889) of the quadruple heirarchical system 17 Cygni (WDS 19464+3344) is presented, as well as analysis of themotions of the outer pair AB-FG. The study is based on CCD observations obtained on the 26-inch refractor of the Pulkovo Observatory (2003-2013), position observations from the WDS catalog, Hipparcos parallaxes, and radial velocities of the components from literature data. A family of orbits for 17 Cyg AB is obtained for the first time, and has a most probable period of 6200 yrs. The apparent motion parameters (AMP) method is used, since the entire visible arc of the orbit over 1832-2013 is only 4°. The AMP method is also used to calculate the orbit of the 17 Cyg FG pair, which has a period of 238 yrs, yielding results in good agreement with the orbits derived in other studies. The ephemerides of the obtained AMP orbits, the position data for the AF pair from the WDS catalog (11 positions during 1893-2002), and Pulkovo CCD observations for 2007-2013 are used to calculate the apparent motion parameters of AB-FG outer pair, as well as a family of close-to-parabolic orbits with periods of 3.7 million years ormore. All the orbits (for both the inner and the outer pairs) are steeply inclined to theGalactic plane. Monte Carlo simulations are used to compute the probability that the outer pair is gravitationally bound, which is 47%. The similarity of the proper motions and radial velocities of all the components provides evidence that they all belong to a single stellar stream. Data from the CNS3 catalog are used to compose a list of candidate members of this stream.

  19. Magnetoreception in birds: different physical processes for two types of directional responses

    PubMed Central

    Wiltschko, Roswitha; Stapput, Katrin; Ritz, Thorsten; Thalau, Peter; Wiltschko, Wolfgang

    2007-01-01

    Migratory orientation in birds involves an inclination compass based on radical-pair processes. Under certain light regimes, however, “fixed-direction” responses are observed that do not undergo the seasonal change between spring and autumn typical for migratory orientation. To identify the underlying transduction mechanisms, we analyzed a fixed-direction response under a combination of 502 nm turquoise and 590 nm yellow light, with migratory orientation under 565 nm green light serving as the control. High-frequency fields, diagnostic for a radical-pair mechanism, disrupted migratory orientation without affecting fixed-direction responses. Local anaesthesia of the upper beak where magnetite is found in birds, in contrast, disrupted the fixed-direction response without affecting migratory orientation. The two types of responses are thus based on different physical principles, with the compass response based on a radical pair mechanism and the fixed-direction responses probably originating in magnetite-based receptors in the upper beak. Directional input from these receptors seems to affect the behavior only when the regular inclination compass does not work properly. Evolutionary considerations suggest that magnetite-based receptors may represent an ancient mechanism that, in birds, has been replaced by the modern inclination compass based on radical-pair processes now used for directional orientation. PMID:19404459

  20. Charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta

    By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency.more » The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.« less

  1. Quantifying inbreeding avoidance through extra-pair reproduction

    PubMed Central

    Reid, Jane M; Arcese, Peter; Keller, Lukas F; Germain, Ryan R; Duthie, A Bradley; Losdat, Sylvain; Wolak, Matthew E; Nietlisbach, Pirmin

    2015-01-01

    Extra-pair reproduction is widely hypothesized to allow females to avoid inbreeding with related socially paired males. Consequently, numerous field studies have tested the key predictions that extra-pair offspring are less inbred than females’ alternative within-pair offspring, and that the probability of extra-pair reproduction increases with a female's relatedness to her socially paired male. However, such studies rarely measure inbreeding or relatedness sufficiently precisely to detect subtle effects, or consider biases stemming from failure to observe inbred offspring that die during early development. Analyses of multigenerational song sparrow (Melospiza melodia) pedigree data showed that most females had opportunity to increase or decrease the coefficient of inbreeding of their offspring through extra-pair reproduction with neighboring males. In practice, observed extra-pair offspring had lower inbreeding coefficients than females’ within-pair offspring on average, while the probability of extra-pair reproduction increased substantially with the coefficient of kinship between a female and her socially paired male. However, simulations showed that such effects could simply reflect bias stemming from inbreeding depression in early offspring survival. The null hypothesis that extra-pair reproduction is random with respect to kinship therefore cannot be definitively rejected in song sparrows, and existing general evidence that females avoid inbreeding through extra-pair reproduction requires reevaluation given such biases. PMID:25346331

  2. Poincaré recurrences of DNA sequences

    NASA Astrophysics Data System (ADS)

    Frahm, K. M.; Shepelyansky, D. L.

    2012-01-01

    We analyze the statistical properties of Poincaré recurrences of Homo sapiens, mammalian, and other DNA sequences taken from the Ensembl Genome data base with up to 15 billion base pairs. We show that the probability of Poincaré recurrences decays in an algebraic way with the Poincaré exponent β≈4 even if the oscillatory dependence is well pronounced. The correlations between recurrences decay with an exponent ν≈0.6 that leads to an anomalous superdiffusive walk. However, for Homo sapiens sequences, with the largest available statistics, the diffusion coefficient converges to a finite value on distances larger than one million base pairs. We argue that the approach based on Poncaré recurrences determines new proximity features between different species and sheds a new light on their evolution history.

  3. Statistics on continuous IBD data: Exact distribution evaluation for a pair of full(half)-sibs and a pair of a (great-) grandchild with a (great-) grandparent

    PubMed Central

    Stefanov, Valeri T

    2002-01-01

    Background Pairs of related individuals are widely used in linkage analysis. Most of the tests for linkage analysis are based on statistics associated with identity by descent (IBD) data. The current biotechnology provides data on very densely packed loci, and therefore, it may provide almost continuous IBD data for pairs of closely related individuals. Therefore, the distribution theory for statistics on continuous IBD data is of interest. In particular, distributional results which allow the evaluation of p-values for relevant tests are of importance. Results A technology is provided for numerical evaluation, with any given accuracy, of the cumulative probabilities of some statistics on continuous genome data for pairs of closely related individuals. In the case of a pair of full-sibs, the following statistics are considered: (i) the proportion of genome with 2 (at least 1) haplotypes shared identical-by-descent (IBD) on a chromosomal segment, (ii) the number of distinct pieces (subsegments) of a chromosomal segment, on each of which exactly 2 (at least 1) haplotypes are shared IBD. The natural counterparts of these statistics for the other relationships are also considered. Relevant Maple codes are provided for a rapid evaluation of the cumulative probabilities of such statistics. The genomic continuum model, with Haldane's model for the crossover process, is assumed. Conclusions A technology, together with relevant software codes for its automated implementation, are provided for exact evaluation of the distributions of relevant statistics associated with continuous genome data on closely related individuals. PMID:11996673

  4. Experimental purification of two-atom entanglement.

    PubMed

    Reichle, R; Leibfried, D; Knill, E; Britton, J; Blakestad, R B; Jost, J D; Langer, C; Ozeri, R; Seidelin, S; Wineland, D J

    2006-10-19

    Entanglement is a necessary resource for quantum applications--entanglement established between quantum systems at different locations enables private communication and quantum teleportation, and facilitates quantum information processing. Distributed entanglement is established by preparing an entangled pair of quantum particles in one location, and transporting one member of the pair to another location. However, decoherence during transport reduces the quality (fidelity) of the entanglement. A protocol to achieve entanglement 'purification' has been proposed to improve the fidelity after transport. This protocol uses separate quantum operations at each location and classical communication to distil high-fidelity entangled pairs from lower-fidelity pairs. Proof-of-principle experiments distilling entangled photon pairs have been carried out. However, these experiments obtained distilled pairs with a low probability of success and required destruction of the entangled pairs, rendering them unavailable for further processing. Here we report efficient and non-destructive entanglement purification with atomic quantum bits. Two noisy entangled pairs were created and distilled into one higher-fidelity pair available for further use. Success probabilities were above 35 per cent. The many applications of entanglement purification make it one of the most important techniques in quantum information processing.

  5. A short walk in quantum probability.

    PubMed

    Hudson, Robin

    2018-04-28

    This is a personal survey of aspects of quantum probability related to the Heisenberg commutation relation for canonical pairs. Using the failure, in general, of non-negativity of the Wigner distribution for canonical pairs to motivate a more satisfactory quantum notion of joint distribution, we visit a central limit theorem for such pairs and a resulting family of quantum planar Brownian motions which deform the classical planar Brownian motion, together with a corresponding family of quantum stochastic areas.This article is part of the themed issue 'Hilbert's sixth problem'. © 2018 The Author(s).

  6. The ambivalent effect of lattice structure on a spatial game

    NASA Astrophysics Data System (ADS)

    Zhang, Hui; Gao, Meng; Li, Zizhen; Maa, Zhihui; Wang, Hailong

    2011-06-01

    The evolution of cooperation is studied in lattice-structured populations, in which each individual who adopts one of the following strategies ‘always defect' (ALLD), ‘tit-for-tat' (TFT), and ‘always cooperate' (ALLC) plays the repeated Prisoner's Dilemma game with its neighbors according to an asynchronous update rule. Computer simulations are applied to analyse the dynamics depending on major parameters. Mathematical analyses based on invasion probability analysis, mean-field approximation, as well as pair approximation are also used. We find that the lattice structure promotes the evolution of cooperation compared with a non-spatial population, this is also confirmed by invasion probability analysis in one dimension. Meanwhile, it also inhibits the evolution of cooperation due to the advantage of being spiteful, which indicates the key role of specific life-history assumptions. Mean-field approximation fails to predict the outcome of computer simulations. Pair approximation is accurate in two dimensions but fails in one dimension.

  7. Experiment and modeling of paired effect on evacuation from a three-dimensional space

    NASA Astrophysics Data System (ADS)

    Jun, Hu; Huijun, Sun; Juan, Wei; Xiaodan, Chen; Lei, You; Musong, Gu

    2014-10-01

    A novel three-dimensional cellular automata evacuation model was proposed based on stairs factor for paired effect and variety velocities in pedestrian evacuation. In the model pedestrians' moving probability of target position at the next moment was defined based on distance profit and repulsive force profit, and evacuation strategy was elaborated in detail through analyzing variety velocities and repulsive phenomenon in moving process. At last, experiments with the simulation platform were conducted to study the relationships of evacuation time, average velocity and pedestrian velocity. The results showed that when the ratio of single pedestrian was higher in the system, the shortest route strategy was good for improving evacuation efficiency; in turn, if ratio of paired pedestrians was higher, it is good for improving evacuation efficiency to adopt strategy that avoided conflicts, and priority should be given to scattered evacuation.

  8. Statistical deprojection of galaxy pairs

    NASA Astrophysics Data System (ADS)

    Nottale, Laurent; Chamaraux, Pierre

    2018-06-01

    Aims: The purpose of the present paper is to provide methods of statistical analysis of the physical properties of galaxy pairs. We perform this study to apply it later to catalogs of isolated pairs of galaxies, especially two new catalogs we recently constructed that contain ≈1000 and ≈13 000 pairs, respectively. We are particularly interested by the dynamics of those pairs, including the determination of their masses. Methods: We could not compute the dynamical parameters directly since the necessary data are incomplete. Indeed, we only have at our disposal one component of the intervelocity between the members, namely along the line of sight, and two components of their interdistance, i.e., the projection on the sky-plane. Moreover, we know only one point of each galaxy orbit. Hence we need statistical methods to find the probability distribution of 3D interdistances and 3D intervelocities from their projections; we designed those methods under the term deprojection. Results: We proceed in two steps to determine and use the deprojection methods. First we derive the probability distributions expected for the various relevant projected quantities, namely intervelocity vz, interdistance rp, their ratio, and the product rp v_z^2, which is involved in mass determination. In a second step, we propose various methods of deprojection of those parameters based on the previous analysis. We start from a histogram of the projected data and we apply inversion formulae to obtain the deprojected distributions; lastly, we test the methods by numerical simulations, which also allow us to determine the uncertainties involved.

  9. Inferring relationships between pairs of individuals from locus heterozygosities

    PubMed Central

    Presciuttini, Silvano; Toni, Chiara; Tempestini, Elena; Verdiani, Simonetta; Casarino, Lucia; Spinetti, Isabella; Stefano, Francesco De; Domenici, Ranieri; Bailey-Wilson, Joan E

    2002-01-01

    Background The traditional exact method for inferring relationships between individuals from genetic data is not easily applicable in all situations that may be encountered in several fields of applied genetics. This study describes an approach that gives affordable results and is easily applicable; it is based on the probabilities that two individuals share 0, 1 or both alleles at a locus identical by state. Results We show that these probabilities (zi) depend on locus heterozygosity (H), and are scarcely affected by variation of the distribution of allele frequencies. This allows us to obtain empirical curves relating zi's to H for a series of common relationships, so that the likelihood ratio of a pair of relationships between any two individuals, given their genotypes at a locus, is a function of a single parameter, H. Application to large samples of mother-child and full-sib pairs shows that the statistical power of this method to infer the correct relationship is not much lower than the exact method. Analysis of a large database of STR data proves that locus heterozygosity does not vary significantly among Caucasian populations, apart from special cases, so that the likelihood ratio of the more common relationships between pairs of individuals may be obtained by looking at tabulated zi values. Conclusions A simple method is provided, which may be used by any scientist with the help of a calculator or a spreadsheet to compute the likelihood ratios of common alternative relationships between pairs of individuals. PMID:12441003

  10. Fingerprint Recognition with Identical Twin Fingerprints

    PubMed Central

    Yang, Xin; Tian, Jie

    2012-01-01

    Fingerprint recognition with identical twins is a challenging task due to the closest genetics-based relationship existing in the identical twins. Several pioneers have analyzed the similarity between twins' fingerprints. In this work we continue to investigate the topic of the similarity of identical twin fingerprints. Our study was tested based on a large identical twin fingerprint database that contains 83 twin pairs, 4 fingers per individual and six impressions per finger: 3984 (83*2*4*6) images. Compared to the previous work, our contributions are summarized as follows: (1) Two state-of-the-art fingerprint identification methods: P071 and VeriFinger 6.1 were used, rather than one fingerprint identification method in previous studies. (2) Six impressions per finger were captured, rather than just one impression, which makes the genuine distribution of matching scores more realistic. (3) A larger sample (83 pairs) was collected. (4) A novel statistical analysis, which aims at showing the probability distribution of the fingerprint types for the corresponding fingers of identical twins which have same fingerprint type, has been conducted. (5) A novel analysis, which aims at showing which finger from identical twins has higher probability of having same fingerprint type, has been conducted. Our results showed that: (a) A state-of-the-art automatic fingerprint verification system can distinguish identical twins without drastic degradation in performance. (b) The chance that the fingerprints have the same type from identical twins is 0.7440, comparing to 0.3215 from non-identical twins. (c) For the corresponding fingers of identical twins which have same fingerprint type, the probability distribution of five major fingerprint types is similar to the probability distribution for all the fingers' fingerprint type. (d) For each of four fingers of identical twins, the probability of having same fingerprint type is similar. PMID:22558204

  11. Fingerprint recognition with identical twin fingerprints.

    PubMed

    Tao, Xunqiang; Chen, Xinjian; Yang, Xin; Tian, Jie

    2012-01-01

    Fingerprint recognition with identical twins is a challenging task due to the closest genetics-based relationship existing in the identical twins. Several pioneers have analyzed the similarity between twins' fingerprints. In this work we continue to investigate the topic of the similarity of identical twin fingerprints. Our study was tested based on a large identical twin fingerprint database that contains 83 twin pairs, 4 fingers per individual and six impressions per finger: 3984 (83*2*4*6) images. Compared to the previous work, our contributions are summarized as follows: (1) Two state-of-the-art fingerprint identification methods: P071 and VeriFinger 6.1 were used, rather than one fingerprint identification method in previous studies. (2) Six impressions per finger were captured, rather than just one impression, which makes the genuine distribution of matching scores more realistic. (3) A larger sample (83 pairs) was collected. (4) A novel statistical analysis, which aims at showing the probability distribution of the fingerprint types for the corresponding fingers of identical twins which have same fingerprint type, has been conducted. (5) A novel analysis, which aims at showing which finger from identical twins has higher probability of having same fingerprint type, has been conducted. Our results showed that: (a) A state-of-the-art automatic fingerprint verification system can distinguish identical twins without drastic degradation in performance. (b) The chance that the fingerprints have the same type from identical twins is 0.7440, comparing to 0.3215 from non-identical twins. (c) For the corresponding fingers of identical twins which have same fingerprint type, the probability distribution of five major fingerprint types is similar to the probability distribution for all the fingers' fingerprint type. (d) For each of four fingers of identical twins, the probability of having same fingerprint type is similar.

  12. Across Space and Time: Infants Learn from Backward and Forward Visual Statistics

    ERIC Educational Resources Information Center

    Tummeltshammer, Kristen; Amso, Dima; French, Robert M.; Kirkham, Natasha Z.

    2017-01-01

    This study investigates whether infants are sensitive to backward and forward transitional probabilities within temporal and spatial visual streams. Two groups of 8-month-old infants were familiarized with an artificial grammar of shapes, comprising backward and forward base pairs (i.e. two shapes linked by strong backward or forward transitional…

  13. The rise and fall of a challenger: the Bullet Cluster in Λ cold dark matter simulations

    NASA Astrophysics Data System (ADS)

    Thompson, Robert; Davé, Romeel; Nagamine, Kentaro

    2015-09-01

    The Bullet Cluster has provided some of the best evidence for the Λ cold dark matter (ΛCDM) model via direct empirical proof of the existence of collisionless dark matter, while posing a serious challenge owing to the unusually high inferred pairwise velocities of its progenitor clusters. Here, we investigate the probability of finding such a high-velocity pair in large-volume N-body simulations, particularly focusing on differences between halo-finding algorithms. We find that algorithms that do not account for the kinematics of infalling groups yield vastly different statistics and probabilities. When employing the ROCKSTAR halo finder that considers particle velocities, we find numerous Bullet-like pair candidates that closely match not only the high pairwise velocity, but also the mass, mass ratio, separation distance, and collision angle of the initial conditions that have been shown to produce the Bullet Cluster in non-cosmological hydrodynamic simulations. The probability of finding a high pairwise velocity pair among haloes with Mhalo ≥ 1014 M⊙ is 4.6 × 10-4 using ROCKSTAR, while it is ≈34 × lower using a friends-of-friends (FoF)-based approach as in previous studies. This is because the typical spatial extent of Bullet progenitors is such that FoF tends to group them into a single halo despite clearly distinct kinematics. Further requiring an appropriately high average mass among the two progenitors, we find the comoving number density of potential Bullet-like candidates to be of the order of ≈10-10 Mpc-3. Our findings suggest that ΛCDM straightforwardly produces massive, high relative velocity halo pairs analogous to Bullet Cluster progenitors, and hence the Bullet Cluster does not present a challenge to the ΛCDM model.

  14. The non-parametric Parzen's window in stereo vision matching.

    PubMed

    Pajares, G; de la Cruz, J

    2002-01-01

    This paper presents an approach to the local stereovision matching problem using edge segments as features with four attributes. From these attributes we compute a matching probability between pairs of features of the stereo images. A correspondence is said true when such a probability is maximum. We introduce a nonparametric strategy based on Parzen's window (1962) to estimate a probability density function (PDF) which is used to obtain the matching probability. This is the main finding of the paper. A comparative analysis of other recent matching methods is included to show that this finding can be justified theoretically. A generalization of the proposed method is made in order to give guidelines about its use with the similarity constraint and also in different environments where other features and attributes are more suitable.

  15. Probability of identity by descent in metapopulations.

    PubMed Central

    Kaj, I; Lascoux, M

    1999-01-01

    Equilibrium probabilities of identity by descent (IBD), for pairs of genes within individuals, for genes between individuals within subpopulations, and for genes between subpopulations are calculated in metapopulation models with fixed or varying colony sizes. A continuous-time analog to the Moran model was used in either case. For fixed-colony size both propagule and migrant pool models were considered. The varying population size model is based on a birth-death-immigration (BDI) process, to which migration between colonies is added. Wright's F statistics are calculated and compared to previous results. Adding between-island migration to the BDI model can have an important effect on the equilibrium probabilities of IBD and on Wright's index. PMID:10388835

  16. Meaner king uses biased bases

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Reimpell, Michael; Werner, Reinhard F.

    2007-06-15

    The mean king problem is a quantum mechanical retrodiction problem, in which Alice has to name the outcome of an ideal measurement made in one of several different orthonormal bases. Alice is allowed to prepare the state of the system and to do a final measurement, possibly including an entangled copy. However, Alice gains knowledge about which basis was measured only after she no longer has access to the quantum system or its copy. We give a necessary and sufficient condition on the bases, for Alice to have a strategy to solve this problem, without assuming that the bases aremore » mutually unbiased. The condition requires the existence of an overall joint probability distribution for random variables, whose marginal pair distributions are fixed as the transition probability matrices of the given bases. In particular, in the qubit case the problem is decided by Bell's original three variable inequality. In the standard setting of mutually unbiased bases, when they do exist, Alice can always succeed. However, for randomly chosen bases her success probability rapidly goes to zero with increasing dimension.« less

  17. Meaner king uses biased bases

    NASA Astrophysics Data System (ADS)

    Reimpell, Michael; Werner, Reinhard F.

    2007-06-01

    The mean king problem is a quantum mechanical retrodiction problem, in which Alice has to name the outcome of an ideal measurement made in one of several different orthonormal bases. Alice is allowed to prepare the state of the system and to do a final measurement, possibly including an entangled copy. However, Alice gains knowledge about which basis was measured only after she no longer has access to the quantum system or its copy. We give a necessary and sufficient condition on the bases, for Alice to have a strategy to solve this problem, without assuming that the bases are mutually unbiased. The condition requires the existence of an overall joint probability distribution for random variables, whose marginal pair distributions are fixed as the transition probability matrices of the given bases. In particular, in the qubit case the problem is decided by Bell’s original three variable inequality. In the standard setting of mutually unbiased bases, when they do exist, Alice can always succeed. However, for randomly chosen bases her success probability rapidly goes to zero with increasing dimension.

  18. Quantifying inbreeding avoidance through extra-pair reproduction.

    PubMed

    Reid, Jane M; Arcese, Peter; Keller, Lukas F; Germain, Ryan R; Duthie, A Bradley; Losdat, Sylvain; Wolak, Matthew E; Nietlisbach, Pirmin

    2015-01-01

    Extra-pair reproduction is widely hypothesized to allow females to avoid inbreeding with related socially paired males. Consequently, numerous field studies have tested the key predictions that extra-pair offspring are less inbred than females' alternative within-pair offspring, and that the probability of extra-pair reproduction increases with a female's relatedness to her socially paired male. However, such studies rarely measure inbreeding or relatedness sufficiently precisely to detect subtle effects, or consider biases stemming from failure to observe inbred offspring that die during early development. Analyses of multigenerational song sparrow (Melospiza melodia) pedigree data showed that most females had opportunity to increase or decrease the coefficient of inbreeding of their offspring through extra-pair reproduction with neighboring males. In practice, observed extra-pair offspring had lower inbreeding coefficients than females' within-pair offspring on average, while the probability of extra-pair reproduction increased substantially with the coefficient of kinship between a female and her socially paired male. However, simulations showed that such effects could simply reflect bias stemming from inbreeding depression in early offspring survival. The null hypothesis that extra-pair reproduction is random with respect to kinship therefore cannot be definitively rejected in song sparrows, and existing general evidence that females avoid inbreeding through extra-pair reproduction requires reevaluation given such biases. © 2014 The Author(s). Evolution © 2014 The Society for the Study of Evolution.

  19. Effect of BrU on the transition between wobble Gua-Thy and tautomeric Gua-Thy base-pairs: ab initio molecular orbital calculations

    NASA Astrophysics Data System (ADS)

    Nomura, Kazuya; Hoshino, Ryota; Hoshiba, Yasuhiro; Danilov, Victor I.; Kurita, Noriyuki

    2013-04-01

    We investigated transition states (TS) between wobble Guanine-Thymine (wG-T) and tautomeric G-T base-pair as well as Br-containing base-pairs by MP2 and density functional theory (DFT) calculations. The obtained TS between wG-T and G*-T (asterisk is an enol-form of base) is different from TS got by the previous DFT calculation. The activation energy (17.9 kcal/mol) evaluated by our calculation is significantly smaller than that (39.21 kcal/mol) obtained by the previous calculation, indicating that our TS is more preferable. In contrast, the obtained TS and activation energy between wG-T and G-T* are similar to those obtained by the previous DFT calculation. We furthermore found that the activation energy between wG-BrU and tautomeric G-BrU is smaller than that between wG-T and tautomeric G-T. This result elucidates that the replacement of CH3 group of T by Br increases the probability of the transition reaction producing the enol-form G* and T* bases. Because G* prefers to bind to T rather than to C, and T* to G not A, our calculated results reveal that the spontaneous mutation from C to T or from A to G base is accelerated by the introduction of wG-BrU base-pair.

  20. A probabilistic analysis of the implications of instrument failures on ESA's Swarm mission for its individual satellite orbit deployments

    NASA Astrophysics Data System (ADS)

    Jackson, Andrew

    2015-07-01

    On launch, one of Swarm's absolute scalar magnetometers (ASMs) failed to function, leaving an asymmetrical arrangement of redundant spares on different spacecrafts. A decision was required concerning the deployment of individual satellites into the low-orbit pair or the higher "lonely" orbit. I analyse the probabilities for successful operation of two of the science components of the Swarm mission in terms of a classical probabilistic failure analysis, with a view to concluding a favourable assignment for the satellite with the single working ASM. I concentrate on the following two science aspects: the east-west gradiometer aspect of the lower pair of satellites and the constellation aspect, which requires a working ASM in each of the two orbital planes. I use the so-called "expert solicitation" probabilities for instrument failure solicited from Mission Advisory Group (MAG) members. My conclusion from the analysis is that it is better to have redundancy of ASMs in the lonely satellite orbit. Although the opposite scenario, having redundancy (and thus four ASMs) in the lower orbit, increases the chance of a working gradiometer late in the mission; it does so at the expense of a likely constellation. Although the results are presented based on actual MAG members' probabilities, the results are rather generic, excepting the case when the probability of individual ASM failure is very small; in this case, any arrangement will ensure a successful mission since there is essentially no failure expected at all. Since the very design of the lower pair is to enable common mode rejection of external signals, it is likely that its work can be successfully achieved during the first 5 years of the mission.

  1. Advanced Large Scale Cross Domain Temporal Topic Modeling Algorithms to Infer the Influence of Recent Research on IPCC Assessment Reports

    NASA Astrophysics Data System (ADS)

    Sleeman, J.; Halem, M.; Finin, T.; Cane, M. A.

    2016-12-01

    Approximately every five years dating back to 1989, thousands of climate scientists, research centers and government labs volunteer to prepare comprehensive Assessment Reports for the Intergovernmental Panel on Climate Change. These are highly curated reports distributed to 200 nation policy makers. There have been five IPCC Assessment Reports to date, the latest leading to a Paris Agreement in Dec. 2016 signed thus far by 172 nations to limit the amount of global Greenhouse gases emitted to producing no more than a 20 C warming of the atmosphere. These reports are a living evolving big data collection tracing 30 years of climate science research, observations, and model scenario intercomparisons. They contain more than 200,000 citations over a 30 year period that trace the evolution of the physical basis of climate science, the observed and predicted impact, risk and adaptation to increased greenhouse gases and mitigation approaches, pathways, policies for climate change. Document-topic and topic-term probability distributions are built from the vocabularies of the respective assessment report chapters and citations. Using Microsoft Bing, we retrieve 150,000 citations referenced across chapters and convert those citations to text. Using a word n-gram model based on a heterogeneous set of climate change terminology, lemmatization, noise filtering and stopword elimination, we calculate word frequencies for chapters and citations. Temporal document sets are built based on the assessment period. In addition to topic modeling, we employ cross domain correlation measures. Using the Jensen-Shannon divergence and Pearson correlation we build correlation matrices for chapter and citations topics. The shared vocabulary acts as the bridge between domains resulting in chapter-citation point pairs in space. Pairs are established based on a document-topic probability distribution. Each chapter and citation is associated with a vector of topics and based on the n most probable topics, we establish which chapter-citation pairs are most similar. We will perform posterior inferences based on Hastings -Metropolis simulated annealing MCMC algorithm to infer, from the evolution of topics starting from AR1 to AR4, assertions of topics for AR5 and potentially AR6.

  2. Connections between the dynamical symmetries in the microscopic shell model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Georgieva, A. I., E-mail: anageorg@issp.bas.bg; Drumev, K. P.

    2016-03-25

    The dynamical symmetries of the microscopic shell model appear as the limiting cases of a symmetry adapted Pairing-Plus-Quadrupole Model /PQM/, with a Hamiltonian containing isoscalar and isovector pairing and quadrupole interactions. We establish a correspondence between each of the three types of pairing bases and Elliott’s SU(3) basis, that describes collective rotation of nuclear systems with quadrupole deformation. It is derived from their complementarity to the same LS coupling chain of the shell model number conserving algebra. The probability distribution of the S U(3) basis states within the pairing eigenstates is also obtained through a numerical diagonalization of the PQMmore » Hamiltonian in each limit. We introduce control parameters, which define the phase diagram of the model and determine the role of each term of the Hamiltonian in the correct reproduction of the experimental data for the considered nuclei.« less

  3. Quasi-probabilities in conditioned quantum measurement and a geometric/statistical interpretation of Aharonov's weak value

    NASA Astrophysics Data System (ADS)

    Lee, Jaeha; Tsutsui, Izumi

    2017-05-01

    We show that the joint behavior of an arbitrary pair of (generally noncommuting) quantum observables can be described by quasi-probabilities, which are an extended version of the standard probabilities used for describing the outcome of measurement for a single observable. The physical situations that require these quasi-probabilities arise when one considers quantum measurement of an observable conditioned by some other variable, with the notable example being the weak measurement employed to obtain Aharonov's weak value. Specifically, we present a general prescription for the construction of quasi-joint probability (QJP) distributions associated with a given combination of observables. These QJP distributions are introduced in two complementary approaches: one from a bottom-up, strictly operational construction realized by examining the mathematical framework of the conditioned measurement scheme, and the other from a top-down viewpoint realized by applying the results of the spectral theorem for normal operators and their Fourier transforms. It is then revealed that, for a pair of simultaneously measurable observables, the QJP distribution reduces to the unique standard joint probability distribution of the pair, whereas for a noncommuting pair there exists an inherent indefiniteness in the choice of such QJP distributions, admitting a multitude of candidates that may equally be used for describing the joint behavior of the pair. In the course of our argument, we find that the QJP distributions furnish the space of operators in the underlying Hilbert space with their characteristic geometric structures such that the orthogonal projections and inner products of observables can be given statistical interpretations as, respectively, “conditionings” and “correlations”. The weak value Aw for an observable A is then given a geometric/statistical interpretation as either the orthogonal projection of A onto the subspace generated by another observable B, or equivalently, as the conditioning of A given B with respect to the QJP distribution under consideration.

  4. Compensatory Evolution of Intrinsic Transcription Terminators in Bacillus Cereus

    PubMed Central

    Safina, Ksenia R.; Mironov, Andrey A.

    2017-01-01

    Many RNA molecules possess complicated secondary structure critical to their function. Mutations in double-helical regions of RNA may disrupt Watson–Crick (WC) interactions causing structure destabilization or even complete loss of function. Such disruption can be compensated by another mutation restoring base pairing, as has been shown for mRNA, rRNA and tRNA. Here, we investigate the evolution of intrinsic transcription terminators between closely related strains of Bacillus cereus. While the terminator structure is maintained by strong natural selection, as evidenced by the low frequency of disrupting mutations, we observe multiple instances of pairs of disrupting-compensating mutations in RNA structure stems. Such two-step switches between different WC pairs occur very fast, consistent with the low fitness conferred by the intermediate non-WC variant. Still, they are not instantaneous, and probably involve transient fixation of the intermediate variant. The GU wobble pair is the most frequent intermediate, and remains fixed longer than other intermediates, consistent with its less disruptive effect on the RNA structure. Double switches involving non-GU intermediates are more frequent at the ends of RNA stems, probably because they are associated with smaller fitness loss. Together, these results show that the fitness landscape of bacterial transcription terminators is rather rugged, but that the fitness valleys associated with unpaired stem nucleotides are rather shallow, facilitating evolution. PMID:28201729

  5. Chirality Characterization of Dispersed Single Wall Carbon Nanotubes

    NASA Technical Reports Server (NTRS)

    Namkung, Min; Williams, Phillip A.; Mayweather, Candis D.; Wincheski, Buzz; Park, Cheol; Namkung, Juock S.

    2005-01-01

    Raman scattering and optical absorption spectroscopy are used for the chirality characterization of HiPco single wall carbon nanotubes (SWNTs) dispersed in aqueous solution with the surfactant sodium dodecylbenzene sulfonate. Radial breathing mode (RBM) Raman peaks for semiconducting and metallic SWNTs are identified by directly comparing the Raman spectra with the Kataura plot. The SWNT diameters are calculated from these resonant peak positions. Next, a list of (n, m) pairs, yielding the SWNT diameters within a few percent of that obtained from each resonant peak position, is established. The interband transition energies for the list of SWNT (n, m) pairs are calculated based on the tight binding energy expression for each list of the (n, m) pairs, and the pairs yielding the closest values to the corresponding experimental optical absorption peaks are selected. The results reveal that (1, 11), (4, 11), and (0, 11) as the most probable chiralities of the semiconducting nanotubes. The results also reveal that (4, 16), (6, 12) and (8, 8) are the most probable chiralities for the metallic nanotubes. Directly relating the Raman scattering data to the optical absorption spectra, the present method is considered the simplest technique currently available. Another advantage of this technique is the use of the E(sup 8)(sub 11) peaks in the optical absorption spectrum in the analysis to enhance the accuracy in the results.

  6. Pairing call-response surveys and distance sampling for a mammalian carnivore

    USGS Publications Warehouse

    Hansen, Sara J. K.; Frair, Jacqueline L.; Underwood, Harold B.; Gibbs, James P.

    2015-01-01

    Density estimates accounting for differential animal detectability are difficult to acquire for wide-ranging and elusive species such as mammalian carnivores. Pairing distance sampling with call-response surveys may provide an efficient means of tracking changes in populations of coyotes (Canis latrans), a species of particular interest in the eastern United States. Blind field trials in rural New York State indicated 119-m linear error for triangulated coyote calls, and a 1.8-km distance threshold for call detectability, which was sufficient to estimate a detection function with precision using distance sampling. We conducted statewide road-based surveys with sampling locations spaced ≥6 km apart from June to August 2010. Each detected call (be it a single or group) counted as a single object, representing 1 territorial pair, because of uncertainty in the number of vocalizing animals. From 524 survey points and 75 detections, we estimated the probability of detecting a calling coyote to be 0.17 ± 0.02 SE, yielding a detection-corrected index of 0.75 pairs/10 km2 (95% CI: 0.52–1.1, 18.5% CV) for a minimum of 8,133 pairs across rural New York State. Importantly, we consider this an index rather than true estimate of abundance given the unknown probability of coyote availability for detection during our surveys. Even so, pairing distance sampling with call-response surveys provided a novel, efficient, and noninvasive means of monitoring populations of wide-ranging and elusive, albeit reliably vocal, mammalian carnivores. Our approach offers an effective new means of tracking species like coyotes, one that is readily extendable to other species and geographic extents, provided key assumptions of distance sampling are met.

  7. Detecting Planet Pairs in Mean Motion Resonances via the Astrometry Method

    NASA Astrophysics Data System (ADS)

    Wu, Dong-Hong; Liu, Hui-Gen; Yu, Zhou-Yi; Zhang, Hui; Zhou, Ji-Lin

    2016-07-01

    Gaia is leading us into a new era with a high astrometry precision of ˜10 μas. Under such precision, astrometry can play an important role in detecting and characterizing exoplanets. In particular, we can identify planet pairs in mean motion resonances (MMRs), which constrain the formation and evolution of planetary systems. In accordance with observations, we consider two-Jupiter or two-super-Earth systems in 1:2, 2:3, and 3:4 MMRs. Our simulations show that the false alarm probabilities (FAPs) of a third planet are extremely small, while the two real planets can be fitted well with a signal-to-noise ratio (S/N) \\gt 3. The probability of reconstructing a resonant system is related to the eccentricities and the resonance intensity. Generally, when the S/N ≥slant 10, if the eccentricities of both planets are larger than 0.01 and the resonance is quite strong, the probability of reconstructing the planet pair in MMRs is ≥slant 80 % . Jupiter pairs in MMRs are reconstructed more easily than super-Earth pairs with similar S/N when we consider dynamical stability. FAPs are also calculated when we detect planet pairs in or near MMRs. The FAPs for 1:2 MMRs are the largest, I.e., FAP \\gt 15 % when S/N ≤slant 10. Extrapolating from the Kepler planet pairs near MMRs and assuming a S/N ˜ 3, we discover and reconstruct a few tens of Jupiter pairs and hundreds of super-Earth pairs in 2:3 and 1:2 MMRs within 30 pc. We also compare the differences between even and uneven data cadence and find that planets are better measured with more uniform phase coverage.

  8. Isoscalar neutron-proton pairing and SU(4)-symmetry breaking in Gamow-Teller transitions

    NASA Astrophysics Data System (ADS)

    Kaneko, K.; Sun, Y.; Mizusaki, T.

    2018-05-01

    The isoscalar neutron-proton pairing is thought to be important for nuclei with equal number of protons and neutrons but its manifestation in structure properties remains to be understood. We investigate the Gamow-Teller (GT) transitions for the f7 /2-shell nuclei in large-scale shell-model calculations with the realistic Hamiltonian. We show that the isoscalar T =0 ,Jπ=1+ neutron-proton pairing interaction plays a decisive role for the concentration of GT strengths at the first-excited 11+ state in 42Sc, and that the suppression of these strengths in 46V, 50Mn, and 54Co is mainly caused by the spin-orbit force supplemented by the quadrupole-quadrupole interaction. Based on the good reproduction of the charge-exchange reaction data, we further analyze the interplay between the isoscalar and isovector pairing correlations. We conclude that even for the most promising A =42 nuclei where the SU(4) isoscalar-isovector-pairing symmetry is less broken, the probability of forming an isoscalar neutron-proton pairing condensation is less than 60% as compared to the expectation at the SU(4)-symmetry limit.

  9. A three-state kinetic agent-based model to analyze tax evasion dynamics

    NASA Astrophysics Data System (ADS)

    Crokidakis, Nuno

    2014-11-01

    In this work we study the problem of tax evasion on a fully-connected population. For this purpose, we consider that the agents may be in three different states, namely honest tax payers, tax evaders and undecided, that are individuals in an intermediate class among honests and evaders. Every individual can change his/her state following a kinetic exchange opinion dynamics, where the agents interact by pairs with competitive negative (with probability q) and positive (with probability 1-q) couplings, representing agreement/disagreement between pairs of agents. In addition, we consider the punishment rules of the Zaklan econophysics model, for which there is a probability pa of an audit each agent is subject to in every period and a length of time k detected tax evaders remain honest. Our results suggest that below the critical point qc=1/4 of the opinion dynamics the compliance is high, and the punishment rules have a small effect in the population. On the other hand, for q>qc the tax evasion can be considerably reduced by the enforcement mechanism. We also discuss the impact of the presence of the undecided agents in the evolution of the system.

  10. Labeling of Chromosomes in Cell Development and the Appearance of Monozygotic Twins.

    PubMed

    Jim, Carol; Berkovich, Simon

    2015-01-01

    Understanding the mechanism behind the structure of the internal cellular clock can lead to advances in the knowledge of origins of pairs of monozygotic twins and higher order multiples as well as other biological phenomena. To gain insight into this mechanism, we analyze possible cell labeling schemes that model an organism's development. Our findings lead us to predict that monozygotic quadruplets are not quadruplets in the traditional sense but rather two pairs of monozygotic twins where the pairs slightly differ-a situation we coin quadruplet twins. From the considered model, the probability of monozygotic twins is found to be (1/2) (K) , and we discover that the probability of monozygotic quadruplets, or triplets as in the case of the death of an embryo, is (1/8) (K) , where K is a species-specific integer representing the number of pairs of homologous chromosomes. The parameter K may determine cancerization with a probability threshold that is approximately inversely proportional to the Hayflick limit. Exposure to some cancerization factors such as small levels of ionizing radiation and chemical pollution may not produce cancer.

  11. Labeling of Chromosomes in Cell Development and the Appearance of Monozygotic Twins

    PubMed Central

    Berkovich, Simon

    2015-01-01

    Understanding the mechanism behind the structure of the internal cellular clock can lead to advances in the knowledge of origins of pairs of monozygotic twins and higher order multiples as well as other biological phenomena. To gain insight into this mechanism, we analyze possible cell labeling schemes that model an organism's development. Our findings lead us to predict that monozygotic quadruplets are not quadruplets in the traditional sense but rather two pairs of monozygotic twins where the pairs slightly differ—a situation we coin quadruplet twins. From the considered model, the probability of monozygotic twins is found to be (1/2)K, and we discover that the probability of monozygotic quadruplets, or triplets as in the case of the death of an embryo, is (1/8)K, where K is a species-specific integer representing the number of pairs of homologous chromosomes. The parameter K may determine cancerization with a probability threshold that is approximately inversely proportional to the Hayflick limit. Exposure to some cancerization factors such as small levels of ionizing radiation and chemical pollution may not produce cancer. PMID:26185760

  12. Freezing transition of the random bond RNA model: Statistical properties of the pairing weights

    NASA Astrophysics Data System (ADS)

    Monthus, Cécile; Garel, Thomas

    2007-03-01

    To characterize the pairing specificity of RNA secondary structures as a function of temperature, we analyze the statistics of the pairing weights as follows: for each base (i) of the sequence of length N , we consider the (N-1) pairing weights wi(j) with the other bases (j≠i) of the sequence. We numerically compute the probability distributions P1(w) of the maximal weight wimax=maxj[wi(j)] , the probability distribution Π(Y2) of the parameter Y2(i)=∑jwi2(j) , as well as the average values of the moments Yk(i)=∑jwik(j) . We find that there are two important temperatures TcTgap , the distribution P1(w) vanishes at some value w0(T)<1 , and accordingly the moments Yk(i)¯ decay exponentially as [w0(T)]k in k . For T

  13. DNA sequence alignment by microhomology sampling during homologous recombination

    PubMed Central

    Qi, Zhi; Redding, Sy; Lee, Ja Yil; Gibb, Bryan; Kwon, YoungHo; Niu, Hengyao; Gaines, William A.; Sung, Patrick

    2015-01-01

    Summary Homologous recombination (HR) mediates the exchange of genetic information between sister or homologous chromatids. During HR, members of the RecA/Rad51 family of recombinases must somehow search through vast quantities of DNA sequence to align and pair ssDNA with a homologous dsDNA template. Here we use single-molecule imaging to visualize Rad51 as it aligns and pairs homologous DNA sequences in real-time. We show that Rad51 uses a length-based recognition mechanism while interrogating dsDNA, enabling robust kinetic selection of 8-nucleotide (nt) tracts of microhomology, which kinetically confines the search to sites with a high probability of being a homologous target. Successful pairing with a 9th nucleotide coincides with an additional reduction in binding free energy and subsequent strand exchange occurs in precise 3-nt steps, reflecting the base triplet organization of the presynaptic complex. These findings provide crucial new insights into the physical and evolutionary underpinnings of DNA recombination. PMID:25684365

  14. Understanding Fomalhaut as a Cooper pair

    NASA Astrophysics Data System (ADS)

    Feng, F.; Jones, H. R. A.

    2018-03-01

    Fomalhaut is a nearby stellar system and has been found to be a triple based on astrometric observations. With new radial velocity and astrometric data, we study the association between Fomalhaut A, B, and C in a Bayesian framework, finding that the system is gravitationally bound or at least associated. Based on simulations of the system, we find that Fomalhaut C can be easily destabilized through combined perturbations from the Galactic tide and stellar encounters. Considering that observing the disruption of a triple is probably rare in the solar neighbourhood, we conclude that Fomalhaut C is a so-called `gravitational pair' of Fomalhaut A and B. Like the Cooper pair mechanism in superconductors, this phenomenon only appears once the orbital energy of a component becomes comparable with the energy fluctuations caused by the environment. Based on our simulations, we find (1) an upper limit of 8 km s-1 velocity difference is appropriate when selecting binary candidates, and (2) an empirical formula for the escape radius, which is more appropriate than tidal radius when measuring the stability of wide binaries.

  15. A new exact and more powerful unconditional test of no treatment effect from binary matched pairs.

    PubMed

    Lloyd, Chris J

    2008-09-01

    We consider the problem of testing for a difference in the probability of success from matched binary pairs. Starting with three standard inexact tests, the nuisance parameter is first estimated and then the residual dependence is eliminated by maximization, producing what I call an E+M P-value. The E+M P-value based on McNemar's statistic is shown numerically to dominate previous suggestions, including partially maximized P-values as described in Berger and Sidik (2003, Statistical Methods in Medical Research 12, 91-108). The latter method, however, may have computational advantages for large samples.

  16. Summary of evidence for an anticodonic basis for the origin of the genetic code

    NASA Technical Reports Server (NTRS)

    Lacey, J. C., Jr.; Mullins, D. W., Jr.

    1981-01-01

    This article summarizes data supporting the hypothesis that the genetic code origin was based on relationships (probably affinities) between amino acids and their anticodon nucleotides. Selective activation seems to follow from selective affinity and consequently, incorporation of amino acids into peptides can also be selective. It is suggested that these selectivities in affinity and activation, coupled with the base pairing specificities, allowed the origin of the code and the process of translation.

  17. Hard choices in assessing survival past dams — a comparison of single- and paired-release strategies

    USGS Publications Warehouse

    Zydlewski, Joseph D.; Stich, Daniel S.; Sigourney, Douglas B.

    2017-01-01

    Mark–recapture models are widely used to estimate survival of salmon smolts migrating past dams. Paired releases have been used to improve estimate accuracy by removing components of mortality not attributable to the dam. This method is accompanied by reduced precision because (i) sample size is reduced relative to a single, large release; and (ii) variance calculations inflate error. We modeled an idealized system with a single dam to assess trade-offs between accuracy and precision and compared methods using root mean squared error (RMSE). Simulations were run under predefined conditions (dam mortality, background mortality, detection probability, and sample size) to determine scenarios when the paired release was preferable to a single release. We demonstrate that a paired-release design provides a theoretical advantage over a single-release design only at large sample sizes and high probabilities of detection. At release numbers typical of many survival studies, paired release can result in overestimation of dam survival. Failures to meet model assumptions of a paired release may result in further overestimation of dam-related survival. Under most conditions, a single-release strategy was preferable.

  18. Construction and identification of a D-Vine model applied to the probability distribution of modal parameters in structural dynamics

    NASA Astrophysics Data System (ADS)

    Dubreuil, S.; Salaün, M.; Rodriguez, E.; Petitjean, F.

    2018-01-01

    This study investigates the construction and identification of the probability distribution of random modal parameters (natural frequencies and effective parameters) in structural dynamics. As these parameters present various types of dependence structures, the retained approach is based on pair copula construction (PCC). A literature review leads us to choose a D-Vine model for the construction of modal parameters probability distributions. Identification of this model is based on likelihood maximization which makes it sensitive to the dimension of the distribution, namely the number of considered modes in our context. To this respect, a mode selection preprocessing step is proposed. It allows the selection of the relevant random modes for a given transfer function. The second point, addressed in this study, concerns the choice of the D-Vine model. Indeed, D-Vine model is not uniquely defined. Two strategies are proposed and compared. The first one is based on the context of the study whereas the second one is purely based on statistical considerations. Finally, the proposed approaches are numerically studied and compared with respect to their capabilities, first in the identification of the probability distribution of random modal parameters and second in the estimation of the 99 % quantiles of some transfer functions.

  19. Discrimination of relationships with the same degree of kinship using chromosomal sharing patterns estimated from high-density SNPs.

    PubMed

    Morimoto, Chie; Manabe, Sho; Fujimoto, Shuntaro; Hamano, Yuya; Tamaki, Keiji

    2018-03-01

    Distinguishing relationships with the same degree of kinship (e.g., uncle-nephew and grandfather-grandson) is generally difficult in forensic genetics by using the commonly employed short tandem repeat loci. In this study, we developed a new method for discerning such relationships between two individuals by examining the number of chromosomal shared segments estimated from high-density single nucleotide polymorphisms (SNPs). We computationally generated second-degree kinships (i.e., uncle-nephew and grandfather-grandson) and third-degree kinships (i.e., first cousins and great-grandfather-great-grandson) for 174,254 autosomal SNPs considering the effect of linkage disequilibrium and recombination for each SNP. We investigated shared chromosomal segments between two individuals that were estimated based on identity by state regions. We then counted the number of segments in each pair. Based on our results, the number of shared chromosomal segments in collateral relationships was larger than that in lineal relationships with both the second-degree and third-degree kinships. This was probably caused by differences involving chromosomal transitions and recombination between relationships. As we probabilistically evaluated the relationships between simulated pairs based on the number of shared segments using logistic regression, we could determine accurate relationships in >90% of second-degree relatives and >70% of third-degree relatives, using a probability criterion for the relationship ≥0.9. Furthermore, we could judge the true relationships of actual sample pairs from volunteers, as well as simulated data. Therefore, this method can be useful for discerning relationships between two individuals with the same degree of kinship. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. The effects of anterior arcuate and dorsomedial frontal cortex lesions on visually guided eye movements: 2. Paired and multiple targets.

    PubMed

    Schiller, P H; Chou, I

    2000-01-01

    This study examined the effects of anterior arcuate and dorsomedial frontal cortex lesions on the execution of saccadic eye movements made to paired and multiple targets in rhesus monkeys. Identical paired targets were presented with various temporal asynchronies to determine the temporal offset required to yield equal probability choices to either target. In the intact animal equal probability choices were typically obtained when the targets appeared simultaneously. After unilateral anterior arcuate lesions a major shift arose in the temporal offset required to obtain equal probability choices for paired targets that necessitated presenting the target in the hemifield contralateral to the lesion more than 100 ms prior to the target in the ipsilateral hemifield. This deficit was still pronounced 1 year after the lesion. Dorsomedial frontal cortex lesions produced much smaller but significant shifts in target selection that recovered more rapidly. Paired lesions produced deficits similar to those observed with anterior arcuate lesions alone. Major deficits were also observed on a multiple target temporal discrimination task after anterior arcuate but not after dorsomedial frontal cortex lesions. These results suggest that the frontal eye fields that reside in anterior bank of the arcuate sulcus play an important role in temporal processing and in target selection. Dorsomedial frontal cortex, that contains the medial eye fields, plays a much less important role in the execution of these tasks.

  1. Altering the Electrostatic Potential in the Major Groove: Thermodynamic and Structural Characterization of 7-Deaza-2;#8242;-deoxyadenosine:dT Base Pairing in DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kowal, Ewa A.; Ganguly, Manjori; Pallan, Pradeep S.

    As part of an ongoing effort to explore the effect of major groove electrostatics on the thermodynamic stability and structure of DNA, a 7-deaza-2'-deoxyadenosine:dT (7-deaza-dA:dT) base pair in the Dickerson-Drew dodecamer (DDD) was studied. The removal of the electronegative N7 atom on dA and the replacement with an electropositive C-H in the major groove was expected to have a significant effect on major groove electrostatics. The structure of the 7-deaza-dA:dT base pair was determined at 1.1 {angstrom} resolution in the presence of Mg{sup 2+}. The 7-deaza-dA, which is isosteric for dA, had minimal effect on the base pairing geometry andmore » the conformation of the DDD in the crystalline state. There was no major groove cation association with the 7-deaza-dA heterocycle. In solution, circular dichroism showed a positive Cotton effect centered at 280 nm and a negative Cotton effect centered at 250 nm that were characteristic of a right-handed helix in the B-conformation. However, temperature-dependent NMR studies showed increased exchange between the thymine N3 imino proton of the 7-deaza-dA:dT base pair and water, suggesting reduced stacking interactions and an increased rate of base pair opening. This correlated with the observed thermodynamic destabilization of the 7-deaza-dA modified duplex relative to the DDD. A combination of UV melting and differential scanning calorimetry experiments were conducted to evaluate the relative contributions of enthalpy and entropy in the thermodynamic destabilization of the DDD. The most significant contribution arose from an unfavorable enthalpy term, which probably results from less favorable stacking interactions in the modified duplex, which was accompanied by a significant reduction in the release of water and cations from the 7-deaza-dA modified DNA.« less

  2. Altering the Electrostatic Potential in the Major Groove: Thermodynamic and Structural Characterization of 7-Deaza-2′-deoxyadenosine:dT Base Pairing in DNA

    PubMed Central

    2011-01-01

    As part of an ongoing effort to explore the effect of major groove electrostatics on the thermodynamic stability and structure of DNA, a 7-deaza-2′-deoxyadenosine:dT (7-deaza-dA:dT) base pair in the Dickerson–Drew dodecamer (DDD) was studied. The removal of the electronegative N7 atom on dA and the replacement with an electropositive C–H in the major groove was expected to have a significant effect on major groove electrostatics. The structure of the 7-deaza-dA:dT base pair was determined at 1.1 Å resolution in the presence of Mg2+. The 7-deaza-dA, which is isosteric for dA, had minimal effect on the base pairing geometry and the conformation of the DDD in the crystalline state. There was no major groove cation association with the 7-deaza-dA heterocycle. In solution, circular dichroism showed a positive Cotton effect centered at 280 nm and a negative Cotton effect centered at 250 nm that were characteristic of a right-handed helix in the B-conformation. However, temperature-dependent NMR studies showed increased exchange between the thymine N3 imino proton of the 7-deaza-dA:dT base pair and water, suggesting reduced stacking interactions and an increased rate of base pair opening. This correlated with the observed thermodynamic destabilization of the 7-deaza-dA modified duplex relative to the DDD. A combination of UV melting and differential scanning calorimetry experiments were conducted to evaluate the relative contributions of enthalpy and entropy in the thermodynamic destabilization of the DDD. The most significant contribution arose from an unfavorable enthalpy term, which probably results from less favorable stacking interactions in the modified duplex, which was accompanied by a significant reduction in the release of water and cations from the 7-deaza-dA modified DNA. PMID:22059929

  3. Dynamics of Markets

    NASA Astrophysics Data System (ADS)

    McCauley, Joseph L.

    2009-09-01

    Preface; 1. Econophysics: why and what; 2. Neo-classical economic theory; 3. Probability and stochastic processes; 4. Introduction to financial economics; 5. Introduction to portfolio selection theory; 6. Scaling, pair correlations, and conditional densities; 7. Statistical ensembles: deducing dynamics from time series; 8. Martingale option pricing; 9. FX market globalization: evolution of the dollar to worldwide reserve currency; 10. Macroeconomics and econometrics: regression models vs. empirically based modeling; 11. Complexity; Index.

  4. Functional base-pairing interaction between highly conserved elements of U3 small nucleolar RNA and the small ribosomal subunit RNA.

    PubMed

    Hughes, J M

    1996-06-21

    The U3 nucleolar RNA has a remarkably wide phyletic distribution extending from the Eukarya to the Archaea. It functions in maturation of the small subunit (SSU) rRNA through a mechanism which is as yet unknown but which involves base-pairing with pre-rRNA. The most conserved part of U3 is within 30 nucleotides of the 5' end, but as yet no function for this domain has been proposed. Elements within this domain are complementary to highly conserved sequences in the SSU rRNA which, in the mature form, fold into a universally conserved pseudoknot. The nature of the complementarity suggests a novel mechanism for U3 function whereby U3 facilitates correct folding of the pseudoknot. Wide phylogenetic comparison provides compelling evidence in support of the interaction in that significant complementary changes have taken place, particularly in the archaeon Sulfolobus, which maintain the base-pairing. Base-substitution mutations in yeast U3 designed to disrupt the base-pairing indicate that the interaction is probably essential. These include cold-sensitivity mutations which exhibit phenotypes similar to U3-depletion, but without impairment of the AO processing step, which occurs within the 5' ETS. These phenotypes are consistent with the destabilization of SSU precursors and partial impairment of the processing steps A1, at the 5' ETS/18 S boundary, and A2, within the ITS1.

  5. Combined-probability space and certainty or uncertainty relations for a finite-level quantum system

    NASA Astrophysics Data System (ADS)

    Sehrawat, Arun

    2017-08-01

    The Born rule provides a probability vector (distribution) with a quantum state for a measurement setting. For two settings, we have a pair of vectors from the same quantum state. Each pair forms a combined-probability vector that obeys certain quantum constraints, which are triangle inequalities in our case. Such a restricted set of combined vectors, called the combined-probability space, is presented here for a d -level quantum system (qudit). The combined space is a compact convex subset of a Euclidean space, and all its extreme points come from a family of parametric curves. Considering a suitable concave function on the combined space to estimate the uncertainty, we deliver an uncertainty relation by finding its global minimum on the curves for a qudit. If one chooses an appropriate concave (or convex) function, then there is no need to search for the absolute minimum (maximum) over the whole space; it will be on the parametric curves. So these curves are quite useful for establishing an uncertainty (or a certainty) relation for a general pair of settings. We also demonstrate that many known tight certainty or uncertainty relations for a qubit can be obtained with the triangle inequalities.

  6. Simultaneous production of lepton pairs in ultraperipheral relativistic heavy ion collisions

    NASA Astrophysics Data System (ADS)

    Kurban, E.; Güçlü, M. C.

    2017-10-01

    We calculate the total cross sections and probabilities of electromagnetic productions of electron, muon, and tauon pairs simultaneously. At the CERN Large Hadron Collider (LHC), the available electromagnetic energy is sufficient to produce all kinds of leptons coherently. The masses of muons and tauons are large, so their Compton wavelengths are small enough to interact with the colliding nuclei. Therefore, the realistic nuclear form factors are included in the calculations of electromagnetic pair productions. The cross section calculations show that, at LHC energies, the probabilities of simultaneous productions of all kinds of leptons are increased significantly compared to energies available at the BNL Relativistic Heavy Ion Collider (RHIC) . Experimentally, observing this simultaneous production can give us important information about strong QED.

  7. Two-photon interference of polarization-entangled photons in a Franson interferometer.

    PubMed

    Kim, Heonoh; Lee, Sang Min; Kwon, Osung; Moon, Han Seb

    2017-07-18

    We present two-photon interference experiments with polarization-entangled photon pairs in a polarization-based Franson-type interferometer. Although the two photons do not meet at a common beamsplitter, a phase-insensitive Hong-Ou-Mandel type two-photon interference peak and dip fringes are observed, resulting from the two-photon interference effect between two indistinguishable two-photon probability amplitudes leading to a coincidence detection. A spatial quantum beating fringe is also measured for nondegenerate photon pairs in the same interferometer, although the two-photon states have no frequency entanglement. When unentangled polarization-correlated photons are used as an input state, the polarization entanglement is successfully recovered through the interferometer via delayed compensation.

  8. Molecular basis of length polymorphism in the human zeta-globin gene complex.

    PubMed Central

    Goodbourn, S E; Higgs, D R; Clegg, J B; Weatherall, D J

    1983-01-01

    The length polymorphism between the human zeta-globin gene and its pseudogene is caused by an allele-specific variation in the copy number of a tandemly repeating 36-base-pair sequence. This sequence is related to a tandemly repeated 14-base-pair sequence in the 5' flanking region of the human insulin gene, which is known to cause length polymorphism, and to a repetitive sequence in intervening sequence (IVS) 1 of the pseudo-zeta-globin gene. Evidence is presented that the latter is also of variable length, probably because of differences in the copy number of the tandem repeat. The homology between the three length polymorphisms may be an indication of the presence of a more widespread group of related sequences in the human genome, which might be useful for generalized linkage studies. PMID:6308667

  9. Causal inference, probability theory, and graphical insights.

    PubMed

    Baker, Stuart G

    2013-11-10

    Causal inference from observational studies is a fundamental topic in biostatistics. The causal graph literature typically views probability theory as insufficient to express causal concepts in observational studies. In contrast, the view here is that probability theory is a desirable and sufficient basis for many topics in causal inference for the following two reasons. First, probability theory is generally more flexible than causal graphs: Besides explaining such causal graph topics as M-bias (adjusting for a collider) and bias amplification and attenuation (when adjusting for instrumental variable), probability theory is also the foundation of the paired availability design for historical controls, which does not fit into a causal graph framework. Second, probability theory is the basis for insightful graphical displays including the BK-Plot for understanding Simpson's paradox with a binary confounder, the BK2-Plot for understanding bias amplification and attenuation in the presence of an unobserved binary confounder, and the PAD-Plot for understanding the principal stratification component of the paired availability design. Published 2013. This article is a US Government work and is in the public domain in the USA.

  10. General theory of the multistage geminate reactions of the isolated pairs of reactants. II. Detailed balance and universal asymptotes of kinetics.

    PubMed

    Kipriyanov, Alexey A; Doktorov, Alexander B

    2014-10-14

    The analysis of general (matrix) kinetic equations for the mean survival probabilities of any of the species in a sample (or mean concentrations) has been made for a wide class of the multistage geminate reactions of the isolated pairs. These kinetic equations (obtained in the frame of the kinetic approach based on the concept of "effective" particles in Paper I) take into account various possible elementary reactions (stages of a multistage reaction) excluding monomolecular, but including physical and chemical processes of the change in internal quantum states carried out with the isolated pairs of reactants (or isolated reactants). The general basic principles of total and detailed balance have been established. The behavior of the reacting system has been considered on macroscopic time scales, and the universal long-term kinetics has been determined.

  11. Statistical models for predicting pair dispersion and particle clustering in isotropic turbulence and their applications

    NASA Astrophysics Data System (ADS)

    Zaichik, Leonid I.; Alipchenkov, Vladimir M.

    2009-10-01

    The purpose of this paper is twofold: (i) to advance and extend the statistical two-point models of pair dispersion and particle clustering in isotropic turbulence that were previously proposed by Zaichik and Alipchenkov (2003 Phys. Fluids15 1776-87 2007 Phys. Fluids 19, 113308) and (ii) to present some applications of these models. The models developed are based on a kinetic equation for the two-point probability density function of the relative velocity distribution of two particles. These models predict the pair relative velocity statistics and the preferential accumulation of heavy particles in stationary and decaying homogeneous isotropic turbulent flows. Moreover, the models are applied to predict the effect of particle clustering on turbulent collisions, sedimentation and intensity of microwave radiation as well as to calculate the mean filtered subgrid stress of the particulate phase. Model predictions are compared with direct numerical simulations and experimental measurements.

  12. Time- and Space-Order Effects in Timed Discrimination of Brightness and Size of Paired Visual Stimuli

    ERIC Educational Resources Information Center

    Patching, Geoffrey R.; Englund, Mats P.; Hellstrom, Ake

    2012-01-01

    Despite the importance of both response probability and response time for testing models of choice, there is a dearth of chronometric studies examining systematic asymmetries that occur over time- and space-orders in the method of paired comparisons. In this study, systematic asymmetries in discriminating the magnitude of paired visual stimuli are…

  13. Computational DNA hole spectroscopy: A new tool to predict mutation hotspots, critical base pairs, and disease ‘driver’ mutations

    PubMed Central

    Suárez, Martha Y.; Villagrán; Miller, John H.

    2015-01-01

    We report on a new technique, computational DNA hole spectroscopy, which creates spectra of electron hole probabilities vs. nucleotide position. A hole is a site of positive charge created when an electron is removed. Peaks in the hole spectrum depict sites where holes tend to localize and potentially trigger a base pair mismatch during replication. Our studies of mitochondrial DNA reveal a correlation between L-strand hole spectrum peaks and spikes in the human mutation spectrum. Importantly, we also find that hole peak positions that do not coincide with large variant frequencies often coincide with disease-implicated mutations and/or (for coding DNA) encoded conserved amino acids. This enables combining hole spectra with variant data to identify critical base pairs and potential disease ‘driver’ mutations. Such integration of DNA hole and variance spectra could ultimately prove invaluable for pinpointing critical regions of the vast non-protein-coding genome. An observed asymmetry in correlations, between the spectrum of human mtDNA variations and the L- and H-strand hole spectra, is attributed to asymmetric DNA replication processes that occur for the leading and lagging strands. PMID:26310834

  14. Computational DNA hole spectroscopy: A new tool to predict mutation hotspots, critical base pairs, and disease 'driver' mutations.

    PubMed

    Villagrán, Martha Y Suárez; Miller, John H

    2015-08-27

    We report on a new technique, computational DNA hole spectroscopy, which creates spectra of electron hole probabilities vs. nucleotide position. A hole is a site of positive charge created when an electron is removed. Peaks in the hole spectrum depict sites where holes tend to localize and potentially trigger a base pair mismatch during replication. Our studies of mitochondrial DNA reveal a correlation between L-strand hole spectrum peaks and spikes in the human mutation spectrum. Importantly, we also find that hole peak positions that do not coincide with large variant frequencies often coincide with disease-implicated mutations and/or (for coding DNA) encoded conserved amino acids. This enables combining hole spectra with variant data to identify critical base pairs and potential disease 'driver' mutations. Such integration of DNA hole and variance spectra could ultimately prove invaluable for pinpointing critical regions of the vast non-protein-coding genome. An observed asymmetry in correlations, between the spectrum of human mtDNA variations and the L- and H-strand hole spectra, is attributed to asymmetric DNA replication processes that occur for the leading and lagging strands.

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Băloi, Mihaela-Andreea, E-mail: mihaela.baloi88@e-uvt.ro; Crucean, Cosmin

    The production of fermions in dipolar electric fields on de Sitter universe is studied. The amplitude and probability of pair production are computed using the exact solution of the Dirac equation in de Sitter spacetime. The form of the dipolar fields is established using the conformal invariance of the Maxwell equations. We obtain that the momentum conservation law is broken in the process of pair production in dipolar electric fields. Also we establish that there are nonvanishing probabilities for processes in which the helicity is conserved/nonconserved. The Minkowski limit is recovered when the expansion factor becomes zero.

  16. Distinct dissociation kinetics between ion pairs: Solvent-coordinate free-energy landscape analysis.

    PubMed

    Yonetani, Yoshiteru

    2015-07-28

    Different ion pairs exhibit different dissociation kinetics; however, while the nature of this process is vital for understanding various molecular systems, the underlying mechanism remains unclear. In this study, to examine the origin of different kinetic rate constants for this process, molecular dynamics simulations were conducted for LiCl, NaCl, KCl, and CsCl in water. The results showed substantial differences in dissociation rate constant, following the trend kLiCl < kNaCl < kKCl < kCsCl. Analysis of the free-energy landscape with a solvent reaction coordinate and subsequent rate component analysis showed that the differences in these rate constants arose predominantly from the variation in solvent-state distribution between the ion pairs. The formation of a water-bridging configuration, in which the water molecule binds to an anion and a cation simultaneously, was identified as a key step in this process: water-bridge formation lowers the related dissociation free-energy barrier, thereby increasing the probability of ion-pair dissociation. Consequently, a higher probability of water-bridge formation leads to a higher ion-pair dissociation rate.

  17. A Biochemical Magic Frequency Based on the Reduction Level of Biological Carbon

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1995-01-01

    We have calculated the average number of electron pairs required for the chemical reduction of carbon dioxide to biological carbon using (a) estimates of the reducing equivalents (electron pairs) needed to synthesize biomolecules from carbon dioxide, and (b) measurements of the molecular composition of different organisms. These calculations showed that the carbon of the Earth's biosphere is at the reduction level of formaldehyde that requires two electron pairs per carbon atom to be synthesized from carbon dioxide. This was also the reduction level of cellular carbon when fuel stored as lipid was not used in the estimate. Since this chemical characteristic of life is probably universal, it could be the one thing we know about other carbon-based life in the universe, and the one thing that other intelligent life knows about us. We believe that this common knowledge that biological carbon throughout the universe is at the reduction level of formaldehyde could lead to the selection of the 72.83814 GHz line of the 0, 0, 0 yields 1, 1, 1 rotational transition of formaldehyde as a frequency for interstellar communication.

  18. Superconducting surface impedance under radiofrequency field

    DOE PAGES

    Xiao, Binping P.; Reece, Charles E.; Kelley, Michael J.

    2013-04-26

    Based on BCS theory with moving Cooper pairs, the electron states distribution at 0K and the probability of electron occupation with finite temperature have been derived and applied to anomalous skin effect theory to obtain the surface impedance of a superconductor under radiofrequency (RF) field. We present the numerical results for Nb and compare these with representative RF field-dependent effective surface resistance measurements from a 1.5 GHz resonant structure.

