Characterizing a Wake-Free Safe Zone for the Simplified Aircraft-Based Paired Approach Concept

NASA Technical Reports Server (NTRS)

Guerreiro, Nelson M.; Neitzke, Kurt W.; Johnson, Sally C.; Stough, H. Paul, III; McKissick, Burnell T.; Syed, Hazari I.

2010-01-01

The Federal Aviation Administration (FAA) has proposed a concept of operations geared towards achieving increased arrival throughput at U.S. Airports, known as the Simplified Aircraft-based Paired Approach (SAPA) concept. In this study, a preliminary characterization of a wake-free safe zone (WFSZ) for the SAPA concept has been performed. The experiment employed Monte-Carlo simulations of varying approach profiles by aircraft pairs to closely-spaced parallel runways. Three different runway lateral spacings were investigated (750 ft, 1000 ft and 1400 ft), along with no stagger and 1500 ft stagger between runway thresholds. The paired aircraft were flown in a leader/trailer configuration with potential wake encounters detected using a wake detection surface translating with the trailing aircraft. The WFSZ is characterized in terms of the smallest observed initial in-trail distance leading to a wake encounter anywhere along the approach path of the aircraft. The results suggest that the WFSZ can be characterized in terms of two primary altitude regions, in ground-effect (IGE) and out of ground-effect (OGE), with the IGE region being the limiting case with a significantly smaller WFSZ. Runway stagger was observed to only modestly reduce the WFSZ size, predominantly in the OGE region.

Improving hot region prediction by parameter optimization of density clustering in PPI.

PubMed

Hu, Jing; Zhang, Xiaolong

2016-11-01

This paper proposed an optimized algorithm which combines density clustering of parameter selection with feature-based classification for hot region prediction. First, all the residues are classified by SVM to remove non-hot spot residues, then density clustering of parameter selection is used to find hot regions. In the density clustering, this paper studies how to select input parameters. There are two parameters radius and density in density-based incremental clustering. We firstly fix density and enumerate radius to find a pair of parameters which leads to maximum number of clusters, and then we fix radius and enumerate density to find another pair of parameters which leads to maximum number of clusters. Experiment results show that the proposed method using both two pairs of parameters provides better prediction performance than the other method, and compare these two predictive results, the result by fixing radius and enumerating density have slightly higher prediction accuracy than that by fixing density and enumerating radius. Copyright © 2016. Published by Elsevier Inc.

Electrostatics Explains the Position-Dependent Effect of G⋅U Wobble Base Pairs on the Affinity of RNA Kissing Complexes.

PubMed

Abi-Ghanem, Josephine; Rabin, Clémence; Porrini, Massimiliano; Dausse, Eric; Toulmé, Jean-Jacques; Gabelica, Valérie

2017-10-06

In the RNA realm, non-Watson-Crick base pairs are abundant and can affect both the RNA 3D structure and its function. Here, we investigated the formation of RNA kissing complexes in which the loop-loop interaction is modulated by non-Watson-Crick pairs. Mass spectrometry, surface plasmon resonance, and UV-melting experiments show that the G⋅U wobble base pair favors kissing complex formation only when placed at specific positions. We tried to rationalize this effect by molecular modeling, including molecular mechanics Poisson-Boltzmann surface area (MMPBSA) thermodynamics calculations and PBSA calculations of the electrostatic potential surfaces. Modeling reveals that the G⋅U stabilization is due to a specific electrostatic environment defined by the base pairs of the entire loop-loop region. The loop is not symmetric, and therefore the identity and position of each base pair matters. Predicting and visualizing the electrostatic environment created by a given sequence can help to design specific kissing complexes with high affinity, for potential therapeutic, nanotechnology or analytical applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Genetic and DNA sequence analysis of the kanamycin resistance transposon Tn903.

PubMed Central

Grindley, N D; Joyce, C M

1980-01-01

The kanamycin resistance transposon Tn903 consists of a unique region of about 1000 base pairs bounded by a pair of 1050-base-pair inverted repeat sequences. Each repeat contains two Pvu II endonuclease cleavage sites separated by 520 base pairs. We have constructed derivatives of Tn903 in which this 520-base-pair fragment is deleted from one or both repeats. Those derivatives that lack both 520-base-pair fragments cannot transpose, whereas those that lack just one remain transposition proficient. One such transposable derivative, Tn903 delta I, has been selected for further study. We have determined the sequence of the intact inverted repeat. The 18 base pairs at each end are identical and inverted relative to one another, a structure characteristic of insertion sequences. Additional experiments indicate that a single inverted repeat from Tn903 can, in fact, transpose; we propose that this element be called IS903. To correlate the DNA sequence with genetic activities, we have created mutations by inserting a 10-base-pair DNA fragment at several sites within the intact repeat of Tn903 delta 1, and we have examined the effect of such insertions on transposability. The results suggest that IS903 encodes a 307-amino-acid polypeptide (a "transposase") that is absolutely required for transposition of IS903 or Tn903. Images PMID:6261245

Negatively supercoiled simian virus 40 DNA contains Z-DNA segments within transcriptional enhancer sequences

NASA Technical Reports Server (NTRS)

Nordheim, A.; Rich, A.

1983-01-01

Three 8-base pair (bp) segments of alternating purine-pyrimidine from the simian virus 40 enhancer region form Z-DNA on negative supercoiling; minichromosome DNase I-hypersensitive sites determined by others bracket these three segments. A survey of transcriptional enhancer sequences reveals a pattern of potential Z-DNA-forming regions which occur in pairs 50-80 bp apart. This may influence local chromatin structure and may be related to transcriptional activation.

Multiple point mutations in a shuttle vector propagated in human cells: evidence for an error-prone DNA polymerase activity.

PubMed

Seidman, M M; Bredberg, A; Seetharam, S; Kraemer, K H

1987-07-01

Mutagenesis was studied at the DNA-sequence level in human fibroblast and lymphoid cells by use of a shuttle vector plasmid, pZ189, containing a suppressor tRNA marker gene. In a series of experiments, 62 plasmids were recovered that had two to six base substitutions in the 160-base-pair marker gene. Approximately 20-30% of the mutant plasmids that were recovered after passing ultraviolet-treated pZ189 through a repair-proficient human fibroblast line contained these multiple mutations. In contrast, passage of ultraviolet-treated pZ189 through an excision-repair-deficient (xeroderma pigmentosum) line yielded only 2% multiple base substitution mutants. Introducing a single-strand nick in otherwise unmodified pZ189 adjacent to the marker, followed by passage through the xeroderma pigmentosum cells, resulted in about 66% multiple base substitution mutants. The multiple mutations were found in a 160-base-pair region containing the marker gene but were rarely found in an adjacent 170-base-pair region. Passing ultraviolet-treated or nicked pZ189 through a repair-proficient human B-cell line also yielded multiple base substitution mutations in 20-33% of the mutant plasmids. An explanation for these multiple mutations is that they were generated by an error-prone polymerase while filling gaps. These mutations share many of the properties displayed by mutations in the immunoglobulin hypervariable regions.

Structural basis of DNA bending and oriented heterodimer binding by the basic leucine zipper domains of Fos and Jun.

PubMed

Leonard, D A; Rajaram, N; Kerppola, T K

1997-05-13

Interactions among transcription factors that bind to separate sequence elements require bending of the intervening DNA and juxtaposition of interacting molecular surfaces in an appropriate orientation. Here, we examine the effects of single amino acid substitutions adjacent to the basic regions of Fos and Jun as well as changes in sequences flanking the AP-1 site on DNA bending. Substitution of charged amino acid residues at positions adjacent to the basic DNA-binding domains of Fos and Jun altered DNA bending. The change in DNA bending was directly proportional to the change in net charge for all heterodimeric combinations between these proteins. Fos and Jun induced distinct DNA bends at different binding sites. Exchange of a single base pair outside of the region contacted in the x-ray crystal structure altered DNA bending. Substitution of base pairs flanking the AP-1 site had converse effects on the opposite directions of DNA bending induced by homodimers and heterodimers. These results suggest that Fos and Jun induce DNA bending in part through electrostatic interactions between amino acid residues adjacent to the basic region and base pairs flanking the AP-1 site. DNA bending by Fos and Jun at inverted binding sites indicated that heterodimers bind to the AP-1 site in a preferred orientation. Mutation of a conserved arginine within the basic regions of Fos and transversion of the central C:G base pair in the AP-1 site to G:C had complementary effects on the orientation of heterodimer binding and DNA bending. The conformational variability of the Fos-Jun-AP-1 complex may contribute to its functional versatility at different promoters.

Securing non-volatile memory regions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Faraboschi, Paolo; Ranganathan, Parthasarathy; Muralimanohar, Naveen

Methods, apparatus and articles of manufacture to secure non-volatile memory regions are disclosed. An example method disclosed herein comprises associating a first key pair and a second key pair different than the first key pair with a process, using the first key pair to secure a first region of a non-volatile memory for the process, and using the second key pair to secure a second region of the non-volatile memory for the same process, the second region being different than the first region.

Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

PubMed

Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

2004-03-01

A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson-Crick base pair in SECIS element plays an important role in the selenocysteine expression by UGA codon.

Structural features of the DNA hairpin d(ATCCTA-GTTA-TAGGAT): formation of a G-A base pair in the loop.

PubMed Central

van Dongen, M J; Mooren, M M; Willems, E F; van der Marel, G A; van Boom, J H; Wijmenga, S S; Hilbers, C W

1997-01-01

The three-dimensional structure of the hairpin formed by d(ATCCTA-GTTA-TAGGAT) has been determined by means of two-dimensional NMR studies, distance geometry and molecular dynamics calculations. The first and the last residues of the tetraloop of this hairpin form a sheared G-A base pair on top of the six Watson-Crick base pairs in the stem. The glycosidic torsion angles of the guanine and adenine residues in the G-A base pair reside in the anti and high- anti domain ( approximately -60 degrees ) respectively. Several dihedral angles in the loop adopt non-standard values to accommodate this base pair. The first and second residue in the loop are stacked in a more or less normal helical fashion; the fourth loop residue also stacks upon the stem, while the third residue is directed away from the loop region. The loop structure can be classified as a so-called type-I loop, in which the bases at the 5'-end of the loop stack in a continuous fashion. In this situation, loop stability is unlikely to depend heavily on the nature of the unpaired bases in the loop. Moreover, the present study indicates that the influence of the polarity of a closing A.T pair is much less significant than that of a closing C.G base pair. PMID:9092659

Modified nucleotides reveal the indirect role of the central base pairs in stabilizing the lac repressor-operator complex.

PubMed Central

Zhang, X; Gottlieb, P A

1995-01-01

Guanine residues in the lac operator were replaced by 2-aminopurine or purine analogues, pairing the modified nucleotides with C. The observed equilibrium dissociation constants for lac repressor binding to substituted operators were measured in 10 mM Tris, 150 mM KCl, 0.1 mM EDTA, 0.1 mM DTE, pH 7.6 at 25 degrees C. These measurements revealed five positions that destabilized the complex when substituted with either analogue. Two positions, which are related by a 2-fold symmetry, are in the major groove of the operator thought to directly interact with the protein. Three sites were in the central region of the operator. A purine analogue at a sixth site perturbed the local DNA structure and destabilized the complex. Alkylation interference experiments of the 2-aminopurine substituted operators demonstrated that, of the five affected, two substitutions displayed altered phosphate interference patterns at the phosphate adjacent to the substituted base. For these operators, complex formation was measured in different concentrations of KCl to assess the contribution of counterion release to the bimolecular process. The results indicated that both complexes were similar to wild-type, although minor changes were observed. The Kobs of the complex was then measured when 2-aminopurine or purine analogues were paired with uracil nucleotide, a base pair that serves to stabilize the DNA. The introduction of the new base pairs revealed two effects on the bimolecular interaction. For those operator sites that are thought to perturb the interaction directly, the affinity of the complex was weakened to levels observed for the singly-substituted operators. In contrast, the nucleotides of 2-aminopurine paired with uracil positioned in the central region of the operator served to enhance the stability of the complex. The purine-uracil base pair substitution on the other hand had a significant destabilizing effect on the interaction. We propose that the central base pairs modulate binding of the complex by altering the intrinsic properties of the DNA. Two specific attributes are required to achieve the lowest free energy of interaction. The DNA must have two interstrand hydrogen bonds to stabilize the duplex and it must have properties associated with directional bending or unwinding. This analysis does not rule out contributions by direct interactions between the protein and the central region of the operator but underscores how indirect effects play a major role in complex formation in this system. Images PMID:7784203

Complete plastid genome sequence of goosegrass (Eleusine indica) and comparison with other Poaceae.

PubMed

Zhang, Hui; Hall, Nathan; McElroy, J Scott; Lowe, Elijah K; Goertzen, Leslie R

2017-02-05

Eleusine indica, also known as goosegrass, is a serious weed in at least 42 countries. In this paper we report the complete plastid genome sequence of goosegrass obtained by de novo assembly of paired-end and mate-paired reads generated by Illumina sequencing of total genomic DNA. The goosegrass plastome is a circular molecule of 135,151bp in length, consisting of two single-copy regions separated by a pair of inverted repeats (IRs) of 20,919 bases. The large (LSC) and the small (SSC) single-copy regions span 80,667 bases and 12,646 bases, respectively. The plastome of goosegrass has 38.19% GC content and includes 108 unique genes, of which 76 are protein-coding, 28 are transfer RNA, and 4 are ribosomal RNA. The goosegrass plastome sequence was compared to eight other species of Poaceae. Although generally conserved with respect to Poaceae, this genomic resource will be useful for evolutionary studies within this weed species and the genus Eleusine. Copyright © 2016. Published by Elsevier B.V.

Analysis of HIV-1 intersubtype recombination breakpoints suggests region with high pairing probability may be a more fundamental factor than sequence similarity affecting HIV-1 recombination.

PubMed

Jia, Lei; Li, Lin; Gui, Tao; Liu, Siyang; Li, Hanping; Han, Jingwan; Guo, Wei; Liu, Yongjian; Li, Jingyun

2016-09-21

With increasing data on HIV-1, a more relevant molecular model describing mechanism details of HIV-1 genetic recombination usually requires upgrades. Currently an incomplete structural understanding of the copy choice mechanism along with several other issues in the field that lack elucidation led us to perform an analysis of the correlation between breakpoint distributions and (1) the probability of base pairing, and (2) intersubtype genetic similarity to further explore structural mechanisms. Near full length sequences of URFs from Asia, Europe, and Africa (one sequence/patient), and representative sequences of worldwide CRFs were retrieved from the Los Alamos HIV database. Their recombination patterns were analyzed by jpHMM in detail. Then the relationships between breakpoint distributions and (1) the probability of base pairing, and (2) intersubtype genetic similarities were investigated. Pearson correlation test showed that all URF groups and the CRF group exhibit the same breakpoint distribution pattern. Additionally, the Wilcoxon two-sample test indicated a significant and inexplicable limitation of recombination in regions with high pairing probability. These regions have been found to be strongly conserved across distinct biological states (i.e., strong intersubtype similarity), and genetic similarity has been determined to be a very important factor promoting recombination. Thus, the results revealed an unexpected disagreement between intersubtype similarity and breakpoint distribution, which were further confirmed by genetic similarity analysis. Our analysis reveals a critical conflict between results from natural HIV-1 isolates and those from HIV-1-based assay vectors in which genetic similarity has been shown to be a very critical factor promoting recombination. These results indicate the region with high-pairing probabilities may be a more fundamental factor affecting HIV-1 recombination than sequence similarity in natural HIV-1 infections. Our findings will be relevant in furthering the understanding of HIV-1 recombination mechanisms.

Cytogenetics of Melitoma segmentaria (Fabricius, 1804) (Hymenoptera, Apidae) reveals differences in the characteristics of heterochromatin in bees

PubMed Central

Cristiano, Maykon Passos; Simões, Talitta Guimarães; Lopes, Denilce Meneses; Pompolo, Silvia das Graças

2014-01-01

Abstract To date, more than 65 species of Brazilian bees (of the superfamily Apoidea) have been cytogenetically studied, but only a few solitary species have been analyzed. One example is the genus Melitoma Lepeletier & Serville, 1828, for which there is no report in the literature with regard to cytogenetic studies. The objective of the present study is to analyze the chromosome number and morphology of the species Melitoma segmentaria (Fabricius, 1804), as well as to determine the pattern of heterochromatin distribution and identify the adenine–thymine (AT)- and guanine–cytosine (GC)-rich regions. Melitoma segmentaria presents chromosome numbers of 2n=30 (females) and n=15 (males). With C-banding, it is possible to classify the chromosomes into seven pseudo-acrocentric pairs (AM), seven pseudo-acrocentric pairs with interstitial heterochromatin (AMi), and one totally heterochromatic metacentric pair (Mh). Fluorochrome staining has revealed that heterochromatin present in the chromosomal arms is rich in GC base pairs (CMA3+) and the centromeric region is rich in AT base pairs (DAPI+). The composition found for Melitoma diverges from the pattern observed in other bees, in which the heterochromatin is usually rich in AT. In bees, few heterochromatic regions are rich in GC and these are usually associated with or localized close to the nucleolus organizer regions (NORs). Silver nitrate impregnation marks the heterochromatin present in the chromosome arms, which makes identification of the NOR in the chromosomes impossible. As this technique reveals proteins in the NOR, the observation that is made in the present study suggests that the proteins found in the heterochromatin are qualitatively similar to those in the NOR. PMID:25349673

The combination of direct and paired link graphs can boost repetitive genome assembly

PubMed Central

Shi, Wenyu; Ji, Peifeng

2017-01-01

Abstract Currently, most paired link based scaffolding algorithms intrinsically mask the sequences between two linked contigs and bypass their direct link information embedded in the original de Bruijn assembly graph. Such disadvantage substantially complicates the scaffolding process and leads to the inability of resolving repetitive contig assembly. Here we present a novel algorithm, inGAP-sf, for effectively generating high-quality and continuous scaffolds. inGAP-sf achieves this by using a new strategy based on the combination of direct link and paired link graphs, in which direct link is used to increase graph connectivity and to decrease graph complexity and paired link is employed to supervise the traversing process on the direct link graph. Such advantage greatly facilitates the assembly of short-repeat enriched regions. Moreover, a new comprehensive decision model is developed to eliminate the noise routes accompanying with the introduced direct link. Through extensive evaluations on both simulated and real datasets, we demonstrated that inGAP-sf outperforms most of the genome scaffolding algorithms by generating more accurate and continuous assembly, especially for short repetitive regions. PMID:27924003

MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

PubMed

Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

2016-01-01

Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic strands to increase the success rate. It is a standalone web-based pipeline, which is fully configured within a virtual machine and thus can be readily used without any configuration. We have experimentally validated primer pairs designed by our pipeline and shown a very high success rate of primer pairs: out of 66 BSP primer pairs, 63 were successfully validated without any further optimization step and using the same qPCR conditions. The MSP-HTPrimer pipeline is freely available from http://sourceforge.net/p/msp-htprimer.

Base Pairing between U3 Small Nucleolar RNA and the 5′ End of 18S rRNA Is Required for Pre-rRNA Processing

PubMed Central

Sharma, Kishor; Tollervey, David

1999-01-01

The loop of a stem structure close to the 5′ end of the 18S rRNA is complementary to the box A region of the U3 small nucleolar RNA (snoRNA). Substitution of the 18S loop nucleotides inhibited pre-rRNA cleavage at site A1, the 5′ end of the 18S rRNA, and at site A2, located 1.9 kb away in internal transcribed spacer 1. This inhibition was largely suppressed by a compensatory mutation in U3, demonstrating functional base pairing. The U3–pre-rRNA base pairing is incompatible with the structure that forms in the mature 18S rRNA and may prevent premature folding of the pre-rRNA. In the Escherichia coli pre-rRNA the homologous region of the 16S rRNA is also sequestered, in that case by base pairing to the 5′ external transcribed spacer (5′ ETS). Cleavage at site A0 in the yeast 5′ ETS strictly requires base pairing between U3 and a sequence within the 5′ ETS. In contrast, the U3-18S interaction is not required for A0 cleavage. U3 therefore carries out at least two functionally distinct base pair interactions with the pre-rRNA. The nucleotide at the site of A1 cleavage was shown to be specified by two distinct signals; one of these is the stem-loop structure within the 18S rRNA. However, in contrast to the efficiency of cleavage, the position of A1 cleavage is not dependent on the U3-loop interaction. We conclude that the 18S stem-loop structure is recognized at least twice during pre-rRNA processing. PMID:10454548

Correlation of RNA secondary structure and attenuation of Sabin vaccine strains of poliovirus in tissue culture.

PubMed

Macadam, A J; Ferguson, G; Burlison, J; Stone, D; Skuce, R; Almond, J W; Minor, P D

1992-08-01

Part of the 5' noncoding regions of all three Sabin vaccine strains of poliovirus contains determinants of attenuation that are shown here to influence the ability of these strains to grow at elevated temperatures in BGM cells. The predicted RNA secondary structure of this region (nt 464-542 in P3/Sabin) suggests that both phenotypes are due to perturbation of base-paired stems. Ts phenotypes of site-directed mutants with defined changes in this region correlated well with predicted secondary structure stabilities. Reversal of base-pair orientation had little effect whereas stem disruption led to marked increases in temperature sensitivity. Phenotypic revertants of such viruses displayed mutations on either side of the stem. Mutations destabilizing stems led to intermediate phenotypes. These results provided evidence for the biological significance of the predicted RNA secondary structure.

Pair production of scalar dyons in Kerr-Newman black holes

NASA Astrophysics Data System (ADS)

Chen, Chiang-Mei; Kim, Sang Pyo; Sun, Jia-Rui; Tang, Fu-Yi

2018-06-01

We study the spontaneous pair production of scalar dyons in the near extremal dyonic Kerr-Newman (KN) black hole, which contains a warped AdS3 structure in the near horizon region. The leading term contribution of the pair production rate and the absorption cross section ratio are also calculated using the Hamilton-Jacobi approach and the thermal interpretation is given. In addition, the holographic dual conformal field theories (CFTs) descriptions of the pair production rate and absorption cross section ratios are analyzed both in the J-, Q- and P-pictures respectively based on the threefold dyonic KN/CFTs dualities.

Structural Mechanism behind Distinct Efficiency of Oct4/Sox2 Proteins in Differentially Spaced DNA Complexes

PubMed Central

Yesudhas, Dhanusha; Anwar, Muhammad Ayaz; Panneerselvam, Suresh; Durai, Prasannavenkatesh; Shah, Masaud; Choi, Sangdun

2016-01-01

The octamer-binding transcription factor 4 (Oct4) and sex-determining region Y (SRY)-box 2 (Sox2) proteins induce various transcriptional regulators to maintain cellular pluripotency. Most Oct4/Sox2 complexes have either 0 base pairs (Oct4/Sox20bp) or 3 base pairs (Oct4/Sox23bp) separation between their DNA-binding sites. Results from previous biochemical studies have shown that the complexes separated by 0 base pairs are associated with a higher pluripotency rate than those separated by 3 base pairs. Here, we performed molecular dynamics (MD) simulations and calculations to determine the binding free energy and per-residue free energy for the Oct4/Sox20bp and Oct4/Sox23bp complexes to identify structural differences that contribute to differences in induction rate. Our MD simulation results showed substantial differences in Oct4/Sox2 domain movements, as well as secondary-structure changes in the Oct4 linker region, suggesting a potential reason underlying the distinct efficiencies of these complexes during reprogramming. Moreover, we identified key residues and hydrogen bonds that potentially facilitate protein-protein and protein-DNA interactions, in agreement with previous experimental findings. Consequently, our results confess that differential spacing of the Oct4/Sox2 DNA binding sites can determine the magnitude of transcription of the targeted genes during reprogramming. PMID:26790000

Nucleotide sequence analysis establishes the role of endogenous murine leukemia virus DNA segments in formation of recombinant mink cell focus-forming murine leukemia viruses.

PubMed Central

Khan, A S

1984-01-01

The sequence of 363 nucleotides near the 3' end of the pol gene and 564 nucleotides from the 5' terminus of the env gene in an endogenous murine leukemia viral (MuLV) DNA segment, cloned from AKR/J mouse DNA and designated as A-12, was obtained. For comparison, the nucleotide sequence in an analogous portion of AKR mink cell focus-forming (MCF) 247 MuLV provirus was also determined. Sequence features unique to MCF247 MuLV DNA in the 3' pol and 5' env regions were identified by comparison with nucleotide sequences in analogous regions of NFS -Th-1 xenotropic and AKR ecotropic MuLV proviruses. These included (i) an insertion of 12 base pairs encoding four amino acids located 60 base pairs from the 3' terminus of the pol gene and immediately preceding the env gene, (ii) the deletion of 12 base pairs (encoding four amino acids) and the insertion of 3 base pairs (encoding one amino acid) in the 5' portion of the env gene, and (iii) single base substitutions resulting in 2 MCF247 -specific amino acids in the 3' pol and 23 in the 5' env regions. Nucleotide sequence comparison involving the 3' pol and 5' env regions of AKR MCF247 , NFS xenotropic, and AKR ecotropic MuLV proviruses with the cloned endogenous MuLV DNA indicated that MCF247 proviral DNA sequences were conserved in the cloned endogenous MuLV proviral segment. In fact, total nucleotide sequence identity existed between the endogenous MuLV DNA and the MCF247 MuLV provirus in the 3' portion of the pol gene. In the 5' env region, only 4 of 564 nucleotides were different, resulting in three amino acid changes between AKR MCF247 MuLV DNA and the endogenous MuLV DNA present in clone A-12. In addition, nucleotide sequence comparison indicated that Moloney-and Friend-MCF MuLVs were also highly related in the 3' pol and 5' env regions to the cloned endogenous MuLV DNA. These results establish the role of endogenous MuLV DNA segments in generation of recombinant MCF viruses. PMID:6328017

Cloning and characterization of an abalone (Haliotis discus hannai) actin gene

NASA Astrophysics Data System (ADS)

Ma, Hongming; Xu, Wei; Mai, Kangsen; Liufu, Zhiguo; Chen, Hong

2004-10-01

An actin encoding gene was cloned by using RT-PCR, 3‧ RACE and 5‧ RACE from abalone Haliotis discus hannai. The full length of the gene is 1532 base pairs, which contains a long 3‧ untranslated region of 307 base pairs and 79 base pairs of 5‧ untranslated sequence. The open reading frame encodes 376 amino acid residues. Sequence comparison with those of human and other mollusks showed high conservation among species at amino acid level. The identities was 96%, 97% and 96% respectively compared with Aplysia californica, Biomphalaria glabrata and Homo sapience β-actin. It is also indicated that this actin is more similar to the human cytoplasmic actin (β-actin) than to human muscle actin.

Longer leukocyte telomere length in Costa Rica's Nicoyan Peninsula: A population-based study

PubMed Central

Rehkopf, David H; Dow, William H; Rosero-Bixby, Luis; Lin, Jue; Epel, Elissa S; Blackburn, Elizabeth H

2013-01-01

Studies in humans suggest that leukocyte telomere length may act as a marker of biological aging. We investigated whether individuals in the Nicoya region of Costa Rica, known for exceptional longevity, had longer telomere length than those in other parts of the country. After controlling for age, age squared, rurality, rainy season and gender, mean leukocyte telomere length in Nicoya was substantially longer (81 base pairs, p<0.05) than in other areas of Costa Rica, providing evidence of a biological pathway to which this notable longevity may be related. This relationship remains unchanged (79 base pairs, p<0.05) after statistically controlling for nineteen potential biological, dietary and social and demographic mediators. Thus the difference in mean leukocyte telomere length that characterizes this unique region does not appear to be explainable by traditional behavioral and biological risk factors. More detailed examination of mean leukocyte telomere length by age shows that the regional telomere length difference declines at older ages. PMID:23988653

Detecting cooperative sequences in the binding of RNA Polymerase-II

NASA Astrophysics Data System (ADS)

Glass, Kimberly; Rozenberg, Julian; Girvan, Michelle; Losert, Wolfgang; Ott, Ed; Vinson, Charles

2008-03-01

Regulation of the expression level of genes is a key biological process controlled largely by the 1000 base pair (bp) sequence preceding each gene (the promoter region). Within that region transcription factor binding sites (TFBS), 5-10 bp long sequences, act individually or cooperate together in the recruitment of, and therefore subsequent gene transcription by, RNA Polymerase-II (RNAP). We have measured the binding of RNAP to promoters on a genome-wide basis using Chromatin Immunoprecipitation (ChIP-on-Chip) microarray assays. Using all 8-base pair long sequences as a test set, we have identified the DNA sequences that are enriched in promoters with high RNAP binding values. We are able to demonstrate that virtually all sequences enriched in such promoters contain a CpG dinucleotide, indicating that TFBS that contain the CpG dinucleotide are involved in RNAP binding to promoters. Further analysis shows that the presence of pairs of CpG containing sequences cooperate to enhance the binding of RNAP to the promoter.

A fully synthetic human Fab antibody library based on fixed VH/VL framework pairings with favorable biophysical properties

PubMed Central

Tiller, Thomas; Schuster, Ingrid; Deppe, Dorothée; Siegers, Katja; Strohner, Ralf; Herrmann, Tanja; Berenguer, Marion; Poujol, Dominique; Stehle, Jennifer; Stark, Yvonne; Heßling, Martin; Daubert, Daniela; Felderer, Karin; Kaden, Stefan; Kölln, Johanna; Enzelberger, Markus; Urlinger, Stefanie

2013-01-01

This report describes the design, generation and testing of Ylanthia, a fully synthetic human Fab antibody library with 1.3E+11 clones. Ylanthia comprises 36 fixed immunoglobulin (Ig) variable heavy (VH)/variable light (VL) chain pairs, which cover a broad range of canonical complementarity-determining region (CDR) structures. The variable Ig heavy and Ig light (VH/VL) chain pairs were selected for biophysical characteristics favorable to manufacturing and development. The selection process included multiple parameters, e.g., assessment of protein expression yield, thermal stability and aggregation propensity in fragment antigen binding (Fab) and IgG1 formats, and relative Fab display rate on phage. The framework regions are fixed and the diversified CDRs were designed based on a systematic analysis of a large set of rearranged human antibody sequences. Care was taken to minimize the occurrence of potential posttranslational modification sites within the CDRs. Phage selection was performed against various antigens and unique antibodies with excellent biophysical properties were isolated. Our results confirm that quality can be built into an antibody library by prudent selection of unmodified, fully human VH/VL pairs as scaffolds. PMID:23571156

Secondary structure of the 3'-noncoding region of flavivirus genomes: comparative analysis of base pairing probabilities.

PubMed

Rauscher, S; Flamm, C; Mandl, C W; Heinz, F X; Stadler, P F

1997-07-01

The prediction of the complete matrix of base pairing probabilities was applied to the 3' noncoding region (NCR) of flavivirus genomes. This approach identifies not only well-defined secondary structure elements, but also regions of high structural flexibility. Flaviviruses, many of which are important human pathogens, have a common genomic organization, but exhibit a significant degree of RNA sequence diversity in the functionally important 3'-NCR. We demonstrate the presence of secondary structures shared by all flaviviruses, as well as structural features that are characteristic for groups of viruses within the genus reflecting the established classification scheme. The significance of most of the predicted structures is corroborated by compensatory mutations. The availability of infectious clones for several flaviviruses will allow the assessment of these structural elements in processes of the viral life cycle, such as replication and assembly.

Scaling features of noncoding DNA

NASA Technical Reports Server (NTRS)

Stanley, H. E.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Peng, C. K.; Simons, M.

1999-01-01

We review evidence supporting the idea that the DNA sequence in genes containing noncoding regions is correlated, and that the correlation is remarkably long range--indeed, base pairs thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene, and utilize this fact to build a Coding Sequence Finder Algorithm, which uses statistical ideas to locate the coding regions of an unknown DNA sequence. Finally, we describe briefly some recent work adapting to DNA the Zipf approach to analyzing linguistic texts, and the Shannon approach to quantifying the "redundancy" of a linguistic text in terms of a measurable entropy function, and reporting that noncoding regions in eukaryotes display a larger redundancy than coding regions. Specifically, we consider the possibility that this result is solely a consequence of nucleotide concentration differences as first noted by Bonhoeffer and his collaborators. We find that cytosine-guanine (CG) concentration does have a strong "background" effect on redundancy. However, we find that for the purine-pyrimidine binary mapping rule, which is not affected by the difference in CG concentration, the Shannon redundancy for the set of analyzed sequences is larger for noncoding regions compared to coding regions.

Distance-dependent duplex DNA destabilization proximal to G-quadruplex/i-motif sequences

PubMed Central

König, Sebastian L. B.; Huppert, Julian L.; Sigel, Roland K. O.; Evans, Amanda C.