  19. Correlative feature analysis on FFDM

    PubMed Central

    Yuan, Yading; Giger, Maryellen L.; Li, Hui; Sennett, Charlene

    2008-01-01

    Identifying the corresponding images of a lesion in different views is an essential step in improving the diagnostic ability of both radiologists and computer-aided diagnosis (CAD) systems. Because of the nonrigidity of the breasts and the 2D projective property of mammograms, this task is not trivial. In this pilot study, we present a computerized framework that differentiates between corresponding images of the same lesion in different views and noncorresponding images, i.e., images of different lesions. A dual-stage segmentation method, which employs an initial radial gradient index (RGI) based segmentation and an active contour model, is applied to extract mass lesions from the surrounding parenchyma. Then various lesion features are automatically extracted from each of the two views of each lesion to quantify the characteristics of density, size, texture and the neighborhood of the lesion, as well as its distance to the nipple. A two-step scheme is employed to estimate the probability that the two lesion images from different mammographic views are of the same physical lesion. In the first step, a correspondence metric for each pairwise feature is estimated by a Bayesian artificial neural network (BANN). Then, these pairwise correspondence metrics are combined using another BANN to yield an overall probability of correspondence. Receiver operating characteristic (ROC) analysis was used to evaluate the performance of the individual features and the selected feature subset in the task of distinguishing corresponding pairs from noncorresponding pairs. Using a FFDM database with 123 corresponding image pairs and 82 noncorresponding pairs, the distance feature yielded an area under the ROC curve (AUC) of 0.81±0.02 with leave-one-out (by physical lesion) evaluation, and the feature metric subset, which included distance, gradient texture, and ROI-based correlation, yielded an AUC of 0.87±0.02. The improvement by using multiple feature metrics was statistically significant compared to single feature performance. PMID:19175108

  20. A new probable stem lineage crustacean with three-dimensionally preserved soft parts from the Herefordshire (Silurian) Lagerstätte, UK

    PubMed Central

    Siveter, Derek J; Sutton, Mark D; Briggs, Derek E.G; Siveter, David J

    2007-01-01

    A new arthropod with three-dimensionally preserved soft parts, Tanazios dokeron, is described from the Wenlock Series (Silurian) of Herefordshire, England, UK. Serial grinding, digital photographic and computer rendering techniques yielded ‘virtual fossils’ in the round for study. The body tagmata of T. dokeron comprise a head shield and a long trunk. The head shield bears six pairs of horn-like spines and the head bears five pairs of appendages. The antennule, antenna and mandible are all uniramous, and the mandible includes a gnathobasic coxa. Appendages four and five are biramous and similar to those of the trunk: each comprises a limb base with an endite, an enditic membrane, and two epipodites, plus an endopod and exopod. The hypostome bears a large cone-like projection centrally, and there may be a short labrum. The trunk has some 64 segments and at least 60 appendage pairs. A very small telson has the anus sited ventrally in its posterior part and also bears a caudal furca. Comparative morphological and cladistic analyses of T. dokeron indicate a crustacean affinity, with a probable position in the eucrustacean stem group. As such the epipodites in T. dokeron are the first recorded in a eucrustacean stem taxon. The new species is interpreted as a benthic or nektobenthic scavenger. PMID:17609185

  1. An Effective Big Data Supervised Imbalanced Classification Approach for Ortholog Detection in Related Yeast Species

    PubMed Central

    Galpert, Deborah; del Río, Sara; Herrera, Francisco; Ancede-Gallardo, Evys; Antunes, Agostinho; Agüero-Chapin, Guillermin

    2015-01-01

    Orthology detection requires more effective scaling algorithms. In this paper, a set of gene pair features based on similarity measures (alignment scores, sequence length, gene membership to conserved regions, and physicochemical profiles) are combined in a supervised pairwise ortholog detection approach to improve effectiveness considering low ortholog ratios in relation to the possible pairwise comparison between two genomes. In this scenario, big data supervised classifiers managing imbalance between ortholog and nonortholog pair classes allow for an effective scaling solution built from two genomes and extended to other genome pairs. The supervised approach was compared with RBH, RSD, and OMA algorithms by using the following yeast genome pairs: Saccharomyces cerevisiae-Kluyveromyces lactis, Saccharomyces cerevisiae-Candida glabrata, and Saccharomyces cerevisiae-Schizosaccharomyces pombe as benchmark datasets. Because of the large amount of imbalanced data, the building and testing of the supervised model were only possible by using big data supervised classifiers managing imbalance. Evaluation metrics taking low ortholog ratios into account were applied. From the effectiveness perspective, MapReduce Random Oversampling combined with Spark SVM outperformed RBH, RSD, and OMA, probably because of the consideration of gene pair features beyond alignment similarities combined with the advances in big data supervised classification. PMID:26605337

  2. An Effective Big Data Supervised Imbalanced Classification Approach for Ortholog Detection in Related Yeast Species.

    PubMed

    Galpert, Deborah; Del Río, Sara; Herrera, Francisco; Ancede-Gallardo, Evys; Antunes, Agostinho; Agüero-Chapin, Guillermin

    2015-01-01

    Orthology detection requires more effective scaling algorithms. In this paper, a set of gene pair features based on similarity measures (alignment scores, sequence length, gene membership to conserved regions, and physicochemical profiles) are combined in a supervised pairwise ortholog detection approach to improve effectiveness considering low ortholog ratios in relation to the possible pairwise comparison between two genomes. In this scenario, big data supervised classifiers managing imbalance between ortholog and nonortholog pair classes allow for an effective scaling solution built from two genomes and extended to other genome pairs. The supervised approach was compared with RBH, RSD, and OMA algorithms by using the following yeast genome pairs: Saccharomyces cerevisiae-Kluyveromyces lactis, Saccharomyces cerevisiae-Candida glabrata, and Saccharomyces cerevisiae-Schizosaccharomyces pombe as benchmark datasets. Because of the large amount of imbalanced data, the building and testing of the supervised model were only possible by using big data supervised classifiers managing imbalance. Evaluation metrics taking low ortholog ratios into account were applied. From the effectiveness perspective, MapReduce Random Oversampling combined with Spark SVM outperformed RBH, RSD, and OMA, probably because of the consideration of gene pair features beyond alignment similarities combined with the advances in big data supervised classification.

  3. Does prediction error drive one-shot declarative learning?

    PubMed

    Greve, Andrea; Cooper, Elisa; Kaula, Alexander; Anderson, Michael C; Henson, Richard

    2017-06-01

    The role of prediction error (PE) in driving learning is well-established in fields such as classical and instrumental conditioning, reward learning and procedural memory; however, its role in human one-shot declarative encoding is less clear. According to one recent hypothesis, PE reflects the divergence between two probability distributions: one reflecting the prior probability (from previous experiences) and the other reflecting the sensory evidence (from the current experience). Assuming unimodal probability distributions, PE can be manipulated in three ways: (1) the distance between the mode of the prior and evidence, (2) the precision of the prior, and (3) the precision of the evidence. We tested these three manipulations across five experiments, in terms of peoples' ability to encode a single presentation of a scene-item pairing as a function of previous exposures to that scene and/or item. Memory was probed by presenting the scene together with three choices for the previously paired item, in which the two foil items were from other pairings within the same condition as the target item. In Experiment 1, we manipulated the evidence to be either consistent or inconsistent with prior expectations, predicting PE to be larger, and hence memory better, when the new pairing was inconsistent. In Experiments 2a-c, we manipulated the precision of the priors, predicting better memory for a new pairing when the (inconsistent) priors were more precise. In Experiment 3, we manipulated both visual noise and prior exposure for unfamiliar faces, before pairing them with scenes, predicting better memory when the sensory evidence was more precise. In all experiments, the PE hypotheses were supported. We discuss alternative explanations of individual experiments, and conclude the Predictive Interactive Multiple Memory Signals (PIMMS) framework provides the most parsimonious account of the full pattern of results.

  4. Coherent exciton transport in dendrimers and continuous-time quantum walks

    NASA Astrophysics Data System (ADS)

    Mülken, Oliver; Bierbaum, Veronika; Blumen, Alexander

    2006-03-01

    We model coherent exciton transport in dendrimers by continuous-time quantum walks. For dendrimers up to the second generation the coherent transport shows perfect recurrences when the initial excitation starts at the central node. For larger dendrimers, the recurrence ceases to be perfect, a fact which resembles results for discrete quantum carpets. Moreover, depending on the initial excitation site, we find that the coherent transport to certain nodes of the dendrimer has a very low probability. When the initial excitation starts from the central node, the problem can be mapped onto a line which simplifies the computational effort. Furthermore, the long time average of the quantum mechanical transition probabilities between pairs of nodes shows characteristic patterns and allows us to classify the nodes into clusters with identical limiting probabilities. For the (space) average of the quantum mechanical probability to be still or to be again at the initial site, we obtain, based on the Cauchy-Schwarz inequality, a simple lower bound which depends only on the eigenvalue spectrum of the Hamiltonian.

  5. Theoretical study on the cooperative exciton dissociation process based on dimensional and hot charge-transfer state effects in an organic photocell

    NASA Astrophysics Data System (ADS)

    Shimazaki, Tomomi; Nakajima, Takahito

    2016-06-01

    This paper discusses the exciton dissociation process at the donor-acceptor interface in organic photocells. In our previous study, we introduced a local temperature to handle the hot charge-transfer (CT) state and calculated the exciton dissociation probability based on the 1D organic semiconductor model [T. Shimazaki and T. Nakajima, Phys. Chem. Chem. Phys. 17, 12538 (2015)]. Although the hot CT state plays an essential role in exciton dissociations, the probabilities calculated are not high enough to efficiently separate bound electron-hole pairs. This paper focuses on the dimensional (entropy) effect together with the hot CT state effect and shows that cooperative behavior between both effects can improve the exciton dissociation process. In addition, we discuss cooperative effects with site-disorders and external-electric-fields.

  6. Infants' statistical learning: 2- and 5-month-olds' segmentation of continuous visual sequences.

    PubMed

    Slone, Lauren Krogh; Johnson, Scott P

    2015-05-01

    Past research suggests that infants have powerful statistical learning abilities; however, studies of infants' visual statistical learning offer differing accounts of the developmental trajectory of and constraints on this learning. To elucidate this issue, the current study tested the hypothesis that young infants' segmentation of visual sequences depends on redundant statistical cues to segmentation. A sample of 20 2-month-olds and 20 5-month-olds observed a continuous sequence of looming shapes in which unit boundaries were defined by both transitional probability and co-occurrence frequency. Following habituation, only 5-month-olds showed evidence of statistically segmenting the sequence, looking longer to a statistically improbable shape pair than to a probable pair. These results reaffirm the power of statistical learning in infants as young as 5 months but also suggest considerable development of statistical segmentation ability between 2 and 5 months of age. Moreover, the results do not support the idea that infants' ability to segment visual sequences based on transitional probabilities and/or co-occurrence frequencies is functional at the onset of visual experience, as has been suggested previously. Rather, this type of statistical segmentation appears to be constrained by the developmental state of the learner. Factors contributing to the development of statistical segmentation ability during early infancy, including memory and attention, are discussed. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. A method of fitting the gravity model based on the Poisson distribution.

    PubMed

    Flowerdew, R; Aitkin, M

    1982-05-01

    "In this paper, [the authors] suggest an alternative method for fitting the gravity model. In this method, the interaction variable is treated as the outcome of a discrete probability process, whose mean is a function of the size and distance variables. This treatment seems appropriate when the dependent variable represents a count of the number of items (people, vehicles, shipments) moving from one place to another. It would seem to have special advantages where there are some pairs of places between which few items move. The argument will be illustrated with reference to data on the numbers of migrants moving in 1970-1971 between pairs of the 126 labor market areas defined for Great Britain...." excerpt

  8. Deterministic Joint Remote Preparation of Arbitrary Four-Qubit Cluster-Type State Using EPR Pairs

    NASA Astrophysics Data System (ADS)

    Li, Wenqian; Chen, Hanwu; Liu, Zhihao

    2017-02-01

    Using four Einstein-Podolsky-Rosen (EPR) pairs as the pre-shared quantum channel, an economic and feasible scheme for deterministic joint remote preparation of the four-particle cluster-type state is presented. In the scheme, one of the senders performs a four-qubit projective measurement based on a set of ingeniously constructed vectors with real coefficients, while the other performs the bipartite projective measurements in terms of the imaginary coefficients. Followed with some appropriate unitary operations and controlled-NOT operations, the receiver can reconstruct the desired state. Compared with other analogous JRSP schemes, our scheme can not only reconstruct the original state (to be prepared remotely) with unit successful probability, but also ensure greater efficiency.

  9. Repeated count surveys help standardize multi-agency estimates of American Oystercatcher (Haematopus palliatus) abundance

    USGS Publications Warehouse

    Hostetter, Nathan J.; Gardner, Beth; Schweitzer, Sara H.; Boettcher, Ruth; Wilke, Alexandra L.; Addison, Lindsay; Swilling, William R.; Pollock, Kenneth H.; Simons, Theodore R.

    2015-01-01

    The extensive breeding range of many shorebird species can make integration of survey data problematic at regional spatial scales. We evaluated the effectiveness of standardized repeated count surveys coordinated across 8 agencies to estimate the abundance of American Oystercatcher (Haematopus palliatus) breeding pairs in the southeastern United States. Breeding season surveys were conducted across coastal North Carolina (90 plots) and the Eastern Shore of Virginia (3 plots). Plots were visited on 1–5 occasions during April–June 2013. N-mixture models were used to estimate abundance and detection probability in relation to survey date, tide stage, plot size, and plot location (coastal bay vs. barrier island). The estimated abundance of oystercatchers in the surveyed area was 1,048 individuals (95% credible interval: 851–1,408) and 470 pairs (384–637), substantially higher than estimates that did not account for detection probability (maximum counts of 674 individuals and 316 pairs). Detection probability was influenced by a quadratic function of survey date, and increased from mid-April (~0.60) to mid-May (~0.80), then remained relatively constant through June. Detection probability was also higher during high tide than during low, rising, or falling tides. Abundance estimates from N-mixture models were validated at 13 plots by exhaustive productivity studies (2–5 surveys wk−1). Intensive productivity studies identified 78 breeding pairs across 13 productivity plots while the N-mixture model abundance estimate was 74 pairs (62–119) using only 1–5 replicated surveys season−1. Our results indicate that standardized replicated count surveys coordinated across multiple agencies and conducted during a relatively short time window (closure assumption) provide tremendous potential to meet both agency-level (e.g., state) and regional-level (e.g., flyway) objectives in large-scale shorebird monitoring programs.

  10. Transmission events revealed in tuberculosis contact investigations in London.

    PubMed

    Cavany, Sean M; Vynnycky, Emilia; Sumner, Tom; Macdonald, Neil; Thomas, H Lucy; White, Jacqui; White, Richard G; Maguire, Helen; Anderson, Charlotte

    2018-04-27

    Contact tracing is a key part of tuberculosis prevention and care, aiming to hasten diagnosis and prevent transmission. The proportion of case-contact pairs for which recent transmission occurred and the typical timespans between the index case and their contact accessing care are not known; we aimed to calculate these. We analysed individual-level TB contact tracing data, collected in London from 20/01/2011-31/12/2015, linked to tuberculosis surveillance and MIRU-VNTR 24-locus strain-typing information. Of pairs of index cases and contacts diagnosed with active tuberculosis, 85/314 (27%) had strain typing data available for both. Of these pairs, 79% (67/85) shared indistinguishable isolates, implying probable recent transmission. Of pairs in which both contact and the index case had a social risk factor, 11/11 (100%) shared indistinguishable isolates, compared to 55/75 (75%) of pairs in which neither had a social risk factor (P = 0.06). The median time interval between the index case and their contact accessing care was 42 days (IQR: 16, 96). As over 20% of pairs did probably not involve recent transmission between index case and contact, the effectiveness of contact tracing is not necessarily limited to those circumstances where the index case has transmitted disease to their close contacts.

  11. Higher-dimensional attractors with absolutely continuous invariant probability

    NASA Astrophysics Data System (ADS)

    Bocker, Carlos; Bortolotti, Ricardo

    2018-05-01

    Consider a dynamical system given by , where E is a linear expanding map of , C is a linear contracting map of and f is in . We provide sufficient conditions for E that imply the existence of an open set of pairs for which the corresponding dynamic T admits a unique absolutely continuous invariant probability. A geometrical characteristic of transversality between self-intersections of images of is present in the dynamic of the maps in . In addition, we give a condition between E and C under which it is possible to perturb f to obtain a pair in .

  12. What is preexisting strength? Predicting free association probabilities, similarity ratings, and cued recall probabilities.

    PubMed

    Nelson, Douglas L; Dyrdal, Gunvor M; Goodmon, Leilani B

    2005-08-01

    Measuring lexical knowledge poses a challenge to the study of the influence of preexisting knowledge on the retrieval of new memories. Many tasks focus on word pairs, but words are embedded in associative networks, so how should preexisting pair strength be measured? It has been measured by free association, similarity ratings, and co-occurrence statistics. Researchers interpret free association response probabilities as unbiased estimates of forward cue-to-target strength. In Study 1, analyses of large free association and extralist cued recall databases indicate that this interpretation is incorrect. Competitor and backward strengths bias free association probabilities, and as with other recall tasks, preexisting strength is described by a ratio rule. In Study 2, associative similarity ratings are predicted by forward and backward, but not by competitor, strength. Preexisting strength is not a unitary construct, because its measurement varies with method. Furthermore, free association probabilities predict extralist cued recall better than do ratings and co-occurrence statistics. The measure that most closely matches the criterion task may provide the best estimate of the identity of preexisting strength.

  13. Study on Incompatibility of Traditional Chinese Medicine: Evidence from Formula Network, Chemical Space, and Metabolism Room

    PubMed Central

    Zhang, Xiao-Dong; Wu, Hong-Ying; Jin, Jin; Yu, Guang-Yun; He, Xin; Wang, Hao; Shen, Xiu; Zhou, Ze-Wei; Liu, Pei-Xun; Fan, Sai-Jun

    2013-01-01

    A traditional Chinese medicine (TCM) formula network including 362 TCM formulas was built by using complex network methodologies. The properties of this network were analyzed including network diameter, average distance, clustering coefficient, and average degree. Meanwhile, we built a TCM chemical space and a TCM metabolism room under the theory of chemical space. The properties of chemical space and metabolism room were calculated and analyzed. The properties of the medicine pairs in “eighteen antagonisms and nineteen mutual inhibitors,” an ancient rule for TCM incompatibility, were studied based on the TCM formula network, chemical space, and metabolism room. The results showed that the properties of these incompatible medicine pairs are different from those of the other TCM based on the analysis of the TCM formula network, chemical space, and metabolism room. The lines of evidence derived from our work demonstrated that the ancient rule of TCM incompatibility, “eighteen antagonisms and nineteen mutual inhibitors,” is probably scientifically based. PMID:24369478

  14. Automated matching of supine and prone colonic polyps based on PCA and SVMs

    NASA Astrophysics Data System (ADS)

    Wang, Shijun; Van Uitert, Robert L.; Summers, Ronald M.

    2008-03-01

    Computed tomographic colonography (CTC) is a feasible and minimally invasive method for the detection of colorectal polyps and cancer screening. In current practice, a patient will be scanned twice during the CTC examination - once supine and once prone. In order to assist the radiologists in evaluating colon polyp candidates in both scans, we expect the computer aided detection (CAD) system can provide not only the locations of suspicious polyps, but also the possible matched pairs of polyps in two scans. In this paper, we propose a new automated matching method based on the extracted features of polyps by using principal component analysis (PCA) and Support Vector Machines (SVMs). Our dataset comes from the 104 CT scans of 52 patients with supine and prone positions collected from three medical centers. From it we constructed two groups of matched polyp candidates according to the size of true polyps: group A contains 12 true polyp pairs (> 9 mm) and 454 false pairs; group B contains 24 true polyp pairs (6-9 mm) and 514 false pairs. By using PCA, we reduced the dimensions of original data (with 157 attributes) to 30 dimensions. We did leave-one-patient-out test on the two groups of data. ROC analysis shows that it is easier to match bigger polyps than that of smaller polyps. On group A data, when false alarm probability is 0.18, the sensitivity of SVM achieves 0.83 which shows that automated matching of polyp candidates is practicable for clinical applications.

  15. Behavior of visual field index in advanced glaucoma.

    PubMed

    Rao, Harsha L; Senthil, Sirisha; Choudhari, Nikhil S; Mandal, Anil K; Garudadri, Chandra S

    2013-01-14

    To evaluate the magnitude of Visual Field Index (VFI) change attributable to change in the estimation algorithm from the pattern deviation probability plot (PDPP) to the total deviation probability plot (TDPP) when the mean deviation (MD) crosses -20 decibels (dB). In a retrospective study, 37 stable glaucoma eyes in which MD of the VFs crossed -20 dB were identified. For each eye, a pair of VFs was selected so that one VF of the pair had a MD better than but close to -20 dB and the other had a MD worse than but again close to -20 dB. The change in VFI in the VF pairs and its associations with the number of points in probability plots with normal threshold sensitivities were evaluated. Similar pairs of VFs from 28 stable glaucoma eyes where the MD crossed -10 dB were chosen as controls. The change in VFI in VF pairs when the MD crossed 20 dB ranged from 3% to 33% (median: 15%), while the change when MD crossed -10 dB ranged from 1% to 8% (median: 4%). Difference in the number of points with normal threshold sensitivities in PDPP when MD was better than -20 dB compared to those in TDPP when MD crossed -20 dB significantly influenced the VFI change (R(2) = 0.65). Considering the eccentricity of these points further explained the VFI change (R(2) = 0.81). The decrease in VFI when MD crosses -20 dB can be highly variable. This has to be considered with the use of VFI in clinical and research settings.

  16. Comparison of Different Risk Perception Measures in Predicting Seasonal Influenza Vaccination among Healthy Chinese Adults in Hong Kong: A Prospective Longitudinal Study

    PubMed Central

    Liao, Qiuyan; Wong, Wing Sze; Fielding, Richard

    2013-01-01

    Background Risk perception is a reported predictor of vaccination uptake, but which measures of risk perception best predict influenza vaccination uptake remain unclear. Methodology During the main influenza seasons (between January and March) of 2009 (Wave 1) and 2010 (Wave 2),505 Chinese students and employees from a Hong Kong university completed an online survey. Multivariate logistic regression models were conducted to assess how well different risk perceptions measures in Wave 1 predicted vaccination uptake against seasonal influenza in Wave 2. Principal Findings The results of the multivariate logistic regression models showed that feeling at risk (β = 0.25, p = 0.021) was the better predictor compared with probability judgment while probability judgment (β = 0.25, p = 0.029 ) was better than beliefs about risk in predicting subsequent influenza vaccination uptake. Beliefs about risk and feeling at risk seemed to predict the same aspect of subsequent vaccination uptake because their associations with vaccination uptake became insignificant when paired into the logistic regression model. Similarly, to compare the four scales for assessing probability judgment in predicting vaccination uptake, the 7-point verbal scale remained a significant and stronger predictor for vaccination uptake when paired with other three scales; the 6-point verbal scale was a significant and stronger predictor when paired with the percentage scale or the 2-point verbal scale; and the percentage scale was a significant and stronger predictor only when paired with the 2-point verbal scale. Conclusions/Significance Beliefs about risk and feeling at risk are not well differentiated by Hong Kong Chinese people. Feeling at risk, an affective-cognitive dimension of risk perception predicts subsequent vaccination uptake better than do probability judgments. Among the four scales for assessing risk probability judgment, the 7-point verbal scale offered the best predictive power for subsequent vaccination uptake. PMID:23894292

  17. Comparison of different risk perception measures in predicting seasonal influenza vaccination among healthy Chinese adults in Hong Kong: a prospective longitudinal study.

    PubMed

    Liao, Qiuyan; Wong, Wing Sze; Fielding, Richard

    2013-01-01

    Risk perception is a reported predictor of vaccination uptake, but which measures of risk perception best predict influenza vaccination uptake remain unclear. During the main influenza seasons (between January and March) of 2009 (Wave 1) and 2010 (Wave 2),505 Chinese students and employees from a Hong Kong university completed an online survey. Multivariate logistic regression models were conducted to assess how well different risk perceptions measures in Wave 1 predicted vaccination uptake against seasonal influenza in Wave 2. The results of the multivariate logistic regression models showed that feeling at risk (β = 0.25, p = 0.021) was the better predictor compared with probability judgment while probability judgment (β = 0.25, p = 0.029 ) was better than beliefs about risk in predicting subsequent influenza vaccination uptake. Beliefs about risk and feeling at risk seemed to predict the same aspect of subsequent vaccination uptake because their associations with vaccination uptake became insignificant when paired into the logistic regression model. Similarly, to compare the four scales for assessing probability judgment in predicting vaccination uptake, the 7-point verbal scale remained a significant and stronger predictor for vaccination uptake when paired with other three scales; the 6-point verbal scale was a significant and stronger predictor when paired with the percentage scale or the 2-point verbal scale; and the percentage scale was a significant and stronger predictor only when paired with the 2-point verbal scale. Beliefs about risk and feeling at risk are not well differentiated by Hong Kong Chinese people. Feeling at risk, an affective-cognitive dimension of risk perception predicts subsequent vaccination uptake better than do probability judgments. Among the four scales for assessing risk probability judgment, the 7-point verbal scale offered the best predictive power for subsequent vaccination uptake.

  18. Spatial Multiplexing of Atom-Photon Entanglement Sources using Feedforward Control and Switching Networks.

    PubMed

    Tian, Long; Xu, Zhongxiao; Chen, Lirong; Ge, Wei; Yuan, Haoxiang; Wen, Yafei; Wang, Shengzhi; Li, Shujing; Wang, Hai

    2017-09-29

    The light-matter quantum interface that can create quantum correlations or entanglement between a photon and one atomic collective excitation is a fundamental building block for a quantum repeater. The intrinsic limit is that the probability of preparing such nonclassical atom-photon correlations has to be kept low in order to suppress multiexcitation. To enhance this probability without introducing multiexcitation errors, a promising scheme is to apply multimode memories to the interface. Significant progress has been made in temporal, spectral, and spatial multiplexing memories, but the enhanced probability for generating the entangled atom-photon pair has not been experimentally realized. Here, by using six spin-wave-photon entanglement sources, a switching network, and feedforward control, we build a multiplexed light-matter interface and then demonstrate a ∼sixfold (∼fourfold) probability increase in generating entangled atom-photon (photon-photon) pairs. The measured compositive Bell parameter for the multiplexed interface is 2.49±0.03 combined with a memory lifetime of up to ∼51  μs.

  19. Questionnaire about psychology/disease correlation–I

    PubMed Central

    Ojog, DG; Pănescu, OM; Rusu, EC; Tănăsescu, MD

    2011-01-01

    Rationale: The existing personality inventories are exploring too general psychological features so that the possible psychology/disease associations might be leveled out. Objective: We attempt to build a tool to explore the possible correlation between certain psychological features and the most common internal disorders. Method: We have used two questionnaires containing many pairs of synonymous items (necessary for assessing the consistency of the answers). The items are divided into four main domains: preoccupation for the basal conditions of existence (health/ disease/ death, fear, money, lodging); interaction with other people; action, will/ volition, self-assertion; and preoccupation with the exterior. In this first article we are presenting the correlations between items of the first domain, based on the answers from our first 3138 respondents. Results and discussion: The concern about health is best reflected by general formulations. The desire for security is best expressed by items combining the worry about money and dwelling, and worst by items reflecting the eagerness to gain, keep or judiciously spend money. Among the various fears, those of future, darkness, and loneliness are better indicators of security concern. In assessing the anxiety about safety/ security, specific worries are more revelatory than the general ones. Precaution and inclination for order are the best indicators for the aspiration to stability. Poorer ones are the desire for cleanliness and the tendency to attachment. Health and security concerns seem to be consistently linked. The consistency evaluating system will be based upon pairs of synonymous items correlated with a10–200 or less error probability Abbreviations: PP = psychological profile; PF = personality feature; Q1/ Q2/ Q3 = first/ second/ third questionnaire; HeSD = health subdomain; SeSD = security subdomain; StSD = stability subdomain; ChiSq = chi square; ErrProb = error probability (probability of error). PMID:21505574

  20. A method of classification for multisource data in remote sensing based on interval-valued probabilities

    NASA Technical Reports Server (NTRS)

    Kim, Hakil; Swain, Philip H.

    1990-01-01

    An axiomatic approach to intervalued (IV) probabilities is presented, where the IV probability is defined by a pair of set-theoretic functions which satisfy some pre-specified axioms. On the basis of this approach representation of statistical evidence and combination of multiple bodies of evidence are emphasized. Although IV probabilities provide an innovative means for the representation and combination of evidential information, they make the decision process rather complicated. It entails more intelligent strategies for making decisions. The development of decision rules over IV probabilities is discussed from the viewpoint of statistical pattern recognition. The proposed method, so called evidential reasoning method, is applied to the ground-cover classification of a multisource data set consisting of Multispectral Scanner (MSS) data, Synthetic Aperture Radar (SAR) data, and digital terrain data such as elevation, slope, and aspect. By treating the data sources separately, the method is able to capture both parametric and nonparametric information and to combine them. Then the method is applied to two separate cases of classifying multiband data obtained by a single sensor. In each case a set of multiple sources is obtained by dividing the dimensionally huge data into smaller and more manageable pieces based on the global statistical correlation information. By a divide-and-combine process, the method is able to utilize more features than the conventional maximum likelihood method.

  1. Prediction of penicillin resistance in Staphylococcus aureus isolates from dairy cows with mastitis, based on prior test results.

    PubMed

    Grinberg, A; Lopez-Villalobos, N; Lawrence, K; Nulsen, M

    2005-10-01

    To gauge how well prior laboratory test results predict in vitro penicillin resistance of Staphylococcus aureus isolates from dairy cows with mastitis. Population-based data on the farm of origin (n=79), genotype based on pulsed-field gel electrophoresis (PFGE) results, and the penicillin-resistance status of Staph. aureus isolates (n=115) from milk samples collected from dairy cows with mastitis submitted to two diagnostic laboratories over a 6-month period were used. Data were mined stochastically using the all-possible-pairs method, binomial modelling and bootstrap simulation, to test whether prior test results enhance the accuracy of prediction of penicillin resistance on farms. Of all Staph. aureus isolates tested, 38% were penicillin resistant. A significant aggregation of penicillin-resistance status was evident within farms. The probability of random pairs of isolates from the same farm having the same penicillin-resistance status was 76%, compared with 53% for random pairings of samples across all farms. Thus, the resistance status of randomly selected isolates was 1.43 times more likely to correctly predict the status of other isolates from the same farm than the random population pairwise concordance probability (p=0.011). This effect was likely due to the clonal relationship of isolates within farms, as the predictive fraction attributable to prior test results was close to nil when the effect of within-farm clonal infections was withdrawn from the model. Knowledge of the penicillin-resistance status of a prior Staph. aureus isolate significantly enhanced the predictive capability of other isolates from the same farm. In the time and space frame of this study, clinicians using previous information from a farm would have more accurately predicted the penicillin-resistance status of an isolate than they would by chance alone on farms infected with clonal Staph. aureus isolates, but not on farms infected with highly genetically heterogeneous bacterial strains.

  2. Theoretical study on the cooperative exciton dissociation process based on dimensional and hot charge-transfer state effects in an organic photocell

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shimazaki, Tomomi; Nakajima, Takahito

    2016-06-21

    This paper discusses the exciton dissociation process at the donor–acceptor interface in organic photocells. In our previous study, we introduced a local temperature to handle the hot charge-transfer (CT) state and calculated the exciton dissociation probability based on the 1D organic semiconductor model [T. Shimazaki and T. Nakajima, Phys. Chem. Chem. Phys. 17, 12538 (2015)]. Although the hot CT state plays an essential role in exciton dissociations, the probabilities calculated are not high enough to efficiently separate bound electron–hole pairs. This paper focuses on the dimensional (entropy) effect together with the hot CT state effect and shows that cooperative behaviormore » between both effects can improve the exciton dissociation process. In addition, we discuss cooperative effects with site-disorders and external-electric-fields.« less

  3. Applications of the first digit law to measure correlations.

    PubMed

    Gramm, R; Yost, J; Su, Q; Grobe, R

    2017-04-01

    The quasiempirical Benford law predicts that the distribution of the first significant digit of random numbers obtained from mixed probability distributions is surprisingly meaningful and reveals some universal behavior. We generalize this finding to examine the joint first-digit probability of a pair of two random numbers and show that undetectable correlations by means of the usual covariance-based measure can be identified in the statistics of the corresponding first digits. We illustrate this new measure by analyzing the correlations and anticorrelations of the positions of two interacting particles in their quantum mechanical ground state. This suggests that by using this measure, the presence or absence of correlations can be determined even if only the first digit of noisy experimental data can be measured accurately.

  4. Discriminating two nonorthogonal states against a noise channel by feed-forward control

    NASA Astrophysics Data System (ADS)

    Guo, Li-Sha; Xu, Bao-Ming; Zou, Jian; Wang, Chao-Quan; Li, Hai; Li, Jun-Gang; Shao, Bin

    2015-02-01

    We propose a scheme by using the feed-forward control (FFC) to realize a better effect of discrimination of two nonorthogonal states after passing a noise channel based on the minimum-error (ME) discrimination. We show that the application of our scheme can highly improve the effect of discrimination compared with the ME discrimination without the FFC for any pair of nonorthogonal states and any degree of amplitude damping. Especially, the effect of our optimal discrimination can reach that of the two initial nonorthogonal pure states in the presence of the noise channel in a deterministic way for equal a priori probabilities or even be better than that in a probabilistic way for unequal a priori probabilities.

  5. Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

    PubMed

    Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

    2017-03-29

    The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

  6. Performance of six diagnostic tests to screen for Chagas disease in blood banks andprevalence of Trypanosoma cruzi infection among donors with inconclusive serologyscreening based on the analysis of epidemiological variables.

    PubMed

    Pereira, Gilberto de Araujo; Louzada-Neto, Francisco; Barbosa, Valdirene de Fátima; Ferreira-Silva, Márcia Maria; de Moraes-Souza, Helio

    2012-01-01

    The frequent occurrence of inconclusive serology in blood banks and the absence of a gold standard test for Chagas'disease led us to examine the efficacy of the blood culture test and five commercial tests (ELISA, IIF, HAI, c-ELISA, rec-ELISA) used in screening blood donors for Chagas disease, as well as to investigate the prevalence of Trypanosoma cruzi infection among donors with inconclusive serology screening in respect to some epidemiological variables. To obtain estimates of interest we considered a Bayesian latent class model with inclusion of covariates from the logit link. A better performance was observed with some categories of epidemiological variables. In addition, all pairs of tests (excluding the blood culture test) presented as good alternatives for both screening (sensitivity > 99.96% in parallel testing) and for confirmation (specificity > 99.93% in serial testing) of Chagas disease. The prevalence of 13.30% observed in the stratum of donors with inconclusive serology, means that probably most of these are non-reactive serology. In addition, depending on the level of specific epidemiological variables, the absence of infection can be predicted with a probability of 100% in this group from the pairs of tests using parallel testing. The epidemiological variables can lead to improved test results and thus assist in the clarification of inconclusive serology screening results. Moreover, all combinations of pairs using the five commercial tests are good alternatives to confirm results.

  7. Optimal sensor placement for active guided wave interrogation of complex metallic components

    NASA Astrophysics Data System (ADS)

    Coelho, Clyde K.; Kim, Seung Bum; Chattopadhyay, Aditi

    2011-04-01

    With research in structural health monitoring (SHM) moving towards increasingly complex structures for damage interrogation, the placement of sensors is becoming a key issue in the performance of the damage detection methodologies. For ultrasonic wave based approaches, this is especially important because of the sensitivity of the travelling Lamb waves to material properties, geometry and boundary conditions that may obscure the presence of damage if they are not taken into account during sensor placement. The framework proposed in this paper defines a sensing region for a pair of piezoelectric transducers in a pitch-catch damage detection approach by taking into account the material attenuation and probability of false alarm. Using information about the region interrogated by a sensoractuator pair, a simulated annealing optimization framework was implemented in order to place sensors on complex metallic geometries such that a selected minimum damage type and size could be detected with an acceptable probability of false alarm anywhere on the structure. This approach was demonstrated on a lug joint to detect a crack and on a large Naval SHM test bed and resulted in a placement of sensors that was able to interrogate all parts of the structure using the minimum number of transducers.

  8. Entropy of finite random binary sequences with weak long-range correlations.

    PubMed

    Melnik, S S; Usatenko, O V

    2014-11-01

    We study the N-step binary stationary ergodic Markov chain and analyze its differential entropy. Supposing that the correlations are weak we express the conditional probability function of the chain through the pair correlation function and represent the entropy as a functional of the pair correlator. Since the model uses the two-point correlators instead of the block probability, it makes it possible to calculate the entropy of strings at much longer distances than using standard methods. A fluctuation contribution to the entropy due to finiteness of random chains is examined. This contribution can be of the same order as its regular part even at the relatively short lengths of subsequences. A self-similar structure of entropy with respect to the decimation transformations is revealed for some specific forms of the pair correlation function. Application of the theory to the DNA sequence of the R3 chromosome of Drosophila melanogaster is presented.

  9. Entropy of finite random binary sequences with weak long-range correlations

    NASA Astrophysics Data System (ADS)

    Melnik, S. S.; Usatenko, O. V.

    2014-11-01

    We study the N -step binary stationary ergodic Markov chain and analyze its differential entropy. Supposing that the correlations are weak we express the conditional probability function of the chain through the pair correlation function and represent the entropy as a functional of the pair correlator. Since the model uses the two-point correlators instead of the block probability, it makes it possible to calculate the entropy of strings at much longer distances than using standard methods. A fluctuation contribution to the entropy due to finiteness of random chains is examined. This contribution can be of the same order as its regular part even at the relatively short lengths of subsequences. A self-similar structure of entropy with respect to the decimation transformations is revealed for some specific forms of the pair correlation function. Application of the theory to the DNA sequence of the R3 chromosome of Drosophila melanogaster is presented.

  10. Acrocentric chromosome associations in man.

    PubMed Central

    Jacobs, P A; Mayer, M; Morton, N E

    1976-01-01

    Heterogeneity among chromosomes was found to be a highly significant source of variation for association proportions, while culture, slide, and observer were negligible sources of variation for association proportions although important for numbers of associations. The consequences of these results for tests of group differences are discussed. It seems evident that each pair of acrocentric chromosomes has its own characteristic probability of entering into association. This is presumably a combination of the probability for each individual member of the pair, a proposition easily tested utilizing acrocentric chromosomes carrying polymorphisms which allow each member of the pair to be individually recognized. A mathematical theory for pairwise satellite association was developed and shown to fit observations on banded chromosomes. While we found very significant heterogeneity among individuals in the frequency with which different chromosomes entered into associations, there was no significant evidence for preferential association between any particular chromosomes, either heterologous or homologous. This finding in our material of apparently random associations between different chromosomes is contrary to claims made by other investigators and should be tested on other material. No correlation was found between the phenotype of the chromosome, as judged by cytogenetic polymorphisms, and its probability of association. PMID:795295

  11. On the Occurrence of Wide Binaries in the Local Disk and Halo Populations

    NASA Astrophysics Data System (ADS)

    Hartman, Zachary; Lepine, Sebastien

    2018-01-01

    We present results from our search for wide binaries in the SUPERBLINK+GAIA all-sky catalog of 2.8 million high proper motion stars (μ>40 mas/yr). Through a Bayesian analysis of common proper motion pairs, we have identified highly probable wide binary/multiple systems based on statistics of their proper motion differences and angular separations. Using a reduced proper motion diagram, we determine whether these wide are part of the young disk, old disk, or Galactic halo population. We examine the relative occurrence rate for very wide companions in these respective populations. All groups are found to contain a significant number of wide binary systems, with about 1 percent of the stars in each group having pairs with separations >1,000 AU.

  12. Effect of chronic stress on short and long-term plasticity in dentate gyrus; study of recovery and adaptation.

    PubMed

    Radahmadi, M; Hosseini, N; Nasimi, A

    2014-11-07

    Stress dramatically affects synaptic plasticity of the hippocampus, disrupts paired-pulse facilitation and impairs long-term potentiation (LTP). This study was performed to find the effects of chronic restraint stress and recovery period on excitability, paired-pulse response, LTP and to find probable adaptation to very long stress in the dentate gyrus. Thirty-eight male Wistar rats were randomly divided into four groups of Control, Rest-Stress (21 days stress), Stress-Rest (recovery) and Stress-Stress (42 days stress: adaptation). Chronic restraint stress was applied 6-h/day. Input-output functions, paired-pulse responses and LTP were recorded from the dentate gyrus while stimulating the perforant pathway. We found that chronic stress attenuated the responsiveness, paired-pulse response and LTP in the dentate gyrus. A 21-day recovery period, after the stress, improved all the three responses toward normal, indicating reversibility of these stress-related hippocampal changes. There was no significant adaptation to very long stress, probably due to severity of stress. Copyright © 2014 IBRO. Published by Elsevier Ltd. All rights reserved.

  13. Using the Fast Fourier Transform to Accelerate the Computational Search for RNA Conformational Switches

    PubMed Central

    Senter, Evan; Sheikh, Saad; Dotu, Ivan; Ponty, Yann; Clote, Peter

    2012-01-01

    Using complex roots of unity and the Fast Fourier Transform, we design a new thermodynamics-based algorithm, FFTbor, that computes the Boltzmann probability that secondary structures differ by base pairs from an arbitrary initial structure of a given RNA sequence. The algorithm, which runs in quartic time and quadratic space , is used to determine the correlation between kinetic folding speed and the ruggedness of the energy landscape, and to predict the location of riboswitch expression platform candidates. A web server is available at http://bioinformatics.bc.edu/clotelab/FFTbor/. PMID:23284639

  14. Melting of genomic DNA: Predictive modeling by nonlinear lattice dynamics

    NASA Astrophysics Data System (ADS)

    Theodorakopoulos, Nikos

    2010-08-01

    The melting behavior of long, heterogeneous DNA chains is examined within the framework of the nonlinear lattice dynamics based Peyrard-Bishop-Dauxois (PBD) model. Data for the pBR322 plasmid and the complete T7 phage have been used to obtain model fits and determine parameter dependence on salt content. Melting curves predicted for the complete fd phage and the Y1 and Y2 fragments of the ϕX174 phage without any adjustable parameters are in good agreement with experiment. The calculated probabilities for single base-pair opening are consistent with values obtained from imino proton exchange experiments.

  15. Factors related to the joint probability of flooding on paired streams

    USGS Publications Warehouse

    Koltun, G.F.; Sherwood, J.M.

    1998-01-01

    The factors related to the joint probabilty of flooding on paired streams were investigated and quantified to provide information to aid in the design of hydraulic structures where the joint probabilty of flooding is an element of the design criteria. Stream pairs were considered to have flooded jointly at the design-year flood threshold (corresponding to the 2-, 10-, 25-, or 50-year instantaneous peak streamflow) if peak streamflows at both streams in the pair were observed or predicted to have equaled or exceeded the threshold on a given calendar day. Daily mean streamflow data were used as a substitute for instantaneous peak streamflow data to determine which flood thresholds were equaled or exceeded on any given day. Instantaneous peak streamflow data, when available, were used preferentially to assess flood-threshold exceedance. Daily mean streamflow data for each stream were paired with concurrent daily mean streamflow data at the other streams. Observed probabilities of joint flooding, determined for the 2-, 10-, 25-, and 50-year flood thresholds, were computed as the ratios of the total number of days when streamflows at both streams concurrently equaled or exceeded their flood thresholds (events) to the total number of days where streamflows at either stream equaled or exceeded its flood threshold (trials). A combination of correlation analyses, graphical analyses, and logistic-regression analyses were used to identify and quantify factors associated with the observed probabilities of joint flooding (event-trial ratios). The analyses indicated that the distance between drainage area centroids, the ratio of the smaller to larger drainage area, the mean drainage area, and the centroid angle adjusted 30 degrees were the basin characteristics most closely associated with the joint probabilty of flooding on paired streams in Ohio. In general, the analyses indicated that the joint probabilty of flooding decreases with an increase in centroid distance and increases with increases in drainage area ratio, mean drainage area, and centroid angle adjusted 30 degrees. Logistic-regression equations were developed, which can be used to estimate the probability that streamflows at two streams jointly equal or exceed the 2-year flood threshold given that the streamflow at one of the two streams equals or exceeds the 2-year flood threshold. The logistic-regression equations are applicable to stream pairs in Ohio (and border areas of adjacent states) that are unregulated, free of significant urban influences, and have characteristics similar to those of the 304 gaged stream pairs used in the logistic-regression analyses. Contingency tables were constructed and analyzed to provide information about the bivariate distribution of floods on paired streams. The contingency tables showed that the percentage of trials in which both streams in the pair concurrently flood at identical recurrence-interval ranges generally increased as centroid distances decreased and was greatest for stream pairs with adjusted centroid angles greater than or equal to 60 degrees and drainage area ratios greater than or equal to 0.01. Also, as centroid distance increased, streamflow at one stream in the pair was more likely to be in a less than 2-year recurrence-interval range when streamflow at the second stream was in a 2-year or greater recurrence-interval range.

  16. A Biochemical Magic Frequency

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1993-01-01

    Life is composed principally of four classes of biomolecules - protein, nucleic acid, polysaccharide and lipid. Using 1) estimates of the reducing equivalents (electron pairs) needed to synthesize these biomolecules from carbon dioxide, and 2) measurements of the molecular composition of different organisms, we calculated the average number of electron pairs required for the reduction of carbon dioxide to biological carbon (electron pairs/carbon atom). These calculations showed that the carbon of the Earths biosphere is at the reduction level of formaldehyde that requires 2 electron pairs/carbon atom to be synthesized from carbon dioxide. This was also the reduction level of carbon of individual organisms, except for those that stored large amounts of fuel as lipid. Since this chemical property of life is easily discovered and probably universal, it's most likely known by other intelligent life in the universe. It could be the one thing we know about other carbon-based life in the universe, and the one thing that other intelligent life knows about us. We believe this common knowledge that formaldehyde represents the reduction level of life's carbon could lead to the selection of the 72.83814 GHz line of the 0,0,0,1,0,1 ground-state rotational transition of formaldehyde as a frequency for interstellar communication.

  17. Efficient pairwise RNA structure prediction using probabilistic alignment constraints in Dynalign

    PubMed Central

    2007-01-01

    Background Joint alignment and secondary structure prediction of two RNA sequences can significantly improve the accuracy of the structural predictions. Methods addressing this problem, however, are forced to employ constraints that reduce computation by restricting the alignments and/or structures (i.e. folds) that are permissible. In this paper, a new methodology is presented for the purpose of establishing alignment constraints based on nucleotide alignment and insertion posterior probabilities. Using a hidden Markov model, posterior probabilities of alignment and insertion are computed for all possible pairings of nucleotide positions from the two sequences. These alignment and insertion posterior probabilities are additively combined to obtain probabilities of co-incidence for nucleotide position pairs. A suitable alignment constraint is obtained by thresholding the co-incidence probabilities. The constraint is integrated with Dynalign, a free energy minimization algorithm for joint alignment and secondary structure prediction. The resulting method is benchmarked against the previous version of Dynalign and against other programs for pairwise RNA structure prediction. Results The proposed technique eliminates manual parameter selection in Dynalign and provides significant computational time savings in comparison to prior constraints in Dynalign while simultaneously providing a small improvement in the structural prediction accuracy. Savings are also realized in memory. In experiments over a 5S RNA dataset with average sequence length of approximately 120 nucleotides, the method reduces computation by a factor of 2. The method performs favorably in comparison to other programs for pairwise RNA structure prediction: yielding better accuracy, on average, and requiring significantly lesser computational resources. Conclusion Probabilistic analysis can be utilized in order to automate the determination of alignment constraints for pairwise RNA structure prediction methods in a principled fashion. These constraints can reduce the computational and memory requirements of these methods while maintaining or improving their accuracy of structural prediction. This extends the practical reach of these methods to longer length sequences. The revised Dynalign code is freely available for download. PMID:17445273

  18. Morphometric analyses of hominoid crania, probabilities of conspecificity and an approximation of a biological species constant.

    PubMed

    Thackeray, J F; Dykes, S

    2016-02-01

    Thackeray has previously explored the possibility of using a morphometric approach to quantify the "amount" of variation within species and to assess probabilities of conspecificity when two fossil specimens are compared, instead of "pigeon-holing" them into discrete species. In an attempt to obtain a statistical (probabilistic) definition of a species, Thackeray has recognized an approximation of a biological species constant (T=-1.61) based on the log-transformed standard error of the coefficient m (log sem) in regression analysis of cranial and other data from pairs of specimens of conspecific extant species, associated with regression equations of the form y=mx+c where m is the slope and c is the intercept, using measurements of any specimen A (x axis), and any specimen B of the same species (y axis). The log-transformed standard error of the co-efficient m (log sem) is a measure of the degree of similarity between pairs of specimens, and in this study shows central tendency around a mean value of -1.61 and standard deviation 0.10 for modern conspecific specimens. In this paper we focus attention on the need to take into account the range of difference in log sem values (Δlog sem or "delta log sem") obtained from comparisons when specimen A (x axis) is compared to B (y axis), and secondly when specimen A (y axis) is compared to B (x axis). Thackeray's approach can be refined to focus on high probabilities of conspecificity for pairs of specimens for which log sem is less than -1.61 and for which Δlog sem is less than 0.03. We appeal for the adoption of a concept here called "sigma taxonomy" (as opposed to "alpha taxonomy"), recognizing that boundaries between species are not always well defined. Copyright © 2015 Elsevier GmbH. All rights reserved.

  19. A bivariate contaminated binormal model for robust fitting of proper ROC curves to a pair of correlated, possibly degenerate, ROC datasets.

    PubMed

    Zhai, Xuetong; Chakraborty, Dev P

    2017-06-01

    The objective was to design and implement a bivariate extension to the contaminated binormal model (CBM) to fit paired receiver operating characteristic (ROC) datasets-possibly degenerate-with proper ROC curves. Paired datasets yield two correlated ratings per case. Degenerate datasets have no interior operating points and proper ROC curves do not inappropriately cross the chance diagonal. The existing method, developed more than three decades ago utilizes a bivariate extension to the binormal model, implemented in CORROC2 software, which yields improper ROC curves and cannot fit degenerate datasets. CBM can fit proper ROC curves to unpaired (i.e., yielding one rating per case) and degenerate datasets, and there is a clear scientific need to extend it to handle paired datasets. In CBM, nondiseased cases are modeled by a probability density function (pdf) consisting of a unit variance peak centered at zero. Diseased cases are modeled with a mixture distribution whose pdf consists of two unit variance peaks, one centered at positive μ with integrated probability α, the mixing fraction parameter, corresponding to the fraction of diseased cases where the disease was visible to the radiologist, and one centered at zero, with integrated probability (1-α), corresponding to disease that was not visible. It is shown that: (a) for nondiseased cases the bivariate extension is a unit variances bivariate normal distribution centered at (0,0) with a specified correlation ρ 1 ; (b) for diseased cases the bivariate extension is a mixture distribution with four peaks, corresponding to disease not visible in either condition, disease visible in only one condition, contributing two peaks, and disease visible in both conditions. An expression for the likelihood function is derived. A maximum likelihood estimation (MLE) algorithm, CORCBM, was implemented in the R programming language that yields parameter estimates and the covariance matrix of the parameters, and other statistics. A limited simulation validation of the method was performed. CORCBM and CORROC2 were applied to two datasets containing nine readers each contributing paired interpretations. CORCBM successfully fitted the data for all readers, whereas CORROC2 failed to fit a degenerate dataset. All fits were visually reasonable. All CORCBM fits were proper, whereas all CORROC2 fits were improper. CORCBM and CORROC2 were in agreement (a) in declaring only one of the nine readers as having significantly different performances in the two modalities; (b) in estimating higher correlations for diseased cases than for nondiseased ones; and (c) in finding that the intermodality correlation estimates for nondiseased cases were consistent between the two methods. All CORCBM fits yielded higher area under curve (AUC) than the CORROC2 fits, consistent with the fact that a proper ROC model like CORCBM is based on a likelihood-ratio-equivalent decision variable, and consequently yields higher performance than the binormal model-based CORROC2. The method gave satisfactory fits to four simulated datasets. CORCBM is a robust method for fitting paired ROC datasets, always yielding proper ROC curves, and able to fit degenerate datasets. © 2017 American Association of Physicists in Medicine.

  20. Strangeness suppression of qq creation observed in exclusive reactions.

    PubMed

    Mestayer, M D; Park, K; Adhikari, K P; Aghasyan, M; Pereira, S Anefalos; Ball, J; Battaglieri, M; Batourine, V; Bedlinskiy, I; Biselli, A S; Boiarinov, S; Briscoe, W J; Brooks, W K; Burkert, V D; Carman, D S; Celentano, A; Chandavar, S; Charles, G; Colaneri, L; Cole, P L; Contalbrigo, M; Cortes, O; Crede, V; D'Angelo, A; Dashyan, N; De Vita, R; Deur, A; Djalali, C; Doughty, D; Dupre, R; El Alaoui, A; El Fassi, L; Elouadrhiri, L; Eugenio, P; Fedotov, G; Fleming, J A; Forest, T A; Garillon, B; Garçon, M; Ghandilyan, Y; Gilfoyle, G P; Giovanetti, K L; Girod, F X; Goetz, J T; Golovatch, E; Gothe, R W; Griffioen, K A; Guegan, B; Guidal, M; Hakobyan, H; Hanretty, C; Hattawy, M; Holtrop, M; Hughes, S M; Hyde, C E; Ilieva, Y; Ireland, D G; Jiang, H; Jo, H S; Joo, K; Keller, D; Khandaker, M; Kim, A; Kim, W; Koirala, S; Kubarovsky, V; Kuleshov, S V; Lenisa, P; Levine, W I; Livingston, K; Lu, H Y; MacGregor, I J D; Mayer, M; McKinnon, B; Meyer, C A; Mirazita, M; Mokeev, V; Montgomery, R A; Moody, C I; Moutarde, H; Movsisyan, A; Camacho, C Munoz; Nadel-Turonski, P; Niccolai, S; Niculescu, G; Niculescu, I; Osipenko, M; Ostrovidov, A I; Pappalardo, L L; Paremuzyan, R; Peng, P; Phelps, W; Pisano, S; Pogorelko, O; Pozdniakov, S; Price, J W; Protopopescu, D; Puckett, A J R; Raue, B A; Rimal, D; Ripani, M; Rizzo, A; Rosner, G; Roy, P; Sabatié, F; Saini, M S; Schott, D; Schumacher, R A; Simonyan, A; Sokhan, D; Strauch, S; Sytnik, V; Tang, W; Tian, Ye; Ungaro, M; Vernarsky, B; Vlassov, A V; Voskanyan, H; Voutier, E; Walford, N K; Watts, D P; Wei, X; Weinstein, L B; Wood, M H; Zachariou, N; Zhang, J; Zhao, Z W; Zonta, I

    2014-10-10

    We measured the ratios of electroproduction cross sections from a proton target for three exclusive meson-baryon final states: ΛK(+), pπ(0), and nπ(+), with the CLAS detector at Jefferson Lab. Using a simple model of quark hadronization, we extract qq creation probabilities for the first time in exclusive two-body production, in which only a single qq pair is created. We observe a sizable suppression of strange quark-antiquark pairs compared to nonstrange pairs, similar to that seen in high-energy production.

  1. Quantum teleportation and entanglement swapping of electron spins in superconducting hybrid structures

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bubanja, Vladimir, E-mail: vladimir.bubanja@callaghaninnovation.govt.nz

    2015-06-15

    We present schemes for quantum teleportation and entanglement swapping of electronic spin states in hybrid superconductor–normal-metal systems. The proposed schemes employ subgap transport whereby the lowest order processes involve Cooper pair-electron and double Cooper-pair cotunneling in quantum teleportation and entanglement swapping protocols, respectively. The competition between elastic cotunneling and Cooper-pair splitting results in the success probability of 25% in both cases. Described implementations of these protocols are within reach of present-day experimental techniques.

  2. Statistical Evaluation of the Rodin–Ohno Hypothesis: Sense/Antisense Coding of Ancestral Class I and II Aminoacyl-tRNA Synthetases

    PubMed Central

    Chandrasekaran, Srinivas Niranj; Yardimci, Galip Gürkan; Erdogan, Ozgün; Roach, Jeffrey; Carter, Charles W.

    2013-01-01

    We tested the idea that ancestral class I and II aminoacyl-tRNA synthetases arose on opposite strands of the same gene. We assembled excerpted 94-residue Urgenes for class I tryptophanyl-tRNA synthetase (TrpRS) and class II Histidyl-tRNA synthetase (HisRS) from a diverse group of species, by identifying and catenating three blocks coding for secondary structures that position the most highly conserved, active-site residues. The codon middle-base pairing frequency was 0.35 ± 0.0002 in all-by-all sense/antisense alignments for 211 TrpRS and 207 HisRS sequences, compared with frequencies between 0.22 ± 0.0009 and 0.27 ± 0.0005 for eight different representations of the null hypothesis. Clustering algorithms demonstrate further that profiles of middle-base pairing in the synthetase antisense alignments are correlated along the sequences from one species-pair to another, whereas this is not the case for similar operations on sets representing the null hypothesis. Most probable reconstructed sequences for ancestral nodes of maximum likelihood trees show that middle-base pairing frequency increases to approximately 0.42 ± 0.002 as bacterial trees approach their roots; ancestral nodes from trees including archaeal sequences show a less pronounced increase. Thus, contemporary and reconstructed sequences all validate important bioinformatic predictions based on descent from opposite strands of the same ancestral gene. They further provide novel evidence for the hypothesis that bacteria lie closer than archaea to the origin of translation. Moreover, the inverse polarity of genetic coding, together with a priori α-helix propensities suggest that in-frame coding on opposite strands leads to similar secondary structures with opposite polarity, as observed in TrpRS and HisRS crystal structures. PMID:23576570

  3. A two-dimensional 1H-NMR study of the dam methylase site: comparison between the hemimethylated GATC sequence, its unmethylated analogue and a hemimethylated CATG sequence. The sequence dependence of methylation upon base-pair lifetimes.

    PubMed

    Fazakerley, G V; Quignard, E; Teoule, R; Guy, A; Guschlbauer, W

    1987-09-15

    We report two-dimensional NOE (NOESY) spectra on the sequence d(GCGATCATGG).d(CCATGATCGC) which contains the unmethylated dam site. As expected the DNA adopts a B-form conformation but appears to be distorted at the TG step of the second strand. This distorsion, probably bending, is not seen on the opposite strand. When the first strand is methylated on adenine in the GATC or CATG sequence the NOESY spectra indicate little or no change in the conformation. However the single strand-duplex exchange is slowed down to the slow-exchange region on a proton NMR time scale. We have assigned the exchangeable imino and cytidine amino resonances of the three duplexes. From the imino linewidths as a function of temperature, we observe that the unmethylated and the hemimethylated Gm6ATC duplexes melt normally from the ends. However, this is not so for the hemimethylated Cm6ATG duplex which, apart from the terminal base pairs, melts cooperatively and at higher temperature. In spectra recorded in H2O a second duplex is observed, for the Gm6ATC sequence, which we have not been able to identify. It is however unlikely to be a hairpin structure. Ultraviolet-melting curves also indicate the presence of two transitions for this duplex. The effect of methylation upon base-pair lifetimes has been studied by comparing the above three duplexes. Little effect is observed upon methylation in the GATC sequence but a drastic increase in the lifetimes of all base pairs is observed upon methylation in the CATG sequence.

  4. Exact transition probabilities in a 6-state Landau–Zener system with path interference

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sinitsyn, Nikolai A.

    2015-04-23

    In this paper, we identify a nontrivial multistate Landau–Zener (LZ) model for which transition probabilities between any pair of diabatic states can be determined analytically and exactly. In the semiclassical picture, this model features the possibility of interference of different trajectories that connect the same initial and final states. Hence, transition probabilities are generally not described by the incoherent successive application of the LZ formula. Finally, we discuss reasons for integrability of this system and provide numerical tests of the suggested expression for the transition probability matrix.

  5. Evidence of scaling of void probability in nucleus-nucleus interactions at few GeV energy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ghosh, Dipak; Biswas, Biswanath; Deb, Argha

    1997-11-01

    The rapidity gap probability in the {sup 24}Mg-AgBr interaction at 4.5GeV/c/nucleon has been studied in detail. The data reveal scaling behavior of the void probability in the central rapidity domain which confirms the validity of the linked-pair approximation for the N-particle cumulant correlation functions. This scaling behavior appears to be similar to the void probability in the Perseus-Pisces supercluster region of galaxies. {copyright} {ital 1997} {ital The American Physical Society}

  6. Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality?

    PubMed

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.

  7. Adjuvant Chemotherapy Improves the Probability of Freedom From Recurrence in Patients With Resected Stage IB Lung Adenocarcinoma.

    PubMed

    Hung, Jung-Jyh; Wu, Yu-Chung; Chou, Teh-Ying; Jeng, Wen-Juei; Yeh, Yi-Chen; Hsu, Wen-Hu

    2016-04-01

    The benefit of adjuvant chemotherapy remains controversial for patients with stage IB non-small-cell lung cancer (NSCLC). This study investigated the effect of adjuvant chemotherapy and the predictors of benefit from adjuvant chemotherapy in patients with stage IB lung adenocarcinoma. A total of 243 patients with completely resected pathologic stage IB lung adenocarcinoma were included in the study. Predictors of the benefits of improved overall survival (OS) or probability of freedom from recurrence (FFR) from platinum-based adjuvant chemotherapy in patients with resected stage IB lung adenocarcinoma were investigated. Among the 243 patients, 70 (28.8%) had received platinum-based doublet adjuvant chemotherapy. A micropapillary/solid-predominant pattern (versus an acinar/papillary-predominant pattern) was a significantly worse prognostic factor for probability of FFR (p = 0.033). Although adjuvant chemotherapy (versus surgical intervention alone) was not a significant prognostic factor for OS (p = 0.303), it was a significant prognostic factor for a better probability of FFR (p = 0.029) on multivariate analysis. In propensity-score-matched pairs, there was no significant difference in OS between patients who received adjuvant chemotherapy and those who did not (p = 0.386). Patients who received adjuvant chemotherapy had a significantly better probability of FFR than those who did not (p = 0.043). For patients with a predominantly micropapillary/solid pattern, adjuvant chemotherapy (p = 0.033) was a significant prognostic factor for a better probability of FFR on multivariate analysis. Adjuvant chemotherapy is a favorable prognostic factor for the probability of FFR in patients with stage IB lung adenocarcinoma, particularly in those with a micropapillary/solid-predominant pattern. Copyright © 2016 The Society of Thoracic Surgeons. Published by Elsevier Inc. All rights reserved.

  8. Building Development Monitoring in Multitemporal Remotely Sensed Image Pairs with Stochastic Birth-Death Dynamics.

    PubMed

    Benedek, C; Descombes, X; Zerubia, J

    2012-01-01

    In this paper, we introduce a new probabilistic method which integrates building extraction with change detection in remotely sensed image pairs. A global optimization process attempts to find the optimal configuration of buildings, considering the observed data, prior knowledge, and interactions between the neighboring building parts. We present methodological contributions in three key issues: 1) We implement a novel object-change modeling approach based on Multitemporal Marked Point Processes, which simultaneously exploits low-level change information between the time layers and object-level building description to recognize and separate changed and unaltered buildings. 2) To answer the challenges of data heterogeneity in aerial and satellite image repositories, we construct a flexible hierarchical framework which can create various building appearance models from different elementary feature-based modules. 3) To simultaneously ensure the convergence, optimality, and computation complexity constraints raised by the increased data quantity, we adopt the quick Multiple Birth and Death optimization technique for change detection purposes, and propose a novel nonuniform stochastic object birth process which generates relevant objects with higher probability based on low-level image features.

  9. Heterogeneous Defensive Naval Weapon Assignment To Swarming Threats In Real Time

    DTIC Science & Technology

    2016-03-01

    threat Damage potential of target t if it hits the ship [integer from 0 to 3] _ ttarget phit Probability that target t hits the ship [probability...secondary weapon systems on target t [integer] _ tsec phit Probability that secondary weapon systems launched from target t hit the ship...pairing. These parameters are calculated as follows: 310 _ _t t tpriority target threat target phit = × × (3.1) 3_ 10 _ _t t tsec priority sec

  10. PSE-HMM: genome-wide CNV detection from NGS data using an HMM with Position-Specific Emission probabilities.

    PubMed

    Malekpour, Seyed Amir; Pezeshk, Hamid; Sadeghi, Mehdi

    2016-11-03

    Copy Number Variation (CNV) is envisaged to be a major source of large structural variations in the human genome. In recent years, many studies apply Next Generation Sequencing (NGS) data for the CNV detection. However, still there is a necessity to invent more accurate computational tools. In this study, mate pair NGS data are used for the CNV detection in a Hidden Markov Model (HMM). The proposed HMM has position specific emission probabilities, i.e. a Gaussian mixture distribution. Each component in the Gaussian mixture distribution captures a different type of aberration that is observed in the mate pairs, after being mapped to the reference genome. These aberrations may include any increase (decrease) in the insertion size or change in the direction of mate pairs that are mapped to the reference genome. This HMM with Position-Specific Emission probabilities (PSE-HMM) is utilized for the genome-wide detection of deletions and tandem duplications. The performance of PSE-HMM is evaluated on a simulated dataset and also on a real data of a Yoruban HapMap individual, NA18507. PSE-HMM is effective in taking observation dependencies into account and reaches a high accuracy in detecting genome-wide CNVs. MATLAB programs are available at http://bs.ipm.ir/softwares/PSE-HMM/ .

  11. Carry-over effects of the social environment on future divorce probability in a wild bird population

    PubMed Central

    Culina, Antica; Hinde, Camilla A.; Sheldon, Ben C.

    2015-01-01

    Initial mate choice and re-mating strategies (infidelity and divorce) influence individual fitness. Both of these should be influenced by the social environment, which determines the number and availability of potential partners. While most studies looking at this relationship take a population-level approach, individual-level responses to variation in the social environment remain largely unstudied. Here, we explore carry-over effects on future mating decisions of the social environment in which the initial mating decision occurred. Using detailed data on the winter social networks of great tits, we tested whether the probability of subsequent divorce, a year later, could be predicted by measures of the social environment at the time of pairing. We found that males that had a lower proportion of female associates, and whose partner ranked lower among these, as well as inexperienced breeders, were more likely to divorce after breeding. We found no evidence that a female's social environment influenced the probability of divorce. Our findings highlight the importance of the social environment that individuals experience during initial pair formation on later pairing outcomes, and demonstrate that such effects can be delayed. Exploring these extended effects of the social environment can yield valuable insights into processes and selective pressures acting upon the mating strategies that individuals adopt. PMID:26468239

  12. UGC 4703 Interacting Pair Near the Isolated Spiral Galaxy NGC 2718: A Milky Way Magellanic Cloud Analog

    NASA Astrophysics Data System (ADS)

    Paudel, Sanjaya; Sengupta, C.

    2017-11-01

    We present an analysis of physical and morphological properties of an interacting pair of dwarf galaxies, UGC 4703, located in the vicinity of an isolated Milky Way (MW) type spiral galaxy NGC 2718. Based on the comparison of physical and morphological properties with that of the Large and Small Magellanic Clouds (LMC and SMC), we report that the UGC 4703 pair-NGC 2718 system is probably an LMC-SMC-MW analog. Located at a sky-projected distance of 81 kpc from NGC 2718, we find that UGC 4703 is clearly interacting with its nearby lower-mass companion UGC 4703B, forming a bridge of stellar stream between them. Total B-band luminosity of UGC 4703 and its companion is -17.75 and -16.25 mag, respectively. We obtained H I 21 cm line data of UGC 4703 using the GMRT to get a more detailed view of neutral hydrogen (H I) emission. The H I image revealed evidence of interaction between the dwarf galaxy pair but no extended emission, such as the Magellanic Stream. We also detected star-forming regions along the UGC 4703/4703B bridge with stellar mass exceeding 107 M ⊙. While comparing the optical and H I morphology of the interacting dwarf pairs (UGC 4703-4703B and LMC-SMC), we discuss possible differences in interaction histories of these systems.

  13. Significance of stress transfer in time-dependent earthquake probability calculations

    USGS Publications Warehouse

    Parsons, T.

    2005-01-01

    A sudden change in stress is seen to modify earthquake rates, but should it also revise earthquake probability? Data used to derive input parameters permits an array of forecasts; so how large a static stress change is require to cause a statistically significant earthquake probability change? To answer that question, effects of parameter and philosophical choices are examined through all phases of sample calculations, Drawing at random from distributions of recurrence-aperiodicity pairs identifies many that recreate long paleoseismic and historic earthquake catalogs. Probability density funtions built from the recurrence-aperiodicity pairs give the range of possible earthquake forecasts under a point process renewal model. Consequences of choices made in stress transfer calculations, such as different slip models, fault rake, dip, and friction are, tracked. For interactions among large faults, calculated peak stress changes may be localized, with most of the receiving fault area changed less than the mean. Thus, to avoid overstating probability change on segments, stress change values should be drawn from a distribution reflecting the spatial pattern rather than using the segment mean. Disparity resulting from interaction probability methodology is also examined. For a fault with a well-understood earthquake history, a minimum stress change to stressing rate ratio of 10:1 to 20:1 is required to significantly skew probabilities with >80-85% confidence. That ratio must be closer to 50:1 to exceed 90-95% confidence levels. Thus revision to earthquake probability is achievable when a perturbing event is very close to the fault in question or the tectonic stressing rate is low.

  14. Probabilistic Reinforcement Learning in Adults with Autism Spectrum Disorders

    PubMed Central

    Solomon, Marjorie; Smith, Anne C.; Frank, Michael J.; Ly, Stanford; Carter, Cameron S.

    2017-01-01

    Background Autism spectrum disorders (ASDs) can be conceptualized as disorders of learning, however there have been few experimental studies taking this perspective. Methods We examined the probabilistic reinforcement learning performance of 28 adults with ASDs and 30 typically developing adults on a task requiring learning relationships between three stimulus pairs consisting of Japanese characters with feedback that was valid with different probabilities (80%, 70%, and 60%). Both univariate and Bayesian state–space data analytic methods were employed. Hypotheses were based on the extant literature as well as on neurobiological and computational models of reinforcement learning. Results Both groups learned the task after training. However, there were group differences in early learning in the first task block where individuals with ASDs acquired the most frequently accurately reinforced stimulus pair (80%) comparably to typically developing individuals; exhibited poorer acquisition of the less frequently reinforced 70% pair as assessed by state–space learning curves; and outperformed typically developing individuals on the near chance (60%) pair. Individuals with ASDs also demonstrated deficits in using positive feedback to exploit rewarded choices. Conclusions Results support the contention that individuals with ASDs are slower learners. Based on neurobiology and on the results of computational modeling, one interpretation of this pattern of findings is that impairments are related to deficits in flexible updating of reinforcement history as mediated by the orbito-frontal cortex, with spared functioning of the basal ganglia. This hypothesis about the pathophysiology of learning in ASDs can be tested using functional magnetic resonance imaging. PMID:21425243

  15. Stochastic parameterization of shallow cumulus convection estimated from high-resolution model data

    NASA Astrophysics Data System (ADS)

    Dorrestijn, Jesse; Crommelin, Daan T.; Siebesma, A. Pier.; Jonker, Harm J. J.

    2013-02-01

    In this paper, we report on the development of a methodology for stochastic parameterization of convective transport by shallow cumulus convection in weather and climate models. We construct a parameterization based on Large-Eddy Simulation (LES) data. These simulations resolve the turbulent fluxes of heat and moisture and are based on a typical case of non-precipitating shallow cumulus convection above sea in the trade-wind region. Using clustering, we determine a finite number of turbulent flux pairs for heat and moisture that are representative for the pairs of flux profiles observed in these simulations. In the stochastic parameterization scheme proposed here, the convection scheme jumps randomly between these pre-computed pairs of turbulent flux profiles. The transition probabilities are estimated from the LES data, and they are conditioned on the resolved-scale state in the model column. Hence, the stochastic parameterization is formulated as a data-inferred conditional Markov chain (CMC), where each state of the Markov chain corresponds to a pair of turbulent heat and moisture fluxes. The CMC parameterization is designed to emulate, in a statistical sense, the convective behaviour observed in the LES data. The CMC is tested in single-column model (SCM) experiments. The SCM is able to reproduce the ensemble spread of the temperature and humidity that was observed in the LES data. Furthermore, there is a good similarity between time series of the fractions of the discretized fluxes produced by SCM and observed in LES.

  16. Systematization of α-decaying nuclei based on shell structures: The case of even-odd nuclei

    NASA Astrophysics Data System (ADS)

    Yarman, Tolga; Zaim, Nimet; Yarman, O.; Kholmetskii, Alexander; Arık, Metin

    2017-01-01

    Previously, we provided a novel systematization of α-decaying even-even nuclei starting with the classically adopted mechanism (Yarman et al., Eur. Phys. J. A 52, 140 (2016)). The decay half-life of an α-decaying nucleus was framed so that i) the α-particle is taken at the outset to be born inside the parent nucleus with a given probability, ii) where it then keeps on bouncing off of the barrier of the parent nucleus till iii) it finally tunnels through the barrier. Knowing beforehand the measured decay half-life, we have taken into consideration, as a parameter, the probability of the α-particle being first born within the parent before it is emitted. We thence developed a scaffold based on shell properties of families composed of alike even-even nuclei. Nevertheless, our model allows us to incorporate any α-decaying nuclei, and along this line, we present a follow-up systematization of even-odd nuclei, with cases of odd-even and odd-odd α-decaying nuclei pending to be considered in a separate contribution. Notwithstanding, we make an effort herein to expand our approach to investigate the effect of "pairing" ( e.g., when a number of nucleons in the given nucleus becomes an even number, instead of the initial odd number, due to the addition of at least one neutron). Our results show that "pairing", as expected, definitely increases the stability of the given nucleus.

  17. Corona emission thresholds for three types of hydrometeor interaction in thunderclouds

    NASA Astrophysics Data System (ADS)

    Blyth, A. M.; Christian, H. J.; Latham, J.

    1998-06-01

    Laboratory studies have been conducted of the conditions under which glancing collisions, at relative velocities V characteristic of those occurring in thunderstorms, of three types of hydrometeor pairs of precipitation dimension (such as (1) warm drop pairs, (2) supercooled drop pairs, and (3) a supercooled drop and a graupel pellet) produce a corona discharge in an electric field E. In each case, the observed corona is emitted at the tip of an ephemeral liquid filament, of length greater than the dimensions of the interacting hydrometeors, drawn out during each interaction. For each type of hydrometeor pair, the probability f that corona was produced during an interaction increased steadily from zero for increasing values of E above about 150 kV/m, and was significantly in excess of 50% for values of E = 400 kV/m, which is probably about the maximum ambient value occurring in a thunderstorm. We conclude that if the associated hydrometeors are present in strongly electrified regions of thunderstorms (unlikely for interaction type 1 but manifestly possible for types 2 and 3, corona initiation leading to the production of lightning could result from each of the three types of interaction studied.

  18. The Conjunction Fallacy: A Misunderstanding about Conjunction?

    ERIC Educational Resources Information Center

    Tentori, Katya; Bonini, Nicolao; Osherson, Daniel

    2004-01-01

    It is easy to construct pairs of sentences X, Y that lead many people to ascribe higher probability to the conjunction X-and-Y than to the conjuncts X, Y. Whether an error is thereby committed depends on reasoners' interpretation of the expressions "probability" and "and." We report two experiments designed to clarify the normative status of…

  19. A mutli-technique search for the most primitive CO chondrites

    NASA Astrophysics Data System (ADS)

    Alexander, C. M. O'D.; Greenwood, R. C.; Bowden, R.; Gibson, J. M.; Howard, K. T.; Franchi, I. A.

    2018-01-01

    As part of a study to identify the most primitive COs and to look for weakly altered CMs amongst the COs, we have conducted a multi-technique study of 16 Antarctic meteorites that had been classified as primitive COs. For this study, we have determined: (1) the bulk H, C and N abundances and isotopes, (2) bulk O isotopic compositions, (3) bulk modal mineralogies, and (4) for some selected samples the abundances and compositions of their insoluble organic matter (IOM). Two of the 16 meteorites do appear to be CMs - BUC 10943 seems to be a fairly typical CM, while MIL 090073 has probably been heated. Of the COs, DOM 08006 appears to be the most primitive CO identified to date and is quite distinct from the other members of its pairing group. The other COs fall into two groups that are less primitive than DOM 08006 and ALH 77307, the previously most primitive CO. The first group is composed of members of the DOM 08004 pairing group, except DOM 08006. The second group is composed of meteorites belonging to the MIL 03377 and MIL 07099 pairing groups. These two pairing groups should probably be combined. There is a dichotomy in the bulk O isotopes between the primitive (all Antarctic finds) and the more metamorphosed COs (mostly falls). This dichotomy can only partly be explained by the terrestrial weathering experienced by the primitive Antarctic samples. It seems that the more equilibrated samples interacted to a greater extent with 16O-poor material, probably water, than the more primitive meteorites.

  20. Breeding ecology of the Puaiohi (Myadestes palmeri)

    USGS Publications Warehouse

    Snetsinger, T.J.; Herrmann, C.M.; Holmes, D.E.; Hayward, C.D.; Fancy, S.G.

    2005-01-01

    We studied the breeding ecology of the critically endangered Puaiohi (Myadestes palmeri), a poorly known Hawaiian thrush endemic to the island of Kauai. From 1996 through 1998, we monitored 96 active nests over the course of three breeding seasons. Mean clutch size was 2.0, and pairs produced an average of 1.5 fledglings/successful nest. Pairs renested after failure and some raised multiple broods. The mean annual reproductive effort was 2.1 nesting attempts/territory, and pairs produced a mean 1.1 fledglings/attempt. Large differences in nesting effort and productivity occurred among years, with mean number of fledglings/territory ranging from 0.4 to 4.9. Predation by owls (probably Short-eared Owls, Asia flammeus) and introduced rats (probably black rats, Rattus rattus) accounted for most nest failures. The presence of non-breeding floaters in the population and their largely unsuccessful attempts to gain territories in the study area suggest that the population is near carrying capacity. The high reproductive potential of the Puaiohi may help explain its persistence despite the species' historical rarity.

  1. Survival estimation and the effects of dependency among animals

    USGS Publications Warehouse

    Schmutz, Joel A.; Ward, David H.; Sedinger, James S.; Rexstad, Eric A.

    1995-01-01

    Survival models assume that fates of individuals are independent, yet the robustness of this assumption has been poorly quantified. We examine how empirically derived estimates of the variance of survival rates are affected by dependency in survival probability among individuals. We used Monte Carlo simulations to generate known amounts of dependency among pairs of individuals and analyzed these data with Kaplan-Meier and Cormack-Jolly-Seber models. Dependency significantly increased these empirical variances as compared to theoretically derived estimates of variance from the same populations. Using resighting data from 168 pairs of black brant, we used a resampling procedure and program RELEASE to estimate empirical and mean theoretical variances. We estimated that the relationship between paired individuals caused the empirical variance of the survival rate to be 155% larger than the empirical variance for unpaired individuals. Monte Carlo simulations and use of this resampling strategy can provide investigators with information on how robust their data are to this common assumption of independent survival probabilities.

  2. Maximizing detection probability of Wetland-dependent birds during point-count surveys in northwestern Florida

    USGS Publications Warehouse

    Nadeau, C.P.; Conway, C.J.; Smith, B.S.; Lewis, T.E.

    2008-01-01

    We conducted 262 call-broadcast point-count surveys (1-6 replicate surveys on each of 62 points) using standardized North American Marsh Bird Monitoring Protocols between 31 May and 7 July 2006 on St. Vincent National Wildlife Refuge, an island off the northwest coast of Florida. We conducted double-blind multiple-observer surveys, paired morning and evening surveys, and paired morning and night surveys to examine the influence of call-broadcast and time of day on detection probability. Observer detection probability for all species pooled was 75% and was similar between passive (69%) and call-broadcast (65%) periods. Detection probability was higher on morning than evening (t = 3.0, P = 0.030) or night (t = 3.4, P = 0.042) surveys when we pooled all species. Detection probability was higher (but not significant for all species) on morning compared to evening or night surveys for all five focal species detected on surveys: Least Bittern (Ixobrychus exilis), Clapper Rail (Rallus longirostris), Purple Gallinule (Porphyrula martinica), Common Moorhen (Gallinula chloropus), and American Coot (Fulica americana). We detected more Least Bitterns (t = 2.4, P = 0.064) and Common Moorhens (t = 2.8, P = 0.026) on morning than evening surveys, and more Clapper Rails (t = 5.1, P = 0.014) on morning than night surveys.

  3. X-ray flares from runaway pair production in active galactic nuclei

    NASA Technical Reports Server (NTRS)

    Kirk, J. G.; Mastichiadis, A.

    1992-01-01

    The hard X-ray spectrum of AGNs is nonthermal, probably arising from an electron-positron pair cascade, with some emission reflected off relatively cold matter. There has been interest in models on which protons are accelerated and create relativistic electrons on interaction with a local radiation field. It is shown here that a sufficient column density of protons can lead to runaway pair production: photons generated by the relativistic pairs are the targets for the protons to produce more pairs. This can produce X-ray fluxes with the characteristics observed in AGN. The model predicts the maximum ratio of luminosity to source size as well as their spectrum in the early phases. The same mechanism may also be able to create the knots of synchrotron-radiating pair plasma seen in sources such as 3C273.

  4. The ALHAMBRA survey: accurate merger fractions derived by PDF analysis of photometrically close pairs

    NASA Astrophysics Data System (ADS)

    López-Sanjuan, C.; Cenarro, A. J.; Varela, J.; Viironen, K.; Molino, A.; Benítez, N.; Arnalte-Mur, P.; Ascaso, B.; Díaz-García, L. A.; Fernández-Soto, A.; Jiménez-Teja, Y.; Márquez, I.; Masegosa, J.; Moles, M.; Pović, M.; Aguerri, J. A. L.; Alfaro, E.; Aparicio-Villegas, T.; Broadhurst, T.; Cabrera-Caño, J.; Castander, F. J.; Cepa, J.; Cerviño, M.; Cristóbal-Hornillos, D.; Del Olmo, A.; González Delgado, R. M.; Husillos, C.; Infante, L.; Martínez, V. J.; Perea, J.; Prada, F.; Quintana, J. M.

    2015-04-01

    Aims: Our goal is to develop and test a novel methodology to compute accurate close-pair fractions with photometric redshifts. Methods: We improved the currently used methodologies to estimate the merger fraction fm from photometric redshifts by (i) using the full probability distribution functions (PDFs) of the sources in redshift space; (ii) including the variation in the luminosity of the sources with z in both the sample selection and the luminosity ratio constrain; and (iii) splitting individual PDFs into red and blue spectral templates to reliably work with colour selections. We tested the performance of our new methodology with the PDFs provided by the ALHAMBRA photometric survey. Results: The merger fractions and rates from the ALHAMBRA survey agree excellently well with those from spectroscopic work for both the general population and red and blue galaxies. With the merger rate of bright (MB ≤ -20-1.1z) galaxies evolving as (1 + z)n, the power-law index n is higher for blue galaxies (n = 2.7 ± 0.5) than for red galaxies (n = 1.3 ± 0.4), confirming previous results. Integrating the merger rate over cosmic time, we find that the average number of mergers per galaxy since z = 1 is Nmred = 0.57 ± 0.05 for red galaxies and Nmblue = 0.26 ± 0.02 for blue galaxies. Conclusions: Our new methodology statistically exploits all the available information provided by photometric redshift codes and yields accurate measurements of the merger fraction by close pairs from using photometric redshifts alone. Current and future photometric surveys will benefit from this new methodology. Based on observations collected at the German-Spanish Astronomical Center, Calar Alto, jointly operated by the Max-Planck-Institut für Astronomie (MPIA) at Heidelberg and the Instituto de Astrofísica de Andalucía (CSIC).The catalogues, probabilities, and figures of the ALHAMBRA close pairs detected in Sect. 5.1 are available at http://https://cloud.iaa.csic.es/alhambra/catalogues/ClosePairs

  5. Prospective Tests of Southern California Earthquake Forecasts

    NASA Astrophysics Data System (ADS)

    Jackson, D. D.; Schorlemmer, D.; Gerstenberger, M.; Kagan, Y. Y.; Helmstetter, A.; Wiemer, S.; Field, N.

    2004-12-01

    We are testing earthquake forecast models prospectively using likelihood ratios. Several investigators have developed such models as part of the Southern California Earthquake Center's project called Regional Earthquake Likelihood Models (RELM). Various models are based on fault geometry and slip rates, seismicity, geodetic strain, and stress interactions. Here we describe the testing procedure and present preliminary results. Forecasts are expressed as the yearly rate of earthquakes within pre-specified bins of longitude, latitude, magnitude, and focal mechanism parameters. We test models against each other in pairs, which requires that both forecasts in a pair be defined over the same set of bins. For this reason we specify a standard "menu" of bins and ground rules to guide forecasters in using common descriptions. One menu category includes five-year forecasts of magnitude 5.0 and larger. Contributors will be requested to submit forecasts in the form of a vector of yearly earthquake rates on a 0.1 degree grid at the beginning of the test. Focal mechanism forecasts, when available, are also archived and used in the tests. Interim progress will be evaluated yearly, but final conclusions would be made on the basis of cumulative five-year performance. The second category includes forecasts of earthquakes above magnitude 4.0 on a 0.1 degree grid, evaluated and renewed daily. Final evaluation would be based on cumulative performance over five years. Other types of forecasts with different magnitude, space, and time sampling are welcome and will be tested against other models with shared characteristics. Tests are based on the log likelihood scores derived from the probability that future earthquakes would occur where they do if a given forecast were true [Kagan and Jackson, J. Geophys. Res.,100, 3,943-3,959, 1995]. For each pair of forecasts, we compute alpha, the probability that the first would be wrongly rejected in favor of the second, and beta, the probability that the second would be wrongly rejected in favor of the first. Computing alpha and beta requires knowing the theoretical distribution of likelihood scores under each hypothesis, which we estimate by simulations. In this scheme, each forecast is given equal status; there is no "null hypothesis" which would be accepted by default. Forecasts and test results will be archived and posted on the RELM web site. Major problems under discussion include how to treat aftershocks, which clearly violate the variable-rate Poissonian hypotheses that we employ, and how to deal with the temporal variations in catalog completeness that follow large earthquakes.

  6. Strangeness suppression of q q ¯ creation observed in exclusive reactions

    DOE PAGES

    Mestayer, M. D.; Park, K.; Adhikari, K. P.; ...

    2014-10-10

    In this study, we measured the ratios of electroproduction cross sections from a proton target for three exclusive meson-baryon final states: ΛK +, pπ 0, and nπ +, with the CLAS detector at Jefferson Lab. Using a simple model of quark hadronization, we extract qq¯ creation probabilities for the first time in exclusive two-body production, in which only a single qq¯ pair is created. We observe a sizable suppression of strange quark-antiquark pairs compared to nonstrange pairs, similar to that seen in high-energy production.

  7. Strangeness Suppression of qq ¯ Creation Observed in Exclusive Reactions

    NASA Astrophysics Data System (ADS)

    Mestayer, M. D.; Park, K.; Adhikari, K. P.; Aghasyan, M.; Pereira, S. Anefalos; Ball, J.; Battaglieri, M.; Batourine, V.; Bedlinskiy, I.; Biselli, A. S.; Boiarinov, S.; Briscoe, W. J.; Brooks, W. K.; Burkert, V. D.; Carman, D. S.; Celentano, A.; Chandavar, S.; Charles, G.; Colaneri, L.; Cole, P. L.; Contalbrigo, M.; Cortes, O.; Crede, V.; D'Angelo, A.; Dashyan, N.; De Vita, R.; Deur, A.; Djalali, C.; Doughty, D.; Dupre, R.; Alaoui, A. El; Fassi, L. El; Elouadrhiri, L.; Eugenio, P.; Fedotov, G.; Fleming, J. A.; Forest, T. A.; Garillon, B.; Garçon, M.; Ghandilyan, Y.; Gilfoyle, G. P.; Giovanetti, K. L.; Girod, F. X.; Goetz, J. T.; Golovatch, E.; Gothe, R. W.; Griffioen, K. A.; Guegan, B.; Guidal, M.; Hakobyan, H.; Hanretty, C.; Hattawy, M.; Holtrop, M.; Hughes, S. M.; Hyde, C. E.; Ilieva, Y.; Ireland, D. G.; Jiang, H.; Jo, H. S.; Joo, K.; Keller, D.; Khandaker, M.; Kim, A.; Kim, W.; Koirala, S.; Kubarovsky, V.; Kuleshov, S. V.; Lenisa, P.; Levine, W. I.; Livingston, K.; Lu, H. Y.; MacGregor, I. J. D.; Mayer, M.; McKinnon, B.; Meyer, C. A.; Mirazita, M.; Mokeev, V.; Montgomery, R. A.; Moody, C. I.; Moutarde, H.; Movsisyan, A.; Camacho, C. Munoz; Nadel-Turonski, P.; Niccolai, S.; Niculescu, G.; Niculescu, I.; Osipenko, M.; Ostrovidov, A. I.; Pappalardo, L. L.; Paremuzyan, R.; Peng, P.; Phelps, W.; Pisano, S.; Pogorelko, O.; Pozdniakov, S.; Price, J. W.; Protopopescu, D.; Puckett, A. J. R.; Raue, B. A.; Rimal, D.; Ripani, M.; Rizzo, A.; Rosner, G.; Roy, P.; Sabatié, F.; Saini, M. S.; Schott, D.; Schumacher, R. A.; Simonyan, A.; Sokhan, D.; Strauch, S.; Sytnik, V.; Tang, W.; Tian, Ye; Ungaro, M.; Vernarsky, B.; Vlassov, A. V.; Voskanyan, H.; Voutier, E.; Walford, N. K.; Watts, D. P.; Wei, X.; Weinstein, L. B.; Wood, M. H.; Zachariou, N.; Zhang, J.; Zhao, Z. W.; Zonta, I.; CLAS Collaboration

    2014-10-01

    We measured the ratios of electroproduction cross sections from a proton target for three exclusive meson-baryon final states: ΛK+, pπ0, and nπ+, with the CLAS detector at Jefferson Lab. Using a simple model of quark hadronization, we extract qq ¯ creation probabilities for the first time in exclusive two-body production, in which only a single qq ¯ pair is created. We observe a sizable suppression of strange quark-antiquark pairs compared to nonstrange pairs, similar to that seen in high-energy production.

  8. Strangeness suppression of q q ¯ creation observed in exclusive reactions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mestayer, M. D.; Park, K.; Adhikari, K. P.

    In this study, we measured the ratios of electroproduction cross sections from a proton target for three exclusive meson-baryon final states: ΛK +, pπ 0, and nπ +, with the CLAS detector at Jefferson Lab. Using a simple model of quark hadronization, we extract qq¯ creation probabilities for the first time in exclusive two-body production, in which only a single qq¯ pair is created. We observe a sizable suppression of strange quark-antiquark pairs compared to nonstrange pairs, similar to that seen in high-energy production.

  9. Information Entropy Analysis of the H1N1 Genetic Code

    NASA Astrophysics Data System (ADS)

    Martwick, Andy

    2010-03-01

    During the current H1N1 pandemic, viral samples are being obtained from large numbers of infected people world-wide and are being sequenced on the NCBI Influenza Virus Resource Database. The information entropy of the sequences was computed from the probability of occurrence of each nucleotide base at every position of each set of sequences using Shannon's definition of information entropy, [ H=∑bpb,2( 1pb ) ] where H is the observed information entropy at each nucleotide position and pb is the probability of the base pair of the nucleotides A, C, G, U. Information entropy of the current H1N1 pandemic is compared to reference human and swine H1N1 entropy. As expected, the current H1N1 entropy is in a low entropy state and has a very large mutation potential. Using the entropy method in mature genes we can identify low entropy regions of nucleotides that generally correlate to critical protein function.

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aaltonen, T.; Brucken, E.; Devoto, F.

    We search for resonant production of tt pairs in 4.8 fb{sup -1} integrated luminosity of pp collision data at {radical}(s)=1.96 TeV in the lepton+jets decay channel, where one top quark decays leptonically and the other hadronically. A matrix-element reconstruction technique is used; for each event a probability density function of the tt candidate invariant mass is sampled. These probability density functions are used to construct a likelihood function, whereby the cross section for resonant tt production is estimated, given a hypothetical resonance mass and width. The data indicate no evidence of resonant production of tt pairs. A benchmark model ofmore » leptophobic Z{sup '}{yields}tt is excluded with m{sub Z}{sup '}<900 GeV/c{sup 2} at 95% confidence level.« less

  11. Microsatellites for Carpotroche brasiliensis (Flacourtiaceae), a useful species for agroforestry and ecosystem conservation.

    PubMed

    Bittencourt, Flora; Alves, Jackeline S; Gaiotto, Fernanda A

    2015-12-01

    We developed microsatellite markers for Carpotroche brasiliensis (Flacourtiaceae), a dioecious tree that is used as a food resource by midsize animals of the Brazilian fauna. We designed 30 primer pairs using next-generation sequencing and classified 25 pairs as polymorphic. Observed heterozygosity ranged from 0.5 to 1.0, and expected heterozygosity ranged from 0.418 to 0.907. The combined probability of exclusion was greater than 0.999 and the combined probability of identity was less than 0.001, indicating that these microsatellites are appropriate for investigations of genetic structure, individual identification, and paternity testing. The developed molecular tools may contribute to future studies of population genetics, answering ecological and evolutionary questions regarding efficient conservation strategies for C. brasiliensis.

  12. Localisation in a Growth Model with Interaction

    NASA Astrophysics Data System (ADS)

    Costa, M.; Menshikov, M.; Shcherbakov, V.; Vachkovskaia, M.

    2018-05-01

    This paper concerns the long term behaviour of a growth model describing a random sequential allocation of particles on a finite cycle graph. The model can be regarded as a reinforced urn model with graph-based interaction. It is motivated by cooperative sequential adsorption, where adsorption rates at a site depend on the configuration of existing particles in the neighbourhood of that site. Our main result is that, with probability one, the growth process will eventually localise either at a single site, or at a pair of neighbouring sites.

  13. Localisation in a Growth Model with Interaction

    NASA Astrophysics Data System (ADS)

    Costa, M.; Menshikov, M.; Shcherbakov, V.; Vachkovskaia, M.

    2018-06-01

    This paper concerns the long term behaviour of a growth model describing a random sequential allocation of particles on a finite cycle graph. The model can be regarded as a reinforced urn model with graph-based interaction. It is motivated by cooperative sequential adsorption, where adsorption rates at a site depend on the configuration of existing particles in the neighbourhood of that site. Our main result is that, with probability one, the growth process will eventually localise either at a single site, or at a pair of neighbouring sites.

  14. MO-AB-BRA-04: Radiation Measurements with a DNA Double-Strand-Break Dosimeter

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Obeidat, M; Cline, K; Stathakis, S

    Purpose: Many types of dosimeters are used to measure radiation, but none of them directly measures the biological effect of this dose. The purpose here is to create a dosimeter that can measure the probability of double-strand breaks (DSB) for DNA, which is directly related to the biological effect of radiation. Methods: The dosimeter has DNA strands, which are labeled on one end with biotin and on the other with fluorescein. The biotin attaches these strands to magnetic beads. We suspended the DNA dosimeter in phosphate-buffered saline (PBS) as it matches the internal environment of the body. We placed smallmore » volumes (50µL) of the DNA dosimeter into tubes and irradiated these samples in a water-equivalent plastic phantom with several doses (three samples per dose). After irradiating the samples, a magnet was placed against the tubes. The fluorescein attached to broken DNA strands was extracted (called the supernatant) and placed into a different tube. The fluorescein on the unbroken strands remained attached to the beads in the tube and was re-suspended with 50µL of PBS. A fluorescence reader was used to measure the fluorescence for both the re-suspended beads and supernatant. To prove that we are measuring DSB, we tested dosimeter response with two different lengths of attached DNA strands (1 and 4 kilo-base pair). Results: The probability of DSB at the dose levels of 5, 10, 25, and 50 Gy were 0.05, 0.08, 0.12, and 0.19, respectively, while the coefficients of variation were 0.14, 0.07, 0.02, and 0.01, respectively. The 4 kilo-base-pair dosimeter produced 5.3 times the response of the 1 kilo-base-pair dosimeter. Conclusion: The DNA dosimeter yields a measurable response to dose that scales with the DNA strand length. The goal now is to refine the dosimeter fabrication to reproducibly create a low coefficient of variation for the lower doses. This work was supported in part by Yarmouk University (Irbid, Jordan) and CPRIT (RP140105)« less

  15. Matrilineage differentiation of the genus Tetragonisca using mitochondrial DNA markers and the polymerase chain reaction-restriction fragment length polymorphism technique.

    PubMed

    Santos, S A; Bronzato, A R; Moreira, B M T; Araujo, K F; Ronqui, L; Mangolin, C A; Toledo, V A A; Ruvolo-Takasusuki, M C C

    2015-10-21

    The Meliponinae are important pollinators of plant species, and one of the most managed species is Tetragonisca angustula. Initially, two subspecies were identified in T. angustula: T. angustula angustula and T. angustula fiebrigi. Subsequently, T. a. fiebrigi was considered a species, based on the coloration of its mesepisternum. The objective of the present study was to obtain genetic markers that could differentiate the two species by amplifying regions of mitochondrial DNA and conducting polymerase chain reaction-restriction fragment length polymorphism analysis. Worker bees were collected in three Brazilian states: Paraná (Maringá, Altônia, and Foz do Iguaçu), São Paulo (Dracena, São Carlos, and Santa Cruz do Rio Pardo), and Rondônia (Ariquemes). Ten pairs of insect heterologous primers were tested and four were used (primer pair 1, ND2 and COI; primer pair 2, COI; primer pair 8, 16S and 12S; and primer pair 9, COII). For the restriction analysis, 13 enzymes were tested: EcoRI, EcoRV, HindIII, HinfI, RsaI, PstI, XbaI, HaeIII, ClaI, XhoI, BglII, PvuII, and ScaI. Markers were obtained (primer pair 8 cleaved with EcoRV and XbaI and primer pair 9 cleaved with HaeIII, RsaI, and XbaI) that enabled matrilineage identification in the nests studied, which confirmed that hybridization could occur between both Tetragonisca species. The beginning of speciation was probably recent, and secondary contact has resulted in crosses between T. angustula females and T. fiebrigi males. Because of this hybridization, it would be appropriate to consider them as two subspecies of T. angustula.

  16. SU-D-BRB-01: A Predictive Planning Tool for Stereotactic Radiosurgery

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Palefsky, S; Roper, J; Elder, E

    Purpose: To demonstrate the feasibility of a predictive planning tool which provides SRS planning guidance based on simple patient anatomical properties: PTV size, PTV shape and distance from critical structures. Methods: Ten framed SRS cases treated at Winship Cancer Institute of Emory University were analyzed to extract data on PTV size, sphericity (shape), and distance from critical structures such as the brainstem and optic chiasm. The cases consisted of five pairs. Each pair consisted of two cases with a similar diagnosis (such as pituitary adenoma or arteriovenous malformation) that were treated with different techniques: DCA, or IMRS. A Naive Bayesmore » Classifier was trained on this data to establish the conditions under which each treatment modality was used. This model was validated by classifying ten other randomly-selected cases into DCA or IMRS classes, calculating the probability of each technique, and comparing results to the treated technique. Results: Of the ten cases used to validate the model, nine had their technique predicted correctly. The three cases treated with IMRS were all identified as such. Their probabilities of being treated with IMRS ranged between 59% and 100%. Six of the seven cases treated with DCA were correctly classified. These probabilities ranged between 51% and 95%. One case treated with DCA was incorrectly predicted to be an IMRS plan. The model’s confidence in this case was 91%. Conclusion: These findings indicate that a predictive planning tool based on simple patient anatomical properties can predict the SRS technique used for treatment. The algorithm operated with 90% accuracy. With further validation on larger patient populations, this tool may be used clinically to guide planners in choosing an appropriate treatment technique. The prediction algorithm could also be adapted to guide selection of treatment parameters such as treatment modality and number of fields for radiotherapy across anatomical sites.« less

  17. An All-Sky Search for Wide Binaries in the SUPERBLINK Proper Motion Catalog

    NASA Astrophysics Data System (ADS)

    Hartman, Zachary; Lepine, Sebastien

    2017-01-01

    We present initial results from an all-sky search for Common Proper Motion (CPM) binaries in the SUPERBLINK all-sky proper motion catalog of 2.8 million stars with proper motions greater than 40 mas/yr, which has been recently enhanced with data from the GAIA mission. We initially search the SUPERBLINK catalog for pairs of stars with angular separations up to 1 degree and proper motion difference less than 40 mas/yr. In order to determine which of these pairs are real binaries, we develop a Bayesian analysis to calculate probabilities of true companionship based on a combination of proper motion magnitude, angular separation, and proper motion differences. The analysis reveals that the SUPERBLINK catalog most likely contains ~40,000 genuine common proper motion binaries. We provide initial estimates of the distances and projected physical separations of these wide binaries.

  18. Controlled dipole-dipole interactions between K Rydberg atoms in a laser-chopped effusive beam

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kutteruf, M. R.; Jones, R. R.

    2010-12-15

    We explore pulsed-field control of resonant dipole-dipole interactions between K Rydberg atoms. A laser-based atomic beam chopper is used to reduce the relative velocities of Rydberg atoms excited from an effusive thermal source. Resonant energy transfer (RET) between pairs of atoms is controlled via Stark tuning of the relevant Rydberg energy levels. Resonance line shapes in the electric field dependence of the RET probability are used to determine the effective temperature of the sample. We demonstrate that the relative atom velocities can be reduced to the point where the duration of the electric-field tuning pulses, and not the motion ofmore » neighboring atoms, defines the interaction time for each pair within the ensemble. Coherent, transform-limited broadening of the resonance line shape is observed as the tuning pulse duration is reduced below the natural time scale for collisions.« less

  19. Highly efficient hyperentanglement concentration with two steps assisted by quantum swap gates.

    PubMed

    Ren, Bao-Cang; Long, Gui Lu

    2015-11-10

    We present a two-step hyperentanglement concentration protocol (hyper-ECP) for polarization-spatial hyperentangled Bell states based on the high-capacity character of hyperentanglement resorting to the swap gates, which is used to obtain maximally hyperentangled states from partially hyperentangled pure states in long-distance quantum communication. The swap gate, which is constructed with the giant optical circular birefringence (GOCB) of a diamond nitrogen-vacancy (NV) center embedded in a photonic crystal cavity, can be used to transfer the information in one degree of freedom (DOF) between photon systems. By transferring the useful information between hyperentangled photon pairs, more photon pairs in maximally hyperentangled state can be obtained in our hyper-ECP, and the success probability of the hyper-ECP is greatly improved. Moreover, we show that the high-fidelity quantum gate operations can be achieved by mapping the infidelities to heralded losses even in the weak coupling regime.

  20. Highly efficient hyperentanglement concentration with two steps assisted by quantum swap gates

    PubMed Central

    Ren, Bao-Cang; Long, Gui Lu

    2015-01-01

    We present a two-step hyperentanglement concentration protocol (hyper-ECP) for polarization-spatial hyperentangled Bell states based on the high-capacity character of hyperentanglement resorting to the swap gates, which is used to obtain maximally hyperentangled states from partially hyperentangled pure states in long-distance quantum communication. The swap gate, which is constructed with the giant optical circular birefringence (GOCB) of a diamond nitrogen-vacancy (NV) center embedded in a photonic crystal cavity, can be used to transfer the information in one degree of freedom (DOF) between photon systems. By transferring the useful information between hyperentangled photon pairs, more photon pairs in maximally hyperentangled state can be obtained in our hyper-ECP, and the success probability of the hyper-ECP is greatly improved. Moreover, we show that the high-fidelity quantum gate operations can be achieved by mapping the infidelities to heralded losses even in the weak coupling regime. PMID:26552898

  1. Analysis and inundation mapping of the April-May 2011 flood at selected locations in northern and eastern Arkansas and southern Missouri

    USGS Publications Warehouse

    Westerman, Drew A.; Merriman, Katherine R.; De Lanois, Jeanne L.; Berenbrock, Charles

    2013-01-01

    Precipitation that fell from April 19 through May 3, 2011, resulted in widespread flooding across northern and eastern Arkansas and southern Missouri. The first storm produced a total of approximately 16 inches of precipitation over an 8-day period, and the following storms produced as much as 12 inches of precipitation over a 2-day period. Moderate to major flooding occurred quickly along many streams within Arkansas and Missouri (including the Black, Cache, Illinois, St. Francis, and White Rivers) at levels that had not been seen since the historic 1927 floods. The 2011 flood claimed an estimated 21 lives in Arkansas and Missouri, and damage caused by the flooding resulted in a Federal Disaster Declaration for 59 Arkansas counties that received Federal or State assistance. To further the goal of documenting and understanding floods, the U.S. Geological Survey, in cooperation with the Federal Emergency Management Agency, the U.S. Army Corps of Engineers–Little Rock and Memphis Districts, and Arkansas Natural Resources Commission, conducted a study to summarize meteorological and hydrological conditions before the flood; computed flood-peak magnitudes for 39 streamgages; estimated annual exceedance probabilities for 37 of those streamgages; determined the joint probabilities for 11 streamgages paired to the Mississippi River at Helena, Arkansas, which refers to the probability that locations on two paired streams simultaneously experience floods of a magnitude greater than or equal to a given annual exceedance probability; collected high-water marks; constructed flood-peak inundation maps showing maximum flood extent and water depths; and summarized flood damages and effects. For the period of record used in this report, peak-of-record stage occurred at 24 of the 39 streamgages, and peak-of-record streamflow occurred at 13 of the 30 streamgages where streamflow was determined. Annual exceedance probabilities were estimated to be less than 0.5 percent at three streamgages. The joint probability values for streamgages paired with the Mississippi River at Helena, Ark., streamgage indicate a low probability of concurrent flooding with the paired streamgages. The inundation maps show the flood-peak extent and water depth of flooding for two stream reaches on the White River and two on the Black River; the vicinities of the communities of Holly Grove and Cotton Plant, Ark.; a reach of the White River that includes the crossing of Interstate 40 north of De Valls Bluff, Ark.; and the Tailwaters of Beaver Dam near Eureka Springs, Ark., Table Rock Dam near Branson, Mo., and Bull Shoals Dam near Flippin, Ark. The data and inundation maps can be used for flood response, recovery, and planning efforts by Federal, State, and local agencies.

  2. Colour assortative pairing in a colour polymorphic lizard is independent of population morph diversity

    NASA Astrophysics Data System (ADS)

    Pérez i de Lanuza, Guillem; Font, Enrique; Carretero, Miguel Ángel

    2016-10-01

    Previous work with a colour polymorphic population of Podarcis muralis (Lacertidae) revealed that lizards pair by ventral colour, favouring the same colour (i.e. homomorphic) pairs. Such assortative pairing, which probably results in colour assortative mating, can have consequences for the genetic structure of the population and potentially promote speciation. The population previously studied, located in the Pyrenees, encompasses white, yellow and orange animals, as well as intermediate white-orange and yellow-orange morphs. However, other Pyrenean populations of P. muralis have less ventral colour morphs. Our aim in this study is to test the generality of the assortative colour pairing system, extending our previous analyses to populations with different morph compositions and frequencies. The results show that the assortative pattern of pairing is similar in all the populations analysed and, hence, independent of morph composition and not restricted to pentamorphic populations. This suggests that assortative pairing by colour is a general phenomenon for colour polymorphic populations of P. muralis.

  3. High-Speed Quantum Key Distribution Using Photonic Integrated Circuits

    DTIC Science & Technology

    2013-01-01

    protocol [14] that uses energy-time entanglement of pairs of photons. We are employing the QPIC architecture to implement a novel high-dimensional disper...continuous Hilbert spaces using measures of the covariance matrix. Although we focus the discussion on a scheme employing entangled photon pairs...is the probability that parameter estimation fails [20]. The parameter ε̄ accounts for the accuracy of estimating the smooth min- entropy , which

  4. Stimulated emission of Cooper pairs in a high-temperature cuprate superconductor

    DOE PAGES

    Zhang, Wentao; Miller, Tristan; Smallwood, Christopher L.; ...

    2016-07-01

    The concept of stimulated emission of bosons has played an important role in modern science and technology, and constitutes the working principle for lasers. In a stimulated emission process, an incoming photon enhances the probability that an excited atomic state will transition to a lower energy state and generate a second photon of the same energy. It is expected, but not experimentally shown, that stimulated emission contributes significantly to the zero resistance current in a superconductor by enhancing the probability that scattered Cooper pairs will return to the macroscopically occupied condensate instead of entering any other state. Here, we usemore » time- and angle-resolved photoemission spectroscopy to study the initial rise of the non-equilibrium quasiparticle population in a Bi 2 Sr 2 CaCu 2 O 8+δ cuprate superconductor induced by an ultrashort laser pulse. Our finding reveals significantly slower buildup of quasiparticles in the superconducting state than in the normal state. The slower buildup only occurs when the pump pulse is too weak to deplete the superconducting condensate, and for cuts inside the Fermi arc region. We propose this is a manifestation of stimulated recombination of broken Cooper pairs, and signals an important momentum space dichotomy in the formation of Cooper pairs inside and outside the Fermi arc region.« less

  5. Assessment of DNA methylation profiling and copy number variation as indications of clonal relationship in ipsilateral and contralateral breast cancers to distinguish recurrent breast cancer from a second primary tumour.

    PubMed

    Huang, Katie T; Mikeska, Thomas; Li, Jason; Takano, Elena A; Millar, Ewan K A; Graham, Peter H; Boyle, Samantha E; Campbell, Ian G; Speed, Terence P; Dobrovic, Alexander; Fox, Stephen B

    2015-10-09

    Patients with breast cancer have an increased risk of developing subsequent breast cancers. It is important to distinguish whether these tumours are de novo or recurrences of the primary tumour in order to guide the appropriate therapy. Our aim was to investigate the use of DNA methylation profiling and array comparative genomic hybridization (aCGH) to determine whether the second tumour is clonally related to the first tumour. Methylation-sensitive high-resolution melting was used to screen promoter methylation in a panel of 13 genes reported as methylated in breast cancer (RASSF1A, TWIST1, APC, WIF1, MGMT, MAL, CDH13, RARβ, BRCA1, CDH1, CDKN2A, TP73, and GSTP1) in 29 tumour pairs (16 ipsilateral and 13 contralateral). Using the methylation profile of these genes, we employed a Bayesian and an empirical statistical approach to estimate clonal relationship. Copy number alterations were analysed using aCGH on the same set of tumour pairs. There is a higher probability of the second tumour being recurrent in ipsilateral tumours compared with contralateral tumours (38 % versus 8 %; p <0.05) based on the methylation profile. Using previously reported recurrence rates as Bayesian prior probabilities, we classified 69 % of ipsilateral and 15 % of contralateral tumours as recurrent. The inferred clonal relationship results of the tumour pairs were generally concordant between methylation profiling and aCGH. Our results show that DNA methylation profiling as well as aCGH have potential as diagnostic tools in improving the clinical decisions to differentiate recurrences from a second de novo tumour.

  6. Resonance of an unshared electron pair between two atoms connected by a single bond

    PubMed Central

    Pauling, Linus

    1983-01-01

    The reported structure of the dimer of a compound of bicovalent tin indicates that the tin-tin bond is of a new type. It can be described as involving resonance between two structures in which there is transfer of an electron pair from one tin atom to the other. The tin atoms are connected by a single covalent bond (each also forms two covalent bonds with carbon atoms), and an unshared electron pair resonates between the fourth sp3 orbitals of the two atoms. Similar structures probably occur in digermene and distannene. PMID:16593329

  7. Star formation rates in isolated galaxies selected from the Two-Micron All-Sky Survey

    NASA Astrophysics Data System (ADS)

    Melnyk, O.; Karachentseva, V.; Karachentsev, I.

    2015-08-01

    We have considered the star formation properties of 1616 isolated galaxies from the 2MASS XSC (Extended Source Catalog) selected sample (2MIG) with the far-ultraviolet GALEX magnitudes. This sample was then compared with corresponding properties of isolated galaxies from the Local Orphan Galaxies (LOG) catalogue and paired galaxies. We found that different selection algorithms define different populations of isolated galaxies. The population of the LOG catalogue, selected from non-clustered galaxies in the Local Supercluster volume, mostly consists of low-mass spiral and late-type galaxies. The specific star formation rate (SSFR) upper limit in isolated and paired galaxies does not exceed the value of ˜dex(-9.4). This is probably common for galaxies of differing activity and environment (at least at z < 0.06). The fractions of quenched galaxies are nearly twice as high in the paired galaxy sample as in the 2MIG isolated galaxy sample. From the behaviour of (S)SFR versus M* relations we deduced that the characteristic value influencing evolutionary processes is the galaxy mass. However, the environmental influence is notable: paired massive galaxies with logM* > 11.5 have higher (S)SFR than isolated galaxies. Our results suggest that the environment helps to trigger the star formation in the highest mass galaxies. We found that the fraction of AGN in the paired sample is only a little higher than in our isolated galaxy sample. We assume that AGN phenomenon is probably defined by secular galaxy evolution.

  8. A selection of giant radio sources from NVSS

    DOE PAGES

    Proctor, D. D.

    2016-06-01

    Results of the application of pattern-recognition techniques to the problem of identifying giant radio sources (GRSs) from the data in the NVSS catalog are presented, and issues affecting the process are explored. Decision-tree pattern-recognition software was applied to training-set source pairs developed from known NVSS large-angular-size radio galaxies. The full training set consisted of 51,195 source pairs, 48 of which were known GRSs for which each lobe was primarily represented by a single catalog component. The source pairs had a maximum separation ofmore » $$20^{\\prime} $$ and a minimum component area of 1.87 square arcmin at the 1.4 mJy level. The importance of comparing the resulting probability distributions of the training and application sets for cases of unknown class ratio is demonstrated. The probability of correctly ranking a randomly selected (GRS, non-GRS) pair from the best of the tested classifiers was determined to be 97.8 ± 1.5%. The best classifiers were applied to the over 870,000 candidate pairs from the entire catalog. Images of higher-ranked sources were visually screened, and a table of over 1600 candidates, including morphological annotation, is presented. These systems include doubles and triples, wide-angle tail and narrow-angle tail, S- or Z-shaped systems, and core-jets and resolved cores. In conclusion, while some resolved-lobe systems are recovered with this technique, generally it is expected that such systems would require a different approach.« less

  9. A comparative study for chest radiograph image retrieval using binary texture and deep learning classification.

    PubMed

    Anavi, Yaron; Kogan, Ilya; Gelbart, Elad; Geva, Ofer; Greenspan, Hayit

    2015-08-01

    In this work various approaches are investigated for X-ray image retrieval and specifically chest pathology retrieval. Given a query image taken from a data set of 443 images, the objective is to rank images according to similarity. Different features, including binary features, texture features, and deep learning (CNN) features are examined. In addition, two approaches are investigated for the retrieval task. One approach is based on the distance of image descriptors using the above features (hereon termed the "descriptor"-based approach); the second approach ("classification"-based approach) is based on a probability descriptor, generated by a pair-wise classification of each two classes (pathologies) and their decision values using an SVM classifier. Best results are achieved using deep learning features in a classification scheme.

  10. Electron holes appear to trigger cancer-implicated mutations

    NASA Astrophysics Data System (ADS)

    Miller, John; Villagran, Martha

    Malignant tumors are caused by mutations, which also affect their subsequent growth and evolution. We use a novel approach, computational DNA hole spectroscopy [M.Y. Suarez-Villagran & J.H. Miller, Sci. Rep. 5, 13571 (2015)], to compute spectra of enhanced hole probability based on actual sequence data. A hole is a mobile site of positive charge created when an electron is removed, for example by radiation or contact with a mutagenic agent. Peaks in the hole spectrum depict sites where holes tend to localize and potentially trigger a base pair mismatch during replication. Our studies of reveal a correlation between hole spectrum peaks and spikes in human mutation frequencies. Importantly, we also find that hole peak positions that do not coincide with large variant frequencies often coincide with cancer-implicated mutations and/or (for coding DNA) encoded conserved amino acids. This enables combining hole spectra with variant data to identify critical base pairs and potential cancer `driver' mutations. Such integration of DNA hole and variance spectra could also prove invaluable for pinpointing critical regions, and sites of driver mutations, in the vast non-protein-coding genome. Supported by the State of Texas through the Texas Ctr. for Superconductivity.

  11. Photon pair source via two coupling single quantum emitters

    NASA Astrophysics Data System (ADS)

    Peng, Yong-Gang; Zheng, Yu-Jun

    2015-10-01

    We study the two coupling two-level single molecules driven by an external field as a photon pair source. The probability of emitting two photons, P2, is employed to describe the photon pair source quality in a short time, and the correlation coefficient RAB is employed to describe the photon pair source quality in a long time limit. The results demonstrate that the coupling single quantum emitters can be considered as a stable photon pair source. Project supported by the National Natural Science Foundation of China (Grand Nos. 91021009, 21073110, and 11374191), the Natural Science Foundation of Shandong Province, China (Grant No. ZR2013AQ020), the Postdoctoral Science Foundation of China (Grant No. 2013M531584), the Doctoral Program of Higher Education of China (Grant Nos. 20130131110005 and 20130131120006), and the Taishan Scholarship Project of Shandong Province, China.

  12. Repair of clustered DNA damage caused by high LET radiation in human fibroblasts

    NASA Technical Reports Server (NTRS)

    Rydberg, B.; Lobrich, M.; Cooper, P. K.; Chatterjee, A. (Principal Investigator)

    1998-01-01

    It has recently been demonstrated experimentally that DNA damage induced by high LET radiation in mammalian cells is non-randomly distributed along the DNA molecule in the form of clusters of various sizes. The sizes of such clusters range from a few base-pairs to at least 200 kilobase-pairs. The high biological efficiency of high LET radiation for induction of relevant biological endpoints is probably a consequence of this clustering, although the exact mechanisms by which the clustering affects the biological outcome is not known. We discuss here results for induction and repair of base damage, single-strand breaks and double-strand breaks for low and high LET radiations. These results are discussed in the context of clustering. Of particular interest is to determine how clustering at different scales affects overall rejoining and fidelity of rejoining of DNA double-strand breaks. However, existing methods for measuring repair of DNA strand breaks are unable to resolve breaks that are close together in a cluster. This causes problems in interpretation of current results from high LET radiation and will require new methods to be developed.

  13. High yield and ultrafast sources of electrically triggered entangled-photon pairs based on strain-tunable quantum dots.

    PubMed

    Zhang, Jiaxiang; Wildmann, Johannes S; Ding, Fei; Trotta, Rinaldo; Huo, Yongheng; Zallo, Eugenio; Huber, Daniel; Rastelli, Armando; Schmidt, Oliver G

    2015-12-01

    Triggered sources of entangled photon pairs are key components in most quantum communication protocols. For practical quantum applications, electrical triggering would allow the realization of compact and deterministic sources of entangled photons. Entangled-light-emitting-diodes based on semiconductor quantum dots are among the most promising sources that can potentially address this task. However, entangled-light-emitting-diodes are plagued by a source of randomness, which results in a very low probability of finding quantum dots with sufficiently small fine structure splitting for entangled-photon generation (∼10(-2)). Here we introduce strain-tunable entangled-light-emitting-diodes that exploit piezoelectric-induced strains to tune quantum dots for entangled-photon generation. We demonstrate that up to 30% of the quantum dots in strain-tunable entangled-light-emitting-diodes emit polarization-entangled photons. An entanglement fidelity as high as 0.83 is achieved with fast temporal post selection. Driven at high speed, that is 400 MHz, strain-tunable entangled-light-emitting-diodes emerge as promising devices for high data-rate quantum applications.

  14. Unsuspected Leptospirosis Is a Cause of Acute Febrile Illness in Nicaragua

    PubMed Central

    Reller, Megan E.; Wunder, Elsio A.; Miles, Jeremy J.; Flom, Judith E.; Mayorga, Orlando; Woods, Christopher W.; Ko, Albert I.; Dumler, J. Stephen; Matute, Armando J.

    2014-01-01

    Background Epidemic severe leptospirosis was recognized in Nicaragua in 1995, but unrecognized epidemic and endemic disease remains unstudied. Methodology/Principal Findings To determine the burden of and risk factors associated with symptomatic leptospirosis in Nicaragua, we prospectively studied patients presenting with fever at a large teaching hospital. Epidemiologic and clinical features were systematically recorded, and paired sera tested by IgM-ELISA to identify patients with probable and possible acute leptospirosis. Microscopic Agglutination Test and PCR were used to confirm acute leptospirosis. Among 704 patients with paired sera tested by MAT, 44 had acute leptospirosis. Patients with acute leptospirosis were more likely to present during rainy months and to report rural residence and fresh water exposure. The sensitivity of clinical impression and acute-phase IgM detected by ELISA were poor. Conclusions/Significance Leptospirosis is a common (6.3%) but unrecognized cause of acute febrile illness in Nicaragua. Rapid point-of-care tests to support early diagnosis and treatment as well as tests to support population-based studies to delineate the epidemiology, incidence, and clinical spectrum of leptospirosis, both ideally pathogen-based, are needed. PMID:25058149

  15. The Finite-Size Scaling Relation for the Order-Parameter Probability Distribution of the Six-Dimensional Ising Model

    NASA Astrophysics Data System (ADS)

    Merdan, Ziya; Karakuş, Özlem

    2016-11-01

    The six dimensional Ising model with nearest-neighbor pair interactions has been simulated and verified numerically on the Creutz Cellular Automaton by using five bit demons near the infinite-lattice critical temperature with the linear dimensions L=4,6,8,10. The order parameter probability distribution for six dimensional Ising model has been calculated at the critical temperature. The constants of the analytical function have been estimated by fitting to probability function obtained numerically at the finite size critical point.

  16. Attractive interaction between Mn atoms on the GaAs(110) surface observed by scanning tunneling microscopy.

    PubMed

    Taninaka, Atsushi; Yoshida, Shoji; Kanazawa, Ken; Hayaki, Eiko; Takeuchi, Osamu; Shigekawa, Hidemi

    2016-06-16

    Scanning tunneling microscopy/spectroscopy (STM/STS) was carried out to investigate the structures of Mn atoms deposited on a GaAs(110) surface at room temperature to directly observe the characteristics of interactions between Mn atoms in GaAs. Mn atoms were paired with a probability higher than the random distribution, indicating an attractive interaction between them. In fact, re-pairing of unpaired Mn atoms was observed during STS measurement. The pair initially had a new structure, which was transformed during STS measurement into one of those formed by atom manipulation at 4 K. Mn atoms in pairs and trimers were aligned in the <110> direction, which is theoretically predicted to produce a high Curie temperature.

  17. How a short double-stranded DNA bends

    NASA Astrophysics Data System (ADS)

    Shin, Jaeoh; Lee, O.-Chul; Sung, Wokyung

    2015-04-01

    A recent experiment using fluorescence microscopy showed that double-stranded DNA fragments shorter than 100 base pairs loop with the probabilities higher by the factor of 102-106 than predicted by the worm-like chain (WLC) model [R. Vafabakhsh and T. Ha, Science 337, 1101(2012)]. Furthermore, the looping probabilities were found to be nearly independent of the loop size. The results signify a breakdown of the WLC model for DNA mechanics which works well on long length scales and calls for fundamental understanding for stressed DNA on shorter length scales. We develop an analytical, statistical mechanical model to investigate what emerges to the short DNA under a tight bending. A bending above a critical level initiates nucleation of a thermally induced bubble, which could be trapped for a long time, in contrast to the bubbles in both free and uniformly bent DNAs, which are either transient or unstable. The trapped bubble is none other than the previously hypothesized kink, which releases the bending energy more easily as the contour length decreases. It leads to tremendous enhancement of the cyclization probabilities, in a reasonable agreement with experiment.

  18. Role of large thermal fluctuations and magnesium ions in t-RNA selectivity of the ribosome

    PubMed Central

    Guo, Zuojun; Gibson, Meghan; Sitha, Sanyasi; Chu, Steven; Mohanty, Udayan

    2011-01-01

    The fidelity of translation selection begins with the base pairing of codon-anticodon complex between the m-RNA and tRNAs. Binding of cognate and near-cognate tRNAs induces 30S subunit of the ribosome to wrap around the ternary complex, EF-Tu(GTP)aa-tRNA. We have proposed that large thermal fluctuations play a crucial role in the selection process. To test this conjecture, we have developed a theoretical technique to determine the probability that the ternary complex, as a result of large thermal fluctuations, forms contacts leading to stabilization of the GTPase activated state. We argue that the configurational searches for such processes are in the tail end of the probability distribution and show that the probability for this event is localized around the most likely configuration. Small variations in the repositioning of cognate relative to near-cognate complexes lead to rate enhancement of the cognate complex. The binding energies of over a dozen unique site-bound magnesium structural motifs are investigated and provide insights into the nature of interaction of divalent metal ions with the ribosome. PMID:21368154

  19. Memory disorders in probable Alzheimer's disease: the role of hippocampal atrophy as shown with MRI.

    PubMed Central

    Deweer, B; Lehéricy, S; Pillon, B; Baulac, M; Chiras, J; Marsault, C; Agid, Y; Dubois, B

    1995-01-01

    Magnetic resonance based volumetric measures of hippocampal formation, amygdala (A), caudate nucleus (CN), normalised for total intracranial volume (TIV), were analysed in relation to measures of cognitive deterioration and specific features of memory functions in 18 patients with probable Alzheimer's disease. Neuropsychological examination included the mini mental state examination (MMSE), the Mattis dementia rating scale (DRS), tests of executive functions, assessment of language abilities and praxis, the Wechsler memory scale (WMS), the California verbal learning test (CVLT) and the Grober and Buschke test. The volume of the hippocampal formation (HF/TIV) was correlated with specific memory variables: memory quotient and paired associates of the WMS; intrusions and discriminability at recognition for the Grober and Buschke test. By contrast, except for intrusions, no correlations were found between memory variables and the volume of amygdala (A/TIV). No correlations were found between the volume of caudate nuclei (CN/TIV) and any neuropsychological score. The volume of the hippocampal formation was therefore selectively related to quantitative and qualitative aspects of memory performance in patients with probable Alzheimer's disease. Images PMID:7745409

  20. Photoanode Thickness Optimization and Impedance Spectroscopic Analysis of Dye-Sensitized Solar Cells based on a Carbazole-Containing Ruthenium Dye

    NASA Astrophysics Data System (ADS)

    Choi, Jongwan; Kim, Felix Sunjoo

    2018-03-01

    We studied the influence of photoanode thickness on the photovoltaic characteristics and impedance responses of the dye-sensitized solar cells based on a ruthenium dye containing a hexyloxyl-substituted carbazole unit (Ru-HCz). As the thickness of photoanode increases from 4.2 μm to 14.8 μm, the dye-loading amount and the efficiency increase. The device with thicker photoanode shows a decrease in the efficiency due to the higher probability of recombination of electron-hole pairs before charge extraction. We also analyzed the electron-transfer and recombination characteristics as a function of photoanode thickness through detailed electrochemical impedance spectroscopy analysis.

  1. Measures of disturbance and incompatibility for quantum measurements

    NASA Astrophysics Data System (ADS)

    Mandayam, Prabha; Srinivas, M. D.

    2014-06-01

    We propose a class of incompatibility measures for quantum observables based on quantifying the effect of a measurement of one observable on the statistics of the outcomes of another. Specifically, for a pair of observables A and B with purely discrete spectra, we compare the following two probability distributions: one resulting from a measurement of A followed by a measurement of B on a given state and the other obtained from a measurement of B alone on the same state. We show that maximizing the distance between these two distributions over all states yields a valid measure of the incompatibility of observables A and B, which is zero if and only if they commute and is strictly greater than zero (and less than or equal to one) otherwise. For finite-dimensional systems, we obtain a tight upper bound on the incompatibility of any pair of observables and show that the bound is attained when the observables are totally nondegenerate and associated with mutually unbiased bases. In the process, we also establish an important relation between the incompatibility of a pair of observables and the maximal disturbances due to their measurements. Finally, we indicate how these measures of incompatibility and disturbance can be extended to the more general class of nonprojective measurements. In particular, we obtain a nontrivial upper bound on the incompatibility of one Lüders instrument with another.

  2. Lost in folding space? Comparing four variants of the thermodynamic model for RNA secondary structure prediction.

    PubMed

    Janssen, Stefan; Schudoma, Christian; Steger, Gerhard; Giegerich, Robert

    2011-11-03

    Many bioinformatics tools for RNA secondary structure analysis are based on a thermodynamic model of RNA folding. They predict a single, "optimal" structure by free energy minimization, they enumerate near-optimal structures, they compute base pair probabilities and dot plots, representative structures of different abstract shapes, or Boltzmann probabilities of structures and shapes. Although all programs refer to the same physical model, they implement it with considerable variation for different tasks, and little is known about the effects of heuristic assumptions and model simplifications used by the programs on the outcome of the analysis. We extract four different models of the thermodynamic folding space which underlie the programs RNAFOLD, RNASHAPES, and RNASUBOPT. Their differences lie within the details of the energy model and the granularity of the folding space. We implement probabilistic shape analysis for all models, and introduce the shape probability shift as a robust measure of model similarity. Using four data sets derived from experimentally solved structures, we provide a quantitative evaluation of the model differences. We find that search space granularity affects the computed shape probabilities less than the over- or underapproximation of free energy by a simplified energy model. Still, the approximations perform similar enough to implementations of the full model to justify their continued use in settings where computational constraints call for simpler algorithms. On the side, we observe that the rarely used level 2 shapes, which predict the complete arrangement of helices, multiloops, internal loops and bulges, include the "true" shape in a rather small number of predicted high probability shapes. This calls for an investigation of new strategies to extract high probability members from the (very large) level 2 shape space of an RNA sequence. We provide implementations of all four models, written in a declarative style that makes them easy to be modified. Based on our study, future work on thermodynamic RNA folding may make a choice of model based on our empirical data. It can take our implementations as a starting point for further program development.

  3. Explosion probability of unexploded ordnance: expert beliefs.

    PubMed

    MacDonald, Jacqueline Anne; Small, Mitchell J; Morgan, M G

    2008-08-01

    This article reports on a study to quantify expert beliefs about the explosion probability of unexploded ordnance (UXO). Some 1,976 sites at closed military bases in the United States are contaminated with UXO and are slated for cleanup, at an estimated cost of $15-140 billion. Because no available technology can guarantee 100% removal of UXO, information about explosion probability is needed to assess the residual risks of civilian reuse of closed military bases and to make decisions about how much to invest in cleanup. This study elicited probability distributions for the chance of UXO explosion from 25 experts in explosive ordnance disposal, all of whom have had field experience in UXO identification and deactivation. The study considered six different scenarios: three different types of UXO handled in two different ways (one involving children and the other involving construction workers). We also asked the experts to rank by sensitivity to explosion 20 different kinds of UXO found at a case study site at Fort Ord, California. We found that the experts do not agree about the probability of UXO explosion, with significant differences among experts in their mean estimates of explosion probabilities and in the amount of uncertainty that they express in their estimates. In three of the six scenarios, the divergence was so great that the average of all the expert probability distributions was statistically indistinguishable from a uniform (0, 1) distribution-suggesting that the sum of expert opinion provides no information at all about the explosion risk. The experts' opinions on the relative sensitivity to explosion of the 20 UXO items also diverged. The average correlation between rankings of any pair of experts was 0.41, which, statistically, is barely significant (p= 0.049) at the 95% confidence level. Thus, one expert's rankings provide little predictive information about another's rankings. The lack of consensus among experts suggests that empirical studies are needed to better understand the explosion risks of UXO.

  4. An efficient variational method to study the denaturation of DNA induced by superhelical stress

    NASA Astrophysics Data System (ADS)

    Jost, Daniel; Everaers, Ralf

    2010-03-01

    Many fundamental biological processes, like transcription or replication, need the opening of the double-stranded DNA. One common way to control the local denaturation is to impose superhelical stress to the DNA using protein machineries. To describe superhelical effect for circular molecules, Benham introduced a model where the standard thermodynamic description of base-pairing is coupled with torsional stress energetics. Here, we introduce an efficient mean-field approximation of the Benham model. Our self-consistent solution is confident and computationally-fast, compared to the full treatment of the model. In particular, our formulation allows to compute the probability of bubble formation for given length and position along the sequence. Evolution of this probability as a function of the superhelical stress could inform us on the ability for organisms to control the strength of superhelicity acting on their genomes.

  5. Refinement of the probability density function model for preferential concentration of aerosol particles in isotropic turbulence

    NASA Astrophysics Data System (ADS)

    Zaichik, Leonid I.; Alipchenkov, Vladimir M.

    2007-11-01

    The purposes of the paper are threefold: (i) to refine the statistical model of preferential particle concentration in isotropic turbulence that was previously proposed by Zaichik and Alipchenkov [Phys. Fluids 15, 1776 (2003)], (ii) to investigate the effect of clustering of low-inertia particles using the refined model, and (iii) to advance a simple model for predicting the collision rate of aerosol particles. The model developed is based on a kinetic equation for the two-point probability density function of the relative velocity distribution of particle pairs. Improvements in predicting the preferential concentration of low-inertia particles are attained due to refining the description of the turbulent velocity field of the carrier fluid by including a difference between the time scales of the of strain and rotation rate correlations. The refined model results in a better agreement with direct numerical simulations for aerosol particles.

  6. Matrix Concentration Inequalities via the Method of Exchangeable Pairs

    DTIC Science & Technology

    2012-01-27

    viewed as an exchangeable pairs version of the Burkholder –Davis–Gundy (BDG) inequality from classical martingale theory [Bur73]. Matrix extensions of...non-commutative probability. Math. Ann., 319:1–16, 2001. [Bur73] D. L. Burkholder . Distribution function inequalities for martingales. Ann. Probab., 1...Statist. Assoc., 58(301):13–30, 1963. [JX03] M. Junge and Q. Xu. Noncommutative Burkholder /Rosenthal inequalities. Ann. Probab., 31(2):948–995, 2003

  7. A linear programming model for protein inference problem in shotgun proteomics.

    PubMed

    Huang, Ting; He, Zengyou

    2012-11-15

    Assembling peptides identified from tandem mass spectra into a list of proteins, referred to as protein inference, is an important issue in shotgun proteomics. The objective of protein inference is to find a subset of proteins that are truly present in the sample. Although many methods have been proposed for protein inference, several issues such as peptide degeneracy still remain unsolved. In this article, we present a linear programming model for protein inference. In this model, we use a transformation of the joint probability that each peptide/protein pair is present in the sample as the variable. Then, both the peptide probability and protein probability can be expressed as a formula in terms of the linear combination of these variables. Based on this simple fact, the protein inference problem is formulated as an optimization problem: minimize the number of proteins with non-zero probabilities under the constraint that the difference between the calculated peptide probability and the peptide probability generated from peptide identification algorithms should be less than some threshold. This model addresses the peptide degeneracy issue by forcing some joint probability variables involving degenerate peptides to be zero in a rigorous manner. The corresponding inference algorithm is named as ProteinLP. We test the performance of ProteinLP on six datasets. Experimental results show that our method is competitive with the state-of-the-art protein inference algorithms. The source code of our algorithm is available at: https://sourceforge.net/projects/prolp/. zyhe@dlut.edu.cn. Supplementary data are available at Bioinformatics Online.

  8. Test of a hypothesis of realism in quantum theory using a Bayesian approach

    NASA Astrophysics Data System (ADS)

    Nikitin, N.; Toms, K.

    2017-05-01

    In this paper we propose a time-independent equality and time-dependent inequality, suitable for an experimental test of the hypothesis of realism. The derivation of these relations is based on the concept of conditional probability and on Bayes' theorem in the framework of Kolmogorov's axiomatics of probability theory. The equality obtained is intrinsically different from the well-known Greenberger-Horne-Zeilinger (GHZ) equality and its variants, because violation of the proposed equality might be tested in experiments with only two microsystems in a maximally entangled Bell state |Ψ-> , while a test of the GHZ equality requires at least three quantum systems in a special state |ΨGHZ> . The obtained inequality differs from Bell's, Wigner's, and Leggett-Garg inequalities, because it deals with spin s =1 /2 projections onto only two nonparallel directions at two different moments of time, while a test of the Bell and Wigner inequalities requires at least three nonparallel directions, and a test of the Leggett-Garg inequalities requires at least three distinct moments of time. Hence, the proposed inequality seems to open an additional experimental possibility to avoid the "contextuality loophole." Violation of the proposed equality and inequality is illustrated with the behavior of a pair of anticorrelated spins in an external magnetic field and also with the oscillations of flavor-entangled pairs of neutral pseudoscalar mesons.

  9. The electron localization as the information content of the conditional pair density

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Urbina, Andres S.; Torres, F. Javier; Universidad San Francisco de Quito

    2016-06-28

    In the present work, the information gained by an electron for “knowing” about the position of another electron with the same spin is calculated using the Kullback-Leibler divergence (D{sub KL}) between the same-spin conditional pair probability density and the marginal probability. D{sub KL} is proposed as an electron localization measurement, based on the observation that regions of the space with high information gain can be associated with strong correlated localized electrons. Taking into consideration the scaling of D{sub KL} with the number of σ-spin electrons of a system (N{sup σ}), the quantity χ = (N{sup σ} − 1) D{sub KL}f{submore » cut} is introduced as a general descriptor that allows the quantification of the electron localization in the space. f{sub cut} is defined such that it goes smoothly to zero for negligible densities. χ is computed for a selection of atomic and molecular systems in order to test its capability to determine the region in space where electrons are localized. As a general conclusion, χ is able to explain the electron structure of molecules on the basis of chemical grounds with a high degree of success and to produce a clear differentiation of the localization of electrons that can be traced to the fluctuation in the average number of electrons in these regions.« less

  10. Observing Galaxy Mergers in Simulations

    NASA Astrophysics Data System (ADS)

    Snyder, Gregory

    2018-01-01

    I will describe results on mergers and morphology of distant galaxies. By mock-observing 3D cosmological simulations, we aim to contrast theory with data, design better diagnostics of physical processes, and examine unexpected signatures of galaxy formation. Recently, we conducted mock surveys of the Illustris Simulations to learn how mergers would appear in deep HST and JWST surveys. With this approach, we reconciled merger rates estimated using observed close galaxy pairs with intrinsic merger rates predicted by theory. This implies that the merger-pair observability time is probably shorter in the early universe, and therefore that major mergers are more common than implied by the simplest arguments. Further, we show that disturbance-based diagnostics of late-stage mergers can be improved significantly by combining multi-dimensional image information with simulated merger identifications to train automated classifiers. We then apply these classifiers to real measurements from the CANDELS fields, recovering a merger fraction increasing with redshift in broad agreement with pair fractions and simulations, and with statistical errors smaller by a factor of two than classical morphology estimators. This emphasizes the importance of using robust training sets, including cosmological simulations and multidimensional data, for interpreting observed processes in galaxy evolution.

  11. Inertial navigation without accelerometers

    NASA Astrophysics Data System (ADS)

    Boehm, M.

    The Kennedy-Thorndike (1932) experiment points to the feasibility of fiber-optic inertial velocimeters, to which state-of-the-art technology could furnish substantial sensitivity and accuracy improvements. Velocimeters of this type would obviate the use of both gyros and accelerometers, and allow inertial navigation to be conducted together with vehicle attitude control, through the derivation of rotation rates from the ratios of the three possible velocimeter pairs. An inertial navigator and reference system based on this approach would probably have both fewer components and simpler algorithms, due to the obviation of the first level of integration in classic inertial navigators.

  12. Skyrme RPA description of γ-vibrational states in rare-earth nuclei

    NASA Astrophysics Data System (ADS)

    Nesterenko, V. O.; Kartavenko, V. G.; Kleinig, W.; Kvasil, J.; Repko, A.; Jolos, R. V.; Reinhard, P.-G.

    2016-01-01

    The lowest γ-vibrational states with Kπ = 2+γ in well-deformed Dy, Er and Yb isotopes are investigated within the self-consistent separable quasiparticle random-phase-approximation (QRPA) approach based on the Skyrme functional. The energies Eγ and reduced transition probabilities B(E2)γ of the states are calculated with the Skyrme force SV-mas10. We demonstrate the strong effect of the pairing blocking on the energies of γ-vibrational states. It is also shown that collectivity of γ-vibrational states is strictly determined by keeping the Nilsson selection rules in the corresponding lowest 2qp configurations.

  13. [Cleavage of DNA fragments induced by UV nanosecond laser excitation at 193 nm].

    PubMed

    Vtiurina, N N; Grokhovskiĭ, S L; Filimonov, I V; Medvedkov, O I; Nechipurenko, D Iu; Vasil'ev, S A; Nechipurenko, Iu D

    2011-01-01

    The cleavage of dsDNA fragments in aqueous solution after irradiation with UV laser pulses at 193 nm has been studied. Samples were investigated using polyacrylamide gel electrophoresis. The intensity of damage of particular phosphodiester bond after hot alkali treatment was shown to depend on the base pair sequence. It was established that the probability of cleavage is twice higher for sites of DNA containing two or more successively running guanine residues. A possible mechanism of damage to the DNA molecule connected with the migration of holes along the helix is discussed.

  14. Changes in flexibility upon binding: Application of the self-consistent pair contact probability method to protein-protein interactions

    NASA Astrophysics Data System (ADS)

    Canino, Lawrence S.; Shen, Tongye; McCammon, J. Andrew

    2002-12-01

    We extend the self-consistent pair contact probability method to the evaluation of the partition function for a protein complex at thermodynamic equilibrium. Specifically, we adapt the method for multichain models and introduce a parametrization for amino acid-specific pairwise interactions. This method is similar to the Gaussian network model but allows for the adjusting of the strengths of native state contacts. The method is first validated on a high resolution x-ray crystal structure of bovine Pancreatic Phospholipase A2 by comparing calculated B-factors with reported values. We then examine binding-induced changes in flexibility in protein-protein complexes, comparing computed results with those obtained from x-ray crystal structures and molecular dynamics simulations. In particular, we focus on the mouse acetylcholinesterase:fasciculin II and the human α-thrombin:thrombomodulin complexes.

  15. Surface code quantum communication.

    PubMed

    Fowler, Austin G; Wang, David S; Hill, Charles D; Ladd, Thaddeus D; Van Meter, Rodney; Hollenberg, Lloyd C L

    2010-05-07

    Quantum communication typically involves a linear chain of repeater stations, each capable of reliable local quantum computation and connected to their nearest neighbors by unreliable communication links. The communication rate of existing protocols is low as two-way classical communication is used. By using a surface code across the repeater chain and generating Bell pairs between neighboring stations with probability of heralded success greater than 0.65 and fidelity greater than 0.96, we show that two-way communication can be avoided and quantum information can be sent over arbitrary distances with arbitrarily low error at a rate limited only by the local gate speed. This is achieved by using the unreliable Bell pairs to measure nonlocal stabilizers and feeding heralded failure information into post-transmission error correction. Our scheme also applies when the probability of heralded success is arbitrarily low.

  16. Rényi and Tsallis formulations of separability conditions in finite dimensions

    NASA Astrophysics Data System (ADS)

    Rastegin, Alexey E.

    2017-12-01

    Separability conditions for a bipartite quantum system of finite-dimensional subsystems are formulated in terms of Rényi and Tsallis entropies. Entropic uncertainty relations often lead to entanglement criteria. We propose new approach based on the convolution of discrete probability distributions. Measurements on a total system are constructed of local ones according to the convolution scheme. Separability conditions are derived on the base of uncertainty relations of the Maassen-Uffink type as well as majorization relations. On each of subsystems, we use a pair of sets of subnormalized vectors that form rank-one POVMs. We also obtain entropic separability conditions for local measurements with a special structure, such as mutually unbiased bases and symmetric informationally complete measurements. The relevance of the derived separability conditions is demonstrated with several examples.

  17. Testing hypotheses of earthquake occurrence

    NASA Astrophysics Data System (ADS)

    Kagan, Y. Y.; Jackson, D. D.; Schorlemmer, D.; Gerstenberger, M.