2013-01-01

G-quadruplexes and i-motifs are complementary examples of non-canonical nucleic acid substructure conformations. G-quadruplex thermodynamic stability has been extensively studied for a variety of base sequences, but the degree of duplex destabilization that adjacent quadruplex structure formation can cause has yet to be fully addressed. Stable in vivo formation of these alternative nucleic acid structures is likely to be highly dependent on whether sufficient spacing exists between neighbouring duplex- and quadruplex-/i-motif-forming regions to accommodate quadruplexes or i-motifs without disrupting duplex stability. Prediction of putative G-quadruplex-forming regions is likely to be assisted by further understanding of what distance (number of base pairs) is required for duplexes to remain stable as quadruplexes or i-motifs form. Using oligonucleotide constructs derived from precedented G-quadruplexes and i-motif-forming bcl-2 P1 promoter region, initial biophysical stability studies indicate that the formation of G-quadruplex and i-motif conformations do destabilize proximal duplex regions. The undermining effect that quadruplex formation can have on duplex stability is mitigated with increased distance from the duplex region: a spacing of five base pairs or more is sufficient to maintain duplex stability proximal to predicted quadruplex/i-motif-forming regions. PMID:23771141

Plastid primers for angiosperm phylogenetics and phylogeography.

PubMed

Prince, Linda M

2015-06-01

PCR primers are available for virtually every region of the plastid genome. Selection of which primer pairs to use is second only to selection of the genic region. This is particularly true for research at the species/population interface. Primer pairs for 130 regions of the chloroplast genome were evaluated in 12 species distributed across the angiosperms. Likelihood of amplification success was inferred based upon number and location of mismatches to target sequence. Intraspecific sequence variability was evaluated under three different criteria in four species. Many published primer pairs should work across all taxa sampled, with the exception of failure due to genomic reorganization events. Universal barcoding primers were the least likely to work (65% success). The list of most variable regions for use within species has little in common with the lists identified in prior studies. Published primer sequences should amplify a diversity of flowering plant DNAs, even those designed for specific taxonomic groups. "Universal" primers may have extremely limited utility. There was little consistency in likelihood of amplification success for any given publication across lineages or within lineage across publications.

U14 small nucleolar RNA makes multiple contacts with the pre-ribosomal RNA.

PubMed

Morrissey, J P; Tollervey, D

1997-06-01

The small nucleolar RNA (snoRNA) U14 has two regions of extended primary sequence complementarity to the 18S rRNA. The 3' region (domain B) shows the consensus structure for the methylation guide class of snoRNAs, whereas base-pairing between the 5' region (domain A) and the 18S rRNA sequence is required for the formation of functional ribosomes. Between domains A and B lies another essential region (domain Y). Here we report that yeast U14 can be cross-linked in vivo to the pre-rRNA; cross-linking is detected exclusively with the 35S primary transcript. Many nucleotides in U14 that lie outside of domains A and B are cross-linked to the pre-rRNA; in particular the essential domain Y region is cross-linked at several sites. U14 is, therefore, in far more extensive contact with the pre-rRNA than predicted from simple base-pairing models. Moreover, U14 can be cross-linked to other small RNA species. The functional interactions made by U14 during ribosome synthesis are likely to be very complex.

SELEX and SHAPE reveal that sequence motifs and an extended hairpin in the 5' portion of Turnip crinkle virus satellite RNA C mediate fitness in plants.

PubMed

Bayne, Charlie F; Widawski, Max E; Gao, Feng; Masab, Mohammed H; Chattopadhyay, Maitreyi; Murawski, Allison M; Sansevere, Robert M; Lerner, Bryan D; Castillo, Rinaldys J; Griesman, Trevor; Fu, Jiantao; Hibben, Jennifer K; Garcia-Perez, Alma D; Simon, Anne E; Kushner, David B

2018-07-01

Noncoding RNAs use their sequence and/or structure to mediate function(s). The 5' portion (166 nt) of the 356-nt noncoding satellite RNA C (satC) of Turnip crinkle virus (TCV) was previously modeled to contain a central region with two stem-loops (H6 and H7) and a large connecting hairpin (H2). We now report that in vivo functional selection (SELEX) experiments assessing sequence/structure requirements in H2, H6, and H7 reveal that H6 loop sequence motifs were recovered at nonrandom rates and only some residues are proposed to base-pair with accessible complementary sequences within the 5' central region. In vitro SHAPE of SELEX winners indicates that the central region is heavily base-paired, such that along with the lower stem and H2 region, one extensive hairpin exists composing the entire 5' region. As these SELEX winners are highly fit, these characteristics facilitate satRNA amplification in association with TCV in plants. Copyright © 2018 Elsevier Inc. All rights reserved.

Binding Sites Analyser (BiSA): Software for Genomic Binding Sites Archiving and Overlap Analysis

PubMed Central

Khushi, Matloob; Liddle, Christopher; Clarke, Christine L.; Graham, J. Dinny

2014-01-01

Genome-wide mapping of transcription factor binding and histone modification reveals complex patterns of interactions. Identifying overlaps in binding patterns by different factors is a major objective of genomic studies, but existing methods to archive large numbers of datasets in a personalised database lack sophistication and utility. Therefore we have developed transcription factor DNA binding site analyser software (BiSA), for archiving of binding regions and easy identification of overlap with or proximity to other regions of interest. Analysis results can be restricted by chromosome or base pair overlap between regions or maximum distance between binding peaks. BiSA is capable of reporting overlapping regions that share common base pairs; regions that are nearby; regions that are not overlapping; and average region sizes. BiSA can identify genes located near binding regions of interest, genomic features near a gene or locus of interest and statistical significance of overlapping regions can also be reported. Overlapping results can be visualized as Venn diagrams. A major strength of BiSA is that it is supported by a comprehensive database of publicly available transcription factor binding sites and histone modifications, which can be directly compared to user data. The documentation and source code are available on http://bisa.sourceforge.net PMID:24533055

Analysis of Food Pairing in Regional Cuisines of India

PubMed Central

Bagler, Ganesh

2015-01-01

Any national cuisine is a sum total of its variety of regional cuisines, which are the cultural and historical identifiers of their respective regions. India is home to a number of regional cuisines that showcase its culinary diversity. Here, we study recipes from eight different regional cuisines of India spanning various geographies and climates. We investigate the phenomenon of food pairing which examines compatibility of two ingredients in a recipe in terms of their shared flavor compounds. Food pairing was enumerated at the level of cuisine, recipes as well as ingredient pairs by quantifying flavor sharing between pairs of ingredients. Our results indicate that each regional cuisine follows negative food pairing pattern; more the extent of flavor sharing between two ingredients, lesser their co-occurrence in that cuisine. We find that frequency of ingredient usage is central in rendering the characteristic food pairing in each of these cuisines. Spice and dairy emerged as the most significant ingredient classes responsible for the biased pattern of food pairing. Interestingly while individual spices contribute to negative food pairing, dairy products on the other hand tend to deviate food pairing towards positive side. Our data analytical study highlighting statistical properties of the regional cuisines, brings out their culinary fingerprints that could be used to design algorithms for generating novel recipes and recipe recommender systems. It forms a basis for exploring possible causal connection between diet and health as well as prospection of therapeutic molecules from food ingredients. Our study also provides insights as to how big data can change the way we look at food. PMID:26430895

Analysis of Food Pairing in Regional Cuisines of India.

PubMed

Jain, Anupam; N K, Rakhi; Bagler, Ganesh

2015-01-01

Any national cuisine is a sum total of its variety of regional cuisines, which are the cultural and historical identifiers of their respective regions. India is home to a number of regional cuisines that showcase its culinary diversity. Here, we study recipes from eight different regional cuisines of India spanning various geographies and climates. We investigate the phenomenon of food pairing which examines compatibility of two ingredients in a recipe in terms of their shared flavor compounds. Food pairing was enumerated at the level of cuisine, recipes as well as ingredient pairs by quantifying flavor sharing between pairs of ingredients. Our results indicate that each regional cuisine follows negative food pairing pattern; more the extent of flavor sharing between two ingredients, lesser their co-occurrence in that cuisine. We find that frequency of ingredient usage is central in rendering the characteristic food pairing in each of these cuisines. Spice and dairy emerged as the most significant ingredient classes responsible for the biased pattern of food pairing. Interestingly while individual spices contribute to negative food pairing, dairy products on the other hand tend to deviate food pairing towards positive side. Our data analytical study highlighting statistical properties of the regional cuisines, brings out their culinary fingerprints that could be used to design algorithms for generating novel recipes and recipe recommender systems. It forms a basis for exploring possible causal connection between diet and health as well as prospection of therapeutic molecules from food ingredients. Our study also provides insights as to how big data can change the way we look at food.

INSAR Study Of Landslides In The Region Of Lake Sevan-Armenia

NASA Astrophysics Data System (ADS)

Lazarov, A.; Minchev, D.

2012-01-01

The region of Lake Sevan in Armenia is of theoretical and practical interest due to its very high landslide phenomena caused by metrological and hydrological reasons. Based on the ESA Principal Investigator Number C1P-6051 and requested data from ASAR instrument of ESA ENVISAT satellite four single look complex images including two images from 2008 and two images from 2009 of the region of the Sevan Lake in Armenia are obtained and thoroughly investigated. The one of the images is pointed out as a master and the rest of them, three images as slaves. Hence, three interferometric pairs are produced. Then data of NASA SRTM mission is applied to the interferometric pairs in order to remove topography from the interferograms. Three interferograms generated illustrate decreasing of coherence caused by high temporary decorelation, which means decreasing the level of coincidence of SLC’s in each interferometric pair, according to the time of acquisition each of them.

Complementarity to an miRNA seed region is sufficient to induce moderate repression of a target transcript in the unicellular green alga Chlamydomonas reinhardtii.

PubMed

Yamasaki, Tomohito; Voshall, Adam; Kim, Eun-Jeong; Moriyama, Etsuko; Cerutti, Heriberto; Ohama, Takeshi

2013-12-01

MicroRNAs (miRNAs) are 20-24 nt non-coding RNAs that play important regulatory roles in a broad range of eukaryotes by pairing with mRNAs to direct post-transcriptional repression. The mechanistic details of miRNA-mediated post-transcriptional regulation have been well documented in multicellular model organisms. However, this process remains poorly studied in algae such as Chlamydomonas reinhardtii, and specific features of miRNA biogenesis, target mRNA recognition and subsequent silencing are not well understood. In this study, we report on the characterization of a Chlamydomonas miRNA, cre-miR1174.2, which is processed from a near-perfect hairpin RNA. Using Gaussia luciferase (gluc) reporter genes, we have demonstrated that cre-miR1174.2 is functional in Chlamydomonas and capable of triggering site-specific cleavage at the center of a perfectly complementary target sequence. A mismatch tolerance test assay, based on pools of transgenic strains, revealed that target hybridization to nucleotides of the seed region, at the 5' end of an miRNA, was sufficient to induce moderate repression of expression. In contrast, pairing to the 3' region of the miRNA was not critical for silencing. Our results suggest that the base-pairing requirements for small RNA-mediated repression in C. reinhardtii are more similar to those of metazoans compared with the extensive complementarity that is typical of land plants. Individual Chlamydomonas miRNAs may potentially modulate the expression of numerous endogenous targets as a result of these relaxed base-pairing requirements. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

Molecular cloning and nucleotide sequence of the alpha and beta subunits of allophycocyanin from the cyanelle genome of Cyanophora paradoxa.

PubMed Central

Bryant, D A; de Lorimier, R; Lambert, D H; Dubbs, J M; Stirewalt, V L; Stevens, S E; Porter, R D; Tam, J; Jay, E

1985-01-01

The genes for the alpha- and beta-subunit apoproteins of allophycocyanin (AP) were isolated from the cyanelle genome of Cyanophora paradoxa and subjected to nucleotide sequence analysis. The AP beta-subunit apoprotein gene was localized to a 7.8-kilobase-pair Pst I restriction fragment from cyanelle DNA by hybridization with a tetradecameric oligonucleotide probe. Sequence analysis using that oligonucleotide and its complement as primers for the dideoxy chain-termination sequencing method confirmed the presence of both AP alpha- and beta-subunit genes on this restriction fragment. Additional oligonucleotide primers were synthesized as sequencing progressed and were used to determine rapidly the nucleotide sequence of a 1336-base-pair region of this cloned fragment. This strategy allowed the sequencing to be completed without a detailed restriction map and without extensive and time-consuming subcloning. The sequenced region contains two open reading frames whose deduced amino acid sequences are 81-85% homologous to cyanobacterial and red algal AP subunits whose amino acid sequences have been determined. The two open reading frames are in the same orientation and are separated by 39 base pairs. AP alpha is 5' to AP beta and both coding sequences are preceded by a polypurine, Shine-Dalgarno-type sequence. Sequences upstream from AP alpha closely resemble the Escherichia coli consensus promoter sequences and also show considerable homology to promoter sequences for several chloroplast-encoded psbA genes. A 56-base-pair palindromic sequence downstream from the AP beta gene could play a role in the termination of transcription or translation. The allophycocyanin apoprotein subunit genes are located on the large single-copy region of the cyanelle genome. PMID:2987916

pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

PubMed

Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

2009-11-23

Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

Nick-free formation of reciprocal heteroduplexes: a simple solution to the topological problem.

PubMed Central

Wilson, J H

1979-01-01

Because the individual strands of DNA are intertwined, formation of heteroduplex structures between duplexes--as in presumed recombination intermediates--presents a topological puzzle, known as the winding problem. Previous approaches to this problem have assumed that single-strand breaks are required to permit formation of fully coiled heteroduplexes. This paper describes a simple, nick-free solution to the winding problem that satisfies all topological constraints. Homologous duplexes associated by their minor-groove surfaces can switch strand pairing to form reciprocal heteroduplexes that coil together into a compact, four-stranded helix throughout the region of pairing. Model building shows that this fused heteroduplex structure is plausible, being composed entirely of right-handed primary helices with Watson-Crick base pairing throughout. Its simplicity of formation, structural symmetry, and high degree of specificity are suggestive of a natural mechanism for alignment by base pairing between intact homologous duplexes. Implications for genetic recombination are discussed. Images PMID:291028

Crystal structure and sequence-dependent conformation of the A.G mispaired oligonucleotide d(CGCAAGCTGGCG).

PubMed Central

Webster, G D; Sanderson, M R; Skelly, J V; Neidle, S; Swann, P F; Li, B F; Tickle, I J

1990-01-01

The crystal structure of the dodecanucleotide d(CGCAAGCTGGCG) has been determined to a resolution of 2.5 A and refined to an R factor of 19.3% for 1710 reflections. The sequence crystallizes as a B-type double helix, with two G(anti).A(syn) base pairs. These are stabilized by three-center hydrogen bonds to pyrimidines that induce perturbations in base-pair geometry. The central AGCT region of the helix has a wide (greater than 6 A) minor groove. PMID:2395870

Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

PubMed Central

Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

2009-01-01

Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

PubMed

Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

2009-01-13

Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

High-Fidelity Down-Conversion Source for Secure Communications Using On-Demand Single Photons

NASA Technical Reports Server (NTRS)

Roberts, Tony

2015-01-01

AdvR, Inc., has built an efficient, fully integrated, waveguide-based source of spectrally uncorrelated photon pairs that will accelerate research and development (R&D) in the emerging field of quantum information science. Key to the innovation is the use of submicron periodically poled waveguides to produce counter propagating photon pairs, which is enabled by AdvR's patented segmented microelectrode poling technique. This novel device will provide a high brightness source of down-conversion pairs with enhanced spectral properties and low attenuation, and it will operate in the visible to the mid-infrared spectral region. A waveguide-based source of spectrally and spatially pure heralded photons will contribute to a wide range of NASA's advanced technology development efforts, including on-demand single photon sources for high-rate spaced-based secure communications.

Comparison of Species Richness Estimates Obtained Using Nearly Complete Fragments and Simulated Pyrosequencing-Generated Fragments in 16S rRNA Gene-Based Environmental Surveys▿ †

PubMed Central

Youssef, Noha; Sheik, Cody S.; Krumholz, Lee R.; Najar, Fares Z.; Roe, Bruce A.; Elshahed, Mostafa S.

2009-01-01

Pyrosequencing-based 16S rRNA gene surveys are increasingly utilized to study highly diverse bacterial communities, with special emphasis on utilizing the large number of sequences obtained (tens to hundreds of thousands) for species richness estimation. However, it is not yet clear how the number of operational taxonomic units (OTUs) and, hence, species richness estimates determined using shorter fragments at different taxonomic cutoffs correlates with the number of OTUs assigned using longer, nearly complete 16S rRNA gene fragments. We constructed a 16S rRNA clone library from an undisturbed tallgrass prairie soil (1,132 clones) and used it to compare species richness estimates obtained using eight pyrosequencing candidate fragments (99 to 361 bp in length) and the nearly full-length fragment. Fragments encompassing the V1 and V2 (V1+V2) region and the V6 region (generated using primer pairs 8F-338R and 967F-1046R) overestimated species richness; fragments encompassing the V3, V7, and V7+V8 hypervariable regions (generated using primer pairs 338F-530R, 1046F-1220R, and 1046F-1392R) underestimated species richness; and fragments encompassing the V4, V5+V6, and V6+V7 regions (generated using primer pairs 530F-805R, 805F-1046R, and 967F-1220R) provided estimates comparable to those obtained with the nearly full-length fragment. These patterns were observed regardless of the alignment method utilized or the parameter used to gauge comparative levels of species richness (number of OTUs observed, slope of scatter plots of pairwise distance values for short and nearly complete fragments, and nonparametric and parametric species richness estimates). Similar results were obtained when analyzing three other datasets derived from soil, adult Zebrafish gut, and basaltic formations in the East Pacific Rise. Regression analysis indicated that these observed discrepancies in species richness estimates within various regions could readily be explained by the proportions of hypervariable, variable, and conserved base pairs within an examined fragment. PMID:19561178

Statistical properties of DNA sequences

NASA Technical Reports Server (NTRS)

Peng, C. K.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Simons, M.; Stanley, H. E.

1995-01-01

We review evidence supporting the idea that the DNA sequence in genes containing non-coding regions is correlated, and that the correlation is remarkably long range--indeed, nucleotides thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene. We resolve the problem of the "non-stationarity" feature of the sequence of base pairs by applying a new algorithm called detrended fluctuation analysis (DFA). We address the claim of Voss that there is no difference in the statistical properties of coding and non-coding regions of DNA by systematically applying the DFA algorithm, as well as standard FFT analysis, to every DNA sequence (33301 coding and 29453 non-coding) in the entire GenBank database. Finally, we describe briefly some recent work showing that the non-coding sequences have certain statistical features in common with natural and artificial languages. Specifically, we adapt to DNA the Zipf approach to analyzing linguistic texts. These statistical properties of non-coding sequences support the possibility that non-coding regions of DNA may carry biological information.

Enhancement of galaxy overdensity around quasar pairs at z < 3.6 based on the Hyper Suprime-Cam Subaru Strategic Program Survey

NASA Astrophysics Data System (ADS)

Onoue, Masafusa; Kashikawa, Nobunari; Uchiyama, Hisakazu; Akiyama, Masayuki; Harikane, Yuichi; Imanishi, Masatoshi; Komiyama, Yutaka; Matsuoka, Yoshiki; Nagao, Tohru; Nishizawa, Atsushi J.; Oguri, Masamune; Ouchi, Masami; Tanaka, Masayuki; Toba, Yoshiki; Toshikawa, Jun

2018-01-01

We investigate the galaxy overdensity around proto-cluster scale quasar pairs at high (z > 3) and low (z ˜ 1) redshift based on the unprecedentedly wide and deep optical survey of the Hyper Suprime-Cam Subaru Strategic Program (HSC-SSP). Using the first-year survey data covering effectively ˜121 deg2 with the 5σ depth of i ˜ 26.4 and the SDSS DR12Q catalog, we find two luminous pairs at z ˜ 3.3 and 3.6 which reside in >5σ overdensity regions of g-dropout galaxies at i < 25. The projected separations of the two pairs are R⊥ = 1.75 and 1.04 proper Mpc (pMpc), and their velocity offsets are ΔV = 692 and 1448 km s-1, respectively. This result is in clear contrast to the average z ˜ 4 quasar environments as discussed in Uchiyama et al. (2018, PASJ 70, S32) and implies that the quasar activities of the pair members are triggered via major mergers in proto-clusters, unlike the vast majority of isolated quasars in general fields that may turn on via non-merger events such as bar and disk instabilities. At z ˜ 1, we find 37 pairs with R⊥ < 2 pMpc and ΔV < 2300 km s-1 in the current HSC-Wide coverage, including four from Hennawi et al. (2006, AJ, 131, 1). The distribution of the peak overdensity significance within two arcminutes around the pairs has a long tail toward high-density (>4σ) regions. Thanks to the large sample size, we find statistical evidence that this excess is unique to the pair environments when compared to single-quasar and randomly selected galaxy environments at the same redshift range. Moreover, there are nine small-scale (R⊥ < 1 pMpc) pairs, two of which are found to reside in cluster fields. Our results demonstrate that <2 pMpc scale quasar pairs at both redshift ranges tend to occur in massive haloes, although perhaps not the most massive ones, and that they are useful in searching for rare density peaks.

Base pairing between the 3' exon and an internal guide sequence increases 3' splice site specificity in the Tetrahymena self-splicing rRNA intron.

PubMed Central

Suh, E R; Waring, R B

1990-01-01

It has been proposed that recognition of the 3' splice site in many group I introns involves base pairing between the start of the 3' exon and a region of the intron known as the internal guide sequence (R. W. Davies, R. B. Waring, J. Ray, T. A. Brown, and C. Scazzocchio, Nature [London] 300:719-724, 1982). We have examined this hypothesis, using the self-splicing rRNA intron from Tetrahymena thermophila. Mutations in the 3' exon that weaken this proposed pairing increased use of a downstream cryptic 3' splice site. Compensatory mutations in the guide sequence that restore this pairing resulted in even stronger selection of the normal 3' splice site. These changes in 3' splice site usage were more pronounced in the background of a mutation (414A) which resulted in an adenine instead of a guanine being the last base of the intron. These results show that the proposed pairing (P10) plays an important role in ensuring that cryptic 3' splice sites are selected against. Surprisingly, the 414A mutation alone did not result in activation of the cryptic 3' splice site. Images PMID:2342465

Phylogenetic species identification in Rattus highlights rapid radiation and morphological similarity of New Guinean species.

PubMed

Robins, Judith H; Tintinger, Vernon; Aplin, Ken P; Hingston, Melanie; Matisoo-Smith, Elizabeth; Penny, David; Lavery, Shane D

2014-01-01

The genus Rattus is highly speciose, the taxonomy is complex, and individuals are often difficult to identify to the species level. Previous studies have demonstrated the usefulness of phylogenetic approaches to identification in Rattus but some species, especially among the endemics of the New Guinean region, showed poor resolution. Possible reasons for this are simple misidentification, incomplete gene lineage sorting, hybridization, and phylogenetically distinct lineages that are unrecognised taxonomically. To assess these explanations we analysed 217 samples, representing nominally 25 Rattus species, collected in New Guinea, Asia, Australia and the Pacific. To reduce misidentification problems we sequenced museum specimens from earlier morphological studies and recently collected tissues from samples with associated voucher specimens. We also reassessed vouchers from previously sequenced specimens. We inferred combined and separate phylogenies from two mitochondrial DNA regions comprising 550 base pair D-loop sequences and both long (655 base pair) and short (150 base pair) cytochrome oxidase I sequences. Our phylogenetic species identification for 17 species was consistent with morphological designations and current taxonomy thus reinforcing the usefulness of this approach. We reduced misidentifications and consequently the number of polyphyletic species in our phylogenies but the New Guinean Rattus clades still exhibited considerable complexity. Only three of our eight New Guinean species were monophyletic. We found good evidence for either incomplete mitochondrial lineage sorting or hybridization between species within two pairs, R. leucopus/R. cf. verecundus and R. steini/R. praetor. Additionally, our results showed that R. praetor, R. niobe and R. verecundus each likely encompass more than one species. Our study clearly points to the need for a revised taxonomy of the rats of New Guinea, based on broader sampling and informed by both morphology and phylogenetics. The remaining taxonomic complexity highlights the recent and rapid radiation of Rattus in the Australo-Papuan region.

Phylogenetic Species Identification in Rattus Highlights Rapid Radiation and Morphological Similarity of New Guinean Species

PubMed Central

Robins, Judith H.; Tintinger, Vernon; Aplin, Ken P.; Hingston, Melanie; Matisoo-Smith, Elizabeth; Penny, David; Lavery, Shane D.

2014-01-01

The genus Rattus is highly speciose, the taxonomy is complex, and individuals are often difficult to identify to the species level. Previous studies have demonstrated the usefulness of phylogenetic approaches to identification in Rattus but some species, especially among the endemics of the New Guinean region, showed poor resolution. Possible reasons for this are simple misidentification, incomplete gene lineage sorting, hybridization, and phylogenetically distinct lineages that are unrecognised taxonomically. To assess these explanations we analysed 217 samples, representing nominally 25 Rattus species, collected in New Guinea, Asia, Australia and the Pacific. To reduce misidentification problems we sequenced museum specimens from earlier morphological studies and recently collected tissues from samples with associated voucher specimens. We also reassessed vouchers from previously sequenced specimens. We inferred combined and separate phylogenies from two mitochondrial DNA regions comprising 550 base pair D-loop sequences and both long (655 base pair) and short (150 base pair) cytochrome oxidase I sequences. Our phylogenetic species identification for 17 species was consistent with morphological designations and current taxonomy thus reinforcing the usefulness of this approach. We reduced misidentifications and consequently the number of polyphyletic species in our phylogenies but the New Guinean Rattus clades still exhibited considerable complexity. Only three of our eight New Guinean species were monophyletic. We found good evidence for either incomplete mitochondrial lineage sorting or hybridization between species within two pairs, R. leucopus/R. cf. verecundus and R. steini/R. praetor. Additionally, our results showed that R. praetor, R. niobe and R. verecundus each likely encompass more than one species. Our study clearly points to the need for a revised taxonomy of the rats of New Guinea, based on broader sampling and informed by both morphology and phylogenetics. The remaining taxonomic complexity highlights the recent and rapid radiation of Rattus in the Australo-Papuan region. PMID:24865350

Characterization of a tandemly repeated DNA sequence family originally derived by retroposition of tRNA(Glu) in the newt.

PubMed

Nagahashi, S; Endoh, H; Suzuki, Y; Okada, N

1991-11-20

A previous report from this laboratory showed that in vitro transcription of total genomic DNA of the newt Cynopus pyrrhogaster resulted in a discrete sized 8 S RNA, which represented highly repetitive and transcribable sequences with a glutamic acid tRNA-like structure in the newt genome. We isolated four independent clones from a newt genomic library and determined the complete sequences of three 2000 to 2400 base-pair PstI fragments spanning the 8 S RNA gene. The glutamic acid tRNA-related segment in the 8 S RNA gene contains the CCA sequence expected as the 3' terminus of a tRNA molecule. Further, the 11 nucleotides located 13 nucleotides upstream from one of the two transcription initiation sites of the 8 S RNA were found to be repeated in the region upstream from the termination site, suggesting that the original unit, which is shorter than the 8 S RNA, was retrotransposed via cDNA intermediates from the PolIII transcript. In the upstream region of the 8 S RNA gene, a 360 nucleotide unit containing the glutamic acid tRNA-related segment was found to be duplicated (clones NE1 and NE10) or triplicated (clone NE3). Except for the difference in the number of the 360 nucleotide unit, the three sequences of the 2000 to 2400 base-pair PstI fragment were essentially the same with only a few mutations and minor deletions. Inverse polymerase chain reaction and sequence determination of the products, together with a Southern hybridization experiment, demonstrated that the family consists of a tandemly repeated unit of 3300, 3700 or 4100 base-pairs. Thus during evolution, this family in the newt was created by retroposition via cDNA intermediates, followed by duplication or triplication of the 360 nucleotide unit and multiplication of the 3300 to 4100 base-pair region at the DNA level.

Trans-activation of the Tetrahymena group I intron ribozyme via a non-native RNA-RNA interaction.

PubMed Central

Ikawa, Y; Shiraishi, H; Inoue, T

1999-01-01

The peripheral P2.1 domain of the Tetrahymena group I intron ribozyme has been shown to be non-essential for splicing. We found, however, that separately prepared P2.1 RNA efficiently accelerates the 3' splice-site-specific hydrolysis reaction of a mutant ribozyme lacking both P2.1 and its upstream region in trans. We report here the unusual properties of this trans-activation. Compensatory mutational analysis revealed that non-native long-range base-pairings between the loop region of P2.1 RNA and L5c region of the mutant ribozyme are needed for the activation in spite of the fact that P2.1 forms base-pairings with P9.1 in the Tetrahymena ribozyme. The trans -activation depends on the non-native RNA-RNA interaction together with the higher order structure of P2.1 RNA. This activation is unique among the known trans-activations that utilize native tertiary interactions or RNA chaperons. PMID:10075996

Estimating Genomic Distance from DNA Sequence Location in Cell Nuclei by a Random Walk Model

NASA Astrophysics Data System (ADS)

van den Engh, Ger; Sachs, Rainer; Trask, Barbara J.

1992-09-01

The folding of chromatin in interphase cell nuclei was studied by fluorescent in situ hybridization with pairs of unique DNA sequence probes. The sites of DNA sequences separated by 100 to 2000 kilobase pairs (kbp) are distributed in interphase chromatin according to a random walk model. This model provides the basis for calculating the spacing of sequences along the linear DNA molecule from interphase distance measurements. An interphase mapping strategy based on this model was tested with 13 probes from a 4-megabase pair (Mbp) region of chromosome 4 containing the Huntington disease locus. The results confirmed the locations of the probes and showed that the remaining gap in the published maps of this region is negligible in size. Interphase distance measurements should facilitate construction of chromosome maps with an average marker density of one per 100 kbp, approximately ten times greater than that achieved by hybridization to metaphase chromosomes.

Strong-coupling effects in superfluid He3 in aerogel

NASA Astrophysics Data System (ADS)

Aoyama, Kazushi; Ikeda, Ryusuke

2007-09-01

Effects of impurity scatterings on the strong-coupling (SC) contribution, stabilizing the ABM (axial) pairing state, to the quartic term of the Ginzburg-Landau free energy of superfluid He3 are theoretically studied to examine recent observations suggestive of an anomalously small SC effect in superfluid He3 in aerogels. To study the SC corrections, two approaches are used. One is based on a perturbation in the short-range repulsive interaction, and the other is a phenomenological approach used previously for the bulk liquid by Sauls and Serene [Phys. Rev. B 24, 183 (1981)]. It is found that the impurity scattering favors the BW pairing state and shrinks the region of the ABM pairing state in the T-P phase diagram. In the phenomenological approach, the resulting shrinkage of the ABM region is especially substantial and, if assuming an anisotropy over a large scale in aerogel, leads to justifying the phase diagrams determined experimentally.

Fiber-Optic Linear Displacement Sensor Based On Matched Interference Filters

NASA Astrophysics Data System (ADS)

Fuhr, Peter L.; Feener, Heidi C.; Spillman, William B.

1990-02-01

A fiber optic linear displacement sensor has been developed in which a pair of matched interference filters are used to encode linear position on a broadband optical signal as relative intensity variations. As the filters are displaced, the optical beam illuminates varying amounts of each filter. Determination of the relative intensities at each filter pairs' passband is based on measurements acquired with matching filters and photodetectors. Source power variation induced errors are minimized by basing determination of linear position on signal Visibility. A theoretical prediction of the sensor's performance is developed and compared with experiments performed in the near IR spectral region using large core multimode optical fiber.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ghosh, Tarini Shankar; Chaitanya, S. Krishna; Sankararamakrishnan, Ramasubbu, E-mail: rsankar@iitk.ac.in

New classes of helix–helix interactions in protein structures are reported in which interactions only occur at the terminal regions or between the terminal region of one helix and the middle region of another helix. Helix–helix interactions are important for the structure, stability and function of α-helical proteins. Helices that either cross in the middle or show extensive contacts between each other, such as coiled coils, have been investigated in previous studies. Interactions between two helices can also occur only at the terminal regions or between the terminal region of one helix and the middle region of another helix. Examples ofmore » such helix pairs are found in aquaporin, H{sup +}/Cl{sup −} transporter and Bcl-2 proteins. The frequency of the occurrence of such ‘end-to-end’ (EE) and ‘end-to-middle’ (EM) helix pairs in protein structures is not known. Questions regarding the residue preferences in the interface and the mode of interhelical interactions in such helix pairs also remain unanswered. In this study, high-resolution structures of all-α proteins from the PDB have been systematically analyzed and the helix pairs that interact only in EE or EM fashion have been extracted. EE and EM helix pairs have been categorized into five classes (N–N, N–C, C–C, N–MID and C–MID) depending on the region of interaction. Nearly 13% of 5725 helix pairs belonged to one of the five classes. Analysis of single-residue propensities indicated that hydrophobic and polar residues prefer to occur in the C-terminal and N-terminal regions, respectively. Hydrophobic C-terminal interacting residues and polar N-terminal interacting residues are also highly conserved. A strong correlation exists between some of the residue properties (surface area/volume and length of side chains) and their preferences for occurring in the interface of EE and EM helix pairs. In contrast to interacting non-EE/EM helix pairs, helices in EE and EM pairs are farther apart. In these helix pairs, residues with large surface area/volume and longer side chains are preferred in the interfacial region.« less

Structure of an anti-HIV-1 hammerhead ribozyme complex with a 17-mer DNA substrate analog of HIV-1 gag RNA and a mechanism for the cleavage reaction: 750 MHz NMR and computer experiments

NASA Technical Reports Server (NTRS)

Ojha, R. P.; Dhingra, M. M.; Sarma, M. H.; Myer, Y. P.; Setlik, R. F.; Shibata, M.; Kazim, A. L.; Ornstein, R. L.; Rein, R.; Turner, C. J.;

Pair-Wise Trajectory Management-Oceanic (PTM-O) . [Concept of Operations—Version 3.9

NASA Technical Reports Server (NTRS)

Jones, Kenneth M.