    2003-12-01

    We present a relatively straightforward likelihood method for testing those earthquake hypotheses that can be stated as vectors of earthquake rate density in defined bins of area, magnitude, and time. We illustrate the method as it will be applied to the Regional Earthquake Likelihood Models (RELM) project of the Southern California Earthquake Center (SCEC). Several earthquake forecast models are being developed as part of this project, and additional contributed forecasts are welcome. Various models are based on fault geometry and slip rates, seismicity, geodetic strain, and stress interactions. We would test models in pairs, requiring that both forecasts in a pair be defined over the same set of bins. Thus we offer a standard "menu" of bins and ground rules to encourage standardization. One menu category includes five-year forecasts of magnitude 5.0 and larger. Forecasts would be in the form of a vector of yearly earthquake rates on a 0.05 degree grid at the beginning of the test. Focal mechanism forecasts, when available, would be also be archived and used in the tests. The five-year forecast category may be appropriate for testing hypotheses of stress shadows from large earthquakes. Interim progress will be evaluated yearly, but final conclusions would be made on the basis of cumulative five-year performance. The second category includes forecasts of earthquakes above magnitude 4.0 on a 0.05 degree grid, evaluated and renewed daily. Final evaluation would be based on cumulative performance over five years. Other types of forecasts with different magnitude, space, and time sampling are welcome and will be tested against other models with shared characteristics. All earthquakes would be counted, and no attempt made to separate foreshocks, main shocks, and aftershocks. Earthquakes would be considered as point sources located at the hypocenter. For each pair of forecasts, we plan to compute alpha, the probability that the first would be wrongly rejected in favor of the second, and beta, the probability that the second would be wrongly rejected in favor of the first. Computing alpha and beta requires knowing the theoretical distribution of likelihood scores under each hypothesis, which we will estimate by simulations. Each forecast is given equal status; there is no "null hypothesis" which would be accepted by default. Forecasts and test results would be archived and posted on the RELM web site. The same methods can be applied to any region with adequate monitoring and sufficient earthquakes. If fewer than ten events are forecasted, the likelihood tests may not give definitive results. The tests do force certain requirements on the forecast models. Because the tests are based on absolute rates, stress models must be explicit about how stress increments affect past seismicity rates. Aftershocks of triggered events must be accounted for. Furthermore, the tests are sensitive to magnitude, so forecast models must specify the magnitude distribution of triggered events. Models should account for probable errors in magnitude and location by appropriate smoothing of the probabilities, as the tests will be "cold hearted:" near misses won't count.

  18. On the correlations between the polyhedron eccentricity parameters and the bond-valence sums for the cations with one lone electron pair.

    PubMed

    Sidey, Vasyl

    2008-08-01

    Applicability of the Wang-Liebau polyhedron eccentricity parameter in the bond-valence model [Wang & Liebau (2007). Acta Cryst. B63, 216-228] has been found to be doubtful: the correlations between the values of the polyhedron eccentricity parameters and the bond-valence sums calculated for the cations with one lone electron pair are probably an artifact of the poorly determined bond-valence parameters.

  19. Effects of fire on golden eagle territory occupancy and reproductive success

    USGS Publications Warehouse

    Kochert, Michael N.; Steenhof, Karen; Marzluff, J.M.; Carpenter, L.B.

    1999-01-01

    We examined effects of fire on golden eagle (Aquila chrysaetos) territory occupancy and reproductive success in southwestern Idaho because wildfires since 1980 have resulted in large-scale losses of shrub habitat in the Snake River Plain. Success (percentage of pairs that raised young) at burned territories declined after major fires (P = 0.004). Pairs in burned areas that could expand into adjacent vacant territories were as successful as pairs in unburned territories and more successful than pairs in burned territories that could not expand. Success at extensively burned territories was lowest 4-6 years after burning but increased 4-5 years later. The incidence and extent of fires did not help predict territories that would have low occupancy and success rates in postburn years. The presence of a vacant neighboring territory and the amount of agriculture and proportion of shrubs within 3 km of the nesting centroid best predicted probability of territory occupancy. Nesting success during preburn years best predicted the probability of a territory being successful in postburn years. Burned territories with high success rates during preburn years continued to have high success rates during postburn years, and those with low success in preburn years continued to be less successful after burning. In areas where much shrub habitat has been lost to fire, management for golden eagles should include active fire suppression and rehabilitation of burned areas.

  20. Subthalamic nucleus long-range synchronization—an independent hallmark of human Parkinson's disease

    PubMed Central

    Moshel, Shay; Shamir, Reuben R.; Raz, Aeyal; de Noriega, Fernando R.; Eitan, Renana; Bergman, Hagai; Israel, Zvi

    2013-01-01

    Beta-band synchronous oscillations in the dorsolateral region of the subthalamic nucleus (STN) of human patients with Parkinson's disease (PD) have been frequently reported. However, the correlation between STN oscillations and synchronization has not been thoroughly explored. The simultaneous recordings of 2390 multi-unit pairs recorded by two parallel microelectrodes (separated by fixed distance of 2 mm, n = 72 trajectories with two electrode tracks >4 mm STN span) in 57 PD patients undergoing STN deep brain stimulation surgery were analyzed. Automatic procedures were utilized to divide the STN into dorsolateral oscillatory and ventromedial non-oscillatory regions, and to quantify the intensity of STN oscillations and synchronicity. Finally, the synchronicity of simultaneously vs. non-simultaneously recorded pairs were compared using a shuffling procedure. Synchronization was observed predominately in the beta range and only between multi-unit pairs in the dorsolateral oscillatory region (n = 615). In paired recordings between sites in the dorsolateral and ventromedial (n = 548) and ventromedial-ventromedial region pairs (n = 1227), no synchronization was observed. Oscillation and synchronicity intensity decline along the STN dorsolateral-ventromedial axis suggesting a fuzzy border between the STN regions. Synchronization strength was significantly correlated to the oscillation power, but synchronization was no longer observed following shuffling. We conclude that STN long-range beta oscillatory synchronization is due to increased neuronal coupling in the Parkinsonian brain and does not merely reflect the outcome of oscillations at similar frequency. The neural synchronization in the dorsolateral (probably the motor domain) STN probably augments the pathological changes in firing rate and patterns of subthalamic neurons in PD patients. PMID:24312018

  1. Microfluidic cell trap array for controlled positioning of single cells on adhesive micropatterns.

    PubMed

    Lin, Laiyi; Chu, Yeh-Shiu; Thiery, Jean Paul; Lim, Chwee Teck; Rodriguez, Isabel

    2013-02-21

    Adhesive micropattern arrays permit the continuous monitoring and systematic study of the behavior of spatially confined cells of well-defined shape and size in ordered configurations. This technique has contributed to defining mechanisms that control cell polarity and cell functions, including proliferation, apoptosis, differentiation and migration in two-dimensional cell culture systems. These micropattern studies often involve isolating a single cell on one adhesive protein micropattern using random seeding methods. Random seeding has been successful for isolated and, to a lesser degree, paired patterns, where two patterns are placed in close proximity. Using this method, we found that the probability of obtaining one cell per pattern decreases significantly as the number of micropatterns in a cluster increases, from 16% for paired micropatterns to 0.3% for clusters of 6 micropatterns. This work presents a simple yet effective platform based on a microfludic sieve-like trap array to exert precise control over the positioning of single cells on micropatterns. We observed a 4-fold improvement over random seeding in the efficiency of placing a pair of single cells on paired micropattern and a 40-fold improvement for 6-pattern clusters. The controlled nature of this platform can also allow the juxtaposition of two different cell populations through a simple modification in the trap arrangement. With excellent control of the identity, number and position of neighbouring cells, this cell-positioning platform provides a unique opportunity for the extension of two-dimensional micropattern studies beyond paired micropatterns to organizations containing many cells or different cell types.

  2. Phase transitions in Nowak Sznajd opinion dynamics

    NASA Astrophysics Data System (ADS)

    Wołoszyn, Maciej; Stauffer, Dietrich; Kułakowski, Krzysztof

    2007-05-01

    The Nowak modification of the Sznajd opinion dynamics model on the square lattice assumes that with probability β the opinions flip due to mass-media advertising from down to up, and vice versa. Besides, with probability α the Sznajd rule applies that a neighbour pair agreeing in its two opinions convinces all its six neighbours of that opinion. Our Monte Carlo simulations and mean-field theory find sharp phase transitions in the parameter space.

  3. Noise thresholds for optical quantum computers.

    PubMed

    Dawson, Christopher M; Haselgrove, Henry L; Nielsen, Michael A

    2006-01-20

    In this Letter we numerically investigate the fault-tolerant threshold for optical cluster-state quantum computing. We allow both photon loss noise and depolarizing noise (as a general proxy for all local noise), and obtain a threshold region of allowed pairs of values for the two types of noise. Roughly speaking, our results show that scalable optical quantum computing is possible for photon loss probabilities <3 x 10(-3), and for depolarization probabilities <10(-4).

  4. Manipulation of double-stranded DNA melting by force

    NASA Astrophysics Data System (ADS)

    Singh, Amit Raj; Granek, Rony

    2017-09-01

    By integrating elasticity—as described by the Gaussian network model—with bond binding energies that distinguish between different base-pair identities and stacking configurations, we study the force induced melting of a double-stranded DNA (dsDNA). Our approach is a generalization of our previous study of thermal dsDNA denaturation [J. Chem. Phys. 145, 144101 (2016), 10.1063/1.4964285] to that induced by force at finite temperatures. It allows us to obtain semimicroscopic information about the opening of the chain, such as whether the dsDNA opens from one of the ends or from the interior, forming an internal bubble. We study different types of force manipulation: (i) "end unzipping," with force acting at a single end base pair perpendicular to the helix, (ii) "midunzipping," with force acting at a middle base pair perpendicular to the helix, and (iii) "end shearing," where the force acts at opposite ends along the helix. By monitoring the free-energy landscape and probability distribution of intermediate denaturation states, we show that different dominant intermediate states are stabilized depending on the type of force manipulation used. In particular, the bubble state of the sequence L60B36, which we have previously found to be a stable state during thermal denaturation, is absent for end unzipping and end shearing, whereas very similar bubbles are stabilized by midunzipping, or when the force location is near the middle of the chain. Ours results offer a simple tool for stabilizing bubbles and loops using force manipulations at different temperatures, and may implicate on the mechanism in which DNA enzymes or motors open regions of the chain.

  5. Analysis and Simulation of the Simplified Aircraft-Based Paired Approach Concept With the ALAS Alerting Algorithm in Conjunction With Echelon and Offset Strategies

    NASA Technical Reports Server (NTRS)

    Torres-Pomales, Wilfredo; Madden, Michael M.; Butler, Rickey W.; Perry, Raleigh B.

    2014-01-01

    This report presents analytical and simulation results of an investigation into proposed operational concepts for closely spaced parallel runways, including the Simplified Aircraft-based Paired Approach (SAPA) with alerting and an escape maneuver, MITRE?s echelon spacing and no escape maneuver, and a hybrid concept aimed at lowering the visibility minima. We found that the SAPA procedure can be used at 950 ft separations or higher with next-generation avionics and that 1150 ft separations or higher is feasible with current-rule compliant ADS-B OUT. An additional 50 ft reduction in runway separation for the SAPA procedure is possible if different glideslopes are used. For the echelon concept we determined that current generation aircraft cannot conduct paired approaches on parallel paths using echelon spacing on runways less than 1400 ft apart and next-generation aircraft will not be able to conduct paired approach on runways less than 1050 ft apart. The hybrid concept added alerting and an escape maneuver starting 1 NM from the threshold when flying the echelon concept. This combination was found to be effective, but the probability of a collision can be seriously impacted if the turn component of the escape maneuver has to be disengaged near the ground (e.g. 300 ft or below) due to airport buildings and surrounding terrain. We also found that stabilizing the approach path in the straight-in segment was only possible if the merge point was at least 1.5 to 2 NM from the threshold unless the total system error can be sufficiently constrained on the offset path and final turn.

  6. Dual-energy contrast-enhanced digital mammography (DE-CEDM): optimization on digital subtraction with practical x-ray low/high-energy spectra

    NASA Astrophysics Data System (ADS)

    Chen, Biao; Jing, Zhenxue; Smith, Andrew P.; Parikh, Samir; Parisky, Yuri

    2006-03-01

    Dual-energy contrast enhanced digital mammography (DE-CEDM), which is based upon the digital subtraction of low/high-energy image pairs acquired before/after the administration of contrast agents, may provide physicians physiologic and morphologic information of breast lesions and help characterize their probability of malignancy. This paper proposes to use only one pair of post-contrast low / high-energy images to obtain digitally subtracted dual-energy contrast-enhanced images with an optimal weighting factor deduced from simulated characteristics of the imaging chain. Based upon our previous CEDM framework, quantitative characteristics of the materials and imaging components in the x-ray imaging chain, including x-ray tube (tungsten) spectrum, filters, breast tissues / lesions, contrast agents (non-ionized iodine solution), and selenium detector, were systemically modeled. Using the base-material (polyethylene-PMMA) decomposition method based on entrance low / high-energy x-ray spectra and breast thickness, the optimal weighting factor was calculated to cancel the contrast between fatty and glandular tissues while enhancing the contrast of iodized lesions. By contrast, previous work determined the optimal weighting factor through either a calibration step or through acquisition of a pre-contrast low/high-energy image pair. Computer simulations were conducted to determine weighting factors, lesions' contrast signal values, and dose levels as functions of x-ray techniques and breast thicknesses. Phantom and clinical feasibility studies were performed on a modified Selenia full field digital mammography system to verify the proposed method and computer-simulated results. The resultant conclusions from the computer simulations and phantom/clinical feasibility studies will be used in the upcoming clinical study.

  7. SU-C-BRB-05: Determining the Adequacy of Auto-Contouring Via Probabilistic Assessment of Ensuing Treatment Plan Metrics in Comparison with Manual Contours

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nourzadeh, H; Watkins, W; Siebers, J

    Purpose: To determine if auto-contour and manual-contour—based plans differ when evaluated with respect to probabilistic coverage metrics and biological model endpoints for prostate IMRT. Methods: Manual and auto-contours were created for 149 CT image sets acquired from 16 unique prostate patients. A single physician manually contoured all images. Auto-contouring was completed utilizing Pinnacle’s Smart Probabilistic Image Contouring Engine (SPICE). For each CT, three different 78 Gy/39 fraction 7-beam IMRT plans are created; PD with drawn ROIs, PAS with auto-contoured ROIs, and PM with auto-contoured OARs with the manually drawn target. For each plan, 1000 virtual treatment simulations with different sampledmore » systematic errors for each simulation and a different sampled random error for each fraction were performed using our in-house GPU-accelerated robustness analyzer tool which reports the statistical probability of achieving dose-volume metrics, NTCP, TCP, and the probability of achieving the optimization criteria for both auto-contoured (AS) and manually drawn (D) ROIs. Metrics are reported for all possible cross-evaluation pairs of ROI types (AS,D) and planning scenarios (PD,PAS,PM). Bhattacharyya coefficient (BC) is calculated to measure the PDF similarities for the dose-volume metric, NTCP, TCP, and objectives with respect to the manually drawn contour evaluated on base plan (D-PD). Results: We observe high BC values (BC≥0.94) for all OAR objectives. BC values of max dose objective on CTV also signify high resemblance (BC≥0.93) between the distributions. On the other hand, BC values for CTV’s D95 and Dmin objectives are small for AS-PM, AS-PD. NTCP distributions are similar across all evaluation pairs, while TCP distributions of AS-PM, AS-PD sustain variations up to %6 compared to other evaluated pairs. Conclusion: No significant probabilistic differences are observed in the metrics when auto-contoured OARs are used. The prostate auto-contour needs improvement to achieve clinically equivalent plans.« less

  8. The effects of mothers’ musical background on sedentary behavior, physical activity, and exercise adherence in their 5-6-years-old children using movement-to-music video program

    PubMed Central

    Raitanen, Jani; Husu, Pauliina; Kujala, Urho M.; Luoto, Riitta M.

    2018-01-01

    Objectives The purpose of this study was to examine whether mothers’ musical background has an effect on their own and their children’s sedentary behavior (SB) and physical activity (PA). The aim was also to assess children’s and their mothers’ exercise adherence when using movement-to-music video program. Design Sub-group analysis of an intervention group in a randomized controlled trial (ISRCTN33885819). Method Seventy-one mother-child-pairs were divided into two categories based on mothers’ musical background. Each pair performed 8 weeks exercise intervention using movement-to-music video program. SB and PA were assessed objectively by accelerometer, and exercise activity, fidelity, and enjoyment were assessed via exercise diaries and questionnaires. Logistic regression model was used to analyze associations in the main outcomes between the groups. Results Those children whose mothers had musical background (MB) had greater probability to increase their light PA during the intervention, but not moderate-to-vigorous PA compared to those children whose mothers did not have musical background (NMB). SB increased in both groups. Mothers in the NMB group had greater probability to increase their light and moderate-to-vigorous PA and decrease their SB than mothers in the MB group. However, exercise adherence decreased considerably in all groups. Completeness, fidelity, and enjoyment were higher among the NMB group compared to the MB group. Conclusions The present results showed that mothers without musical background were more interested in movement-to-music exercises, as well as their children. For further studies it would be important to evaluate an effect of children’s own music-based activities on their SB and PA. PMID:29668726

  9. Fitness consequences of nest desertion in an endangered host, the least Bell's vireo

    USGS Publications Warehouse

    Kus, Barbara E.

    2002-01-01

    Recent analyses of the impact of cowbird parasitism on host productivity suggest that while parasitism reduces productivity on a per-nest basis, the ability of pairs to desert parasitized nests and renest allows them to achieve productivity comparable to that of unparasitized pairs. This has implications for the management of several endangered species that are highly vulnerable to parasitism and consequently the target of cowbird control programs. I calculated seasonal nesting effort (number of nests per pair) and productivity of 568 pairs of Least Bell's Vireos (Vireo bellii pusillus) monitored over 11 years at the San Luis Rey River in San Diego County, California (where cowbird trapping has reduced, but not eliminated, parasitism), assigning pairs to one of three groups: (1) deserters, (2) rescued (parasitized pairs with nests “rescued” from probable failure by the removal of cowbird eggs), and (3) unparasitized. Parasitized pairs attempted significantly more nests per season than did unparasitized pairs, with deserters producing more nests than rescued pairs. However, productivity of deserting pairs was significantly lower than that of both rescued and unparasitized pairs, largely because subsequent nests of deserting pairs were also parasitized. Seasonal productivity of rescued and unparasitized pairs was comparable, indicating that in this species, reduction of cowbird impacts through nest manipulation to remove cowbird eggs is effective. Desertion by Least Bell's Vireos does not appear to be an adequate natural defense against parasitism, suggesting the need for continued cowbird control while vireo populations are re-established.

  10. Physical constraints of cultural evolution of dialects in killer whales.

    PubMed

    Filatova, Olga A; Samarra, Filipa I P; Barrett-Lennard, Lance G; Miller, Patrick J O; Ford, John K B; Yurk, Harald; Matkin, Craig O; Hoyt, Erich

    2016-11-01

    Odontocete sounds are produced by two pairs of phonic lips situated in soft nares below the blowhole; the right pair is larger and is more likely to produce clicks, while the left pair is more likely to produce whistles. This has important implications for the cultural evolution of delphinid sounds: the greater the physical constraints, the greater the probability of random convergence. In this paper the authors examine the call structure of eight killer whale populations to identify structural constraints and to determine if they are consistent among all populations. Constraints were especially pronounced in two-voiced calls. In the calls of all eight populations, the lower component of two-voiced (biphonic) calls was typically centered below 4 kHz, while the upper component was typically above that value. The lower component of two-voiced calls had a narrower frequency range than single-voiced calls in all populations. This may be because some single-voiced calls are homologous to the lower component, while others are homologous to the higher component of two-voiced calls. Physical constraints on the call structure reduce the possible variation and increase the probability of random convergence, producing similar calls in different populations.

  11. Genetic Variation among Major Human Geographic Groups Supports a Peculiar Evolutionary Trend in PAX9

    PubMed Central

    Paixão-Côrtes, Vanessa R.; Meyer, Diogo; Pereira, Tiago V.; Mazières, Stéphane; Elion, Jacques; Krishnamoorthy, Rajagopal; Zago, Marco A.; Silva, Wilson A.; Salzano, Francisco M.; Bortolini, Maria Cátira

    2011-01-01

    A total of 172 persons from nine South Amerindian, three African and one Eskimo populations were studied in relation to the Paired box gene 9 (PAX9) exon 3 (138 base pairs) as well as its 5′and 3′flanking intronic segments (232 bp and 220 bp, respectively) and integrated with the information available for the same genetic region from individuals of different geographical origins. Nine mutations were scored in exon 3 and six in its flanking regions; four of them are new South American tribe-specific singletons. Exon3 nucleotide diversity is several orders of magnitude higher than its intronic regions. Additionally, a set of variants in the PAX9 and 101 other genes related with dentition can define at least some dental morphological differences between Sub-Saharan Africans and non-Africans, probably associated with adaptations after the modern human exodus from Africa. Exon 3 of PAX9 could be a good molecular example of how evolvability works. PMID:21298044

  12. Modeling of site occupancy dynamics for northern spotted owls, with emphasis on the effects of barred owls

    USGS Publications Warehouse

    Olson, Gail S.; Anthony, Robert G.; Forsman, Eric D.; Ackers, Steven H.; Loschl, Peter J.; Reid, Janice A.; Dugger, Katie M.; Glenn, Elizabeth M.; Ripple, William J.

    2005-01-01

    Northern spotted owls (Strix occidentalis caurina) have been studied intensively since their listing as a threatened species by the U.S. Fish and Wildlife Service in 1990. Studies of spotted owl site occupancy have used various binary response measures, but most of these studies have made the assumption that detectability is perfect, or at least high and not variable. Further, previous studies did not consider temporal variation in site occupancy. We used relatively new methods for open population modeling of site occupancy that incorporated imperfect and variable detectability of spotted owls and allowed modeling of temporal variation in site occupancy, extinction, and colonization probabilities. We also examined the effects of barred owl (S. varia) presence on these parameters. We used spotted owl survey data from 1990 to 2002 for 3 study areas in Oregon, USA, and we used program MARK to develop and analyze site occupancy models. We found per visit detection probabilities averaged <0.70 and were highly variable among study years and study areas. Site occupancy probabilities for owl pairs declined greatly on 1 study area and slightly on the other 2 areas. For all owls, including singles and pairs, site occupancy was mostly stable through time. Barred owl presence had a negative effect on spotted owl detection probabilities, and it had either a positive effect on local-extinction probabilities or a negative effect on colonization probabilities. We conclude that further analyses of spotted owls must account for imperfect and variable detectability and barred owl presence to properly interpret results. Further, because barred owl presence is increasing within the range of northern spotted owls, we expect to see further declines in the proportion of sites occupied by spotted owls.

  13. The Origin of Complex Quantum Amplitudes

    NASA Astrophysics Data System (ADS)

    Goyal, Philip; Knuth, Kevin H.; Skilling, John

    2009-12-01

    Physics is real. Measurement produces real numbers. Yet quantum mechanics uses complex arithmetic, in which √-1 is necessary but mysteriously relates to nothing else. By applying the same sort of symmetry arguments that Cox [1, 2] used to justify probability calculus, we are now able to explain this puzzle. The dual device/object nature of observation requires us to describe the world in terms of pairs of real numbers about which we never have full knowledge. These pairs combine according to complex arithmetic, using Feynman's rules.

  14. Clinician gestalt estimate of pretest probability for acute coronary syndrome and pulmonary embolism in patients with chest pain and dyspnea.

    PubMed

    Kline, Jeffrey A; Stubblefield, William B

    2014-03-01

    Pretest probability helps guide diagnostic testing for patients with suspected acute coronary syndrome and pulmonary embolism. Pretest probability derived from the clinician's unstructured gestalt estimate is easier and more readily available than methods that require computation. We compare the diagnostic accuracy of physician gestalt estimate for the pretest probability of acute coronary syndrome and pulmonary embolism with a validated, computerized method. This was a secondary analysis of a prospectively collected, multicenter study. Patients (N=840) had chest pain, dyspnea, nondiagnostic ECGs, and no obvious diagnosis. Clinician gestalt pretest probability for both acute coronary syndrome and pulmonary embolism was assessed by visual analog scale and from the method of attribute matching using a Web-based computer program. Patients were followed for outcomes at 90 days. Clinicians had significantly higher estimates than attribute matching for both acute coronary syndrome (17% versus 4%; P<.001, paired t test) and pulmonary embolism (12% versus 6%; P<.001). The 2 methods had poor correlation for both acute coronary syndrome (r(2)=0.15) and pulmonary embolism (r(2)=0.06). Areas under the receiver operating characteristic curve were lower for clinician estimate compared with the computerized method for acute coronary syndrome: 0.64 (95% confidence interval [CI] 0.51 to 0.77) for clinician gestalt versus 0.78 (95% CI 0.71 to 0.85) for attribute matching. For pulmonary embolism, these values were 0.81 (95% CI 0.79 to 0.92) for clinician gestalt and 0.84 (95% CI 0.76 to 0.93) for attribute matching. Compared with a validated machine-based method, clinicians consistently overestimated pretest probability but on receiver operating curve analysis were as accurate for pulmonary embolism but not acute coronary syndrome. Copyright © 2013 American College of Emergency Physicians. Published by Mosby, Inc. All rights reserved.

  15. Probability of detection of nests and implications for survey design

    USGS Publications Warehouse

    Smith, P.A.; Bart, J.; Lanctot, Richard B.; McCaffery, B.J.; Brown, S.

    2009-01-01

    Surveys based on double sampling include a correction for the probability of detection by assuming complete enumeration of birds in an intensively surveyed subsample of plots. To evaluate this assumption, we calculated the probability of detecting active shorebird nests by using information from observers who searched the same plots independently. Our results demonstrate that this probability varies substantially by species and stage of the nesting cycle but less by site or density of nests. Among the species we studied, the estimated single-visit probability of nest detection during the incubation period varied from 0.21 for the White-rumped Sandpiper (Calidris fuscicollis), the most difficult species to detect, to 0.64 for the Western Sandpiper (Calidris mauri), the most easily detected species, with a mean across species of 0.46. We used these detection probabilities to predict the fraction of persistent nests found over repeated nest searches. For a species with the mean value for detectability, the detection rate exceeded 0.85 after four visits. This level of nest detection was exceeded in only three visits for the Western Sandpiper, but six to nine visits were required for the White-rumped Sandpiper, depending on the type of survey employed. Our results suggest that the double-sampling method's requirement of nearly complete counts of birds in the intensively surveyed plots is likely to be met for birds with nests that survive over several visits of nest searching. Individuals with nests that fail quickly or individuals that do not breed can be detected with high probability only if territorial behavior is used to identify likely nesting pairs. ?? The Cooper Ornithological Society, 2009.

  16. Modelling human mobility patterns using photographic data shared online.

    PubMed

    Barchiesi, Daniele; Preis, Tobias; Bishop, Steven; Moat, Helen Susannah

    2015-08-01

    Humans are inherently mobile creatures. The way we move around our environment has consequences for a wide range of problems, including the design of efficient transportation systems and the planning of urban areas. Here, we gather data about the position in space and time of about 16 000 individuals who uploaded geo-tagged images from locations within the UK to the Flickr photo-sharing website. Inspired by the theory of Lévy flights, which has previously been used to describe the statistical properties of human mobility, we design a machine learning algorithm to infer the probability of finding people in geographical locations and the probability of movement between pairs of locations. Our findings are in general agreement with official figures in the UK and on travel flows between pairs of major cities, suggesting that online data sources may be used to quantify and model large-scale human mobility patterns.

  17. Modelling human mobility patterns using photographic data shared online

    PubMed Central

    Barchiesi, Daniele; Preis, Tobias; Bishop, Steven; Moat, Helen Susannah

    2015-01-01

    Humans are inherently mobile creatures. The way we move around our environment has consequences for a wide range of problems, including the design of efficient transportation systems and the planning of urban areas. Here, we gather data about the position in space and time of about 16 000 individuals who uploaded geo-tagged images from locations within the UK to the Flickr photo-sharing website. Inspired by the theory of Lévy flights, which has previously been used to describe the statistical properties of human mobility, we design a machine learning algorithm to infer the probability of finding people in geographical locations and the probability of movement between pairs of locations. Our findings are in general agreement with official figures in the UK and on travel flows between pairs of major cities, suggesting that online data sources may be used to quantify and model large-scale human mobility patterns. PMID:26361545

  18. Upper bounds on the error probabilities and asymptotic error exponents in quantum multiple state discrimination

    NASA Astrophysics Data System (ADS)

    Audenaert, Koenraad M. R.; Mosonyi, Milán

    2014-10-01

    We consider the multiple hypothesis testing problem for symmetric quantum state discrimination between r given states σ1, …, σr. By splitting up the overall test into multiple binary tests in various ways we obtain a number of upper bounds on the optimal error probability in terms of the binary error probabilities. These upper bounds allow us to deduce various bounds on the asymptotic error rate, for which it has been hypothesized that it is given by the multi-hypothesis quantum Chernoff bound (or Chernoff divergence) C(σ1, …, σr), as recently introduced by Nussbaum and Szkoła in analogy with Salikhov's classical multi-hypothesis Chernoff bound. This quantity is defined as the minimum of the pairwise binary Chernoff divergences min _{j

  19. Individualized Levels System and Systematic Stimulus Pairing to Reduce Multiply Controlled Aggression of a Child With Autism Spectrum Disorder.

    PubMed

    Randall, Kayla R; Lambert, Joseph M; Matthews, Mary P; Houchins-Juarez, Nealetta J

    2018-05-01

    Research has shown that physical aggression is common in individuals with autism spectrum disorder (ASD). Interventions for multiply controlled aggression may be complex and difficult to implement with fidelity. As a result, the probability of treatment efficacy for this class of behavior may suffer. We designed an individualized levels system to reduce the physical aggression of an 11-year-old female with ASD. We then employed a systematic stimulus pairing procedure to facilitate generalization. Results suggest individualized levels systems can suppress multiply controlled aggression and that systematic stimulus pairing is an effective way to transfer treatment effects from trained therapists to caregivers.

  20. Effect of the SOS response on the mean fitness of unicellular populations: a quasispecies approach.

    PubMed

    Kama, Amit; Tannenbaum, Emmanuel

    2010-11-30

    The goal of this paper is to develop a mathematical model that analyzes the selective advantage of the SOS response in unicellular organisms. To this end, this paper develops a quasispecies model that incorporates the SOS response. We consider a unicellular, asexually replicating population of organisms, whose genomes consist of a single, double-stranded DNA molecule, i.e. one chromosome. We assume that repair of post-replication mismatched base-pairs occurs with probability , and that the SOS response is triggered when the total number of mismatched base-pairs is at least . We further assume that the per-mismatch SOS elimination rate is characterized by a first-order rate constant . For a single fitness peak landscape where the master genome can sustain up to mismatches and remain viable, this model is analytically solvable in the limit of infinite sequence length. The results, which are confirmed by stochastic simulations, indicate that the SOS response does indeed confer a fitness advantage to a population, provided that it is only activated when DNA damage is so extensive that a cell will die if it does not attempt to repair its DNA.

  1. Probabilistic model for quick detection of dissimilar binary images

    NASA Astrophysics Data System (ADS)

    Mustafa, Adnan A. Y.

    2015-09-01

    We present a quick method to detect dissimilar binary images. The method is based on a "probabilistic matching model" for image matching. The matching model is used to predict the probability of occurrence of distinct-dissimilar image pairs (completely different images) when matching one image to another. Based on this model, distinct-dissimilar images can be detected by matching only a few points between two images with high confidence, namely 11 points for a 99.9% successful detection rate. For image pairs that are dissimilar but not distinct-dissimilar, more points need to be mapped. The number of points required to attain a certain successful detection rate or confidence depends on the amount of similarity between the compared images. As this similarity increases, more points are required. For example, images that differ by 1% can be detected by mapping fewer than 70 points on average. More importantly, the model is image size invariant; so, images of any sizes will produce high confidence levels with a limited number of matched points. As a result, this method does not suffer from the image size handicap that impedes current methods. We report on extensive tests conducted on real images of different sizes.

  2. Probabilistic forecasting of extreme weather events based on extreme value theory

    NASA Astrophysics Data System (ADS)

    Van De Vyver, Hans; Van Schaeybroeck, Bert

    2016-04-01

    Extreme events in weather and climate such as high wind gusts, heavy precipitation or extreme temperatures are commonly associated with high impacts on both environment and society. Forecasting extreme weather events is difficult, and very high-resolution models are needed to describe explicitly extreme weather phenomena. A prediction system for such events should therefore preferably be probabilistic in nature. Probabilistic forecasts and state estimations are nowadays common in the numerical weather prediction community. In this work, we develop a new probabilistic framework based on extreme value theory that aims to provide early warnings up to several days in advance. We consider the combined events when an observation variable Y (for instance wind speed) exceeds a high threshold y and its corresponding deterministic forecasts X also exceeds a high forecast threshold y. More specifically two problems are addressed:} We consider pairs (X,Y) of extreme events where X represents a deterministic forecast, and Y the observation variable (for instance wind speed). More specifically two problems are addressed: Given a high forecast X=x_0, what is the probability that Y>y? In other words: provide inference on the conditional probability: [ Pr{Y>y|X=x_0}. ] Given a probabilistic model for Problem 1, what is the impact on the verification analysis of extreme events. These problems can be solved with bivariate extremes (Coles, 2001), and the verification analysis in (Ferro, 2007). We apply the Ramos and Ledford (2009) parametric model for bivariate tail estimation of the pair (X,Y). The model accommodates different types of extremal dependence and asymmetry within a parsimonious representation. Results are presented using the ensemble reforecast system of the European Centre of Weather Forecasts (Hagedorn, 2008). Coles, S. (2001) An Introduction to Statistical modelling of Extreme Values. Springer-Verlag.Ferro, C.A.T. (2007) A probability model for verifying deterministic forecasts of extreme events. Wea. Forecasting {22}, 1089-1100.Hagedorn, R. (2008) Using the ECMWF reforecast dataset to calibrate EPS forecasts. ECMWF Newsletter, {117}, 8-13.Ramos, A., Ledford, A. (2009) A new class of models for bivariate joint tails. J.R. Statist. Soc. B {71}, 219-241.

  3. VizieR Online Data Catalog: Proper motions in M 11 (Su+ 1998)

    NASA Astrophysics Data System (ADS)

    Su, C.-G.; Zhao, J.-L.; Tian, K.-P.

    1997-07-01

    Relative proper motions of 872 stars in the open cluster M 11 region are reduced using 10 plate pairs taken over time baselines of 16~70 years with the double astrograph telescope of Shanghai Observatory. The scale is 30"/mm. The plates were measured with the PDS machines in the Purple Mountain Observatory in Nanjing and the Institute of Technology and Communication in Luoyang, China. The average proper motion accuracy is about 1.1mas/yr with 85% of the data better than 1mas/yr. Membership probabilities of 785 stars within 25' centred on M 11 are determined based on their proper motions. The method used is suggested by Su et al. (1995AcApS..15..217S) with some improvements of Zhao & He (1990A&A...237...54Z), in which the space distribution and magnitude dependencies for cluster stars are taken into account. The results are significantly good. The total integrated membership probabilities for all these stars is 547 and the number of stars with probabilities higher than 0.7 is 541. It can be found after the membership determination that there exists mass segregation in M 11. Some comparisons and discussion are also given. (1 data file).

  4. Academic achievement of twins and singletons in early adulthood: Taiwanese cohort study.

    PubMed

    Tsou, Meng-Ting; Tsou, Meng-Wen; Wu, Ming-Ping; Liu, Jin-Tan

    2008-07-21

    To examine the long term effects of low birth weight on academic achievements in twins and singletons and to determine whether the academic achievement of twins in early adulthood is inferior to that of singletons. Cohort study. Taiwanese nationwide register of academic outcome. A cohort of 218 972 singletons and 1687 twins born in Taiwan, 1983-5. College attendance and test scores in the college joint entrance examinations. After adjustment for birth weight, gestational age, birth order, and sex and the sociodemographic characteristics of the parents, twins were found to have significantly lower mean test scores than singletons in Chinese, mathematics, and natural science, as well as a 2.2% lower probability of attending college. Low birthweight twins had an 8.5% lower probability of college attendance than normal weight twins, while low birthweight singletons had only a 3.2% lower probability. The negative effects of low birth weight on the test scores in English and mathematics were substantially greater for twins than for singletons. The twin pair analysis showed that the association between birth weight and academic achievement scores, which existed for opposite sex twin pairs, was not discernible for same sex twin pairs, indicating that birth weight might partly reflect other underlying genetic variations. These data support the proposition that twins perform less well academically than singletons. Low birth weight has a negative association with subsequent academic achievement in early adulthood, with the effect being stronger for twins than for singletons. The association between birth weight and academic performance might be partly attributable to genetic factors.

  5. Nuclear p ⊥-broadening of an energetic parton pair

    NASA Astrophysics Data System (ADS)

    Cougoulic, Florian; Peigné, Stéphane

    2018-05-01

    We revisit the transverse momentum broadening of a fast parton pair crossing a nuclear medium, putting emphasis on the pair global color state, for any number of colors N and within the eikonal limit for parton propagation and the Gaussian approximation for the gluon field of the target. The pair transverse momentum probability distribution is derived in a kinetic equation approach, and is determined by an operator ℬ describing the possible transitions between the pair color states when crossing the medium. The exponential of ℬ encompasses the 4-point correlators of Wilson lines in the saturation formalism. We emphasize the relation of ℬ with the anomalous dimension matrices appearing in the study of soft gluon radiation associated to hard 2 → 2 partonic processes. In a well-chosen, orthonormal basis of the pair color states, we rederive ℬ for any type of parton pair, making maximal use of SU( N) invariants and using `birdtrack' color pictorial notations, providing a quite economical derivation of all previously known 4-point correlators (or equivalently, anomalous dimension matrices for 2 → 2 parton scattering). We discuss some general features of the pair transverse momentum distribution. The latter simplifies in the `compact pair expansion' which singles out the global charges (Casimirs) of the pair color states. This study should provide the necessary tools to address nuclear broadening of n-parton systems in phenomenology while highlighting the color structure of the process.

  6. Informing disease models with temporal and spatial contact structure among GPS-collared individuals in wild populations.

    PubMed

    Williams, David M; Dechen Quinn, Amy C; Porter, William F

    2014-01-01

    Contacts between hosts are essential for transmission of many infectious agents. Understanding how contacts, and thus transmission rates, occur in space and time is critical to effectively responding to disease outbreaks in free-ranging animal populations. Contacts between animals in the wild are often difficult to observe or measure directly. Instead, one must infer contacts from metrics such as proximity in space and time. Our objective was to examine how contacts between white-tailed deer (Odocoileus virginianus) vary in space and among seasons. We used GPS movement data from 71 deer in central New York State to quantify potential direct contacts between deer and indirect overlap in space use across time and space. Daily probabilities of direct contact decreased from winter (0.05-0.14), to low levels post-parturition through summer (0.00-0.02), and increased during the rut to winter levels. The cumulative distribution for the spatial structure of direct and indirect contact probabilities around a hypothetical point of occurrence increased rapidly with distance for deer pairs separated by 1,000 m-7,000 m. Ninety-five percent of the probabilities of direct contact occurred among deer pairs within 8,500 m of one another, and 99% within 10,900 m. Probabilities of indirect contact accumulated across greater spatial extents: 95% at 11,900 m and 99% at 49,000 m. Contacts were spatially consistent across seasons, indicating that although contact rates differ seasonally, they occur proportionally across similar landscape extents. Distributions of contact probabilities across space can inform management decisions for assessing risk and allocating resources in response.

  7. Bilocal current densities and mean trajectories in a Young interferometer with two Gaussian slits and two detectors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Withers, L. P., E-mail: lpwithers@mitre.org; Narducci, F. A., E-mail: francesco.narducci@navy.mil

    2015-06-15

    The recent single-photon double-slit experiment of Steinberg et al., based on a weak measurement method proposed by Wiseman, showed that, by encoding the photon’s transverse momentum behind the slits into its polarization state, the momentum profile can subsequently be measured on average, from a difference of the separated fringe intensities for the two circular polarization components. They then integrated the measured average velocity field, to obtain the average trajectories of the photons enroute to the detector array. In this paper, we propose a modification of their experiment, to demonstrate that the average particle velocities and trajectories change when the modemore » of detection changes. The proposed experiment replaces a single detector by a pair of detectors with a given spacing between them. The pair of detectors is configured so that it is impossible to distinguish which detector received the particle. The pair of detectors is then analogous to the simple pair of slits, in that it is impossible to distinguish which slit the particle passed through. To establish the paradoxical outcome of the modified experiment, the theory and explicit three-dimensional formulas are developed for the bilocal probability and current densities, and for the average velocity field and trajectories as the particle wavefunction propagates in the volume of space behind the Gaussian slits. Examples of these predicted results are plotted. Implementation details of the proposed experiment are discussed.« less

  8. An entangled-light-emitting diode.

    PubMed

    Salter, C L; Stevenson, R M; Farrer, I; Nicoll, C A; Ritchie, D A; Shields, A J

    2010-06-03

    An optical quantum computer, powerful enough to solve problems so far intractable using conventional digital logic, requires a large number of entangled photons. At present, entangled-light sources are optically driven with lasers, which are impractical for quantum computing owing to the bulk and complexity of the optics required for large-scale applications. Parametric down-conversion is the most widely used source of entangled light, and has been used to implement non-destructive quantum logic gates. However, these sources are Poissonian and probabilistically emit zero or multiple entangled photon pairs in most cycles, fundamentally limiting the success probability of quantum computational operations. These complications can be overcome by using an electrically driven on-demand source of entangled photon pairs, but so far such a source has not been produced. Here we report the realization of an electrically driven source of entangled photon pairs, consisting of a quantum dot embedded in a semiconductor light-emitting diode (LED) structure. We show that the device emits entangled photon pairs under d.c. and a.c. injection, the latter achieving an entanglement fidelity of up to 0.82. Entangled light with such high fidelity is sufficient for application in quantum relays, in core components of quantum computing such as teleportation, and in entanglement swapping. The a.c. operation of the entangled-light-emitting diode (ELED) indicates its potential function as an on-demand source without the need for a complicated laser driving system; consequently, the ELED is at present the best source on which to base future scalable quantum information applications.

  9. High-resolution HLA haplotype frequencies of stem cell donors in Germany with foreign parentage: how can they be used to improve unrelated donor searches?

    PubMed

    Pingel, Julia; Solloch, Ute V; Hofmann, Jan A; Lange, Vinzenz; Ehninger, Gerhard; Schmidt, Alexander H

    2013-03-01

    In hematopoietic stem cell transplantation, human leukocyte antigens (HLA), usually HLA loci A, B, C, DRB1 and DQB1, are required to check histocompatibility between a potential donor and the recipient suffering from a malignant or non-malignant blood disease. As databases of potential unrelated donors are very heterogeneous with respect to typing resolution and number of typed loci, donor registries make use of haplotype frequency-based algorithms to provide matching probabilities for each potentially matching recipient/donor pair. However, it is well known that HLA allele and haplotype frequencies differ significantly between populations. We estimated high-resolution HLA-A, -B, -C, -DRB1 haplotype and allele frequencies of donors within DKMS German Bone Marrow Donor Center with parentage from 17 different countries: Turkey, Poland, Italy, Russian Federation, Croatia, Greece, Austria, Kazakhstan, France, The Netherlands, Republic of China, Romania, Portugal, USA, Spain, United Kingdom and Bosnia and Herzegovina. 5-locus haplotypes including HLA-DQB1 are presented for Turkey, Poland, Italy and Russian Federation. We calculated linkage disequilibria for each sample. Genetic distances between included countries could be shown to reflect geography. We further demonstrate how genetic differences between populations are reflected in matching probabilities of recipient/donor pairs and how they influence the search for unrelated donors as well as strategic donor center typings. Copyright © 2012 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  10. Survival Estimates for the Passage of Juvenile Chinook Salmon through Snake River Dams and Reservoirs, 1993 Annual Report.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Iwamoto, Robert N.; Sandford, Benjamin P.; McIntyre, Kenneth W.

    1994-04-01

    A pilot study was conducted to estimate survival of hatchery-reared yearling chinook salmon through dams and reservoirs on the Snake River. The goals of the study were to: (1) field test and evaluate the Single-Release, Modified-Single-Release, and Paired-Release Models for the estimation of survival probabilities through sections of a river and hydroelectric projects; (2) identify operational and logistical constraints to the execution of these models; and (3) determine the usefulness of the models in providing estimates of survival probabilities. Field testing indicated that the numbers of hatchery-reared yearling chinook salmon needed for accurate survival estimates could be collected at differentmore » areas with available gear and methods. For the primary evaluation, seven replicates of 830 to 1,442 hatchery-reared yearling chinook salmon were purse-seined from Lower Granite Reservoir, PIT tagged, and released near Nisqually John boat landing (River Kilometer 726). Secondary releases of PIT-tagged smolts were made at Lower Granite Dam to estimate survival of fish passing through turbines and after detection in the bypass system. Similar secondary releases were made at Little Goose Dam, but with additional releases through the spillway. Based on the success of the 1993 pilot study, the authors believe that the Single-Release and Paired-Release Models will provide accurate estimates of juvenile salmonid passage survival for individual river sections, reservoirs, and hydroelectric projects in the Columbia and Snake Rivers.« less

  11. Abbreviation definition identification based on automatic precision estimates.

    PubMed

    Sohn, Sunghwan; Comeau, Donald C; Kim, Won; Wilbur, W John

    2008-09-25

    The rapid growth of biomedical literature presents challenges for automatic text processing, and one of the challenges is abbreviation identification. The presence of unrecognized abbreviations in text hinders indexing algorithms and adversely affects information retrieval and extraction. Automatic abbreviation definition identification can help resolve these issues. However, abbreviations and their definitions identified by an automatic process are of uncertain validity. Due to the size of databases such as MEDLINE only a small fraction of abbreviation-definition pairs can be examined manually. An automatic way to estimate the accuracy of abbreviation-definition pairs extracted from text is needed. In this paper we propose an abbreviation definition identification algorithm that employs a variety of strategies to identify the most probable abbreviation definition. In addition our algorithm produces an accuracy estimate, pseudo-precision, for each strategy without using a human-judged gold standard. The pseudo-precisions determine the order in which the algorithm applies the strategies in seeking to identify the definition of an abbreviation. On the Medstract corpus our algorithm produced 97% precision and 85% recall which is higher than previously reported results. We also annotated 1250 randomly selected MEDLINE records as a gold standard. On this set we achieved 96.5% precision and 83.2% recall. This compares favourably with the well known Schwartz and Hearst algorithm. We developed an algorithm for abbreviation identification that uses a variety of strategies to identify the most probable definition for an abbreviation and also produces an estimated accuracy of the result. This process is purely automatic.

  12. Report on Pairing-based Cryptography.

    PubMed

    Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

    2015-01-01

    This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.

  13. Report on Pairing-based Cryptography

    PubMed Central

    Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

    2015-01-01

    This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST’s position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed. PMID:26958435

  14. Distant Supervision with Transductive Learning for Adverse Drug Reaction Identification from Electronic Medical Records

    PubMed Central

    Ikeda, Mitsuru

    2017-01-01

    Information extraction and knowledge discovery regarding adverse drug reaction (ADR) from large-scale clinical texts are very useful and needy processes. Two major difficulties of this task are the lack of domain experts for labeling examples and intractable processing of unstructured clinical texts. Even though most previous works have been conducted on these issues by applying semisupervised learning for the former and a word-based approach for the latter, they face with complexity in an acquisition of initial labeled data and ignorance of structured sequence of natural language. In this study, we propose automatic data labeling by distant supervision where knowledge bases are exploited to assign an entity-level relation label for each drug-event pair in texts, and then, we use patterns for characterizing ADR relation. The multiple-instance learning with expectation-maximization method is employed to estimate model parameters. The method applies transductive learning to iteratively reassign a probability of unknown drug-event pair at the training time. By investigating experiments with 50,998 discharge summaries, we evaluate our method by varying large number of parameters, that is, pattern types, pattern-weighting models, and initial and iterative weightings of relations for unlabeled data. Based on evaluations, our proposed method outperforms the word-based feature for NB-EM (iEM), MILR, and TSVM with F1 score of 11.3%, 9.3%, and 6.5% improvement, respectively. PMID:29090077

  15. Pairing preferences of the model mono-valence mono-atomic ions investigated by molecular simulation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Qiang; Department of Chemistry, Bohai University, Jinzhou 121000; Zhang, Ruiting

    2014-05-14

    We carried out a series of potential of mean force calculations to study the pairing preferences of a series of model mono-atomic 1:1 ions with evenly varied sizes. The probabilities of forming the contact ion pair (CIP) and the single water separate ion pair (SIP) were presented in the two-dimensional plots with respect to the ion sizes. The pairing preferences reflected in these plots largely agree with the empirical rule of matching ion sizes in the small and big size regions. In the region that the ion sizes are close to the size of the water molecule; however, a significantmore » deviation from this conventional rule is observed. Our further analysis indicated that this deviation originates from the competition between CIP and the water bridging SIP state. The competition is mainly an enthalpy modulated phenomenon in which the existing of the water bridging plays a significant role.« less

  16. Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics

    PubMed Central

    Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.

    2015-01-01

    Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

  17. General survey of hAT transposon superfamily with highlight on hobo element in Drosophila.

    PubMed

    Ladevèze, Véronique; Chaminade, Nicole; Lemeunier, Françoise; Periquet, Georges; Aulard, Sylvie

    2012-09-01

    The hAT transposons, very abundant in all kingdoms, have a common evolutionary origin probably predating the plant-fungi-animal divergence. In this paper we present their general characteristics. Members of this superfamily belong to Class II transposable elements. hAT elements share transposase, short terminal inverted repeats and eight base-pairs duplication of genomic target. We focus on hAT elements in Drosophila, especially hobo. Its distribution, dynamics and impact on genome restructuring in laboratory strains as well as in natural populations are reported. Finally, the evolutionary history of hAT elements, their domestication and use as transgenic tools are discussed.

  18. Conditional maximum-entropy method for selecting prior distributions in Bayesian statistics

    NASA Astrophysics Data System (ADS)

    Abe, Sumiyoshi

    2014-11-01

    The conditional maximum-entropy method (abbreviated here as C-MaxEnt) is formulated for selecting prior probability distributions in Bayesian statistics for parameter estimation. This method is inspired by a statistical-mechanical approach to systems governed by dynamics with largely separated time scales and is based on three key concepts: conjugate pairs of variables, dimensionless integration measures with coarse-graining factors and partial maximization of the joint entropy. The method enables one to calculate a prior purely from a likelihood in a simple way. It is shown, in particular, how it not only yields Jeffreys's rules but also reveals new structures hidden behind them.

  19. Recent results on heavy flavor physics from LEP experiments using 1990-92 data

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gasparini, U.

    1994-12-01

    After three years of data taking, the four LEP experiments collected a total of about four million Z{sup 0} hadronic decays, in which a heavy quark pair (either b{bar b} or c{bar c}) is produced with 40% probability. Results are presented both in the sector of the electroweak precision measurements, with particular emphasis on the beauty quark, and in the determination of the beauty decay properties, where lifetimes and branching ratio measurements take advantage of the large statistics now available and of the recent improvements in the analysis based on microvertex detectors and particle identification devices.

  20. Quasi-stationary states and fermion pair creation from a vacuum in supercritical Coulomb field

    NASA Astrophysics Data System (ADS)

    Khalilov, V. R.

    2017-12-01

    Creation of charged fermion pair from a vacuum in so-called supercritical Coulomb potential is examined for the case when fermions can move only in the same (one) plane. In which case, quantum dynamics of charged massive or massless fermions can be described by the two-dimensional Dirac Hamiltonians with an usual (-a/r) Coulomb potential. These Hamiltonians are singular and require the additional definition in order for them to be treated as self-adjoint quantum-mechanical operators. We construct the self-adjoint two-dimensional Dirac Hamiltonians with a Coulomb potential and determine the quantum-mechanical states for such Hamiltonians in the corresponding Hilbert spaces of square-integrable functions. We determine the scattering amplitude in which the self-adjoint extension parameter is incorporated and then obtain equations implicitly defining possible discrete energy spectra of the self-adjoint Dirac Hamiltonians with a Coulomb potential. It is shown that this quantum system becomes unstable in the presence of a supercritical Coulomb potential which manifests in the appearance of quasi-stationary states in the lower (negative) energy continuum. The energy spectrum of those states is quasi-discrete, consists of broadened levels with widths related to the inverse lifetimes of the quasi-stationary states as well as the probability of creation of charged fermion pair by a supercritical Coulomb field. Explicit analytical expressions for the creation probabilities of charged (massive or massless) fermion pair are obtained in a supercritical Coulomb field.

  1. Improving strand pairing prediction through exploring folding cooperativity

    PubMed Central

    Jeong, Jieun; Berman, Piotr; Przytycka, Teresa M.

    2008-01-01

    The topology of β-sheets is defined by the pattern of hydrogen-bonded strand pairing. Therefore, predicting hydrogen bonded strand partners is a fundamental step towards predicting β-sheet topology. At the same time, finding the correct partners is very difficult due to long range interactions involved in strand pairing. Additionally, patterns of aminoacids observed in β-sheet formations are very general and therefore difficult to use for computational recognition of specific contacts between strands. In this work, we report a new strand pairing algorithm. To address above mentioned difficulties, our algorithm attempts to mimic elements of the folding process. Namely, in addition to ensuring that the predicted hydrogen bonded strand pairs satisfy basic global consistency constraints, it takes into account hypothetical folding pathways. Consistently with this view, introducing hydrogen bonds between a pair of strands changes the probabilities of forming hydrogen bonds between other pairs of strand. We demonstrate that this approach provides an improvement over previously proposed algorithms. We also compare the performance of this method to that of a global optimization algorithm that poses the problem as integer linear programming optimization problem and solves it using ILOG CPLEX™ package. PMID:18989036

  2. On the accuracy and reproducibility of a novel probabilistic atlas-based generation for calculation of head attenuation maps on integrated PET/MR scanners.

    PubMed

    Chen, Kevin T; Izquierdo-Garcia, David; Poynton, Clare B; Chonde, Daniel B; Catana, Ciprian

    2017-03-01

    To propose an MR-based method for generating continuous-valued head attenuation maps and to assess its accuracy and reproducibility. Demonstrating that novel MR-based photon attenuation correction methods are both accurate and reproducible is essential prior to using them routinely in research and clinical studies on integrated PET/MR scanners. Continuous-valued linear attenuation coefficient maps ("μ-maps") were generated by combining atlases that provided the prior probability of voxel positions belonging to a certain tissue class (air, soft tissue, or bone) and an MR intensity-based likelihood classifier to produce posterior probability maps of tissue classes. These probabilities were used as weights to generate the μ-maps. The accuracy of this probabilistic atlas-based continuous-valued μ-map ("PAC-map") generation method was assessed by calculating the voxel-wise absolute relative change (RC) between the MR-based and scaled CT-based attenuation-corrected PET images. To assess reproducibility, we performed pair-wise comparisons of the RC values obtained from the PET images reconstructed using the μ-maps generated from the data acquired at three time points. The proposed method produced continuous-valued μ-maps that qualitatively reflected the variable anatomy in patients with brain tumor and agreed well with the scaled CT-based μ-maps. The absolute RC comparing the resulting PET volumes was 1.76 ± 2.33 %, quantitatively demonstrating that the method is accurate. Additionally, we also showed that the method is highly reproducible, the mean RC value for the PET images reconstructed using the μ-maps obtained at the three visits being 0.65 ± 0.95 %. Accurate and highly reproducible continuous-valued head μ-maps can be generated from MR data using a probabilistic atlas-based approach.

  3. Social pairing of Seychelles warblers under reduced constraints: MHC, neutral heterozygosity, and age.

    PubMed

    Wright, David J; Brouwer, Lyanne; Mannarelli, Maria-Elena; Burke, Terry; Komdeur, Jan; Richardson, David S

    2016-01-01

    The prevalence and significance of precopulatory mate choice remains keenly debated. The major histocompatibility complex (MHC) plays a key role in vertebrate adaptive immunity, and variation at the MHC influences individual survival. Although MHC-dependent mate choice has been documented in certain species, many other studies find no such pattern. This may be, at least in part, because in natural systems constraints may reduce the choices available to individuals and prevent full expression of underlying preferences. We used translocations to previously unoccupied islands to experimentally reduce constraints on female social mate choice in the Seychelles warbler ( Acrocephalus sechellensis ), a species in which patterns of MHC-dependent extrapair paternity (EPP), but not social mate choice, have been observed. We find no evidence of MHC-dependent social mate choice in the new populations. Instead, we find that older males and males with more microsatellite heterozygosity are more likely to have successfully paired. Our data cannot resolve whether these patterns in pairing were due to male-male competition or female choice. However, our research does suggest that female Seychelles warblers do not choose social mates using MHC class I to increase fitness. It may also indicate that the MHC-dependent EPP observed in the source population is probably due to mechanisms other than female precopulatory mate choice based on MHC cues.

  4. Score distributions of gapped multiple sequence alignments down to the low-probability tail

    NASA Astrophysics Data System (ADS)

    Fieth, Pascal; Hartmann, Alexander K.

    2016-08-01

    Assessing the significance of alignment scores of optimally aligned DNA or amino acid sequences can be achieved via the knowledge of the score distribution of random sequences. But this requires obtaining the distribution in the biologically relevant high-scoring region, where the probabilities are exponentially small. For gapless local alignments of infinitely long sequences this distribution is known analytically to follow a Gumbel distribution. Distributions for gapped local alignments and global alignments of finite lengths can only be obtained numerically. To obtain result for the small-probability region, specific statistical mechanics-based rare-event algorithms can be applied. In previous studies, this was achieved for pairwise alignments. They showed that, contrary to results from previous simple sampling studies, strong deviations from the Gumbel distribution occur in case of finite sequence lengths. Here we extend the studies to multiple sequence alignments with gaps, which are much more relevant for practical applications in molecular biology. We study the distributions of scores over a large range of the support, reaching probabilities as small as 10-160, for global and local (sum-of-pair scores) multiple alignments. We find that even after suitable rescaling, eliminating the sequence-length dependence, the distributions for multiple alignment differ from the pairwise alignment case. Furthermore, we also show that the previously discussed Gaussian correction to the Gumbel distribution needs to be refined, also for the case of pairwise alignments.

  5. Winter movement dynamics of Black Brant

    USGS Publications Warehouse

    Lindberg, Mark S.; Ward, David H.; Tibbitts, T. Lee; Roser, John

    2007-01-01

    Although North American geese are managed based on their breeding distributions, the dynamics of those breeding populations may be affected by events that occur during the winter. Birth rates of capital breeding geese may be influenced by wintering conditions, mortality may be influenced by timing of migration and wintering distribution, and immigration and emigration among breeding populations may depend on winter movement and timing of pair formation. We examined factors affecting movements of black brant (Branta bernicla nigricans) among their primary wintering sites in Mexico and southern California, USA, (Mar 1998-Mar 2000) using capture-recapture models. Although brant exhibited high probability (>0.85) of monthly and annual fidelity to the wintering sites we sampled, we observed movements among all wintering sites. Movement probabilities both within and among winters were negatively related to distance between sites. We observed a higher probability both of southward movement between winters (Mar to Dec) and northward movement between months within winters. Between-winter movements were probably most strongly affected by spatial and temporal variation in habitat quality as we saw movement patterns consistent with contrasting environmental conditions (e.g., La Niña and El Niño southern oscillation cycles). Month-to-month movements were related to migration patterns and may also have been affected by differences in habitat conditions among sites. Patterns of winter movements indicate that a network of wintering sites may be necessary for effective conservation of brant.

  6. Winter movement dynamics of black brant

    USGS Publications Warehouse

    Lindberg, Mark S.; Ward, David H.; Tibbitts, T. Lee; Roser, John

    2007-01-01

    Although North American geese are managed based on their breeding distributions, the dynamics of those breeding populations may be affected by events that occur during the winter. Birth rates of capital breeding geese may be influenced by wintering conditions, mortality may be influenced by timing of migration and wintering distribution, and immigration and emigration among breeding populations may depend on winter movement and timing of pair formation. We examined factors affecting movements of black brant (Branta bernicla nigricans) among their primary wintering sites in Mexico and southern California, USA, (Mar 1998–Mar 2000) using capture–recapture models. Although brant exhibited high probability (>0.85) of monthly and annual fidelity to the wintering sites we sampled, we observed movements among all wintering sites. Movement probabilities both within and among winters were negatively related to distance between sites. We observed a higher probability both of southward movement between winters (Mar to Dec) and northward movement between months within winters. Between-winter movements were probably most strongly affected by spatial and temporal variation in habitat quality as we saw movement patterns consistent with contrasting environmental conditions (e.g., La Niña and El Niño southern oscillation cycles). Month-to-month movements were related to migration patterns and may also have been affected by differences in habitat conditions among sites. Patterns of winter movements indicate that a network of wintering sites may be necessary for effective conservation of brant.

  7. Adaptive attunement of selective covert attention to evolutionary-relevant emotional visual scenes.

    PubMed

    Fernández-Martín, Andrés; Gutiérrez-García, Aída; Capafons, Juan; Calvo, Manuel G

    2017-05-01

    We investigated selective attention to emotional scenes in peripheral vision, as a function of adaptive relevance of scene affective content for male and female observers. Pairs of emotional-neutral images appeared peripherally-with perceptual stimulus differences controlled-while viewers were fixating on a different stimulus in central vision. Early selective orienting was assessed by the probability of directing the first fixation towards either scene, and the time until first fixation. Emotional scenes selectively captured covert attention even when they were task-irrelevant, thus revealing involuntary, automatic processing. Sex of observers and specific emotional scene content (e.g., male-to-female-aggression, families and babies, etc.) interactively modulated covert attention, depending on adaptive priorities and goals for each sex, both for pleasant and unpleasant content. The attentional system exhibits domain-specific and sex-specific biases and attunements, probably rooted in evolutionary pressures to enhance reproductive and protective success. Emotional cues selectively capture covert attention based on their bio-social significance. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. A probability distribution model of tooth pits for evaluating time-varying mesh stiffness of pitting gears

    NASA Astrophysics Data System (ADS)

    Lei, Yaguo; Liu, Zongyao; Wang, Delong; Yang, Xiao; Liu, Huan; Lin, Jing

    2018-06-01

    Tooth damage often causes a reduction in gear mesh stiffness. Thus time-varying mesh stiffness (TVMS) can be treated as an indication of gear health conditions. This study is devoted to investigating the mesh stiffness variations of a pair of external spur gears with tooth pitting, and proposes a new model for describing tooth pitting based on probability distribution. In the model, considering the appearance and development process of tooth pitting, we model the pitting on the surface of spur gear teeth as a series of pits with a uniform distribution in the direction of tooth width and a normal distribution in the direction of tooth height, respectively. In addition, four pitting degrees, from no pitting to severe pitting, are modeled. Finally, influences of tooth pitting on TVMS are analyzed in details and the proposed model is validated by comparing with a finite element model. The comparison results show that the proposed model is effective for the TVMS evaluations of pitting gears.

  9. Collision avoidance in TV white spaces: a cross-layer design approach for cognitive radio networks

    NASA Astrophysics Data System (ADS)

    Foukalas, Fotis; Karetsos, George T.

    2015-07-01

    One of the most promising applications of cognitive radio networks (CRNs) is the efficient exploitation of TV white spaces (TVWSs) for enhancing the performance of wireless networks. In this paper, we propose a cross-layer design (CLD) of carrier sense multiple access with collision avoidance (CSMA/CA) mechanism at the medium access control (MAC) layer with spectrum sensing (SpSe) at the physical layer, for identifying the occupancy status of TV bands. The proposed CLD relies on a Markov chain model with a state pair containing both the SpSe and the CSMA/CA from which we derive the collision probability and the achievable throughput. Analytical and simulation results are obtained for different collision avoidance and SpSe implementation scenarios by varying the contention window, back off stage and probability of detection. The obtained results depict the achievable throughput under different collision avoidance and SpSe implementation scenarios indicating thereby the performance of collision avoidance in TVWSs-based CRNs.

  10. Holes influence the mutation spectrum of human mitochondrial DNA

    NASA Astrophysics Data System (ADS)

    Villagran, Martha; Miller, John

    Mutations drive evolution and disease, showing highly non-random patterns of variant frequency vs. nucleotide position. We use computational DNA hole spectroscopy [M.Y. Suarez-Villagran & J.H. Miller, Sci. Rep. 5, 13571 (2015)] to reveal sites of enhanced hole probability in selected regions of human mitochondrial DNA. A hole is a mobile site of positive charge created when an electron is removed, for example by radiation or contact with a mutagenic agent. The hole spectra are quantum mechanically computed using a two-stranded tight binding model of DNA. We observe significant correlation between spectra of hole probabilities and of genetic variation frequencies from the MITOMAP database. These results suggest that hole-enhanced mutation mechanisms exert a substantial, perhaps dominant, influence on mutation patterns in DNA. One example is where a trapped hole induces a hydrogen bond shift, known as tautomerization, which then triggers a base-pair mismatch during replication. Our results deepen overall understanding of sequence specific mutation rates, encompassing both hotspots and cold spots, which drive molecular evolution.

  11. PACAP Interactions in the Mouse Brain: Implications for Behavioral and Other Disorders

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Acquaah-Mensah, George; Taylor, Ronald C.; Bhave, Sanjiv V.

    2012-01-10

    As an activator of adenylate cyclase, the neuropeptide Pituitary Adenylate Cyclase Activating Peptide (PACAP) impacts levels of cyclic AMP, a key second messenger available in brain cells. PACAP is involved in certain adult behaviors. To elucidate PACAP interactions, a compendium of microarrays representing mRNA expression in the adult mouse whole brain was pooled from the Phenogen database for analysis. A regulatory network was computed based on mutual information between gene pairs using gene expression data across the compendium. Clusters among genes directly linked to PACAP, and probable interactions between corresponding proteins were computed. Database 'experts' affirmed some of the inferredmore » relationships. The findings suggest ADCY7 is probably the adenylate cyclase isoform most relevant to PACAP's action. They also support intervening roles for kinases including GSK3B, PI 3-kinase, SGK3 and AMPK. Other high-confidence interactions are hypothesized for future testing. This new information has implications for certain behavioral and other disorders.« less

  12. Synchrotron cooling and annihilation of an e/+/-e/-/ plasma - The radiation mechanism for the 5 March, 1979 transient

    NASA Technical Reports Server (NTRS)

    Ramaty, R.; Bussard, R. W.; Lingenfelter, R. E.

    1981-01-01

    Positron-electron pair radiation is examined as a mechanism that could be responsible for the impulsive phase emission of the 5 March, 1979 transient. Synchrotron cooling and subsequent annihilation of the pairs can account for the energy spectrum, the very high brightness, and the 0.4 MeV feature observed from this transient, whose source is likely to be a neutron star in the supernova remnant N49 in the Large Magellanic Cloud. In this model, the observed radiation is produced in the skin layer of a hot, radiation-dominated pair atmosphere, probably confined to the vicinity of the neutron star by a strong magnetic field. In this layer, about 10 to the 12th generations of pairs are formed (by photon-photon collisions), cooled and annihilated during the 0.15 s duration of the impulsive phase.

  13. Nucleic acid duplexes incorporating a dissociable covalent base pair

    NASA Technical Reports Server (NTRS)

    Gao, K.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    1999-01-01

    We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure.

  14. Statistical parsimony networks and species assemblages in Cephalotrichid nemerteans (nemertea).

    PubMed

    Chen, Haixia; Strand, Malin; Norenburg, Jon L; Sun, Shichun; Kajihara, Hiroshi; Chernyshev, Alexey V; Maslakova, Svetlana A; Sundberg, Per

    2010-09-21

    It has been suggested that statistical parsimony network analysis could be used to get an indication of species represented in a set of nucleotide data, and the approach has been used to discuss species boundaries in some taxa. Based on 635 base pairs of the mitochondrial protein-coding gene cytochrome c oxidase I (COI), we analyzed 152 nemertean specimens using statistical parsimony network analysis with the connection probability set to 95%. The analysis revealed 15 distinct networks together with seven singletons. Statistical parsimony yielded three networks supporting the species status of Cephalothrix rufifrons, C. major and C. spiralis as they currently have been delineated by morphological characters and geographical location. Many other networks contained haplotypes from nearby geographical locations. Cladistic structure by maximum likelihood analysis overall supported the network analysis, but indicated a false positive result where subnetworks should have been connected into one network/species. This probably is caused by undersampling of the intraspecific haplotype diversity. Statistical parsimony network analysis provides a rapid and useful tool for detecting possible undescribed/cryptic species among cephalotrichid nemerteans based on COI gene. It should be combined with phylogenetic analysis to get indications of false positive results, i.e., subnetworks that would have been connected with more extensive haplotype sampling.

  15. High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

    PubMed

    Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2015-11-02

    Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. A Patient-Centered, Provider-Facilitated Approach to the Refinement of Nonlinear Frequency Compression Parameters Based on Subjective Preference Ratings of Amplified Sound Quality.

    PubMed

    Johnson, Earl E; Light, Keri C

    2015-09-01

    To evaluate sound quality preferences of participants wearing hearing aids with different strengths of nonlinear frequency compression (NFC) processing versus no NFC processing. Two analysis methods, one without and one with a qualifier as to the magnitude of preferences, were compared for their percent agreement to differentiate a small difference in perceived sound quality as a result of applied NFC processing. A single-blind design was used with participants unaware of the presence or strength of NFC processing (independent variable). The National Acoustic Laboratories-Nonlinear 2 (NAL-NL2) prescription of amplification was chosen because audibility is intentionally not prescribed in the presence of larger sensorineural hearing loss thresholds. A lack of prescribed audibility, when present, was deemed an objective qualifier for NFC. NFC is known to improve the input bandwidth available to listeners when high-frequency audibility is not otherwise available and increasing strengths of NFC were examined. Experimental condition 3 (EC3) was stronger than the manufacturer default (EC2). More aggressive strengths (e.g., EC4 and EC5), however, were expected to include excessive distortion and even reduce the output bandwidth that had been prescribed as audible by NAL-NL2 (EC1). A total of 14 male Veterans with severe high-frequency sensorineural hearing loss. Participant sound quality preference ratings (dependent variable) without a qualifier as to the magnitude of preference were analyzed based on binomial probability theory, as is traditional with paired comparison data. The ratings with a qualifier as to the magnitude of preference were analyzed based on the nonparametric statistic of the Wilcoxon signed rank test. The binomial probability analysis method identified a sound quality preference as well as the nonparametric probability test method. As the strength of NFC increased, more participants preferred the EC with less NFC. Fourteen of 14 participants showed equal preference between EC1 and EC2 perhaps, in part, because EC2 showed no objective improvement in audibility for six of the 14 participants (42%). Thirteen of the 14 participants showed no preference between NAL-NL2 and EC3, but all participants had an objective improvement in audibility. With more NFC than EC3, more and more participants preferred the other EC with less NFC in the paired comparison. By referencing the recommended sensation levels of amplitude compression (e.g., NAL-NL2) in the ear canal of hearing aid wearers, the targeting of NFC parameters can likely be optimized with respect to improvements in effective audibility that may contribute to speech recognition without adversely impacting sound quality. After targeting of NFC parameters, providers can facilitate decisions about the use of NFC parameters (strengths of processing) via sound quality preference judgments using paired comparisons. American Academy of Audiology.

  17. Long-life partners or sex friends? Impact of parental pair bond on offspring personality.

    PubMed

    Le Bot, Océane; Lumineau, Sophie; de Margerie, Emmanuel; Pittet, Florent; Trabalon, Marie; Houdelier, Cécilia

    2014-12-01

    Previous investigations reported that some traits of parental relationships, including pair-bond duration or mate behavioural compatibility, influence subsequent offspring fitness by acting on their behaviour and growth and thus their early survival. We hypothesized that the development of a pair bond between sexual partners would have a prenatal influence. This study investigated the impact of two pairing managements on the egg characteristics and development of offspring of Japanese quail (Coturnix c. japonica). Thirty males and 30 females were paired either continuously (C; mates together all the time) or non-continuously (NC; pairs met only three times a week for 5 min). Separation-reunion tests evaluated parental pair bond. Egg yolk testosterone and androstenedione levels were evaluated, and the somatic and behavioural development of C and NC chicks was assessed. Our results revealed that members of C pairs were attached to their mates and, although no significant differences in androgen levels could be evidenced between egg sets, a higher proportion of C pairs' eggs were fertilized and their chicks appeared less emotive and more social. Our results revealed that the parental relationship can modulate the behavioural development of their offspring, probably via non-genetic effects, and this could play a major role in the emergence of inter-individual variability. © 2014. Published by The Company of Biologists Ltd.

  18. Counting Unfolding Events in Stretched Helices with Induced Oscillation by Optical Tweezers

    NASA Astrophysics Data System (ADS)

    Bacabac, Rommel Gaud; Otadoy, Roland

    Correlation measures based on embedded probe fluctuations, single or paired, are now widely used for characterizing the viscoelastic properties of biological samples. However, more robust applications using this technique are still lacking. Considering that the study of living matter routinely demonstrates new and complex phenomena, mathematical and experimental tools for analysis have to catch up in order to arrive at newer insights. Therefore, we derive ways of probing non-equilibrium events in helical biopolymers provided by stretching beyond thermal forces. We generalize, for the first time, calculations for winding turn probabilities to account for unfolding events in single fibrous biopolymers and globular proteins under tensile stretching using twin optical traps. The approach is based on approximating the ensuing probe fluctuations as originating from a damped harmonic oscillator under oscillatory forcing.

  19. Probability Forecasting Using Monte Carlo Simulation

    NASA Astrophysics Data System (ADS)

    Duncan, M.; Frisbee, J.; Wysack, J.

    2014-09-01

    Space Situational Awareness (SSA) is defined as the knowledge and characterization of all aspects of space. SSA is now a fundamental and critical component of space operations. Increased dependence on our space assets has in turn lead to a greater need for accurate, near real-time knowledge of all space activities. With the growth of the orbital debris population, satellite operators are performing collision avoidance maneuvers more frequently. Frequent maneuver execution expends fuel and reduces the operational lifetime of the spacecraft. Thus the need for new, more sophisticated collision threat characterization methods must be implemented. The collision probability metric is used operationally to quantify the collision risk. The collision probability is typically calculated days into the future, so that high risk and potential high risk conjunction events are identified early enough to develop an appropriate course of action. As the time horizon to the conjunction event is reduced, the collision probability changes. A significant change in the collision probability will change the satellite mission stakeholder's course of action. So constructing a method for estimating how the collision probability will evolve improves operations by providing satellite operators with a new piece of information, namely an estimate or 'forecast' of how the risk will change as time to the event is reduced. Collision probability forecasting is a predictive process where the future risk of a conjunction event is estimated. The method utilizes a Monte Carlo simulation that produces a likelihood distribution for a given collision threshold. Using known state and state uncertainty information, the simulation generates a set possible trajectories for a given space object pair. Each new trajectory produces a unique event geometry at the time of close approach. Given state uncertainty information for both objects, a collision probability value can be computed for every trail. This yields a collision probability distribution given known, predicted uncertainty. This paper presents the details of the collision probability forecasting method. We examine various conjunction event scenarios and numerically demonstrate the utility of this approach in typical event scenarios. We explore the utility of a probability-based track scenario simulation that models expected tracking data frequency as the tasking levels are increased. The resulting orbital uncertainty is subsequently used in the forecasting algorithm.

  20. Orbits of 15 visual binaries

    NASA Astrophysics Data System (ADS)

    Heintz, W. D.

    1981-04-01

    Micrometer observations in 1979-1980 permitted the computation of substantially revised or new orbital elements for 15 visual pairs. They include the bright stars 52 Ari and 78 UMa (in the UMa cluster), four faint dK pairs, and the probable triple ADS 16185. Ephemerides for equator of data are listed in a table along with the orbital elements of the binaries. The measured positions and their residuals are listed in a second table. The considered binaries include ADS 896, 2336, 6315, 7054, 7629, 8092, 8555, 8739, 13987, 16185, Rst 1658, 3906, 3972, 4529, and Jsp 691.

  1. Jonckheere Double Star Photometry - Part XI: Lepus & Vulpecula

    NASA Astrophysics Data System (ADS)

    Knapp, Wilfried; Nanson, John

    2018-07-01

    If any double star discoverer is in urgent need of photometry then it is Jonckheere. There are over 3000 Jonckheere objects listed in the WDS catalog and a good part of them with magnitudes obviously far too bright. This report covers the Jonckheere objects in the constellations Lep and Vul. At least one image per object was taken with V-filter to allow for visual magnitude measurement by differential photometry. All objects were additionally checked for common proper motion. Five qualify indeed as most probably CPM pairs with an additional five as potential CPM pairs.

  2. Multiclass Posterior Probability Twin SVM for Motor Imagery EEG Classification.

    PubMed

    She, Qingshan; Ma, Yuliang; Meng, Ming; Luo, Zhizeng

    2015-01-01

    Motor imagery electroencephalography is widely used in the brain-computer interface systems. Due to inherent characteristics of electroencephalography signals, accurate and real-time multiclass classification is always challenging. In order to solve this problem, a multiclass posterior probability solution for twin SVM is proposed by the ranking continuous output and pairwise coupling in this paper. First, two-class posterior probability model is constructed to approximate the posterior probability by the ranking continuous output techniques and Platt's estimating method. Secondly, a solution of multiclass probabilistic outputs for twin SVM is provided by combining every pair of class probabilities according to the method of pairwise coupling. Finally, the proposed method is compared with multiclass SVM and twin SVM via voting, and multiclass posterior probability SVM using different coupling approaches. The efficacy on the classification accuracy and time complexity of the proposed method has been demonstrated by both the UCI benchmark datasets and real world EEG data from BCI Competition IV Dataset 2a, respectively.

  3. Molecular systematics and phylogeography of the genus Lagothrix (Atelidae, Primates) by means of the mitochondrial COII gene.

    PubMed

    Ruiz-Garcia, Manuel; Pinedo-Castro, Myreya Omayra

    2010-01-01

    We propose the first molecular systematic hypothesis on the origin and evolution of Lagothrix taxa based on an analysis of 720 base pairs of the cytochrome c oxidase subunit II mitochondrial gene in 97 Lagothrix specimens. All the current Lagothrix forms probably descended from the ancestor L. poeppigii or perhaps (less probably) that of L. lugens. We detected at least 2 lineages in L. poeppigii. L. cana and L. lagotricha were determined to be monophyletic and had lower gene diversity levels compared to L. poeppigii and L. lugens. The most basal ancestors of the current L. poeppigii lineages diverged from the other Lagothrix taxa around 2.5 million years ago, at the end of the Pliocene or at the beginning of the Pleistocene. Clearly, L. cana and L. lagotricha were the 2 most recently derived Lagothrix taxa. The diversification within L. lugens and L. poeppigii may coincide with the first and second Pleistocene glacial periods, respectively, while the diversification within L. cana and L. lagotricha could have occurred in the last 400,000 years, coinciding with the climatological changes provoked by the Illinois-Riss (third) and Wisconsin-Würm (fourth) glaciations. Copyright © 2010 S. Karger AG, Basel.

  4. Replacement of the Faces subtest by Visual Reproductions within Wechsler Memory Scale-Third Edition (WMS-III) visual memory indexes: implications for discrepancy analysis.

    PubMed

    Hawkins, Keith A; Tulsky, David S

    2004-06-01

    Within discrepancy analysis differences between scores are examined for abnormality. Although larger differences are generally associated with rising impairment probabilities, the relationship between discrepancy size and abnormality varies across score pairs in relation to the correlation between the contrasted scores in normal subjects. Examinee ability level also affects the size of discrepancies observed normally. Wechsler Memory Scale-Third Edition (WMS-III) visual index scores correlate only modestly with other Wechsler Adult Intelligence Scale-Third Edition (WAIS-III) and WMS-III index scores; consequently, differences between these scores and others have to be very large before they become unusual, especially for subjects of higher intelligence. The substitution of the Faces subtest by Visual Reproductions within visual memory indexes formed by the combination of WMS-III visual subtests (creating immediate recall, delayed recall, and combined immediate and delayed index scores) results in higher correlation coefficients, and a decline in the discrepancy size required to surpass base rate thresholds for probable impairment. This gain appears not to occur at the cost of a diminished sensitivity to diverse pathologies. New WMS-III discrepancy base rate data are supplied to complement those currently available to clinicians.

  5. The nearest neighbor and next nearest neighbor effects on the thermodynamic and kinetic properties of RNA base pair

    NASA Astrophysics Data System (ADS)

    Wang, Yujie; Wang, Zhen; Wang, Yanli; Liu, Taigang; Zhang, Wenbing

    2018-01-01

    The thermodynamic and kinetic parameters of an RNA base pair with different nearest and next nearest neighbors were obtained through long-time molecular dynamics simulation of the opening-closing switch process of the base pair near its melting temperature. The results indicate that thermodynamic parameters of GC base pair are dependent on the nearest neighbor base pair, and the next nearest neighbor base pair has little effect, which validated the nearest-neighbor model. The closing and opening rates of the GC base pair also showed nearest neighbor dependences. At certain temperature, the closing and opening rates of the GC pair with nearest neighbor AU is larger than that with the nearest neighbor GC, and the next nearest neighbor plays little role. The free energy landscape of the GC base pair with the nearest neighbor GC is rougher than that with nearest neighbor AU.

  6. Repertoire of novel sequence signatures for the detection of Candidatus Liberibacter asiaticus by quantitative real-time PCR

    PubMed Central

    2014-01-01

    Background Huanglongbing (HLB) or citrus greening is a devastating disease of citrus. The gram-negative bacterium Candidatus Liberibacter asiaticus (Las) belonging to the α-proteobacteria is responsible for HLB in North America as well as in Asia. Currently, there is no cure for this disease. Early detection and quarantine of Las-infected trees are important management strategies used to prevent HLB from invading HLB-free citrus producing regions. Quantitative real-time PCR (qRT-PCR) based molecular diagnostic assays have been routinely used in the detection and diagnosis of Las. The oligonucleotide primer pairs based on conserved genes or regions, which include 16S rDNA and the β-operon, have been widely employed in the detection of Las by qRT-PCR. The availability of whole genome sequence of Las now allows the design of primers beyond the conserved regions for the detection of Las explicitly. Results We took a complimentary approach by systematically screening the genes in a genome-wide fashion, to identify the unique signatures that are only present in Las by an exhaustive sequence based similarity search against the nucleotide sequence database. Our search resulted in 34 probable unique signatures. Furthermore, by designing the primer pair specific to the identified signatures, we showed that most of our primer sets are able to detect Las from the infected plant and psyllid materials collected from the USA and China by qRT-PCR. Overall, 18 primer pairs of the 34 are found to be highly specific to Las with no cross reactivity to the closely related species Ca. L. americanus (Lam) and Ca. L. africanus (Laf). Conclusions We have designed qRT-PCR primers based on Las specific genes. Among them, 18 are suitable for the detection of Las from Las-infected plant and psyllid samples. The repertoire of primers that we have developed and characterized in this study enhanced the qRT-PCR based molecular diagnosis of HLB. PMID:24533511

  7. [Structural and Dipole Structure Peculiarities of Hoogsteen Base Pairs Formed in Complementary Nucleobases according to ab initio Quantum Mechanics Studies].

    PubMed

    Petrenko, Y M

    2015-01-01

    Ab initio quantum mechanics studies for the detection of structure and dipole structure peculiarities of Hoogsteen base pairs relative to Watson-Crick base pairs, were performed during our work. These base pairs are formed as a result of complementary interactions. It was revealed, that adenine-thymine Hoogsteen base pair and adenine-thymine Watson-Crick base pairs can be formed depending on initial configuration. Cytosine-guanine Hoogsteen pairs are formed only when cytosine was originally protonated. Both types of Hoogsteen pairs have noticeable difference in the bond distances and angles. These differences appeared in purine as well as in pyrimidine parts of the pairs. Hoogsteen pairs have mostly shorter hydrogen bond lengths and significantly larger angles of hydrogen bonds and larger angles between the hydrogen bonds than Watson-Crick base pairs. Notable differences are also observed with respect to charge distribution and dipole moment. Quantitative data on these differences are shown in our work. It is also reported that the values of local parameters (according to Cambridge classification of the parameters which determine DNA properties) in Hoogsteen base pairs, are greatly different from Watson-Crick ones.

  8. Nucleic acid duplexes incorporating a dissociable covalent base pair

    PubMed Central

    Gao, Kui; Orgel, Leslie E.

    1999-01-01

    We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure. PMID:10611299

  9. The neural correlates of subjective utility of monetary outcome and probability weight in economic and in motor decision under risk

    PubMed Central

    Wu, Shih-Wei; Delgado, Mauricio R.; Maloney, Laurence T.

    2011-01-01

    In decision under risk, people choose between lotteries that contain a list of potential outcomes paired with their probabilities of occurrence. We previously developed a method for translating such lotteries to mathematically equivalent motor lotteries. The probability of each outcome in a motor lottery is determined by the subject’s noise in executing a movement. In this study, we used functional magnetic resonance imaging in humans to compare the neural correlates of monetary outcome and probability in classical lottery tasks where information about probability was explicitly communicated to the subjects and in mathematically equivalent motor lottery tasks where probability was implicit in the subjects’ own motor noise. We found that activity in the medial prefrontal cortex (mPFC) and the posterior cingulate cortex (PCC) quantitatively represent the subjective utility of monetary outcome in both tasks. For probability, we found that the mPFC significantly tracked the distortion of such information in both tasks. Specifically, activity in mPFC represents probability information but not the physical properties of the stimuli correlated with this information. Together, the results demonstrate that mPFC represents probability from two distinct forms of decision under risk. PMID:21677166

  10. The neural correlates of subjective utility of monetary outcome and probability weight in economic and in motor decision under risk.

    PubMed

    Wu, Shih-Wei; Delgado, Mauricio R; Maloney, Laurence T

    2011-06-15

    In decision under risk, people choose between lotteries that contain a list of potential outcomes paired with their probabilities of occurrence. We previously developed a method for translating such lotteries to mathematically equivalent "motor lotteries." The probability of each outcome in a motor lottery is determined by the subject's noise in executing a movement. In this study, we used functional magnetic resonance imaging in humans to compare the neural correlates of monetary outcome and probability in classical lottery tasks in which information about probability was explicitly communicated to the subjects and in mathematically equivalent motor lottery tasks in which probability was implicit in the subjects' own motor noise. We found that activity in the medial prefrontal cortex (mPFC) and the posterior cingulate cortex quantitatively represent the subjective utility of monetary outcome in both tasks. For probability, we found that the mPFC significantly tracked the distortion of such information in both tasks. Specifically, activity in mPFC represents probability information but not the physical properties of the stimuli correlated with this information. Together, the results demonstrate that mPFC represents probability from two distinct forms of decision under risk.

  11. A System-Level Throughput Model for Quantum Key Distribution

    DTIC Science & Technology

    2015-09-17

    object. In quantum entanglement , the physical properties of particle pairs or groups of particles are correlated – the quantum state of each particle...One-Time Pad Algorithm ............................................................................. 8 Figure 2. Photon Polarization [19...64 Poisson distribution for multi- photon probability (29

  12. Search for supersymmetry in events with at least three electrons or muons, jets, and missing transverse momentum in proton-proton collisions at $$ \\sqrt{s}=13 $$ TeV

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sirunyan, A. M.; Tumasyan, A.; Adam, W.

    Here, a search for new physics is carried out in events with at least three electrons or muons in any combination, jets, and missing transverse momentum. Results are based on the sample of proton-proton collision data produced by the LHC at a center-of-mass energy of 13 TeV and collected by the CMS experiment in 2016. The data sample analyzed corresponds to an integrated luminosity of 35.9 fbmore » $$^{-1}$$. Events are classified according to the number of b jets, missing transverse momentum, hadronic transverse momentum, and the invariant mass of same-flavor dilepton pairs with opposite charge. No significant excess above the expected standard model background is observed. Exclusion limits at 95% confidence level are computed for four different supersymmetric simplified models with pair production of gluinos or third-generation squarks. In the model with gluino pair production, with subsequent decays into a top quark-antiquark pair and a neutralino, gluinos with masses smaller than 1610 GeV are excluded for a massless lightest supersymmetric particle. In the case of bottom squark pair production, the bottom squark masses are excluded up to 840 GeV for charginos lighter than 200 GeV. For a simplified model of heavy top squark pair production, the $$\\mathrm{\\widetilde{\\text{t}}_2}$$ mass is excluded up to 720, 780, or 710 GeV for models with an exclusive $$\\mathrm{\\widetilde{\\text{t}}_2}\\rightarrow\\mathrm{\\widetilde{\\text{t}}_1}\\mathrm{H}$$ decay, an exclusive $$\\mathrm{\\widetilde{\\text{t}}_2}\\rightarrow\\mathrm{\\widetilde{\\text{t}}_1}\\mathrm{Z}$$ decay, or an equally probable mix of those two decays. In order to provide a simplified version of the analysis for easier interpretation, a small set of aggregate signal regions also has been defined, providing a compromise between simplicity and analysis sensitivity.« less

  13. Search for supersymmetry in events with at least three electrons or muons, jets, and missing transverse momentum in proton-proton collisions at √{s}=13 TeV

    NASA Astrophysics Data System (ADS)

    Sirunyan, A. M.; Tumasyan, A.; Adam, W.; Ambrogi, F.; Asilar, E.; Bergauer, T.; Brandstetter, J.; Brondolin, E.; Dragicevic, M.; Erö, J.; Flechl, M.; Friedl, M.; Frühwirth, R.; Ghete, V. M.; Grossmann, J.; Hrubec, J.; Jeitler, M.; König, A.; Krammer, N.; Krätschmer, I.; Liko, D.; Madlener, T.; Mikulec, I.; Pree, E.; Rabady, D.; Rad, N.; Rohringer, H.; Schieck, J.; Schöfbeck, R.; Spanring, M.; Spitzbart, D.; Waltenberger, W.; Wittmann, J.; Wulz, C.-E.; Zarucki, M.; Chekhovsky, V.; Mossolov, V.; Gonzalez, J. Suarez; De Wolf, E. A.; Di Croce, D.; Janssen, X.; Lauwers, J.; Van De Klundert, M.; Van Haevermaet, H.; Van Mechelen, P.; Van Remortel, N.; Zeid, S. Abu; Blekman, F.; D'Hondt, J.; De Bruyn, I.; De Clercq, J.; Deroover, K.; Flouris, G.; Lontkovskyi, D.; Lowette, S.; Moortgat, S.; Moreels, L.; Python, Q.; Skovpen, K.; Tavernier, S.; Van Doninck, W.; Van Mulders, P.; Van Parijs, I.; Beghin, D.; Brun, H.; Clerbaux, B.; De Lentdecker, G.; Delannoy, H.; Fasanella, G.; Favart, L.; Goldouzian, R.; Grebenyuk, A.; Karapostoli, G.; Lenzi, T.; Luetic, J.; Maerschalk, T.; Marinov, A.; Randle-conde, A.; Seva, T.; Velde, C. Vander; Vanlaer, P.; Vannerom, D.; Yonamine, R.; Zenoni, F.; Zhang, F.; Cimmino, A.; Cornelis, T.; Dobur, D.; Fagot, A.; Gul, M.; Khvastunov, I.; Poyraz, D.; Roskas, C.; Salva, S.; Tytgat, M.; Verbeke, W.; Zaganidis, N.; Bakhshiansohi, H.; Bondu, O.; Brochet, S.; Bruno, G.; Caputo, C.; Caudron, A.; De Visscher, S.; Delaere, C.; Delcourt, M.; Francois, B.; Giammanco, A.; Jafari, A.; Komm, M.; Krintiras, G.; Lemaitre, V.; Magitteri, A.; Mertens, A.; Musich, M.; Piotrzkowski, K.; Quertenmont, L.; Marono, M. Vidal; Wertz, S.; Beliy, N.; Júnior, W. L. Aldá; Alves, F. L.; Alves, G. A.; Brito, L.; Junior, M. Correa Martins; Hensel, C.; Moraes, A.; Pol, M. E.; Rebello Teles, P.; Chagas, E. Belchior Batista Das; Carvalho, W.; Chinellato, J.; Custódio, A.; Da Costa, E. M.; Da Silveira, G. G.; De Jesus Damiao, D.; Fonseca De Souza, S.; Guativa, L. M. Huertas; Malbouisson, H.; Melo De Almeida, M.; Herrera, C. Mora; Mundim, L.; Nogima, H.; Santoro, A.; Sznajder, A.; Tonelli Manganote, E. J.; Da Silva De Araujo, F. Torres; Pereira, A. Vilela; Ahuja, S.; Bernardes, C. A.; Tomei, T. R. Fernandez Perez; Gregores, E. M.; Mercadante, P. G.; Novaes, S. F.; Padula, Sandra S.; Abad, D. Romero; Vargas, J. C. Ruiz; Aleksandrov, A.; Hadjiiska, R.; Iaydjiev, P.; Misheva, M.; Rodozov, M.; Shopova, M.; Stoykova, S.; Sultanov, G.; Dimitrov, A.; Glushkov, I.; Litov, L.; Pavlov, B.; Petkov, P.; Fang, W.; Gao, X.; Ahmad, M.; Bian, J. G.; Chen, G. M.; Chen, H. S.; Chen, M.; Chen, Y.; Jiang, C. H.; Leggat, D.; Liao, H.; Liu, Z.; Romeo, F.; Shaheen, S. M.; Spiezia, A.; Tao, J.; Wang, C.; Wang, Z.; Yazgan, E.; Zhang, H.; Zhang, S.; Zhao, J.; Ban, Y.; Chen, G.; Li, Q.; Liu, S.; Mao, Y.; Qian, S. J.; Wang, D.; Xu, Z.; Avila, C.; Cabrera, A.; Sierra, L. F. Chaparro; Florez, C.; Hernández, C. F. González; Alvarez, J. D. Ruiz; Courbon, B.; Godinovic, N.; Lelas, D.; Puljak, I.; Cipriano, P. M. Ribeiro; Sculac, T.; Antunovic, Z.; Kovac, M.; Brigljevic, V.; Ferencek, D.; Kadija, K.; Mesic, B.; Starodumov, A.; Susa, T.; Ather, M. W.; Attikis, A.; Mavromanolakis, G.; Mousa, J.; Nicolaou, C.; Ptochos, F.; Razis, P. A.; Rykaczewski, H.; Finger, M.; Finger, M.; Jarrin, E. Carrera; Kamel, A. Ellithi; Khalil, S.; Mohamed, A.; Dewanjee, R. K.; Kadastik, M.; Perrini, L.; Raidal, M.; Tiko, A.; Veelken, C.; Eerola, P.; Pekkanen, J.; Voutilainen, M.; Härkönen, J.; Järvinen, T.; Karimäki, V.; Kinnunen, R.; Lampén, T.; Lassila-Perini, K.; Lehti, S.; Lindén, T.; Luukka, P.; Tuominen, E.; Tuominiemi, J.; Tuovinen, E.; Talvitie, J.; Tuuva, T.; Besancon, M.; Couderc, F.; Dejardin, M.; Denegri, D.; Faure, J. L.; Ferri, F.; Ganjour, S.; Ghosh, S.; Givernaud, A.; Gras, P.; Hamel de Monchenault, G.; Jarry, P.; Kucher, I.; Locci, E.; Machet, M.; Malcles, J.; Negro, G.; Rander, J.; Rosowsky, A.; Sahin, M. Ö.; Titov, M.; Abdulsalam, A.; Amendola, C.; Antropov, I.; Baffioni, S.; Beaudette, F.; Busson, P.; Cadamuro, L.; Charlot, C.; Granier de Cassagnac, R.; Jo, M.; Lisniak, S.; Lobanov, A.; Blanco, J. Martin; Nguyen, M.; Ochando, C.; Ortona, G.; Paganini, P.; Pigard, P.; Salerno, R.; Sauvan, J. B.; Sirois, Y.; Leiton, A. G. Stahl; Strebler, T.; Yilmaz, Y.; Zabi, A.; Zghiche, A.; Agram, J.-L.; Andrea, J.; Bloch, D.; Brom, J.-M.; Buttignol, M.; Chabert, E. C.; Chanon, N.; Collard, C.; Conte, E.; Coubez, X.; Fontaine, J.-C.; Gelé, D.; Goerlach, U.; Jansová, M.; Le Bihan, A.-C.; Tonon, N.; Van Hove, P.; Gadrat, S.; Beauceron, S.; Bernet, C.; Boudoul, G.; Chierici, R.; Contardo, D.; Depasse, P.; El Mamouni, H.; Fay, J.; Finco, L.; Gascon, S.; Gouzevitch, M.; Grenier, G.; Ille, B.; Lagarde, F.; Laktineh, I. B.; Lethuillier, M.; Mirabito, L.; Pequegnot, A. L.; Perries, S.; Popov, A.; Sordini, V.; Donckt, M. Vander; Viret, S.; Khvedelidze, A.; Tsamalaidze, Z.; Autermann, C.; Feld, L.; Kiesel, M. K.; Klein, K.; Lipinski, M.; Preuten, M.; Schomakers, C.; Schulz, J.; Verlage, T.; Zhukov, V.; Albert, A.; Dietz-Laursonn, E.; Duchardt, D.; Endres, M.; Erdmann, M.; Erdweg, S.; Esch, T.; Fischer, R.; Güth, A.; Hamer, M.; Hebbeker, T.; Heidemann, C.; Hoepfner, K.; Knutzen, S.; Merschmeyer, M.; Meyer, A.; Millet, P.; Mukherjee, S.; Pook, T.; Radziej, M.; Reithler, H.; Rieger, M.; Scheuch, F.; Teyssier, D.; Thüer, S.; Flügge, G.; Kargoll, B.; Kress, T.; Künsken, A.; Lingemann, J.; Müller, T.; Nehrkorn, A.; Nowack, A.; Pistone, C.; Pooth, O.; Stahl, A.; Martin, M. Aldaya; Arndt, T.; Asawatangtrakuldee, C.; Beernaert, K.; Behnke, O.; Behrens, U.; Martínez, A. Bermúdez; Anuar, A. A. Bin; Borras, K.; Botta, V.; Campbell, A.; Connor, P.; Contreras-Campana, C.; Costanza, F.; Pardos, C. Diez; Eckerlin, G.; Eckstein, D.; Eichhorn, T.; Eren, E.; Gallo, E.; Garcia, J. Garay; Geiser, A.; Gizhko, A.; Luyando, J. M. Grados; Grohsjean, A.; Gunnellini, P.; Guthoff, M.; Harb, A.; Hauk, J.; Hempel, M.; Jung, H.; Kalogeropoulos, A.; Kasemann, M.; Keaveney, J.; Kleinwort, C.; Korol, I.; Krücker, D.; Lange, W.; Lelek, A.; Lenz, T.; Leonard, J.; Lipka, K.; Lohmann, W.; Mankel, R.; Melzer-Pellmann, I.-A.; Meyer, A. B.; Mittag, G.; Mnich, J.; Mussgiller, A.; Ntomari, E.; Pitzl, D.; Raspereza, A.; Roland, B.; Savitskyi, M.; Saxena, P.; Shevchenko, R.; Spannagel, S.; Stefaniuk, N.; Van Onsem, G. P.; Walsh, R.; Wen, Y.; Wichmann, K.; Wissing, C.; Zenaiev, O.; Bein, S.; Blobel, V.; Vignali, M. Centis; Dreyer, T.; Garutti, E.; Gonzalez, D.; Haller, J.; Hinzmann, A.; Hoffmann, M.; Karavdina, A.; Klanner, R.; Kogler, R.; Kovalchuk, N.; Kurz, S.; Lapsien, T.; Marchesini, I.; Marconi, D.; Meyer, M.; Niedziela, M.; Nowatschin, D.; Pantaleo, F.; Peiffer, T.; Perieanu, A.; Scharf, C.; Schleper, P.; Schmidt, A.; Schumann, S.; Schwandt, J.; Sonneveld, J.; Stadie, H.; Steinbrück, G.; Stober, F. M.; Stöver, M.; Tholen, H.; Troendle, D.; Usai, E.; Vanelderen, L.; Vanhoefer, A.; Vormwald, B.; Akbiyik, M.; Barth, C.; Baur, S.; Butz, E.; Caspart, R.; Chwalek, T.; Colombo, F.; De Boer, W.; Dierlamm, A.; Freund, B.; Friese, R.; Giffels, M.; Haitz, D.; Hartmann, F.; Heindl, S. M.; Husemann, U.; Kassel, F.; Kudella, S.; Mildner, H.; Mozer, M. U.; Müller, Th.; Plagge, M.; Quast, G.; Rabbertz, K.; Schröder, M.; Shvetsov, I.; Sieber, G.; Simonis, H. J.; Ulrich, R.; Wayand, S.; Weber, M.; Weiler, T.; Williamson, S.; Wöhrmann, C.; Wolf, R.; Anagnostou, G.; Daskalakis, G.; Geralis, T.; Giakoumopoulou, V. A.; Kyriakis, A.; Loukas, D.; Topsis-Giotis, I.; Karathanasis, G.; Kesisoglou, S.; Panagiotou, A.; Saoulidou, N.; Kousouris, K.; Evangelou, I.; Foudas, C.; Kokkas, P.; Mallios, S.; Manthos, N.; Papadopoulos, I.; Paradas, E.; Strologas, J.; Triantis, F. A.; Csanad, M.; Filipovic, N.; Pasztor, G.; Veres, G. I.; Bencze, G.; Hajdu, C.; Horvath, D.; Hunyadi, Á.; Sikler, F.; Veszpremi, V.; Zsigmond, A. J.; Beni, N.; Czellar, S.; Karancsi, J.; Makovec, A.; Molnar, J.; Szillasi, Z.; Bartók, M.; Raics, P.; Trocsanyi, Z. L.; Ujvari, B.; Choudhury, S.; Komaragiri, J. R.; Bahinipati, S.; Bhowmik, S.; Mal, P.; Mandal, K.; Nayak, A.; Sahoo, D. K.; Sahoo, N.; Swain, S. K.; Bansal, S.; Beri, S. B.; Bhatnagar, V.; Chawla, R.; Dhingra, N.; Kalsi, A. K.; Kaur, A.; Kaur, M.; Kumar, R.; Kumari, P.; Mehta, A.; Singh, J. B.; Walia, G.; Kumar, Ashok; Shah, Aashaq; Bhardwaj, A.; Chauhan, S.; Choudhary, B. C.; Garg, R. B.; Keshri, S.; Kumar, A.; Malhotra, S.; Naimuddin, M.; Ranjan, K.; Sharma, R.; Bhardwaj, R.; Bhattacharya, R.; Bhattacharya, S.; Bhawandeep, U.; Dey, S.; Dutt, S.; Dutta, S.; Ghosh, S.; Majumdar, N.; Modak, A.; Mondal, K.; Mukhopadhyay, S.; Nandan, S.; Purohit, A.; Roy, A.; Roy, D.; Chowdhury, S. Roy; Sarkar, S.; Sharan, M.; Thakur, S.; Behera, P. K.; Chudasama, R.; Dutta, D.; Jha, V.; Kumar, V.; Mohanty, A. K.; Netrakanti, P. K.; Pant, L. M.; Shukla, P.; Topkar, A.; Aziz, T.; Dugad, S.; Mahakud, B.; Mitra, S.; Mohanty, G. B.; Sur, N.; Sutar, B.; Banerjee, S.; Bhattacharya, S.; Chatterjee, S.; Das, P.; Guchait, M.; Jain, Sa.; Kumar, S.; Maity, M.; Majumder, G.; Mazumdar, K.; Sarkar, T.; Wickramage, N.; Chauhan, S.; Dube, S.; Hegde, V.; Kapoor, A.; Kothekar, K.; Pandey, S.; Rane, A.; Sharma, S.; Chenarani, S.; Tadavani, E. Eskandari; Etesami, S. M.; Khakzad, M.; Najafabadi, M. Mohammadi; Naseri, M.; Mehdiabadi, S. Paktinat; Hosseinabadi, F. Rezaei; Safarzadeh, B.; Zeinali, M.; Felcini, M.; Grunewald, M.; Abbrescia, M.; Calabria, C.; Colaleo, A.; Creanza, D.; Cristella, L.; De Filippis, N.; De Palma, M.; Errico, F.; Fiore, L.; Iaselli, G.; Lezki, S.; Maggi, G.; Maggi, M.; Miniello, G.; My, S.; Nuzzo, S.; Pompili, A.; Pugliese, G.; Radogna, R.; Ranieri, A.; Selvaggi, G.; Sharma, A.; Silvestris, L.; Venditti, R.; Verwilligen, P.; Abbiendi, G.; Battilana, C.; Bonacorsi, D.; Braibant-Giacomelli, S.; Campanini, R.; Capiluppi, P.; Castro, A.; Cavallo, F. R.; Chhibra, S. S.; Codispoti, G.; Cuffiani, M.; Dallavalle, G. M.; Fabbri, F.; Fanfani, A.; Fasanella, D.; Giacomelli, P.; Grandi, C.; Guiducci, L.; Marcellini, S.; Masetti, G.; Montanari, A.; Navarria, F. L.; Perrotta, A.; Rossi, A. M.; Rovelli, T.; Siroli, G. P.; Tosi, N.; Albergo, S.; Costa, S.; Di Mattia, A.; Giordano, F.; Potenza, R.; Tricomi, A.; Tuve, C.; Barbagli, G.; Chatterjee, K.; Ciulli, V.; Civinini, C.; D'Alessandro, R.; Focardi, E.; Lenzi, P.; Meschini, M.; Paoletti, S.; Russo, L.; Sguazzoni, G.; Strom, D.; Viliani, L.; Benussi, L.; Bianco, S.; Fabbri, F.; Piccolo, D.; Primavera, F.; Calvelli, V.; Ferro, F.; Robutti, E.; Tosi, S.; Benaglia, A.; Brianza, L.; Brivio, F.; Ciriolo, V.; Dinardo, M. E.; Fiorendi, S.; Gennai, S.; Ghezzi, A.; Govoni, P.; Malberti, M.; Malvezzi, S.; Manzoni, R. A.; Menasce, D.; Moroni, L.; Paganoni, M.; Pauwels, K.; Pedrini, D.; Pigazzini, S.; Ragazzi, S.; Redaelli, N.; Tabarelli de Fatis, T.; Buontempo, S.; Cavallo, N.; Di Guida, S.; Fabozzi, F.; Fienga, F.; Iorio, A. O. M.; Khan, W. A.; Lista, L.; Meola, S.; Paolucci, P.; Sciacca, C.; Thyssen, F.; Azzi, P.; Bacchetta, N.; Badoer, S.; Bellato, M.; Benato, L.; Bisello, D.; Boletti, A.; Carvalho Antunes De Oliveira, A.; Checchia, P.; Dall'Osso, M.; De Castro Manzano, P.; Dorigo, T.; Gasparini, U.; Gozzelino, A.; Lacaprara, S.; Lujan, P.; Margoni, M.; Meneguzzo, A. T.; Pozzobon, N.; Ronchese, P.; Rossin, R.; Simonetto, F.; Torassa, E.; Zanetti, M.; Zotto, P.; Zumerle, G.; Braghieri, A.; Magnani, A.; Montagna, P.; Ratti, S. P.; Re, V.; Ressegotti, M.; Riccardi, C.; Salvini, P.; Vai, I.; Vitulo, P.; Solestizi, L. Alunni; Biasini, M.; Bilei, G. M.; Cecchi, C.; Ciangottini, D.; Fanò, L.; Lariccia, P.; Leonardi, R.; Manoni, E.; Mantovani, G.; Mariani, V.; Menichelli, M.; Rossi, A.; Santocchia, A.; Spiga, D.; Androsov, K.; Azzurri, P.; Bagliesi, G.; Boccali, T.; Borrello, L.; Castaldi, R.; Ciocci, M. A.; Dell'Orso, R.; Fedi, G.; Giannini, L.; Giassi, A.; Grippo, M. T.; Ligabue, F.; Lomtadze, T.; Manca, E.; Mandorli, G.; Martini, L.; Messineo, A.; Palla, F.; Rizzi, A.; Savoy-Navarro, A.; Spagnolo, P.; Tenchini, R.; Tonelli, G.; Venturi, A.; Verdini, P. G.; Barone, L.; Cavallari, F.; Cipriani, M.; Daci, N.; Del Re, D.; Di Marco, E.; Diemoz, M.; Gelli, S.; Longo, E.; Margaroli, F.; Marzocchi, B.; Meridiani, P.; Organtini, G.; Paramatti, R.; Preiato, F.; Rahatlou, S.; Rovelli, C.; Santanastasio, F.; Amapane, N.; Arcidiacono, R.; Argiro, S.; Arneodo, M.; Bartosik, N.; Bellan, R.; Biino, C.; Cartiglia, N.; Cenna, F.; Costa, M.; Covarelli, R.; Degano, A.; Demaria, N.; Kiani, B.; Mariotti, C.; Maselli, S.; Migliore, E.; Monaco, V.; Monteil, E.; Monteno, M.; Obertino, M. M.; Pacher, L.; Pastrone, N.; Pelliccioni, M.; Angioni, G. L. Pinna; Ravera, F.; Romero, A.; Ruspa, M.; Sacchi, R.; Shchelina, K.; Sola, V.; Solano, A.; Staiano, A.; Traczyk, P.; Belforte, S.; Casarsa, M.; Cossutti, F.; Ricca, G. Della; Zanetti, A.; Kim, D. H.; Kim, G. N.; Kim, M. S.; Lee, J.; Lee, S.; Lee, S. W.; Moon, C. S.; Oh, Y. D.; Sekmen, S.; Son, D. C.; Yang, Y. C.; Lee, A.; Kim, H.; Moon, D. H.; Oh, G.; Cifuentes, J. A. Brochero; Goh, J.; Kim, T. J.; Cho, S.; Choi, S.; Go, Y.; Gyun, D.; Ha, S.; Hong, B.; Jo, Y.; Kim, Y.; Lee, K.; Lee, K. S.; Lee, S.; Lim, J.; Park, S. K.; Roh, Y.; Almond, J.; Kim, J.; Kim, J. S.; Lee, H.; Lee, K.; Nam, K.; Oh, S. B.; Radburn-Smith, B. C.; Seo, S. h.; Yang, U. K.; Yoo, H. D.; Yu, G. B.; Choi, M.; Kim, H.; Kim, J. H.; Lee, J. S. H.; Park, I. C.; Choi, Y.; Hwang, C.; Lee, J.; Yu, I.; Dudenas, V.; Juodagalvis, A.; Vaitkus, J.; Ahmed, I.; Ibrahim, Z. A.; Ali, M. A. B. Md; Idris, F. Mohamad; Abdullah, W. A. T. Wan; Yusli, M. N.; Zolkapli, Z.; Reyes-Almanza, R.; Ramirez-Sanchez, G.; Duran-Osuna, M. C.; Castilla-Valdez, H.; De La Cruz-Burelo, E.; Heredia-De La Cruz, I.; Rabadan-Trejo, R. I.; Lopez-Fernandez, R.; Guisao, J. Mejia; Sanchez-Hernandez, A.; Moreno, S. Carrillo; Barrera, C. Oropeza; Vazquez Valencia, F.; Pedraza, I.; Ibarguen, H. A. Salazar; Estrada, C. Uribe; Pineda, A. Morelos; Krofcheck, D.; Butler, P. H.; Ahmad, A.; Ahmad, M.; Hassan, Q.; Hoorani, H. R.; Saddique, A.; Shah, M. A.; Shoaib, M.; Waqas, M.; Bialkowska, H.; Bluj, M.; Boimska, B.; Frueboes, T.; Górski, M.; Kazana, M.; Nawrocki, K.; Szleper, M.; Zalewski, P.; Bunkowski, K.; Byszuk, A.; Doroba, K.; Kalinowski, A.; Konecki, M.; Krolikowski, J.; Misiura, M.; Olszewski, M.; Pyskir, A.; Walczak, M.; Bargassa, P.; Da Cruz E Silva, C. Beirão; Di Francesco, A.; Faccioli, P.; Galinhas, B.; Gallinaro, M.; Hollar, J.; Leonardo, N.; Iglesias, L. Lloret; Nemallapudi, M. V.; Seixas, J.; Strong, G.; Toldaiev, O.; Vadruccio, D.; Varela, J.; Afanasiev, S.; Bunin, P.; Gavrilenko, M.; Golutvin, I.; Gorbunov, I.; Kamenev, A.; Karjavin, V.; Lanev, A.; Malakhov, A.; Matveev, V.; Palichik, V.; Perelygin, V.; Shmatov, S.; Shulha, S.; Skatchkov, N.; Smirnov, V.; Voytishin, N.; Zarubin, A.; Ivanov, Y.; Kim, V.; Kuznetsova, E.; Levchenko, P.; Murzin, V.; Oreshkin, V.; Smirnov, I.; Sulimov, V.; Uvarov, L.; Vavilov, S.; Vorobyev, A.; Andreev, Yu.; Dermenev, A.; Gninenko, S.; Golubev, N.; Karneyeu, A.; Kirsanov, M.; Krasnikov, N.; Pashenkov, A.; Tlisov, D.; Toropin, A.; Epshteyn, V.; Gavrilov, V.; Lychkovskaya, N.; Popov, V.; Pozdnyakov, I.; Safronov, G.; Spiridonov, A.; Stepennov, A.; Toms, M.; Vlasov, E.; Zhokin, A.; Aushev, T.; Bylinkin, A.; Chadeeva, M.; Parygin, P.; Philippov, D.; Polikarpov, S.; Popova, E.; Rusinov, V.; Andreev, V.; Azarkin, M.; Dremin, I.; Kirakosyan, M.; Terkulov, A.; Baskakov, A.; Belyaev, A.; Boos, E.; Dubinin, M.; Dudko, L.; Ershov, A.; Gribushin, A.; Klyukhin, V.; Kodolova, O.; Lokhtin, I.; Miagkov, I.; Obraztsov, S.; Petrushanko, S.; Savrin, V.; Snigirev, A.; Blinov, V.; Skovpen, Y.; Shtol, D.; Azhgirey, I.; Bayshev, I.; Bitioukov, S.; Elumakhov, D.; Kachanov, V.; Kalinin, A.; Konstantinov, D.; Petrov, V.; Ryutin, R.; Sobol, A.; Troshin, S.; Tyurin, N.; Uzunian, A.; Volkov, A.; Adzic, P.; Cirkovic, P.; Devetak, D.; Dordevic, M.; Milosevic, J.; Rekovic, V.; Maestre, J. Alcaraz; Luna, M. Barrio; Cerrada, M.; Colino, N.; De La Cruz, B.; Delgado Peris, A.; Escalante Del Valle, A.; Fernandez Bedoya, C.; Ramos, J. P. Fernández; Flix, J.; Fouz, M. C.; Garcia-Abia, P.; Gonzalez Lopez, O.; Lopez, S. Goy; Hernandez, J. M.; Josa, M. I.; Moran, D.; Pérez-Calero Yzquierdo, A.; Puerta Pelayo, J.; Quintario Olmeda, A.; Redondo, I.; Romero, L.; Soares, M. S.; Álvarez Fernández, A.; Albajar, C.; de Trocóniz, J. F.; Missiroli, M.; Cuevas, J.; Erice, C.; Fernandez Menendez, J.; Gonzalez Caballero, I.; González Fernández, J. R.; Palencia Cortezon, E.; Sanchez Cruz, S.; Vischia, P.; Garcia, J. M. Vizan; Cabrillo, I. J.; Calderon, A.; Quero, B. Chazin; Curras, E.; Campderros, J. Duarte; Fernandez, M.; Garcia-Ferrero, J.; Gomez, G.; Virto, A. Lopez; Marco, J.; Rivero, C. Martinez; Martinez Ruiz del Arbol, P.; Matorras, F.; Gomez, J. Piedra; Rodrigo, T.; Ruiz-Jimeno, A.; Scodellaro, L.; Trevisani, N.; Vila, I.; Cortabitarte, R. Vilar; Abbaneo, D.; Auffray, E.; Baillon, P.; Ball, A. H.; Barney, D.; Bianco, M.; Bloch, P.; Bocci, A.; Botta, C.; Camporesi, T.; Castello, R.; Cepeda, M.; Cerminara, G.; Chapon, E.; Chen, Y.; d'Enterria, D.; Dabrowski, A.; Daponte, V.; David, A.; De Gruttola, M.; De Roeck, A.; Dobson, M.; Dorney, B.; du Pree, T.; Dünser, M.; Dupont, N.; Elliott-Peisert, A.; Everaerts, P.; Fallavollita, F.; Franzoni, G.; Fulcher, J.; Funk, W.; Gigi, D.; Gilbert, A.; Gill, K.; Glege, F.; Gulhan, D.; Harris, P.; Hegeman, J.; Innocente, V.; Janot, P.; Karacheban, O.; Kieseler, J.; Kirschenmann, H.; Knünz, V.; Kornmayer, A.; Kortelainen, M. J.; Krammer, M.; Lange, C.; Lecoq, P.; Lourenço, C.; Lucchini, M. T.; Malgeri, L.; Mannelli, M.; Martelli, A.; Meijers, F.; Merlin, J. A.; Mersi, S.; Meschi, E.; Milenovic, P.; Moortgat, F.; Mulders, M.; Neugebauer, H.; Ngadiuba, J.; Orfanelli, S.; Orsini, L.; Pape, L.; Perez, E.; Peruzzi, M.; Petrilli, A.; Petrucciani, G.; Pfeiffer, A.; Pierini, M.; Racz, A.; Reis, T.; Rolandi, G.; Rovere, M.; Sakulin, H.; Schäfer, C.; Schwick, C.; Seidel, M.; Selvaggi, M.; Sharma, A.; Silva, P.; Sphicas, P.; Stakia, A.; Steggemann, J.; Stoye, M.; Tosi, M.; Treille, D.; Triossi, A.; Tsirou, A.; Veckalns, V.; Verweij, M.; Zeuner, W. D.; Bertl, W.; Caminada, L.; Deiters, K.; Erdmann, W.; Horisberger, R.; Ingram, Q.; Kaestli, H. C.; Kotlinski, D.; Langenegger, U.; Rohe, T.; Wiederkehr, S. A.; Bäni, L.; Berger, P.; Bianchini, L.; Casal, B.; Dissertori, G.; Dittmar, M.; Donegà, M.; Grab, C.; Heidegger, C.; Hits, D.; Hoss, J.; Kasieczka, G.; Klijnsma, T.; Lustermann, W.; Mangano, B.; Marionneau, M.; Meinhard, M. T.; Meister, D.; Micheli, F.; Musella, P.; Nessi-Tedaldi, F.; Pandolfi, F.; Pata, J.; Pauss, F.; Perrin, G.; Perrozzi, L.; Quittnat, M.; Reichmann, M.; Schönenberger, M.; Shchutska, L.; Tavolaro, V. R.; Theofilatos, K.; Olsson, M. L. Vesterbacka; Wallny, R.; Zhu, D. H.; Aarrestad, T. K.; Amsler, C.; Canelli, M. F.; De Cosa, A.; Del Burgo, R.; Donato, S.; Galloni, C.; Hreus, T.; Kilminster, B.; Pinna, D.; Rauco, G.; Robmann, P.; Salerno, D.; Seitz, C.; Takahashi, Y.; Zucchetta, A.; Candelise, V.; Doan, T. H.; Jain, Sh.; Khurana, R.; Kuo, C. M.; Lin, W.; Pozdnyakov, A.; Yu, S. S.; Kumar, Arun; Chang, P.; Chao, Y.; Chen, K. F.; Chen, P. H.; Fiori, F.; Hou, W.-S.; Hsiung, Y.; Liu, Y. F.; Lu, R.-S.; Paganis, E.; Psallidas, A.; Steen, A.; Tsai, J. f.; Asavapibhop, B.; Kovitanggoon, K.; Singh, G.; Srimanobhas, N.; Boran, F.; Cerci, S.; Damarseckin, S.; Demiroglu, Z. S.; Dozen, C.; Dumanoglu, I.; Girgis, S.; Gokbulut, G.; Guler, Y.; Hos, I.; Kangal, E. E.; Kara, O.; Topaksu, A. Kayis; Kiminsu, U.; Oglakci, M.; Onengut, G.; Ozdemir, K.; Cerci, D. Sunar; Tali, B.; Turkcapar, S.; Zorbakir, I. S.; Zorbilmez, C.; Bilin, B.; Karapinar, G.; Ocalan, K.; Yalvac, M.; Zeyrek, M.; Gülmez, E.; Kaya, M.; Kaya, O.; Tekten, S.; Yetkin, E. A.; Agaras, M. N.; Atay, S.; Cakir, A.; Cankocak, K.; Grynyov, B.; Levchuk, L.; Aggleton, R.; Ball, F.; Beck, L.; Brooke, J. J.; Burns, D.; Clement, E.; Cussans, D.; Davignon, O.; Flacher, H.; Goldstein, J.; Grimes, M.; Heath, G. P.; Heath, H. F.; Jacob, J.; Kreczko, L.; Lucas, C.; Newbold, D. M.; Paramesvaran, S.; Poll, A.; Sakuma, T.; Seif El Nasr-storey, S.; Smith, D.; Smith, V. J.; Bell, K. W.; Belyaev, A.; Brew, C.; Brown, R. M.; Calligaris, L.; Cieri, D.; Cockerill, D. J. A.; Coughlan, J. A.; Harder, K.; Harper, S.; Olaiya, E.; Petyt, D.; Shepherd-Themistocleous, C. H.; Thea, A.; Tomalin, I. R.; Williams, T.; Auzinger, G.; Bainbridge, R.; Borg, J.; Breeze, S.; Buchmuller, O.; Bundock, A.; Casasso, S.; Citron, M.; Colling, D.; Corpe, L.; Dauncey, P.; Davies, G.; De Wit, A.; Negra, M. Della; Di Maria, R.; Elwood, A.; Haddad, Y.; Hall, G.; Iles, G.; James, T.; Lane, R.; Laner, C.; Lyons, L.; Magnan, A.-M.; Malik, S.; Mastrolorenzo, L.; Matsushita, T.; Nash, J.; Nikitenko, A.; Palladino, V.; Pesaresi, M.; Raymond, D. M.; Richards, A.; Rose, A.; Scott, E.; Seez, C.; Shtipliyski, A.; Summers, S.; Tapper, A.; Uchida, K.; Vazquez Acosta, M.; Virdee, T.; Wardle, N.; Winterbottom, D.; Wright, J.; Zenz, S. C.; Cole, J. E.; Hobson, P. R.; Khan, A.; Kyberd, P.; Reid, I. D.; Symonds, P.; Teodorescu, L.; Turner, M.; Borzou, A.; Call, K.; Dittmann, J.; Hatakeyama, K.; Liu, H.; Pastika, N.; Smith, C.; Bartek, R.; Dominguez, A.; Buccilli, A.; Cooper, S. I.; Henderson, C.; Rumerio, P.; West, C.; Arcaro, D.; Avetisyan, A.; Bose, T.; Gastler, D.; Rankin, D.; Richardson, C.; Rohlf, J.; Sulak, L.; Zou, D.; Benelli, G.; Cutts, D.; Garabedian, A.; Hakala, J.; Heintz, U.; Hogan, J. M.; Kwok, K. H. M.; Laird, E.; Landsberg, G.; Mao, Z.; Narain, M.; Pazzini, J.; Piperov, S.; Sagir, S.; Syarif, R.; Yu, D.; Band, R.; Brainerd, C.; Burns, D.; Calderon De La Barca Sanchez, M.; Chertok, M.; Conway, J.; Conway, R.; Cox, P. T.; Erbacher, R.; Flores, C.; Funk, G.; Gardner, M.; Ko, W.; Lander, R.; Mclean, C.; Mulhearn, M.; Pellett, D.; Pilot, J.; Shalhout, S.; Shi, M.; Smith, J.; Stolp, D.; Tos, K.; Tripathi, M.; Wang, Z.; Bachtis, M.; Bravo, C.; Cousins, R.; Dasgupta, A.; Florent, A.; Hauser, J.; Ignatenko, M.; Mccoll, N.; Regnard, S.; Saltzberg, D.; Schnaible, C.; Valuev, V.; Bouvier, E.; Burt, K.; Clare, R.; Ellison, J.; Gary, J. W.; Shirazi, S. M. A. Ghiasi; Hanson, G.; Heilman, J.; Jandir, P.; Kennedy, E.; Lacroix, F.; Long, O. R.; Negrete, M. Olmedo; Paneva, M. I.; Shrinivas, A.; Si, W.; Wang, L.; Wei, H.; Wimpenny, S.; Yates, B. R.; Branson, J. G.; Cittolin, S.; Derdzinski, M.; Gerosa, R.; Hashemi, B.; Holzner, A.; Klein, D.; Kole, G.; Krutelyov, V.; Letts, J.; Macneill, I.; Masciovecchio, M.; Olivito, D.; Padhi, S.; Pieri, M.; Sani, M.; Sharma, V.; Simon, S.; Tadel, M.; Vartak, A.; Wasserbaech, S.; Wood, J.; Würthwein, F.; Yagil, A.; Porta, G. Zevi Della; Amin, N.; Bhandari, R.; Bradmiller-Feld, J.; Campagnari, C.; Dishaw, A.; Dutta, V.; Sevilla, M. Franco; George, C.; Golf, F.; Gouskos, L.; Gran, J.; Heller, R.; Incandela, J.; Mullin, S. D.; Ovcharova, A.; Qu, H.; Richman, J.; Stuart, D.; Suarez, I.; Yoo, J.; Anderson, D.; Bendavid, J.; Bornheim, A.; Lawhorn, J. M.; Newman, H. B.; Nguyen, T.; Pena, C.; Spiropulu, M.; Vlimant, J. R.; Xie, S.; Zhang, Z.; Zhu, R. Y.; Andrews, M. B.; Ferguson, T.; Mudholkar, T.; Paulini, M.; Russ, J.; Sun, M.; Vogel, H.; Vorobiev, I.; Weinberg, M.; Cumalat, J. P.; Ford, W. T.; Jensen, F.; Johnson, A.; Krohn, M.; Leontsinis, S.; Mulholland, T.; Stenson, K.; Wagner, S. R.; Alexander, J.; Chaves, J.; Chu, J.; Dittmer, S.; Mcdermott, K.; Mirman, N.; Patterson, J. R.; Rinkevicius, A.; Ryd, A.; Skinnari, L.; Soffi, L.; Tan, S. M.; Tao, Z.; Thom, J.; Tucker, J.; Wittich, P.; Zientek, M.; Abdullin, S.; Albrow, M.; Alyari, M.; Apollinari, G.; Apresyan, A.; Apyan, A.; Banerjee, S.; Bauerdick, L. A. T.; Beretvas, A.; Berryhill, J.; Bhat, P. C.; Bolla, G.; Burkett, K.; Butler, J. N.; Canepa, A.; Cerati, G. B.; Cheung, H. W. K.; Chlebana, F.; Cremonesi, M.; Duarte, J.; Elvira, V. D.; Freeman, J.; Gecse, Z.; Gottschalk, E.; Gray, L.; Green, D.; Grünendahl, S.; Gutsche, O.; Harris, R. M.; Hasegawa, S.; Hirschauer, J.; Hu, Z.; Jayatilaka, B.; Jindariani, S.; Johnson, M.; Joshi, U.; Klima, B.; Kreis, B.; Lammel, S.; Lincoln, D.; Lipton, R.; Liu, M.; Liu, T.; Lopes De Sá, R.; Lykken, J.; Maeshima, K.; Magini, N.; Marraffino, J. M.; Maruyama, S.; Mason, D.; McBride, P.; Merkel, P.; Mrenna, S.; Nahn, S.; O'Dell, V.; Pedro, K.; Prokofyev, O.; Rakness, G.; Ristori, L.; Schneider, B.; Sexton-Kennedy, E.; Soha, A.; Spalding, W. J.; Spiegel, L.; Stoynev, S.; Strait, J.; Strobbe, N.; Taylor, L.; Tkaczyk, S.; Tran, N. V.; Uplegger, L.; Vaandering, E. W.; Vernieri, C.; Verzocchi, M.; Vidal, R.; Wang, M.; Weber, H. A.; Whitbeck, A.; Acosta, D.; Avery, P.; Bortignon, P.; Bourilkov, D.; Brinkerhoff, A.; Carnes, A.; Carver, M.; Curry, D.; Field, R. D.; Furic, I. K.; Konigsberg, J.; Korytov, A.; Kotov, K.; Ma, P.; Matchev, K.; Mei, H.; Mitselmakher, G.; Rank, D.; Sperka, D.; Terentyev, N.; Thomas, L.; Wang, J.; Wang, S.; Yelton, J.; Joshi, Y. R.; Linn, S.; Markowitz, P.; Rodriguez, J. L.; Ackert, A.; Adams, T.; Askew, A.; Hagopian, S.; Hagopian, V.; Johnson, K. F.; Kolberg, T.; Martinez, G.; Perry, T.; Prosper, H.; Saha, A.; Santra, A.; Sharma, V.; Yohay, R.; Baarmand, M. M.; Bhopatkar, V.; Colafranceschi, S.; Hohlmann, M.; Noonan, D.; Roy, T.; Yumiceva, F.; Adams, M. R.; Apanasevich, L.; Berry, D.; Betts, R. R.; Cavanaugh, R.; Chen, X.; Evdokimov, O.; Gerber, C. E.; Hangal, D. A.; Hofman, D. J.; Jung, K.; Kamin, J.; Gonzalez, I. D. Sandoval; Tonjes, M. B.; Trauger, H.; Varelas, N.; Wang, H.; Wu, Z.; Zhang, J.; Bilki, B.; Clarida, W.; Dilsiz, K.; Durgut, S.; Gandrajula, R. P.; Haytmyradov, M.; Khristenko, V.; Merlo, J.-P.; Mermerkaya, H.; Mestvirishvili, A.; Moeller, A.; Nachtman, J.; Ogul, H.; Onel, Y.; Ozok, F.; Penzo, A.; Snyder, C.; Tiras, E.; Wetzel, J.; Yi, K.; Blumenfeld, B.; Cocoros, A.; Eminizer, N.; Fehling, D.; Feng, L.; Gritsan, A. V.; Maksimovic, P.; Roskes, J.; Sarica, U.; Swartz, M.; Xiao, M.; You, C.; Al-bataineh, A.; Baringer, P.; Bean, A.; Boren, S.; Bowen, J.; Castle, J.; Khalil, S.; Kropivnitskaya, A.; Majumder, D.; Mcbrayer, W.; Murray, M.; Royon, C.; Sanders, S.; Schmitz, E.; Takaki, J. D. Tapia; Wang, Q.; Ivanov, A.; Kaadze, K.; Maravin, Y.; Mohammadi, A.; Saini, L. K.; Skhirtladze, N.; Toda, S.; Rebassoo, F.; Wright, D.; Anelli, C.; Baden, A.; Baron, O.; Belloni, A.; Calvert, B.; Eno, S. C.; Ferraioli, C.; Hadley, N. J.; Jabeen, S.; Jeng, G. Y.; Kellogg, R. G.; Kunkle, J.; Mignerey, A. C.; Ricci-Tam, F.; Shin, Y. H.; Skuja, A.; Tonwar, S. C.; Abercrombie, D.; Allen, B.; Azzolini, V.; Barbieri, R.; Baty, A.; Bi, R.; Brandt, S.; Busza, W.; Cali, I. A.; D'Alfonso, M.; Demiragli, Z.; Ceballos, G. Gomez; Goncharov, M.; Hsu, D.; Iiyama, Y.; Innocenti, G. M.; Klute, M.; Kovalskyi, D.; Lai, Y. S.; Lee, Y.-J.; Levin, A.; Luckey, P. D.; Maier, B.; Marini, A. C.; Mcginn, C.; Mironov, C.; Narayanan, S.; Niu, X.; Paus, C.; Roland, C.; Roland, G.; Salfeld-Nebgen, J.; Stephans, G. S. F.; Tatar, K.; Velicanu, D.; Wang, J.; Wang, T. W.; Wyslouch, B.; Benvenuti, A. C.; Chatterjee, R. M.; Evans, A.; Hansen, P.; Kalafut, S.; Kubota, Y.; Lesko, Z.; Mans, J.; Nourbakhsh, S.; Ruckstuhl, N.; Rusack, R.; Turkewitz, J.; Acosta, J. G.; Oliveros, S.; Avdeeva, E.; Bloom, K.; Claes, D. R.; Fangmeier, C.; Gonzalez Suarez, R.; Kamalieddin, R.; Kravchenko, I.; Monroy, J.; Siado, J. E.; Snow, G. R.; Stieger, B.; Dolen, J.; Godshalk, A.; Harrington, C.; Iashvili, I.; Nguyen, D.; Parker, A.; Rappoccio, S.; Roozbahani, B.; Alverson, G.; Barberis, E.; Hortiangtham, A.; Massironi, A.; Morse, D. M.; Nash, D.; Orimoto, T.; Teixeira De Lima, R.; Trocino, D.; Wood, D.; Bhattacharya, S.; Charaf, O.; Hahn, K. A.; Mucia, N.; Odell, N.; Pollack, B.; Schmitt, M. H.; Sung, K.; Trovato, M.; Velasco, M.; Dev, N.; Hildreth, M.; Anampa, K. Hurtado; Jessop, C.; Karmgard, D. J.; Kellams, N.; Lannon, K.; Loukas, N.; Marinelli, N.; Meng, F.; Mueller, C.; Musienko, Y.; Planer, M.; Reinsvold, A.; Ruchti, R.; Smith, G.; Taroni, S.; Wayne, M.; Wolf, M.; Woodard, A.; Alimena, J.; Antonelli, L.; Bylsma, B.; Durkin, L. S.; Flowers, S.; Francis, B.; Hart, A.; Hill, C.; Ji, W.; Liu, B.; Luo, W.; Puigh, D.; Winer, B. L.; Wulsin, H. W.; Cooperstein, S.; Driga, O.; Elmer, P.; Hardenbrook, J.; Hebda, P.; Higginbotham, S.; Lange, D.; Luo, J.; Marlow, D.; Mei, K.; Ojalvo, I.; Olsen, J.; Palmer, C.; Piroué, P.; Stickland, D.; Tully, C.; Malik, S.; Norberg, S.; Barker, A.; Barnes, V. E.; Das, S.; Folgueras, S.; Gutay, L.; Jha, M. K.; Jones, M.; Jung, A. W.; Khatiwada, A.; Miller, D. H.; Neumeister, N.; Peng, C. C.; Schulte, J. F.; Sun, J.; Wang, F.; Xie, W.; Cheng, T.; Parashar, N.; Stupak, J.; Adair, A.; Akgun, B.; Chen, Z.; Ecklund, K. M.; Geurts, F. J. M.; Guilbaud, M.; Li, W.; Michlin, B.; Northup, M.; Padley, B. P.; Roberts, J.; Rorie, J.; Tu, Z.; Zabel, J.; Bodek, A.; de Barbaro, P.; Demina, R.; Duh, Y. t.; Ferbel, T.; Galanti, M.; Garcia-Bellido, A.; Han, J.; Hindrichs, O.; Khukhunaishvili, A.; Lo, K. H.; Tan, P.; Verzetti, M.; Ciesielski, R.; Goulianos, K.; Mesropian, C.; Agapitos, A.; Chou, J. P.; Gershtein, Y.; Espinosa, T. A. Gómez; Halkiadakis, E.; Heindl, M.; Hughes, E.; Kaplan, S.; Elayavalli, R. Kunnawalkam; Kyriacou, S.; Lath, A.; Montalvo, R.; Nash, K.; Osherson, M.; Saka, H.; Salur, S.; Schnetzer, S.; Sheffield, D.; Somalwar, S.; Stone, R.; Thomas, S.; Thomassen, P.; Walker, M.; Delannoy, A. G.; Foerster, M.; Heideman, J.; Riley, G.; Rose, K.; Spanier, S.; Thapa, K.; Bouhali, O.; Hernandez, A. Castaneda; Celik, A.; Dalchenko, M.; De Mattia, M.; Delgado, A.; Dildick, S.; Eusebi, R.; Gilmore, J.; Huang, T.; Kamon, T.; Mueller, R.; Pakhotin, Y.; Patel, R.; Perloff, A.; Perniè, L.; Rathjens, D.; Safonov, A.; Tatarinov, A.; Ulmer, K. A.; Akchurin, N.; Damgov, J.; De Guio, F.; Dudero, P. R.; Faulkner, J.; Gurpinar, E.; Kunori, S.; Lamichhane, K.; Lee, S. W.; Libeiro, T.; Peltola, T.; Undleeb, S.; Volobouev, I.; Wang, Z.; Greene, S.; Gurrola, A.; Janjam, R.; Johns, W.; Maguire, C.; Melo, A.; Ni, H.; Padeken, K.; Sheldon, P.; Tuo, S.; Velkovska, J.; Xu, Q.; Arenton, M. W.; Barria, P.; Cox, B.; Hirosky, R.; Joyce, M.; Ledovskoy, A.; Li, H.; Neu, C.; Sinthuprasith, T.; Wang, Y.; Wolfe, E.; Xia, F.; Harr, R.; Karchin, P. E.; Sturdy, J.; Zaleski, S.; Brodski, M.; Buchanan, J.; Caillol, C.; Dasu, S.; Dodd, L.; Duric, S.; Gomber, B.; Grothe, M.; Herndon, M.; Hervé, A.; Hussain, U.; Klabbers, P.; Lanaro, A.; Levine, A.; Long, K.; Loveless, R.; Pierro, G. A.; Polese, G.; Ruggles, T.; Savin, A.; Smith, N.; Smith, W. H.; Taylor, D.; Woods, N.

    2018-02-01

    A search for new physics is carried out in events with at least three electrons or muons in any combination, jets, and missing transverse momentum. Results are based on the sample of proton-proton collision data produced by the LHC at a center-of-mass energy of 13 TeV and collected by the CMS experiment in 2016. The data sample analyzed corresponds to an integrated luminosity of 35.9 fb-1. Events are classified according to the number of b jets, missing transverse momentum, hadronic transverse momentum, and the invariant mass of same-flavor dilepton pairs with opposite charge. No significant excess above the expected standard model background is observed. Exclusion limits at 95% confidence level are computed for four different supersymmetric simplified models with pair production of gluinos or third-generation squarks. In the model with gluino pair production, with subsequent decays into a top quark-antiquark pair and a neutralino, gluinos with masses smaller than 1610 GeV are excluded for a massless lightest supersymmetric particle. In the case of bottom squark pair production, the bottom squark masses are excluded up to 840 GeV for charginos lighter than 200 GeV. For a simplified model of heavy top squark pair production, the \\tilde{t}_2 mass is excluded up to 720, 780, or 710 GeV for models with an exclusive \\tilde{t}_2\\to \\tilde{t}_1H decay, an exclusive \\tilde{t}_2\\to \\tilde{t}_1Z decay, or an equally probable mix of those two decays. In order to provide a simplified version of the analysis for easier interpretation, a small set of aggregate signal regions also has been defined, providing a compromise between simplicity and analysis sensitivity.

  14. Search for supersymmetry in events with at least three electrons or muons, jets, and missing transverse momentum in proton-proton collisions at $$ \\sqrt{s}=13 $$ TeV

    DOE PAGES

    Sirunyan, A. M.; Tumasyan, A.; Adam, W.; ...

    2018-02-12

    Here, a search for new physics is carried out in events with at least three electrons or muons in any combination, jets, and missing transverse momentum. Results are based on the sample of proton-proton collision data produced by the LHC at a center-of-mass energy of 13 TeV and collected by the CMS experiment in 2016. The data sample analyzed corresponds to an integrated luminosity of 35.9 fbmore » $$^{-1}$$. Events are classified according to the number of b jets, missing transverse momentum, hadronic transverse momentum, and the invariant mass of same-flavor dilepton pairs with opposite charge. No significant excess above the expected standard model background is observed. Exclusion limits at 95% confidence level are computed for four different supersymmetric simplified models with pair production of gluinos or third-generation squarks. In the model with gluino pair production, with subsequent decays into a top quark-antiquark pair and a neutralino, gluinos with masses smaller than 1610 GeV are excluded for a massless lightest supersymmetric particle. In the case of bottom squark pair production, the bottom squark masses are excluded up to 840 GeV for charginos lighter than 200 GeV. For a simplified model of heavy top squark pair production, the $$\\mathrm{\\widetilde{\\text{t}}_2}$$ mass is excluded up to 720, 780, or 710 GeV for models with an exclusive $$\\mathrm{\\widetilde{\\text{t}}_2}\\rightarrow\\mathrm{\\widetilde{\\text{t}}_1}\\mathrm{H}$$ decay, an exclusive $$\\mathrm{\\widetilde{\\text{t}}_2}\\rightarrow\\mathrm{\\widetilde{\\text{t}}_1}\\mathrm{Z}$$ decay, or an equally probable mix of those two decays. In order to provide a simplified version of the analysis for easier interpretation, a small set of aggregate signal regions also has been defined, providing a compromise between simplicity and analysis sensitivity.« less

  15. Uninformative Prior Multiple Target Tracking Using Evidential Particle Filters

    NASA Astrophysics Data System (ADS)

    Worthy, J. L., III; Holzinger, M. J.

    Space situational awareness requires the ability to initialize state estimation from short measurements and the reliable association of observations to support the characterization of the space environment. The electro-optical systems used to observe space objects cannot fully characterize the state of an object given a short, unobservable sequence of measurements. Further, it is difficult to associate these short-arc measurements if many such measurements are generated through the observation of a cluster of satellites, debris from a satellite break-up, or from spurious detections of an object. An optimization based, probabilistic short-arc observation association approach coupled with a Dempster-Shafer based evidential particle filter in a multiple target tracking framework is developed and proposed to address these problems. The optimization based approach is shown in literature to be computationally efficient and can produce probabilities of association, state estimates, and covariances while accounting for systemic errors. Rigorous application of Dempster-Shafer theory is shown to be effective at enabling ignorance to be properly accounted for in estimation by augmenting probability with belief and plausibility. The proposed multiple hypothesis framework will use a non-exclusive hypothesis formulation of Dempster-Shafer theory to assign belief mass to candidate association pairs and generate tracks based on the belief to plausibility ratio. The proposed algorithm is demonstrated using simulated observations of a GEO satellite breakup scenario.

  16. Phene Plate (PhP) biochemical fingerprinting. A screening method for epidemiological typing of enterococcal isolates.