2014-01-01

This document describes the Pair-wise Trajectory Management-Oceanic (PTM-O) Concept of Operations (ConOps). Pair-wise Trajectory Management (PTM) is a concept that includes airborne and ground-based capabilities designed to enable and to benefit from, airborne pair-wise distance-monitoring capability. PTM includes the capabilities needed for the controller to issue a PTM clearance that resolves a conflict for a specific pair of aircraft. PTM avionics include the capabilities needed for the flight crew to manage their trajectory relative to specific designated aircraft. Pair-wise Trajectory Management PTM-Oceanic (PTM-O) is a regional specific application of the PTM concept. PTM is sponsored by the National Aeronautics and Space Administration (NASA) Concept and Technology Development Project (part of NASA's Airspace Systems Program). The goal of PTM is to use enhanced and distributed communications and surveillance along with airborne tools to permit reduced separation standards for given aircraft pairs, thereby increasing the capacity and efficiency of aircraft operations at a given altitude or volume of airspace.

The 5S rRNA loop E: chemical probing and phylogenetic data versus crystal structure.

PubMed

Leontis, N B; Westhof, E

1998-09-01

A significant fraction of the bases in a folded, structured RNA molecule participate in noncanonical base pairing interactions, often in the context of internal loops or multi-helix junction loops. The appearance of each new high-resolution RNA structure provides welcome data to guide efforts to understand and predict RNA 3D structure, especially when the RNA in question is a functionally conserved molecule. The recent publication of the crystal structure of the "Loop E" region of bacterial 5S ribosomal RNA is such an event [Correll CC, Freeborn B, Moore PB, Steitz TA, 1997, Cell 91:705-712]. In addition to providing more examples of already established noncanonical base pairs, such as purine-purine sheared pairings, trans-Hoogsteen UA, and GU wobble pairs, the structure provides the first high-resolution views of two new purine-purine pairings and a new GU pairing. The goal of the present analysis is to expand the capabilities of both chemical probing and phylogenetic analysis to predict with greater accuracy the structures of RNA molecules. First, in light of existing chemical probing data, we investigate what lessons could be learned regarding the interpretation of this widely used method of RNA structure probing. Then we analyze the 3D structure with reference to molecular phylogeny data (assuming conservation of function) to discover what alternative base pairings are geometrically compatible with the structure. The comparisons between previous modeling efforts and crystal structures show that the intricate involvements of ions and water molecules in the maintenance of non-Watson-Crick pairs render the process of correctly identifying the interacting sites in such pairs treacherous, except in cases of trans-Hoogsteen A/U or sheared A/G pairs for the adenine N1 site. The phylogenetic analysis identifies A/A, A/C, A/U and C/A, C/C, and C/U pairings isosteric with sheared A/G, as well as A/A and A/C pairings isosteric with both G/U and G/G bifurcated pairings. Thus, each non-Watson-Crick pair could be characterized by a phylogenetic signature of variations between isosteric-like pairings. In addition to the conservative changes, which form a dictionary of pairings isosterically compatible with those observed in the crystal structure, concerted changes involving several base pairs also occur. The latter covariations may indicate transitions between related but distinctive motifs within the loop E of 5S ribosomal RNA.

Barriers to implementing protocols for kidney paired donation and desensitization: survey of U.S. transplant programs.

PubMed

Clark, Emma; Hanto, Ruthanne; Rodrigue, James R

2010-12-01

Special types of kidney transplant exist for patients who have willing but incompatible donors. Two types of transplants that circumvent donor-recipient incompatibility are "kidney paired donation" and "desensitization." Lack of access to these protocols limits living donations and shortens the life span of patients with willing but incompatible donors. To understand potential barriers to implementing kidney paired donation and desensitization, as well as attitudes toward nondirected donation and compatible type O donation, which would maximize the number of kidney paired donation transplants performed via chains. We created a 56-question Web-based survey to elicit information from US transplant program directors about 24 potential barriers to implementing these protocols. Of 166 programs contacted, 96 responded, including 88 complete and 8 partial responses. After pediatric-only programs and multiple responses from the same program were removed, 84 total (78 complete) remained. Respondents were asked to designate each barrier as "major," "minor," or "not a barrier". Availability of dedicated nurse coordinators and the United Network for Organ Sharing's variance request process (although kidney paired donation does not actually require a variance) were significant barriers to kidney paired donation. Most respondents (54%, 42/78) would prefer to participate in a regional rather than a national protocol for kidney paired donation. Risk of complications was the most significant barrier to desensitization. University affiliation, region, and training (nephrologist vs surgeon) had little effect on perception of barriers. Most (92%, 71/78) would evaluate nondirected donations; 53% (41/78) would encourage compatible type O donors to enter kidney paired donation.

Role of Prefrontal and Parietal Cortices in Associative Learning

PubMed Central

Anderson, John R.; Byrne, Dana; Fincham, Jon M.; Gunn, Pat

2017-01-01

Two studies were performed that compared a “Paired” condition in which participants studied paired associates with a “Generated” condition in which participants completed word fragments to produce paired associates. In both tasks, participants were responsible for memory of the material either studied or generated. The experiments revealed significant differences between the responses of a predefined prefrontal region and a predefined parietal region. The parietal region responded more in the Generated condition than the Paired condition, whereas there was no difference in the prefrontal region. On the other hand, the prefrontal region responded to the delay between study and test in both the Paired and Generated conditions, whereas the parietal region only responded to delay in the Generated condition. This pattern of results is consistent with the hypothesis that the parietal region is responsive to changes in problem representation and the prefrontal region to retrieval operations. An information-processing model embodying these assumptions was fit to the blood oxygen level–dependent responses in these regions. PMID:17675369

Age-Related Brain Activation Changes during Rule Repetition in Word-Matching.

PubMed

Methqal, Ikram; Pinsard, Basile; Amiri, Mahnoush; Wilson, Maximiliano A; Monchi, Oury; Provost, Jean-Sebastien; Joanette, Yves

2017-01-01

Objective: The purpose of this study was to explore the age-related brain activation changes during a word-matching semantic-category-based task, which required either repeating or changing a semantic rule to be applied. In order to do so, a word-semantic rule-based task was adapted from the Wisconsin Sorting Card Test, involving the repeated feedback-driven selection of given pairs of words based on semantic category-based criteria. Method: Forty healthy adults (20 younger and 20 older) performed a word-matching task while undergoing a fMRI scan in which they were required to pair a target word with another word from a group of three words. The required pairing is based on three word-pair semantic rules which correspond to different levels of semantic control demands: functional relatedness, moderately typical-relatedness (which were considered as low control demands), and atypical-relatedness (high control demands). The sorting period consisted of a continuous execution of the same sorting rule and an inferred trial-by-trial feedback was given. Results: Behavioral performance revealed increases in response times and decreases of correct responses according to the level of semantic control demands (functional vs. typical vs. atypical) for both age groups (younger and older) reflecting graded differences in the repetition of the application of a given semantic rule. Neuroimaging findings of significant brain activation showed two main results: (1) Greater task-related activation changes for the repetition of the application of atypical rules relative to typical and functional rules, and (2) Changes (older > younger) in the inferior prefrontal regions for functional rules and more extensive and bilateral activations for typical and atypical rules. Regarding the inter-semantic rules comparison, only task-related activation differences were observed for functional > typical (e.g., inferior parietal and temporal regions bilaterally) and atypical > typical (e.g., prefrontal, inferior parietal, posterior temporal, and subcortical regions). Conclusion: These results suggest that healthy cognitive aging relies on the adaptive changes of inferior prefrontal resources involved in the repetitive execution of semantic rules, thus reflecting graded differences in support of task demands.

Heterochromatin characterization and ribosomal gene location in two monotypic genera of bloodsucker bugs (Cimicidae, Heteroptera) with holokinetic chromosomes and achiasmatic male meiosis.

PubMed

Poggio, M G; Di Iorio, O; Turienzo, P; Papeschi, A G; Bressa, M J

2014-12-01

Members of the family Cimicidae (Heteroptera: Cimicomorpha) are temporary bloodsuckers on birds and bats as primary hosts and humans as secondary hosts. Acanthocrios furnarii (2n=12=10+XY, male) and Psitticimex uritui (2n=31=28+X1X2Y, male) are two monotypic genera of the subfamily Haematosiphoninae, which have achiasmatic male meiosis of collochore type. Here, we examined chromatin organization and constitution of cimicid holokinetic chromosomes by determining the amount, composition and distribution of constitutive heterochromatin, and number and location of nucleolus organizer regions (NORs) in both species. Results showed that these two bloodsucker bugs possess high heterochromatin content and have an achiasmatic male meiosis, in which three regions can be differentiated in each autosomal bivalent: (i) terminal heterochromatic regions in repulsion; (ii) a central region, where the homologous chromosomes are located parallel but without contact between them; and (iii) small areas within the central region, where collochores are detected. Acanthocrios furnarii presented a single NOR on an autosomal pair, whereas P. uritui presented two NORs, one on an autosomal pair and the other on a sex chromosome. All NORs were found to be associated with CMA3 bright bands, indicating that the whole rDNA repeating unit is rich in G+C base pairs. Based on the variations in the diploid autosomal number, the presence of simple and multiple sex chromosome systems, and the number and location of 18S rDNA loci in the two Cimicidae species studied, we might infer that rDNA clusters and genome are highly dynamic among the representatives of this family.

The pair correlation function of krypton in the critical region: theory and experiment

NASA Astrophysics Data System (ADS)

Barocchi, F.; Chieux, P.; Fontana, R.; Magli, R.; Meroni, A.; Parola, A.; Reatto, L.; Tau, M.

1997-10-01

We present the results of high-precision measurements of the structure factor S(k) of krypton in the near-critical region of the liquid - vapour phase transition for values of k ranging from 1.5 up to 0953-8984/9/42/003/img15. The experimental results are compared with a theoretical calculation based on the hierarchical reference theory (HRT) with an accurate potential which includes two- and three-body contributions. The theory is based on a new implementation of HRT in which we avoid the use of hard spheres as a reference system. With this soft-core formulation we find a generally good agreement with experiments both at large k, where S(k) probes the short-range correlations, as well as at small k, where critical fluctuations become dominant. Also, for the density derivative of the pair correlation function there is an overall good agreement between theory and experiment.

Homology between Escherichia coli plasmids ColE1 and p15A.

PubMed Central

Bird, R E

1981-01-01

The location and extent of the homology between plasmids ColE1 and p15A were determined by analysis of heteroduplexes formed between them as well as with a related plasmid, pBR322, and by hybridization of radioactive deoxyribonucleic acids to restriction fragments of p15A and ColE1. The homology between the plasmids contained the entire region of ColE1 required for its replication as well as an additional 400 base pairs downstream from the origin of replication. This region on p15A, which was 980 +/- 43 base pairs, started at 0.1 of the molecular length from one end formed by cleavage with the restriction endonuclease BglI and extended to 0.54 of the molecular length from the same end. Restriction cleavage maps for the enzymes BglI, HpaI, HaeII, HaeIII, and HincII are also presented. Images PMID:6259130

NDI and DAN DNA: nucleic acid-directed assembly of NDI and DAN.

PubMed

Ikkanda, Brian A; Samuel, Stevan A; Iverson, Brent L

2014-03-07

Two novel DNA base surrogate phosphoramidites 1 and 2, based upon relatively electron-rich 1,5-dialkoxynaphthalene (DAN) and relatively electron-deficient 1,4,5,8-naphthalenetetracarboxylic diimide (NDI), respectively, were designed, synthesized, and incorporated into DNA oligonucleotide strands. The DAN and NDI artificial DNA bases were inserted within a three-base-pair region within the interior of a 12-mer oligonucleotide duplex in various sequential arrangements and investigated with CD spectroscopy and UV melting curve analysis. The CD spectra of the modified duplexes indicated B-form DNA topology. Melting curve analyses revealed trends in DNA duplex stability that correlate with the known association of DAN and NDI moieties in aqueous solution as well as the known favorable interactions between NDI and natural DNA base pairs. This demonstrates that DNA duplex stability and specificity can be driven by the electrostatic complementarity between DAN and NDI. In the most favorable case, an NDI-DAN-NDI arrangement in the middle of the DNA duplex was found to be approximately as stabilizing as three A-T base pairs.

Identification of a TAAT-containing motif required for high level expression of the COL1A1 promoter in differentiated osteoblasts of transgenic mice

NASA Technical Reports Server (NTRS)

Dodig, M.; Kronenberg, M. S.; Bedalov, A.; Kream, B. E.; Gronowicz, G.; Clark, S. H.; Mack, K.; Liu, Y. H.; Maxon, R.; Pan, Z. Z.;

Progression in disability and regional grey matter atrophy in relapsing-remitting multiple sclerosis.

PubMed

Hofstetter, Louis; Naegelin, Yvonne; Filli, Lukas; Kuster, Pascal; Traud, Stefan; Smieskova, Renata; Mueller-Lenke, Nicole; Kappos, Ludwig; Gass, Achim; Sprenger, Till; Penner, Iris-Katharina; Nichols, Thomas E; Vrenken, Hugo; Barkhof, Frederik; Polman, Chris; Radue, Ernst-Wilhelm; Borgwardt, Stefan J; Bendfeldt, Kerstin

2014-02-01

In multiple sclerosis (MS) regional grey matter (GM) atrophy has been associated with disability progression. The aim of this study was to compare regional GM volume changes in relapsing-remitting MS (RRMS) patients with progressive and stable disability, using voxel-based morphometry (VBM). We acquired baseline and 1-year follow-up 3-dimensional (3D) T1-weighted magnetic resonance imaging (MRI) data of RRMS patients, using two 1.5-Tesla scanners. Patients were matched pair-wise with respect to age, gender, disease duration, medication, scanner and baseline Expanded Disability Status Scale (EDSS) into 13 pairs, with either progressive EDSS (≥ 1 point change y(-1)) or stable EDSS, as well as into 29 pairs with either progressive Multiple Sclerosis Functional Composite (MSFC) at ≥ 0.25% decrease in y(-1) in any component, or stable MSFC. We analysed longitudinal regional differences in GM volumes in the progressive and stable EDSS and MSFC groups, respectively, using VBM. Significant GM volume reductions occurred in the right precuneus, in the progressive EDSS group. Differential between-group effects occurred in the right precuneus and in the postcentral gyrus. Further longitudinal GM volume reductions occurred in the right orbicular gyrus, in the progressive MSFC group, but no between-group differences were observed (non-stationary cluster-wise inference, all P(corrected) < 0.05). These results suggested a direct association of disability progression and regional GM atrophy in RRMS.

Environmental variability, historical contingency, and the structure of regional fish and macroinvertebrate faunas in Ouachita Mountain stream systems

Treesearch

Lance R. Williams; Christopher M. Taylor; Melvin L. Warren; J. Alan Clingenpeel

2003-01-01

In 1990-1992, the United States Forest Service sampled six hydrologically variable streams paired in three different drainage basins in the Ouachita Mountains, Arkansas, U.S.A. Fishes, macroinvertebrates, and stream environmental variables were quantified for each stream. We used these data to examine the relationship between regional faunas (based on taxonomy and...

Morphological and molecular differentiation of Staphylocystis clydesengeri n. sp. (Cestoda, Hymenolepididae) from the vagrant shrew, Sorex vagrans (Soricomorpha, Soricidae), in North America.

PubMed

Tkach, Vasyl V; Makarikov, Arseny A; Kinsella, John M

2013-01-01

Staphylocystis clydesengeri n. sp. is described from shrews Sorex vagrans in Montana and Washington, United States. It differs from the only previously known North American representative of the genus, S. schilleri, in having more numerous (37-42 vs. 22-30) and larger (39-44 microm vs. 27-30 microm) rostellar hooks. The two species also differ in several other important characters such as relative length of the cirrus pouch, position of gonads and shape of mature proglottides. Morphological differentiation of the new species from all previously known Palearctic species of Staphylocystis from Sorex is also provided. Differentiation from Staphylocystis parasitic in crocidurine shrews is not provided due to the high level of specificity among shrew hymenolepidids to the host genera and much greater levels of sequence divergence between Staphylocystis from the two groups of shrews. Molecular differentiation based on 2,800 base pair long sequences of nuclear ribosomal RNA (complete ITS region and partial 28S region), 663 base pair long sequences of mitochondrial nad1 gene and 542 base pair long sequences of mitochondrial ribosomal 16S gene strongly support the status of Staphylocystis clydesengeri n. sp. Relative utility of the DNA fragments used in this study for reliable differentiation among closely related species of mammalian hymenolepidids is discussed. Nuclear ribosomal RNA region appears to be too conserved for this purpose. Use of at least one mitochondrial gene in addition to nuclear ribosomal RNA or without it, is recommended. Vampirolepis novosibirskiensis Sawada & Kobayashi, 1994 is transferred to Staphylocystis as a junior synonym of S. furcara (Stieda, 1862). Rodentolepis gnoskei Greiman & Tkach, 2012 is transferred to Pararodentolepis Makarikov and Gulyaev, 2009 as a new combination Pararodentolepis gnoskei (Greiman & Tkach, 2012) n. comb.

A Region Tracking-Based Vehicle Detection Algorithm in Nighttime Traffic Scenes

PubMed Central

Wang, Jianqiang; Sun, Xiaoyan; Guo, Junbin

2013-01-01

The preceding vehicles detection technique in nighttime traffic scenes is an important part of the advanced driver assistance system (ADAS). This paper proposes a region tracking-based vehicle detection algorithm via the image processing technique. First, the brightness of the taillights during nighttime is used as the typical feature, and we use the existing global detection algorithm to detect and pair the taillights. When the vehicle is detected, a time series analysis model is introduced to predict vehicle positions and the possible region (PR) of the vehicle in the next frame. Then, the vehicle is only detected in the PR. This could reduce the detection time and avoid the false pairing between the bright spots in the PR and the bright spots out of the PR. Additionally, we present a thresholds updating method to make the thresholds adaptive. Finally, experimental studies are provided to demonstrate the application and substantiate the superiority of the proposed algorithm. The results show that the proposed algorithm can simultaneously reduce both the false negative detection rate and the false positive detection rate.

cis-Acting elements important for retroviral RNA packaging specificity.

PubMed

Beasley, Benjamin E; Hu, Wei-Shau

2002-05-01

Spleen necrosis virus (SNV) proteins can package RNA from distantly related murine leukemia virus (MLV), whereas MLV proteins cannot package SNV RNA efficiently. We used this nonreciprocal recognition to investigate regions of packaging signals that influence viral RNA encapsidation specificity. Although the MLV and SNV packaging signals (Psi and E, respectively) do not contain significant sequence homology, they both contain a pair of hairpins. This hairpin pair was previously proposed to be the core element in MLV Psi. In the present study, MLV-based vectors were generated to contain chimeric SNV/MLV packaging signals in which the hairpins were replaced with the heterologous counterpart. The interactions between these chimeras and MLV or SNV proteins were examined by virus replication and RNA analyses. SNV proteins recognized all of the chimeras, indicating that these chimeras were functional. We found that replacing the hairpin pair did not drastically alter the ability of MLV proteins to package these chimeras. These results indicate that, despite the important role of the hairpin pair in RNA packaging, it is not the major motif responsible for the ability of MLV proteins to discriminate between the MLV and SNV packaging signals. To determine the role of sequences flanking the hairpins in RNA packaging specificity, vectors with swapped flanking regions were generated and evaluated. SNV proteins packaged all of these chimeras efficiently. In contrast, MLV proteins strongly favored chimeras with the MLV 5'-flanking regions. These data indicated that MLV Gag recognizes multiple elements in the viral packaging signal, including the hairpin structure and flanking regions.

Preparation and analysis of multilayer composites based on polyelectrolyte complexes

NASA Astrophysics Data System (ADS)

Petrova, V. A.; Orekhov, A. S.; Chernyakov, D. D.; Baklagina, Yu. G.; Romanov, D. P.; Kononova, S. V.; Volod'ko, A. V.; Ermak, I. M.; Klechkovskaya, V. V.; Skorik, Yu. A.

2016-11-01

A method for preparing multilayer film composites based on chitosan has been developed by the example of polymer pairs: chitosan-hyaluronic acid, chitosan-alginic acid, and chitosan-carrageenan. The structure of the composite films is characterized by X-ray diffractometry and scanning electron microscopy. It is shown that the deposition of a solution of hyaluronic acid, alginic acid, or carrageenan on a chitosan gel film leads to the formation of a polyelectrolyte complex layer at the interface, which is accompanied by the ordering of chitosan chains in the surface region; the microstructure of this layer depends on the nature of contacting polymer pairs.

Base-unpaired regions in supercoiled replicative form DNA of coliphage M13

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dasgupta, S.; Allison, D.P.; Snyder, C.E.

Superhelical covalently closed circular replicative form DNA (RF I) of coliphage M13 appears as a relaxed molecule that has a base-unpaired region in the form of a bubble (100 to 200 base pairs long) seen in electron micrographs when spread in the presence of formaldehyde and formamide or after pretreatment with glyoxal. S1 endonuclease, specific for single-stranded DNA, converts superhelical M13 RF I DNA, but not nonsuperhelical M13 RF I to a significant extent, into unit-length linear molecules by sequential nicking of two strands. The locations of S1 nuclease-susceptible sites and glyoxal-fixed base-unpaired regions were both related to the fivemore » A-T-rich regions in M13 RF DNA. While S1 nuclease does not show preference for any of these sites, glyoxal-fixed bubbles occur predominantly at the major A-T-rich region in M13 RF DNA.« less

A small RNA activates CFA synthase by isoform-specific mRNA stabilization

PubMed Central

Fröhlich, Kathrin Sophie; Papenfort, Kai; Fekete, Agnes; Vogel, Jörg

2013-01-01

Small RNAs use a diversity of well-characterized mechanisms to repress mRNAs, but how they activate gene expression at the mRNA level remains not well understood. The predominant activation mechanism of Hfq-associated small RNAs has been translational control whereby base pairing with the target prevents the formation of an intrinsic inhibitory structure in the mRNA and promotes translation initiation. Here, we report a translation-independent mechanism whereby the small RNA RydC selectively activates the longer of two isoforms of cfa mRNA (encoding cyclopropane fatty acid synthase) in Salmonella enterica. Target activation is achieved through seed pairing of the pseudoknot-exposed, conserved 5′ end of RydC to an upstream region of the cfa mRNA. The seed pairing stabilizes the messenger, likely by interfering directly with RNase E-mediated decay in the 5′ untranslated region. Intriguingly, this mechanism is generic such that the activation is equally achieved by seed pairing of unrelated small RNAs, suggesting that this mechanism may be utilized in the design of RNA-controlled synthetic circuits. Physiologically, RydC is the first small RNA known to regulate membrane stability. PMID:24141880

A small RNA activates CFA synthase by isoform-specific mRNA stabilization.

PubMed

Fröhlich, Kathrin Sophie; Papenfort, Kai; Fekete, Agnes; Vogel, Jörg

2013-11-13

Small RNAs use a diversity of well-characterized mechanisms to repress mRNAs, but how they activate gene expression at the mRNA level remains not well understood. The predominant activation mechanism of Hfq-associated small RNAs has been translational control whereby base pairing with the target prevents the formation of an intrinsic inhibitory structure in the mRNA and promotes translation initiation. Here, we report a translation-independent mechanism whereby the small RNA RydC selectively activates the longer of two isoforms of cfa mRNA (encoding cyclopropane fatty acid synthase) in Salmonella enterica. Target activation is achieved through seed pairing of the pseudoknot-exposed, conserved 5' end of RydC to an upstream region of the cfa mRNA. The seed pairing stabilizes the messenger, likely by interfering directly with RNase E-mediated decay in the 5' untranslated region. Intriguingly, this mechanism is generic such that the activation is equally achieved by seed pairing of unrelated small RNAs, suggesting that this mechanism may be utilized in the design of RNA-controlled synthetic circuits. Physiologically, RydC is the first small RNA known to regulate membrane stability.

Properties of promoters cloned randomly from the Saccharomyces cerevisiae genome.

PubMed Central

Santangelo, G M; Tornow, J; McLaughlin, C S; Moldave, K

1988-01-01

Promoters were isolated at random from the genome of Saccharomyces cerevisiae by using a plasmid that contains a divergently arrayed pair of promoterless reporter genes. A comprehensive library was constructed by inserting random (DNase I-generated) fragments into the intergenic region upstream from the reporter genes. Simple in vivo assays for either reporter gene product (alcohol dehydrogenase or beta-galactosidase) allowed the rapid identification of promoters from among these random fragments. Poly(dA-dT) homopolymer tracts were present in three of five randomly cloned promoters. With two exceptions, each RNA start site detected was 40 to 100 base pairs downstream from a TATA element. All of the randomly cloned promoters were capable of activating reporter gene transcription bidirectionally. Interestingly, one of the promoter fragments originated in a region of the S. cerevisiae rDNA spacer; regulated divergent transcription (presumably by RNA polymerase II) initiated in the same region. Images PMID:2847031

High throughput pyrosequencing technology for molecular differential detection of Babesia vogeli, Hepatozoon canis, Ehrlichia canis and Anaplasma platys in canine blood samples.

PubMed

Kaewkong, Worasak; Intapan, Pewpan M; Sanpool, Oranuch; Janwan, Penchom; Thanchomnang, Tongjit; Kongklieng, Amornmas; Tantrawatpan, Chairat; Boonmars, Thidarut; Lulitanond, Viraphong; Taweethavonsawat, Piyanan; Chungpivat, Sudchit; Maleewong, Wanchai

2014-06-01

Canine babesiosis, hepatozoonosis, ehrlichiosis, and anaplasmosis are tick-borne diseases caused by different hemopathogens. These diseases are causes of morbidity and mortality in dogs. The classic method for parasite detection and differentiation is based on microscopic observation of blood smears. The limitations of the microscopic method are that its performance requires a specially qualified person with professional competence, and it is ineffective in differentiating closely related species. This study applied PCR amplification with high throughput pyrosequencing for molecular differential detection of the following 4 hemoparasites common to tropical areas in dog blood samples: Babesia vogeli, Hepatozoon canis, Ehrlichia canis, and Anaplasma platys. PCR was initially used to amplify specific target regions of the ribosomal RNA genes of each parasite using 2 primer pairs that included 18S rRNA for protozoa (B. vogeli and H. canis) and 16S rRNA for rickettsia (E. canis and A. platys). Babesia vogeli and H. canis were discriminated using 9 nucleotide positions out of 30 base pairs, whereas E. canis and A. platys were differentiated using 15 nucleotide positions out of 34 base pairs that were determined from regions adjacent to 3' ends of the sequencing primers. This method provides a challenging alternative for a rapid diagnosis and surveillance of these tick-borne diseases in canines. Copyright © 2014 Elsevier GmbH. All rights reserved.

Population Estimates, Conservation Concerns, and Management of Tropicbirds in the Western Atlantic

Treesearch

DAVID S. LEE; MARTHA WALSH-MCGEHEE

2000-01-01

Two species of tropicbirds (Phaethontidae) live in the Western North Atlantic. The Whitetailed Tropicbird of the region is an endemic race, Phaethon lepturus catesbyi, with approximately 5000 pairs. This is half the estimate made less than two decades ago. The Red-billed Tropicbird, P. aethereus, has approximately 2000 pairs regionally and fewer than 8000 pairs...

Virtually optimized insoles for offloading the diabetic foot: A randomized crossover study.

PubMed

Telfer, S; Woodburn, J; Collier, A; Cavanagh, P R

2017-07-26

Integration of objective biomechanical measures of foot function into the design process for insoles has been shown to provide enhanced plantar tissue protection for individuals at-risk of plantar ulceration. The use of virtual simulations utilizing numerical modeling techniques offers a potential approach to further optimize these devices. In a patient population at-risk of foot ulceration, we aimed to compare the pressure offloading performance of insoles that were optimized via numerical simulation techniques against shape-based devices. Twenty participants with diabetes and at-risk feet were enrolled in this study. Three pairs of personalized insoles: one based on shape data and subsequently manufactured via direct milling; and two were based on a design derived from shape, pressure, and ultrasound data which underwent a finite element analysis-based virtual optimization procedure. For the latter set of insole designs, one pair was manufactured via direct milling, and a second pair was manufactured through 3D printing. The offloading performance of the insoles was analyzed for forefoot regions identified as having elevated plantar pressures. In 88% of the regions of interest, the use of virtually optimized insoles resulted in lower peak plantar pressures compared to the shape-based devices. Overall, the virtually optimized insoles significantly reduced peak pressures by a mean of 41.3kPa (p<0.001, 95% CI [31.1, 51.5]) for milled and 40.5kPa (p<0.001, 95% CI [26.4, 54.5]) for printed devices compared to shape-based insoles. The integration of virtual optimization into the insole design process resulted in improved offloading performance compared to standard, shape-based devices. ISRCTN19805071, www.ISRCTN.org. Copyright © 2017 Elsevier Ltd. All rights reserved.

Repertoire of novel sequence signatures for the detection of Candidatus Liberibacter asiaticus by quantitative real-time PCR

PubMed Central

2014-01-01

Background Huanglongbing (HLB) or citrus greening is a devastating disease of citrus. The gram-negative bacterium Candidatus Liberibacter asiaticus (Las) belonging to the α-proteobacteria is responsible for HLB in North America as well as in Asia. Currently, there is no cure for this disease. Early detection and quarantine of Las-infected trees are important management strategies used to prevent HLB from invading HLB-free citrus producing regions. Quantitative real-time PCR (qRT-PCR) based molecular diagnostic assays have been routinely used in the detection and diagnosis of Las. The oligonucleotide primer pairs based on conserved genes or regions, which include 16S rDNA and the β-operon, have been widely employed in the detection of Las by qRT-PCR. The availability of whole genome sequence of Las now allows the design of primers beyond the conserved regions for the detection of Las explicitly. Results We took a complimentary approach by systematically screening the genes in a genome-wide fashion, to identify the unique signatures that are only present in Las by an exhaustive sequence based similarity search against the nucleotide sequence database. Our search resulted in 34 probable unique signatures. Furthermore, by designing the primer pair specific to the identified signatures, we showed that most of our primer sets are able to detect Las from the infected plant and psyllid materials collected from the USA and China by qRT-PCR. Overall, 18 primer pairs of the 34 are found to be highly specific to Las with no cross reactivity to the closely related species Ca. L. americanus (Lam) and Ca. L. africanus (Laf). Conclusions We have designed qRT-PCR primers based on Las specific genes. Among them, 18 are suitable for the detection of Las from Las-infected plant and psyllid samples. The repertoire of primers that we have developed and characterized in this study enhanced the qRT-PCR based molecular diagnosis of HLB. PMID:24533511

Karyotype differentiation of four Cestrum species (Solanaceae) revealed by fluorescent chromosome banding and FISH

PubMed Central

2009-01-01

The karyotypes of four South American species of Cestrum (C. capsulare,C. corymbosum,C. laevigatum and C. megalophylum) were studied using conventional staining, C-CMA/DAPI chromosome banding and FISH with 45S and 5S rDNA probes. The karyotypes showed a chromosome number of 2n = 2x = 16, with metacentric chromosomes, except for the eighth submeta- to acrocentric pair. Several types of heterochromatin were detected, which varied in size, number, distribution and base composition. The C-CMA+ bands and 45S rDNA were located predominantly in terminal regions. The C-CMA + /DAPI + bands appeared in interstitial and terminal regions, and the C-DAPI + bands were found in all chromosome regions. The 5S rDNA sites were observed on the long arm of pair 8 in all species except C. capsulare, where they were found in the paracentromeric region of the long arm of pair 4. The differences in band patterns among the species studied here, along with data from other nine species reported in the literature, suggest that the bands are dispersed in an equilocal and non-equilocal manner and that structural rearrangements can be responsible for internal karyotype diversification. However, it is important to point out that the structural changes involving repetitive segments did not culminate in substantial changes in the general karyotype structure concerning chromosome size and morphology. PMID:21637687

Genetic and environmental influences on mean diffusivity and volume in subcortical brain regions.

PubMed

Gillespie, Nathan A; Neale, Michael C; Hagler, Donald J; Eyler, Lisa T; Fennema-Notestine, Christine; Franz, Carol E; Lyons, Michael J; McEvoy, Linda K; Dale, Anders M; Panizzon, Matthew S; Kremen, William S

2017-05-01

Increased mean diffusivity (MD) is hypothesized to reflect tissue degeneration and may provide subtle indicators of neuropathology as well as age-related brain changes in the absence of volumetric differences. Our aim was to determine the degree to which genetic and environmental variation in subcortical MD is distinct from variation in subcortical volume. Data were derived from a sample of 387 male twins (83 MZ twin pairs, 55 DZ twin pairs, and 111 incomplete twin pairs) who were MRI scanned as part of the Vietnam Era Twin Study of Aging. Quantitative estimates of MD and volume for 7 subcortical regions were obtained: thalamus, caudate nucleus, putamen, pallidum, hippocampus, amygdala, and nucleus accumbens. After adjusting for covariates, bivariate twin models were fitted to estimate the size and significance of phenotypic, genotypic, and environmental correlations between MD and volume at each subcortical region. With the exception of the amygdala, familial aggregation in MD was entirely explained by additive genetic factors across all subcortical regions with estimates ranging from 46 to 84%. Based on bivariate twin modeling, variation in subcortical MD appears to be both genetically and environmentally unrelated to individual differences in subcortical volume. Therefore, subcortical MD may be an alternative biomarker of brain morphology for complex traits worthy of future investigation. Hum Brain Mapp 38:2589-2598, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

ATP hydrolysis provides functions that promote rejection of pairings between different copies of long repeated sequences

PubMed Central

Danilowicz, Claudia; Hermans, Laura; Coljee, Vincent; Prévost, Chantal

2017-01-01

Abstract During DNA recombination and repair, RecA family proteins must promote rapid joining of homologous DNA. Repeated sequences with >100 base pair lengths occupy more than 1% of bacterial genomes; however, commitment to strand exchange was believed to occur after testing ∼20–30 bp. If that were true, pairings between different copies of long repeated sequences would usually become irreversible. Our experiments reveal that in the presence of ATP hydrolysis even 75 bp sequence-matched strand exchange products remain quite reversible. Experiments also indicate that when ATP hydrolysis is present, flanking heterologous dsDNA regions increase the reversibility of sequence matched strand exchange products with lengths up to ∼75 bp. Results of molecular dynamics simulations provide insight into how ATP hydrolysis destabilizes strand exchange products. These results inspired a model that shows how pairings between long repeated sequences could be efficiently rejected even though most homologous pairings form irreversible products. PMID:28854739

Molecular electrostatics for probing lone pair-π interactions.

PubMed

Mohan, Neetha; Suresh, Cherumuttathu H; Kumar, Anmol; Gadre, Shridhar R

2013-11-14

An electrostatics-based approach has been proposed for probing the weak interactions between lone pair containing molecules and π deficient molecular systems. For electron-rich molecules, the negative minima in molecular electrostatic potential (MESP) topography give the location of electron localization and the MESP value at the minimum (Vmin) quantifies the electron-rich character of that region. Interactive behavior of a lone pair bearing molecule with electron deficient π-systems, such as hexafluorobenzene, 1,3,5-trinitrobenzene, 2,4,6-trifluoro-1,3,5-triazine and 1,2,4,5-tetracyanobenzene explored within DFT brings out good correlation of the lone pair-π interaction energy (E(int)) with the Vmin value of the electron-rich system. Such interaction is found to be portrayed well with the Electrostatic Potential for Intermolecular Complexation (EPIC) model. On the basis of the precise location of MESP minimum, a prediction for the orientation of a lone pair bearing molecule with an electron deficient π-system is possible in the majority of the cases studied.

Sequetyping: Serotyping Streptococcus pneumoniae by a Single PCR Sequencing Strategy

PubMed Central

Leung, Marcus H.; Bryson, Kevin; Freystatter, Kathrin; Pichon, Bruno; Edwards, Giles; Gillespie, Stephen H.

2012-01-01

The introduction of pneumococcal conjugate vaccines necessitates continued monitoring of circulating strains to assess vaccine efficacy and replacement serotypes. Conventional serological methods are costly, labor-intensive, and prone to misidentification, while current DNA-based methods have limited serotype coverage requiring multiple PCR primers. In this study, a computer algorithm was developed to interrogate the capsulation locus (cps) of vaccine serotypes to locate primer pairs in conserved regions that border variable regions and could differentiate between serotypes. In silico analysis of cps from 92 serotypes indicated that a primer pair spanning the regulatory gene cpsB could putatively amplify 84 serotypes and differentiate 46. This primer set was specific to Streptococcus pneumoniae, with no amplification observed for other species, including S. mitis, S. oralis, and S. pseudopneumoniae. One hundred thirty-eight pneumococcal strains covering 48 serotypes were tested. Of 23 vaccine serotypes included in the study, most (19/22, 86%) were identified correctly at least to the serogroup level, including all of the 13-valent conjugate vaccine and other replacement serotypes. Reproducibility was demonstrated by the correct sequetyping of different strains of a serotype. This novel sequence-based method employing a single PCR primer pair is cost-effective and simple. Furthermore, it has the potential to identify new serotypes that may evolve in the future. PMID:22553238

AB INITIO PULSAR MAGNETOSPHERE: THREE-DIMENSIONAL PARTICLE-IN-CELL SIMULATIONS OF OBLIQUE PULSARS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Philippov, Alexander A.; Spitkovsky, Anatoly; Cerutti, Benoit, E-mail: sashaph@princeton.edu

2015-03-01

We present “first-principles” relativistic particle-in-cell simulations of the oblique pulsar magnetosphere with pair formation. The magnetosphere starts to form with particles extracted from the surface of the neutron star. These particles are accelerated by surface electric fields and emit photons capable of producing electron–positron pairs. We inject secondary pairs at the locations of primary energetic particles whose energy exceeds the threshold for pair formation. We find solutions that are close to the ideal force-free magnetosphere with the Y-point and current sheet. Solutions with obliquities ≤40° do not show pair production in the open field line region because the local currentmore » density along the magnetic field is below the Goldreich–Julian value. The bulk outflow in these solutions is charge-separated, and pair formation happens in the current sheet and return current layer only. Solutions with higher inclinations show pair production in the open field line region, with high multiplicity of the bulk flow and the size of the pair-producing region increasing with inclination. We observe the spin-down of the star to be comparable to MHD model predictions. The magnetic dissipation in the current sheet ranges between 20% for the aligned rotator and 3% for the orthogonal rotator. Our results suggest that for low obliquity neutron stars with suppressed pair formation at the light cylinder, the presence of phenomena related to pair activity in the bulk of the polar region, e.g., radio emission, may crucially depend on the physics beyond our simplified model, such as the effects of curved spacetime or multipolar surface fields.« less

Copy Number Variations in Tilapia Genomes.

PubMed

Li, Bi Jun; Li, Hong Lian; Meng, Zining; Zhang, Yong; Lin, Haoran; Yue, Gen Hua; Xia, Jun Hong

2017-02-01

Discovering the nature and pattern of genome variation is fundamental in understanding phenotypic diversity among populations. Although several millions of single nucleotide polymorphisms (SNPs) have been discovered in tilapia, the genome-wide characterization of larger structural variants, such as copy number variation (CNV) regions has not been carried out yet. We conducted a genome-wide scan for CNVs in 47 individuals from three tilapia populations. Based on 254 Gb of high-quality paired-end sequencing reads, we identified 4642 distinct high-confidence CNVs. These CNVs account for 1.9% (12.411 Mb) of the used Nile tilapia reference genome. A total of 1100 predicted CNVs were found overlapping with exon regions of protein genes. Further association analysis based on linear model regression found 85 CNVs ranging between 300 and 27,000 base pairs significantly associated to population types (R 2  > 0.9 and P > 0.001). Our study sheds first insights on genome-wide CNVs in tilapia. These CNVs among and within tilapia populations may have functional effects on phenotypes and specific adaptation to particular environments.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Petrova, V. A.; Orekhov, A. S.; Chernyakov, D. D.

A method for preparing multilayer film composites based on chitosan has been developed by the example of polymer pairs: chitosan–hyaluronic acid, chitosan–alginic acid, and chitosan–carrageenan. The structure of the composite films is characterized by X-ray diffractometry and scanning electron microscopy. It is shown that the deposition of a solution of hyaluronic acid, alginic acid, or carrageenan on a chitosan gel film leads to the formation of a polyelectrolyte complex layer at the interface, which is accompanied by the ordering of chitosan chains in the surface region; the microstructure of this layer depends on the nature of contacting polymer pairs.

The immunoglobulin heavy chain locus of the duck. Genomic organization and expression of D, J, and C region genes.

PubMed

Lundqvist, M L; Middleton, D L; Hazard, S; Warr, G W

2001-12-14

The region of the duck IgH locus extending from upstream of the proximal diversity (D) segment to downstream of the constant gene cluster has been cloned and mapped. A sequence contig of 48,796 base pairs established that the organization of the genes is D-J(H)-mu-alpha-upsilon. No evidence for a functional homologue (or remnant) of a delta gene was found. The alpha gene is in inverted transcriptional orientation; class switch to IgA expression thus requires inversion of the approximately 27-kilobase pair region that includes both mu and alpha genes. The secreted forms of duck alpha and mu are each encoded by 4 constant region exons, and the hydrophobic C-terminal regions of the membrane receptor forms of alpha and mu are encoded by one and two transmembrane exons, respectively. Putative switch (S) regions were identified for duck mu and upsilon by comparison with chicken Smu and Supsilon sequences and for duck alpha by comparison with mouse Salpha. The duck IgH locus is rich in complex variable number tandem repeats, which occupy approximately 60% of the sequenced region, and occur at a much higher frequency in the IgH locus than in other sequenced regions of the duck genome.

Search for exclusive or semi-exclusive γγ production and observation of exclusive and semi-exclusive e +e - production in pp collisions at $$ \\sqrt{s}=7 $$ TeV

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chatrchyan, S.; Khachatryan, V.; Sirunyan, A. M.

A search for exclusive or semi-exclusive photon pair production, pp to p(*) + photon pair + p(*) (where p(*) stands for a diffractively-dissociated proton), and the observation of exclusive and semi-exclusive electron pair production, pp to p(*) + ee + p(*), in proton-proton collisions at sqrt(s) = 7 TeV, are presented. The analysis is based on a data sample corresponding to an integrated luminosity of 36 inverse picobarns recorded by the CMS experiment at the LHC at low instantaneous luminosities. Candidate photon pair or electron pair events are selected by requiring the presence of two photons or a positron andmore » an electron, each with transverse energy ET > 5.5 GeV and pseudorapidity abs(eta) < 2.5, and no other particles in the region abs(eta) < 5.2. No exclusive or semi-exclusive diphoton candidates are found in the data. An upper limit on the cross section for the reaction pp to p(*) + photon pair + p(*), within the above kinematic selections, is set at 1.18 pb at 95% confidence level. Seventeen exclusive or semi-exclusive dielectron candidates are observed, with an estimated background of 0.85 +/- 0.28 (stat.) events, in agreement with the QED-based prediction of 16.3 +/- 1.3 (syst.) events.« less

The structure of the human interferon alpha/beta receptor gene.

PubMed

Lutfalla, G; Gardiner, K; Proudhon, D; Vielh, E; Uzé, G

1992-02-05

Using the cDNA coding for the human interferon alpha/beta receptor (IFNAR), the IFNAR gene has been physically mapped relative to the other loci of the chromosome 21q22.1 region. 32,906 base pairs covering the IFNAR gene have been cloned and sequenced. Primer extension and solution hybridization-ribonuclease protection have been used to determine that the transcription of the gene is initiated in a broad region of 20 base pairs. Some aspects of the polymorphism of the gene, including noncoding sequences, have been analyzed; some are allelic differences in the coding sequence that induce amino acid variations in the resulting protein. The exon structure of the IFNAR gene and of that of the available genes for the receptors of the cytokine/growth hormone/prolactin/interferon receptor family have been compared with the predictions for the secondary structure of those receptors. From this analysis, we postulate a common origin and propose an hypothesis for the divergence from the immunoglobulin superfamily.

Norrie disease gene sequence variants in an ethnically diverse population with retinopathy of prematurity.

PubMed

Hutcheson, Kelly A; Paluru, Prasuna C; Bernstein, Steven L; Koh, Jamie; Rappaport, Eric F; Leach, Richard A; Young, Terri L

2005-07-14

Retinopathy of prematurity (ROP) is a leading cause of visual loss in the pediatric population. Mutations in the Norrie disease gene (NDP) are associated with heritable retinal vascular disorders, and have been found in a small subset of patients with severe retinopathy of prematurity. Varying rates of progression to threshold disease in different races may have a genetic basis, as recent studies suggest that the incidence of NDP mutations may vary in different groups. African Americans, for example, are less likely to develop severe degrees of ROP. We screened a large cohort of ethnically diverse patients for mutations in the entire NDP. A total of 143 subjects of different ethnic backgrounds were enrolled in the study. Fifty-four patients had severe ROP (Stage 3 or worse). Of these, 38 were threshold in at least one eye (with a mean gestational age of 26.1 weeks and mean birth weight of 788.4 g). There were 36 patients with mild or no ROP, 31 parents with no history of retinal disease or prematurity, and 22 wild type (normal) controls. There were 70 African American subjects, 55 Caucasians, and 18 of other races. Severe ROP was noted in 29 African American subjects, 17 Caucasians, and 8 of other races. Seven polymerase chain reaction primer pairs spanning the NDP were optimized for denaturing high performance liquid chromatography and direct sequencing. Three primer pairs covered the coding region, and the remaining four spanned the 3' and 5' untranslated regions (UTR). Six of 54 (11%) infants with severe ROP had polymorphisms in the NDP. Five of the infants were African American, and one was Caucasian. Two parents were heterozygous for the same polymorphism as their child. One parent-child pair had a single base pair (bp) insertion in the 3' UTR region. Another parent-child pair had two mutations: a 14 bp deletion in the 5' UTR region of exon 1 and a single nucleotide polymorphism in the 5' UTR region of exon 2. No coding region sequence changes were found. No polymorphisms were observed in infants with mild or no ROP, or in the wild type controls. Of the six sequence alterations found, five were novel nucleotide changes: One in the 5' UTR region of exon 2, and four in the 3' UTR region of exon 3. The extent of NDP polymorphisms in this large, racially diverse group of infants is moderate. NDP polymorphisms may play a role in the pathogenesis of ROP, but do not appear to be a major causative factor.

The 5΄ UTR of the type I toxin ZorO can both inhibit and enhance translation

PubMed Central

Wen, Jia; Harp, John R.

2017-01-01

Abstract Many bacterial type I toxin mRNAs possess a long 5΄ untranslated region (UTR) that serves as the target site of the corresponding antitoxin sRNA. This is the case for the zorO-orzO type I system where the OrzO antitoxin base pairs to the 174-nucleotide zorO 5΄ UTR. Here, we demonstrate that the full-length 5΄ UTR of the zorO type I toxin hinders its own translation independent of the sRNA whereas a processed 5΄ UTR (zorO Δ28) promotes translation. The full-length zorO 5΄ UTR folds into an extensive secondary structure sequestering the ribosome binding site (RBS). Processing of the 5΄ UTR does not alter the RBS structure, but opens a large region (EAP region) located upstream of the RBS. Truncation of this EAP region impairs zorO translation, but this defect can be rescued upon exposing the RBS. Additionally, the region spanning +35 to +50 of the zorO mRNA is needed for optimal translation of zorO. Importantly, the positive and negative effects on translation imparted by the 5΄ UTR can be transferred onto a reporter gene, indicative that the 5΄ UTR can solely drive regulation. Moreover, we show that the OrzO sRNA can inhibit zorO translation via base pairing to the of the EAP region. PMID:27903909

Ligand-mediated and tertiary interactions cooperatively stabilize the P1 region in the guanine-sensing riboswitch

PubMed Central

Hanke, Christian A.

2017-01-01

Riboswitches are genetic regulatory elements that control gene expression depending on ligand binding. The guanine-sensing riboswitch (Gsw) binds ligands at a three-way junction formed by paired regions P1, P2, and P3. Loops L2 and L3 cap the P2 and P3 helices and form tertiary interactions. Part of P1 belongs to the switching sequence dictating the fate of the mRNA. Previous studies revealed an intricate relationship between ligand binding and presence of the tertiary interactions, and between ligand binding and influence on the P1 region. However, no information is available on the interplay among these three main regions in Gsw. Here we show that stabilization of the L2-L3 region by tertiary interactions, and the ligand binding site by ligand binding, cooperatively influences the structural stability of terminal base pairs in the P1 region in the presence of Mg2+ ions. The results are based on molecular dynamics simulations with an aggregate simulation time of ~10 μs across multiple systems of the unbound state of the Gsw aptamer and a G37A/C61U mutant, and rigidity analyses. The results could explain why the three-way junction is a central structural element also in other riboswitches and how the cooperative effect could become contextual with respect to intracellular Mg2+ concentration. The results suggest that the transmission of allosteric information to P1 can be entropy-dominated. PMID:28640851

The Bradyrhizobium japonicum nolA gene and its involvement in the genotype-specific nodulation of soybeans.

PubMed Central

Sadowsky, M J; Cregan, P B; Gottfert, M; Sharma, A; Gerhold, D; Rodriguez-Quinones, F; Keyser, H H; Hennecke, H; Stacey, G

1991-01-01

Several soybean genotypes have been identified which specifically exclude nodulation by members of Bradyrhizobium japonicum serocluster 123. We have identified and sequenced a DNA region from B. japonicum strain USDA 110 which is involved in genotype-specific nodulation of soybeans. This 2.3-kilobase region, cloned in pMJS12, allows B. japonicum serocluster 123 isolates to form nodules on plants of serogroup 123-restricting genotypes. The nodules, however, were ineffective for symbiotic nitrogen fixation. The nodulation-complementing region is located approximately 590 base pairs transcriptionally downstream from nodD2. The 5' end of pMJS12 contains a putative open reading frame (ORF) of 710 base pairs, termed nolA. Transposon Tn3-HoHo mutations only within the ORF abolished nodulation complementation. The N terminus of the predicted nolA gene product has strong similarity with the N terminus of MerR, the regulator of mercury resistance genes. Translational lacZ fusion experiments indicated that nolA was moderately induced by soybean seed extract and the isoflavone genistein. Restriction fragments that hybridize to pMJS12 were detected in genomic DNAs from both nodulation-restricted and -unrestricted strains. PMID:1988958

Particle Number Conserving Approach to the Collective States in a Small Fermi-System

NASA Astrophysics Data System (ADS)

Glick, Jennifer; Zelevinsky, Vladimir

2014-03-01

The standard Bardeen-Cooper-Schrieffer (BCS) description of pairing theory, random phase approximation (RPA) and Hartree-Fock-Bogoliubov (HFB) methods, routinely used in macroscopic many-body physics when the dimension of the Hamiltonian matrix is prohibitively large, include features which are not well suited to describe mesoscopic systems such as nuclei or cold atoms in traps. Two important disadvantages are the non-conservation of exact particle number through the introduction of quasiparticles, and the absence of a non-trivial paired solution in the discrete spectrum with weak pairing. We develop the pairing theory based on the exact particle number conservation, whose first applications to the ground state physics presented in [A. Volya and V. Zelevinsky, in 50 Years of Nuclear BCS, World Scientific, 2012] demonstrated that such an approach avoids well known deficiencies of the standard treatment, especially in the region of weak pairing. Now, we use the method for low-lying collective excitations which in many cases are even more sensitive to conservation laws. We show that the RPA version based on solving the operator equations of motion is reduced to the set of recurrence relations for neighboring systems which precisely conserve the exact particle number. Supported by the NSF grant PHY-1068217.

X-ray-structure of a cytidylyl-3',5'-adenosine-proflavine complex: a self-paired parallel-chain double helical dimer with an intercalated acridine dye.

PubMed Central

Westhof, E; Sundaralingam, M

1980-01-01

The non-self-complementary dinucleoside monophosphate cytidylyl-3',5'-adenosine (CpA) forms a base-paired parallel-chain dimer with an intercalated proflavine. The dimer complex possesses a right-handed helical twist. The dimer helix has an irregular girth with a neutral adenine-adenine (A-A) pair, hydrogen-bonded through the N6 and N7 sites (C1'...C1' separation of 10.97 A), and a triply hydrogen-bonded protonated cytosine-cytosine (C-C) pair with a proton shared between the base N3 sites (Cl'...Cl' separation of 9.59 A). The torsion angles of the sugar-phosphate backbone are within their most preferred ranges and the sugar puckering sequence (5' leads to 3') is C3'-endo, C2'-endo. There is also a second proflavine molecule sandwiched between CpA dimers on the 21-axis. Both proflavines are necessarily disordered, being on dyad axis, and this suggests possible insights into the dynamics of intercalation of planar drugs. This structure shows that intercalation of planar drugs in nucleic acids may not be restricted to antiparallel complementary Watson-Crick pairing regions and provides additional mechanisms for acridine mutagenesis. PMID:6929524

Analysis of low flows and selected methods for estimating low-flow characteristics at partial-record and ungaged stream sites in western Washington

USGS Publications Warehouse

Curran, Christopher A.; Eng, Ken; Konrad, Christopher P.

2012-01-01

Regional low-flow regression models for estimating Q7,10 at ungaged stream sites are developed from the records of daily discharge at 65 continuous gaging stations (including 22 discontinued gaging stations) for the purpose of evaluating explanatory variables. By incorporating the base-flow recession time constant τ as an explanatory variable in the regression model, the root-mean square error for estimating Q7,10 at ungaged sites can be lowered to 72 percent (for known values of τ), which is 42 percent less than if only basin area and mean annual precipitation are used as explanatory variables. If partial-record sites are included in the regression data set, τ must be estimated from pairs of discharge measurements made during continuous periods of declining low flows. Eight measurement pairs are optimal for estimating τ at partial-record sites, and result in a lowering of the root-mean square error by 25 percent. A low-flow survey strategy that includes paired measurements at partial-record sites requires additional effort and planning beyond a standard strategy, but could be used to enhance regional estimates of τ and potentially reduce the error of regional regression models for estimating low-flow characteristics at ungaged sites.

Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis.

PubMed

Brovarets, Ol'ha O; Hovorun, Dmytro M

2014-01-01

Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H-bonds in the А·Т base pair are cooperative, reinforcing each other, whereas the C2H⋯O2 H-bond in the А(∗)·Т(∗) base pair behaves anticooperatively, in other words it gets weakened while two others get strengthened. From a quantum-mechanical point of view, the A(∗)·T(∗) Löwdin's base pair appeared to be dynamically unstable because the electronic energy of the back-reaction barrier of the A·T → A(∗)·T(∗) tautomerization does not exceed zero-point vibrational energy associated with the mode for which vibrational frequency becomes imaginary in the TS of tautomerization. Additionally, it was demonstrated using the conductor-like polarizable continuum model that the effects of biomolecular environment (ϵ = 4) cannot ensure dynamic stabilization of the A(∗)·T(∗) Löwdin's base pair. These findings, together with data available from the literature, indicate that the tautomerization of the A·T Watson-Crick base pair to the A(∗)·T(∗) Löwdin's base pair through the DPT cannot be a source of spontaneous point errors that occur during DNA replication.

Phytoplasma-specific PCR primers based on sequences of the 16S-23S rRNA spacer region.

PubMed Central

Smart, C D; Schneider, B; Blomquist, C L; Guerra, L J; Harrison, N A; Ahrens, U; Lorenz, K H; Seemüller, E; Kirkpatrick, B C

1996-01-01

In order to develop a diagnostic tool to identify phytoplasmas and classify them according to their phylogenetic group, we took advantage of the sequence diversity of the 16S-23S intergenic spacer regions (SRs) of phytoplasmas. Ten PCR primers were developed from the SR sequences and were shown to amplify in a group-specific fashion. For some groups of phytoplasmas, such as elm yellows, ash yellows, and pear decline, the SR primer was paired with a specific primer from within the 16S rRNA gene. Each of these primer pairs was specific for a specific phytoplasma group, and they did not produce PCR products of the correct size from any other phytoplasma group. One primer was designed to anneal within the conserved tRNA(Ile) and, when paired with a universal primer, amplified all phytoplasmas tested. None of the primers produced PCR amplification products of the correct size from healthy plant DNA. These primers can serve as effective tools for identifying particular phytoplasmas in field samples. PMID:8702291

Chromosomal stasis in distinct families of marine Percomorpharia from South Atlantic.

PubMed

Paim, Fabilene Gomes; Almeida, Leandro Aragão da Hora; Affonso, Paulo Roberto Antunes de Mello; Sobrinho-Scudeler, Patrícia Elda; Oliveira, Claudio; Diniz, Débora

2017-01-01

The weakness of physical barriers in the marine environment and the dispersal potential of fish populations have been invoked as explanations of the apparent karyotype stasis of marine Percomorpha, but several taxa remain poorly studied cytogenetically. To increase the chromosomal data in this fish group, we analyzed cytogenetically three widespread Atlantic species from distinct families: Chaetodipterus faber Broussonet, 1782 (Ephippidae), Lutjanus synagris Linnaeus, 1758 (Lutjanidae) and Rypticus randalli Courtenay, 1967 (Serranidae). The three species shared a karyotype composed of 2n=48 acrocentric chromosomes, single nucleolus organizer regions (NORs) and reduced amounts of centromeric heterochromatin. A single NOR-bearing pair was identified in all species by physical mapping of 18S rDNA while non-syntenic 5S rRNA genes were located at centromeric region of a single pair. The similar karyotypic macrostructure observed in unrelated groups of Percomorpharia reinforces the conservative karyoevolution of marine teleosteans. Nonetheless, the species could be differentiated based on the pair bearing ribosomal cistrons, revealing the importance of microstructural analyses in species with symmetric and stable karyotypes.

PolyU tail of rho-independent terminator of bacterial small RNAs is essential for Hfq action.

PubMed

Otaka, Hironori; Ishikawa, Hirokazu; Morita, Teppei; Aiba, Hiroji

2011-08-09

Major bacterial small RNAs (sRNAs) regulate the translation and stability of target mRNAs through base pairing with the help of the RNA chaperone Hfq. The Hfq-dependent sRNAs consist of three basic elements, mRNA base-pairing region, Hfq-binding site, and rho-independent terminator. Although the base-pairing region and the terminator are well documented in many sRNAs, the Hfq-binding site is less well-defined except that Hfq binds RNA with a preference for AU-rich sequences. Here, we performed mutational and biochemical studies to define the sRNA site required for Hfq action using SgrS as a model sRNA. We found that shortening terminator polyU tail eliminates the ability of SgrS to bind to Hfq and to silence ptsG mRNA. We also demonstrate that the SgrS terminator can be replaced with any foreign rho-independent terminators possessing a polyU tail longer than 8 without losing the ability to silence ptsG mRNA in an Hfq-dependent manner. Moreover, we found that shortening the terminator polyU tail of several other sRNAs also eliminates the ability to bind to Hfq and to regulate target mRNAs. We conclude that the polyU tail of sRNAs is essential for Hfq action in general. The data also indicate that the terminator polyU tail plays a role in Hfq-dependent stabilization of sRNAs.

PolyU tail of rho-independent terminator of bacterial small RNAs is essential for Hfq action

PubMed Central

Otaka, Hironori; Ishikawa, Hirokazu; Morita, Teppei; Aiba, Hiroji

2011-01-01

Major bacterial small RNAs (sRNAs) regulate the translation and stability of target mRNAs through base pairing with the help of the RNA chaperone Hfq. The Hfq-dependent sRNAs consist of three basic elements, mRNA base-pairing region, Hfq-binding site, and rho-independent terminator. Although the base-pairing region and the terminator are well documented in many sRNAs, the Hfq-binding site is less well-defined except that Hfq binds RNA with a preference for AU-rich sequences. Here, we performed mutational and biochemical studies to define the sRNA site required for Hfq action using SgrS as a model sRNA. We found that shortening terminator polyU tail eliminates the ability of SgrS to bind to Hfq and to silence ptsG mRNA. We also demonstrate that the SgrS terminator can be replaced with any foreign rho-independent terminators possessing a polyU tail longer than 8 without losing the ability to silence ptsG mRNA in an Hfq-dependent manner. Moreover, we found that shortening the terminator polyU tail of several other sRNAs also eliminates the ability to bind to Hfq and to regulate target mRNAs. We conclude that the polyU tail of sRNAs is essential for Hfq action in general. The data also indicate that the terminator polyU tail plays a role in Hfq-dependent stabilization of sRNAs. PMID:21788484

Differing Requirements for RAD51 and DMC1 in Meiotic Pairing of Centromeres and Chromosome Arms in Arabidopsis thaliana

PubMed Central

Da Ines, Olivier; Abe, Kiyomi; Goubely, Chantal; Gallego, Maria Eugenia; White, Charles I.

2012-01-01

During meiosis homologous chromosomes pair, recombine, and synapse, thus ensuring accurate chromosome segregation and the halving of ploidy necessary for gametogenesis. The processes permitting a chromosome to pair only with its homologue are not fully understood, but successful pairing of homologous chromosomes is tightly linked to recombination. In Arabidopsis thaliana, meiotic prophase of rad51, xrcc3, and rad51C mutants appears normal up to the zygotene/pachytene stage, after which the genome fragments, leading to sterility. To better understand the relationship between recombination and chromosome pairing, we have analysed meiotic chromosome pairing in these and in dmc1 mutant lines. Our data show a differing requirement for these proteins in pairing of centromeric regions and chromosome arms. No homologous pairing of mid-arm or distal regions was observed in rad51, xrcc3, and rad51C mutants. However, homologous centromeres do pair in these mutants and we show that this does depend upon recombination, principally on DMC1. This centromere pairing extends well beyond the heterochromatic centromere region and, surprisingly, does not require XRCC3 and RAD51C. In addition to clarifying and bringing the roles of centromeres in meiotic synapsis to the fore, this analysis thus separates the roles in meiotic synapsis of DMC1 and RAD51 and the meiotic RAD51 paralogs, XRCC3 and RAD51C, with respect to different chromosome domains. PMID:22532804

Staged membrane oxidation reactor system

DOEpatents

Repasky, John Michael; Carolan, Michael Francis; Stein, VanEric Edward; Chen, Christopher Ming-Poh

2014-05-20

Ion transport membrane oxidation system comprising (a) two or more membrane oxidation stages, each stage comprising a reactant zone, an oxidant zone, one or more ion transport membranes separating the reactant zone from the oxidant zone, a reactant gas inlet region, a reactant gas outlet region, an oxidant gas inlet region, and an oxidant gas outlet region; (b) an interstage reactant gas flow path disposed between each pair of membrane oxidation stages and adapted to place the reactant gas outlet region of a first stage of the pair in flow communication with the reactant gas inlet region of a second stage of the pair; and (c) one or more reactant interstage feed gas lines, each line being in flow communication with any interstage reactant gas flow path or with the reactant zone of any membrane oxidation stage receiving interstage reactant gas.

Staged membrane oxidation reactor system

DOEpatents

Repasky, John Michael; Carolan, Michael Francis; Stein, VanEric Edward; Chen, Christopher Ming-Poh

2013-04-16

Ion transport membrane oxidation system comprising (a) two or more membrane oxidation stages, each stage comprising a reactant zone, an oxidant zone, one or more ion transport membranes separating the reactant zone from the oxidant zone, a reactant gas inlet region, a reactant gas outlet region, an oxidant gas inlet region, and an oxidant gas outlet region; (b) an interstage reactant gas flow path disposed between each pair of membrane oxidation stages and adapted to place the reactant gas outlet region of a first stage of the pair in flow communication with the reactant gas inlet region of a second stage of the pair; and (c) one or more reactant interstage feed gas lines, each line being in flow communication with any interstage reactant gas flow path or with the reactant zone of any membrane oxidation stage receiving interstage reactant gas.