    PubMed

    Saeedi, B; Tärnberg, M; Gill, H; Hällgren, A; Jonasson, J; Nilsson, L E; Isaksson, B; Kühn, I; Hanberger, H

    2005-09-01

    Pulsed-field gel electrophoresis (PFGE) is currently considered the gold standard for genotyping of enterococci. However, PFGE is both expensive and time-consuming. The purpose of this study was to investigate whether the PhP system can be used as a reliable clinical screening method for detection of genetically related isolates of enterococci. If so, it should be possible to minimize the number of isolates subjected to PFGE typing, which would save time and money. Ninety-nine clinical enterococcal isolates were analysed by PhP (similarity levels 0.90-0.975) and PFGE (similarity levels < or =3 and < or =6 bands) and all possible pairs of isolates were cross-classified as matched or mismatched. We found that the probability that a pair of isolates (A and B) belonging to the same type according to PhP also belong to the same cluster according to PFGE, i.e. p(A(PFGE)=B(PFGE) * A(PhP)=B(PhP)), and the probability that a pair of isolates of different types according to PhP also belong to different clusters according to PFGE, i.e. p(A(PFGE) not equalB(PFGE) * A(PhP) not equalB(PhP)), was relatively high for E. faecalis (0.86 and 0.96, respectively), but was lower for E. faecium (0.51 and 0.77, respectively). The concordance which shows the probability that PhP and PFGE agree on match or mismatch was 86%-93% for E. faecalis and 54%-66% for E. faecium, which indicates that the PhP method may be useful for epidemiological typing of E. faecalis in the current settings but not for E. faecium.

  17. Generating intrinsically disordered protein conformational ensembles from a Markov chain

    NASA Astrophysics Data System (ADS)

    Cukier, Robert I.

    2018-03-01

    Intrinsically disordered proteins (IDPs) sample a diverse conformational space. They are important to signaling and regulatory pathways in cells. An entropy penalty must be payed when an IDP becomes ordered upon interaction with another protein or a ligand. Thus, the degree of conformational disorder of an IDP is of interest. We create a dichotomic Markov model that can explore entropic features of an IDP. The Markov condition introduces local (neighbor residues in a protein sequence) rotamer dependences that arise from van der Waals and other chemical constraints. A protein sequence of length N is characterized by its (information) entropy and mutual information, MIMC, the latter providing a measure of the dependence among the random variables describing the rotamer probabilities of the residues that comprise the sequence. For a Markov chain, the MIMC is proportional to the pair mutual information MI which depends on the singlet and pair probabilities of neighbor residue rotamer sampling. All 2N sequence states are generated, along with their probabilities, and contrasted with the probabilities under the assumption of independent residues. An efficient method to generate realizations of the chain is also provided. The chain entropy, MIMC, and state probabilities provide the ingredients to distinguish different scenarios using the terminologies: MoRF (molecular recognition feature), not-MoRF, and not-IDP. A MoRF corresponds to large entropy and large MIMC (strong dependence among the residues' rotamer sampling), a not-MoRF corresponds to large entropy but small MIMC, and not-IDP corresponds to low entropy irrespective of the MIMC. We show that MorFs are most appropriate as descriptors of IDPs. They provide a reasonable number of high-population states that reflect the dependences between neighbor residues, thus classifying them as IDPs, yet without very large entropy that might lead to a too high entropy penalty.

  18. Informing Disease Models with Temporal and Spatial Contact Structure among GPS-Collared Individuals in Wild Populations

    PubMed Central

    Williams, David M.; Dechen Quinn, Amy C.; Porter, William F.

    2014-01-01

    Contacts between hosts are essential for transmission of many infectious agents. Understanding how contacts, and thus transmission rates, occur in space and time is critical to effectively responding to disease outbreaks in free-ranging animal populations. Contacts between animals in the wild are often difficult to observe or measure directly. Instead, one must infer contacts from metrics such as proximity in space and time. Our objective was to examine how contacts between white-tailed deer (Odocoileus virginianus) vary in space and among seasons. We used GPS movement data from 71 deer in central New York State to quantify potential direct contacts between deer and indirect overlap in space use across time and space. Daily probabilities of direct contact decreased from winter (0.05–0.14), to low levels post-parturition through summer (0.00–0.02), and increased during the rut to winter levels. The cumulative distribution for the spatial structure of direct and indirect contact probabilities around a hypothetical point of occurrence increased rapidly with distance for deer pairs separated by 1,000 m – 7,000 m. Ninety-five percent of the probabilities of direct contact occurred among deer pairs within 8,500 m of one another, and 99% within 10,900 m. Probabilities of indirect contact accumulated across greater spatial extents: 95% at 11,900 m and 99% at 49,000 m. Contacts were spatially consistent across seasons, indicating that although contact rates differ seasonally, they occur proportionally across similar landscape extents. Distributions of contact probabilities across space can inform management decisions for assessing risk and allocating resources in response. PMID:24409293

  19. Molecular recognition of DNA base pairs by the formamido/pyrrole and formamido/imidazole pairings in stacked polyamides.

    PubMed

    Buchmueller, Karen L; Staples, Andrew M; Uthe, Peter B; Howard, Cameron M; Pacheco, Kimberly A O; Cox, Kari K; Henry, James A; Bailey, Suzanna L; Horick, Sarah M; Nguyen, Binh; Wilson, W David; Lee, Moses

    2005-01-01

    Polyamides containing an N-terminal formamido (f) group bind to the minor groove of DNA as staggered, antiparallel dimers in a sequence-specific manner. The formamido group increases the affinity and binding site size, and it promotes the molecules to stack in a staggered fashion thereby pairing itself with either a pyrrole (Py) or an imidazole (Im). There has not been a systematic study on the DNA recognition properties of the f/Py and f/Im terminal pairings. These pairings were analyzed here in the context of f-ImPyPy, f-ImPyIm, f-PyPyPy and f-PyPyIm, which contain the central pairing modes, -ImPy- and -PyPy-. The specificity of these triamides towards symmetrical recognition sites allowed for the f/Py and f/Im terminal pairings to be directly compared by SPR, CD and DeltaT (M) experiments. The f/Py pairing, when placed next to the -ImPy- or -PyPy- central pairings, prefers A/T and T/A base pairs to G/C base pairs, suggesting that f/Py has similar DNA recognition specificity to Py/Py. With -ImPy- central pairings, f/Im prefers C/G base pairs (>10 times) to the other Watson-Crick base pairs; therefore, f/Im behaves like the Py/Im pair. However, the f/Im pairing is not selective for the C/G base pair when placed next to the -PyPy- central pairings.

  20. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mazurkiewicz, Kamil; Haranczyk, Maciej; Gutowski, Maciej S.

    The electron affinity and the propensity to electron-induced proton transfer (PT) of hydrogen-bonded complexes between the Watson–Crick adenine–thymine pair (AT) and simple organic acid (HX), attached to adenine in the Hoogsteen-type configuration, were studied at the B3LYP/6-31+G** level. Although the carboxyl group is deprotonated at physiological pH, its neutral form, COOH, resembles the peptide bond or the amide fragment in the side chain of asparagine (Asn) or glutamine (Gln). Thus, these complexes mimic the interaction between the DNA environment (e.g., proteins) and nucleobase pairs incorporated in the biopolymer. Electron attachment is thermodynamically feasible and adiabatic electron affinities range from 0.41more » to 1.28 eV, while the vertical detachment energies of the resulting anions span the range of 0.39 –2.88 eV. Low-energy activation barriers separate the anionic minima: aHX(AT) from the more stable single-PT anionic geometry, aHX(AT)-SPT, and aHX(AT)-SPT from the double-PT anionic geometry, aHX(AT)-DPT. Interaction between the adenine of the Watson–Crick AT base pair with an acidic proton donor probably counterbalances the larger EA of isolated thymine, as SOMO is almost evenly delocalized over both types of nucleic bases in the aHX(AT) anions. Moreover, as a result of PT the excess electron localizes entirely on adenine. Thus, in DNA interacting with its physiological environment, damage induced by low-energy electrons could begin, contrary to the current view, with the formation of purine anions, which are not formed in isolated DNA because of the greater stability of anionic pyrimidines.« less

  1. Brood size and its importance for nestling growth in the Biscutate Swift (Streptoprocne biscutata, Aves: Apodidae).

    PubMed

    Pichorim, M; Monteiro-Filho, E L A

    2008-11-01

    Many Apodidae, including Streptoprocne biscutata (Sclater, 1866), drop eggs from their nests during incubation. This is interpreted as nest site competition or accident. We provide evidence that egg ejection is deliberate and that this behaviour controls the brood size. Brood sizes were manipulated and nestling growth was measured to test the hypothesis that pairs can regulate brood size during incubation based on current ability to rear nestlings. Natural (control) broods with one, two and three nestlings, and manipulated (experimental) broods reduced to one and increased to two and three young were monitored. Growth rates were measured based on weight, and wing, tail and tarsus lengths of natural and manipulated broods. We compared the slopes of each measure's regression lines of the nestlings of each brood size by t-test. Nestling growth of control nests was similar and relatively little associated with brood size. In broods reduced to one nestling, weight, wing and tail had greater growth rates, and in broods increased to three nestlings growth rates were lower. Weight was most, and tarsus length least influenced by brood size. In general, nestling growth of manipulated nests was inversely proportional to brood size. The results suggest that pairs with larger clutches are in better physical conditions than others. Thus, in experimental broods, pairs are over or under-loaded because feeding activities increase or decrease and these changes affect the growth rate of the nestlings. The present study suggests that egg ejection can control brood size. This behaviour is probably stimulated by physical changes in the adult birds during incubation.

  2. Unique Thermal Stability of Unnatural Hydrophobic Ds Bases in Double-Stranded DNAs.

    PubMed

    Kimoto, Michiko; Hirao, Ichiro

    2017-10-20

    Genetic alphabet expansion technology, the introduction of unnatural bases or base pairs into replicable DNA, has rapidly advanced as a new synthetic biology area. A hydrophobic unnatural base pair between 7-(2-thienyl)imidazo[4,5-b]pyridine (Ds) and 2-nitro-4-propynylpyrrole (Px) exhibited high fidelity as a third base pair in PCR. SELEX methods using the Ds-Px pair enabled high-affinity DNA aptamer generation, and introducing a few Ds bases into DNA aptamers extremely augmented their affinities and selectivities to target proteins. Here, to further scrutinize the functions of this highly hydrophobic Ds base, the thermal stabilities of double-stranded DNAs (dsDNA) containing a noncognate Ds-Ds or G-Ds pair were examined. The thermal stability of the Ds-Ds self-pair was as high as that of the natural G-C pair, and apart from the generally higher stability of the G-C pair than that of the A-T pair, most of the 5'-pyrimidine-Ds-purine-3' sequences, such as CDsA and TDsA, exhibited higher stability than the 5'-purine-Ds-pyrimidine-3' sequences, such as GDsC and ADsC, in dsDNAs. This trait enabled the GC-content-independent control of the thermal stability of the designed dsDNA fragments. The melting temperatures of dsDNA fragments containing the Ds-Ds pair can be predicted from the nearest-neighbor parameters including the Ds base. In addition, the noncognate G-Ds pair can efficiently distinguish its neighboring cognate natural base pairs from noncognate pairs. We demonstrated that real-time PCR using primers containing Ds accurately detected a single-nucleotide mismatch in target DNAs. These unique properties of the Ds base that affect the stabilities of the neighboring base pairs could impart new functions to DNA molecules and technologies.

  3. Validation of an automated fluorescein method for determining bromide in water

    USGS Publications Warehouse

    Fishman, M. J.; Schroder, L.J.; Friedman, L.C.

    1985-01-01

    Surface, atmospheric precipitation and deionized water samples were spiked with ??g l-1 concentrations of bromide, and the solutions stored in polyethylene and polytetrafluoroethylene bottles. Bromide was determined periodically for 30 days. Automated fluorescein and ion chromatography methods were used to determine bromide in these prepared samples. Analysis of the data by the paired t-test indicates that the two methods are not significantly different at a probability of 95% for samples containing from 0.015 to 0.5 mg l-1 of bromide. The correlation coefficient for the same sets of paired data is 0.9987. Recovery data, except for the surface water samples to which 0.005 mg l-1 of bromide was added, range from 89 to 112%. There appears to be no loss of bromide from solution in either type of container.Surface, atmospheric precipitation and deionized water samples were spiked with mu g l** minus **1 concentrations of bromide, and the solutions stored in polyethylene and polytetrafluoroethylene bottles. Bromide was determined periodically for 30 days. Automated fluorescein and ion chromatography methods were used to determine bromide in these prepared samples. Analysis of the data by the paired t-test indicates that the two methods are not significantly different at a probability of 95% for samples containing from 0. 015 to 0. 5 mg l** minus **1 of bromide. The correlation coefficient for the same sets of paired data is 0. 9987. Recovery data, except for the surface water samples to which 0. 005 mg l** minus **1 of bromide was added, range from 89 to 112%. Refs.

  4. We are not the 99 percent: quantifying asphericity in the distribution of Local Group satellites

    NASA Astrophysics Data System (ADS)

    Forero-Romero, Jaime E.; Arias, Verónica

    2018-05-01

    We use simulations to build an analytic probability distribution for the asphericity in the satellite distribution around Local Group (LG) type galaxies in the Lambda Cold Dark Matter (LCDM) paradigm. We use this distribution to estimate the atypicality of the satellite distributions in the LG even when the underlying simulations do not have enough systems fully resembling the LG in terms of its typical masses, separation and kinematics. We demonstrate the method using three different simulations (Illustris-1, Illustris-1-Dark and ELVIS) and a number of satellites ranging from 11 to 15. Detailed results differ greatly among the simulations suggesting a strong influence of the typical DM halo mass, the number of satellites and the simulated baryonic effects. However, there are three common trends. First, at most 2% of the pairs are expected to have satellite distributions with the same asphericity as the LG; second, at most 80% of the pairs have a halo with a satellite distribution as aspherical as in M31; and third, at most 4% of the pairs have a halo with satellite distribution as planar as in the MW. These quantitative results place the LG at the level of a 3σ outlier in the LCDM paradigm. We suggest that understanding the reasons for this atypicality requires quantifying the asphericity probability distribution as a function of halo mass and large scale environment. The approach presented here can facilitate that kind of study and other comparisons between different numerical setups and choices to study satellites around LG pairs in simulations.

  5. Environmental correlates of breeding in the Crested Caracara (Caracara cheriway)

    USGS Publications Warehouse

    Morrison, J.L.; Pias, Kyle E.; Cohen, J.B.; Catlin, D.H.

    2009-01-01

    We evaluated the influence of weather on reproduction of the Crested Caracara (Caracara cheriway) in an agricultural landscape in south-central Florida. We used a mixed logistic-regression modeling approach within an information-theoretic framework to examine the influence of total rainfall, rainfall frequency, and temperature on the number of breeding pairs, timing of breeding, nest success, and productivity of Crested Caracaras during 1994–2000. The best models indicated an influence of rainfall frequency and laying period on reproduction. More individuals nested and more pairs nested earlier during years with more frequent rainfall in late summer and early fall. Pairs that nested later in each breeding season had smaller clutches, lower nest success and productivity, and higher probability of nest failure. More frequent rainfall during early spring months that are usually characterized by water deficit (March–May), more frequent rainfall during the fall drawdown period (September–November), and a shorter winter dry period showed some association with higher probability of brood reduction and lower nest success. The proportion of nests that failed was higher in “wet” years, when total rainfall during the breeding season (September–April) was >10% above the 20-year average. Rainfall may influence reproduction in Crested Caracaras indirectly through food resources. As total rainfall increased during February–April, when most pairs are feeding nestlings or dependent fledglings, the proportion of drawdown-dependent species (those that become available as rainfall decreases and wetlands become isolated and shallow) in the diet of Crested Caracaras declined, which may indicate reduced availability of foraging habitat for this primarily terrestrial raptor.

  6. Fluctuation theorem for entropy production during effusion of a relativistic ideal gas.

    PubMed

    Cleuren, B; Willaert, K; Engel, A; Van den Broeck, C

    2008-02-01

    The probability distribution of the entropy production for the effusion of a relativistic ideal gas is calculated explicitly. This result is then extended to include particle and antiparticle pair production and annihilation. In both cases, the fluctuation theorem is verified.

  7. On the joint spectral density of bivariate random sequences. Thesis Technical Report No. 21

    NASA Technical Reports Server (NTRS)

    Aalfs, David D.

    1995-01-01

    For univariate random sequences, the power spectral density acts like a probability density function of the frequencies present in the sequence. This dissertation extends that concept to bivariate random sequences. For this purpose, a function called the joint spectral density is defined that represents a joint probability weighing of the frequency content of pairs of random sequences. Given a pair of random sequences, the joint spectral density is not uniquely determined in the absence of any constraints. Two approaches to constraining the sequences are suggested: (1) assume the sequences are the margins of some stationary random field, (2) assume the sequences conform to a particular model that is linked to the joint spectral density. For both approaches, the properties of the resulting sequences are investigated in some detail, and simulation is used to corroborate theoretical results. It is concluded that under either of these two constraints, the joint spectral density can be computed from the non-stationary cross-correlation.

  8. A directional nucleation-zipping mechanism for triple helix formation

    PubMed Central

    Alberti, Patrizia; Arimondo, Paola B.; Mergny, Jean-Louis; Garestier, Thérèse; Hélène, Claude; Sun, Jian-Sheng

    2002-01-01

    A detailed kinetic study of triple helix formation was performed by surface plasmon resonance. Three systems were investigated involving 15mer pyrimidine oligonucleotides as third strands. Rate constants and activation energies were validated by comparison with thermodynamic values calculated from UV-melting analysis. Replacement of a T·A base pair by a C·G pair at either the 5′ or the 3′ end of the target sequence allowed us to assess mismatch effects and to delineate the mechanism of triple helix formation. Our data show that the association rate constant is governed by the sequence of base triplets on the 5′ side of the triplex (referred to as the 5′ side of the target oligopurine strand) and provides evidence that the reaction pathway for triple helix formation in the pyrimidine motif proceeds from the 5′ end to the 3′ end of the triplex according to the nucleation-zipping model. It seems that this is a general feature for all triple helices formation, probably due to the right-handedness of the DNA double helix that provides a stronger base stacking at the 5′ than at the 3′ duplex–triplex junction. Understanding the mechanism of triple helix formation is not only of fundamental interest, but may also help in designing better triple helix-forming oligonucleotides for gene targeting and control of gene expression. PMID:12490709

  9. Probability, not linear summation, mediates the detection of concentric orientation-defined textures.

    PubMed

    Schmidtmann, Gunnar; Jennings, Ben J; Bell, Jason; Kingdom, Frederick A A

    2015-01-01

    Previous studies investigating signal integration in circular Glass patterns have concluded that the information in these patterns is linearly summed across the entire display for detection. Here we test whether an alternative form of summation, probability summation (PS), modeled under the assumptions of Signal Detection Theory (SDT), can be rejected as a model of Glass pattern detection. PS under SDT alone predicts that the exponent β of the Quick- (or Weibull-) fitted psychometric function should decrease with increasing signal area. We measured spatial integration in circular, radial, spiral, and parallel Glass patterns, as well as comparable patterns composed of Gabors instead of dot pairs. We measured the signal-to-noise ratio required for detection as a function of the size of the area containing signal, with the remaining area containing dot-pair or Gabor-orientation noise. Contrary to some previous studies, we found that the strength of summation never reached values close to linear summation for any stimuli. More importantly, the exponent β systematically decreased with signal area, as predicted by PS under SDT. We applied a model for PS under SDT and found that it gave a good account of the data. We conclude that probability summation is the most likely basis for the detection of circular, radial, spiral, and parallel orientation-defined textures.

  10. Sympatric occurrence of four cytotypes and one extra chromosome in Bryconamericus ecai (Characidae): 18S rDNA polymorphism and heterochromatin composition.

    PubMed

    dos Santos, Angélica Rossotti; Rubert, Marceléia; Giuliano-Caetano, Lucia; Dias, Ana Lúcia

    2012-02-01

    In the present study, specimens of Bryconamericus ecai collected from the Forquetinha River/RS, were cytogenetically analyzed, disclosing a wide karyotypic diversity in this species. All individuals had 2n = 50, with different karyotypic formulae, resulting in four cytotypes and one B macrochromosome observed in cytotype III. Heterochromatin was distributed in the pericentromeric region of most chromosomes on the four cytotypes and also on a chromosome pair with interstitial markings in cytotype IV. Staining with CMA(3) and DAPI fluorochromes revealed a C-band region rich in AT base pairs in cytotypes I, II and III, and a pair with GC-rich heterochromatin in cytotypes II and III. Cytotype IV presented CMA(3) and DAPI positive heterochromatin. Silver nitrate impregnation, in situ hybridization, and fluorochrome staining showed a multiple system of AgNORs, 18S rDNA and CMA(3) sites in cytotypes I, III and IV, with both inter-and intraindividual variability in the number and location of these sites. Cytotype II had only one pair of NORs coincident with the 18S rDNA and CMA(3) sites, indicating a simple system. The chromosomal polymorphism observed among the specimens of B. ecai added to the literature data show that chromosomal rearrangements, especially pericentric inversions, play an important role in the karyotypic evolution of this group of fish. It can also be implied that more than one species of Bryconamericus is probably occurring, living in sympatry in the Forquetinha River/RS. © 2012 The Authors.

  11. Influence of Glu/Arg, Asp/Arg, and Glu/Lys Salt Bridges on α-Helical Stability and Folding Kinetics.

    PubMed

    Meuzelaar, Heleen; Vreede, Jocelyne; Woutersen, Sander

    2016-06-07

    Using a combination of ultraviolet circular dichroism, temperature-jump transient-infrared spectroscopy, and molecular dynamics simulations, we investigate the effect of salt bridges between different types of charged amino-acid residue pairs on α-helix folding. We determine the stability and the folding and unfolding rates of 12 alanine-based α-helical peptides, each of which has a nearly identical composition containing three pairs of positively and negatively charged residues (either Glu(-)/Arg(+), Asp(-)/Arg(+), or Glu(-)/Lys(+)). Within each set of peptides, the distance and order of the oppositely charged residues in the peptide sequence differ, such that they have different capabilities of forming salt bridges. Our results indicate that stabilizing salt bridges (in which the interacting residues are spaced and ordered such that they favor helix formation) speed up α-helix formation by up to 50% and slow down the unfolding of the α-helix, whereas salt bridges with an unfavorable geometry have the opposite effect. Comparing the peptides with different types of charge pairs, we observe that salt bridges between side chains of Glu(-) and Arg(+) are most favorable for the speed of folding, probably because of the larger conformational space of the salt-bridging Glu(-)/Arg(+) rotamer pairs compared to Asp(-)/Arg(+) and Glu(-)/Lys(+). We speculate that the observed impact of salt bridges on the folding kinetics might explain why some proteins contain salt bridges that do not stabilize the final, folded conformation. Copyright © 2016 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  12. Molecular recognition of DNA base pairs by the formamido/pyrrole and formamido/imidazole pairings in stacked polyamides

    PubMed Central

    Buchmueller, Karen L.; Staples, Andrew M.; Uthe, Peter B.; Howard, Cameron M.; Pacheco, Kimberly A. O.; Cox, Kari K.; Henry, James A.; Bailey, Suzanna L.; Horick, Sarah M.; Nguyen, Binh; Wilson, W. David; Lee, Moses

    2005-01-01

    Polyamides containing an N-terminal formamido (f) group bind to the minor groove of DNA as staggered, antiparallel dimers in a sequence-specific manner. The formamido group increases the affinity and binding site size, and it promotes the molecules to stack in a staggered fashion thereby pairing itself with either a pyrrole (Py) or an imidazole (Im). There has not been a systematic study on the DNA recognition properties of the f/Py and f/Im terminal pairings. These pairings were analyzed here in the context of f-ImPyPy, f-ImPyIm, f-PyPyPy and f-PyPyIm, which contain the central pairing modes, –ImPy– and –PyPy–. The specificity of these triamides towards symmetrical recognition sites allowed for the f/Py and f/Im terminal pairings to be directly compared by SPR, CD and ΔTM experiments. The f/Py pairing, when placed next to the –ImPy– or –PyPy– central pairings, prefers A/T and T/A base pairs to G/C base pairs, suggesting that f/Py has similar DNA recognition specificity to Py/Py. With –ImPy– central pairings, f/Im prefers C/G base pairs (>10 times) to the other Watson–Crick base pairs; therefore, f/Im behaves like the Py/Im pair. However, the f/Im pairing is not selective for the C/G base pair when placed next to the –PyPy– central pairings. PMID:15703305

  13. Think Pair Share with Formative Assessment for Junior High School Student

    NASA Astrophysics Data System (ADS)

    Pradana, O. R. Y.; Sujadi, I.; Pramudya, I.

    2017-09-01

    Geometry is a science related to abstract thinking ability so that not many students are able to understand this material well. In this case, the learning model plays a crucial role in improving student achievement. This means that a less precise learning model will cause difficulties for students. Therefore, this study provides a quantitative explanation of the Think Pair Share learning model combined with the formative assessment. This study aims to test the Think Pair Share with the formative assessment on junior high school students. This research uses a quantitative approach of Pretest-Posttest in control group and experiment group. ANOVA test and Scheffe test used to analyse the effectiveness this learning. Findings in this study are student achievement on the material geometry with Think Pair Share using formative assessment has increased significantly. This happens probably because this learning makes students become more active during learning. Hope in the future, Think Pair Share with formative assessment be a useful learning for teachers and this learning applied by the teacher around the world especially on the material geometry.

  14. Base-Pairing Energies of Protonated Nucleoside Base Pairs of dCyd and m5dCyd: Implications for the Stability of DNA i-Motif Conformations

    NASA Astrophysics Data System (ADS)

    Yang, Bo; Rodgers, M. T.

    2015-08-01

    Hypermethylation of cytosine in expanded (CCG)n•(CGG)n trinucleotide repeats results in Fragile X syndrome, the most common cause of inherited mental retardation. The (CCG)n•(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of protonated base pairs of cytosine. Here we investigate the effects of 5-methylation and the sugar moiety on the base-pairing energies (BPEs) of protonated cytosine base pairs by examining protonated nucleoside base pairs of 2'-deoxycytidine (dCyd) and 5-methyl-2'-deoxycytidine (m5dCyd) using threshold collision-induced dissociation techniques. 5-Methylation of a single or both cytosine residues leads to very small change in the BPE. However, the accumulated effect may be dramatic in diseased state trinucleotide repeats where many methylated base pairs may be present. The BPEs of the protonated nucleoside base pairs examined here significantly exceed those of Watson-Crick dGuo•dCyd and neutral dCyd•dCyd base pairs, such that these base-pairing interactions provide the major forces responsible for stabilization of DNA i-motif conformations. Compared with isolated protonated nucleobase pairs of cytosine and 1-methylcytosine, the 2'-deoxyribose sugar produces an effect similar to the 1-methyl substituent, and leads to a slight decrease in the BPE. These results suggest that the base-pairing interactions may be slightly weaker in nucleic acids, but that the extended backbone is likely to exert a relatively small effect on the total BPE. The proton affinity (PA) of m5dCyd is also determined by competitive analysis of the primary dissociation pathways that occur in parallel for the protonated (m5dCyd)H+(dCyd) nucleoside base pair and the absolute PA of dCyd previously reported.

  15. Nodal infection in Markovian susceptible-infected-susceptible and susceptible-infected-removed epidemics on networks are non-negatively correlated

    NASA Astrophysics Data System (ADS)

    Cator, E.; Van Mieghem, P.

    2014-05-01

    By invoking the famous Fortuin, Kasteleyn, and Ginibre (FKG) inequality, we prove the conjecture that the correlation of infection at the same time between any pair of nodes in a network cannot be negative for (exact) Markovian susceptible-infected-susceptible (SIS) and susceptible-infected-removed (SIR) epidemics on networks. The truth of the conjecture establishes that the N-intertwined mean-field approximation (NIMFA) upper bounds the infection probability in any graph so that network design based on NIMFA always leads to safe protections against malware spread. However, when the infection or/and curing are not Poisson processes, the infection correlation between two nodes can be negative.

  16. Nodal infection in Markovian susceptible-infected-susceptible and susceptible-infected-removed epidemics on networks are non-negatively correlated.

    PubMed

    Cator, E; Van Mieghem, P

    2014-05-01

    By invoking the famous Fortuin, Kasteleyn, and Ginibre (FKG) inequality, we prove the conjecture that the correlation of infection at the same time between any pair of nodes in a network cannot be negative for (exact) Markovian susceptible-infected-susceptible (SIS) and susceptible-infected-removed (SIR) epidemics on networks. The truth of the conjecture establishes that the N-intertwined mean-field approximation (NIMFA) upper bounds the infection probability in any graph so that network design based on NIMFA always leads to safe protections against malware spread. However, when the infection or/and curing are not Poisson processes, the infection correlation between two nodes can be negative.

  17. The interaction between vocabulary size and phonotactic probability effects on children's production accuracy and fluency in nonword repetition.

    PubMed

    Edwards, Jan; Beckman, Mary E; Munson, Benjamin

    2004-04-01

    Adults' performance on a variety of tasks suggests that phonological processing of nonwords is grounded in generalizations about sublexical patterns over all known words. A small body of research suggests that children's phonological acquisition is similarly based on generalizations over the lexicon. To test this account, production accuracy and fluency were examined in nonword repetitions by 104 children and 22 adults. Stimuli were 22 pairs of nonwords, in which one nonword contained a low-frequency or unattested two-phoneme sequence and the other contained a high-frequency sequence. For a subset of these nonword pairs, segment durations were measured. The same sound was produced with a longer duration (less fluently) when it appeared in a low-frequency sequence, as compared to a high-frequency sequence. Low-frequency sequences were also repeated with lower accuracy than high-frequency sequences. Moreover, children with smaller vocabularies showed a larger influence of frequency on accuracy than children with larger vocabularies. Taken together, these results provide support for a model of phonological acquisition in which knowledge of sublexical units emerges from generalizations made over lexical items.

  18. Computer simulation on the collision-sticking dynamics of two colloidal particles in an optical trap.

    PubMed

    Xu, Shenghua; Sun, Zhiwei

    2007-04-14

    Collisions of a particle pair induced by optical tweezers have been employed to study colloidal stability. In order to deepen insights regarding the collision-sticking dynamics of a particle pair in the optical trap that were observed in experimental approaches at the particle level, the authors carry out a Brownian dynamics simulation. In the simulation, various contributing factors, including the Derjaguin-Landau-Verwey-Overbeek interaction of particles, hydrodynamic interactions, optical trapping forces on the two particles, and the Brownian motion, were all taken into account. The simulation reproduces the tendencies of the accumulated sticking probability during the trapping duration for the trapped particle pair described in our previous study and provides an explanation for why the two entangled particles in the trap experience two different statuses.

  19. Quadratic RK shooting solution for a environmental parameter prediction boundary value problem

    NASA Astrophysics Data System (ADS)

    Famelis, Ioannis Th.; Tsitouras, Ch.

    2014-10-01

    Using tools of Information Geometry, the minimum distance between two elements of a statistical manifold is defined by the corresponding geodesic, e.g. the minimum length curve that connects them. Such a curve, where the probability distribution functions in the case of our meteorological data are two parameter Weibull distributions, satisfies a 2nd order Boundary Value (BV) system. We study the numerical treatment of the resulting special quadratic form system using Shooting method. We compare the solutions of the problem when we employ a classical Singly Diagonally Implicit Runge Kutta (SDIRK) 4(3) pair of methods and a quadratic SDIRK 5(3) pair . Both pairs have the same computational costs whereas the second one attains higher order as it is specially constructed for quadratic problems.

  20. Relative commutativity degree of some dihedral groups

    NASA Astrophysics Data System (ADS)

    Abdul Hamid, Muhanizah; Mohd Ali, Nor Muhainiah; Sarmin, Nor Haniza; Abd Manaf, Fadila Normahia

    2013-04-01

    The commutativity degree of a finite group G was introduced by Erdos and Turan for symmetric groups, finite groups and finite rings in 1968. The commutativity degree, P(G), is defined as the probability that a random pair of elements in a group commute. The relative commutativity degree of a group G is defined as the probability for an element of subgroup, H and an element of G to commute with one another and denoted by P(H,G). In this research the relative commutativity degree of some dihedral groups are determined.

  1. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

    PubMed

    Takezawa, Yusuke; Shionoya, Mitsuhiko

    2012-12-18

    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional DNA molecules such as artificial DNAzymes and DNA machines. In addition, the metallo-base pairing system is a powerful tool for the construction of homogeneous and heterogeneous metal arrays, which can lead to DNA-based nanomaterials such as electronic wires and magnetic devices. Recently researchers have investigated these systems as enzyme replacements, which may offer an additional contribution to chemical biology and synthetic biology through the expansion of the genetic alphabet.

  2. Theoretical determination of one-electron redox potentials for DNA bases, base pairs, and stacks.

    PubMed

    Paukku, Y; Hill, G

    2011-05-12

    Electron affinities, ionization potentials, and redox potentials for DNA bases, base pairs, and N-methylated derivatives are computed at the DFT/M06-2X/6-31++G(d,p) level of theory. Redox properties of a guanine-guanine stack model are explored as well. Reduction and oxidation potentials are in good agreement with the experimental ones. Electron affinities of base pairs were found to be negative. Methylation of canonical bases affects the ionization potentials the most. Base pair formation and base stacking lower ionization potentials by 0.3 eV. Pairing of guanine with the 5-methylcytosine does not seem to influence the redox properties of this base pair much.

  3. Towards a Holistic Cortical Thickness Descriptor: Heat Kernel-Based Grey Matter Morphology Signatures.

    PubMed

    Wang, Gang; Wang, Yalin

    2017-02-15

    In this paper, we propose a heat kernel based regional shape descriptor that may be capable of better exploiting volumetric morphological information than other available methods, thereby improving statistical power on brain magnetic resonance imaging (MRI) analysis. The mechanism of our analysis is driven by the graph spectrum and the heat kernel theory, to capture the volumetric geometry information in the constructed tetrahedral meshes. In order to capture profound brain grey matter shape changes, we first use the volumetric Laplace-Beltrami operator to determine the point pair correspondence between white-grey matter and CSF-grey matter boundary surfaces by computing the streamlines in a tetrahedral mesh. Secondly, we propose multi-scale grey matter morphology signatures to describe the transition probability by random walk between the point pairs, which reflects the inherent geometric characteristics. Thirdly, a point distribution model is applied to reduce the dimensionality of the grey matter morphology signatures and generate the internal structure features. With the sparse linear discriminant analysis, we select a concise morphology feature set with improved classification accuracies. In our experiments, the proposed work outperformed the cortical thickness features computed by FreeSurfer software in the classification of Alzheimer's disease and its prodromal stage, i.e., mild cognitive impairment, on publicly available data from the Alzheimer's Disease Neuroimaging Initiative. The multi-scale and physics based volumetric structure feature may bring stronger statistical power than some traditional methods for MRI-based grey matter morphology analysis. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Base pairing and base mis-pairing in nucleic acids

    NASA Technical Reports Server (NTRS)

    Wang, A. H. J.; Rich, A.

    1986-01-01

    In recent years we have learned that DNA is conformationally active. It can exist in a number of different stable conformations including both right-handed and left-handed forms. Using single crystal X-ray diffraction analysis we are able to discover not only additional conformations of the nucleic acids but also different types of hydrogen bonded base-base interactions. Although Watson-Crick base pairings are the predominant type of interaction in double helical DNA, they are not the only types. Recently, we have been able to examine mismatching of guanine-thymine base pairs in left-handed Z-DNA at atomic resolution (1A). A minimum amount of distortion of the sugar phosphate backbone is found in the G x T pairing in which the bases are held together by two hydrogen bonds in the wobble pairing interaction. Because of the high resolution of the analysis we can visualize water molecules which fill in to accommodate the other hydrogen bonding positions in the bases which are not used in the base-base interactions. Studies on other DNA oligomers have revealed that other types of non-Watson-Crick hydrogen bonding interactions can occur. In the structure of a DNA octamer with the sequence d(GCGTACGC) complexed to an antibiotic triostin A, it was found that the two central AT base pairs are held together by Hoogsteen rather than Watson-Crick base pairs. Similarly, the G x C base pairs at the ends are also Hoogsteen rather than Watson-Crick pairing. Hoogsteen base pairs make a modified helix which is distinct from the Watson-Crick double helix.

  5. Hidden in Plain Sight: Subtle Effects of the 8-Oxoguanine Lesion on the Structure, Dynamics, and Thermodynamics of a 15-Base-Pair Oligodeoxynucleotide Duplex†

    PubMed Central

    Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.

    2011-01-01

    The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242

  6. Neural Signatures of Intransitive Preferences

    PubMed Central

    Kalenscher, Tobias; Tobler, Philippe N.; Huijbers, Willem; Daselaar, Sander M.; Pennartz, Cyriel M.A.

    2010-01-01

    It is often assumed that decisions are made by rank-ordering and thus comparing the available choice options based on their subjective values. Rank-ordering requires that the alternatives’ subjective values are mentally represented at least on an ordinal scale. Because one alternative cannot be at the same time better and worse than another alternative, choices should satisfy transitivity (if alternative A is preferred over B, and B is preferred over C, A should be preferred over C). Yet, individuals often demonstrate striking violations of transitivity (preferring C over A). We used functional magnetic resonance imaging to study the neural correlates of intransitive choices between gambles varying in magnitude and probability of financial gains. Behavioral intransitivities were common. They occurred because participants did not evaluate the gambles independently, but in comparison with the alternative gamble presented. Neural value signals in prefrontal and parietal cortex were not ordinal-scaled and transitive, but reflected fluctuations in the gambles’ local, pairing-dependent preference-ranks. Detailed behavioral analysis of gamble preferences showed that, depending on the difference in the offered gambles’ attributes, participants gave variable priority to magnitude or probability and thus shifted between preferring richer or safer gambles. The variable, context-dependent priority given to magnitude and probability was tracked by insula (magnitude) and posterior cingulate (probability). Their activation-balance may reflect the individual decision rules leading to intransitivities. Thus, the phenomenon of intransitivity is reflected in the organization of the neural systems involved in risky decision-making. PMID:20814565

  7. Social pairing of Seychelles warblers under reduced constraints: MHC, neutral heterozygosity, and age

    PubMed Central

    Wright, David J.; Brouwer, Lyanne; Mannarelli, Maria-Elena; Burke, Terry; Komdeur, Jan

    2016-01-01

    The prevalence and significance of precopulatory mate choice remains keenly debated. The major histocompatibility complex (MHC) plays a key role in vertebrate adaptive immunity, and variation at the MHC influences individual survival. Although MHC-dependent mate choice has been documented in certain species, many other studies find no such pattern. This may be, at least in part, because in natural systems constraints may reduce the choices available to individuals and prevent full expression of underlying preferences. We used translocations to previously unoccupied islands to experimentally reduce constraints on female social mate choice in the Seychelles warbler (Acrocephalus sechellensis), a species in which patterns of MHC-dependent extrapair paternity (EPP), but not social mate choice, have been observed. We find no evidence of MHC-dependent social mate choice in the new populations. Instead, we find that older males and males with more microsatellite heterozygosity are more likely to have successfully paired. Our data cannot resolve whether these patterns in pairing were due to male–male competition or female choice. However, our research does suggest that female Seychelles warblers do not choose social mates using MHC class I to increase fitness. It may also indicate that the MHC-dependent EPP observed in the source population is probably due to mechanisms other than female precopulatory mate choice based on MHC cues. PMID:26792973

  8. Structural landscape of base pairs containing post-transcriptional modifications in RNA

    PubMed Central

    Seelam, Preethi P.; Sharma, Purshotam

    2017-01-01

    Base pairs involving post-transcriptionally modified nucleobases are believed to play important roles in a wide variety of functional RNAs. Here we present our attempts toward understanding the structural and functional role of naturally occurring modified base pairs using a combination of X-ray crystal structure database analysis, sequence analysis, and advanced quantum chemical methods. Our bioinformatics analysis reveals that despite their presence in all major secondary structural elements, modified base pairs are most prevalent in tRNA crystal structures and most commonly involve guanine or uridine modifications. Further, analysis of tRNA sequences reveals additional examples of modified base pairs at structurally conserved tRNA regions and highlights the conservation patterns of these base pairs in three domains of life. Comparison of structures and binding energies of modified base pairs with their unmodified counterparts, using quantum chemical methods, allowed us to classify the base modifications in terms of the nature of their electronic structure effects on base-pairing. Analysis of specific structural contexts of modified base pairs in RNA crystal structures revealed several interesting scenarios, including those at the tRNA:rRNA interface, antibiotic-binding sites on the ribosome, and the three-way junctions within tRNA. These scenarios, when analyzed in the context of available experimental data, allowed us to correlate the occurrence and strength of modified base pairs with their specific functional roles. Overall, our study highlights the structural importance of modified base pairs in RNA and points toward the need for greater appreciation of the role of modified bases and their interactions, in the context of many biological processes involving RNA. PMID:28341704

  9. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

    PubMed

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

    2004-03-01

    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson-Crick base pair in SECIS element plays an important role in the selenocysteine expression by UGA codon.

  10. Introducing a model of pairing based on base pair specific interactions between identical DNA sequences

    NASA Astrophysics Data System (ADS)

    (O' Lee, Dominic J.

    2018-02-01

    At present, there have been suggested two types of physical mechanism that may facilitate preferential pairing between DNA molecules, with identical or similar base pair texts, without separation of base pairs. One mechanism solely relies on base pair specific patterns of helix distortion being the same on the two molecules, discussed extensively in the past. The other mechanism proposes that there are preferential interactions between base pairs of the same composition. We introduce a model, built on this second mechanism, where both thermal stretching and twisting fluctuations are included, as well as the base pair specific helix distortions. Firstly, we consider an approximation for weak pairing interactions, or short molecules. This yields a dependence of the energy on the square root of the molecular length, which could explain recent experimental data. However, analysis suggests that this approximation is no longer valid at large DNA lengths. In a second approximation, for long molecules, we define two adaptation lengths for twisting and stretching, over which the pairing interaction can limit the accumulation of helix disorder. When the pairing interaction is sufficiently strong, both adaptation lengths are finite; however, as we reduce pairing strength, the stretching adaptation length remains finite but the torsional one becomes infinite. This second state persists to arbitrarily weak values of the pairing strength; suggesting that, if the molecules are long enough, the pairing energy scales as length. To probe differences between the two pairing mechanisms, we also construct a model of similar form. However, now, pairing between identical sequences solely relies on the intrinsic helix distortion patterns. Between the two models, we see interesting qualitative differences. We discuss our findings, and suggest new work to distinguish between the two mechanisms.

  11. Agent based modeling of the coevolution of hostility and pacifism

    NASA Astrophysics Data System (ADS)

    Dalmagro, Fermin; Jimenez, Juan

    2015-01-01

    We propose a model based on a population of agents whose states represent either hostile or peaceful behavior. Randomly selected pairs of agents interact according to a variation of the Prisoners Dilemma game, and the probabilities that the agents behave aggressively or not are constantly updated by the model so that the agents that remain in the game are those with the highest fitness. We show that the population of agents oscillate between generalized conflict and global peace, without either reaching a stable state. We then use this model to explain some of the emergent behaviors in collective conflicts, by comparing the simulated results with empirical data obtained from social systems. In particular, using public data reports we show how the model precisely reproduces interesting quantitative characteristics of diverse types of armed conflicts, public protests, riots and strikes.

  12. Unitary limit in crossed Andreev transport

    DOE PAGES

    Sadovskyy, I. A.; Lesovik, G. B.; Vinokur, V. M.

    2015-10-08

    One of the most promising approaches for generating spin- and energy-entangled electron pairs is splitting a Cooper pair into the metal through spatially separated terminals. Utilizing hybrid systems with the energy-dependent barriers at the superconductor/normal metal (NS) interfaces, one can achieve a practically 100% efficiency outcome of entangled electrons. We investigate a minimalistic one-dimensional model comprising a superconductor and two metallic leads and derive an expression for an electron-to-hole transmission probability as a measure of splitting efficiency. We find the conditions for achieving 100% efficiency and present analytical results for the differential conductance and differential noise.

  13. Initiation at closely spaced replication origins in a yeast chromosome.

    PubMed

    Brewer, B J; Fangman, W L

    1993-12-10

    Replication of eukaryotic chromosomes involves initiation at origins spaced an average of 50 to 100 kilobase pairs. In yeast, potential origins can be recognized as autonomous replication sequences (ARSs) that allow maintenance of plasmids. However, there are more ARS elements than active chromosomal origins. The possibility was examined that close spacing of ARSs can lead to inactive origins. Two ARSs located 6.5 kilobase pairs apart can indeed interfere with each other. Replication is initiated from one or the other ARS with equal probability, but rarely (< 5%) from both ARSs on the same DNA molecule.

  14. Bivariate extreme value distributions

    NASA Technical Reports Server (NTRS)

    Elshamy, M.

    1992-01-01

    In certain engineering applications, such as those occurring in the analyses of ascent structural loads for the Space Transportation System (STS), some of the load variables have a lower bound of zero. Thus, the need for practical models of bivariate extreme value probability distribution functions with lower limits was identified. We discuss the Gumbel models and present practical forms of bivariate extreme probability distributions of Weibull and Frechet types with two parameters. Bivariate extreme value probability distribution functions can be expressed in terms of the marginal extremel distributions and a 'dependence' function subject to certain analytical conditions. Properties of such bivariate extreme distributions, sums and differences of paired extremals, as well as the corresponding forms of conditional distributions, are discussed. Practical estimation techniques are also given.

  15. Study of recreational land and open space using Skylab imagery

    NASA Technical Reports Server (NTRS)

    Sattinger, I. J. (Principal Investigator)

    1975-01-01

    The author has identified the following significant results. An analysis of the statistical uniqueness of each of the signatures of the Gratiot-Saginaw State Game Area was made by computing a matrix of probabilities of misclassification for all possible signature pairs. Within each data set, the 35 signatures were then aggregated into a smaller set of composite signatures by combining groups of signatures having high probabilities of misclassification. Computer separation of forest denisty classes was poor with multispectral scanner data collected on 5 August 1973. Signatures from the scanner data were further analyzed to determine the ranking of spectral channels for computer separation of the scene classes. Probabilities of misclassification were computed for composite signatures using four separate combinations of data source and channel selection.

  16. The effect of incremental changes in phonotactic probability and neighborhood density on word learning by preschool children

    PubMed Central

    Storkel, Holly L.; Bontempo, Daniel E.; Aschenbrenner, Andrew J.; Maekawa, Junko; Lee, Su-Yeon

    2013-01-01

    Purpose Phonotactic probability or neighborhood density have predominately been defined using gross distinctions (i.e., low vs. high). The current studies examined the influence of finer changes in probability (Experiment 1) and density (Experiment 2) on word learning. Method The full range of probability or density was examined by sampling five nonwords from each of four quartiles. Three- and 5-year-old children received training on nonword-nonobject pairs. Learning was measured in a picture-naming task immediately following training and 1-week after training. Results were analyzed using multi-level modeling. Results A linear spline model best captured nonlinearities in phonotactic probability. Specifically word learning improved as probability increased in the lowest quartile, worsened as probability increased in the midlow quartile, and then remained stable and poor in the two highest quartiles. An ordinary linear model sufficiently described neighborhood density. Here, word learning improved as density increased across all quartiles. Conclusion Given these different patterns, phonotactic probability and neighborhood density appear to influence different word learning processes. Specifically, phonotactic probability may affect recognition that a sound sequence is an acceptable word in the language and is a novel word for the child, whereas neighborhood density may influence creation of a new representation in long-term memory. PMID:23882005

  17. Bonding in Heavier Group 14 Zero-Valent Complexes-A Combined Maximum Probability Domain and Valence Bond Theory Approach.

    PubMed

    Turek, Jan; Braïda, Benoît; De Proft, Frank

    2017-10-17

    The bonding in heavier Group 14 zero-valent complexes of a general formula L 2 E (E=Si-Pb; L=phosphine, N-heterocyclic and acyclic carbene, cyclic tetrylene and carbon monoxide) is probed by combining valence bond (VB) theory and maximum probability domain (MPD) approaches. All studied complexes are initially evaluated on the basis of the structural parameters and the shape of frontier orbitals revealing a bent structural motif and the presence of two lone pairs at the central E atom. For the VB calculations three resonance structures are suggested, representing the "ylidone", "ylidene" and "bent allene" structures, respectively. The influence of both ligands and central atoms on the bonding situation is clearly expressed in different weights of the resonance structures for the particular complexes. In general, the bonding in the studied E 0 compounds, the tetrylones, is best described as a resonating combination of "ylidone" and "ylidene" structures with a minor contribution of the "bent allene" structure. Moreover, the VB calculations allow for a straightforward assessment of the π-backbonding (E→L) stabilization energy. The validity of the suggested resonance model is further confirmed by the complementary MPD calculations focusing on the E lone pair region as well as the E-L bonding region. Likewise, the MPD method reveals a strong influence of the σ-donating and π-accepting properties of the ligand. In particular, either one single domain or two symmetrical domains are found in the lone pair region of the central atom, supporting the predominance of either the "ylidene" or "ylidone" structures having one or two lone pairs at the central atom, respectively. Furthermore, the calculated average populations in the lone pair MPDs correlate very well with the natural bond orbital (NBO) populations, and can be related to the average number of electrons that is backdonated to the ligands. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. pKa shifting in double-stranded RNA is highly dependent upon nearest neighbors and bulge positioning.

    PubMed

    Wilcox, Jennifer L; Bevilacqua, Philip C

    2013-10-22

    Shifting of pKa's in RNA is important for many biological processes; however, the driving forces responsible for shifting are not well understood. Herein, we determine how structural environments surrounding protonated bases affect pKa shifting in double-stranded RNA (dsRNA). Using (31)P NMR, we determined the pKa of the adenine in an A(+)·C base pair in various sequence and structural environments. We found a significant dependence of pKa on the base pairing strength of nearest neighbors and the location of a nearby bulge. Increasing nearest neighbor base pairing strength shifted the pKa of the adenine in an A(+)·C base pair higher by an additional 1.6 pKa units, from 6.5 to 8.1, which is well above neutrality. The addition of a bulge two base pairs away from a protonated A(+)·C base pair shifted the pKa by only ~0.5 units less than a perfectly base paired hairpin; however, positioning the bulge just one base pair away from the A(+)·C base pair prohibited formation of the protonated base pair as well as several flanking base pairs. Comparison of data collected at 25 °C and 100 mM KCl to biological temperature and Mg(2+) concentration revealed only slight pKa changes, suggesting that similar sequence contexts in biological systems have the potential to be protonated at biological pH. We present a general model to aid in the determination of the roles protonated bases may play in various dsRNA-mediated processes including ADAR editing, miRNA processing, programmed ribosomal frameshifting, and general acid-base catalysis in ribozymes.

  19. Kappa statistic for clustered matched-pair data.

    PubMed

    Yang, Zhao; Zhou, Ming

    2014-07-10

    Kappa statistic is widely used to assess the agreement between two procedures in the independent matched-pair data. For matched-pair data collected in clusters, on the basis of the delta method and sampling techniques, we propose a nonparametric variance estimator for the kappa statistic without within-cluster correlation structure or distributional assumptions. The results of an extensive Monte Carlo simulation study demonstrate that the proposed kappa statistic provides consistent estimation and the proposed variance estimator behaves reasonably well for at least a moderately large number of clusters (e.g., K ≥50). Compared with the variance estimator ignoring dependence within a cluster, the proposed variance estimator performs better in maintaining the nominal coverage probability when the intra-cluster correlation is fair (ρ ≥0.3), with more pronounced improvement when ρ is further increased. To illustrate the practical application of the proposed estimator, we analyze two real data examples of clustered matched-pair data. Copyright © 2014 John Wiley & Sons, Ltd.

  20. Database of non-canonical base pairs found in known RNA structures

    NASA Technical Reports Server (NTRS)

    Nagaswamy, U.; Voss, N.; Zhang, Z.; Fox, G. E.

    2000-01-01

    Atomic resolution RNA structures are being published at an increasing rate. It is common to find a modest number of non-canonical base pairs in these structures in addition to the usual Watson-Crick pairs. This database summarizes the occurrence of these rare base pairs in accordance with standard nomenclature. The database, http://prion.bchs.uh.edu/, contains information such as sequence context, sugar pucker conformation, anti / syn base conformations, chemical shift, p K (a)values, melting temperature and free energy. Of the 29 anticipated pairs with two or more hydrogen bonds, 20 have been encountered to date. In addition, four unexpected pairs with two hydrogen bonds have been reported bringing the total to 24. Single hydrogen bond versions of five of the expected geometries have been encountered among the single hydrogen bond interactions. In addition, 18 different types of base triplets have been encountered, each of which involves three to six hydrogen bonds. The vast majority of the rare base pairs are antiparallel with the bases in the anti configuration relative to the ribose. The most common are the GU wobble, the Sheared GA pair, the Reverse Hoogsteen pair and the GA imino pair.

  1. Selfish routing equilibrium in stochastic traffic network: A probability-dominant description.

    PubMed

    Zhang, Wenyi; He, Zhengbing; Guan, Wei; Ma, Rui

    2017-01-01

    This paper suggests a probability-dominant user equilibrium (PdUE) model to describe the selfish routing equilibrium in a stochastic traffic network. At PdUE, travel demands are only assigned to the most dominant routes in the same origin-destination pair. A probability-dominant rerouting dynamic model is proposed to explain the behavioral mechanism of PdUE. To facilitate applications, the logit formula of PdUE is developed, of which a well-designed route set is not indispensable and the equivalent varitional inequality formation is simple. Two routing strategies, i.e., the probability-dominant strategy (PDS) and the dominant probability strategy (DPS), are discussed through a hypothetical experiment. It is found that, whether out of insurance or striving for perfection, PDS is a better choice than DPS. For more general cases, the conducted numerical tests lead to the same conclusion. These imply that PdUE (rather than the conventional stochastic user equilibrium) is a desirable selfish routing equilibrium for a stochastic network, given that the probability distributions of travel time are available to travelers.

  2. Selfish routing equilibrium in stochastic traffic network: A probability-dominant description

    PubMed Central

    Zhang, Wenyi; Guan, Wei; Ma, Rui

    2017-01-01

    This paper suggests a probability-dominant user equilibrium (PdUE) model to describe the selfish routing equilibrium in a stochastic traffic network. At PdUE, travel demands are only assigned to the most dominant routes in the same origin-destination pair. A probability-dominant rerouting dynamic model is proposed to explain the behavioral mechanism of PdUE. To facilitate applications, the logit formula of PdUE is developed, of which a well-designed route set is not indispensable and the equivalent varitional inequality formation is simple. Two routing strategies, i.e., the probability-dominant strategy (PDS) and the dominant probability strategy (DPS), are discussed through a hypothetical experiment. It is found that, whether out of insurance or striving for perfection, PDS is a better choice than DPS. For more general cases, the conducted numerical tests lead to the same conclusion. These imply that PdUE (rather than the conventional stochastic user equilibrium) is a desirable selfish routing equilibrium for a stochastic network, given that the probability distributions of travel time are available to travelers. PMID:28829834

  3. Force Density Function Relationships in 2-D Granular Media

    NASA Technical Reports Server (NTRS)

    Youngquist, Robert C.; Metzger, Philip T.; Kilts, Kelly N.

    2004-01-01

    An integral transform relationship is developed to convert between two important probability density functions (distributions) used in the study of contact forces in granular physics. Developing this transform has now made it possible to compare and relate various theoretical approaches with one another and with the experimental data despite the fact that one may predict the Cartesian probability density and another the force magnitude probability density. Also, the transforms identify which functional forms are relevant to describe the probability density observed in nature, and so the modified Bessel function of the second kind has been identified as the relevant form for the Cartesian probability density corresponding to exponential forms in the force magnitude distribution. Furthermore, it is shown that this transform pair supplies a sufficient mathematical framework to describe the evolution of the force magnitude distribution under shearing. Apart from the choice of several coefficients, whose evolution of values must be explained in the physics, this framework successfully reproduces the features of the distribution that are taken to be an indicator of jamming and unjamming in a granular packing. Key words. Granular Physics, Probability Density Functions, Fourier Transforms

  4. Accuracy of taxonomy prediction for 16S rRNA and fungal ITS sequences

    PubMed Central

    2018-01-01

    Prediction of taxonomy for marker gene sequences such as 16S ribosomal RNA (rRNA) is a fundamental task in microbiology. Most experimentally observed sequences are diverged from reference sequences of authoritatively named organisms, creating a challenge for prediction methods. I assessed the accuracy of several algorithms using cross-validation by identity, a new benchmark strategy which explicitly models the variation in distances between query sequences and the closest entry in a reference database. When the accuracy of genus predictions was averaged over a representative range of identities with the reference database (100%, 99%, 97%, 95% and 90%), all tested methods had ≤50% accuracy on the currently-popular V4 region of 16S rRNA. Accuracy was found to fall rapidly with identity; for example, better methods were found to have V4 genus prediction accuracy of ∼100% at 100% identity but ∼50% at 97% identity. The relationship between identity and taxonomy was quantified as the probability that a rank is the lowest shared by a pair of sequences with a given pair-wise identity. With the V4 region, 95% identity was found to be a twilight zone where taxonomy is highly ambiguous because the probabilities that the lowest shared rank between pairs of sequences is genus, family, order or class are approximately equal. PMID:29682424

  5. Retroperitoneal versus transperitoneal robotic-assisted laparoscopic partial nephrectomy: a matched-pair, bicenter analysis with cost comparison using time-driven activity-based costing.

    PubMed

    Laviana, Aaron A; Tan, Hung-Jui; Hu, Jim C; Weizer, Alon Z; Chang, Sam S; Barocas, Daniel A

    2018-03-01

    To perform a bicenter, retrospective study of perioperative outcomes of retroperitoneal versus transperitoneal robotic-assisted laparoscopic partial nephrectomy (RALPN) and assess costs using time-driven activity-based costing (TDABC). We identified 355 consecutive patients who underwent RALPN at University of California Los Angeles and the University of Michigan during 2009-2016. We matched according to RENAL nephrometry score, date, and institution for 78 retroperitoneal versus 78 transperitoneal RALPN. Unadjusted analyses were performed using McNemar's Chi-squared or paired t test, and adjusted analyses were performed using multivariable repeated measures regression analysis. From multivariable models, predicted probabilities were derived according to approach. Cost analysis was performed using TDABC. Patients treated with retroperitoneal versus transperitoneal RALPN were similar in age (P = 0.490), sex (P = 0.715), BMI (P = 0.273), and comorbidity (P = 0.393). Most tumors were posterior or lateral in both the retroperitoneal (92.3%) and transperitoneal (85.9%) groups. Retroperitoneal RALPN was associated with shorter operative times (167.0 versus 191.1 min, P = 0.001) and length of stay (LOS) (1.8 versus 2.7 days, P < 0.001). There were no differences in renal function preservation or cancer control. In adjusted analyses, retroperitoneal RALPN was 17.6-min shorter (P < 0.001) and had a 76% lower probability of LOS at least 2 days (P < 0.001). Utilizing TDABC, transperitoneal RALPN added $2337 in cost when factoring in disposable equipment, operative time, LOS, and personnel. In two high-volume, tertiary centers, retroperitoneal RALPN is associated with reduced operative times and shortened LOS in posterior and lateral tumors, whereas sharing similar clinicopathologic outcomes, which may translate into lower healthcare costs. Further investigation into anterior tumors is needed.

  6. DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

    PubMed

    Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

    2012-10-11

    Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

  7. Cowbird removals unexpectedly increase productivity of a brood parasite and the songbird host.

    PubMed

    Kosciuch, Karl L; Sandercock, Brett K

    2008-03-01

    Generalist brood parasites reduce productivity and population growth of avian hosts and have been implicated in population declines of several songbirds of conservation concern. To estimate the demographic effects of brood parasitism on Bell's Vireos (Vireo bellii), we removed Brown-headed Cowbirds (Molothrus ater) in a replicated switchback experimental design. Cowbird removals decreased parasitism frequency from 77% and 85% at unmanipulated plots to 58% and 47% at removal plots in 2004 and 2005, respectively. Vireo productivity per pair was higher at cowbird removal plots when years were pooled (mean = 2.6 +/- 0.2 [SE] young per pair) compared to unmanipulated plots (1.2 +/- 0.1). Nest desertion frequency was lower at cowbird removal plots (35% of parasitized nests) compared to unmanipulated plots (69%) because removal of host eggs was the proximate cue for nest desertion, and vireos experienced lower rates of egg loss at cowbird removal plots. Nest success was higher among unparasitized than parasitized nests, and parasitized nests at cowbird removal plots had a higher probability of success than parasitized nests at unmanipulated plots. Unexpectedly, cowbird productivity from vireo pairs was higher at cowbird removal plots (mean = 0.3 +/- 0.06 young per pair) than at unmanipulated plots (0.1 +/- 0.03) because fewer parasitized nests were deserted and the probability of nest success was higher. Our study provides the first evidence that increases in cowbird productivity may be an unintended consequence of cowbird control programs, especially during the initial years of trapping when parasitism may only be moderately reduced. Thus, understanding the demographic impacts of cowbird removals requires an informed understanding of the behavioral ecology of host-parasite interactions.

  8. Technical Report on Modeling for Quasispecies Abundance Inference with Confidence Intervals from Metagenomic Sequence Data

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McLoughlin, K.

    2016-01-11

    The overall aim of this project is to develop a software package, called MetaQuant, that can determine the constituents of a complex microbial sample and estimate their relative abundances by analysis of metagenomic sequencing data. The goal for Task 1 is to create a generative model describing the stochastic process underlying the creation of sequence read pairs in the data set. The stages in this generative process include the selection of a source genome sequence for each read pair, with probability dependent on its abundance in the sample. The other stages describe the evolution of the source genome from itsmore » nearest common ancestor with a reference genome, breakage of the source DNA into short fragments, and the errors in sequencing the ends of the fragments to produce read pairs.« less

  9. Strong evidence for ZZ production in pp[over] collisions at sqrt[s]=1.96 TeV.

    PubMed

    Aaltonen, T; Adelman, J; Akimoto, T; Albrow, M G; Alvarez González, B; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Apresyan, A; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Azzi-Bacchetta, P; Azzurri, P; Bacchetta, N; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Baroiant, S; Bartsch, V; Bauer, G; Beauchemin, P-H; Bedeschi, F; Bednar, P; Behari, S; Bellettini, G; Bellinger, J; Belloni, A; Benjamin, D; Beretvas, A; Beringer, J; Berry, T; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bolla, G; Bolshov, A; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Bridgeman, A; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Budd, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrera, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carlsmith, D; Carosi, R; Carrillo, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Compostella, G; Convery, M E; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Crescioli, F; Cuenca Almenar, C; Cuevas, J; Culbertson, R; Cully, J C; Dagenhart, D; Datta, M; Davies, T; de Barbaro, P; De Cecco, S; Deisher, A; De Lentdecker, G; De Lorenzo, G; Dell'Orso, M; Demortier, L; Deng, J; Deninno, M; De Pedis, D; Derwent, P F; Di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Ferrazza, C; Field, R; Flanagan, G; Forrest, R; Forrester, S; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garberson, F; Garcia, J E; Garfinkel, A F; Genser, K; Gerberich, H; Gerdes, D; Giagu, S; Giakoumopolou, V; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C M; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Grundler, U; Guimaraes da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hamilton, A; Han, B-Y; Han, J Y; Handler, R; Happacher, F; Hara, K; Hare, D; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hauser, J; Hays, C; Heck, M; Heijboer, A; Heinemann, B; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hewamanage, S; Hidas, D; Hill, C S; Hirschbuehl, D; Hocker, A; Hou, S; Houlden, M; Hsu, S-C; Huffman, B T; Hughes, R E; Husemann, U; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; Iyutin, B; James, E; Jayatilaka, B; Jeans, D; Jeon, E J; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Kar, D; Karchin, P E; Kato, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Koay, S A; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kraus, J; Kreps, M; Kroll, J; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhlmann, S E; Kuhr, T; Kulkarni, N P; Kusakabe, Y; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; LeCompte, T; Lee, J; Lee, J; Lee, Y J; Lee, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Lin, C; Lin, C S; Linacre, J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Lovas, L; Lu, R-S; Lucchesi, D; Lueck, J; Luci, C; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; MacQueen, D; Madrak, R; Maeshima, K; Makhoul, K; Maki, T; Maksimovic, P; Malde, S; Malik, S; Manca, G; Manousakis, A; Margaroli, F; Marino, C; Marino, C P; Martin, A; Martin, M; Martin, V; Martínez, M; Martínez-Ballarín, R; Maruyama, T; Mastrandrea, P; Masubuchi, T; Mattson, M E; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miles, J; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyake, H; Moed, S; Moggi, N; Moon, C S; Moore, R; Morello, M; Movilla Fernandez, P; Mülmenstädt, J; Mukherjee, A; Muller, Th; Mumford, R; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Nagano, A; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Necula, V; Neu, C; Neubauer, M S; Nielsen, J; Nodulman, L; Norman, M; Norniella, O; Nurse, E; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Oldeman, R; Orava, R; Osterberg, K; Pagan Griso, S; Pagliarone, C; Palencia, E; Papadimitriou, V; Papaikonomou, A; Paramonov, A A; Parks, B; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Paus, C; Pellett, D E; Penzo, A; Phillips, T J; Piacentino, G; Piedra, J; Pinera, L; Pitts, K; Plager, C; Pondrom, L; Portell, X; Poukhov, O; Pounder, N; Prakoshyn, F; Pronko, A; Proudfoot, J; Ptohos, F; Punzi, G; Pursley, J; Rademacker, J; Rahaman, A; Ramakrishnan, V; Ranjan, N; Redondo, I; Reisert, B; Rekovic, V; Renton, P; Rescigno, M; Richter, S; Rimondi, F; Ristori, L; Robson, A; Rodrigo, T; Rogers, E; Rolli, S; Roser, R; Rossi, M; Rossin, R; Roy, P; Ruiz, A; Russ, J; Rusu, V; Saarikko, H; Safonov, A; Sakumoto, W K; Salamanna, G; Saltó, O; Santi, L; Sarkar, S; Sartori, L; Sato, K; Savoy-Navarro, A; Scheidle, T; Schlabach, P; Schmidt, E E; Schmidt, M A; Schmidt, M P; Schmitt, M; Schwarz, T; Scodellaro, L; Scott, A L; Scribano, A; Scuri, F; Sedov, A; Seidel, S; Seiya, Y; Semenov, A; Sexton-Kennedy, L; Sfyrla, A; Shalhout, S Z; Shapiro, M D; Shears, T; Shepard, P F; Sherman, D; Shimojima, M; Shochet, M; Shon, Y; Shreyber, I; Sidoti, A; Sinervo, P; Sisakyan, A; Slaughter, A J; Slaunwhite, J; Sliwa, K; Smith, J R; Snider, F D; Snihur, R; Soderberg, M; Soha, A; Somalwar, S; Sorin, V; Spalding, J; Spinella, F; Spreitzer, T; Squillacioti, P; Stanitzki, M; St Denis, R; Stelzer, B; Stelzer-Chilton, O; Stentz, D; Strologas, J; Stuart, D; Suh, J S; Sukhanov, A; Sun, H; Suslov, I; Suzuki, T; Taffard, A; Takashima, R; Takeuchi, Y; Tanaka, R; Tecchio, M; Teng, P K; Terashi, K; Thom, J; Thompson, A S; Thompson, G A; Thomson, E; Tipton, P; Tiwari, V; Tkaczyk, S; Toback, D; Tokar, S; Tollefson, K; Tomura, T; Tonelli, D; Torre, S; Torretta, D; Tourneur, S; Trischuk, W; Tu, Y; Turini, N; Ukegawa, F; Uozumi, S; Vallecorsa, S; van Remortel, N; Varganov, A; Vataga, E; Vázquez, F; Velev, G; Vellidis, C; Veszpremi, V; Vidal, M; Vidal, R; Vila, I; Vilar, R; Vine, T; Vogel, M; Volobouev, I; Volpi, G; Würthwein, F; Wagner, P; Wagner, R G; Wagner, R L; Wagner-Kuhr, J; Wagner, W; Wakisaka, T; Wallny, R; Wang, S M; Warburton, A; Waters, D; Weinberger, M; Wester, W C; Whitehouse, B; Whiteson, D; Wicklund, A B; Wicklund, E; Williams, G; Williams, H H; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, C; Wright, T; Wu, X; Wynne, S M; Yagil, A; Yamamoto, K; Yamaoka, J; Yamashita, T; Yang, C; Yang, U K; Yang, Y C; Yao, W M; Yeh, G P; Yoh, J; Yorita, K; Yoshida, T; Yu, G B; Yu, I; Yu, S S; Yun, J C; Zanello, L; Zanetti, A; Zaw, I; Zhang, X; Zheng, Y; Zucchelli, S; Group, R C

    2008-05-23

    We report the first evidence of Z boson pair production at a hadron collider with a significance exceeding 4 standard deviations. This result is based on a data sample corresponding to 1.9 fb(-1) of integrated luminosity from pp[over] collisions at sqrt[s]=1.96 TeV collected with the Collider Detector at Fermilab II detector. In the lll'l' channel, we observe three ZZ candidates with an expected background of 0.096(-0.063)+0.092 events. In the llnunu channel, we use a leading-order calculation of the relative ZZ and WW event probabilities to discriminate between signal and background. In the combination of lll'l' and llnunu channels, we observe an excess of events with a probability of 5.1 x 10(-6) to be due to the expected background. This corresponds to a significance of 4.4 standard deviations. The measured cross section is sigma(pp[over]-->ZZ)=1.4(-0.6)+0.7(stat+syst) pb, consistent with the standard model expectation.

  10. Competition in saccade target selection reveals attentional guidance by simultaneously active working memory representations.

    PubMed

    Beck, Valerie M; Hollingworth, Andrew

    2017-02-01

    The content of visual working memory (VWM) guides attention, but whether this interaction is limited to a single VWM representation or functional for multiple VWM representations is under debate. To test this issue, we developed a gaze-contingent search paradigm to directly manipulate selection history and examine the competition between multiple cue-matching saccade target objects. Participants first saw a dual-color cue followed by two pairs of colored objects presented sequentially. For each pair, participants selectively fixated an object that matched one of the cued colors. Critically, for the second pair, the cued color from the first pair was presented either with a new distractor color or with the second cued color. In the latter case, if two cued colors in VWM interact with selection simultaneously, we expected the second cued color object to generate substantial competition for selection, even though the first cued color was used to guide attention in the immediately previous pair. Indeed, in the second pair, selection probability of the first cued color was substantially reduced in the presence of the second cued color. This competition between cue-matching objects provides strong evidence that both VWM representations interacted simultaneously with selection. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  11. Why do some women prefer submissive men? Hierarchically disparate couples reach higher reproductive success in European urban humans.