Staged membrane oxidation reactor system

DOEpatents

Repasky, John Michael; Carolan, Michael Francis; Stein, VanEric Edward; Chen, Christopher Ming-Poh

2012-09-11

Ion transport membrane oxidation system comprising (a) two or more membrane oxidation stages, each stage comprising a reactant zone, an oxidant zone, one or more ion transport membranes separating the reactant zone from the oxidant zone, a reactant gas inlet region, a reactant gas outlet region, an oxidant gas inlet region, and an oxidant gas outlet region; (b) an interstage reactant gas flow path disposed between each pair of membrane oxidation stages and adapted to place the reactant gas outlet region of a first stage of the pair in flow communication with the reactant gas inlet region of a second stage of the pair; and (c) one or more reactant interstage feed gas lines, each line being in flow communication with any interstage reactant gas flow path or with the reactant zone of any membrane oxidation stage receiving interstage reactant gas.

Genetic Variation among Major Human Geographic Groups Supports a Peculiar Evolutionary Trend in PAX9

PubMed Central

Paixão-Côrtes, Vanessa R.; Meyer, Diogo; Pereira, Tiago V.; Mazières, Stéphane; Elion, Jacques; Krishnamoorthy, Rajagopal; Zago, Marco A.; Silva, Wilson A.; Salzano, Francisco M.; Bortolini, Maria Cátira

2011-01-01

A total of 172 persons from nine South Amerindian, three African and one Eskimo populations were studied in relation to the Paired box gene 9 (PAX9) exon 3 (138 base pairs) as well as its 5′and 3′flanking intronic segments (232 bp and 220 bp, respectively) and integrated with the information available for the same genetic region from individuals of different geographical origins. Nine mutations were scored in exon 3 and six in its flanking regions; four of them are new South American tribe-specific singletons. Exon3 nucleotide diversity is several orders of magnitude higher than its intronic regions. Additionally, a set of variants in the PAX9 and 101 other genes related with dentition can define at least some dental morphological differences between Sub-Saharan Africans and non-Africans, probably associated with adaptations after the modern human exodus from Africa. Exon 3 of PAX9 could be a good molecular example of how evolvability works. PMID:21298044

The role of spatial organization in preference for color pairs.

PubMed

Schloss, Karen B; Palmer, Stephen E

2011-01-01

We investigated how spatial organization influences color-pair preference asymmetries: differential preference for one color pair over another when the pairs contain the same colors in opposite spatial configurations. Schloss and Palmer (2011, Attention, Perception, & Psychophysics 73 55-571) found weak figure ground preference asymmetries for small squares centered on large squares in aesthetic ratings. Here, we found robust preference asymmetries using a more sensitive forced-choice task: participants strongly prefer pairs with yellower, lighter figures on bluer, darker grounds (experiment 1). We also investigated which spatial factors influence these preference asymmetries. Relative area of the two component regions is clearly important, and perceived 3-D area of the 2-D displays (ie after the ground is amodally completed behind the figure) is more influential than 2-D area (experiment 2). Surroundedness is not required, because yellowness blueness effects were comparable for pairs in which the figure was surrounded by the ground, and for mosaic arrangements in which the regions were adjacent and separated by a gap (experiment 3). Lightness darkness effects, however, were opposite for figure ground versus mosaic organizations: people prefer figure-ground organizations in which smaller regions are lighter, but prefer mosaic organizations in which smaller regions are darker. Physiological, phenomenological, and ecological explanations of the reported results are discussed.

Schizophrenia: A genome scan targets chromosomes 3p and 8p as potential sites of susceptibility genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pulver, A.E.; Lasseter, V.K.; Kasch, L.

Using a systematically ascertained sample of 57 families, each having 2 or more members with a consensus diagnosis of schizophrenia (DSM-III-R criteria), we have carried out linkage studies of 520 loci, covering approximately 70% of the genome for susceptibility loci for schizophrenia. A two-stage strategy based on lod score thresholds from simulation studies of our sample identified regions for further exploration. In each region, a dense map of highly informative dinucleotide repeat polymorphisms (heterozygosity greater than .70) was analyzed using dominant, recessive, and {open_quotes}affected only{close_quotes} models and nonparametric sib pair identity-by-descent methods. For one region, 8p22-p21, affected sib-pair analyses gavemore » a P value = .0001, corresponding to a lod score approximately equal to 3.00. For 8p22-p21, the maximum two-point lod score occurred using the {open_quotes}affected only{close_quotes} recessive model (Z{sub max} = 2.35; {theta}{sub M} = {theta}{sub F}); allowing for a constant sex difference in recombination fractions found in reference pedigrees, Z{sub max} = 2.78 ({theta}{sub M}/{theta}{sub F} = 3). For a second region, 3p26-p24, the maximum two-point lod score was 2.34 ({open_quotes}affected only{close_quotes} dominant model), and the affected sib-pair P value was .01. These two regions are worthy of further exploration as potential sites of susceptibility genes for schizophrenia. 59 refs., 2 figs., 4 tabs.« less

Light-emitting self-assembled peptide nucleic acids exhibit both stacking interactions and Watson-Crick base pairing.

PubMed

Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud

2015-04-01

The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.

A rapid, generally applicable method to engineer zinc fingers illustrated by targeting the HIV-1 promoter.

PubMed

Isalan, M; Klug, A; Choo, Y

2001-07-01

DNA-binding domains with predetermined sequence specificity are engineered by selection of zinc finger modules using phage display, allowing the construction of customized transcription factors. Despite remarkable progress in this field, the available protein-engineering methods are deficient in many respects, thus hampering the applicability of the technique. Here we present a rapid and convenient method that can be used to design zinc finger proteins against a variety of DNA-binding sites. This is based on a pair of pre-made zinc finger phage-display libraries, which are used in parallel to select two DNA-binding domains each of which recognizes given 5 base pair sequences, and whose products are recombined to produce a single protein that recognizes a composite (9 base pair) site of predefined sequence. Engineering using this system can be completed in less than two weeks and yields proteins that bind sequence-specifically to DNA with Kd values in the nanomolar range. To illustrate the technique, we have selected seven different proteins to bind various regions of the human immunodeficiency virus 1 (HIV-1) promoter.

Abnormal functional connectivity during visuospatial processing is associated with disrupted organisation of white matter in autism

PubMed Central

McGrath, Jane; Johnson, Katherine; O'Hanlon, Erik; Garavan, Hugh; Leemans, Alexander; Gallagher, Louise

2013-01-01

Disruption of structural and functional neural connectivity has been widely reported in Autism Spectrum Disorder (ASD) but there is a striking lack of research attempting to integrate analysis of functional and structural connectivity in the same study population, an approach that may provide key insights into the specific neurobiological underpinnings of altered functional connectivity in autism. The aims of this study were (1) to determine whether functional connectivity abnormalities were associated with structural abnormalities of white matter (WM) in ASD and (2) to examine the relationships between aberrant neural connectivity and behavior in ASD. Twenty-two individuals with ASD and 22 age, IQ-matched controls completed a high-angular-resolution diffusion MRI scan. Structural connectivity was analysed using constrained spherical deconvolution (CSD) based tractography. Regions for tractography were generated from the results of a previous study, in which 10 pairs of brain regions showed abnormal functional connectivity during visuospatial processing in ASD. WM tracts directly connected 5 of the 10 region pairs that showed abnormal functional connectivity; linking a region in the left occipital lobe (left BA19) and five paired regions: left caudate head, left caudate body, left uncus, left thalamus, and left cuneus. Measures of WM microstructural organization were extracted from these tracts. Fractional anisotropy (FA) reductions in the ASD group relative to controls were significant for WM connecting left BA19 to left caudate head and left BA19 to left thalamus. Using a multimodal imaging approach, this study has revealed aberrant WM microstructure in tracts that directly connect brain regions that are abnormally functionally connected in ASD. These results provide novel evidence to suggest that structural brain pathology may contribute (1) to abnormal functional connectivity and (2) to atypical visuospatial processing in ASD. PMID:24133425

Mitomycin C-induced pairing of heterochromatin reflects initiation of DNA repair and chromatid exchange formation.

PubMed

Abdel-Halim, H I; Natarajan, A T; Mullenders, L H F; Boei, J J W A

2005-04-15

Chromatid interchanges induced by the DNA cross-linking agent mitomycin C (MMC) are over-represented in human chromosomes containing large heterochromatic regions. We found that nearly all exchange breakpoints of chromosome 9 are located within the paracentromeric heterochromatin and over 70% of exchanges involving chromosome 9 are between its homologues. We provide evidence that the required pairing of chromosome 9 heterochromatic regions occurs in G(0)/G(1) and S-phase cells as a result of an active cellular process initiated upon MMC treatment. By contrast, no pairing was observed for a euchromatic paracentromeric region of the equal-sized chromosome 8. The MMC-induced pairing of chromosome 9 heterochromatin is observed in a subset of cells; its percentage closely mimics the frequency of homologous interchanges found at metaphase. Moreover, the absence of pairing in cells derived from XPF patients correlates with an altered spectrum of MMC-induced exchanges. Together, the data suggest that the heterochromatin-specific pairing following MMC treatment reflects the initiation of DNA cross-link repair and the formation of exchanges.

Development of a sensor for temperature and water concentration in combustion gases using a single tunable diode laser

NASA Astrophysics Data System (ADS)

Zhou, Xin; Liu, Xiang; Jeffries, Jay B.; Hanson, R. K.

2003-08-01

The water vapour spectrum in the 1-2 µm near-infrared region is systematically analysed to find the best absorption transitions for sensitive measurement of H2O concentration and temperature in combustion environments using a single tunable diode laser with typical distributed feedback single-mode scanning range (1 cm-1). The use of a single laser, even with relatively narrow tuning range, can offer distinct advantages over wavelength-multiplexing techniques. The strategy and spectroscopic criteria for selecting optimum wavelength regions and absorption line combinations are discussed. It should be stressed that no single figure of merit can be derived to simplify the selection process, and the optimum line pair should be chosen case by case. Our investigation reveals that the 1.8 µm spectral region is especially promising, and we have identified 10 of the best water line pairs in this spectral region for temperature measurements in flames. Based on these findings, a pair of H2O transitions near 1.8 µm was targeted for the design and development of an initial single-laser sensor for simultaneously measuring H2O concentration and temperature in atmospheric-pressure flames. As part of the sensor development effort, fundamental spectroscopic parameters including the line strength, line-centre frequency and lower state energies of the probed transitions were measured experimentally to improve the current databases. We conclude with demonstration results in a steady and a forced atmospheric-pressure laboratory combustor.

Multiple resource evaluation of region 2 US forest service lands utilizing LANDSAT MSS data. [San Juan Mountains, Colorado

NASA Technical Reports Server (NTRS)

Krebs, P. V.; Hoffer, R. M. (Principal Investigator)

1976-01-01

The author has identified the following significant results. LANDSAT MSS imagery provided an excellent overview which put a geomorphic study into a regional perspective, using scale 1:250,000 or smaller. It was used for deriving a data base for land use planning for southern San Juan Mountains. Stereo pairing of adjacent images was the best method for all geomorphic mapping. Combining this with snow enhancement, seasonal enhancement, and reversal aided in interpretation of geomorphic features. Drainage patterns were mapped in much greater detail from LANDSAT than from a two deg quadrangle base.

Topographic map of the western region of Dao Vallis in Hellas Planitia, Mars; MTM 500k -40/082E OMKT

USGS Publications Warehouse

Rosiek, Mark R.; Redding, Bonnie L.; Galuszka, Donna M.

2006-01-01

This map, compiled photogrammetrically from Viking Orbiter stereo image pairs, is part of a series of topographic maps of areas of special scientific interest on Mars. Contours were derived from a digital terrain model (DTM) compiled on a digital photogrammetric workstation using Viking Orbiter stereo image pairs with orientation parameters derived from an analytic aerotriangulation. The image base for this map employs Viking Orbiter images from orbits 406 and 363. An orthophotomosaic was created on the digital photogrammetric workstation using the DTM compiled from stereo models.

Bilateral connectivity in the somatosensory region using near-infrared spectroscopy (NIRS) by wavelet coherence

NASA Astrophysics Data System (ADS)

Fernandez Rojas, Raul; Huang, Xu; Ou, Keng-Liang

2016-12-01

Near-infrared spectroscopy (NIRS) has been used in medical imaging to obtain oxygenation and hemodynamic response in the cerebral cortex. This technique has been applied in cortical activation detection and functional connectivity in brain research. Despite some advances in functional connectivity, most of the studies have focused on the prefrontal cortex and little has been done to study the somatosensory region (S1). For that reason, the aim of our present study is to assess bilateral connectivity in the somatosensory region by using NIRS and noxious stimulation. Eleven healthy subjects were investigated using near-infrared spectroscopy during an acupuncture stimulation procedure to safely induce pain in subjects. A multiscale analysis based on wavelet transform coherence (WTC) was designed to assess the functional connectivity of corresponding channel pairs within the left and right s1 region. The cortical activation in the somatosensory region was higher after the acupuncture stimulation, which was consistent with similar studies. The coherence in time-frequency domain between homologous signals generated by contralateral channel pairs revealed two main periods (3.2 s and 12.8 s) with high coherence. Based on the WTC analysis, it was also found that the coherence increase in these periods was task-related. This study contributes to the research field to investigate cerebral hemodynamic response of pain perception using NIRS and demonstrates the use of wavelet transform as a method to investigate functional lateralization in the cerebral cortex.

Design factors that influence PCR amplification success of cross-species primers among 1147 mammalian primer pairs

PubMed Central

Housley, Donna JE; Zalewski, Zachary A; Beckett, Stephanie E; Venta, Patrick J

2006-01-01

Background Cross-species primers have been used with moderate success to address a variety of questions concerning genome structure, evolution, and gene function. However, the factors affecting their success have never been adequately addressed, particularly with respect to producing a consistent method to achieve high throughput. Using 1,147 mammalian cross-species primer pairs (1089 not previously reported), we tested several factors to determine their influence on the probability that a given target will amplify in a given species under a single amplification condition. These factors included: number of mismatches between the two species (the index species) used to identify conserved regions to which the primers were designed, GC-content of the gene and amplified region, CpG dinucleotides in the primer region, degree of encoded protein conservation, length of the primers, and the degree of evolutionary distance between the target species and the two index species. Results The amplification success rate for the cross-species primers was significantly influenced by the number of mismatches between the two index species (6–8% decrease per mismatch in a primer pair), the GC-content within the amplified region (for the dog, GC ≥ 50%, 56.9% amplified; GC<50%, 74.2% amplified), the degree of protein conservation (R2 = 0.14) and the relatedness of the target species to the index species. For the dog, 598 products of 930 primer pairs (64.3%) (excluding primers in which dog was an index species) were sequenced and shown to be the expected product, with an additional three percent producing the incorrect sequence. When hamster DNA was used with the single amplification condition in a microtiter plate-based format, 510 of 1087 primer pairs (46.9%) produced amplified products. The primer pairs are spaced at an average distance of 2.3 Mb in the human genome and may be used to produce up to several hundred thousand bp of species-specific sequence. Conclusion The most important factors influencing the proportion of successful amplifications are the number of index species mismatches, GC-richness of the target amplimer, and the relatedness of the target species to the index species, at least under the single PCR condition used. The 1147 cross-species primer pairs can be used in a high throughput manner to generate data for studies on the genetics and genomics of non-sequenced mammalian genomes. PMID:17029642

Hippocampal activations in mesial temporal lobe epilepsy due to hippocampal sclerosis- an observational study on intramural encoding-delayed recall paradigms using task-based memory fMRI.

PubMed

Rajesh, P G; Thomas, Bejoy; Pammi, V S Chandrasekhar; Kesavadas, C; Alexander, Aley; Radhakrishnan, Ashalatha; Thomas, S V; Menon, R N

2018-05-26

To validate concurrent utility of within-scanner encoding and delayed recognition-memory paradigms to ascertain hippocampal activations during task-based memory fMRI. Memory paradigms were designed for faces, word-pairs and abstract designs. A deep-encoding task was designed comprising of a total of 9 cycles run within a 1.5T MRI scanner. A recall session was performed after 1 h within the scanner using an event-related design. Group analysis was done with 'correct-incorrect' responses applied as parametric modulators in Statistical Parametric Mapping version 8 using boot-strap method to enable estimation of laterality indices (LI) using custom anatomical masks involving the medio-basal temporal structures. Twenty seven subjects with drug-resistant mesial temporal lobe epilepsy due to hippocampal sclerosis (MTLE-HS) [17 patients of left-MTLE and 10 patients of right-MTLE] and 21 right handed age-matched healthy controls (HC) were recruited. For the encoding paradigm blood oxygen level dependent (BOLD) responses in HC demonstrated right laterality for faces, left laterality for word pairs, and bilaterality for design encoding over the regions of interest. Both right and left MTLE-HS groups revealed left lateralisation for word-pair encoding, bilateral activation for face encoding, with design encoding in right MTLE-HS demonstrating a left shift. As opposed to lateralization shown in controls, group analysis of cued-recall BOLD signals acquired within scanner in left MTLE-HS demonstrated right lateralization for word-pairs with bilaterality for faces and designs. The right MTLE-HS group demonstrated bilateral activations for faces, word-pairs and designs. Recall-based fMRI paradigms indicate hippocampal plasticity in MTLE-HS, maximal for word-pair associate recall tasks. Copyright © 2018 Elsevier B.V. All rights reserved.

Characterization of the complete chloroplast genome of Platycarya strobilacea (Juglandaceae)

Treesearch

Jing Yan; Kai Han; Shuyun Zeng; Peng Zhao; Keith Woeste; Jianfang Li; Zhan-Lin Liu

2017-01-01

The whole chloroplast genome (cp genome) sequence of Platycarya strobilacea was characterized from Illumina pair-end sequencing data. The complete cp genome was 160,994 bp in length and contained a large single copy region (LSC) of 90,225 bp and a small single copy region (SSC) of 18,371 bp, which were separated by a pair of inverted repeat regions...

Maximizing the significance in Higgs boson pair analyses [Mad-Maximized Higgs Pair Analyses

DOE PAGES

Kling, Felix; Plehn, Tilman; Schichtel, Peter

2017-02-22

Here, we study Higgs pair production with a subsequent decay to a pair of photons and a pair of bottoms at the LHC. We use the log-likelihood ratio to identify the kinematic regions which either allow us to separate the di-Higgs signal from backgrounds or to determine the Higgs self-coupling. We find that both regions are separate enough to ensure that details of the background modeling will not affect the determination of the self-coupling. Assuming dominant statistical uncertainties we determine the best precision with which the Higgs self-coupling can be probed in this channel. We finally comment on the samemore » questions at a future 100 TeV collider.« less

Maximizing the significance in Higgs boson pair analyses [Mad-Maximized Higgs Pair Analyses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kling, Felix; Plehn, Tilman; Schichtel, Peter

Here, we study Higgs pair production with a subsequent decay to a pair of photons and a pair of bottoms at the LHC. We use the log-likelihood ratio to identify the kinematic regions which either allow us to separate the di-Higgs signal from backgrounds or to determine the Higgs self-coupling. We find that both regions are separate enough to ensure that details of the background modeling will not affect the determination of the self-coupling. Assuming dominant statistical uncertainties we determine the best precision with which the Higgs self-coupling can be probed in this channel. We finally comment on the samemore » questions at a future 100 TeV collider.« less

Parietal lesion effects on cued recall following pair associate learning.

PubMed

Ben-Zvi, Shir; Soroker, Nachum; Levy, Daniel A

2015-07-01

We investigated the involvement of the posterior parietal cortex in episodic memory in a lesion-effects study of cued recall following pair-associate learning. Groups of patients who had experienced first-incident stroke, generally in middle cerebral artery territory, and exhibited damage that included lateral posterior parietal regions, were tested within an early post-stroke time window. In three experiments, patients and matched healthy comparison groups executed repeated study and cued recall test blocks of pairs of words (Experiment 1), pairs of object pictures (Experiment 2), or pairs of object pictures and environmental sounds (Experiment 3). Patients' brain CT scans were subjected to quantitative analysis of lesion volumes. Behavioral and lesion data were used to compute correlations between area lesion extent and memory deficits, and to conduct voxel-based lesion-symptom mapping. These analyses implicated lateral ventral parietal cortex, especially the angular gyrus, in cued recall deficits, most pronouncedly in the cross-modal picture-sound pairs task, though significant parietal lesion effects were also found in the unimodal word pairs and picture pairs tasks. In contrast to an earlier study in which comparable parietal lesions did not cause deficits in item recognition, these results indicate that lateral posterior parietal areas make a substantive contribution to demanding forms of recollective retrieval as represented by cued recall, especially for complex associative representations. Copyright © 2015 Elsevier Ltd. All rights reserved.

Spectroscopy of Single AlInAs Quantum Dots

NASA Astrophysics Data System (ADS)

Derebezov, I. A.; Gaisler, A. V.; Gaisler, V. A.; Dmitriev, D. V.; Toropov, A. I.; Kozhukhov, A. S.; Shcheglov, D. V.; Latyshev, A. V.; Aseev, A. L.

2018-03-01

A system of quantum dots based on Al x In1- x As/Al y Ga1- y As solid solutions is investigated. The use of Al x In1- x As wide-gap solid solutions as the basis of quantum dots substantially extends the spectral emission range to the short-wavelength region, including the wavelength region near 770 nm, which is of interest for the development of aerospace systems of quantum cryptography. The optical characteristics of Al x In1- x As single quantum dots grown by the Stranski-Krastanov mechanism were studied by cryogenic microphotoluminescence. The statistics of the emission of single quantum dot excitons was studied using a Hanbury Brown-Twiss interferometer. The pair photon correlation function indicates the sub-Poissonian nature of the emission statistics, which directly confirms the possibility of developing single-photon emitters based on Al x In1- x As quantum dots. The fine structure of quantum dot exciton states was investigated at wavelengths near 770 nm. The splitting of the exciton states is found to be similar to the natural width of exciton lines, which is of great interest for the development of entangled photon pair emitters based on Al x In1- x As quantum dots.

Graph-based surface reconstruction from stereo pairs using image segmentation

NASA Astrophysics Data System (ADS)

Bleyer, Michael; Gelautz, Margrit

2005-01-01

This paper describes a novel stereo matching algorithm for epipolar rectified images. The method applies colour segmentation on the reference image. The use of segmentation makes the algorithm capable of handling large untextured regions, estimating precise depth boundaries and propagating disparity information to occluded regions, which are challenging tasks for conventional stereo methods. We model disparity inside a segment by a planar equation. Initial disparity segments are clustered to form a set of disparity layers, which are planar surfaces that are likely to occur in the scene. Assignments of segments to disparity layers are then derived by minimization of a global cost function via a robust optimization technique that employs graph cuts. The cost function is defined on the pixel level, as well as on the segment level. While the pixel level measures the data similarity based on the current disparity map and detects occlusions symmetrically in both views, the segment level propagates the segmentation information and incorporates a smoothness term. New planar models are then generated based on the disparity layers' spatial extents. Results obtained for benchmark and self-recorded image pairs indicate that the proposed method is able to compete with the best-performing state-of-the-art algorithms.

Sulphur responsiveness of the Chlamydomonas reinhardtii LHCBM9 promoter.

PubMed

Sawyer, Anne L; Hankamer, Ben D; Ross, Ian L

2015-05-01

A 44-base-pair region in the Chlamydomonas reinhardtii LHCBM9 promoter is essential for sulphur responsiveness. The photosynthetic light-harvesting complex (LHC) proteins play essential roles both in light capture, the first step of photosynthesis, and in photoprotective mechanisms. In contrast to the other LHC proteins and the majority of photosynthesis proteins, the Chlamydomonas reinhardtii photosystem II-associated LHC protein, LHCBM9, was recently reported to be up-regulated under sulphur deprivation conditions, which also induce hydrogen production. Here, we examined the sulphur responsiveness of the LHCBM9 gene at the transcriptional level, through promoter deletion analysis. The LHCBM9 promoter was found to be responsive to sulphur deprivation, with a 44-base-pair region between nucleotide positions -136 and -180 relative to the translation start site identified as essential for this response. Anaerobiosis was found to enhance promoter activity under sulphur deprivation conditions, however, alone was unable to induce promoter activity. The study of LHCBM9 is of biological and biotechnological importance, as its expression is linked to photobiological hydrogen production, theoretically the most efficient process for biofuel production, while the simplicity of using an S-deprivation trigger enables the development of a novel C. reinhardtii-inducible promoter system based on LHCBM9.

Visual integration enhances associative memory equally for young and older adults without reducing hippocampal encoding activation.

PubMed

Memel, Molly; Ryan, Lee

2017-06-01

The ability to remember associations between previously unrelated pieces of information is often impaired in older adults (Naveh-Benjamin, 2000). Unitization, the process of creating a perceptually or semantically integrated representation that includes both items in an associative pair, attenuates age-related associative deficits (Bastin et al., 2013; Ahmad et al., 2015; Zheng et al., 2015). Compared to non-unitized pairs, unitized pairs may rely less on hippocampally-mediated binding associated with recollection, and more on familiarity-based processes mediated by perirhinal cortex (PRC) and parahippocampal cortex (PHC). While unitization of verbal materials improves associative memory in older adults, less is known about the impact of visual integration. The present study determined whether visual integration improves associative memory in older adults by minimizing the need for hippocampal (HC) recruitment and shifting encoding to non-hippocampal medial temporal structures, such as the PRC and PHC. Young and older adults were presented with a series of objects paired with naturalistic scenes while undergoing fMRI scanning, and were later given an associative memory test. Visual integration was varied by presenting the object either next to the scene (Separated condition) or visually integrated within the scene (Combined condition). Visual integration improved associative memory among young and older adults to a similar degree by increasing the hit rate for intact pairs, but without increasing false alarms for recombined pairs, suggesting enhanced recollection rather than increased reliance on familiarity. Also contrary to expectations, visual integration resulted in increased hippocampal activation in both age groups, along with increases in PRC and PHC activation. Activation in all three MTL regions predicted discrimination performance during the Separated condition in young adults, while only a marginal relationship between PRC activation and performance was observed during the Combined condition. Older adults showed less overall activation in MTL regions compared to young adults, and associative memory performance was most strongly predicted by prefrontal, rather than MTL, activation. We suggest that visual integration benefits both young and older adults similarly, and provides a special case of unitization that may be mediated by recollective, rather than familiarity-based encoding processes. Copyright © 2017 Elsevier Ltd. All rights reserved.

Transmission-Ratio Distortion and Allele Sharing in Affected Sib Pairs: A New Linkage Statistic with Reduced Bias, with Application to Chromosome 6q25.3

PubMed Central

Lemire, Mathieu; Roslin, Nicole M.; Laprise, Catherine; Hudson, Thomas J.; Morgan, Kenneth

2004-01-01

We studied the effect of transmission-ratio distortion (TRD) on tests of linkage based on allele sharing in affected sib pairs. We developed and implemented a discrete-trait allele-sharing test statistic, Sad, analogous to the Spairs test statistic of Whittemore and Halpern, that evaluates an excess sharing of alleles at autosomal loci in pairs of affected siblings, as well as a lack of sharing in phenotypically discordant relative pairs, where available. Under the null hypothesis of no linkage, nuclear families with at least two affected siblings and one unaffected sibling have a contribution to Sad that is unbiased, with respect to the effects of TRD independent of the disease under study. If more distantly related unaffected individuals are studied, the bias of Sad is generally reduced compared with that of Spairs, but not completely. Moreover, Sad has higher power, in some circumstances, because of the availability of unaffected relatives, who are ignored in affected-only analyses. We discuss situations in which it may be an efficient use of resources to genotype unaffected relatives, which would give insights for promising study designs. The method is applied to a sample of pedigrees ascertained for asthma in a chromosomal region in which TRD has been reported. Results are consistent with the presence of transmission distortion in that region. PMID:15322985

THz spectra and corresponding vibrational modes of DNA base pair cocrystals and polynucleotides

NASA Astrophysics Data System (ADS)

Wang, Fang; Zhao, Dongbo; Dong, Hao; Jiang, Ling; Huang, Lin; Liu, Yunfei; Li, Shuhua

2018-07-01

The generalized energy-based fragmentation (GEBF) approach has been applied to study the THz spectra and vibrational modes of base pair cocrystals under periodic boundary conditions (denoted as PBC-GEBF). Results of vibrational mode reveal that hydrogen bonds play a pivotal role in the pairing process of base crystals, where most Nsbnd H and Csbnd H bonds stretch to some extent. We also found that hydrogen bonds of a self-made A:T cocrystal completely break in a transition from liquid to the solid state, while self-made C:G cocrystal is different and easier to form a cocrystal, as confirmed by X-ray diffraction (XRD) and terahertz (THz) spectra. Furthermore, we have studied DNA polynucleotides (in both A and B forms) found that the vibrational modes changed a lot during the process of their forming double strand. Despite the key role played by hydrogen bonds, the key contribution originates from collective motions of the main skeleton. A comparative study of the spectra of some stranded fragments suggests that different sequences or forms have similar spectra in THz band. They distinguish from each other mainly in the low-frequency regions, especially below 1 THz. This study would make great contributions to the molecular dynamics model based DNA long-chain structure simulation in the future study.

Development of double-pair double difference location algorithm and its application to the regular earthquakes and non-volcanic tremors

NASA Astrophysics Data System (ADS)

Guo, H.; Zhang, H.

2016-12-01

Relocating high-precision earthquakes is a central task for monitoring earthquakes and studying the structure of earth's interior. The most popular location method is the event-pair double-difference (DD) relative location method, which uses the catalog and/or more accurate waveform cross-correlation (WCC) differential times from event pairs with small inter-event separations to the common stations to reduce the effect of the velocity uncertainties outside the source region. Similarly, Zhang et al. [2010] developed a station-pair DD location method which uses the differential times from common events to pairs of stations to reduce the effect of the velocity uncertainties near the source region, to relocate the non-volcanic tremors (NVT) beneath the San Andreas Fault (SAF). To utilize advantages of both DD location methods, we have proposed and developed a new double-pair DD location method to use the differential times from pairs of events to pairs of stations. The new method can remove the event origin time and station correction terms from the inversion system and cancel out the effects of the velocity uncertainties near and outside the source region simultaneously. We tested and applied the new method on the northern California regular earthquakes to validate its performance. In comparison, among three DD location methods, the new double-pair DD method can determine more accurate relative locations and the station-pair DD method can better improve the absolute locations. Thus, we further proposed a new location strategy combining station-pair and double-pair differential times to determine accurate absolute and relative locations at the same time. For NVTs, it is difficult to pick the first arrivals and derive the WCC event-pair differential times, thus the general practice is to measure station-pair envelope WCC differential times. However, station-pair tremor locations are scattered due to the low-precision relative locations. The ability that double-pair data can be directly constructed from the station-pair data means that double-pair DD method can be used for improving NVT locations. We have applied the new method to the NVTs beneath the SAF near Cholame, California. Compared to the previous results, the new double-pair DD tremor locations are more concentrated and show more detailed structures.

Asynchronous inputs alter excitability, spike timing, and topography in primary auditory cortex

PubMed Central

Pandya, Pritesh K.; Moucha, Raluca; Engineer, Navzer D.; Rathbun, Daniel L.; Vazquez, Jessica; Kilgard, Michael P.

2010-01-01

Correlation-based synaptic plasticity provides a potential cellular mechanism for learning and memory. Studies in the visual and somatosensory systems have shown that behavioral and surgical manipulation of sensory inputs leads to changes in cortical organization that are consistent with the operation of these learning rules. In this study, we examine how the organization of primary auditory cortex (A1) is altered by tones designed to decrease the average input correlation across the frequency map. After one month of separately pairing nucleus basalis stimulation with 2 and 14 kHz tones, a greater proportion of A1 neurons responded to frequencies below 2 kHz and above 14 kHz. Despite the expanded representation of these tones, cortical excitability was specifically reduced in the high and low frequency regions of A1, as evidenced by increased neural thresholds and decreased response strength. In contrast, in the frequency region between the two paired tones, driven rates were unaffected and spontaneous firing rate was increased. Neural response latencies were increased across the frequency map when nucleus basalis stimulation was associated with asynchronous activation of the high and low frequency regions of A1. This set of changes did not occur when pulsed noise bursts were paired with nucleus basalis stimulation. These results are consistent with earlier observations that sensory input statistics can shape cortical map organization and spike timing. PMID:15855025

PARTS: Probabilistic Alignment for RNA joinT Secondary structure prediction

PubMed Central

Harmanci, Arif Ozgun; Sharma, Gaurav; Mathews, David H.

2008-01-01

A novel method is presented for joint prediction of alignment and common secondary structures of two RNA sequences. The joint consideration of common secondary structures and alignment is accomplished by structural alignment over a search space defined by the newly introduced motif called matched helical regions. The matched helical region formulation generalizes previously employed constraints for structural alignment and thereby better accommodates the structural variability within RNA families. A probabilistic model based on pseudo free energies obtained from precomputed base pairing and alignment probabilities is utilized for scoring structural alignments. Maximum a posteriori (MAP) common secondary structures, sequence alignment and joint posterior probabilities of base pairing are obtained from the model via a dynamic programming algorithm called PARTS. The advantage of the more general structural alignment of PARTS is seen in secondary structure predictions for the RNase P family. For this family, the PARTS MAP predictions of secondary structures and alignment perform significantly better than prior methods that utilize a more restrictive structural alignment model. For the tRNA and 5S rRNA families, the richer structural alignment model of PARTS does not offer a benefit and the method therefore performs comparably with existing alternatives. For all RNA families studied, the posterior probability estimates obtained from PARTS offer an improvement over posterior probability estimates from a single sequence prediction. When considering the base pairings predicted over a threshold value of confidence, the combination of sensitivity and positive predictive value is superior for PARTS than for the single sequence prediction. PARTS source code is available for download under the GNU public license at http://rna.urmc.rochester.edu. PMID:18304945

Small RNA-mediated regulation in bacteria: A growing palette of diverse mechanisms.

PubMed

Dutta, Tanmay; Srivastava, Shubhangi

2018-05-20

Small RNAs (sRNAs) in bacteria have evolved with diverse mechanisms to balance their target gene expression in response to changes in the environment. Accumulating studies on bacterial regulatory processes firmly established that sRNAs modulate their target gene expression generally at the posttranscriptional level. Identification of large number of sRNAs by advanced technologies, like deep sequencing, tilling microarray, indicates the existence of a plethora of distinctive sRNA-mediated regulatory mechanisms in bacteria. Types of the novel mechanisms are increasing with the discovery of new sRNAs. Complementary base pairing between sRNAs and target RNAs assisted by RNA chaperones like Hfq and ProQ, in many occasions, to regulate the cognate gene expression is prevalent in sRNA mechanisms. sRNAs, in most studied cases, can directly base pair with target mRNA to remodel its expression. Base pairing can happen either in the untranslated regions or in the coding regions of mRNA to activate/repress its translation. sRNAs also act as target mimic to titrate away different regulatory RNAs from its target. Other mechanism includes the sequestration of regulatory proteins, especially transcription factors, by sRNAs. Numerous sRNAs, following analogous mechanism, are widespread in bacteria, and thus, has drawn immense attention for the development of RNA-based technologies. Nevertheless, typical sRNA mechanisms are also discovered to be confined in some bacteria. Analysis of the sRNA mechanisms unravels their existence in both the single step processes and the complex regulatory networks with a global effect on cell physiology. This review deals with the diverse array of mechanisms, which sRNAs follow to maintain bacterial lifestyle. Copyright © 2018 Elsevier B.V. All rights reserved.

Modeling DNA bubble formation at the atomic scale

DOE Office of Scientific and Technical Information (OSTI.GOV)

Beleva, V; Rasmussen, K. O.; Garcia, A. E.

We describe the fluctuations of double stranded DNA molecules using a minimalist Go model over a wide range of temperatures. Minimalist models allow us to describe, at the atomic level, the opening and formation of bubbles in DNA double helices. This model includes all the geometrical constraints in helix melting imposed by the 3D structure of the molecule. The DNA forms melted bubbles within double helices. These bubbles form and break as a function of time. The equilibrium average number of broken base pairs shows a sharp change as a function of T. We observe a temperature profile of sequencemore » dependent bubble formation similar to those measured by Zeng et al. Long nuclei acid molecules melt partially through the formations of bubbles. It is known that CG rich sequences melt at higher temperatures than AT rich sequences. The melting temperature, however, is not solely determined by the CG content, but by the sequence through base stacking and solvent interactions. Recently, models that incorporate the sequence and nonlinear dynamics of DNA double strands have shown that DNA exhibits a very rich dynamics. Recent extensions of the Bishop-Peyrard model show that fluctuations in the DNA structure lead to opening in localized regions, and that these regions in the DNA are associated with transcription initiation sites. 1D and 2D models of DNA may contain enough information about stacking and base pairing interactions, but lack the coupling between twisting, bending and base pair opening imposed by the double helical structure of DNA that all atom models easily describe. However, the complexity of the energy function used in all atom simulations (including solvent, ions, etc) does not allow for the description of DNA folding/unfolding events that occur in the microsecond time scale.« less

A curved RNA helix incorporating an internal loop with G·A and A·A non-Watson–Crick base pairing

PubMed Central

Baeyens, Katrien J.; De Bondt, Hendrik L.; Pardi, Arthur; Holbrook, Stephen R.

1996-01-01

The crystal structure of the RNA dodecamer 5′-GGCC(GAAA)GGCC-3′ has been determined from x-ray diffraction data to 2.3-Å resolution. In the crystal, these oligomers form double helices around twofold symmetry axes. Four consecutive non-Watson–Crick base pairs make up an internal loop in the middle of the duplex, including sheared G·A pairs and novel asymmetric A·A pairs. This internal loop sequence produces a significant curvature and narrowing of the double helix. The helix is curved by 34° from end to end and the diameter is narrowed by 24% in the internal loop. A Mn2+ ion is bound directly to the N7 of the first guanine in the Watson–Crick region following the internal loop and the phosphate of the preceding residue. This Mn2+ location corresponds to a metal binding site observed in the hammerhead catalytic RNA. PMID:8917508

Vaccine induced differential expressions of miRNAs at cytolytic stage in chickens resistant or susceptible to Marek’s disease

USDA-ARS?s Scientific Manuscript database

Gene expression regulation is critical for all cellular processes since dysregulation of it often results in elevated disease risk and compromised cellular immunity. MicroRNAs (miRNAs) directly regulate gene expression post-transcriptionally through base-pairing with regions in the 3’-untranslated s...

Genetic relationships of meadow vole (Microtus pennsylvanicus) populations in central Appalachian wetlands

Treesearch

K. E. Francl; T. C. Glenn; S. B. Castleberry; W. M. Ford

2008-01-01

We sequenced and compared variation within a 375-base-pair segment of the mitochondrial DNA control region of 323 meadow voles (Microtus pennsylvanicus (Ord. 1815)) among 14 populations to determine the influence of past and present landscape connectivity among isolated wetlands in the central Appalachian Mountains. To best explain observed...

Genomic Mapping of Human DNA provides Evidence of Difference in Stretch between AT and GC rich regions

NASA Astrophysics Data System (ADS)

Reifenberger, Jeffrey; Dorfman, Kevin; Cao, Han

Human DNA is a not a polymer consisting of a uniform distribution of all 4 nucleic acids, but rather contains regions of high AT and high GC content. When confined, these regions could have different stretch due to the extra hydrogen bond present in the GC basepair. To measure this potential difference, human genomic DNA was nicked with NtBspQI, labeled with a cy3 like fluorophore at the nick site, stained with YOYO, loaded into a device containing an array of nanochannels, and imaged. Over 473,000 individual molecules of DNA, corresponding to roughly 30x coverage of a human genome, were collected and aligned to the human reference. Based on the known AT/GC content between aligned pairs of labels, the stretch was measured for regions of similar size but different AT/GC content. We found that regions of high GC content were consistently more stretched than regions of high AT content between pairs of labels varying in size between 2.5 kbp and 500 kbp. We measured that for every 1% increase in GC content there was roughly a 0.06% increase in stretch. While this effect is small, it is important to take into account differences in stretch between AT and GC rich regions to improve the sensitivity of detection of structural variations from genomic variations. NIH Grant: R01-HG006851.

Heterochromatin base pair composition and diversification in holocentric chromosomes of kissing bugs (Hemiptera, Reduviidae).

PubMed

Bardella, Vanessa Bellini; Pita, Sebastián; Vanzela, André Luis Laforga; Galvão, Cleber; Panzera, Francisco

2016-10-01

The subfamily Triatominae (Hemiptera, Reduviidae) includes 150 species of blood-sucking insects, vectors of Chagas disease or American trypanosomiasis. Karyotypic information reveals a striking stability in the number of autosomes. However, this group shows substantial variability in genome size, the amount and distribution of C-heterochromatin, and the chromosome positions of 45S rDNA clusters. Here, we analysed the karyotypes of 41 species from six different genera with C-fluorescence banding in order to evaluate the base-pair richness of heterochromatic regions. Our results show a high heterogeneity in the fluorescent staining of the heterochromatin in both autosomes and sex chromosomes, never reported before within an insect subfamily with holocentric chromosomes. This technique allows a clear discrimination of the heterochromatic regions classified as similar by C-banding, constituting a new chromosome marker with taxonomic and evolutionary significance. The diverse fluorescent patterns are likely due to the amplification of different repeated sequences, reflecting an unusual dynamic rearrangement in the genomes of this subfamily. Further, we discuss the evolution of these repeated sequences in both autosomes and sex chromosomes in species of Triatominae.

Mutagenesis of the lac promoter region in M13 mp10 phage DNA by 4'-hydroxymethyl-4,5',8-trimethylpsoralen

DOE Office of Scientific and Technical Information (OSTI.GOV)

Piette, J.; Decuyper-Debergh, D.; Gamper, H.

Double-stranded M13 phage DNA (M13 mp10 replicative form) was photoreacted with 4'-hydroxymethyl-4,5',8-trimethylpsoralen, using light of wavelength greater than 320 nm or greater than 390 nm to generate predominantly crosslinks or monoadducts, respectively. The damaged DNAs were scored for inactivation and mutagenesis after transfection into Escherichia coli. The appearance of light-blue or colorless plaques on indicator medium showed that mutation had occurred in the lac insert of the viral DNA. A comparison of the consequences of the two phototreatments with psoralen supports the idea that crosslinks are both more lethal and more mutagenic than monoadducts. Numerous mutant clones partially or totallymore » deficient in beta-galactosidase were plaque-purified and amplified. The viral DNA of each clone was sequenced by the dideoxy chain-terminating procedure. All of the observed base-pair changes were mapped to the lac promoter region and consisted of 3 transition, 14 transversion, and 6 single base-pair frame-shift mutations. The predominant mutation was a T.A----G.C transversion.« less

New longitudinal mode and compression of pair ions in plasma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ehsan, Zahida; Imran, Muhammad, E-mail: imransindhu@hotmail.com; Tsintsadze, N. L.

Positive and negative ions forming the so-called pair plasma differing in sign of their charge but asymmetric in mass and temperature support a new acoustic-like mode. The condition for the excitation of ion sound wave through electron beam induced Cherenkov instability is also investigated. This beam can generate a perturbation in the pair ion plasmas in the presence of electrons when there is number density, temperature, and mass difference in the two species of ions. Basic emphasis is on the focusing of ion sound waves, and we show how, in the area of localization of wave energy, the density ofmore » pair particles increases while electrons are pushed away from that region. Further, this localization of wave is dependent on the shape of the pulse. Considering the example of pancake and bullet shaped pulses, we find that only the former leads to compression of pair ions in the supersonic regime of the focusing region. Here, possible existence of regions where pure pair particles can exist may also be speculated which is not only useful from academic point of view but also to mimic the situation of plasma (electron positron asymmetric and symmetric) observed in astrophysical environment.« less

A convergence algorithm for correlation of breech face images based on the congruent matching cells (CMC) method.

PubMed

Chen, Zhe; Song, John; Chu, Wei; Soons, Johannes A; Zhao, Xuezeng

2017-11-01

The Congruent Matching Cells (CMC) method was invented at the National Institute of Standards and Technology (NIST) for accurate firearm evidence identification and error rate estimation. The CMC method is based on the principle of discretization. The toolmark image of the reference sample is divided into correlation cells. Each cell is registered to the cell-sized area of the compared image that has maximum surface topography similarity. For each resulting cell pair, one parameter quantifies the similarity of the cell surface topography and three parameters quantify the pattern congruency of the registration position and orientation. An identification (declared match) requires a significant number of CMCs, that is, cell pairs that meet both similarity and pattern congruency requirements. The use of cell correlations reduces the effects of "invalid regions" in the compared image pairs and increases the correlation accuracy. The identification accuracy of the CMC method can be further improved by considering a feature named "convergence," that is, the tendency of the x-y registration positions of the correlated cell pairs to converge at the correct registration angle when comparing same-source samples at different relative orientations. In this paper, the difference of the convergence feature between known matching (KM) and known non-matching (KNM) image pairs is characterized, based on which an improved algorithm is developed for breech face image correlations using the CMC method. Its advantage is demonstrated by comparison with three existing CMC algorithms using four datasets. The datasets address three different brands of consecutively manufactured pistol slides, with significant differences in the distribution overlap of cell pair topography similarity for KM and KNM image pairs. For the same CMC threshold values, the convergence algorithm demonstrates noticeably improved results by reducing the number of false-positive or false-negative CMCs in a comparison. Published by Elsevier B.V.

Extension of helix II of an HIV-1-directed hammerhead ribozyme with long antisense flanks does not alter kinetic parameters in vitro but causes loss of the inhibitory potential in living cells.

PubMed Central

Homann, M; Tabler, M; Tzortzakaki, S; Sczakiel, G

1994-01-01

When designed to cleave a target RNA in trans, the hammerhead ribozyme contains two antisense flanks which form helix I and helix III by pairing with the complementary target RNA. The sequences forming helix II are contained on the ribozyme strand and represent a major structural component of the hammerhead structure. In the case of an inhibitory 429 nucleotides long trans-ribozyme (2as-Rz12) which was directed against the 5'-leader/gag region of the human immunodeficiency virus type 1 (HIV-1), helix II was not pre-formed in the single-stranded molecule. Thus, major structural changes are necessary before cleavage can occur. To study whether pre-formation of helix II in the non-paired 2as-Rz12 RNA could influence the observed cleavage rate in vitro and its inhibitory activity on HIV-1 replication, we extended the 4 base pair helix II of 2as-Rz12 to 6, 10, 21, and 22 base pairs respectively. Limited RNase cleavage reactions performed in vitro at 37 degrees C and at physiological ion strength indicated that a helix II of the hammerhead domain was pre-formed when its length was at least six base pairs. This modification neither affected the association rate with target RNA nor the cleavage rate in vitro. In contrast to this, extension of helix II led to a significantly decreased inhibition of HIV-1 replication in human cells. Together with the finding of others that shortening of helix II to less than two base pairs reduces the catalytic activity in vitro, this observation indicates that the length of helix II in the naturally occurring RNAs with a hammerhead domain is already close or identical to the optimal length for catalytic activity in vitro and in vivo. Images PMID:7524030

Characterization of a highly polymorphic region 5′ to JH in the human immunoglobulin heavy chain

PubMed Central

Silva, Alcino J.; Johnson, John P.; White, Raymond L.

1987-01-01

A cloned DNA segment 1.25 kilobases (kb) upstream from the joining segments of the human heavy chain immunoglobulin gene revealed extensive polymorphic variation at this locus, and the polymorphic pattern was stably transmitted to the next generation. Genomic restriction analysis showed that the polymorphism was caused by insertions/deletions within an MspI/BamHI fragment. Sequencing of one allele, 848 base pairs (bp) long, revealed eleven 50-base-pair tandem repeats. A second allele, 648 bp long, was cloned from a human genomic cosmid library, sequenced, and found to contain four fewer repeats than the first allele. A survey of 186 chromosomes from unrelated individuals of primarily northern European descent revealed at least six alleles. Images PMID:2884636

Perceptual similarity of regional dialects of American English

PubMed Central

Clopper, Cynthia G.; Levi, Susannah V.; Pisoni, David B.

2012-01-01

Previous research on the perception of dialect variation has measured the perceptual similarity of talkers based on regional dialect using only indirect methods. In the present study, a paired comparison similarity ratings task was used to obtain direct measures of perceptual similarity. Naive listeners were asked to make explicit judgments about the similarity of a set of talkers based on regional dialect. The talkers represented four regional varieties of American English and both genders. Results revealed an additive effect of gender and dialect on mean similarity ratings and two primary dimensions of perceptual dialect similarity: geography (northern versus southern varieties) and dialect markedness (many versus few characteristic properties). The present findings are consistent with earlier research on the perception of dialect variation, as well as recent speech perception studies which demonstrate the integral role of talker gender in speech perception. PMID:16454310

Precursor of superfluidity in a strongly interacting Fermi gas with negative effective range

NASA Astrophysics Data System (ADS)

Tajima, Hiroyuki

2018-04-01

We investigate theoretically the effects of pairing fluctuations in an ultracold Fermi gas near a Feshbach resonance with a negative effective range. By employing a many-body T -matrix theory with a coupled fermion-boson model, we show that the single-particle density of states exhibits the so-called pseudogap phenomenon, which is a precursor of superfluidity induced by strong pairing fluctuations. We clarify the region where strong pairing fluctuations play a crucial role in single-particle properties, from the broad-resonance region to the narrow-resonance limit at the divergent two-body scattering length. We also extrapolate the effects of pairing fluctuations to the positive-effective-range region from our results near the narrow Feshbach resonance. Results shown in this paper are relevant to the connection between ultracold Fermi gases and low-density neutron matter from the viewpoint of finite-effective-range corrections.

Cytogenetic studies in Eigenmannia virescens (Sternopygidae, Gymnotiformes) and new inferences on the origin of sex chromosomes in the Eigenmannia genus

PubMed Central

2009-01-01

Background Cytogenetic studies were carried out on samples of Eigenmannia virescens (Sternopygidae, Gymnotiformes) obtained from four river systems of the Eastern Amazon region (Para, Brazil). Results All four populations had 2n = 38, with ZZ/ZW sex chromosomes (Z, acrocentric; W, submetacentric). Constitutive heterochromatin (CH) was found at the centromeric regions of all chromosomes. The W chromosome had a heterochromatic block in the proximal region of the short arm; this CH was positive for DAPI staining, indicating that it is rich in A-T base pairs. The nucleolar organizer region (NOR) was localized to the short arm of chromosome pair 15; this result was confirmed by fluorescent in situ hybridization (FISH) with human 45S rDNA, and CMA3 staining indicated that the region is G-C rich. FISH with telomeric probes did not show any evidence of interstitial telomeric sequences (ITS). Conclusion Previous studies have shown that the species Eigenmannia sp. 2 and E. virescens have differentiated sex chromosomes, and diverse sex chromosome systems have been described for E. virescens specimens obtained from different Brazilian rivers. A comparative analysis of the present data and prior reports suggests that the sex chromosomes of Eigenmannia may have arisen independently in the different populations. PMID:19930594

Liquid droplet sensing using twisted optical fiber couplers fabricated by hydrofluoric acid flow etching

NASA Astrophysics Data System (ADS)

Son, Gyeongho; Jung, Youngho; Yu, Kyoungsik

2017-04-01

We report a directional-coupler-based refractive index sensor and its cost-effective fabrication method using hydrofluoric acid droplet wet-etching and surface-tension-driven liquid flows. The proposed fiber sensor consists of a pair of twisted tapered optical fibers with low excess losses. The fiber cores in the etched microfiber region are exposed to the surrounding medium for efficient interaction with the guided light. We observe that the etching-based low-loss fiber-optic sensors can measure the water droplet volume by detecting the refractive index changes of the surrounding medium around the etched fiber core region.

Between a Rock and a Hard Place: Habitat Selection in Female-Calf Humpback Whale (Megaptera novaeangliae) Pairs on the Hawaiian Breeding Grounds

PubMed Central

Cartwright, Rachel; Gillespie, Blake; LaBonte, Kristen; Mangold, Terence; Venema, Amy; Eden, Kevin; Sullivan, Matthew

2012-01-01

The Au'au Channel between the islands of Maui and Lanai, Hawaii comprises critical breeding habitat for humpback whales (Megaptera novaeangliae) of the Central North Pacific stock. However, like many regions where marine mega-fauna gather, these waters are also the focus of a flourishing local eco-tourism and whale watching industry. Our aim was to establish current trends in habitat preference in female-calf humpback whale pairs within this region, focusing specifically on the busy, eastern portions of the channel. We used an equally-spaced zigzag transect survey design, compiled our results in a GIS model to identify spatial trends and calculated Neu's Indices to quantify levels of habitat use. Our study revealed that while mysticete female-calf pairs on breeding grounds typically favor shallow, inshore waters, female-calf pairs in the Au'au Channel avoided shallow waters (<20 m) and regions within 2 km of the shoreline. Preferred regions for female-calf pairs comprised water depths between 40–60 m, regions of rugged bottom topography and regions that lay between 4 and 6 km from a small boat harbor (Lahaina Harbor) that fell within the study area. In contrast to other humpback whale breeding grounds, there was only minimal evidence of typical patterns of stratification or segregation according to group composition. A review of habitat use by maternal females across Hawaiian waters indicates that maternal habitat choice varies between localities within the Hawaiian Islands, suggesting that maternal females alter their use of habitat according to locally varying pressures. This ability to respond to varying environments may be the key that allows wildlife species to persist in regions where human activity and critical habitat overlap. PMID:22666432

Extraction and textural characterization of above-ground areas from aerial stereo pairs: a quality assessment

NASA Astrophysics Data System (ADS)

Baillard, C.; Dissard, O.; Jamet, O.; Maître, H.

Above-ground analysis is a key point to the reconstruction of urban scenes, but it is a difficult task because of the diversity of the involved objects. We propose a new method to above-ground extraction from an aerial stereo pair, which does not require any assumption about object shape or nature. A Digital Surface Model is first produced by a stereoscopic matching stage preserving discontinuities, and then processed by a region-based Markovian classification algorithm. The produced above-ground areas are finally characterized as man-made or natural according to the grey level information. The quality of the results is assessed and discussed.

Computational DNA hole spectroscopy: A new tool to predict mutation hotspots, critical base pairs, and disease ‘driver’ mutations

PubMed Central

Suárez, Martha Y.; Villagrán; Miller, John H.

2015-01-01

We report on a new technique, computational DNA hole spectroscopy, which creates spectra of electron hole probabilities vs. nucleotide position. A hole is a site of positive charge created when an electron is removed. Peaks in the hole spectrum depict sites where holes tend to localize and potentially trigger a base pair mismatch during replication. Our studies of mitochondrial DNA reveal a correlation between L-strand hole spectrum peaks and spikes in the human mutation spectrum. Importantly, we also find that hole peak positions that do not coincide with large variant frequencies often coincide with disease-implicated mutations and/or (for coding DNA) encoded conserved amino acids. This enables combining hole spectra with variant data to identify critical base pairs and potential disease ‘driver’ mutations. Such integration of DNA hole and variance spectra could ultimately prove invaluable for pinpointing critical regions of the vast non-protein-coding genome. An observed asymmetry in correlations, between the spectrum of human mtDNA variations and the L- and H-strand hole spectra, is attributed to asymmetric DNA replication processes that occur for the leading and lagging strands. PMID:26310834

Computational DNA hole spectroscopy: A new tool to predict mutation hotspots, critical base pairs, and disease 'driver' mutations.

PubMed

Villagrán, Martha Y Suárez; Miller, John H

2015-08-27

We report on a new technique, computational DNA hole spectroscopy, which creates spectra of electron hole probabilities vs. nucleotide position. A hole is a site of positive charge created when an electron is removed. Peaks in the hole spectrum depict sites where holes tend to localize and potentially trigger a base pair mismatch during replication. Our studies of mitochondrial DNA reveal a correlation between L-strand hole spectrum peaks and spikes in the human mutation spectrum. Importantly, we also find that hole peak positions that do not coincide with large variant frequencies often coincide with disease-implicated mutations and/or (for coding DNA) encoded conserved amino acids. This enables combining hole spectra with variant data to identify critical base pairs and potential disease 'driver' mutations. Such integration of DNA hole and variance spectra could ultimately prove invaluable for pinpointing critical regions of the vast non-protein-coding genome. An observed asymmetry in correlations, between the spectrum of human mtDNA variations and the L- and H-strand hole spectra, is attributed to asymmetric DNA replication processes that occur for the leading and lagging strands.

Complexes of DNA bases and Watson-Crick base pairs interaction with neutral silver Agn (n = 8, 10, 12) clusters: a DFT and TDDFT study.

PubMed

Srivastava, Ruby

2018-03-01

We study the binding of the neutral Ag n (n = 8, 10, 12) to the DNA base-adenine (A), guanine (G) and Watson-Crick -adenine-thymine, guanine-cytosine pairs. Geometries of complexes were optimized at the DFT level using the hybrid B3LYP functional. LANL2DZ effective core potential was used for silver and 6-31 + G ** was used for all other atoms. NBO charges were analyzed using the Natural population analysis. The absorption properties of Ag n -A,G/WC complexes were also studied using time-dependent density functional theory. The absorption spectra for these complexes show wavelength in the visible region. It was revealed that silver clusters interact more strongly with WC pairs than with isolated DNA complexes. Furthermore, it was found that the electronic charge transferred from silver to isolated DNA clusters are less than the electronic charge transferred from silver to the Ag n -WC complexes. The vertical ionization potential, vertical electron affinity, hardness, and electrophilicity index of Ag n -DNA/WC complexes have also been discussed.

Preceding Vehicle Detection and Tracking Adaptive to Illumination Variation in Night Traffic Scenes Based on Relevance Analysis

PubMed Central

Guo, Junbin; Wang, Jianqiang; Guo, Xiaosong; Yu, Chuanqiang; Sun, Xiaoyan

2014-01-01

Preceding vehicle detection and tracking at nighttime are challenging problems due to the disturbance of other extraneous illuminant sources coexisting with the vehicle lights. To improve the detection accuracy and robustness of vehicle detection, a novel method for vehicle detection and tracking at nighttime is proposed in this paper. The characteristics of taillights in the gray level are applied to determine the lower boundary of the threshold for taillights segmentation, and the optimal threshold for taillight segmentation is calculated using the OTSU algorithm between the lower boundary and the highest grayscale of the region of interest. The candidate taillight pairs are extracted based on the similarity between left and right taillights, and the non-vehicle taillight pairs are removed based on the relevance analysis of vehicle location between frames. To reduce the false negative rate of vehicle detection, a vehicle tracking method based on taillights estimation is applied. The taillight spot candidate is sought in the region predicted by Kalman filtering, and the disturbed taillight is estimated based on the symmetry and location of the other taillight of the same vehicle. Vehicle tracking is completed after estimating its location according to the two taillight spots. The results of experiments on a vehicle platform indicate that the proposed method could detect vehicles quickly, correctly and robustly in the actual traffic environments with illumination variation. PMID:25195855

Preceding vehicle detection and tracking adaptive to illumination variation in night traffic scenes based on relevance analysis.

PubMed

Guo, Junbin; Wang, Jianqiang; Guo, Xiaosong; Yu, Chuanqiang; Sun, Xiaoyan

2014-08-19

Preceding vehicle detection and tracking at nighttime are challenging problems due to the disturbance of other extraneous illuminant sources coexisting with the vehicle lights. To improve the detection accuracy and robustness of vehicle detection, a novel method for vehicle detection and tracking at nighttime is proposed in this paper. The characteristics of taillights in the gray level are applied to determine the lower boundary of the threshold for taillights segmentation, and the optimal threshold for taillight segmentation is calculated using the OTSU algorithm between the lower boundary and the highest grayscale of the region of interest. The candidate taillight pairs are extracted based on the similarity between left and right taillights, and the non-vehicle taillight pairs are removed based on the relevance analysis of vehicle location between frames. To reduce the false negative rate of vehicle detection, a vehicle tracking method based on taillights estimation is applied. The taillight spot candidate is sought in the region predicted by Kalman filtering, and the disturbed taillight is estimated based on the symmetry and location of the other taillight of the same vehicle. Vehicle tracking is completed after estimating its location according to the two taillight spots. The results of experiments on a vehicle platform indicate that the proposed method could detect vehicles quickly, correctly and robustly in the actual traffic environments with illumination variation.

Report on Pairing-based Cryptography.

PubMed

Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

2015-01-01

This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.

Report on Pairing-based Cryptography

PubMed Central

Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

2015-01-01

This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST’s position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed. PMID:26958435

An approach to the diagnosis of metabolic syndrome by the multi-electrode impedance method

NASA Astrophysics Data System (ADS)

Furuya, N.; Sakamoto, K.; Kanai, H.

2010-04-01

It is well known that metabolic syndrome can induce myocardial infarction and cerebral infarction. So, it is very important to measure the visceral fat volume. In the electric impedance method, information in the vicinity of the electrodes is strongly reflected. Therefore, we propose a new multi-electrode arrangement method based on the impedance sensitivity theorem to measure the visceral fat volume. This electrode arrangement is designed to enable high impedance sensitivity in the visceral and subcutaneous fat regions. Currents are simultaneously applied to several current electrodes on the body surface, and one voltage electrode pair is arranged on the body surface near the organ of interest to obtain the visceral fat information and another voltage electrode pair is arranged on the body surface near the current electrodes to obtain the subcutaneous fat information. A simulation study indicates that by weighting the impedance sensitivity distribution, as in our method, a high-sensitivity region in the visceral and the subcutaneous fat regions can be formed. In addition, it was confirmed that the visceral fat volume can be estimated by the measured impedance data.

Why the tautomerization of the G·C Watson-Crick base pair via the DPT does not cause point mutations during DNA replication? QM and QTAIM comprehensive analysis.

PubMed

Brovarets', Ol'ha O; Hovorun, Dmytro M

2014-01-01

The ground-state tautomerization of the G·C Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4), corresponding to a hydrophobic interface of protein-nucleic acid interactions, using DFT and MP2 levels of quantum-mechanical (QM) theory and quantum theory "Atoms in molecules" (QTAIM). Based on the sweeps of the electron-topological, geometric, polar, and energetic parameters, which describe the course of the G·C ↔ G*·C* tautomerization (mutagenic tautomers of the G and C bases are marked with an asterisk) through the DPT along the intrinsic reaction coordinate (IRC), it was proved that it is, strictly speaking, a concerted asynchronous process both at the DFT and MP2 levels of theory, in which protons move with a small time gap in vacuum, while this time delay noticeably increases in the continuum with ϵ = 4. It was demonstrated using the conductor-like polarizable continuum model (CPCM) that the continuum with ϵ = 4 does not qualitatively affect the course of the tautomerization reaction. The DPT in the G·C Watson-Crick base pair occurs without any intermediates both in vacuum and in the continuum with ϵ = 4 at the DFT/MP2 levels of theory. The nine key points along the IRC of the G·C base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These key points have been used to define the reactant, transition state, and product regions of the DPT reaction in the G·C base pair. Analysis of the energetic characteristics of the H-bonds allows us to arrive at a definite conclusion that the middle N1H⋯N3/N3H⋯N1 and the lower N2H⋯O2/N2H⋯O2 parallel H-bonds in the G·C/G*·C* base pairs, respectively, are anticooperative, that is, the strengthening of the middle H-bond is accompanied by the weakening of the lower H-bond. At that point, the upper N4H⋯O6 and O6H⋯N4 H-bonds in the G·C and G*·C* base pairs, respectively, remain constant at the changes of the middle and the lower H-bonds at the beginning and at the ending of the G·C ↔ G*·C* tautomerization. Aiming to answer the question posed in the title of the article, we established that the G*·C* Löwdin's base pair satisfies all the requirements necessary to cause point mutations in DNA except its lifetime, which is much less than the period of time required for the replication machinery to forcibly dissociate a base pair into the monomers (several ns) during DNA replication. So, from the physicochemical point of view, the G*·C* Löwdin's base pair cannot be considered as a source of point mutations arising during DNA replication.

Separating lexical-semantic access from other mnemonic processes in picture-name verification

PubMed Central

Smith, Jason F.; Braun, Allen R.; Alexander, Gene E.; Chen, Kewei; Horwitz, Barry

2013-01-01

We present a novel paradigm to identify shared and unique brain regions underlying non-semantic, non-phonological, abstract, audio-visual (AV) memory vs. naming using a longitudinal functional magnetic resonance imaging experiment. Participants were trained to associate novel AV stimulus pairs containing hidden linguistic content. Half of the stimulus pairs were distorted images of animals and sine-wave speech versions of the animal's name. Images and sounds were distorted in such a way as to make their linguistic content easily recognizable only after being made aware of its existence. Memory for the pairings was tested by presenting an AV pair and asking participants to verify if the two stimuli formed a learned pairing. After memory testing, the hidden linguistic content was revealed and participants were tested again on their recollection of the pairings in this linguistically informed state. Once informed, the AV verification task could be performed by naming the picture. There was substantial overlap between the regions involved in recognition of non-linguistic sensory memory and naming, suggesting a strong relation between them. Contrasts between sessions identified left angular gyrus and middle temporal gyrus as key additional players in the naming network. Left inferior frontal regions participated in both naming and non-linguistic AV memory suggesting the region is responsible for AV memory independent of phonological content contrary to previous proposals. Functional connectivity between angular gyrus and left inferior frontal gyrus and left middle temporal gyrus increased when performing the AV task as naming. The results are consistent with the hypothesis that, at the spatial resolution of fMRI, the regions that facilitate non-linguistic AV associations are a subset of those that facilitate naming though reorganized into distinct networks. PMID:24130539

Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics

PubMed Central

Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.

2015-01-01

Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

Risk assessment of water pollution sources based on an integrated k-means clustering and set pair analysis method in the region of Shiyan, China.