    PubMed

    Jozifkova, Eva; Konvicka, Martin; Flegr, Jaroslav

    2014-01-01

    Equality between partners is considering a feature of the functional partnerships in westernized societies. However, the evolutionary consequences of how in-pair hierarchy influences reproduction are less known. Attraction of some high-ranking women towards low-ranking men represents a puzzle. Young urban adults (120 men, 171 women) filled out a questionnaire focused on their sexual preference for higher or lower ranking partners, their future in-pair hierarchy, and hierarchy between their parents. Human pairs with a hierarchic disparity between partners conceive more offspring than pairs of equally-ranking individuals, who, in turn, conceive more offspring than pairs of two dominating partners. Importantly, the higher reproductive success of hierarchically disparate pairs holds, regardless of which sex, male or female, is the dominant one. In addition, the subjects preferring hierarchy disparity in partnerships were with greater probability sexually aroused by such disparity, suggesting that both the partnership preference and the triggers of sexual arousal may reflect a mating strategy. These results challenge the frequently held belief in within-pair equality as a trademark of functional partnerships. It rather appears that existence of some disparity improves within-pair cohesion, facilitating both cooperation between partners and improving the pairs' ability to face societal challenges. The parallel existence of submissivity-dominance hierarchies within human sexes allows for the parallel existence of alternative reproductive strategies, and may form a background for the diversity of mating systems observed in human societies. Arousal of overemphasized dominance/submissiveness may explain sadomasochistic sex, still little understood from the evolutionary psychology point of view.

  12. Prediction of probable mutations in influenza virus hemagglutinin protein based on large-scale ab initio fragment molecular orbital calculations.

    PubMed

    Yoshioka, Akio; Fukuzawa, Kaori; Mochizuki, Yuji; Yamashita, Katsumi; Nakano, Tatsuya; Okiyama, Yoshio; Nobusawa, Eri; Nakajima, Katsuhisa; Tanaka, Shigenori

    2011-09-01

    Ab initio electronic-state calculations for influenza virus hemagglutinin (HA) trimer complexed with Fab antibody were performed on the basis of the fragment molecular orbital (FMO) method at the second and third-order Møller-Plesset (MP2 and MP3) perturbation levels. For the protein complex containing 2351 residues and 36,160 atoms, the inter-fragment interaction energies (IFIEs) were evaluated to illustrate the effective interactions between all the pairs of amino acid residues. By analyzing the calculated data on the IFIEs, we first discussed the interactions and their fluctuations between multiple domains contained in the trimer complex. Next, by combining the IFIE data between the Fab antibody and each residue in the HA antigen with experimental data on the hemadsorption activity of HA mutants, we proposed a protocol to predict probable mutations in HA. The proposed protocol based on the FMO-MP2.5 calculation can explain the historical facts concerning the actual mutations after the emergence of A/Hong Kong/1/68 influenza virus with subtype H3N2, and thus provides a useful methodology to enumerate those residue sites likely to mutate in the future. Copyright © 2011 Elsevier Inc. All rights reserved.

  13. Exploring the Specifications of Spatial Adjacencies and Weights in Bayesian Spatial Modeling with Intrinsic Conditional Autoregressive Priors in a Small-area Study of Fall Injuries

    PubMed Central

    Law, Jane

    2016-01-01

    Intrinsic conditional autoregressive modeling in a Bayeisan hierarchical framework has been increasingly applied in small-area ecological studies. This study explores the specifications of spatial structure in this Bayesian framework in two aspects: adjacency, i.e., the set of neighbor(s) for each area; and (spatial) weight for each pair of neighbors. Our analysis was based on a small-area study of falling injuries among people age 65 and older in Ontario, Canada, that was aimed to estimate risks and identify risk factors of such falls. In the case study, we observed incorrect adjacencies information caused by deficiencies in the digital map itself. Further, when equal weights was replaced by weights based on a variable of expected count, the range of estimated risks increased, the number of areas with probability of estimated risk greater than one at different probability thresholds increased, and model fit improved. More importantly, significance of a risk factor diminished. Further research to thoroughly investigate different methods of variable weights; quantify the influence of specifications of spatial weights; and develop strategies for better defining spatial structure of a map in small-area analysis in Bayesian hierarchical spatial modeling is recommended. PMID:29546147

  14. Deep convolutional neural network for mammographic density segmentation

    NASA Astrophysics Data System (ADS)

    Wei, Jun; Li, Songfeng; Chan, Heang-Ping; Helvie, Mark A.; Roubidoux, Marilyn A.; Lu, Yao; Zhou, Chuan; Hadjiiski, Lubomir; Samala, Ravi K.

    2018-02-01

    Breast density is one of the most significant factors for cancer risk. In this study, we proposed a supervised deep learning approach for automated estimation of percentage density (PD) on digital mammography (DM). The deep convolutional neural network (DCNN) was trained to estimate a probability map of breast density (PMD). PD was calculated as the ratio of the dense area to the breast area based on the probability of each pixel belonging to dense region or fatty region at a decision threshold of 0.5. The DCNN estimate was compared to a feature-based statistical learning approach, in which gray level, texture and morphological features were extracted from each ROI and the least absolute shrinkage and selection operator (LASSO) was used to select and combine the useful features to generate the PMD. The reference PD of each image was provided by two experienced MQSA radiologists. With IRB approval, we retrospectively collected 347 DMs from patient files at our institution. The 10-fold cross-validation results showed a strong correlation r=0.96 between the DCNN estimation and interactive segmentation by radiologists while that of the feature-based statistical learning approach vs radiologists' segmentation had a correlation r=0.78. The difference between the segmentation by DCNN and by radiologists was significantly smaller than that between the feature-based learning approach and radiologists (p < 0.0001) by two-tailed paired t-test. This study demonstrated that the DCNN approach has the potential to replace radiologists' interactive thresholding in PD estimation on DMs.

  15. STITCHER: Dynamic assembly of likely amyloid and prion β-structures from secondary structure predictions

    PubMed Central

    Bryan, Allen W; O’Donnell, Charles W; Menke, Matthew; Cowen, Lenore J; Lindquist, Susan; Berger, Bonnie

    2012-01-01

    The supersecondary structure of amyloids and prions, proteins of intense clinical and biological interest, are difficult to determine by standard experimental or computational means. In addition, significant conformational heterogeneity is known or suspected to exist in many amyloid fibrils. Previous work has demonstrated that probability-based prediction of discrete β-strand pairs can offer insight into these structures. Here, we devise a system of energetic rules that can be used to dynamically assemble these discrete β-strand pairs into complete amyloid β-structures. The STITCHER algorithm progressively ‘stitches’ strand-pairs into full β-sheets based on a novel free-energy model, incorporating experimentally observed amino-acid side-chain stacking contributions, entropic estimates, and steric restrictions for amyloidal parallel β-sheet construction. A dynamic program computes the top 50 structures and returns both the highest scoring structure and a consensus structure taken by polling this list for common discrete elements. Putative structural heterogeneity can be inferred from sequence regions that compose poorly. Predictions show agreement with experimental models of Alzheimer’s amyloid beta peptide and the Podospora anserina Het-s prion. Predictions of the HET-s homolog HET-S also reflect experimental observations of poor amyloid formation. We put forward predicted structures for the yeast prion Sup35, suggesting N-terminal structural stability enabled by tyrosine ladders, and C-terminal heterogeneity. Predictions for the Rnq1 prion and alpha-synuclein are also given, identifying a similar mix of homogenous and heterogeneous secondary structure elements. STITCHER provides novel insight into the energetic basis of amyloid structure, provides accurate structure predictions, and can help guide future experimental studies. Proteins 2012. © 2011 Wiley Periodicals, Inc. PMID:22095906

  16. STITCHER: Dynamic assembly of likely amyloid and prion β-structures from secondary structure predictions.

    PubMed

    Bryan, Allen W; O'Donnell, Charles W; Menke, Matthew; Cowen, Lenore J; Lindquist, Susan; Berger, Bonnie

    2012-02-01

    The supersecondary structure of amyloids and prions, proteins of intense clinical and biological interest, are difficult to determine by standard experimental or computational means. In addition, significant conformational heterogeneity is known or suspected to exist in many amyloid fibrils. Previous work has demonstrated that probability-based prediction of discrete β-strand pairs can offer insight into these structures. Here, we devise a system of energetic rules that can be used to dynamically assemble these discrete β-strand pairs into complete amyloid β-structures. The STITCHER algorithm progressively 'stitches' strand-pairs into full β-sheets based on a novel free-energy model, incorporating experimentally observed amino-acid side-chain stacking contributions, entropic estimates, and steric restrictions for amyloidal parallel β-sheet construction. A dynamic program computes the top 50 structures and returns both the highest scoring structure and a consensus structure taken by polling this list for common discrete elements. Putative structural heterogeneity can be inferred from sequence regions that compose poorly. Predictions show agreement with experimental models of Alzheimer's amyloid beta peptide and the Podospora anserina Het-s prion. Predictions of the HET-s homolog HET-S also reflect experimental observations of poor amyloid formation. We put forward predicted structures for the yeast prion Sup35, suggesting N-terminal structural stability enabled by tyrosine ladders, and C-terminal heterogeneity. Predictions for the Rnq1 prion and alpha-synuclein are also given, identifying a similar mix of homogenous and heterogeneous secondary structure elements. STITCHER provides novel insight into the energetic basis of amyloid structure, provides accurate structure predictions, and can help guide future experimental studies. Copyright © 2011 Wiley Periodicals, Inc.

  17. Optical Properties of Vibronically Coupled Cy3 Dimers on DNA Scaffolds.

    PubMed

    Cunningham, Paul D; Kim, Young C; Díaz, Sebastián A; Buckhout-White, Susan; Mathur, Divita; Medintz, Igor L; Melinger, Joseph S

    2018-05-17

    We examine the effect of electronic coupling on the optical properties of Cy3 dimers attached to DNA duplexes as a function of base pair (bp) separation using steady-state and time-resolved spectroscopy. For close Cy3-Cy3 separations, 0 and 1 bp between dyes, intermediate to strong electronic coupling is revealed by modulation of the absorption and fluorescence properties including spectral band shape, peak wavelength, and excited-state lifetime. Using a vibronic exciton model, we estimate coupling strengths of 150 and 266 cm -1 for the 1 and 0 bp separations, respectively, which are comparable to those found in natural light-harvesting complexes. For the strongest electronic coupling (0 bp separation), we observe that the absorption band shape is strongly affected by the base pairs that surround the dyes, where more strongly hydrogen-bonded G-C pairs produce a red-shifted absorption spectrum consistent with a J-type dimer. This effect is studied theoretically using molecular dynamics simulation, which predicts an in-line dye configuration that is consistent with the experimental J-type spectrum. When the Cy3 dimers are in a standard aqueous buffer, the presence of relatively strong electronic coupling is accompanied by decreased fluorescence lifetime, suggesting that it promotes nonradiative relaxation in cyanine dyes. However, we show that the use of a viscous solvent can suppress this nonradiative recombination and thereby restore the dimer fluorescent emission. Ultrafast transient absorption measurements of Cy3 dimers in both standard aqueous buffer and viscous glycerol buffer suggest that sufficiently strong electronic coupling increases the probability of excited-state relaxation through a dark state that is related to Cy3 torsional motion.

  18. The dispersion and detection patterns of mtDNA-assigned red fox Vulpes vulpes scats in Tasmania are anomalous.

    PubMed

    Marks, Clive A; Obendorf, David; Pereira, Filipe; Edwards, Ivo; Hall, Graham P

    2014-08-01

    Models used for resource allocation in eradication programmes must be based on replicated data of known quality and have proven predictive accuracy, or they may provide a false indication of species presence and/or distribution. In the absence of data corroborating the presence of extant foxes Vulpes vulpes in Tasmania, a habitat-specific model based upon mtDNA data (Sarre et al . 2012. Journal Applied Ecology , 50, 459-468) implied that foxes were widespread. Overall, 61 of 9940 (0·6%) surveyed scats were assigned as mtDNA fox positive by the fox eradication programme (FEP). We investigated the spatiotemporal distribution of the 61 mtDNA-assigned fox scats and modelled the probability of replicating scat detection in independent surveys using detection dogs based upon empirically derived probabilities of scat detection success obtained by the FEP using imported fox scats. In a prior mainland study, fox genotypes were recurrently detected in a consecutive four-day pool of scats. In Tasmania, only three contemporaneously collected scat pairs of unknown genotype were detected by the FEP within an area corresponding to a conservatively large mainland fox home range (639 ha) in a decade. Nearest neighbour pairs were widely spaced (mean = 7·0 km; circular area = 153 km 2 ) and generated after a mean of 281 days. The majority of assigned mtDNA positive scats were found in urban and peri-urban environments corresponding to small mainland fox home ranges (30-45 ha) that imply higher scat density and more certain replication. Using the lowest empirically determined scat detection success for dogs, the failure to replicate fox scat detection on 34 of 36 occasions in a large (639 ha) home range is highly improbable ( P  = 0·00001) and suggestive of Type I error. Synthesis and applications . Type I error, which may have various sources, should be considered when scat mtDNA data are few, accumulated over many years, uncorroborated by observations of extant specimens, inadequately replicated in independent surveys within an expected spatiotemporal scale and reported in geographically isolated environments unlikely to have been colonized.

  19. Rotational-translational fourier imaging system

    NASA Technical Reports Server (NTRS)

    Campbell, Jonathan W. (Inventor)

    2004-01-01

    This invention has the ability to create Fourier-based images with only two grid pairs. The two grid pairs are manipulated in a manner that allows (1) a first grid pair to provide multiple real components of the Fourier-based image and (2) a second grid pair to provide multiple imaginary components of the Fourier-based image. The novelty of this invention resides in the use of only two grid pairs to provide the same imaging information that has been traditionally collected with multiple grid pairs.

  20. Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

    PubMed

    Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-03-14

    We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

  1. Correlative feature analysis of FFDM images

    NASA Astrophysics Data System (ADS)

    Yuan, Yading; Giger, Maryellen L.; Li, Hui; Sennett, Charlene

    2008-03-01

    Identifying the corresponding image pair of a lesion is an essential step for combining information from different views of the lesion to improve the diagnostic ability of both radiologists and CAD systems. Because of the non-rigidity of the breasts and the 2D projective property of mammograms, this task is not trivial. In this study, we present a computerized framework that differentiates the corresponding images from different views of a lesion from non-corresponding ones. A dual-stage segmentation method, which employs an initial radial gradient index(RGI) based segmentation and an active contour model, was initially applied to extract mass lesions from the surrounding tissues. Then various lesion features were automatically extracted from each of the two views of each lesion to quantify the characteristics of margin, shape, size, texture and context of the lesion, as well as its distance to nipple. We employed a two-step method to select an effective subset of features, and combined it with a BANN to obtain a discriminant score, which yielded an estimate of the probability that the two images are of the same physical lesion. ROC analysis was used to evaluate the performance of the individual features and the selected feature subset in the task of distinguishing between corresponding and non-corresponding pairs. By using a FFDM database with 124 corresponding image pairs and 35 non-corresponding pairs, the distance feature yielded an AUC (area under the ROC curve) of 0.8 with leave-one-out evaluation by lesion, and the feature subset, which includes distance feature, lesion size and lesion contrast, yielded an AUC of 0.86. The improvement by using multiple features was statistically significant as compared to single feature performance. (p<0.001)

  2. Structural studies on Pax-8 Prd domain/DNA complex.

    PubMed

    Campagnolo, M; Pesaresi, A; Zelezetsky, I; Geremia, S; Randaccio, L; Bisca, A; Tell, G

    2007-04-01

    Pax-8 is a member of the Pax family of transcription factors and is essential in the development of thyroid follicular cells. Pax-8 has two DNA-binding domains: the paired domain and the homeo domain. In this study, a preliminary X-ray diffraction analysis of the mammalian Pax-8 paired domain in complex with the C-site of the thyroglobulin promoter was achieved. The Pax-8 paired domain was crystallized by the hanging-drop vapor-diffusion method in complex with both a blunt-ended 26 bp DNA fragment and with a sticky-ended 24 bp DNA fragment with two additional overhanging bases. Crystallization experiments make clear that the growth of transparent crystals with large dimensions and regular shape is particularly influenced by ionic strength. The crystals of Pax-8 complex with blunt-ended and sticky-ended DNA, diffracted synchrotron radiation to 6.0 and 8.0 A resolution and belongs both to the C centered monoclinic system with cell dimensions: a = 89.88 A, b = 80.05 A, c = 67.73 A, and beta = 124.3 degrees and a = 256.56, b = 69.07, c = 99.32 A, and beta = 98.1 degrees , respectively. Fluorescence experiments suggest that the crystalline disorder, deduced by the poor diffraction, can be attributed to the low homogeneity of the protein-DNA sample. The theoretical comparative model of the Pax-8 paired domain complexed with the C-site of the thyroglobulin promoter shows the probable presence of some specific protein-DNA interactions already observed in other Pax proteins and the important role of the cysteine residues of PAI subdomain in the redox control of the DNA recognition.

  3. Interacting star clusters in the Large Magellanic Cloud. Overmerging problem solved by cluster group formation

    NASA Astrophysics Data System (ADS)

    Leon, Stéphane; Bergond, Gilles; Vallenari, Antonella

    1999-04-01

    We present the tidal tail distributions of a sample of candidate binary clusters located in the bar of the Large Magellanic Cloud (LMC). One isolated cluster, SL 268, is presented in order to study the effect of the LMC tidal field. All the candidate binary clusters show tidal tails, confirming that the pairs are formed by physically linked objects. The stellar mass in the tails covers a large range, from 1.8x 10(3) to 3x 10(4) \\msun. We derive a total mass estimate for SL 268 and SL 356. At large radii, the projected density profiles of SL 268 and SL 356 fall off as r(-gamma ) , with gamma = 2.27 and gamma =3.44, respectively. Out of 4 pairs or multiple systems, 2 are older than the theoretical survival time of binary clusters (going from a few 10(6) years to 10(8) years). A pair shows too large age difference between the components to be consistent with classical theoretical models of binary cluster formation (Fujimoto & Kumai \\cite{fujimoto97}). We refer to this as the ``overmerging'' problem. A different scenario is proposed: the formation proceeds in large molecular complexes giving birth to groups of clusters over a few 10(7) years. In these groups the expected cluster encounter rate is larger, and tidal capture has higher probability. Cluster pairs are not born together through the splitting of the parent cloud, but formed later by tidal capture. For 3 pairs, we tentatively identify the star cluster group (SCG) memberships. The SCG formation, through the recent cluster starburst triggered by the LMC-SMC encounter, in contrast with the quiescent open cluster formation in the Milky Way can be an explanation to the paucity of binary clusters observed in our Galaxy. Based on observations collected at the European Southern Observatory, La Silla, Chile}

  4. The separation distance distribution in electron-donor-acceptor systems and the wavelength dependence of free ion yields

    NASA Astrophysics Data System (ADS)

    Zhou, Jinwei; Findley, Bret R.; Braun, Charles L.; Sutin, Norman

    2001-06-01

    We recently reported that free radical ion quantum yields for electron-donor-acceptor (EDA) systems of alkylbenzenes-tetracyanoethylene (TCNE) exhibit a remarkable wavelength dependence in dichloromethane, a medium polarity solvent. We proposed that weak absorption by long-distance, unassociated or "random" D⋯A pairs is mainly responsible for the free radical ion yield. Here a model for the wavelength dependence of the free ion yield is developed for four systems in which differing degrees of EDA complex formation are present: 1,3,5-tri-tert-butylbenzene-TCNE in which only random pairs exist due to the bulky groups on the electron donor, and toluene—TCNE, 1,3,5-triethylbenzene-TCNE and 1,3,5-trimethylbenzene-TCNE. Mulliken-Hush theory is used to determine the excitation distance distribution of unassociated, random pairs at different wavelengths. For each absorption distribution, free radical ion yields at different wavelengths are then calculated using Onsager's result for the ion separation probability. Encouraging agreement between the calculated yields and our experimental results is obtained. As far as we are aware, this is the first time that photoexcitation of unassociated donor/acceptor pairs has been invoked as the source of separated radical ion pairs.

  5. Pair and triplet approximation of a spatial lattice population model with multiscale dispersal using Markov chains for estimating spatial autocorrelation.

    PubMed

    Hiebeler, David E; Millett, Nicholas E

    2011-06-21

    We investigate a spatial lattice model of a population employing dispersal to nearest and second-nearest neighbors, as well as long-distance dispersal across the landscape. The model is studied via stochastic spatial simulations, ordinary pair approximation, and triplet approximation. The latter method, which uses the probabilities of state configurations of contiguous blocks of three sites as its state variables, is demonstrated to be greatly superior to pair approximations for estimating spatial correlation information at various scales. Correlations between pairs of sites separated by arbitrary distances are estimated by constructing spatial Markov processes using the information from both approximations. These correlations demonstrate why pair approximation misses basic qualitative features of the model, such as decreasing population density as a large proportion of offspring are dropped on second-nearest neighbors, and why triplet approximation is able to include them. Analytical and numerical results show that, excluding long-distance dispersal, the initial growth rate of an invading population is maximized and the equilibrium population density is also roughly maximized when the population spreads its offspring evenly over nearest and second-nearest neighboring sites. Copyright © 2011 Elsevier Ltd. All rights reserved.

  6. Comparison of statistical models for writer verification

    NASA Astrophysics Data System (ADS)

    Srihari, Sargur; Ball, Gregory R.

    2009-01-01

    A novel statistical model for determining whether a pair of documents, a known and a questioned, were written by the same individual is proposed. The goal of this formulation is to learn the specific uniqueness of style in a particular author's writing, given the known document. Since there are often insufficient samples to extrapolate a generalized model of an writer's handwriting based solely on the document, we instead generalize over the differences between the author and a large population of known different writers. This is in contrast to an earlier model proposed whereby probability distributions were a priori without learning. We show the performance of the model along with a comparison in performance to the non-learning, older model, which shows significant improvement.

  7. A methodology for the assessment of manned flight simulator fidelity

    NASA Technical Reports Server (NTRS)

    Hess, Ronald A.; Malsbury, Terry N.

    1989-01-01

    A relatively simple analytical methodology for assessing the fidelity of manned flight simulators for specific vehicles and tasks is offered. The methodology is based upon an application of a structural model of the human pilot, including motion cue effects. In particular, predicted pilot/vehicle dynamic characteristics are obtained with and without simulator limitations. A procedure for selecting model parameters can be implemented, given a probable pilot control strategy. In analyzing a pair of piloting tasks for which flight and simulation data are available, the methodology correctly predicted the existence of simulator fidelity problems. The methodology permitted the analytical evaluation of a change in simulator characteristics and indicated that a major source of the fidelity problems was a visual time delay in the simulation.

  8. Testing for entanglement with periodic coarse graining

    NASA Astrophysics Data System (ADS)

    Tasca, D. S.; Rudnicki, Łukasz; Aspden, R. S.; Padgett, M. J.; Souto Ribeiro, P. H.; Walborn, S. P.

    2018-04-01

    Continuous-variable systems find valuable applications in quantum information processing. To deal with an infinite-dimensional Hilbert space, one in general has to handle large numbers of discretized measurements in tasks such as entanglement detection. Here we employ the continuous transverse spatial variables of photon pairs to experimentally demonstrate entanglement criteria based on a periodic structure of coarse-grained measurements. The periodization of the measurements allows an efficient evaluation of entanglement using spatial masks acting as mode analyzers over the entire transverse field distribution of the photons and without the need to reconstruct the probability densities of the conjugate continuous variables. Our experimental results demonstrate the utility of the derived criteria with a success rate in entanglement detection of ˜60 % relative to 7344 studied cases.

  9. A 1:2 crystalline complex of ApA:proflavine: a model for binding to single-stranded regions in RNA.

    PubMed Central

    Neidle, S; Taylor, G; Sanderson, M

    1978-01-01

    The structure of a 1"2 complex of adenylyl-(3',5')-adenosine phosphate and proflavine hemisulfate has been determined using the methods of x-ray crystallography. Since the ApA does not form a mini double helix, it may serve as a model for the interaction of planar molecules with single stranded nucleic acids. The dinucleotide adopts an extended conformation with the adenines in adjacent molecules forming base pairs. A most unusual feature of the molecule is that it does not obey the "rigid nucleotide" concept although none of the torsion angles occur in energetically unfavourable regions. This is most probably due to the strong interactions between the proflavine and the oligonucleotide. PMID:724521

  10. A statistical analysis of RNA folding algorithms through thermodynamic parameter perturbation.

    PubMed

    Layton, D M; Bundschuh, R

    2005-01-01

    Computational RNA secondary structure prediction is rather well established. However, such prediction algorithms always depend on a large number of experimentally measured parameters. Here, we study how sensitive structure prediction algorithms are to changes in these parameters. We found already that for changes corresponding to the actual experimental error to which these parameters have been determined, 30% of the structure are falsely predicted whereas the ground state structure is preserved under parameter perturbation in only 5% of all the cases. We establish that base-pairing probabilities calculated in a thermal ensemble are viable although not a perfect measure for the reliability of the prediction of individual structure elements. Here, a new measure of stability using parameter perturbation is proposed, and its limitations are discussed.

  11. Statistical analysis of dimer formation in supersaturated metal vapor based on molecular dynamics simulation

    NASA Astrophysics Data System (ADS)

    Korenchenko, Anna E.; Vorontsov, Alexander G.; Gelchinski, Boris R.; Sannikov, Grigorii P.

    2018-04-01

    We discuss the problem of dimer formation during the homogeneous nucleation of atomic metal vapor in an inert gas environment. We simulated nucleation with molecular dynamics and carried out the statistical analysis of double- and triple-atomic collisions as the two ways of long-lived diatomic complex formation. Close pair of atoms with lifetime greater than the mean time interval between atom-atom collisions is called a long-lived diatomic complex. We found that double- and triple-atomic collisions gave approximately the same probabilities of long-lived diatomic complex formation, but internal energy of the resulted state was essentially lower in the second case. Some diatomic complexes formed in three-particle collisions are stable enough to be a critical nucleus.

  12. Pairing field methods to improve inference in wildlife surveys while accommodating detection covariance

    USGS Publications Warehouse

    Clare, John; McKinney, Shawn T.; DePue, John E.; Loftin, Cynthia S.

    2017-01-01

    It is common to use multiple field sampling methods when implementing wildlife surveys to compare method efficacy or cost efficiency, integrate distinct pieces of information provided by separate methods, or evaluate method-specific biases and misclassification error. Existing models that combine information from multiple field methods or sampling devices permit rigorous comparison of method-specific detection parameters, enable estimation of additional parameters such as false-positive detection probability, and improve occurrence or abundance estimates, but with the assumption that the separate sampling methods produce detections independently of one another. This assumption is tenuous if methods are paired or deployed in close proximity simultaneously, a common practice that reduces the additional effort required to implement multiple methods and reduces the risk that differences between method-specific detection parameters are confounded by other environmental factors. We develop occupancy and spatial capture–recapture models that permit covariance between the detections produced by different methods, use simulation to compare estimator performance of the new models to models assuming independence, and provide an empirical application based on American marten (Martes americana) surveys using paired remote cameras, hair catches, and snow tracking. Simulation results indicate existing models that assume that methods independently detect organisms produce biased parameter estimates and substantially understate estimate uncertainty when this assumption is violated, while our reformulated models are robust to either methodological independence or covariance. Empirical results suggested that remote cameras and snow tracking had comparable probability of detecting present martens, but that snow tracking also produced false-positive marten detections that could potentially substantially bias distribution estimates if not corrected for. Remote cameras detected marten individuals more readily than passive hair catches. Inability to photographically distinguish individual sex did not appear to induce negative bias in camera density estimates; instead, hair catches appeared to produce detection competition between individuals that may have been a source of negative bias. Our model reformulations broaden the range of circumstances in which analyses incorporating multiple sources of information can be robustly used, and our empirical results demonstrate that using multiple field-methods can enhance inferences regarding ecological parameters of interest and improve understanding of how reliably survey methods sample these parameters.

  13. Biostatistics Series Module 3: Comparing Groups: Numerical Variables.

    PubMed

    Hazra, Avijit; Gogtay, Nithya

    2016-01-01

    Numerical data that are normally distributed can be analyzed with parametric tests, that is, tests which are based on the parameters that define a normal distribution curve. If the distribution is uncertain, the data can be plotted as a normal probability plot and visually inspected, or tested for normality using one of a number of goodness of fit tests, such as the Kolmogorov-Smirnov test. The widely used Student's t-test has three variants. The one-sample t-test is used to assess if a sample mean (as an estimate of the population mean) differs significantly from a given population mean. The means of two independent samples may be compared for a statistically significant difference by the unpaired or independent samples t-test. If the data sets are related in some way, their means may be compared by the paired or dependent samples t-test. The t-test should not be used to compare the means of more than two groups. Although it is possible to compare groups in pairs, when there are more than two groups, this will increase the probability of a Type I error. The one-way analysis of variance (ANOVA) is employed to compare the means of three or more independent data sets that are normally distributed. Multiple measurements from the same set of subjects cannot be treated as separate, unrelated data sets. Comparison of means in such a situation requires repeated measures ANOVA. It is to be noted that while a multiple group comparison test such as ANOVA can point to a significant difference, it does not identify exactly between which two groups the difference lies. To do this, multiple group comparison needs to be followed up by an appropriate post hoc test. An example is the Tukey's honestly significant difference test following ANOVA. If the assumptions for parametric tests are not met, there are nonparametric alternatives for comparing data sets. These include Mann-Whitney U-test as the nonparametric counterpart of the unpaired Student's t-test, Wilcoxon signed-rank test as the counterpart of the paired Student's t-test, Kruskal-Wallis test as the nonparametric equivalent of ANOVA and the Friedman's test as the counterpart of repeated measures ANOVA.

  14. Efficient Implementation of the Pairing on Mobilephones Using BREW

    NASA Astrophysics Data System (ADS)

    Yoshitomi, Motoi; Takagi, Tsuyoshi; Kiyomoto, Shinsaku; Tanaka, Toshiaki

    Pairing based cryptosystems can accomplish novel security applications such as ID-based cryptosystems, which have not been constructed efficiently without the pairing. The processing speed of the pairing based cryptosystems is relatively slow compared with the other conventional public key cryptosystems. However, several efficient algorithms for computing the pairing have been proposed, namely Duursma-Lee algorithm and its variant ηT pairing. In this paper, we present an efficient implementation of the pairing over some mobilephones. Moreover, we compare the processing speed of the pairing with that of the other standard public key cryptosystems, i. e. RSA cryptosystem and elliptic curve cryptosystem. Indeed the processing speed of our implementation in ARM9 processors on BREW achieves under 100 milliseconds using the supersingular curve over F397. In addition, the pairing is more efficient than the other public key cryptosystems, and the pairing can be achieved enough also on BREW mobilephones. It has become efficient enough to implement security applications, such as short signature, ID-based cryptosystems or broadcast encryption, using the pairing on BREW mobilephones.

  15. Survival probability of a truncated radial oscillator subject to periodic kicks

    NASA Astrophysics Data System (ADS)

    Tanabe, Seiichi; Watanabe, Shinichi; Saif, Farhan; Matsuzawa, Michio

    2002-03-01

    Classical and quantum survival probabilities are compared for a truncated radial oscillator undergoing impulsive interactions with periodic laser pulses represented here as kicks. The system is truncated in the sense that the harmonic potential is made valid only within a finite range; the rest of the space is treated as a perfect absorber. Exploring extended values of the parameters of this model [Phys. Rev. A 63, 052721 (2001)], we supplement discussions on classical and quantum features near resonances. The classical system proves to be quasi-integrable and preserves phase-space area despite the momentum transfered by the kicks, exhibiting simple yet rich phase-space features. A geometrical argument reveals quantum-classical correspondence in the locations of minima in the paired survival probabilities while the ``ionization'' rates differ due to quantum tunneling.

  16. Theory-based behavioral intervention increases self-reported physical activity in South African men: a cluster-randomized controlled trial.

    PubMed

    Jemmott, John B; Jemmott, Loretta S; Ngwane, Zolani; Zhang, Jingwen; Heeren, G Anita; Icard, Larry D; O'Leary, Ann; Mtose, Xoliswa; Teitelman, Anne; Carty, Craig

    2014-07-01

    To determine whether a health-promotion intervention increases South African men's adherence to physical-activity guidelines. We utilized a cluster-randomized controlled trial design. Eligible clusters, residential neighborhoods near East London, South Africa, were matched in pairs. Within randomly selected pairs, neighborhoods were randomized to theory-based, culturally congruent health-promotion intervention encouraging physical activity or attention-matched HIV/STI risk-reduction control intervention. Men residing in the neighborhoods and reporting coitus in the previous 3 months were eligible. Primary outcome was self-reported individual-level adherence to physical-activity guidelines averaged over 6-month and 12-month post-intervention assessments. Data were collected in 2007-2010. Data collectors, but not facilitators or participants, were blind to group assignment. Primary outcome intention-to-treat analysis included 22 of 22 clusters and 537 of 572 men in the health-promotion intervention and 22 of 22 clusters and 569 of 609 men in the attention-control intervention. Model-estimated probability of meeting physical-activity guidelines was 51.0% in the health-promotion intervention and 44.7% in attention-matched control (OR=1.34; 95% CI, 1.09-1.63), adjusting for baseline prevalence and clustering from 44 neighborhoods. A theory-based culturally congruent intervention increased South African men's self-reported physical activity, a key contributor to deaths from non-communicable diseases in South Africa. ClinicalTrials.gov Identifier: NCT01490359. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. Recovering a Probabilistic Knowledge Structure by Constraining Its Parameter Space

    ERIC Educational Resources Information Center

    Stefanutti, Luca; Robusto, Egidio

    2009-01-01

    In the Basic Local Independence Model (BLIM) of Doignon and Falmagne ("Knowledge Spaces," Springer, Berlin, 1999), the probabilistic relationship between the latent knowledge states and the observable response patterns is established by the introduction of a pair of parameters for each of the problems: a lucky guess probability and a careless…

  18. New Center Applies Cost-Benefit Analysis to Education Policies

    ERIC Educational Resources Information Center

    Viadero, Debra

    2008-01-01

    This article describes the Center for Benefit-Cost Studies of Education, at Teachers College, Columbia University. Launched last year by a pair of economists, the center specializes in calculating and comparing the long- and short-term costs--and probable payoffs--of different educational strategies that promise to improve students' lives. Studies…

  19. Probabilistic biological network alignment.

    PubMed

    Todor, Andrei; Dobra, Alin; Kahveci, Tamer

    2013-01-01

    Interactions between molecules are probabilistic events. An interaction may or may not happen with some probability, depending on a variety of factors such as the size, abundance, or proximity of the interacting molecules. In this paper, we consider the problem of aligning two biological networks. Unlike existing methods, we allow one of the two networks to contain probabilistic interactions. Allowing interaction probabilities makes the alignment more biologically relevant at the expense of explosive growth in the number of alternative topologies that may arise from different subsets of interactions that take place. We develop a novel method that efficiently and precisely characterizes this massive search space. We represent the topological similarity between pairs of aligned molecules (i.e., proteins) with the help of random variables and compute their expected values. We validate our method showing that, without sacrificing the running time performance, it can produce novel alignments. Our results also demonstrate that our method identifies biologically meaningful mappings under a comprehensive set of criteria used in the literature as well as the statistical coherence measure that we developed to analyze the statistical significance of the similarity of the functions of the aligned protein pairs.

  20. Internal twisting motion dependent conductance of an aperiodic DNA molecule

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

    The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

  1. Anomalous maximum and minimum for the dissociation of a geminate pair in energetically disordered media

    NASA Astrophysics Data System (ADS)

    Govatski, J. A.; da Luz, M. G. E.; Koehler, M.

    2015-01-01

    We study the geminated pair dissociation probability φ as function of applied electric field and temperature in energetically disordered nD media. Regardless nD, for certain parameters regions φ versus the disorder degree (σ) displays anomalous minimum (maximum) at low (moderate) fields. This behavior is compatible with a transport energy which reaches a maximum and then decreases to negative values as σ increases. Our results explain the temperature dependence of the persistent photoconductivity in C60 single crystals going through order-disorder transitions. They also indicate how an energetic disorder spatial variation may contribute to higher exciton dissociation in multicomponent donor/acceptor systems.

  2. Search for first generation leptoquark pair production in the electron + missing energy + jets final state

    DOE PAGES

    Abazov, Victor Mukhamedovich

    2011-10-11

    We present a search for the pair production of first generation scalar leptoquarks (LQ) in data corresponding to an integrated luminosity of 5.4 fb -1 collected with the D0 detector at the Fermilab Tevatron Collider in pp collisions at √s = 1.96 TeV. In the channel LQLQ → eqν eq, where q,q are u or d quarks, no significant excess of data over background is observed, and we set a 95% C.L. lower limit of 326 GeV on the leptoquark mass, assuming equal probabilities of leptoquark decays to eq and ν eq.

  3. An ensemble of SVM classifiers based on gene pairs.

    PubMed

    Tong, Muchenxuan; Liu, Kun-Hong; Xu, Chungui; Ju, Wenbin

    2013-07-01

    In this paper, a genetic algorithm (GA) based ensemble support vector machine (SVM) classifier built on gene pairs (GA-ESP) is proposed. The SVMs (base classifiers of the ensemble system) are trained on different informative gene pairs. These gene pairs are selected by the top scoring pair (TSP) criterion. Each of these pairs projects the original microarray expression onto a 2-D space. Extensive permutation of gene pairs may reveal more useful information and potentially lead to an ensemble classifier with satisfactory accuracy and interpretability. GA is further applied to select an optimized combination of base classifiers. The effectiveness of the GA-ESP classifier is evaluated on both binary-class and multi-class datasets. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. LEGEND, a LEO-to-GEO Environment Debris Model

    NASA Technical Reports Server (NTRS)

    Liou, Jer Chyi; Hall, Doyle T.

    2013-01-01

    LEGEND (LEO-to-GEO Environment Debris model) is a three-dimensional orbital debris evolutionary model that is capable of simulating the historical and future debris populations in the near-Earth environment. The historical component in LEGEND adopts a deterministic approach to mimic the known historical populations. Launched rocket bodies, spacecraft, and mission-related debris (rings, bolts, etc.) are added to the simulated environment. Known historical breakup events are reproduced, and fragments down to 1 mm in size are created. The LEGEND future projection component adopts a Monte Carlo approach and uses an innovative pair-wise collision probability evaluation algorithm to simulate the future breakups and the growth of the debris populations. This algorithm is based on a new "random sampling in time" approach that preserves characteristics of the traditional approach and captures the rapidly changing nature of the orbital debris environment. LEGEND is a Fortran 90-based numerical simulation program. It operates in a UNIX/Linux environment.

  5. Processing data base information having nonwhite noise

    DOEpatents

    Gross, Kenneth C.; Morreale, Patricia

    1995-01-01

    A method and system for processing a set of data from an industrial process and/or a sensor. The method and system can include processing data from either real or calculated data related to an industrial process variable. One of the data sets can be an artificial signal data set generated by an autoregressive moving average technique. After obtaining two data sets associated with one physical variable, a difference function data set is obtained by determining the arithmetic difference between the two pairs of data sets over time. A frequency domain transformation is made of the difference function data set to obtain Fourier modes describing a composite function data set. A residual function data set is obtained by subtracting the composite function data set from the difference function data set and the residual function data set (free of nonwhite noise) is analyzed by a statistical probability ratio test to provide a validated data base.

  6. Quantitative analysis of ultrasonic images of fibrotic liver using co-occurrence matrix based on multi-Rayleigh model

    NASA Astrophysics Data System (ADS)

    Isono, Hiroshi; Hirata, Shinnosuke; Hachiya, Hiroyuki

    2015-07-01

    In medical ultrasonic images of liver disease, a texture with a speckle pattern indicates a microscopic structure such as nodules surrounded by fibrous tissues in hepatitis or cirrhosis. We have been applying texture analysis based on a co-occurrence matrix to ultrasonic images of fibrotic liver for quantitative tissue characterization. A co-occurrence matrix consists of the probability distribution of brightness of pixel pairs specified with spatial parameters and gives new information on liver disease. Ultrasonic images of different types of fibrotic liver were simulated and the texture-feature contrast was calculated to quantify the co-occurrence matrices generated from the images. The results show that the contrast converges with a value that can be theoretically estimated using a multi-Rayleigh model of echo signal amplitude distribution. We also found that the contrast value increases as liver fibrosis progresses and fluctuates depending on the size of fibrotic structure.

  7. Inferring patterns in mitochondrial DNA sequences through hypercube independent spanning trees.

    PubMed

    Silva, Eduardo Sant Ana da; Pedrini, Helio

    2016-03-01

    Given a graph G, a set of spanning trees rooted at a vertex r of G is said vertex/edge independent if, for each vertex v of G, v≠r, the paths of r to v in any pair of trees are vertex/edge disjoint. Independent spanning trees (ISTs) provide a number of advantages in data broadcasting due to their fault tolerant properties. For this reason, some studies have addressed the issue by providing mechanisms for constructing independent spanning trees efficiently. In this work, we investigate how to construct independent spanning trees on hypercubes, which are generated based upon spanning binomial trees, and how to use them to predict mitochondrial DNA sequence parts through paths on the hypercube. The prediction works both for inferring mitochondrial DNA sequences comprised of six bases as well as infer anomalies that probably should not belong to the mitochondrial DNA standard. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Envisaging quantum transport phenomenon in a muddled base pair of DNA

    NASA Astrophysics Data System (ADS)

    Vohra, Rajan; Sawhney, Ravinder Singh

    2018-05-01

    The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.

  9. Higher order structural effects stabilizing the reverse Watson–Crick Guanine-Cytosine base pair in functional RNAs

    PubMed Central

    Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi

    2014-01-01

    The G:C reverse Watson–Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. PMID:24121683

  10. Diversity and Molecular Phylogeny of Mitochondrial DNA of Rhesus Macaques (Macaca mulatta) in Bangladesh

    PubMed Central

    HASAN, M. KAMRUL; FEEROZ, M. MOSTAFA; JONES-ENGEL, LISA; ENGEL, GREGORY A.; KANTHASWAMY, SREE; SMITH, DAVID GLENN

    2015-01-01

    While studies of rhesus macaques (Macaca mulatta) in the eastern (e.g., China) and western (e.g., India) parts of their geographic range have revealed major genetic differences that warrant the recognition of two different subspecies, little is known about genetic characteristics of rhesus macaques in the transitional zone extending from eastern India and Bangladesh through the northern part of Indo-China, the probable original homeland of the species. We analyzed genetic variation of 762 base pairs of mitochondrial DNA from 86 fecal swab samples and 19 blood samples from 25 local populations of rhesus macaque in Bangladesh collected from January 2010 to August 2012. These sequences were compared with those of rhesus macaques from India, China, and Myanmar. Forty-six haplotypes defined by 200 (26%) polymorphic nucleotide sites were detected. Estimates of gene diversity, expected heterozygosity, and nucleotide diversity for the total population were 0.9599 ± 0.0097, 0.0193 ± 0.0582, and 0.0196 ± 0.0098, respectively. A mismatch distribution of paired nucleotide differences yielded a statistically significantly negative value of Tajima's D, reflecting a population that rapidly expanded after the terminal Pleistocene. Most haplotypes throughout regions of Bangladesh, including an isolated region in the southwestern area (Sundarbans), clustered with haplotypes assigned to the minor haplogroup Ind-2 from India reflecting an east to west dispersal of rhesus macaques to India. Haplotypes from the southeast region of Bangladesh formed a cluster with those from Myanmar, and represent the oldest rhesus macaque haplotypes of Bangladesh. These results are consistent with the hypothesis that rhesus macaques first entered Bangladesh from the southeast, probably from Indo-China, then dispersed westward throughout eastern and central India. PMID:24810278

  11. Diversity and molecular phylogeny of mitochondrial DNA of rhesus macaques (Macaca mulatta) in Bangladesh.

    PubMed

    Hasan, M Kamrul; Feeroz, M Mostafa; Jones-Engel, Lisa; Engel, Gregory A; Kanthaswamy, Sree; Smith, David Glenn

    2014-11-01

    While studies of rhesus macaques (Macaca mulatta) in the eastern (e.g., China) and western (e.g., India) parts of their geographic range have revealed major genetic differences that warrant the recognition of two different subspecies, little is known about genetic characteristics of rhesus macaques in the transitional zone extending from eastern India and Bangladesh through the northern part of Indo-China, the probable original homeland of the species. We analyzed genetic variation of 762 base pairs of mitochondrial DNA from 86 fecal swab samples and 19 blood samples from 25 local populations of rhesus macaque in Bangladesh collected from January 2010 to August 2012. These sequences were compared with those of rhesus macaques from India, China, and Myanmar. Forty-six haplotypes defined by 200 (26%) polymorphic nucleotide sites were detected. Estimates of gene diversity, expected heterozygosity, and nucleotide diversity for the total population were 0.9599 ± 0.0097, 0.0193 ± 0.0582, and 0.0196 ± 0.0098, respectively. A mismatch distribution of paired nucleotide differences yielded a statistically significantly negative value of Tajima's D, reflecting a population that rapidly expanded after the terminal Pleistocene. Most haplotypes throughout regions of Bangladesh, including an isolated region in the southwestern area (Sundarbans), clustered with haplotypes assigned to the minor haplogroup Ind-2 from India reflecting an east to west dispersal of rhesus macaques to India. Haplotypes from the southeast region of Bangladesh formed a cluster with those from Myanmar, and represent the oldest rhesus macaque haplotypes of Bangladesh. These results are consistent with the hypothesis that rhesus macaques first entered Bangladesh from the southeast, probably from Indo-China, then dispersed westward throughout eastern and central India. © 2014 Wiley Periodicals, Inc.

  12. Metabolic parameters linked by phenotype microarray to acid resistance profiles of poultry-associated Salmonella enterica.

    PubMed

    Guard, Jean; Rothrock, Michael J; Shah, Devendra H; Jones, Deana R; Gast, Richard K; Sanchez-Ingunza, Roxana; Madsen, Melissa; El-Attrache, John; Lungu, Bwalya

    Phenotype microarrays were analyzed for 51 datasets derived from Salmonella enterica. The top 4 serotypes associated with poultry products and one associated with turkey, respectively Typhimurium, Enteritidis, Heidelberg, Infantis and Senftenberg, were represented. Datasets were partitioned initially into two clusters based on ranking by values at pH 4.5 (PM10 A03). Negative control wells were used to establish 90 respiratory units as the point differentiating acid resistance from sensitive strains. Thus, 24 isolates that appeared most acid-resistant were compared initially to 27 that appeared most acid-sensitive (24 × 27 format). Paired cluster analysis was also done and it included the 7 most acid-resistant and -sensitive datasets (7 × 7 format). Statistical analyses of ranked data were then calculated in order of standard deviation, probability value by the Student's t-test and a measure of the magnitude of difference called effect size. Data were reported as significant if, by order of filtering, the following parameters were calculated: i) a standard deviation of 24 respiratory units or greater from all datasets for each chemical, ii) a probability value of less than or equal to 0.03 between clusters and iii) an effect size of at least 0.50 or greater between clusters. Results suggest that between 7.89% and 23.16% of 950 chemicals differentiated acid-resistant isolates from sensitive ones, depending on the format applied. Differences were more evident at the extremes of phenotype using the subset of data in the paired 7 × 7 format. Results thus provide a strategy for selecting compounds for additional research, which may impede the emergence of acid-resistant Salmonella enterica in food. Published by Elsevier Masson SAS.

  13. A quantitative analysis of the local connectivity between pyramidal neurons in layers 2/3 of the rat visual cortex.

    PubMed

    Hellwig, B

    2000-02-01

    This study provides a detailed quantitative estimate for local synaptic connectivity between neocortical pyramidal neurons. A new way of obtaining such an estimate is presented. In acute slices of the rat visual cortex, four layer 2 and four layer 3 pyramidal neurons were intracellularly injected with biocytin. Axonal and dendritic arborizations were three-dimensionally reconstructed with the aid of a computer-based camera lucida system. In a computer experiment, pairs of pre- and postsynaptic neurons were formed and potential synaptic contacts were calculated. For each pair, the calculations were carried out for a whole range of distances (0 to 500 microm) between the presynaptic and the postsynaptic neuron, in order to estimate cortical connectivity as a function of the spatial separation of neurons. It was also differentiated whether neurons were situated in the same or in different cortical layers. The data thus obtained was used to compute connection probabilities, the average number of contacts between neurons, the frequency of specific numbers of contacts and the total number of contacts a dendritic tree receives from the surrounding cortical volume. Connection probabilities ranged from 50% to 80% for directly adjacent neurons and from 0% to 15% for neurons 500 microm apart. In many cases, connections were mediated by one contact only. However, close neighbors made on average up to 3 contacts with each other. The question as to whether the method employed in this study yields a realistic estimate of synaptic connectivity is discussed. It is argued that the results can be used as a detailed blueprint for building artificial neural networks with a cortex-like architecture.

  14. Effects of surface motion and electron-hole pair excitations in CO2 dissociation and scattering on Ni(100)

    NASA Astrophysics Data System (ADS)

    Luo, Xuan; Zhou, Xueyao; Jiang, Bin

    2018-05-01

    The energy transfer between different channels is an important aspect in chemical reactions at surfaces. We investigate here in detail the energy transfer dynamics in a prototypical system, i.e., reactive and nonreactive scattering of CO2 on Ni(100), which is related to heterogeneous catalytic processes with Ni-based catalysts for CO2 reduction. On the basis of our earlier nine-dimensional potential energy surface for CO2/Ni(100), dynamical calculations have been done using the generalized Langevin oscillator (GLO) model combined with local density friction approximation (LDFA), in which the former accounts for the surface motion and the latter accounts for the low-energy electron-hole pair (EHP) excitation. In spite of its simplicity, it is found that the GLO model yields quite satisfactory results, including the significant energy loss and product energy disposal, trapping, and steering dynamics, all of which agree well with the ab initio molecular dynamics ones where many surface atoms are explicitly involved with high computational cost. However, the GLO model fails to describe the reactivity enhancement due to the lattice motion because it intrinsically does not incorporate the variance of barrier height on the surface atom displacement. On the other hand, in LDFA, the energy transferred to EHPs is found to play a minor role and barely alter the dynamics, except for slightly reducing the dissociation probabilities. In addition, vibrational state-selected dissociative sticking probabilities are calculated and previously observed strong mode specificity is confirmed. Our work suggests that further improvement of the GLO model is needed to consider the lattice-induced barrier lowering.

  15. Theory and simulation of the time-dependent rate coefficients of diffusion-influenced reactions.

    PubMed Central

    Zhou, H X; Szabo, A

    1996-01-01

    A general formalism is developed for calculating the time-dependent rate coefficient k(t) of an irreversible diffusion-influenced reaction. This formalism allows one to treat most factors that affect k(t), including rotational Brownian motion and conformational gating of reactant molecules and orientation constraint for product formation. At long times k(t) is shown to have the asymptotic expansion k(infinity)[1 + k(infinity) (pie Dt)-1/2 /4 pie D + ...], where D is the relative translational diffusion constant. An approximate analytical method for calculating k(t) is presented. This is based on the approximation that the probability density of the reactant pair in the reactive region keeps the equilibrium distribution but with a decreasing amplitude. The rate coefficient then is determined by the Green function in the absence of chemical reaction. Within the framework of this approximation, two general relations are obtained. The first relation allows the rate coefficient for an arbitrary amplitude of the reactivity to be found if the rate coefficient for one amplitude of the reactivity is known. The second relation allows the rate coefficient in the presence of conformational gating to be found from that in the absence of conformational gating. The ratio k(t)/k(0) is shown to be the survival probability of the reactant pair at time t starting from an initial distribution that is localized in the reactive region. This relation forms the basis of the calculation of k(t) through Brownian dynamics simulations. Two simulation procedures involving the propagation of nonreactive trajectories initiated only from the reactive region are described and illustrated on a model system. Both analytical and simulation results demonstrate the accuracy of the equilibrium-distribution approximation method. PMID:8913584

  16. Bifacial Base-Pairing Behaviors of 5-Hydroxyuracil DNA Bases through Hydrogen Bonding and Metal Coordination.

    PubMed

    Takezawa, Yusuke; Nishiyama, Kotaro; Mashima, Tsukasa; Katahira, Masato; Shionoya, Mitsuhiko

    2015-10-12

    A novel bifacial ligand-bearing nucleobase, 5-hydroxyuracil (U(OH) ), which forms both a hydrogen-bonded base pair (U(OH) -A) and a metal-mediated base pair (U(OH) -M-U(OH) ) has been developed. The U(OH) -M-U(OH) base pairs were quantitatively formed in the presence of lanthanide ions such as Gd(III) when U(OH) -U(OH) pairs were consecutively incorporated into DNA duplexes. This result established metal-assisted duplex stabilization as well as DNA-templated assembly of lanthanide ions. Notably, a duplex possessing U(OH) -A base pairs was destabilized by addition of Gd(III) ions. This observation suggests that the hybridization behaviors of the U(OH) -containing DNA strands are altered by metal complexation. Thus, the U(OH) nucleobase with a bifacial base-pairing property holds great promise as a component for metal-responsive DNA materials. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Molecular switching behavior in isosteric DNA base pairs.

    PubMed

    Jissy, A K; Konar, Sukanya; Datta, Ayan

    2013-04-15

    The structures and proton-coupled behavior of adenine-thymine (A-T) and a modified base pair containing a thymine isostere, adenine-difluorotoluene (A-F), are studied in different solvents by dispersion-corrected density functional theory. The stability of the canonical Watson-Crick base pair and the mismatched pair in various solvents with low and high dielectric constants is analyzed. It is demonstrated that A-F base pairing is favored in solvents with low dielectric constant. The stabilization and conformational changes induced by protonation are also analyzed for the natural as well as the mismatched base pair. DNA sequences capable of changing their sequence conformation on protonation are used in the construction of pH-based molecular switches. An acidic medium has a profound influence in stabilizing the isostere base pair. Such a large gain in stability on protonation leads to an interesting pH-controlled molecular switch, which can be incorporated in a natural DNA tract. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Potential accuracy of translation estimation between radar and optical images

    NASA Astrophysics Data System (ADS)

    Uss, M.; Vozel, B.; Lukin, V.; Chehdi, K.

    2015-10-01

    This paper investigates the potential accuracy achievable for optical to radar image registration by area-based approach. The analysis is carried out mainly based on the Cramér-Rao Lower Bound (CRLB) on translation estimation accuracy previously proposed by the authors and called CRLBfBm. This bound is now modified to take into account radar image speckle noise properties: spatial correlation and signal-dependency. The newly derived theoretical bound is fed with noise and texture parameters estimated for the co-registered pair of optical Landsat 8 and radar SIR-C images. It is found that difficulty of optical to radar image registration stems more from speckle noise influence than from dissimilarity of the considered kinds of images. At finer scales (and higher speckle noise level), probability of finding control fragments (CF) suitable for registration is low (1% or less) but overall number of such fragments is high thanks to image size. Conversely, at the coarse scale, where speckle noise level is reduced, probability of finding CFs suitable for registration can be as high as 40%, but overall number of such CFs is lower. Thus, the study confirms and supports area-based multiresolution approach for optical to radar registration where coarse scales are used for fast registration "lock" and finer scales for reaching higher registration accuracy. The CRLBfBm is found inaccurate for the main scale due to intensive speckle noise influence. For other scales, the validity of the CRLBfBm bound is confirmed by calculating statistical efficiency of area-based registration method based on normalized correlation coefficient (NCC) measure that takes high values of about 25%.

  19. Linkage of Viral Sequences among HIV-Infected Village Residents in Botswana: Estimation of Linkage Rates in the Presence of Missing Data

    PubMed Central

    Carnegie, Nicole Bohme; Wang, Rui; Novitsky, Vladimir; De Gruttola, Victor

    2014-01-01

    Linkage analysis is useful in investigating disease transmission dynamics and the effect of interventions on them, but estimates of probabilities of linkage between infected people from observed data can be biased downward when missingness is informative. We investigate variation in the rates at which subjects' viral genotypes link across groups defined by viral load (low/high) and antiretroviral treatment (ART) status using blood samples from household surveys in the Northeast sector of Mochudi, Botswana. The probability of obtaining a sequence from a sample varies with viral load; samples with low viral load are harder to amplify. Pairwise genetic distances were estimated from aligned nucleotide sequences of HIV-1C env gp120. It is first shown that the probability that randomly selected sequences are linked can be estimated consistently from observed data. This is then used to develop estimates of the probability that a sequence from one group links to at least one sequence from another group under the assumption of independence across pairs. Furthermore, a resampling approach is developed that accounts for the presence of correlation across pairs, with diagnostics for assessing the reliability of the method. Sequences were obtained for 65% of subjects with high viral load (HVL, n = 117), 54% of subjects with low viral load but not on ART (LVL, n = 180), and 45% of subjects on ART (ART, n = 126). The probability of linkage between two individuals is highest if both have HVL, and lowest if one has LVL and the other has LVL or is on ART. Linkage across groups is high for HVL and lower for LVL and ART. Adjustment for missing data increases the group-wise linkage rates by 40–100%, and changes the relative rates between groups. Bias in inferences regarding HIV viral linkage that arise from differential ability to genotype samples can be reduced by appropriate methods for accommodating missing data. PMID:24415932

  20. Linkage of viral sequences among HIV-infected village residents in Botswana: estimation of linkage rates in the presence of missing data.

    PubMed

    Carnegie, Nicole Bohme; Wang, Rui; Novitsky, Vladimir; De Gruttola, Victor

    2014-01-01

    Linkage analysis is useful in investigating disease transmission dynamics and the effect of interventions on them, but estimates of probabilities of linkage between infected people from observed data can be biased downward when missingness is informative. We investigate variation in the rates at which subjects' viral genotypes link across groups defined by viral load (low/high) and antiretroviral treatment (ART) status using blood samples from household surveys in the Northeast sector of Mochudi, Botswana. The probability of obtaining a sequence from a sample varies with viral load; samples with low viral load are harder to amplify. Pairwise genetic distances were estimated from aligned nucleotide sequences of HIV-1C env gp120. It is first shown that the probability that randomly selected sequences are linked can be estimated consistently from observed data. This is then used to develop estimates of the probability that a sequence from one group links to at least one sequence from another group under the assumption of independence across pairs. Furthermore, a resampling approach is developed that accounts for the presence of correlation across pairs, with diagnostics for assessing the reliability of the method. Sequences were obtained for 65% of subjects with high viral load (HVL, n = 117), 54% of subjects with low viral load but not on ART (LVL, n = 180), and 45% of subjects on ART (ART, n = 126). The probability of linkage between two individuals is highest if both have HVL, and lowest if one has LVL and the other has LVL or is on ART. Linkage across groups is high for HVL and lower for LVL and ART. Adjustment for missing data increases the group-wise linkage rates by 40-100%, and changes the relative rates between groups. Bias in inferences regarding HIV viral linkage that arise from differential ability to genotype samples can be reduced by appropriate methods for accommodating missing data.

  1. 1,8-Naphthyridine-2,7-diamine: a potential universal reader of Watson-Crick base pairs for DNA sequencing by electron tunneling.

    PubMed

    Liang, Feng; Lindsay, Stuart; Zhang, Peiming

    2012-11-21

    With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.

  2. 1,8-Naphthyridine-2,7-diamine: A Potential Universal Reader of the Watson-Crick Base Pairs for DNA Sequencing by Electron Tunneling

    PubMed Central

    Liang, Feng; Lindsay, Stuart; Zhang, Peiming

    2013-01-01

    With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read the DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A:T and G:C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs. PMID:23038027

  3. Cross-contact chain

    NASA Technical Reports Server (NTRS)

    Lieneweg, Udo (Inventor)

    1988-01-01

    A system is provided for use with wafers that include multiple integrated circuits that include two conductive layers in contact at multiple interfaces. Contact chains are formed beside the integrated circuits, each contact chain formed of the same two layers as the circuits, in the form of conductive segments alternating between the upper and lower layers and with the ends of the segments connected in series through interfaces. A current source passes a current through the series-connected segments, by way of a pair of current tabs connected to opposite ends of the series of segments. While the current flows, voltage measurements are taken between each of a plurality of pairs of voltage tabs, the two tabs of each pair connected to opposite ends of an interface that lies along the series-connected segments. A plot of interface conductances on a normal probability chart, enables prediction of the yield of good integrated circuits from the wafer.

  4. Cross-contact chain

    NASA Technical Reports Server (NTRS)

    Lieneweg, U. (Inventor)

    1986-01-01

    A system is provided for use with wafers that include multiple integrated circuits that include two conductive layers in contact at multiple interfaces. Contact chains are formed beside the integrated circuits, each contact chain formed of the same two layers as the circuits, in the form of conductive segments alternating between the upper and lower layers and with the ends of the segments connected in series through interfaces. A current source passes a current through the series-connected segments, by way of a pair of current tabs connected to opposite ends of the series of segments. While the current flows, voltage measurements are taken between each of a plurality of pairs of voltage tabs, the two tabs of each pair connected to opposite ends of an interface that lies along the series-connected segments. A plot of interface conductances on normal probability chart enables prediction of the yield of good integrated circuits from the wafer.

  5. Reliability evaluation of a multistate network subject to time constraint under routing policy

    NASA Astrophysics Data System (ADS)

    Lin, Yi-Kuei

    2013-08-01

    A multistate network is a stochastic network composed of multistate arcs in which each arc has several possible capacities and may fail due to failure, maintenance, etc. The quality of a multistate network depends on how to meet the customer's requirements and how to provide the service in time. The system reliability, the probability that a given amount of data can be transmitted through a pair of minimal paths (MPs) simultaneously under the time constraint, is a proper index to evaluate the quality of a multistate network. An efficient solution procedure is first proposed to calculate it. In order to further enhance the system reliability, the network administrator decides the routing policy in advance to indicate the first and the second priority pairs of MPs. The second priority pair of MPs takes charge of the transmission duty if the first fails. The system reliability under the routing policy can be subsequently evaluated.

  6. Generalized quantum interference of correlated photon pairs.

    PubMed

    Kim, Heonoh; Lee, Sang Min; Moon, Han Seb

    2015-05-07

    Superposition and indistinguishablility between probability amplitudes have played an essential role in observing quantum interference effects of correlated photons. The Hong-Ou-Mandel interference and interferences of the path-entangled photon number state are of special interest in the field of quantum information technologies. However, a fully generalized two-photon quantum interferometric scheme accounting for the Hong-Ou-Mandel scheme and path-entangled photon number states has not yet been proposed. Here we report the experimental demonstrations of the generalized two-photon interferometry with both the interferometric properties of the Hong-Ou-Mandel effect and the fully unfolded version of the path-entangled photon number state using photon-pair sources, which are independently generated by spontaneous parametric down-conversion. Our experimental scheme explains two-photon interference fringes revealing single- and two-photon coherence properties in a single interferometer setup. Using the proposed interferometric measurement, it is possible to directly estimate the joint spectral intensity of a photon pair source.

  7. The place of the Local Group in the cosmic web

    NASA Astrophysics Data System (ADS)

    Forero-Romero, Jaime E.; González, Roberto

    2016-10-01

    We use the Bolshoi Simulation to find the most probable location of the Local Group (LG) in the cosmic web. Our LG simulacra are pairs of halos with isolation and kinematic properties consistent with observations. The cosmic web is defined using a tidal tensor approach. We find that the LG's preferred location is regions with a dark matter overdensity close to the cosmic average. This makes filaments and sheets the preferred environment. We also find a strong alignment between the LG and the cosmic web. The orbital angular momentum is preferentially perpendicular to the smallest tidal eigenvector, while the vector connecting the two halos is strongly aligned along the the smallest tidal eigenvector and perpendicular to the largest tidal eigenvector; the pair lies and moves along filaments and sheets. We do not find any evidence for an alignment between the spin of each halo in the pair and the cosmic web.

  8. Quantum control on entangled bipartite qubits

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Delgado, Francisco

    2010-04-15

    Ising interactions between qubits can produce distortion on entangled pairs generated for engineering purposes (e.g., for quantum computation or quantum cryptography). The presence of parasite magnetic fields destroys or alters the expected behavior for which it was intended. In addition, these pairs are generated with some dispersion in their original configuration, so their discrimination is necessary for applications. Nevertheless, discrimination should be made after Ising distortion. Quantum control helps in both problems; making some projective measurements upon the pair to decide the original state to replace it, or just trying to reconstruct it using some procedures which do not altermore » their quantum nature. Results about the performance of these procedures are reported. First, we will work with pure systems studying restrictions and advantages. Then, we will extend these operations for mixed states generated with uncertainty in the time of distortion, correcting them by assuming the control prescriptions for the most probable one.« less

  9. General theory of multistage geminate reactions of isolated pairs of reactants. I. Kinetic equations.

    PubMed

    Doktorov, Alexander B; Kipriyanov, Alexey A

    2014-05-14

    General matrix approach to the consideration of multistage geminate reactions of isolated pairs of reactants depending on reactant mobility is formulated on the basis of the concept of "effective" particles. Various elementary reactions (stages of multistage reaction including physicochemical processes of internal quantum state changes) proceeding with the participation of isolated pairs of reactants (or isolated reactants) are taken into account. Investigation has been made in terms of kinetic approach implying the derivation of general (matrix) kinetic equations for local and mean probabilities of finding any of the reaction species in the sample under study (or for local and mean concentrations). The recipes for the calculation of kinetic coefficients of the equations for mean quantities in terms of relative coordinates of reactants have been formulated in the general case of inhomogeneous reacting systems. Important specific case of homogeneous reacting systems is considered.

  10. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

    PubMed

    Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

    2013-06-17

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Characterization of DNA condensates induced by poly(ethylene oxide) and polylysine.

    PubMed Central

    Laemmli, U K

    1975-01-01

    High-molecular-weight DNA is known to collapse into very compact particles in a salt solution containing polymers like poly(ethylene oxide) [(EO)n] or polyacrylate. The biological relevance of this phenomenon is suggested by our recent finding that high concentrations of the highly acidic internal peptides found in the mature T4 bacteriophage head, as well as poly(glutamic acid) and poly(aspartic acid), can collapse DNA in a similar manner. The structure of DNAs collapsed by various methods has been studied with electron microscope. We find (EO)n collapses T4 or T7 bacteriophage DNA into compact particles only slightly larger than the size of the T4 and T7 head, respectively. In contrast, polylysine collapses DNA into different types of structures. Double-stranded DNA collapsed with (EO)n is cut by the single-strand specific Neurospora crassa endonuclease (EC 3.1.4.21) into small fragments. Extensive digestion only occurs above the critical concentration of polymer required for DNA collapse, demonstrating the (EO)n-collapsed DNA contains enzyme-vulnerable regions (probably at each fold), which are preferentially attacked. The size of the DNA fragments produced by limit-digestion with the nuclease ranges between 200 and 400 base pairs when DNA is collapsed by (EO)n. Only fragments of DNA which are larger than 600 base pairs are cut by the endonuclease in (EO)n-containing solution. Images PMID:1060108

  12. MODULATION BY IONIC STRENGTH AND SUPERHELICITY OF BENZO[a]PYRENE DIOL EPOXIDE INDUCED DNA ALKYLATION AND UNWINDING

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gamper, Howard B.; Straub, Kenneth; Calvin, Melvin

    Superhelical and partially relaxed SV40 DNA were reacted in vitro with (+)7{beta}, 8{alpha}-dihydroxy-9{alpha},10{alpha}-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene (BaP diol epoxide). The modified DNA contained N{sup 2} guanine and N{sup 6} adeninte hydrocarbon adducts in the ratio 86:14. Superhelical SV40 DNA was approximately 6% more susceptible to modification than partially relaxed viral DNA. Counterions inhibited DNA alkylation by up to 90%, Mg{sup 2+} being 50-fold more effective than Na{sup +}. The sensitivity of covalent binding to helix stability is consistent with a reaction complex in which BaP diol epoxide is intercalated. The superhelical density of the modified DNA substrates was determined electrophoretically relative to partiallymore » relaxed standards and an unwinding angle for the hydrocarbon adducts was calculated. The angle was dependent upon the superhelicity of the DNA molecule and ranged from 330{sup o} to 30{sup o}. This data indicates that the modified base pairs are disrupted and, in the presence of torsional strain, act as centers for the further denaturation of up to 8 adjacent base pairs. In the absence of such strain the alkylation sites have an ordered structure with the attached hydrocarbon probably oriented in the minor or major groove of the helix.« less

  13. Structural studies demonstrating a bacteriophage-like replication cycle of the eukaryote-infecting Paramecium bursaria chlorella virus-1

    PubMed Central

    Shimoni, Eyal; Dadosh, Tali; Rechav, Katya; Unger, Tamar

    2017-01-01

    A fundamental stage in viral infection is the internalization of viral genomes in host cells. Although extensively studied, the mechanisms and factors responsible for the genome internalization process remain poorly understood. Here we report our observations, derived from diverse imaging methods on genome internalization of the large dsDNA Paramecium bursaria chlorella virus-1 (PBCV-1). Our studies reveal that early infection stages of this eukaryotic-infecting virus occurs by a bacteriophage-like pathway, whereby PBCV-1 generates a hole in the host cell wall and ejects its dsDNA genome in a linear, base-pair-by-base-pair process, through a membrane tunnel generated by the fusion of the virus internal membrane with the host membrane. Furthermore, our results imply that PBCV-1 DNA condensation that occurs shortly after infection probably plays a role in genome internalization, as hypothesized for the infection of some bacteriophages. The subsequent perforation of the host photosynthetic membranes presumably enables trafficking of viral genomes towards host nuclei. Previous studies established that at late infection stages PBCV-1 generates cytoplasmic organelles, termed viral factories, where viral assembly takes place, a feature characteristic of many large dsDNA viruses that infect eukaryotic organisms. PBCV-1 thus appears to combine a bacteriophage-like mechanism during early infection stages with a eukaryotic-like infection pathway in its late replication cycle. PMID:28850602

  14. Longitudinal Study of Hepatitis A Infection by Saliva Sampling: The Kinetics of HAV Markers in Saliva Revealed the Application of Saliva Tests for Hepatitis A Study.

    PubMed

    Amado Leon, Luciane Almeida; de Almeida, Adilson José; de Paula, Vanessa Salete; Tourinho, Renata Santos; Villela, Daniel Antunes Maciel; Gaspar, Ana Maria Coimbra; Lewis-Ximenez, Lia Laura; Pinto, Marcelo Alves

    2015-01-01

    Despite the increasing numbers of studies investigating hepatitis A diagnostic through saliva, the frequency and the pattern of hepatitis A virus (HAV) markers in this fluid still remains unknown. To address this issue, we carried on a longitudinal study to examine the kinetics of HAV markers in saliva, in comparison with serum samples. The present study followed-up ten patients with acute hepatitis A infection during 180 days post diagnosis (dpd). Total anti-HAV was detected in paired serum and saliva samples until the end of the follow-up, showing a peak titer at 90th. However, total anti-HAV level was higher in serum than in saliva samples. This HAV marker showed a probability of 100% to be detected in both serum and saliva during 180 dpd. The IgM anti-HAV could be detected in saliva up to 150 dpd, showing the highest frequency at 30th, when it was detected in all individuals. During the first month of HAV infection, this acute HAV marker showed a detection probability of 100% in paired samples. The detection of IgM anti-HAV in saliva was not dependent on its level in serum, HAV-RNA detection and/or viral load, since no association was found between IgM anti-HAV positivity in saliva and any of these parameter (p>0.05). Most of the patients (80%) were found to contain HAV-RNA in saliva, mainly at early acute phase (30th day). However, it was possible to demonstrate the HAV RNA presence in paired samples for more than 90 days, even after seroconversion. No significant relationship was observed between salivary HAV-RNA positivity and serum viral load, demonstrating that serum viral load is not predictive of HAV-RNA detection in saliva. Similar viral load was seen in paired samples (on average 104 copies/mL). These data demonstrate that the best diagnostic coverage can be achieved by salivary anti-HAV antibodies and HAV-RNA tests during 30-90 dpd. The long detection and high probability of specific-HAV antibodies positivity in saliva samples make the assessment of salivary antibodies a useful tool for diagnosis and epidemiological studies. The high frequency of HAV-RNA in saliva and the probability of detection of about 50%, during the first 30 dpd, demonstrate that saliva is also useful for molecular investigation of hepatitis A cases, mainly during the early course of infection. Therefore, the collection of saliva may provide a simple, cheap and non-invasive means of diagnosis, epidemiological surveys and monitoring of hepatitis A infection purposes.