PubMed

Li, Chunhui; Sun, Lian; Jia, Junxiang; Cai, Yanpeng; Wang, Xuan

2016-07-01

Source water areas are facing many potential water pollution risks. Risk assessment is an effective method to evaluate such risks. In this paper an integrated model based on k-means clustering analysis and set pair analysis was established aiming at evaluating the risks associated with water pollution in source water areas, in which the weights of indicators were determined through the entropy weight method. Then the proposed model was applied to assess water pollution risks in the region of Shiyan in which China's key source water area Danjiangkou Reservoir for the water source of the middle route of South-to-North Water Diversion Project is located. The results showed that eleven sources with relative high risk value were identified. At the regional scale, Shiyan City and Danjiangkou City would have a high risk value in term of the industrial discharge. Comparatively, Danjiangkou City and Yunxian County would have a high risk value in terms of agricultural pollution. Overall, the risk values of north regions close to the main stream and reservoir of the region of Shiyan were higher than that in the south. The results of risk level indicated that five sources were in lower risk level (i.e., level II), two in moderate risk level (i.e., level III), one in higher risk level (i.e., level IV) and three in highest risk level (i.e., level V). Also risks of industrial discharge are higher than that of the agricultural sector. It is thus essential to manage the pillar industry of the region of Shiyan and certain agricultural companies in the vicinity of the reservoir to reduce water pollution risks of source water areas. Copyright © 2016 Elsevier B.V. All rights reserved.

Quadrilateral finite element mesh coarsening

DOEpatents

Staten, Matthew L; Dewey, Mark W; Benzley, Steven E

2012-10-16

Techniques for coarsening a quadrilateral mesh are described. These techniques include identifying a coarsening region within the quadrilateral mesh to be coarsened. Quadrilateral elements along a path through the coarsening region are removed. Node pairs along opposite sides of the path are identified. The node pairs along the path are then merged to collapse the path.

Aquaporin 2 of Rhipicephalus (Boophilus) microplus as a potential target to control ticks and tick-borne parasites

USDA-ARS?s Scientific Manuscript database

In a collaboration with Washington State University and ARS-Pullman, WA researchers, we identified and sequenced a 1,059 base pair Rhipicephalus microplus transcript that contained the coding region for a water channel protein, Aquaporin 2 (RmAQP2). The clone sequencing resulted in the production of...

Acetylcholinesterase 1 in populations of organophosphate resistant North American strains of the cattle tick, Rhipicephalus microplus (Acari: Ixodidae)

USDA-ARS?s Scientific Manuscript database

In a collaboration with Purdue University researchers, we sequenced a 143,606 base pair Rhipicephalus microplus BAC library clone that contained the coding region for acetylcholinesterase 1 (AChE1). Sequencing was by Sanger protocols and the final assembly resulted in 15 contigs of varying length, e...

Evolutionary consequences of putative intra- and interspecific hybridiation in agaric fungi

Treesearch

Karen W. Hughes; Ronald H. Petersen; D. Jean Lodge; Sarah E. Bergemann; Kendra Baumgartner; Rodham E. Tulloss; Edgar Lickey; Joaquin. Cifuentes

2013-01-01

Agaric fungi of the southern Appalachian Mountains including Great Smoky Mountains National Park are often heterozygous for the rDNA internal transcribed spacer region (ITS) with .42% of collections showing some heterozygosity for indels and/or base-pair substitutions. For these collections, intra-individual haplotype divergence is typically less than 2%, but for 3% of...

Effect of removing understory on growth of upland oak

Treesearch

Martin E. Dale

1975-01-01

The amount of additional growth attributed to complete eradication of all woody understory vegetation varied for several widely scattered upland oak stands in the region. Based on paired-plot comparisons of 10 or more years' results, basal-area and cubic-volume growth usually increased slightly when the understory was eradicated. The amount of increase was related...

Detecting multiple moving objects in crowded environments with coherent motion regions

DOEpatents

Cheriyadat, Anil M.; Radke, Richard J.

2013-06-11

Coherent motion regions extend in time as well as space, enforcing consistency in detected objects over long time periods and making the algorithm robust to noisy or short point tracks. As a result of enforcing the constraint that selected coherent motion regions contain disjoint sets of tracks defined in a three-dimensional space including a time dimension. An algorithm operates directly on raw, unconditioned low-level feature point tracks, and minimizes a global measure of the coherent motion regions. At least one discrete moving object is identified in a time series of video images based on the trajectory similarity factors, which is a measure of a maximum distance between a pair of feature point tracks.

Recent population size, trends, and limiting factors for the double-crested Cormorant in Western North America

USGS Publications Warehouse

Adkins, Jessica Y.; Roby, Daniel D.; Lyons, Donald E.; Courtot, Karen N.; Collis, Ken; Carter, Harry R.; Shuford, W. David; Capitolo, Phillip J.

2014-01-01

The status of the double-crested cormorant (Phalacrocorax auritus) in western North America was last evaluated during 1987–2003. In the interim, concern has grown over the potential impact of predation by double-crested cormorants on juvenile salmonids (Oncorhynchusspp.), particularly in the Columbia Basin and along the Pacific coast where some salmonids are listed for protection under the United States Endangered Species Act. Recent re-evaluations of double-crested cormorant management at the local, flyway, and federal level warrant further examination of the current population size and trends in western North America. We collected colony size data for the western population (British Columbia, Washington, Oregon, Idaho, California, Nevada, Utah, Arizona, and the portions of Montana, Wyoming, Colorado and New Mexico west of the Continental Divide) by conducting aircraft-, boat-, or ground-based surveys and by cooperating with government agencies, universities, and non-profit organizations. In 2009, we estimated approximately 31,200 breeding pairs in the western population. We estimated that cormorant numbers in the Pacific Region (British Columbia, Washington, Oregon, and California) increased 72% from 1987–1992 to circa 2009. Based on the best available data for this period, the average annual growth rate (λ) of the number of breeding birds in the Pacific Region was 1.03, versus 1.07 for the population east of the Continental Divide during recent decades. Most of the increase in the Pacific Region can be attributed to an increase in the size of the nesting colony on East Sand Island in the Columbia River estuary, which accounts for about 39% of all breeding pairs in the western population and is the largest known breeding colony for the species (12,087 breeding pairs estimated in 2009). In contrast, numbers of breeding pairs estimated in coastal British Columbia and Washington have declined by approximately 66% during this same period. Disturbance at breeding colonies by bald eagles (Haliaeetus leucocephalus) and humans are likely limiting factors on the growth of the western population at present. Because of differences in biology and management, the western population of double-crested cormorants warrants consideration as a separate management unit from the population east of the Continental Divide.

An Effective Big Data Supervised Imbalanced Classification Approach for Ortholog Detection in Related Yeast Species

PubMed Central

Galpert, Deborah; del Río, Sara; Herrera, Francisco; Ancede-Gallardo, Evys; Antunes, Agostinho; Agüero-Chapin, Guillermin

2015-01-01

Orthology detection requires more effective scaling algorithms. In this paper, a set of gene pair features based on similarity measures (alignment scores, sequence length, gene membership to conserved regions, and physicochemical profiles) are combined in a supervised pairwise ortholog detection approach to improve effectiveness considering low ortholog ratios in relation to the possible pairwise comparison between two genomes. In this scenario, big data supervised classifiers managing imbalance between ortholog and nonortholog pair classes allow for an effective scaling solution built from two genomes and extended to other genome pairs. The supervised approach was compared with RBH, RSD, and OMA algorithms by using the following yeast genome pairs: Saccharomyces cerevisiae-Kluyveromyces lactis, Saccharomyces cerevisiae-Candida glabrata, and Saccharomyces cerevisiae-Schizosaccharomyces pombe as benchmark datasets. Because of the large amount of imbalanced data, the building and testing of the supervised model were only possible by using big data supervised classifiers managing imbalance. Evaluation metrics taking low ortholog ratios into account were applied. From the effectiveness perspective, MapReduce Random Oversampling combined with Spark SVM outperformed RBH, RSD, and OMA, probably because of the consideration of gene pair features beyond alignment similarities combined with the advances in big data supervised classification. PMID:26605337

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ichinose, G. A.; Myers, S. C.; Ford, S. R.

Here, we performed relative locations of six event pairs based on surface wave (SW) and body wave (BW) differential traveltimes of the 9 September 2016, 6 January 2016, 12 February 2013, and 25 May 2009 announced North Korea nuclear explosions. The SW relative locations for the 25 May 2009 and 12 February 2013 events were inconsistent with the BWs when paired with other events, and only the 6 January 2016/9 September 2016 pair was consistent. Apparent SW phase shift is investigated with respect to the BW relative locations. The pairs formed with the 25 May 2009 and 12 February 2013more » events, beneath the southeast slope of Mount Mant'ap, have the largest phase shifts and amplitude ratio deviations, whereas the least deviation was from the 6 January 2016 and 9 September 2016 event pair beneath the mountain peak. Regional moment tensors (MTs) predict the amplitude ratios but do not resolve the relative phase. We find that MTs with 10% difference in isotropic and rotated +CLVD can fit both relative phase and amplitude ratios. SW relative locations of highly isotropic and correlated explosion clusters can be affected by topography and small differences in MT.« less

An Effective Big Data Supervised Imbalanced Classification Approach for Ortholog Detection in Related Yeast Species.

PubMed

Galpert, Deborah; Del Río, Sara; Herrera, Francisco; Ancede-Gallardo, Evys; Antunes, Agostinho; Agüero-Chapin, Guillermin

2015-01-01

Orthology detection requires more effective scaling algorithms. In this paper, a set of gene pair features based on similarity measures (alignment scores, sequence length, gene membership to conserved regions, and physicochemical profiles) are combined in a supervised pairwise ortholog detection approach to improve effectiveness considering low ortholog ratios in relation to the possible pairwise comparison between two genomes. In this scenario, big data supervised classifiers managing imbalance between ortholog and nonortholog pair classes allow for an effective scaling solution built from two genomes and extended to other genome pairs. The supervised approach was compared with RBH, RSD, and OMA algorithms by using the following yeast genome pairs: Saccharomyces cerevisiae-Kluyveromyces lactis, Saccharomyces cerevisiae-Candida glabrata, and Saccharomyces cerevisiae-Schizosaccharomyces pombe as benchmark datasets. Because of the large amount of imbalanced data, the building and testing of the supervised model were only possible by using big data supervised classifiers managing imbalance. Evaluation metrics taking low ortholog ratios into account were applied. From the effectiveness perspective, MapReduce Random Oversampling combined with Spark SVM outperformed RBH, RSD, and OMA, probably because of the consideration of gene pair features beyond alignment similarities combined with the advances in big data supervised classification.

Comparison and Validation of Some ITS Primer Pairs Useful for Fungal Metabarcoding Studies

PubMed Central

Op De Beeck, Michiel; Lievens, Bart; Busschaert, Pieter; Declerck, Stéphan; Vangronsveld, Jaco; Colpaert, Jan V.

2014-01-01

Current metabarcoding studies aiming to characterize microbial communities generally rely on the amplification and sequencing of relatively short DNA regions. For fungi, the internal transcribed spacer (ITS) region in the ribosomal RNA (rRNA) operon has been accepted as the formal fungal barcode. Despite an increasing number of fungal metabarcoding studies, the amplification efficiency of primers is generally not tested prior to their application in metabarcoding studies. Some of the challenges that metabarcoding primers should overcome efficiently are the amplification of target DNA strands in samples rich in non-target DNA and environmental pollutants, such as humic acids, that may have been co-extracted with DNA. In the current study, three selected primer pairs were tested for their suitability as fungal metabarcoding primers. The selected primer pairs include two primer pairs that have been frequently used in fungal metabarcoding studies (ITS1F/ITS2 and ITS3/ITS4) and a primer pair (ITS86F/ITS4) that has been shown to efficiently amplify the ITS2 region of a broad range of fungal taxa in environmental soil samples. The selected primer pairs were evaluated in a 454 amplicon pyrosequencing experiment, real-time PCR (qPCR) experiments and in silico analyses. Results indicate that experimental evaluation of primers provides valuable information that could aid in the selection of suitable primers for fungal metabarcoding studies. Furthermore, we show that the ITS86F/ITS4 primer pair outperforms other primer pairs tested in terms of in silico primer efficiency, PCR efficiency, coverage, number of reads and number of species-level operational taxonomic units (OTUs) obtained. These traits push the ITS86F/ITS4 primer pair forward as highly suitable for studying fungal diversity and community structures using DNA metabarcoding. PMID:24933453

Nucleic acid duplexes incorporating a dissociable covalent base pair

NASA Technical Reports Server (NTRS)

Gao, K.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

1999-01-01

We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure.

Higgs Pair Production as a Signal of Enhanced Yukawa Couplings

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bauer, Martin; Carena, Marcela; Carmona, Adrián

We present a non-trivial correlation between the enhancement of the Higgs-fermion couplings and the Higgs pair production cross section in two Higgs doublet models with a flavour symmetry. This symmetry suppresses flavour-changing neutral couplings of the Higgs boson and allows for a partial explanation of the hierarchy in the Yukawa sector. After taking into account the constraints from electroweak precision measurements, Higgs coupling strength measurements, and unitarity and perturbativity bounds, we identify an interesting region of parameter space leading to enhanced Yukawa couplings as well as enhanced di-Higgs gluon fusion production at the LHC reach. This effect is visible inmore » both the resonant and non-resonant contributions to the Higgs pair production cross section. We encourage dedicated searches based on differential distributions as a novel way to indirectly probe enhanced Higgs couplings to light fermions.« less

Density functional theory study on the ionic liquid pyridinium hydrogen sulfate

NASA Astrophysics Data System (ADS)

Tankov, Ivaylo; Yankova, Rumyana; Genieva, Svetlana; Mitkova, Magdalena; Stratiev, Dicho

2017-07-01

The geometry, electronic structure and chemical reactivity of a pyridinium-based ionic liquid, pyridinium hydrogen sulfate ([H-Pyr]+[HSO4]-), have been discussed on the basis of quantum chemical density functional theory calculations using B3LYP/6-311+G(d,p) and B3LYP/6-311++G(2d,2p) approaches. The calculations indicated that [H-Pyr]+[HSO4]- exists in the form of an ion pair. A large electropositive potential was found on the pyridinium ring, while the regions of a negative electrostatic potential is linked with the lone pair of electronegative oxygen atoms in hydrogen sulfate anion ([HSO4]-). Electron transfer both within the anion, and between the anion and cation of an ion pair were described using natural bond orbital theory. The energy values of -7.1375 and -2.8801 eV were related to HOMO and LUMO orbitals, respectively.

Topological superfluids with finite-momentum pairing and Majorana fermions.

PubMed

Qu, Chunlei; Zheng, Zhen; Gong, Ming; Xu, Yong; Mao, Li; Zou, Xubo; Guo, Guangcan; Zhang, Chuanwei

2013-01-01

Majorana fermions (MFs), quantum particles that are their own antiparticles, are not only of fundamental importance in elementary particle physics and dark matter, but also building blocks for fault-tolerant quantum computation. Recently MFs have been intensively studied in solid state and cold atomic systems. These studies are generally based on superconducting pairing with zero total momentum. On the other hand, finite total momentum Cooper pairings, known as Fulde-Ferrell (FF) Larkin-Ovchinnikov (LO) states, were widely studied in many branches of physics. However, whether FF and LO superconductors can support MFs has not been explored. Here we show that MFs can exist in certain types of gapped FF states, yielding a new quantum matter: topological FF superfluids/superconductors. We demonstrate the existence of such topological FF superfluids and the associated MFs using spin-orbit-coupled degenerate Fermi gases and derive their parameter regions. The implementation of topological FF superconductors in semiconductor/superconductor heterostructures is also discussed.

High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

PubMed

Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

2015-11-02

Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Parallel computation of genome-scale RNA secondary structure to detect structural constraints on human genome.

PubMed

Kawaguchi, Risa; Kiryu, Hisanori

2016-05-06

RNA secondary structure around splice sites is known to assist normal splicing by promoting spliceosome recognition. However, analyzing the structural properties of entire intronic regions or pre-mRNA sequences has been difficult hitherto, owing to serious experimental and computational limitations, such as low read coverage and numerical problems. Our novel software, "ParasoR", is designed to run on a computer cluster and enables the exact computation of various structural features of long RNA sequences under the constraint of maximal base-pairing distance. ParasoR divides dynamic programming (DP) matrices into smaller pieces, such that each piece can be computed by a separate computer node without losing the connectivity information between the pieces. ParasoR directly computes the ratios of DP variables to avoid the reduction of numerical precision caused by the cancellation of a large number of Boltzmann factors. The structural preferences of mRNAs computed by ParasoR shows a high concordance with those determined by high-throughput sequencing analyses. Using ParasoR, we investigated the global structural preferences of transcribed regions in the human genome. A genome-wide folding simulation indicated that transcribed regions are significantly more structural than intergenic regions after removing repeat sequences and k-mer frequency bias. In particular, we observed a highly significant preference for base pairing over entire intronic regions as compared to their antisense sequences, as well as to intergenic regions. A comparison between pre-mRNAs and mRNAs showed that coding regions become more accessible after splicing, indicating constraints for translational efficiency. Such changes are correlated with gene expression levels, as well as GC content, and are enriched among genes associated with cytoskeleton and kinase functions. We have shown that ParasoR is very useful for analyzing the structural properties of long RNA sequences such as mRNAs, pre-mRNAs, and long non-coding RNAs whose lengths can be more than a million bases in the human genome. In our analyses, transcribed regions including introns are indicated to be subject to various types of structural constraints that cannot be explained from simple sequence composition biases. ParasoR is freely available at https://github.com/carushi/ParasoR .

THz spectra and corresponding vibrational modes of DNA base pair cocrystals and polynucleotides.

PubMed

Wang, Fang; Zhao, Dongbo; Dong, Hao; Jiang, Ling; Huang, Lin; Liu, Yunfei; Li, Shuhua

2018-07-05

The generalized energy-based fragmentation (GEBF) approach has been applied to study the THz spectra and vibrational modes of base pair cocrystals under periodic boundary conditions (denoted as PBC-GEBF). Results of vibrational mode reveal that hydrogen bonds play a pivotal role in the pairing process of base crystals, where most NH and CH bonds stretch to some extent. We also found that hydrogen bonds of a self-made A:T cocrystal completely break in a transition from liquid to the solid state, while self-made C:G cocrystal is different and easier to form a cocrystal, as confirmed by X-ray diffraction (XRD) and terahertz (THz) spectra. Furthermore, we have studied DNA polynucleotides (in both A and B forms) found that the vibrational modes changed a lot during the process of their forming double strand. Despite the key role played by hydrogen bonds, the key contribution originates from collective motions of the main skeleton. A comparative study of the spectra of some stranded fragments suggests that different sequences or forms have similar spectra in THz band. They distinguish from each other mainly in the low-frequency regions, especially below 1 THz. This study would make great contributions to the molecular dynamics model based DNA long-chain structure simulation in the future study. Copyright © 2018 Elsevier B.V. All rights reserved.

Molecular basis of length polymorphism in the human zeta-globin gene complex.

PubMed Central

Goodbourn, S E; Higgs, D R; Clegg, J B; Weatherall, D J

1983-01-01

The length polymorphism between the human zeta-globin gene and its pseudogene is caused by an allele-specific variation in the copy number of a tandemly repeating 36-base-pair sequence. This sequence is related to a tandemly repeated 14-base-pair sequence in the 5' flanking region of the human insulin gene, which is known to cause length polymorphism, and to a repetitive sequence in intervening sequence (IVS) 1 of the pseudo-zeta-globin gene. Evidence is presented that the latter is also of variable length, probably because of differences in the copy number of the tandem repeat. The homology between the three length polymorphisms may be an indication of the presence of a more widespread group of related sequences in the human genome, which might be useful for generalized linkage studies. PMID:6308667

Mapping the Regional Influence of Genetics on Brain Structure Variability - A Tensor-Based Morphometry Study

PubMed Central

Brun, Caroline; Leporé, Natasha; Pennec, Xavier; Lee, Agatha D.; Barysheva, Marina; Madsen, Sarah K.; Avedissian, Christina; Chou, Yi-Yu; de Zubicaray, Greig I.; McMahon, Katie; Wright, Margaret; Toga, Arthur W.; Thompson, Paul M.

2010-01-01

Genetic and environmental factors influence brain structure and function profoundly The search for heritable anatomical features and their influencing genes would be accelerated with detailed 3D maps showing the degree to which brain morphometry is genetically determined. As part of an MRI study that will scan 1150 twins, we applied Tensor-Based Morphometry to compute morphometric differences in 23 pairs of identical twins and 23 pairs of same-sex fraternal twins (mean age: 23.8 ± 1.8 SD years). All 92 twins’ 3D brain MRI scans were nonlinearly registered to a common space using a Riemannian fluid-based warping approach to compute volumetric differences across subjects. A multi-template method was used to improve volume quantification. Vector fields driving each subject’s anatomy onto the common template were analyzed to create maps of local volumetric excesses and deficits relative to the standard template. Using a new structural equation modeling method, we computed the voxelwise proportion of variance in volumes attributable to additive (A) or dominant (D) genetic factors versus shared environmental (C) or unique environmental factors (E). The method was also applied to various anatomical regions of interest (ROIs). As hypothesized, the overall volumes of the brain, basal ganglia, thalamus, and each lobe were under strong genetic control; local white matter volumes were mostly controlled by common environment. After adjusting for individual differences in overall brain scale, genetic influences were still relatively high in the corpus callosum and in early-maturing brain regions such as the occipital lobes, while environmental influences were greater in frontal brain regions which have a more protracted maturational time-course. PMID:19446645

AfterQC: automatic filtering, trimming, error removing and quality control for fastq data.

PubMed

Chen, Shifu; Huang, Tanxiao; Zhou, Yanqing; Han, Yue; Xu, Mingyan; Gu, Jia

2017-03-14

Some applications, especially those clinical applications requiring high accuracy of sequencing data, usually have to face the troubles caused by unavoidable sequencing errors. Several tools have been proposed to profile the sequencing quality, but few of them can quantify or correct the sequencing errors. This unmet requirement motivated us to develop AfterQC, a tool with functions to profile sequencing errors and correct most of them, plus highly automated quality control and data filtering features. Different from most tools, AfterQC analyses the overlapping of paired sequences for pair-end sequencing data. Based on overlapping analysis, AfterQC can detect and cut adapters, and furthermore it gives a novel function to correct wrong bases in the overlapping regions. Another new feature is to detect and visualise sequencing bubbles, which can be commonly found on the flowcell lanes and may raise sequencing errors. Besides normal per cycle quality and base content plotting, AfterQC also provides features like polyX (a long sub-sequence of a same base X) filtering, automatic trimming and K-MER based strand bias profiling. For each single or pair of FastQ files, AfterQC filters out bad reads, detects and eliminates sequencer's bubble effects, trims reads at front and tail, detects the sequencing errors and corrects part of them, and finally outputs clean data and generates HTML reports with interactive figures. AfterQC can run in batch mode with multiprocess support, it can run with a single FastQ file, a single pair of FastQ files (for pair-end sequencing), or a folder for all included FastQ files to be processed automatically. Based on overlapping analysis, AfterQC can estimate the sequencing error rate and profile the error transform distribution. The results of our error profiling tests show that the error distribution is highly platform dependent. Much more than just another new quality control (QC) tool, AfterQC is able to perform quality control, data filtering, error profiling and base correction automatically. Experimental results show that AfterQC can help to eliminate the sequencing errors for pair-end sequencing data to provide much cleaner outputs, and consequently help to reduce the false-positive variants, especially for the low-frequency somatic mutations. While providing rich configurable options, AfterQC can detect and set all the options automatically and require no argument in most cases.

Power law X- and gamma-ray emission from relativistic thermal plasmas

NASA Technical Reports Server (NTRS)

Zdziarski, A. A.

1984-01-01

Pair equilibrium in thermal plasmas emitting power law photon spectra by repeated Compton scatterings of a soft photon source active galactic nuclei was studied. Dependence of the spectral index on optical thickness and on temperature of the plasma is discussed. The equation for pair equilibrium is solved for the maximum steady luminosity. Analytical solutions for the subrelativistic region, and for the ultrarelativistic region are found. In the transrelativistic region the solutions are expressed by single integrals over the pair production cross sections, performed numerically. The constraints on soft photon source imposed by the condition that the soft photon flux cannot exceed the black-body flux are considered. For the Comptonized synchrotron radiation model a relation between magnetic field strength and output luminosity is found.

Meiotic cytology and chromosome behaviour in wild-type Arabidopsis thaliana.

PubMed

Armstrong, Susan J; Jones, Gareth H

2003-01-01

This article reviews the historical development of cytology and cytogenetics in Arabidopsis, and summarizes recent developments in molecular cytogenetics, with special emphasis on meiotic studies. Despite the small genome and small chromosomes of Arabidopsis, considerable progress has been made in developing appropriate cytogenetical techniques for chromosome analysis. Fluorescence in situ hybridization (FISH) applied to extended meiotic pachytene chromosomes has resulted in a standardized karyotype (idiogram) for the species that has also been aligned with the genetical map. A better understanding of floral and meiotic development has been achieved by combining cytological studies, based on both sectioning and spreading techniques, with morphometric data and developmental landmarks. The meiotic interphase, preceding prophase I, has been investigated by marking the nuclei undergoing DNA replication with BrdU. This allowed the subclasses of meiotic interphase to be distinguished and also provided a means to time the duration of meiosis and its constituent phases. The FISH technique has been used to analyse in detail the meiotic organization of telomeres and centromeric regions. The results indicate that centromere regions do not play an active role in chromosome pairing and synapsis; however, telomeres pair homologously in advance of general chromosome synapsis. The FISH technique is currently being applied to analysing the pairing and synapsis of interstitial chromosome regions through interphase and prophase I. FISH probes also allow the five bivalents of Arabidopsis to be identified at metaphase I and this has permitted an analysis of chiasma frequencies in individual bivalents, both in wild-type Arabidopsis and in two meiotic mutants.

Patterns of Activity in A Global Model of A Solar Active Region

NASA Technical Reports Server (NTRS)

Bradshaw, S. J.; Viall, N. M.

2016-01-01

In this work we investigate the global activity patterns predicted from a model active region heated by distributions of nanoflares that have a range of frequencies. What differs is the average frequency of the distributions. The activity patterns are manifested in time lag maps of narrow-band instrument channel pairs. We combine hydrodynamic and forward modeling codes with a magnetic field extrapolation to create a model active region and apply the time lag method to synthetic observations. Our aim is not to reproduce a particular set of observations in detail, but to recover some typical properties and patterns observed in active regions. Our key findings are the following. (1) Cooling dominates the time lag signature and the time lags between the channel pairs are generally consistent with observed values. (2) Shorter coronal loops in the core cool more quickly than longer loops at the periphery. (3) All channel pairs show zero time lag when the line of sight passes through coronal loop footpoints. (4) There is strong evidence that plasma must be re-energized on a timescale comparable to the cooling timescale to reproduce the observed coronal activity, but it is likely that a relatively broad spectrum of heating frequencies are operating across active regions. (5) Due to their highly dynamic nature, we find nanoflare trains produce zero time lags along entire flux tubes in our model active region that are seen between the same channel pairs in observed active regions.

The nearest neighbor and next nearest neighbor effects on the thermodynamic and kinetic properties of RNA base pair

NASA Astrophysics Data System (ADS)

Wang, Yujie; Wang, Zhen; Wang, Yanli; Liu, Taigang; Zhang, Wenbing

2018-01-01

The thermodynamic and kinetic parameters of an RNA base pair with different nearest and next nearest neighbors were obtained through long-time molecular dynamics simulation of the opening-closing switch process of the base pair near its melting temperature. The results indicate that thermodynamic parameters of GC base pair are dependent on the nearest neighbor base pair, and the next nearest neighbor base pair has little effect, which validated the nearest-neighbor model. The closing and opening rates of the GC base pair also showed nearest neighbor dependences. At certain temperature, the closing and opening rates of the GC pair with nearest neighbor AU is larger than that with the nearest neighbor GC, and the next nearest neighbor plays little role. The free energy landscape of the GC base pair with the nearest neighbor GC is rougher than that with nearest neighbor AU.

[Structural and Dipole Structure Peculiarities of Hoogsteen Base Pairs Formed in Complementary Nucleobases according to ab initio Quantum Mechanics Studies].

PubMed

Petrenko, Y M

2015-01-01

Ab initio quantum mechanics studies for the detection of structure and dipole structure peculiarities of Hoogsteen base pairs relative to Watson-Crick base pairs, were performed during our work. These base pairs are formed as a result of complementary interactions. It was revealed, that adenine-thymine Hoogsteen base pair and adenine-thymine Watson-Crick base pairs can be formed depending on initial configuration. Cytosine-guanine Hoogsteen pairs are formed only when cytosine was originally protonated. Both types of Hoogsteen pairs have noticeable difference in the bond distances and angles. These differences appeared in purine as well as in pyrimidine parts of the pairs. Hoogsteen pairs have mostly shorter hydrogen bond lengths and significantly larger angles of hydrogen bonds and larger angles between the hydrogen bonds than Watson-Crick base pairs. Notable differences are also observed with respect to charge distribution and dipole moment. Quantitative data on these differences are shown in our work. It is also reported that the values of local parameters (according to Cambridge classification of the parameters which determine DNA properties) in Hoogsteen base pairs, are greatly different from Watson-Crick ones.

The path to memory is guided by strategy: distinct networks are engaged in associative encoding under visual and verbal strategy and influence memory performance in healthy and impaired individuals

PubMed Central

Hales, J. B.; Brewer, J. B.

2018-01-01

Given the diversity of stimuli encountered in daily life, a variety of strategies must be used for learning new information. Relating and encoding visual and verbal stimuli into memory has been probed using various tasks and stimulus-types. Engagement of specific subsequent memory and cortical processing regions depends on the stimulus modality of studied material; however, it remains unclear whether different encoding strategies similarly influence regional activity when stimulus-type is held constant. In this study, subjects encoded object pairs using a visual or verbal associative strategy during functional magnetic resonance imaging (fMRI), and subsequent memory was assessed for pairs encoded under each strategy. Each strategy elicited distinct regional processing and subsequent memory effects: middle / superior frontal, lateral parietal, and lateral occipital for visually-associated pairs and inferior frontal, medial frontal, and medial occipital for verbally-associated pairs. This regional selectivity mimics the effects of stimulus modality, suggesting that cortical involvement in associative encoding is driven by strategy, and not simply by stimulus-type. The clinical relevance of these findings, probed in two patients with recent aphasic strokes, suggest that training with strategies utilizing unaffected cortical regions might improve memory ability in patients with brain damage. PMID:22390467

Nucleic acid duplexes incorporating a dissociable covalent base pair

PubMed Central

Gao, Kui; Orgel, Leslie E.

1999-01-01

We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure. PMID:10611299

Spectra from pair-equilibrium plasmas

NASA Technical Reports Server (NTRS)

Zdziarski, A. A.

1984-01-01

A numerical model of relativistic nonmagnetized plasma with uniform temperature and electron density distributions is considered, and spectra from plasma in pair equilibrium are studied. A range of dimensionless temperature (T) greater than about 0.2 is considered. The spectra from low pair density plasmas in pair equilibrium vary from un-Comptonized bremsstrahlung spectra at Thomson cross section tau(N) much less than one to Comptonized bremsstrahlung spectra with tau(N) over one. For high pair density plasmas the spectra are flat for T greater than about one, and have broad intensity peaks at energy roughly equal to 3T for T less than one. In the latter region the total luminosity is approximately twice the annihilation luminosity. All spectra are flat in the X-ray region, in contradiction to observed AGN spectra. For dimensionless luminosity greater than about 100, the cooling time becomes shorter than the Thomson time.

Stabilised DNA secondary structures with increasing transcription localise hypermutable bases for somatic hypermutation in IGHV3-23.

PubMed

Duvvuri, Bhargavi; Duvvuri, Venkata R; Wu, Jianhong; Wu, Gillian E

2012-07-01

Somatic hypermutation (SHM) mediated by activation-induced cytidine deaminase (AID) is a transcription-coupled mechanism most responsible for generating high affinity antibodies. An issue remaining enigmatic in SHM is how AID is preferentially targeted during transcription to hypermutable bases in its substrates (WRC motifs) on both DNA strands. AID targets only single stranded DNA. By modelling the dynamical behaviour of IGHV3-23 DNA, a commonly used human variable gene segment, we observed that hypermutable bases on the non-transcribed strand are paired whereas those on transcribed strand are mostly unpaired. Hypermutable bases (both paired and unpaired) are made accessible to AID in stabilised secondary structures formed with increasing transcription levels. This observation provides a rationale for the hypermutable bases on both the strands of DNA being targeted to a similar extent despite having differences in unpairedness. We propose that increasing transcription and RNAP II stalling resulting in the formation and stabilisation of stem-loop structures with AID hotspots in negatively supercoiled region can localise the hypermutable bases of both strands of DNA, to AID-mediated SHM.