  15. Longitudinal Study of Hepatitis A Infection by Saliva Sampling: The Kinetics of HAV Markers in Saliva Revealed the Application of Saliva Tests for Hepatitis A Study

    PubMed Central

    Amado Leon, Luciane Almeida; de Almeida, Adilson José; de Paula, Vanessa Salete; Tourinho, Renata Santos; Villela, Daniel Antunes Maciel; Gaspar, Ana Maria Coimbra; Lewis-Ximenez, Lia Laura; Pinto, Marcelo Alves

    2015-01-01

    Despite the increasing numbers of studies investigating hepatitis A diagnostic through saliva, the frequency and the pattern of hepatitis A virus (HAV) markers in this fluid still remains unknown. To address this issue, we carried on a longitudinal study to examine the kinetics of HAV markers in saliva, in comparison with serum samples. The present study followed-up ten patients with acute hepatitis A infection during 180 days post diagnosis (dpd). Total anti-HAV was detected in paired serum and saliva samples until the end of the follow-up, showing a peak titer at 90th. However, total anti-HAV level was higher in serum than in saliva samples. This HAV marker showed a probability of 100% to be detected in both serum and saliva during 180 dpd. The IgM anti-HAV could be detected in saliva up to 150 dpd, showing the highest frequency at 30th, when it was detected in all individuals. During the first month of HAV infection, this acute HAV marker showed a detection probability of 100% in paired samples. The detection of IgM anti-HAV in saliva was not dependent on its level in serum, HAV-RNA detection and/or viral load, since no association was found between IgM anti-HAV positivity in saliva and any of these parameter (p>0.05). Most of the patients (80%) were found to contain HAV-RNA in saliva, mainly at early acute phase (30th day). However, it was possible to demonstrate the HAV RNA presence in paired samples for more than 90 days, even after seroconversion. No significant relationship was observed between salivary HAV-RNA positivity and serum viral load, demonstrating that serum viral load is not predictive of HAV-RNA detection in saliva. Similar viral load was seen in paired samples (on average 104 copies/mL). These data demonstrate that the best diagnostic coverage can be achieved by salivary anti-HAV antibodies and HAV-RNA tests during 30–90 dpd. The long detection and high probability of specific-HAV antibodies positivity in saliva samples make the assessment of salivary antibodies a useful tool for diagnosis and epidemiological studies. The high frequency of HAV-RNA in saliva and the probability of detection of about 50%, during the first 30 dpd, demonstrate that saliva is also useful for molecular investigation of hepatitis A cases, mainly during the early course of infection. Therefore, the collection of saliva may provide a simple, cheap and non-invasive means of diagnosis, epidemiological surveys and monitoring of hepatitis A infection purposes. PMID:26690904

  16. Phonotactic Probability Effects in Children Who Stutter

    PubMed Central

    Anderson, Julie D.; Byrd, Courtney T.

    2008-01-01

    Purpose The purpose of this study was to examine the influence of phonotactic probability, the frequency of different sound segments and segment sequences, on the overall fluency with which words are produced by preschool children who stutter (CWS), as well as to determine whether it has an effect on the type of stuttered disfluency produced. Method A 500+ word language sample was obtained from 19 CWS. Each stuttered word was randomly paired with a fluently produced word that closely matched it in grammatical class, word length, familiarity, word and neighborhood frequency, and neighborhood density. Phonotactic probability values were obtained for the stuttered and fluent words from an online database. Results Phonotactic probability did not have a significant influence on the overall susceptibility of words to stuttering, but it did impact the type of stuttered disfluency produced. In specific, single-syllable word repetitions were significantly lower in phonotactic probability than fluently produced words, as well as part-word repetitions and sound prolongations. Conclusions In general, the differential impact of phonotactic probability on the type of stuttering-like disfluency produced by young CWS provides some support for the notion that different disfluency types may originate in the disruption of different levels of processing. PMID:18658056

  17. Predicted sequence of cortical tau and amyloid-β deposition in Alzheimer disease spectrum.

    PubMed

    Cho, Hanna; Lee, Hye Sun; Choi, Jae Yong; Lee, Jae Hoon; Ryu, Young Hoon; Lee, Myung Sik; Lyoo, Chul Hyoung

    2018-04-17

    We investigated sequential order between tau and amyloid-β (Aβ) deposition in Alzheimer disease spectrum using a conditional probability method. Two hundred twenty participants underwent 18 F-flortaucipir and 18 F-florbetaben positron emission tomography scans and neuropsychological tests. The presence of tau and Aβ in each region and impairment in each cognitive domain were determined by Z-score cutoffs. By comparing pairs of conditional probabilities, the sequential order of tau and Aβ deposition were determined. Probability for the presence of tau in the entorhinal cortex was higher than that of Aβ in all cortical regions, and in the medial temporal cortices, probability for the presence of tau was higher than that of Aβ. Conversely, in the remaining neocortex above the inferior temporal cortex, probability for the presence of Aβ was always higher than that of tau. Tau pathology in the entorhinal cortex may appear earlier than neocortical Aβ and may spread in the absence of Aβ within the neighboring medial temporal regions. However, Aβ may be required for massive tau deposition in the distant cortical areas. Copyright © 2018 Elsevier Inc. All rights reserved.

  18. Interaction of paired cortical and peripheral nerve stimulation on human motor neurons.

    PubMed

    Poon, David E; Roy, Francois D; Gorassini, Monica A; Stein, Richard B

    2008-06-01

    This paper contrasts responses in the soleus muscle of normal human subjects to two major inputs: the tibial nerve (TN) and the corticospinal tract. Paired transcranial magnetic stimulation (TMS) of the motor cortex at intervals of 10-25 ms strongly facilitated the motor evoked potential (MEP) produced by the second stimulus. In contrast, paired TN stimulation produced a depression of the reflex response to the second stimulus. Direct activation of the pyramidal tract did not facilitate a second response, suggesting that the MEP facilitation observed using paired TMS occurred in the cortex. A TN stimulus also depressed a subsequent MEP. Since the TN stimulus depressed both inputs, the mechanism is probably post-synaptic, such as afterhyperpolarization of motor neurons. Presynaptic mechanisms, such as homosynaptic depression, would only affect the pathway used as a conditioning stimulus. When TN and TMS pulses were paired, the largest facilitation occurred when TMS preceded TN by about 5 ms, which is optimal for summation of the two pathways at the level of the spinal motor neurons. A later, smaller facilitation occurred when a single TN stimulus preceded TMS by 50-60 ms, an interval that allows enough time for the sensory afferent input to reach the sensory cortex and be relayed to the motor cortex. Other work indicates that repetitively pairing nerve stimuli and TMS at these intervals, known as paired associative stimulation, produces long-term increases in the MEP and may be useful in strengthening residual pathways after damage to the central nervous system.

  19. Unmanned aerial vehicles for surveying marine fauna: assessing detection probability.

    PubMed

    Hodgson, Amanda; Peel, David; Kelly, Natalie

    2017-06-01

    Aerial surveys are conducted for various fauna to assess abundance, distribution, and habitat use over large spatial scales. They are traditionally conducted using light aircraft with observers recording sightings in real time. Unmanned Aerial Vehicles (UAVs) offer an alternative with many potential advantages, including eliminating human risk. To be effective, this emerging platform needs to provide detection rates of animals comparable to traditional methods. UAVs can also acquire new types of information, and this new data requires a reevaluation of traditional analyses used in aerial surveys; including estimating the probability of detecting animals. We conducted 17 replicate UAV surveys of humpback whales (Megaptera novaeangliae) while simultaneously obtaining a 'census' of the population from land-based observations, to assess UAV detection probability. The ScanEagle UAV, carrying a digital SLR camera, continuously captured images (with 75% overlap) along transects covering the visual range of land-based observers. We also used ScanEagle to conduct focal follows of whale pods (n = 12, mean duration = 40 min), to assess a new method of estimating availability. A comparison of the whale detections from the UAV to the land-based census provided an estimated UAV detection probability of 0.33 (CV = 0.25; incorporating both availability and perception biases), which was not affected by environmental covariates (Beaufort sea state, glare, and cloud cover). According to our focal follows, the mean availability was 0.63 (CV = 0.37), with pods including mother/calf pairs having a higher availability (0.86, CV = 0.20) than those without (0.59, CV = 0.38). The follows also revealed (and provided a potential correction for) a downward bias in group size estimates from the UAV surveys, which resulted from asynchronous diving within whale pods, and a relatively short observation window of 9 s. We have shown that UAVs are an effective alternative to traditional methods, providing a detection probability that is within the range of previous studies for our target species. We also describe a method of assessing availability bias that represents spatial and temporal characteristics of a survey, from the same perspective as the survey platform, is benign, and provides additional data on animal behavior. © 2017 by the Ecological Society of America.

  20. Using sightability-adjusted brood-pair ratios to estimate waterfowl productivity

    USGS Publications Warehouse

    Pagano, Anthony M.; Amundson, Courtney L.; Pieron, Matthew R.; Arnold, Todd W.; Kimmel, Timothy C.

    2014-01-01

    Historically, biologists used brood-pair ratios (BPRs) as an index to waterfowl productivity to help guide management decisions and evaluate conservation practices. However, BPRs are biased by imperfect detection probabilities, especially for broods. We conducted roadside surveys for breeding waterfowl pairs on 7–8 study sites in the springs of 2006–2008 in northeastern North Dakota, USA. Later each year, we conducted replicate counts of broods on the same wetlands and used mark–recapture methods to estimate sightability-adjusted BPRs (SA-BPRs). Traditional roadside brood surveys detected only 30–45% of the available broods, depending on species. We explored the potential for using SA-BPRs to measure hen success (i.e., the probability a female hatches ≥1 egg across all nesting attempts) for mallards (Anas platyrhynchos) and other upland-nesting dabbling ducks (Anas spp.). We found that SA-BPRs explained 40% of the variation in hen success over 5 species of dabbling ducks, and we were able to detect an effect of predator reduction on hen success in combined dabblers, but not in mallards alone. However, we found no relationship between SA-BPRs and mallard fledging rates (hen success × initial brood size × duckling survival). Our results suggest that SA-BPRs can provide a cost-effective alternative to traditional measures of productivity such as nesting success, but not to measures of duckling survival. Nevertheless, SA-BPRs may be useful in areas where traditional measures of waterfowl productivity are logistically or financially challenging.

  1. Resolving dual binding conformations of cellulosome cohesin-dockerin complexes using single-molecule force spectroscopy.

    PubMed

    Jobst, Markus A; Milles, Lukas F; Schoeler, Constantin; Ott, Wolfgang; Fried, Daniel B; Bayer, Edward A; Gaub, Hermann E; Nash, Michael A

    2015-10-31

    Receptor-ligand pairs are ordinarily thought to interact through a lock and key mechanism, where a unique molecular conformation is formed upon binding. Contrary to this paradigm, cellulosomal cohesin-dockerin (Coh-Doc) pairs are believed to interact through redundant dual binding modes consisting of two distinct conformations. Here, we combined site-directed mutagenesis and single-molecule force spectroscopy (SMFS) to study the unbinding of Coh:Doc complexes under force. We designed Doc mutations to knock out each binding mode, and compared their single-molecule unfolding patterns as they were dissociated from Coh using an atomic force microscope (AFM) cantilever. Although average bulk measurements were unable to resolve the differences in Doc binding modes due to the similarity of the interactions, with a single-molecule method we were able to discriminate the two modes based on distinct differences in their mechanical properties. We conclude that under native conditions wild-type Doc from Clostridium thermocellum exocellulase Cel48S populates both binding modes with similar probabilities. Given the vast number of Doc domains with predicted dual binding modes across multiple bacterial species, our approach opens up new possibilities for understanding assembly and catalytic properties of a broad range of multi-enzyme complexes.

  2. A stable wavelength-tunable triggered source of single photons and cascaded photon pairs at the telecom C-band

    NASA Astrophysics Data System (ADS)

    Zeuner, Katharina D.; Paul, Matthias; Lettner, Thomas; Reuterskiöld Hedlund, Carl; Schweickert, Lucas; Steinhauer, Stephan; Yang, Lily; Zichi, Julien; Hammar, Mattias; Jöns, Klaus D.; Zwiller, Val

    2018-04-01

    The implementation of fiber-based long-range quantum communication requires tunable sources of single photons at the telecom C-band. Stable and easy-to-implement wavelength-tunability of individual sources is crucial to (i) bring remote sources into resonance, (ii) define a wavelength standard, and (iii) ensure scalability to operate a quantum repeater. So far, the most promising sources for true, telecom single photons are semiconductor quantum dots, due to their ability to deterministically and reliably emit single and entangled photons. However, the required wavelength-tunability is hard to attain. Here, we show a stable wavelength-tunable quantum light source by integrating strain-released InAs quantum dots on piezoelectric substrates. We present triggered single-photon emission at 1.55 μm with a multi-photon emission probability as low as 0.097, as well as photon pair emission from the radiative biexciton-exciton cascade. We achieve a tuning range of 0.25 nm which will allow us to spectrally overlap remote quantum dots or tuning distant quantum dots into resonance with quantum memories. This opens up realistic avenues for the implementation of photonic quantum information processing applications at telecom wavelengths.

  3. Lotka-Volterra systems in environments with randomly disordered temporal periodicity

    NASA Astrophysics Data System (ADS)

    Naess, Arvid; Dimentberg, Michael F.; Gaidai, Oleg

    2008-08-01

    A generalized Lotka-Volterra model for a pair of interacting populations of predators and prey is studied. The model accounts for the prey’s interspecies competition and therefore is asymptotically stable, whereas its oscillatory behavior is induced by temporal variations in environmental conditions simulated by those in the prey’s reproduction rate. Two models of the variations are considered, each of them combining randomness with “hidden” periodicity. The stationary joint probability density function (PDF) of the number of predators and prey is calculated numerically by the path integration (PI) method based on the use of characteristic functions and the fast Fourier transform. The numerical results match those for the asymptotic case of white-noise variations for which an analytical solution is available. Several examples are studied, with calculations of important characteristics of oscillations, for example the expected rate of up-crossings given the level of the predator number. The calculated PDFs may be of predominantly random (unimodal) or predominantly periodic nature (bimodal). Thus, the PI method has been demonstrated to be a powerful tool for studies of the dynamics of predator-prey pairs. The method captures the random oscillations as observed in nature, taking into account potential periodicity in the environmental conditions.

  4. Lotka-Volterra systems in environments with randomly disordered temporal periodicity.

    PubMed

    Naess, Arvid; Dimentberg, Michael F; Gaidai, Oleg

    2008-08-01

    A generalized Lotka-Volterra model for a pair of interacting populations of predators and prey is studied. The model accounts for the prey's interspecies competition and therefore is asymptotically stable, whereas its oscillatory behavior is induced by temporal variations in environmental conditions simulated by those in the prey's reproduction rate. Two models of the variations are considered, each of them combining randomness with "hidden" periodicity. The stationary joint probability density function (PDF) of the number of predators and prey is calculated numerically by the path integration (PI) method based on the use of characteristic functions and the fast Fourier transform. The numerical results match those for the asymptotic case of white-noise variations for which an analytical solution is available. Several examples are studied, with calculations of important characteristics of oscillations, for example the expected rate of up-crossings given the level of the predator number. The calculated PDFs may be of predominantly random (unimodal) or predominantly periodic nature (bimodal). Thus, the PI method has been demonstrated to be a powerful tool for studies of the dynamics of predator-prey pairs. The method captures the random oscillations as observed in nature, taking into account potential periodicity in the environmental conditions.

  5. Interactions between similar and dissimilar charged interfaces in the presence of multivalent anions.

    PubMed

    Moazzami-Gudarzi, Mohsen; Adam, Pavel; Smith, Alexander M; Trefalt, Gregor; Szilágyi, István; Maroni, Plinio; Borkovec, Michal

    2018-04-04

    Direct force measurements involving amidine latex (AL) and sulfate latex (SL) particles in aqueous solutions containing multivalent ferrocyanide anions are presented. These measurements feature three different pairs of particles, namely SL-SL, AL-SL, and AL-AL. The force profiles are quantitatively interpreted in terms of the theory by Derjaguin, Landau, Verwey, and Overbeek (DLVO) that is combined with a short-ranged exponential attraction. In monovalent salt solutions, the AL particles are positively charged, while the SL particles are negatively charged. In solutions containing ferrocyanide, the charge of the AL particles is reversed as the concentration is increased. The longer-ranged component of all force profiles is fully compatible with DLVO theory, provided effects of charge regulation are included. At shorter distances, an additional exponential attraction must be introduced, whereby the respective decay length is about 2 nm for the AL-AL pair, and below 1 nm for the SL-SL pair. This non-DLVO force is intermediate for the asymmetric AL-SL pair. These additional forces are probably related to charge fluctuations, patch-charged interactions, or hydrophobic forces.

  6. Algorithmic information theory and the hidden variable question

    NASA Technical Reports Server (NTRS)

    Fuchs, Christopher

    1992-01-01

    The admissibility of certain nonlocal hidden-variable theories are explained via information theory. Consider a pair of Stern-Gerlach devices with fixed nonparallel orientations that periodically perform spin measurements on identically prepared pairs of electrons in the singlet spin state. Suppose the outcomes are recorded as binary strings l and r (with l sub n and r sub n denoting their n-length prefixes). The hidden-variable theories considered here require that there exists a recursive function which may be used to transform l sub n into r sub n for any n. This note demonstrates that such a theory cannot reproduce all the statistical predictions of quantum mechanics. Specifically, consider an ensemble of outcome pairs (l,r). From the associated probability measure, the Shannon entropies H sub n and H bar sub n for strings l sub n and pairs (l sub n, r sub n) may be formed. It is shown that such a theory requires that the absolute value of H bar sub n - H sub n be bounded - contrasting the quantum mechanical prediction that it grow with n.

  7. Magnetic photon splitting and gamma ray burst spectra

    NASA Technical Reports Server (NTRS)

    Baring, Matthew G.

    1992-01-01

    The splitting of photons into two photons becomes both possible and significant in magnetic fields in excess of 10(exp 12) Gauss. Below the threshold energy, 2m sub e c(exp 2) for single photon pair production, splitting can be an astronomically observable phenomenon evident in gamma ray burst spectra. In such circumstances, it was found that magnetic photon splitting reprocesses the gamma ray burst continuum by degrading the photon energy, with a net effect that is quite similar to pair cascade reprocessing of the spectrum. Results are presented for the spectral modifications due to splitting, taking into account the different probabilities for splitting for different polarization modes. Unpolarized and polarized pair cascade photon spectra form the input spectra for the model, which calculates the resulting splitting reprocessed spectra numerically by solving the photon kinetic equations for each polarization mode. This inclusion of photon polarizations is found to not alter previous predictions that splitting produce a significant flattening of the hard X ray continuum and a bump at MeV energies below a pair production turnover. The spectrum near the bump is always strongly polarized.

  8. Unbiased clustering estimation in the presence of missing observations

    NASA Astrophysics Data System (ADS)

    Bianchi, Davide; Percival, Will J.

    2017-11-01

    In order to be efficient, spectroscopic galaxy redshift surveys do not obtain redshifts for all galaxies in the population targeted. The missing galaxies are often clustered, commonly leading to a lower proportion of successful observations in dense regions. One example is the close-pair issue for SDSS spectroscopic galaxy surveys, which have a deficit of pairs of observed galaxies with angular separation closer than the hardware limit on placing neighbouring fibres. Spatially clustered missing observations will exist in the next generations of surveys. Various schemes have previously been suggested to mitigate these effects, but none works for all situations. We argue that the solution is to link the missing galaxies to those observed with statistically equivalent clustering properties, and that the best way to do this is to rerun the targeting algorithm, varying the angular position of the observations. Provided that every pair has a non-zero probability of being observed in one realization of the algorithm, then a pair-upweighting scheme linking targets to successful observations, can correct these issues. We present such a scheme, and demonstrate its validity using realizations of an idealized simple survey strategy.

  9. Comparison of clinical knowledge bases for summarization of electronic health records.

    PubMed

    McCoy, Allison B; Sittig, Dean F; Wright, Adam

    2013-01-01

    Automated summarization tools that create condition-specific displays may improve clinician efficiency. These tools require new kinds of knowledge that is difficult to obtain. We compared five problem-medication pair knowledge bases generated using four previously described knowledge base development approaches. The number of pairs in the resulting mapped knowledge bases varied widely due to differing mapping techniques from the source terminologies, ranging from 2,873 to 63,977,738 pairs. The number of overlapping pairs across knowledge bases was low, with one knowledge base having half of the pairs overlapping with another knowledge base, and most having less than a third overlapping. Further research is necessary to better evaluate the knowledge bases independently in additional settings, and to identify methods to integrate the knowledge bases.

  10. [The Visual Association Test to study episodic memory in clinical geriatric psychology].

    PubMed

    Diesfeldt, Han; Prins, Marleen; Lauret, Gijs

    2018-04-01

    The Visual Association Test (VAT) is a brief learning task that consists of six line drawings of pairs of interacting objects (association cards). Subjects are asked to name or identify each object and later are presented with one object from the pair (the cue) and asked to name the other (the target). The VAT was administered in a consecutive sample of 174 psychogeriatric day care participants with mild to major neurocognitive disorder. Comparison of test performance with normative data from non-demented subjects revealed that 69% scored within the range of a major deficit (0-8 over two recall trials), 14% a minor, and 17% no deficit (9-10, and ≥10 respectively).VAT-scores correlated with another test of memory function, the Cognitive Screening Test (CST), based on the Short Portable Mental Status Questionnaire (r = 0.53). Tests of executive functioning (Expanded Mental Control Test, Category Fluency, Clock Drawing) did not add significantly to the explanation of variance in VAT-scores.Fifty-five participants (31.6%) were faced with initial problems in naming or identifying one or more objects on the cue cards or association cards. If necessary, naming was aided by the investigator. Initial difficulties in identifying cue objects were associated with lower VAT-scores, but this did not hold for difficulties in identifying target objects.A hierarchical multiple regression analysis was used to examine whether linear or quadratic trends best fitted VAT performance across the range of CST scores. The regression model revealed a linear but not a quadratic trend. The best fitting linear model implied that VAT scores differentiated between CST scores in the lower, as well as in the upper range, indicating the absence of floor and ceiling effects, respectively. Moreover, the VAT compares favourably to word list-learning tasks being more attractive in its presentation of interacting visual objects and cued recall based on incidental learning of the association between cues and targets.For practical purposes and based on documented sensitivity and specificity, Bayesian probability tables give predictive power of age-specific VAT cutoff scores for the presence or absence of a major neurocognitive disorder across a range of a priori probabilities or base rates.

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Okutsu, N.; Shimamura, K.; Shimizu, E.

    To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH{sub 2} group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH{sub 2} group of G-Cmore » base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes.« less

  12. Attentional Regulation in Young Twins with Probable Stuttering, High Nonfluency, and Typical Fluency

    ERIC Educational Resources Information Center

    Felsenfeld, Susan; van Beljsterveldt, Catharina Eugenie Maria; Boomsma, Dorret Irene

    2010-01-01

    Purpose: Using a sample of 20,445 Dutch twins, this study examined the relationship between speech fluency and attentional regulation in children. A secondary objective was to identify etiological overlap between nonfluency and poor attention using fluency-discordant twin pairs. Method: Three fluency groups were created at age 5 using a parent…

  13. Assessing risk to birds from industrial wind energy development via paired resource selection nodels

    Treesearch

    Tricia A. Miller; Robert P. Brooks; Michael Lanzone; David Brandes; Jeff Cooper; Kieran O' malley; Charles Maisonneuve; Junior Tremblay; Adam Duerr; Todd Katzner

    2014-01-01

    When wildlife habitat overlaps with industrial development animals may be harmed. Because wildlife and people select resources to maximize biological fitness and economic return, respectively, we estimated risk, the probability of eagles encountering and being affected by turbines, by overlaying models of resource selection for each entity. This conceptual framework...

  14. TH-A-BRF-02: BEST IN PHYSICS (JOINT IMAGING-THERAPY) - Modeling Tumor Evolution for Adaptive Radiation Therapy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Y; Lee, CG; Chan, TCY

    2014-06-15

    Purpose: To develop mathematical models of tumor geometry changes under radiotherapy that may support future adaptive paradigms. Methods: A total of 29 cervical patients were scanned using MRI, once for planning and weekly thereafter for treatment monitoring. Using the tumor volumes contoured by a radiologist, three mathematical models were investigated based on the assumption of a stochastic process of tumor evolution. The “weekly MRI” model predicts tumor geometry for the following week from the last two consecutive MRI scans, based on the voxel transition probability. The other two models use only the first pair of consecutive MRI scans, and themore » transition probabilities were estimated via tumor type classified from the entire data set. The classification is based on either measuring the tumor volume (the “weekly volume” model), or implementing an auxiliary “Markov chain” model. These models were compared to a constant volume approach that represents the current clinical practice, using various model parameters; e.g., the threshold probability β converts the probability map into a tumor shape (larger threshold implies smaller tumor). Model performance was measured using volume conformity index (VCI), i.e., the union of the actual target and modeled target volume squared divided by product of these two volumes. Results: The “weekly MRI” model outperforms the constant volume model by 26% on average, and by 103% for the worst 10% of cases in terms of VCI under a wide range of β. The “weekly volume” and “Markov chain” models outperform the constant volume model by 20% and 16% on average, respectively. They also perform better than the “weekly MRI” model when β is large. Conclusion: It has been demonstrated that mathematical models can be developed to predict tumor geometry changes for cervical cancer undergoing radiotherapy. The models can potentially support adaptive radiotherapy paradigm by reducing normal tissue dose. This research was supported in part by the Ontario Consortium for Adaptive Interventions in Radiation Oncology (OCAIRO) funded by the Ontario Research Fund (ORF) and the MITACS Accelerate Internship Program.« less

  15. Bond-length distributions for ions bonded to oxygen: results for the non-metals and discussion of lone-pair stereoactivity and the polymerization of PO4

    PubMed Central

    Gagné, Olivier Charles

    2018-01-01

    Bond-length distributions are examined for three configurations of the H+ ion, 16 configurations of the group 14–16 non-metal ions and seven configurations of the group 17 ions bonded to oxygen, for 223 coordination polyhedra and 452 bond distances for the H+ ion, 5957 coordination polyhedra and 22 784 bond distances for the group 14–16 non-metal ions, and 248 coordination polyhedra and 1394 bond distances for the group 17 non-metal ions. H⋯O and O—H + H⋯O distances correlate with O⋯O distance (R 2 = 0.94 and 0.96): H⋯O = 1.273 × O⋯O – 1.717 Å; O—H + H⋯O = 1.068 × O⋯O – 0.170 Å. These equations may be used to locate the hydrogen atom more accurately in a structure refined by X-ray diffraction. For non-metal elements that occur with lone-pair electrons, the most observed state between the n versus n+2 oxidation state is that of highest oxidation state for period 3 cations, and lowest oxidation state for period 4 and 5 cations when bonded to O2−. Observed O—X—O bond angles indicate that the period 3 non-metal ions P3+, S4+, Cl3+ and Cl5+ are lone-pair seteroactive when bonded to O2−, even though they do not form secondary bonds. There is no strong correlation between the degree of lone-pair stereoactivity and coordination number when including secondary bonds. There is no correlation between lone-pair stereoactivity and bond-valence sum at the central cation. In synthetic compounds, PO4 polymerizes via one or two bridging oxygen atoms, but not by three. Partitioning our PO4 dataset shows that multi-modality in the distribution of bond lengths is caused by the different bond-valence constraints that arise for Obr = 0, 1 and 2. For strongly bonded cations, i.e. oxyanions, the most probable cause of mean bond length variation is the effect of structure type, i.e. stress induced by the inability of a structure to follow its a priori bond lengths. For ions with stereoactive lone-pair electrons, the most probable cause of variation is bond-length distortion.

  16. Recognition of Watson-Crick base pairs: constraints and limits due to geometric selection and tautomerism

    PubMed Central

    Yusupov, Marat; Yusupova, Gulnara

    2014-01-01

    The natural bases of nucleic acids have a strong preference for one tautomer form, guaranteeing fidelity in their hydrogen bonding potential. However, base pairs observed in recent crystal structures of polymerases and ribosomes are best explained by an alternative base tautomer, leading to the formation of base pairs with Watson-Crick-like geometries. These observations set limits to geometric selection in molecular recognition of complementary Watson-Crick pairs for fidelity in replication and translation processes. PMID:24765524

  17. Combinatorial DNA Damage Pairing Model Based on X-Ray-Induced Foci Predicts the Dose and LET Dependence of Cell Death in Human Breast Cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vadhavkar, Nikhil; Pham, Christopher; Georgescu, Walter

    In contrast to the classic view of static DNA double-strand breaks (DSBs) being repaired at the site of damage, we hypothesize that DSBs move and merge with each other over large distances (m). As X-ray dose increases, the probability of having DSB clusters increases as does the probability of misrepair and cell death. Experimental work characterizing the X-ray dose dependence of radiation-induced foci (RIF) in nonmalignant human mammary epithelial cells (MCF10A) is used here to validate a DSB clustering model. We then use the principles of the local effect model (LEM) to predict the yield of DSBs at the submicronmore » level. Two mechanisms for DSB clustering, namely random coalescence of DSBs versus active movement of DSBs into repair domains are compared and tested. Simulations that best predicted both RIF dose dependence and cell survival after X-ray irradiation favored the repair domain hypothesis, suggesting the nucleus is divided into an array of regularly spaced repair domains of ~;;1.55 m sides. Applying the same approach to high-linear energy transfer (LET) ion tracks, we are able to predict experimental RIF/m along tracks with an overall relative error of 12percent, for LET ranging between 30 350 keV/m and for three different ions. Finally, cell death was predicted by assuming an exponential dependence on the total number of DSBs and of all possible combinations of paired DSBs within each simulated RIF. Relative biological effectiveness (RBE) predictions for cell survival of MCF10A exposed to high-LET showed an LET dependence that matches previous experimental results for similar cell types. Overall, this work suggests that microdosimetric properties of ion tracks at the submicron level are sufficient to explain both RIF data and survival curves for any LET, similarly to the LEM assumption. Conversely, high-LET death mechanism does not have to infer linear-quadratic dose formalism as done in the LEM. In addition, the size of repair domains derived in our model are based on experimental RIF and are three times larger than the hypothetical LEM voxel used to fit survival curves. Our model is therefore an alternative to previous approaches that provides a testable biological mechanism (i.e., RIF). In addition, we propose that DSB pairing will help develop more accurate alternatives to the linear cancer risk model (LNT) currently used for regulating exposure to very low levels of ionizing radiation.« less

  18. The origin of polynucleotide-directed protein synthesis

    NASA Technical Reports Server (NTRS)

    Orgel, Leslie E.

    1989-01-01

    If protein synthesis evolved in an RNA world it was probably preceded by simpler processes by means of which interaction with amino acids conferred selective advantage on replicating RNA molecules. It is suggested that at first the simple attachment of amino acids to the 2'(3') termini of RNA templates favored initiation of replication at the end of the template rather than at internal positions. The second stage in the evolution of protein synthesis would probably have been the association of pairs of charged RNA adaptors in such a way as to favor noncoded formation of peptides. Only after this process had become efficient could coded synthesis have begun.

  19. Comparison of the Mortality Probability Admission Model III, National Quality Forum, and Acute Physiology and Chronic Health Evaluation IV hospital mortality models: implications for national benchmarking*.

    PubMed

    Kramer, Andrew A; Higgins, Thomas L; Zimmerman, Jack E

    2014-03-01

    To examine the accuracy of the original Mortality Probability Admission Model III, ICU Outcomes Model/National Quality Forum modification of Mortality Probability Admission Model III, and Acute Physiology and Chronic Health Evaluation IVa models for comparing observed and risk-adjusted hospital mortality predictions. Retrospective paired analyses of day 1 hospital mortality predictions using three prognostic models. Fifty-five ICUs at 38 U.S. hospitals from January 2008 to December 2012. Among 174,001 intensive care admissions, 109,926 met model inclusion criteria and 55,304 had data for mortality prediction using all three models. None. We compared patient exclusions and the discrimination, calibration, and accuracy for each model. Acute Physiology and Chronic Health Evaluation IVa excluded 10.7% of all patients, ICU Outcomes Model/National Quality Forum 20.1%, and Mortality Probability Admission Model III 24.1%. Discrimination of Acute Physiology and Chronic Health Evaluation IVa was superior with area under receiver operating curve (0.88) compared with Mortality Probability Admission Model III (0.81) and ICU Outcomes Model/National Quality Forum (0.80). Acute Physiology and Chronic Health Evaluation IVa was better calibrated (lowest Hosmer-Lemeshow statistic). The accuracy of Acute Physiology and Chronic Health Evaluation IVa was superior (adjusted Brier score = 31.0%) to that for Mortality Probability Admission Model III (16.1%) and ICU Outcomes Model/National Quality Forum (17.8%). Compared with observed mortality, Acute Physiology and Chronic Health Evaluation IVa overpredicted mortality by 1.5% and Mortality Probability Admission Model III by 3.1%; ICU Outcomes Model/National Quality Forum underpredicted mortality by 1.2%. Calibration curves showed that Acute Physiology and Chronic Health Evaluation performed well over the entire risk range, unlike the Mortality Probability Admission Model and ICU Outcomes Model/National Quality Forum models. Acute Physiology and Chronic Health Evaluation IVa had better accuracy within patient subgroups and for specific admission diagnoses. Acute Physiology and Chronic Health Evaluation IVa offered the best discrimination and calibration on a large common dataset and excluded fewer patients than Mortality Probability Admission Model III or ICU Outcomes Model/National Quality Forum. The choice of ICU performance benchmarks should be based on a comparison of model accuracy using data for identical patients.

  20. An activity canyon characterization of the pharmacological topography.

    PubMed

    Kulkarni, Varsha S; Wild, David J

    2016-01-01

    Highly chemically similar drugs usually possess similar biological activities, but sometimes, small changes in chemistry can result in a large difference in biological effects. Chemically similar drug pairs that show extreme deviations in activity represent distinctive drug interactions having important implications. These associations between chemical and biological similarity are studied as discontinuities in activity landscapes. Particularly, activity cliffs are quantified by the drop in similar activity of chemically similar drugs. In this paper, we construct a landscape using a large drug-target network and consider the rises in similarity and variation in activity along the chemical space. Detailed analysis of structure and activity gives a rigorous quantification of distinctive pairs and the probability of their occurrence. We analyze pairwise similarity (s) and variation (d) in activity of drugs on proteins. Interactions between drugs are quantified by considering pairwise s and d weights jointly with corresponding chemical similarity (c) weights. Similarity and variation in activity are measured as the number of common and uncommon targets of two drugs respectively. Distinctive interactions occur between drugs having high c and above (below) average d (s). Computation of predicted probability of distinctiveness employs joint probability of c, s and of c, d assuming independence of structure and activity. Predictions conform with the observations at different levels of distinctiveness. Results are validated on the data used and another drug ensemble. In the landscape, while s and d decrease as c increases, d maintains value more than s. c ∈ [0.3, 0.64] is the transitional region where rises in d are significantly greater than drops in s. It is fascinating that distinctive interactions filtered with high d and low s are different in nature. It is crucial that high c interactions are more probable of having above average d than s. Identification of distinctive interactions is better with high d than low s. These interactions belong to diverse classes. d is greatest between drugs and analogs prepared for treatment of same class of ailments but with different therapeutic specifications. In contrast, analogs having low s would treat ailments from distinct classes. Intermittent spikes in d along the axis of c represent canyons in the activity landscape. This new representation accounts for distinctiveness through relative rises in s and d. It provides a mathematical basis for predicting the probability of occurrence of distinctiveness. It identifies the drug pairs at varying levels of distinctiveness and non-distinctiveness. The predicted probability formula is validated even if data approximately satisfy the conditions of its construction. Also, the postulated independence of structure and activity is of little significance to the overall assessment. The difference in distinctive interactions obtained by s and d highlights the importance of studying both of them, and reveals how the choice of measurement can affect the interpretation. The methods in this paper can be used to interpret whether or not drug interactions are distinctive and the probability of their occurrence. Practitioners and researchers can rely on this identification for quantitative modeling and assessment.

  1. Continuous-Time Monitoring of Landau-Zener Interference in a Cooper-Pair Box

    NASA Astrophysics Data System (ADS)

    Sillanpää, Mika; Lehtinen, Teijo; Paila, Antti; Makhlin, Yuriy; Hakonen, Pertti

    2006-05-01

    Landau-Zener (LZ) tunneling can occur with a certain probability when crossing energy levels of a quantum two-level system are swept across the minimum energy separation. Here we present experimental evidence of quantum interference effects in solid-state LZ tunneling. We used a Cooper-pair box qubit where the LZ tunneling occurs at the charge degeneracy. By employing a weak nondemolition monitoring, we observe interference between consecutive LZ-tunneling events; we find that the average level occupancies depend on the dynamical phase. The system’s unusually strong linear response is explained by interband relaxation. Our interferometer can be used as a high-resolution Mach-Zehnder type detector for phase and charge.

  2. Continuous-time monitoring of Landau-Zener interference in a cooper-pair box.

    PubMed

    Sillanpää, Mika; Lehtinen, Teijo; Paila, Antti; Makhlin, Yuriy; Hakonen, Pertti

    2006-05-12

    Landau-Zener (LZ) tunneling can occur with a certain probability when crossing energy levels of a quantum two-level system are swept across the minimum energy separation. Here we present experimental evidence of quantum interference effects in solid-state LZ tunneling. We used a Cooper-pair box qubit where the LZ tunneling occurs at the charge degeneracy. By employing a weak nondemolition monitoring, we observe interference between consecutive LZ-tunneling events; we find that the average level occupancies depend on the dynamical phase. The system's unusually strong linear response is explained by interband relaxation. Our interferometer can be used as a high-resolution Mach-Zehnder-type detector for phase and charge.

  3. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aaltonen, T.

    We search for resonant production of tt pairs in 4.8 fb -1 integrated luminosity of pp collision data at √s = 1.96 TeV in the lepton+jets decay channel, where one top quark decays leptonically and the other hadronically. A matrix element reconstruction technique is used; for each event a probability density function (pdf) of the tt candidate invariant mass is sampled. These pdfs are used to construct a likelihood function, whereby the cross section for resonant tt production is estimated, given a hypothetical resonance mass and width. The data indicate no evidence of resonant production of tt pairs. A benchmarkmore » model of leptophobic Z' → tt is excluded with m Z' < 900 GeV at 95% confidence level.« less

  4. Violation of continuous-variable Einstein-Podolsky-Rosen steering with discrete measurements.

    PubMed

    Schneeloch, James; Dixon, P Ben; Howland, Gregory A; Broadbent, Curtis J; Howell, John C

    2013-03-29

    In this Letter, we derive an entropic Einstein-Podolsky-Rosen (EPR) steering inequality for continuous-variable systems using only experimentally measured discrete probability distributions and details of the measurement apparatus. We use this inequality to witness EPR steering between the positions and momenta of photon pairs generated in spontaneous parametric down-conversion. We examine the asymmetry between parties in this inequality, and show that this asymmetry can be used to reduce the technical requirements of experimental setups intended to demonstrate the EPR paradox. Furthermore, we develop a more stringent steering inequality that is symmetric between parties, and use it to show that the down-converted photon pairs also exhibit symmetric EPR steering.

  5. Violation of Continuous-Variable Einstein-Podolsky-Rosen Steering with Discrete Measurements

    NASA Astrophysics Data System (ADS)

    Schneeloch, James; Dixon, P. Ben; Howland, Gregory A.; Broadbent, Curtis J.; Howell, John C.

    2013-03-01

    In this Letter, we derive an entropic Einstein-Podolsky-Rosen (EPR) steering inequality for continuous-variable systems using only experimentally measured discrete probability distributions and details of the measurement apparatus. We use this inequality to witness EPR steering between the positions and momenta of photon pairs generated in spontaneous parametric down-conversion. We examine the asymmetry between parties in this inequality, and show that this asymmetry can be used to reduce the technical requirements of experimental setups intended to demonstrate the EPR paradox. Furthermore, we develop a more stringent steering inequality that is symmetric between parties, and use it to show that the down-converted photon pairs also exhibit symmetric EPR steering.

  6. Identifications and limited spectroscopy for Luyten common proper motion stars with probable white dwarf components. I - Pair brighter than 17th magnitude

    NASA Technical Reports Server (NTRS)

    Oswalt, Terry D.; Hintzen, Paul M.; Luyten, Willem J.

    1988-01-01

    Identifications are provided for 103 bright Luyten common proper motion (CPM) stellar systems with m(pg) less than 17.0 mag containing likely white dwarf (WD) components. New spectral types are presented for 55 components, and spectral types for 51 more are available in the literature. With the CPM systems previously published by Giclas et al. (1978), the Luyten stars provide a uniform sample of nearly 200 pairs or multiples brighter than 17h magnitude. Selection effects biasing the combined samples are discussed; in particular, evidence is presented that fewer than 1 percent of wide WD binaries have been detected.

  7. Dependence on solute concentration of the efficiency of scavenging of electrons in recombining geminate ion pairs

    NASA Astrophysics Data System (ADS)

    Tweeten, David W.; Lee, Kaidee; Lipsky, Sanford

    The fluorescence from solutions of hexafluorobenzene in cyclopentane, 2,2,4-trimethylpentane, 2,2-dimethylbutane and tetramethylsilane irradiated with β-particles has been studied as a function of the hexafluorobenzene concentration from c = 10 -3-10 -1 M. The data are analyzed to permit extraction of geminate ion-pair scavenging probability p†. This is found to have a dependence on c entirely similar to what has previously been reported for p† extracted from quenching of solvent fluorescence by perfluorocarbon scavengers, i.e. p† = (α c) 0.7/[1 + (α c) 0.7]. The difference between these results and that for p† obtained via measurement of chemical product formation is discussed.

  8. Landau-Zener transitions for Majorana fermions

    NASA Astrophysics Data System (ADS)

    Khlebnikov, Sergei

    2018-05-01

    One-dimensional systems obtained as low-energy limits of hybrid superconductor-topological insulator devices provide means of production, transport, and destruction of Majorana bound states (MBSs) by variations of the magnetic flux. When two or more pairs of MBSs are present in the intermediate state, there is a possibility of a Landau-Zener transition wherein even a slow variation of the flux leads to production of a quasiparticle pair. We study numerically a version of this process with four MBSs produced and subsequently destroyed and find that, quite universally, the probability of quasiparticle production in it is 50%. This implies that the effect may be a limiting factor in applications requiring a high degree of quantum coherence.

  9. Generation of Single Photons and Entangled Photon Pairs from a Quantum Dot

    NASA Astrophysics Data System (ADS)

    Yamamoto, Y.; Pelton, M.; Santori, C.; Solomon, G. S.

    2002-10-01

    Current quantum cryptography systems are limited by the Poissonian photon statistics of a standard light source: a security loophole is opened up by the possibility of multiple-photon pulses. By replacing the source with a single-photon emitter, transmission rates of secure information can be improved. A single photon source is also essential to implement a linear optics quantum computer. We have investigated the use of single self-assembled InAs/GaAs quantum dots as such single-photon sources, and have seen a hundred-fold reduction in the multi-photon probability as compared to Poissonian pulses. An extension of our experiment should also allow for the generation of triggered, polarizationentangled photon pairs.

  10. Structure based alignment and clustering of proteins (STRALCP)

    DOEpatents

    Zemla, Adam T.; Zhou, Carol E.; Smith, Jason R.; Lam, Marisa W.

    2013-06-18

    Disclosed are computational methods of clustering a set of protein structures based on local and pair-wise global similarity values. Pair-wise local and global similarity values are generated based on pair-wise structural alignments for each protein in the set of protein structures. Initially, the protein structures are clustered based on pair-wise local similarity values. The protein structures are then clustered based on pair-wise global similarity values. For each given cluster both a representative structure and spans of conserved residues are identified. The representative protein structure is used to assign newly-solved protein structures to a group. The spans are used to characterize conservation and assign a "structural footprint" to the cluster.

  11. Electron-hole pair effects in methane dissociative chemisorption on Ni(111)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Luo, Xuan; Jiang, Bin, E-mail: bjiangch@ustc.edu.cn; Juaristi, J. Iñaki

    The dissociative chemisorption of methane on metal surfaces has attracted much attention in recent years as a prototype of gas-surface reactions in understanding the mode specific and bond selective chemistry. In this work, we systematically investigate the influence of electron-hole pair excitations on the dissociative chemisorption of CH{sub 4}/CH{sub 3}D/CHD{sub 3} on Ni(111). The energy dissipation induced by surface electron-hole pair excitations is modeled as a friction force introduced in the generalized Langevin equation, in which the independent atomic friction coefficients are determined within the local-density friction approximation. Quasi-classical trajectory calculations for CH{sub 4}/CH{sub 3}D/CHD{sub 3} have been carried outmore » on a recently developed twelve-dimensional potential energy surface. Comparing the dissociation probabilities obtained with and without friction, our results clearly indicate that the electron-hole pair effects are generally small, both on absolute reactivity of each vibrational state and on the mode specificity and bond selectivity. Given similar observations in both water and methane dissociation processes, we conclude that electron-hole pair excitations would not play an important role as long as the reaction is direct and the interaction time between the molecule and metal electrons is relatively short.« less

  12. Multisensory integration across the senses in young and old adults

    PubMed Central

    Mahoney, Jeannette R.; Li, Po Ching Clara; Oh-Park, Mooyeon; Verghese, Joe; Holtzer, Roee

    2011-01-01

    Stimuli are processed concurrently and across multiple sensory inputs. Here we directly compared the effect of multisensory integration (MSI) on reaction time across three paired sensory inputs in eighteen young (M=19.17 yrs) and eighteen old (M=76.44 yrs) individuals. Participants were determined to be non-demented and without any medical or psychiatric conditions that would affect their performance. Participants responded to randomly presented unisensory (auditory, visual, somatosensory) stimuli and three paired sensory inputs consisting of auditory-somatosensory (AS) auditory-visual (AV) and visual-somatosensory (VS) stimuli. Results revealed that reaction time (RT) to all multisensory pairings was significantly faster than those elicited to the constituent unisensory conditions across age groups; findings that could not be accounted for by simple probability summation. Both young and old participants responded the fastest to multisensory pairings containing somatosensory input. Compared to younger adults, older adults demonstrated a significantly greater RT benefit when processing concurrent VS information. In terms of co-activation, older adults demonstrated a significant increase in the magnitude of visual-somatosensory co-activation (i.e., multisensory integration), while younger adults demonstrated a significant increase in the magnitude of auditory-visual and auditory-somatosensory co-activation. This study provides first evidence in support of the facilitative effect of pairing somatosensory with visual stimuli in older adults. PMID:22024545

  13. Sequence dependency of canonical base pair opening in the DNA double helix

    PubMed Central

    Villa, Alessandra

    2017-01-01

    The flipping-out of a DNA base from the double helical structure is a key step of many cellular processes, such as DNA replication, modification and repair. Base pair opening is the first step of base flipping and the exact mechanism is still not well understood. We investigate sequence effects on base pair opening using extensive classical molecular dynamics simulations targeting the opening of 11 different canonical base pairs in two DNA sequences. Two popular biomolecular force fields are applied. To enhance sampling and calculate free energies, we bias the simulation along a simple distance coordinate using a newly developed adaptive sampling algorithm. The simulation is guided back and forth along the coordinate, allowing for multiple opening pathways. We compare the calculated free energies with those from an NMR study and check assumptions of the model used for interpreting the NMR data. Our results further show that the neighboring sequence is an important factor for the opening free energy, but also indicates that other sequence effects may play a role. All base pairs are observed to have a propensity for opening toward the major groove. The preferred opening base is cytosine for GC base pairs, while for AT there is sequence dependent competition between the two bases. For AT opening, we identify two non-canonical base pair interactions contributing to a local minimum in the free energy profile. For both AT and CG we observe long-lived interactions with water and with sodium ions at specific sites on the open base pair. PMID:28369121

  14. Theoretical study on the binding mechanism between N6-methyladenine and natural DNA bases.

    PubMed

    Song, Qi-Xia; Ding, Zhen-Dong; Liu, Jian-Hua; Li, Yan; Wang, Hai-Jun

    2013-03-01

    N6-methyladenine (m(6)A) is a rare base naturally occurring in DNA. It is different from the base adenine due to its N-CH(3). Therefore, the base not only pairs with thymine, but also with other DNA bases (cytosine, adenine and guanine). In this work, Møller-Plesset second-order (MP2) method has been used to investigate the binding mechanism between m(6)A and natural DNA bases in gas phase and in aqueous solution. The results show that N-CH(3) changed the way of N6-methyladenine binding to natural DNA bases. The binding style significantly influences the stability of base pairs. The trans-m(6)A:G and trans-m(6)A:C conformers are the most stable among all the base pairs. The existence of solvent can remarkably reduce the stability of the base pairs, and the DNA bases prefer pairing with trans-m(6)A to cis-m(6)A. Besides, the properties of these hydrogen bonds have been analyzed by atom in molecules (AIM) theory, natural bond orbital (NBO) analysis and Wiberg bond indexes (WBI). In addition, pairing with m(6)A decreases the binding energies compared to the normal Watson-Crick base pairs, it may explain the instability of the N6 site methylated DNA in theory.

  15. Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs.

    PubMed

    McCoy, A B; Wright, A; Krousel-Wood, M; Thomas, E J; McCoy, J A; Sittig, D F

    2015-01-01

    Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes.

  16. Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs

    PubMed Central

    Wright, A.; Krousel-Wood, M.; Thomas, E. J.; McCoy, J. A.; Sittig, D. F.

    2015-01-01

    Summary Background Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. Objective We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. Methods We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. Results The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. Conclusions We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes. PMID:26171079

  17. Nuclear scissors modes and hidden angular momenta

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Balbutsev, E. B., E-mail: balbuts@theor.jinr.ru; Molodtsova, I. V.; Schuck, P.

    The coupled dynamics of low-lying modes and various giant resonances are studied with the help of the Wigner Function Moments method generalized to take into account spin degrees of freedom and pair correlations simultaneously. The method is based on Time-Dependent Hartree–Fock–Bogoliubov equations. The model of the harmonic oscillator including spin–orbit potential plus quadrupole–quadrupole and spin–spin interactions is considered. New low-lying spin-dependent modes are analyzed. Special attention is paid to the scissors modes. A new source of nuclear magnetism, connected with counter-rotation of spins up and down around the symmetry axis (hidden angular momenta), is discovered. Its inclusion into the theorymore » allows one to improve substantially the agreement with experimental data in the description of energies and transition probabilities of scissors modes.« less

  18. Quantum entanglement percolation

    NASA Astrophysics Data System (ADS)

    Siomau, Michael

    2016-09-01

    Quantum communication demands efficient distribution of quantum entanglement across a network of connected partners. The search for efficient strategies for the entanglement distribution may be based on percolation theory, which describes evolution of network connectivity with respect to some network parameters. In this framework, the probability to establish perfect entanglement between two remote partners decays exponentially with the distance between them before the percolation transition point, which unambiguously defines percolation properties of any classical network or lattice. Here we introduce quantum networks created with local operations and classical communication, which exhibit non-classical percolation transition points leading to striking communication advantages over those offered by the corresponding classical networks. We show, in particular, how to establish perfect entanglement between any two nodes in the simplest possible network—the 1D chain—using imperfectly entangled pairs of qubits.

  19. DEFINITION OF MULTIVARIATE GEOCHEMICAL ASSOCIATIONS WITH POLYMETALLIC MINERAL OCCURRENCES USING A SPATIALLY DEPENDENT CLUSTERING TECHNIQUE AND RASTERIZED STREAM SEDIMENT DATA - AN ALASKAN EXAMPLE.

    USGS Publications Warehouse

    Jenson, Susan K.; Trautwein, C.M.

    1984-01-01

    The application of an unsupervised, spatially dependent clustering technique (AMOEBA) to interpolated raster arrays of stream sediment data has been found to provide useful multivariate geochemical associations for modeling regional polymetallic resource potential. The technique is based on three assumptions regarding the compositional and spatial relationships of stream sediment data and their regional significance. These assumptions are: (1) compositionally separable classes exist and can be statistically distinguished; (2) the classification of multivariate data should minimize the pair probability of misclustering to establish useful compositional associations; and (3) a compositionally defined class represented by three or more contiguous cells within an array is a more important descriptor of a terrane than a class represented by spatial outliers.

  20. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

    PubMed

    Kondo, Jiro; Westhof, Eric

    2011-10-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  1. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes

    PubMed Central

    Kondo, Jiro; Westhof, Eric

    2011-01-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

  2. Automatic threshold selection for multi-class open set recognition

    NASA Astrophysics Data System (ADS)

    Scherreik, Matthew; Rigling, Brian

    2017-05-01

    Multi-class open set recognition is the problem of supervised classification with additional unknown classes encountered after a model has been trained. An open set classifer often has two core components. The first component is a base classifier which estimates the most likely class of a given example. The second component consists of open set logic which estimates if the example is truly a member of the candidate class. Such a system is operated in a feed-forward fashion. That is, a candidate label is first estimated by the base classifier, and the true membership of the example to the candidate class is estimated afterward. Previous works have developed an iterative threshold selection algorithm for rejecting examples from classes which were not present at training time. In those studies, a Platt-calibrated SVM was used as the base classifier, and the thresholds were applied to class posterior probabilities for rejection. In this work, we investigate the effectiveness of other base classifiers when paired with the threshold selection algorithm and compare their performance with the original SVM solution.

  3. Closing loop base pairs in RNA loop-loop complexes: structural behavior, interaction energy and solvation analysis through molecular dynamics simulations.

    PubMed

    Golebiowski, Jérôme; Antonczak, Serge; Fernandez-Carmona, Juan; Condom, Roger; Cabrol-Bass, Daniel

    2004-12-01

    Nanosecond molecular dynamics using the Ewald summation method have been performed to elucidate the structural and energetic role of the closing base pair in loop-loop RNA duplexes neutralized by Mg2+ counterions in aqueous phases. Mismatches GA, CU and Watson-Crick GC base pairs have been considered for closing the loop of an RNA in complementary interaction with HIV-1 TAR. The simulations reveal that the mismatch GA base, mediated by a water molecule, leads to a complex that presents the best compromise between flexibility and energetic contributions. The mismatch CU base pair, in spite of the presence of an inserted water molecule, is too short to achieve a tight interaction at the closing-loop junction and seems to force TAR to reorganize upon binding. An energetic analysis has allowed us to quantify the strength of the interactions of the closing and the loop-loop pairs throughout the simulations. Although the water-mediated GA closing base pair presents an interaction energy similar to that found on fully geometry-optimized structure, the water-mediated CU closing base pair energy interaction reaches less than half the optimal value.

  4. [Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

    PubMed

    Brovarets', O O

    2013-01-01

    At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

  5. A new model for approximating RNA folding trajectories and population kinetics

    NASA Astrophysics Data System (ADS)

    Kirkpatrick, Bonnie; Hajiaghayi, Monir; Condon, Anne

    2013-01-01

    RNA participates both in functional aspects of the cell and in gene regulation. The interactions of these molecules are mediated by their secondary structure which can be viewed as a planar circle graph with arcs for all the chemical bonds between pairs of bases in the RNA sequence. The problem of predicting RNA secondary structure, specifically the chemically most probable structure, has many useful and efficient algorithms. This leaves RNA folding, the problem of predicting the dynamic behavior of RNA structure over time, as the main open problem. RNA folding is important for functional understanding because some RNA molecules change secondary structure in response to interactions with the environment. The full RNA folding model on at most O(3n) secondary structures is the gold standard. We present a new subset approximation model for the full model, give methods to analyze its accuracy and discuss the relative merits of our model as compared with a pre-existing subset approximation. The main advantage of our model is that it generates Monte Carlo folding pathways with the same probabilities with which they are generated under the full model. The pre-existing subset approximation does not have this property.

  6. Alkali elemental and potassium isotopic compositions of Semarkona chondrules

    USGS Publications Warehouse

    Alexander, C.M. O'D.; Grossman, J.N.

    2005-01-01

    We report measurements of K isotope ratios in 28 Semarkona chondrules with a wide range of petrologic types and bulk compositions as well as the compositions of CPX-mesostasis pairs in 17 type I Semarkona chondrules, including two chondrules with radial alkali zonation and 19 type II chondrules. Despite the wide range in K/Al ratios, no systematic variations in K isotopic compositions were found. Semarkona chondrules do not record a simple history of Rayleigh-type loss of K. Experimentally determined evaporation rates suggest that considerable alkali evaporation would have occurred during chondrule formation. Nevertheless, based on Na CPX-mesostasis distribution coefficients, the alkali contents of the cores of most chondrules in Semarkona were probably established at the time of final crystallization. However, Na CPX-mesostasis distribution coefficients also show that alkali zonation in type I Semarkona chondrules was produced by entry of alkalis after solidification, probably during parent body alteration. This alkali metasomatism may have gone to completion in some chondrules. Our preferred explanation for the lack of systematic isotopic enrichments, even in alkali depleted type I chondrule cores, is that they exchanged with the ambient gas as they cooled. ?? The Meteoritical Society, 2005.

  7. DNA Extraction from Museum Specimens of Parasitic Hymenoptera

    PubMed Central

    Andersen, Jeremy C.; Mills, Nicholas J.

    2012-01-01

    At the same time that molecular researchers are improving techniques to extract DNA from museum specimens, this increased demand for access to museum specimens has created tension between the need to preserve specimens for maintaining collections and morphological research and the desire to conduct molecular analyses. To address these concerns, we examined the suitability of non-invasive DNA extraction techniques on three species of parasitic Hymenoptera (Braconidae), and test the effects of body size (parasitoid species), age (time since collection), and DNA concentration from each extract on the probability of amplifying meaningful fragments of two commonly used genetic loci. We found that age was a significant factor for determining the probability of success for sequencing both 28S and COI fragments. While the size of the braconid parasitoids significantly affected the total amount of extracted DNA, neither size nor DNA concentration were significant factors for the amplification of either gene region. We also tested several primer combinations of various lengths, but were unable to amplify fragments longer than ∼150 base pairs. These short fragments of 28S and COI were however sufficient for species identification, and for the discovery of within species genetic variation. PMID:23077493

  8. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Leszczynski, Jerzy; Sponer, Judit; Sponer, Jiri

    Recent experimental studies on the Watson Crick type base pairing of triazine and aminopyrimidine derivatives suggest that acid/base properties of the constituent bases might be related to the duplex stabilities measured in solution. Herein we use high-level quantum chemical calculations and molecular dynamics simulations to evaluate the base pairing and stacking interactions of seven selected base pairs, which are common in that they are stabilized by two NH O hydrogen bonds separated by one NH N hydrogen bond. We show that neither the base pairing nor the base stacking interaction energies correlate with the reported pKa data of the basesmore » and the melting points of the duplexes. This suggests that the experimentally observed correlation between the melting point data of the duplexes and the pKa values of the constituent bases is not rooted in the intrinsic base pairing and stacking properties. The physical chemistry origin of the observed experimental correlation thus remains unexplained and requires further investigations. In addition, since our calculations are carried out with extrapolation to the complete basis set of atomic orbitals and with inclusion of higher electron correlation effects, they provide reference data for stacking and base pairing energies of non-natural bases.« less

  9. Thermal transport in topological-insulator-based superconducting hybrid structures with mixed singlet and triplet pairing states.

    PubMed

    Li, Hai; Zhao, Yuan Yuan

    2017-11-22

    In the framework of the Bogoliubov-de Gennes equation, we investigate the thermal transport properties in topological-insulator-based superconducting hybrid structures with mixed spin-singlet and spin-triplet pairing states, and emphasize the different manifestations of the spin-singlet and spin-triplet pairing states in the thermal transport signatures. It is revealed that the temperature-dependent differential thermal conductance strongly depends on the components of the pairing state, and the negative differential thermal conductance only occurs in the spin-singlet pairing state dominated regime. It is also found that the thermal conductance is profoundly sensitive to the components of the pairing state. In the spin-singlet pairing state controlled regime, the thermal conductance obviously oscillates with the phase difference and junction length. With increasing the proportion of the spin-triplet pairing state, the oscillating characteristic of the thermal conductance fades out distinctly. These results suggest an alternative route for distinguishing the components of pairing states in topological-insulator-based superconducting hybrid structures.

  10. Robust Detection of Rare Species Using Environmental DNA: The Importance of Primer Specificity

    PubMed Central

    Wilcox, Taylor M.; McKelvey, Kevin S.; Young, Michael K.; Jane, Stephen F.; Lowe, Winsor H.; Whiteley, Andrew R.; Schwartz, Michael K.

    2013-01-01

    Environmental DNA (eDNA) is being rapidly adopted as a tool to detect rare animals. Quantitative PCR (qPCR) using probe-based chemistries may represent a particularly powerful tool because of the method’s sensitivity, specificity, and potential to quantify target DNA. However, there has been little work understanding the performance of these assays in the presence of closely related, sympatric taxa. If related species cause any cross-amplification or interference, false positives and negatives may be generated. These errors can be disastrous if false positives lead to overestimate the abundance of an endangered species or if false negatives prevent detection of an invasive species. In this study we test factors that influence the specificity and sensitivity of TaqMan MGB assays using co-occurring, closely related brook trout (Salvelinus fontinalis) and bull trout (S. confluentus) as a case study. We found qPCR to be substantially more sensitive than traditional PCR, with a high probability of detection at concentrations as low as 0.5 target copies/µl. We also found that number and placement of base pair mismatches between the Taqman MGB assay and non-target templates was important to target specificity, and that specificity was most influenced by base pair mismatches in the primers, rather than in the probe. We found that insufficient specificity can result in both false positive and false negative results, particularly in the presence of abundant related species. Our results highlight the utility of qPCR as a highly sensitive eDNA tool, and underscore the importance of careful assay design. PMID:23555689

  11. Robust detection of rare species using environmental DNA: the importance of primer specificity.

    PubMed

    Wilcox, Taylor M; McKelvey, Kevin S; Young, Michael K; Jane, Stephen F; Lowe, Winsor H; Whiteley, Andrew R; Schwartz, Michael K

    2013-01-01

    Environmental DNA (eDNA) is being rapidly adopted as a tool to detect rare animals. Quantitative PCR (qPCR) using probe-based chemistries may represent a particularly powerful tool because of the method's sensitivity, specificity, and potential to quantify target DNA. However, there has been little work understanding the performance of these assays in the presence of closely related, sympatric taxa. If related species cause any cross-amplification or interference, false positives and negatives may be generated. These errors can be disastrous if false positives lead to overestimate the abundance of an endangered species or if false negatives prevent detection of an invasive species. In this study we test factors that influence the specificity and sensitivity of TaqMan MGB assays using co-occurring, closely related brook trout (Salvelinus fontinalis) and bull trout (S. confluentus) as a case study. We found qPCR to be substantially more sensitive than traditional PCR, with a high probability of detection at concentrations as low as 0.5 target copies/µl. We also found that number and placement of base pair mismatches between the Taqman MGB assay and non-target templates was important to target specificity, and that specificity was most influenced by base pair mismatches in the primers, rather than in the probe. We found that insufficient specificity can result in both false positive and false negative results, particularly in the presence of abundant related species. Our results highlight the utility of qPCR as a highly sensitive eDNA tool, and underscore the importance of careful assay design.

  12. OsDMC1 Is Not Required for Homologous Pairing in Rice Meiosis1[OPEN

    PubMed Central

    Tang, Ding; Liu, Xiaofei; Du, Guijie; Shen, Yi; Li, Yafei; Cheng, Zhukuan

    2016-01-01

    Meiotic homologous recombination is pivotal to sexual reproduction. DMC1, a conserved recombinase, is involved in directing single-end invasion between interhomologs during meiotic recombination. In this study, we identified OsDMC1A and OsDMC1B, two closely related proteins in rice (Oryza sativa) with high sequence similarity to DMC1 proteins from other species. Analysis of Osdmc1a and Osdmc1b Tos17 insertion mutants indicated that these genes are functionally redundant. Immunolocalization analysis revealed OsDMC1 foci occurred at leptotene, which disappeared from late pachytene chromosomes in wild-type meiocytes. According to cytological analyses, homologous pairing is accomplished in the Osdmc1a Osdmc1b double mutant, but synapsis is seriously disrupted. The reduced number of bivalents and abnormal OsHEI10 foci in Osdmc1a Osdmc1b establishes an essential role for OsDMC1 in crossover formation. In the absence of OsDMC1, early recombination events probably occur normally, leading to normal localization of γH2AX, PAIR3, OsMRE11, OsCOM1, and OsRAD51C. Moreover, OsDMC1 was not detected in pairing-defective mutants, such as pair2, pair3, Oscom1, and Osrad51c, while it was loaded onto meiotic chromosomes in zep1, Osmer3, Oszip4, and Oshei10. Taken together, these results suggest that during meiosis, OsDMC1 is dispensable for homologous pairing in rice, which is quite different from the DMC1 homologs identified so far in other organisms. PMID:26960731

  13. Photos for Estimating Residue Loadings Before and After Burning in Southern Appalachian Mixed Pine - Hardwood Clearcuts

    Treesearch

    Bradford M. Sanders; David H. van Lear

    1988-01-01

    Paired photographs show fuel conditions before and after burning in recently clearcut stands of mixed pine-hardwoods in the Southern Appalachians. Comparison with the photos permits fast assessment of fuel loading and probable burning success. Information with each photo includes measured weights, volumes, and other residue data, information about the timber stand and...

  14. A Further Note on Generalized Hyperexponential Distributions

    DTIC Science & Technology

    1989-11-15

    functions. The inverse transform of each of m factors is of the form The requirement that 0, < r7 thus yields a mixture of an atom at the origin and a...real and (0, + 0,+,)/2 < Re(r/,) when (7h, 77t4) are a complex conjugate pair. Then the inverse transform of f*(s) is a probability distribution. To

  15. On the enhancement of the back-to-back two-electron-one photon ionization in molecules

    NASA Astrophysics Data System (ADS)

    Amusia, Miron; Drukarev, Eugene

    2014-05-01

    Recently, the long ago predicted quasi-free mechanism of two-electron photoionization was detected already at relatively low energy photoionization in He. It was observed that some pairs of electrons are leaving the target atom back-to-back, i.e. in opposite direction with almost the same energy. They have opposite spin directions. The cross-section of this process depends upon the probability for a pair of electrons to be close to each other before meeting the incoming photon. Such probability is greatly enhanced in molecules with covalent bonding, like H2. In this and similar molecules the electrons spend an essential part of time being between nuclei and thus screening them from each other. We demonstrate that indeed the back-to-back contribution is much bigger in H2 than in He. We analyze qualitatively some other situations that lead to relative growth of back-to-back contribution. Atoms with electrons with bigger principal quantum numbers have bigger back-to-back contributions. An external pressure applied to molecules forces electrons to be closer to each other. As a result for them the back-to-back contribution can be controllable enhanced.

  16. Early follicular testosterone level predicts preference for masculinity in male faces - but not for women taking hormonal contraception.

    PubMed

    Bobst, Cora; Sauter, Sabine; Foppa, Andrina; Lobmaier, Janek S

    2014-03-01

    It has been shown that women's preference for masculinity in male faces changes across the menstrual cycle. Preference for masculinity is stronger when conception probability is high than when it is low. These findings have been linked to cyclic fluctuations of hormone levels. The purpose of the present study is to further investigate the link between gonadal steroids (i.e. testosterone, estradiol, and progesterone) and masculinity preference in women, while holding the cycle phase constant. Sixty-two female participants were tested in their early follicular cycle phase, when conception probability is low. Participants were shown face pairs and where asked to choose the more attractive face. Face pairs consisted of a masculinized and feminized version of the same face. For naturally cycling women we found a positive relationship between saliva testosterone levels and masculinity preference, but there was no link between any hormones and masculinity preference for women taking hormonal contraception. We conclude that in naturally cycling women early follicular testosterone levels are associated with masculinity preference. However, these hormonal links were not found for women with artificially modified hormonal levels, that is, for women taking hormonal contraception. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. [Autoshaping of a button-push response and eye movement in human subjects].

    PubMed

    Kimura, H; Fukui, I; Inaki, K

    1990-12-01

    Two experiments were conducted with human subjects to investigate the similarities and differences between animal and human behaviors under autoshaping procedures. In these experiments, light served as CS, and display on TV served as US. Whether the pushing button response or gazing response to CS could be obtained in human subjects under Pavlovian conditioning procedure was examined. In Experiment 1, uninstructed naive subjects were placed in a room containing a push-button and a TV display. Within the experimental sessions, the push-button was lit for 8 s as CS, and then paired with the display of a soft pornographic program on TV for 10 s. The result indicated that the modeling of pushing button promoted the increase of response probability among the subjects. The trials conducted after the rest period indicated an increase of response probability. In Experiment 2, a 4 cm square translucent panel was lit for 20 s as CS, and then paired with the display of a computer graphic picture on TV for 8 s as US. Some subjects started gazing at the CS for several seconds. These results indicated that some subjects could acquire the gazing response under the autoshaping procedure.

  18. Genetic and DNA sequence analysis of the kanamycin resistance transposon Tn903.

    PubMed Central

    Grindley, N D; Joyce, C M

    1980-01-01

    The kanamycin resistance transposon Tn903 consists of a unique region of about 1000 base pairs bounded by a pair of 1050-base-pair inverted repeat sequences. Each repeat contains two Pvu II endonuclease cleavage sites separated by 520 base pairs. We have constructed derivatives of Tn903 in which this 520-base-pair fragment is deleted from one or both repeats. Those derivatives that lack both 520-base-pair fragments cannot transpose, whereas those that lack just one remain transposition proficient. One such transposable derivative, Tn903 delta I, has been selected for further study. We have determined the sequence of the intact inverted repeat. The 18 base pairs at each end are identical and inverted relative to one another, a structure characteristic of insertion sequences. Additional experiments indicate that a single inverted repeat from Tn903 can, in fact, transpose; we propose that this element be called IS903. To correlate the DNA sequence with genetic activities, we have created mutations by inserting a 10-base-pair DNA fragment at several sites within the intact repeat of Tn903 delta 1, and we have examined the effect of such insertions on transposability. The results suggest that IS903 encodes a 307-amino-acid polypeptide (a "transposase") that is absolutely required for transposition of IS903 or Tn903. Images PMID:6261245

  19. Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

    PubMed

    Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

    2018-03-26

    DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

    PubMed

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-08

    The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

Top