WHERE DO WET, DRY, AND MIXED GALAXY MERGERS OCCUR? A STUDY OF THE ENVIRONMENTS OF CLOSE GALAXY PAIRS IN THE DEEP2 GALAXY REDSHIFT SURVEY

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Lihwai; Cooper, Michael C.; Willmer, Christopher N. A.

2010-08-01

We study the environments of wet, dry, and mixed galaxy mergers at 0.75 < z < 1.2 using close pairs in the DEEP2 Galaxy Redshift Survey. We find that the typical environment of dry and mixed merger candidates is denser than that of wet mergers, mostly due to the color-density relation. While the galaxy companion rate (N{sub c}) is observed to increase with overdensity, using N-body simulations, we find that the fraction of pairs that will eventually merge decreases with the local density, predominantly because interlopers are more common in dense environments. After taking into account the merger probability ofmore » pairs as a function of local density, we find only marginal environment dependence of the galaxy merger rate for wet mergers. On the other hand, the dry and mixed merger rates increase rapidly with local density due to the increased population of red galaxies in dense environments, implying that the dry and mixed mergers are most effective in overdense regions. We also find that the environment distribution of K+A galaxies is similar to that of wet mergers alone and of wet+mixed mergers, suggesting a possible connection between K+A galaxies and wet and/or wet+mixed mergers. Based on our results, we therefore expect that the properties, including structures and masses, of red-sequence galaxies should be different between those in underdense regions and those in overdense regions since the dry mergers are significantly more important in dense environments. We conclude that, as early as z {approx} 1, high-density regions are the preferred environment in which dry mergers occur, and that present-day red-sequence galaxies in overdense environments have, on average, undergone 1.2 {+-} 0.3 dry mergers since this time, accounting for (38 {+-} 10)% of their mass accretion in the last 8 billion years. The main uncertainty in this finding is the conversion from the pair fraction to the galaxy merger rate, which is possibly as large as a factor of 2. Our findings suggest that dry mergers are crucial in the mass assembly of massive red galaxies in dense environments, such as brightest cluster galaxies in galaxy groups and clusters.« less

Targeting Conserved Genes in Fusarium Species.

PubMed

Gil-Serna, Jéssica; Patiño, Belén; Jurado, Miguel; Mirete, Salvador; Vázquez, Covadonga; González-Jaén, M Teresa

2017-01-01

Fumonisins are important mycotoxins contaminating foods and feeds which are mainly produced by F. verticillioides and F. proliferatum. Additionally, both are pathogens of maize and other cereals. We describe two highly sensitive, rapid, and species-specific PCR protocols which enable detection and discrimination of these closely related species in cereal flour or grain samples. The specific primer pairs of these assays were based on the intergenic spacer region of the multicopy rDNA unit which highly improves the sensitivity of the PCR assay in comparison with single-copy target regions.

[High-resolution GTG-banding and nucleolar organizer regions of chromosomes of two vole species: Microtus rossiaemeridonionalis and M. transcaspicus (Rodentia, Arvicolidae)].

PubMed

Mazurok, N A; Rubtsova, N V; Isaenko, A A; Nesterova, T B; Meĭer, M N; Zakiian, S M

1998-08-01

With the use of the GTG-banding of prometaphase chromosomes, 503 and 402 segments were revealed in haploid chromosome sets of voles Microtus rossiaemeridionalis and M. transcaspicus, respectively. Based on a detailed study of chromosomes at different condensation levels, idiograms of M. rossiaemeridionalis and M. transcaspicus chromosomes were constructed. Sequential Ag-staining and GTG-banding allowed nucleolar organizer regions (NORs) to be localized in 16 and 11 chromosome pairs of M. rossiaemeridionalis and M. transcaspicus, respectively.

Alternate paddle configuration for improved wear resistance in the saltstone mixer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Reigel, M.; Fowley, M.

The Saltstone Production Facility has a 10-inch Readco-Kurimoto continuous mixer that mixes the premix dry feeds and low-level waste salt solution to make fresh (uncured) saltstone. Inspection of the mixer in January 2013 showed significant wear on the third, fourth and fifth paddle pairs after the conveying augers. A 2-inch Readco-Kurimoto continuous mixer was used to test alternate paddle configurations for use in the 10-inch mixer to decrease the wear rate on the paddles. Two wear tests were conducted to investigate a method of reducing wear on the mixer paddles. The first test (wear test 2a) had a paddle configurationmore » similar to the currently installed 10-inch mixer in the SPF. This test established baseline wear. The second test (wear test 2b) had a reconfigured paddle arrangement that replaced the flat paddles with helical paddles for paddle pairs 2 - 6 and aligned paddle pair 1 with the augers. The intent of the reconfiguration was to more effectively convey the partially wetted dry feeds through the transition region and into the liquid feed where paddle wear is reduced due to dry feeds and salt solution being mixed at the intended water to premix ratio. The design of the helical paddles provides conveyance through the transition region to the liquid feed inlet. The alignment with the auger is aimed to provide a smoother transition (minimizing the discontinuity between the auger and paddle pair 1) into the downstream paddles. A soft metal with low wear resistance (6000 series aluminum) was used for the wear testing paddles to determine wear patterns while minimizing run time and maximizing wear rate. For the two paddle configurations tested using the scaled 2-inch Readco-Kurimoto continuous mixer, with the first six paddles after the augers replaced by the wear paddles and the remaining paddles were stainless steel. Since the 10-inch SPF mixer is designed with the liquid inlet centered over paddle pairs 5 and 6, the scaled 2-inch mixer was configured the same way. The wear rate from wear test 2a was approximately double the wear rate from wear test 2b for paddle pairs 4 and 5. For both configurations, there was little or no wear on paddle pairs 1, 2, 3 and 6 based on mass change, indicating that the un-wetted and fully wetted premix materials cause less wear than the partially wetted premix. Additionally, inspection of the wear surface of the paddles showed more deformation on the flat paddles than the helical paddles which was consistent with the wear rates. Aligning of the auger discharge flight with paddle pair 1 resulted in a lower wear rate paddle pair 1 rather than having them misaligned with the feed augers. During the paddle wear tests, polishing wear was observed on the inside barrel of the mixer. The polishing wear is evident on the upper housing clamshell and the lower housing clamshell primarily at paddle pairs 4 and 5, which is the transition region of the mixer. Wear on the mixer barrel increases the space between the paddles and the barrel, resulting in increased grout build up on the barrel. Since the mixer barrel cannot be reconfigured or replaced in the SPF, the method for mitigating wear on the barrel is to move the more viscous grout through the transition region as quickly as possible. In addition, the location of the liquid inlet does not allow for sufficient cleaning of the mixer since residual grout remains on paddle pairs 1 - 4. As the paddles continue to wear and the self-cleaning capability of the paddles is lost, the lack of sufficient flushing would aid in grout build up between the barrel and the paddles which could eventually lead to decreased throughput capacity of the dry feeds. Changing the paddle configuration from flat to helical resulted in no change to the rheological properties of the grout mixture. Both tests produced a grout that is within the processing range of the SPF. Based on the results of this testing, it is recommended for the currently installed SPF mixer that paddle pairs 1 through 6 be helical rather than flat, with the paddle pair 1 aligned with the feed augers in order to minimize the wear occurring in the SPF mixer. Based on the results of this testing, it is recommended that the mixer be inspected and critical measurements be taken whenever the SPF processing schedule allows in order to establish a wear rate of the 10-inch mixer paddles.5 Based on these measurements, the lifetime of paddles in the transition region can be established in order to set up a maintenance schedule for the mixer. Since replacing the entire mixer is very expensive and time intensive, replacing the worn paddles after a specific time period would allow for planned shutdowns as well as process optimization such that the mixer throughput is not compromised. In addition, further testing should be performed to determine an alternate liquid inlet location to better flush the mixer of residual grout at the end of processing. Sufficiently cleaning the mixer will help eliminate another potential source of wear. Another potential method for reducing the wear rate in the mixer is to reduce the mixer speed without affecting the throughput capacity. Since wear rate is a function of impact velocity of the grout and mixing paddles, testing could be done using the 2-inch mixer determine the optimum mixer speed to reduce wear but not adversely impact facility operations (e.g. throughput capacity and grout properties).« less

Differential expression profiles of miRNAs induced by vaccination followed by Marek’s disease virus challenge at cytolytic stage in chickens resistant or susceptible to Marek’s disease

USDA-ARS?s Scientific Manuscript database

Mounting evidence shows microRNAs (miRNAs) directly regulate gene expression post-transcriptionally through base-pairing with regions in the 3’-untranslated sequences of target gene mRNAs, which results in dysregulation of gene expression/translation and subsequently modulates cellular processes. We...

Brain Regions Involved in the Retrieval of Spatial and Episodic Details Associated with a Familiar Environment: An fMRI Study

ERIC Educational Resources Information Center

Hirshhorn, Marnie; Grady, Cheryl; Rosenbaum, R. Shayna; Winocur, Gordon; Moscovitch, Morris

2012-01-01

Functional magnetic resonance imaging (fMRI) was used to compare brain activity during the retrieval of coarse- and fine-grained spatial details and episodic details associated with a familiar environment. Long-time Toronto residents compared pairs of landmarks based on their absolute geographic locations (requiring either coarse or fine…

Polyelectrolyte properties of single stranded DNA measured using SAXS and single molecule FRET: beyond the wormlike chain model

PubMed Central

Meisburger, Steve P.; Sutton, Julie L.; Chen, Huimin; Pabit, Suzette A.; Kirmizialtin, Serdal; Elber, Ron; Pollack, Lois

2013-01-01

Nucleic acids are highly charged polyelectrolytes that interact strongly with salt ions. Rigid, base-paired regions are successfully described with worm like chain models, but non base-paired single stranded regions have fundamentally different polymer properties because of their greater flexibility. Recently, attention has turned to single stranded nucleic acids due to the growing recognition of their biological importance, as well as the availability of sophisticated experimental techniques sensitive to the conformation of individual molecules. We investigate polyelectrolyte properties of poly(dT), an important and widely studied model system for flexible single stranded nucleic acids, in physiologically important mixed mono- and di-valent salt. We report measurements of the form factor and interparticle interactions using SAXS, end to end distances using smFRET, and number of excess ions using ASAXS. We present a coarse-grained model that accounts for flexibility, excluded volume, and electrostatic interactions in these systems. Predictions of the model are validated against experiment. We also discuss the state of all-atom, explicit solvent Molecular Dynamics simulations of poly(dT), the next step in understanding the complexities of ion interactions with these highly charged and flexible polymers. PMID:23606337

Subthalamic nucleus long-range synchronization—an independent hallmark of human Parkinson's disease

PubMed Central

Moshel, Shay; Shamir, Reuben R.; Raz, Aeyal; de Noriega, Fernando R.; Eitan, Renana; Bergman, Hagai; Israel, Zvi

2013-01-01

Beta-band synchronous oscillations in the dorsolateral region of the subthalamic nucleus (STN) of human patients with Parkinson's disease (PD) have been frequently reported. However, the correlation between STN oscillations and synchronization has not been thoroughly explored. The simultaneous recordings of 2390 multi-unit pairs recorded by two parallel microelectrodes (separated by fixed distance of 2 mm, n = 72 trajectories with two electrode tracks >4 mm STN span) in 57 PD patients undergoing STN deep brain stimulation surgery were analyzed. Automatic procedures were utilized to divide the STN into dorsolateral oscillatory and ventromedial non-oscillatory regions, and to quantify the intensity of STN oscillations and synchronicity. Finally, the synchronicity of simultaneously vs. non-simultaneously recorded pairs were compared using a shuffling procedure. Synchronization was observed predominately in the beta range and only between multi-unit pairs in the dorsolateral oscillatory region (n = 615). In paired recordings between sites in the dorsolateral and ventromedial (n = 548) and ventromedial-ventromedial region pairs (n = 1227), no synchronization was observed. Oscillation and synchronicity intensity decline along the STN dorsolateral-ventromedial axis suggesting a fuzzy border between the STN regions. Synchronization strength was significantly correlated to the oscillation power, but synchronization was no longer observed following shuffling. We conclude that STN long-range beta oscillatory synchronization is due to increased neuronal coupling in the Parkinsonian brain and does not merely reflect the outcome of oscillations at similar frequency. The neural synchronization in the dorsolateral (probably the motor domain) STN probably augments the pathological changes in firing rate and patterns of subthalamic neurons in PD patients. PMID:24312018

Partial Correlation-Based Retinotopically Organized Resting-State Functional Connectivity Within and Between Areas of the Visual Cortex Reflects More Than Cortical Distance

PubMed Central

Dawson, Debra Ann; Lam, Jack; Lewis, Lindsay B.; Carbonell, Felix; Mendola, Janine D.

2016-01-01

Abstract Numerous studies have demonstrated functional magnetic resonance imaging (fMRI)-based resting-state functional connectivity (RSFC) between cortical areas. Recent evidence suggests that synchronous fluctuations in blood oxygenation level-dependent fMRI reflect functional organization at a scale finer than that of visual areas. In this study, we investigated whether RSFCs within and between lower visual areas are retinotopically organized and whether retinotopically organized RSFC merely reflects cortical distance. Subjects underwent retinotopic mapping and separately resting-state fMRI. Visual areas V1, V2, and V3, were subdivided into regions of interest (ROIs) according to quadrants and visual field eccentricity. Functional connectivity (FC) was computed based on Pearson's linear correlation (correlation), and Pearson's linear partial correlation (correlation between two time courses after the time courses from all other regions in the network are regressed out). Within a quadrant, within visual areas, all correlation and nearly all partial correlation FC measures showed statistical significance. Consistently in V1, V2, and to a lesser extent in V3, correlation decreased with increasing eccentricity separation. Consistent with previously reported monkey anatomical connectivity, correlation/partial correlation values between regions from adjacent areas (V1-V2 and V2-V3) were higher than those between nonadjacent areas (V1-V3). Within a quadrant, partial correlation showed consistent significance between regions from two different areas with the same or adjacent eccentricities. Pairs of ROIs with similar eccentricity showed higher correlation/partial correlation than pairs distant in eccentricity. Between dorsal and ventral quadrants, partial correlation between common and adjacent eccentricity regions within a visual area showed statistical significance; this extended to more distant eccentricity regions in V1. Within and between quadrants, correlation decreased approximately linearly with increasing distances separating the tested ROIs. Partial correlation showed a more complex dependence on cortical distance: it decreased exponentially with increasing distance within a quadrant, but was best fit by a quadratic function between quadrants. We conclude that RSFCs within and between lower visual areas are retinotopically organized. Correlation-based FC is nonselectively high across lower visual areas, even between regions that do not share direct anatomical connections. The mechanisms likely involve network effects caused by the dense anatomical connectivity within this network and projections from higher visual areas. FC based on partial correlation, which minimizes network effects, follows expectations based on direct anatomical connections in the monkey visual cortex better than correlation. Last, partial correlation-based retinotopically organized RSFC reflects more than cortical distance effects. PMID:26415043

Partial Correlation-Based Retinotopically Organized Resting-State Functional Connectivity Within and Between Areas of the Visual Cortex Reflects More Than Cortical Distance.

PubMed

Dawson, Debra Ann; Lam, Jack; Lewis, Lindsay B; Carbonell, Felix; Mendola, Janine D; Shmuel, Amir

2016-02-01

Numerous studies have demonstrated functional magnetic resonance imaging (fMRI)-based resting-state functional connectivity (RSFC) between cortical areas. Recent evidence suggests that synchronous fluctuations in blood oxygenation level-dependent fMRI reflect functional organization at a scale finer than that of visual areas. In this study, we investigated whether RSFCs within and between lower visual areas are retinotopically organized and whether retinotopically organized RSFC merely reflects cortical distance. Subjects underwent retinotopic mapping and separately resting-state fMRI. Visual areas V1, V2, and V3, were subdivided into regions of interest (ROIs) according to quadrants and visual field eccentricity. Functional connectivity (FC) was computed based on Pearson's linear correlation (correlation), and Pearson's linear partial correlation (correlation between two time courses after the time courses from all other regions in the network are regressed out). Within a quadrant, within visual areas, all correlation and nearly all partial correlation FC measures showed statistical significance. Consistently in V1, V2, and to a lesser extent in V3, correlation decreased with increasing eccentricity separation. Consistent with previously reported monkey anatomical connectivity, correlation/partial correlation values between regions from adjacent areas (V1-V2 and V2-V3) were higher than those between nonadjacent areas (V1-V3). Within a quadrant, partial correlation showed consistent significance between regions from two different areas with the same or adjacent eccentricities. Pairs of ROIs with similar eccentricity showed higher correlation/partial correlation than pairs distant in eccentricity. Between dorsal and ventral quadrants, partial correlation between common and adjacent eccentricity regions within a visual area showed statistical significance; this extended to more distant eccentricity regions in V1. Within and between quadrants, correlation decreased approximately linearly with increasing distances separating the tested ROIs. Partial correlation showed a more complex dependence on cortical distance: it decreased exponentially with increasing distance within a quadrant, but was best fit by a quadratic function between quadrants. We conclude that RSFCs within and between lower visual areas are retinotopically organized. Correlation-based FC is nonselectively high across lower visual areas, even between regions that do not share direct anatomical connections. The mechanisms likely involve network effects caused by the dense anatomical connectivity within this network and projections from higher visual areas. FC based on partial correlation, which minimizes network effects, follows expectations based on direct anatomical connections in the monkey visual cortex better than correlation. Last, partial correlation-based retinotopically organized RSFC reflects more than cortical distance effects.

Molecular recognition of DNA base pairs by the formamido/pyrrole and formamido/imidazole pairings in stacked polyamides.

PubMed

Buchmueller, Karen L; Staples, Andrew M; Uthe, Peter B; Howard, Cameron M; Pacheco, Kimberly A O; Cox, Kari K; Henry, James A; Bailey, Suzanna L; Horick, Sarah M; Nguyen, Binh; Wilson, W David; Lee, Moses

2005-01-01

Polyamides containing an N-terminal formamido (f) group bind to the minor groove of DNA as staggered, antiparallel dimers in a sequence-specific manner. The formamido group increases the affinity and binding site size, and it promotes the molecules to stack in a staggered fashion thereby pairing itself with either a pyrrole (Py) or an imidazole (Im). There has not been a systematic study on the DNA recognition properties of the f/Py and f/Im terminal pairings. These pairings were analyzed here in the context of f-ImPyPy, f-ImPyIm, f-PyPyPy and f-PyPyIm, which contain the central pairing modes, -ImPy- and -PyPy-. The specificity of these triamides towards symmetrical recognition sites allowed for the f/Py and f/Im terminal pairings to be directly compared by SPR, CD and DeltaT (M) experiments. The f/Py pairing, when placed next to the -ImPy- or -PyPy- central pairings, prefers A/T and T/A base pairs to G/C base pairs, suggesting that f/Py has similar DNA recognition specificity to Py/Py. With -ImPy- central pairings, f/Im prefers C/G base pairs (>10 times) to the other Watson-Crick base pairs; therefore, f/Im behaves like the Py/Im pair. However, the f/Im pairing is not selective for the C/G base pair when placed next to the -PyPy- central pairings.

Feature-Based Retinal Image Registration Using D-Saddle Feature

PubMed Central

Hasikin, Khairunnisa; A. Karim, Noor Khairiah; Ahmedy, Fatimah

2017-01-01

Retinal image registration is important to assist diagnosis and monitor retinal diseases, such as diabetic retinopathy and glaucoma. However, registering retinal images for various registration applications requires the detection and distribution of feature points on the low-quality region that consists of vessels of varying contrast and sizes. A recent feature detector known as Saddle detects feature points on vessels that are poorly distributed and densely positioned on strong contrast vessels. Therefore, we propose a multiresolution difference of Gaussian pyramid with Saddle detector (D-Saddle) to detect feature points on the low-quality region that consists of vessels with varying contrast and sizes. D-Saddle is tested on Fundus Image Registration (FIRE) Dataset that consists of 134 retinal image pairs. Experimental results show that D-Saddle successfully registered 43% of retinal image pairs with average registration accuracy of 2.329 pixels while a lower success rate is observed in other four state-of-the-art retinal image registration methods GDB-ICP (28%), Harris-PIIFD (4%), H-M (16%), and Saddle (16%). Furthermore, the registration accuracy of D-Saddle has the weakest correlation (Spearman) with the intensity uniformity metric among all methods. Finally, the paired t-test shows that D-Saddle significantly improved the overall registration accuracy of the original Saddle. PMID:29204257

Physical mapping of the 5S and 18S rDNA in ten species of Hypostomus Lacépède 1803 (Siluriformes: Loricariidae): evolutionary tendencies in the genus.

PubMed

Bueno, Vanessa; Venere, Paulo César; Thums Konerat, Jocicléia; Zawadzki, Cláudio Henrique; Vicari, Marcelo Ricardo; Margarido, Vladimir Pavan

2014-01-01

Hypostomus is a diverse group with unclear aspects regarding its biology, including the mechanisms that led to chromosome diversification within the group. Fluorescence in situ hybridization (FISH) with 5S and 18S rDNA probes was performed on ten Hypostomini species. Hypostomus faveolus, H. cochliodon, H. albopunctatus, H. aff. paulinus, and H. topavae had only one chromosome pair with 18S rDNA sites, while H. ancistroides, H. commersoni, H. hermanni, H. regani, and H. strigaticeps had multiple 18S rDNA sites. Regarding the 5S rDNA genes, H. ancistroides, H. regani, H. albopunctatus, H. aff. paulinus, and H. topavae had 5S rDNA sites on only one chromosome pair and H. faveolus, H. cochliodon, H. commersoni, H. hermanni, and H. strigaticeps had multiple 5S rDNA sites. Most species had 18S rDNA sites in the telomeric region of the chromosomes. All species but H. cochliodon had 5S rDNA in the centromeric/pericentromeric region of one metacentric pair. Obtained results are discussed based on existent phylogenies for the genus, with comments on possible dispersion mechanisms to justify the variability of the rDNA sites in Hypostomus.

Origins of coevolution between residues distant in protein 3D structures

PubMed Central

Ovchinnikov, Sergey; Kamisetty, Hetunandan; Baker, David

2017-01-01

Residue pairs that directly coevolve in protein families are generally close in protein 3D structures. Here we study the exceptions to this general trend—directly coevolving residue pairs that are distant in protein structures—to determine the origins of evolutionary pressure on spatially distant residues and to understand the sources of error in contact-based structure prediction. Over a set of 4,000 protein families, we find that 25% of directly coevolving residue pairs are separated by more than 5 Å in protein structures and 3% by more than 15 Å. The majority (91%) of directly coevolving residue pairs in the 5–15 Å range are found to be in contact in at least one homologous structure—these exceptions arise from structural variation in the family in the region containing the residues. Thirty-five percent of the exceptions greater than 15 Å are at homo-oligomeric interfaces, 19% arise from family structural variation, and 27% are in repeat proteins likely reflecting alignment errors. Of the remaining long-range exceptions (<1% of the total number of coupled pairs), many can be attributed to close interactions in an oligomeric state. Overall, the results suggest that directly coevolving residue pairs not in repeat proteins are spatially proximal in at least one biologically relevant protein conformation within the family; we find little evidence for direct coupling between residues at spatially separated allosteric and functional sites or for increased direct coupling between residue pairs on putative allosteric pathways connecting them. PMID:28784799

Regionalization of land-use impacts on streamflow using a network of paired catchments

NASA Astrophysics Data System (ADS)

Ochoa-Tocachi, Boris F.; Buytaert, Wouter; De Bièvre, Bert

2016-09-01

Quantifying the impact of land use and cover (LUC) change on catchment hydrological response is essential for land-use planning and management. Yet hydrologists are often not able to present consistent and reliable evidence to support such decision-making. The issue tends to be twofold: a scarcity of relevant observations, and the difficulty of regionalizing any existing observations. This study explores the potential of a paired catchment monitoring network to provide statistically robust, regionalized predictions of LUC change impact in an environment of high hydrological variability. We test the importance of LUC variables to explain hydrological responses and to improve regionalized predictions using 24 catchments distributed along the Tropical Andes. For this, we calculate first 50 physical catchment properties, and then select a subset based on correlation analysis. The reduced set is subsequently used to regionalize a selection of hydrological indices using multiple linear regression. Contrary to earlier studies, we find that incorporating LUC variables in the regional model structures increases significantly regression performance and predictive capacity for 66% of the indices. For the runoff ratio, baseflow index, and slope of the flow duration curve, the mean absolute error reduces by 53% and the variance of the residuals by 79%, on average. We attribute the explanatory capacity of LUC in the regional model to the pairwise monitoring setup, which increases the contrast of the land-use signal in the data set. As such, it may be a useful strategy to optimize data collection to support watershed management practices and improve decision-making in data-scarce regions.

Unique Thermal Stability of Unnatural Hydrophobic Ds Bases in Double-Stranded DNAs.

PubMed

Kimoto, Michiko; Hirao, Ichiro

2017-10-20

Genetic alphabet expansion technology, the introduction of unnatural bases or base pairs into replicable DNA, has rapidly advanced as a new synthetic biology area. A hydrophobic unnatural base pair between 7-(2-thienyl)imidazo[4,5-b]pyridine (Ds) and 2-nitro-4-propynylpyrrole (Px) exhibited high fidelity as a third base pair in PCR. SELEX methods using the Ds-Px pair enabled high-affinity DNA aptamer generation, and introducing a few Ds bases into DNA aptamers extremely augmented their affinities and selectivities to target proteins. Here, to further scrutinize the functions of this highly hydrophobic Ds base, the thermal stabilities of double-stranded DNAs (dsDNA) containing a noncognate Ds-Ds or G-Ds pair were examined. The thermal stability of the Ds-Ds self-pair was as high as that of the natural G-C pair, and apart from the generally higher stability of the G-C pair than that of the A-T pair, most of the 5'-pyrimidine-Ds-purine-3' sequences, such as CDsA and TDsA, exhibited higher stability than the 5'-purine-Ds-pyrimidine-3' sequences, such as GDsC and ADsC, in dsDNAs. This trait enabled the GC-content-independent control of the thermal stability of the designed dsDNA fragments. The melting temperatures of dsDNA fragments containing the Ds-Ds pair can be predicted from the nearest-neighbor parameters including the Ds base. In addition, the noncognate G-Ds pair can efficiently distinguish its neighboring cognate natural base pairs from noncognate pairs. We demonstrated that real-time PCR using primers containing Ds accurately detected a single-nucleotide mismatch in target DNAs. These unique properties of the Ds base that affect the stabilities of the neighboring base pairs could impart new functions to DNA molecules and technologies.

Central region component1, a novel synaptonemal complex component, is essential for meiotic recombination initiation in rice.

PubMed

Miao, Chunbo; Tang, Ding; Zhang, Honggen; Wang, Mo; Li, Yafei; Tang, Shuzhu; Yu, Hengxiu; Gu, Minghong; Cheng, Zhukuan

2013-08-01

In meiosis, homologous recombination entails programmed DNA double-strand break (DSB) formation and synaptonemal complex (SC) assembly coupled with the DSB repair. Although SCs display extensive structural conservation among species, their components identified are poorly conserved at the sequence level. Here, we identified a novel SC component, designated central region component1 (CRC1), in rice (Oryza sativa). CRC1 colocalizes with ZEP1, the rice SC transverse filament protein, to the central region of SCs in a mutually dependent fashion. Consistent with this colocalization, CRC1 interacts with ZEP1 in yeast two-hybrid assays. CRC1 is orthologous to Saccharomyces cerevisiae pachytene checkpoint2 (Pch2) and Mus musculus THYROID receptor-interacting protein13 (TRIP13) and may be a conserved SC component. Additionally, we provide evidence that CRC1 is essential for meiotic DSB formation. CRC1 interacts with homologous pairing aberration in rice meiosis1 (PAIR1) in vitro, suggesting that these proteins act as a complex to promote DSB formation. PAIR2, the rice ortholog of budding yeast homolog pairing1, is required for homologous chromosome pairing. We found that CRC1 is also essential for the recruitment of PAIR2 onto meiotic chromosomes. The roles of CRC1 identified here have not been reported for Pch2 or TRIP13.

CENTRAL REGION COMPONENT1, a Novel Synaptonemal Complex Component, Is Essential for Meiotic Recombination Initiation in Rice[C][W

PubMed Central

Miao, Chunbo; Tang, Ding; Zhang, Honggen; Wang, Mo; Li, Yafei; Tang, Shuzhu; Yu, Hengxiu; Gu, Minghong; Cheng, Zhukuan

2013-01-01

In meiosis, homologous recombination entails programmed DNA double-strand break (DSB) formation and synaptonemal complex (SC) assembly coupled with the DSB repair. Although SCs display extensive structural conservation among species, their components identified are poorly conserved at the sequence level. Here, we identified a novel SC component, designated CENTRAL REGION COMPONENT1 (CRC1), in rice (Oryza sativa). CRC1 colocalizes with ZEP1, the rice SC transverse filament protein, to the central region of SCs in a mutually dependent fashion. Consistent with this colocalization, CRC1 interacts with ZEP1 in yeast two-hybrid assays. CRC1 is orthologous to Saccharomyces cerevisiae pachytene checkpoint2 (Pch2) and Mus musculus THYROID RECEPTOR-INTERACTING PROTEIN13 (TRIP13) and may be a conserved SC component. Additionally, we provide evidence that CRC1 is essential for meiotic DSB formation. CRC1 interacts with HOMOLOGOUS PAIRING ABERRATION IN RICE MEIOSIS1 (PAIR1) in vitro, suggesting that these proteins act as a complex to promote DSB formation. PAIR2, the rice ortholog of budding yeast homolog pairing1, is required for homologous chromosome pairing. We found that CRC1 is also essential for the recruitment of PAIR2 onto meiotic chromosomes. The roles of CRC1 identified here have not been reported for Pch2 or TRIP13. PMID:23943860

Assessing the recharge process and importance of montane water to adjacent tectonic valley-plain groundwater using a ternary end-member mixing analysis based on isotopic and chemical tracers

NASA Astrophysics Data System (ADS)

Peng, Tsung-Ren; Zhan, Wen-Jun; Tong, Lun-Tao; Chen, Chi-Tsun; Liu, Tsang-Sen; Lu, Wan-Chung

2018-03-01

A study in eastern Taiwan evaluated the importance of montane water contribution (MC) to adjacent valley-plain groundwater (VPG) in a tectonic suture zone. The evaluation used a ternary natural-tracer-based end-member mixing analysis (EMMA). With this purpose, VPG and three end-member water samples of plain precipitation (PP), mountain-front recharge (MFR), and mountain-block recharge (MBR) were collected and analyzed for stable isotopic compositions (δ 2H and δ 18O) and chemical concentrations (electrical conductivity (EC) and Cl-). After evaluation, Cl- is deemed unsuitable for EMMA in this study, and the contribution fractions of respective end members derived by the δ 18O-EC pair are similar to those derived by the δ 2H-EC pair. EMMA results indicate that the MC, including MFR and MBR, contributes at least 70% (679 × 106 m3 water volume) of the VPG, significantly greater than the approximately 30% of PP contribution, and greater than the 20-50% in equivalent humid regions worldwide. The large MC is attributable to highly fractured strata and the steep topography of studied catchments caused by active tectonism. Furthermore, the contribution fractions derived by EMMA reflect the unique hydrogeological conditions in the respective study sub-regions. A region with a large MBR fraction is indicative of active lateral groundwater flow as a result of highly fractured strata in montane catchments. On the other hand, a region characterized by a large MFR fraction may possess high-permeability stream beds or high stream gradients. Those hydrogeological implications are helpful for water resource management and protection authorities of the studied regions.

Electrically pumped edge-emitting photonic bandgap semiconductor laser

DOEpatents

Lin, Shawn-Yu; Zubrzycki, Walter J.

2004-01-06

A highly efficient, electrically pumped edge-emitting semiconductor laser based on a one- or two-dimensional photonic bandgap (PBG) structure is described. The laser optical cavity is formed using a pair of PBG mirrors operating in the photonic band gap regime. Transverse confinement is achieved by surrounding an active semiconductor layer of high refractive index with lower-index cladding layers. The cladding layers can be electrically insulating in the passive PBG mirror and waveguide regions with a small conducting aperture for efficient channeling of the injection pump current into the active region. The active layer can comprise a quantum well structure. The quantum well structure can be relaxed in the passive regions to provide efficient extraction of laser light from the active region.

Assessment of DNA Contamination in RNA Samples Based on Ribosomal DNA

PubMed Central

Hashemipetroudi, Seyyed Hamidreza; Nematzadeh, Ghorbanali; Ahmadian, Gholamreza; Yamchi, Ahad; Kuhlmann, Markus

2018-01-01

One method extensively used for the quantification of gene expression changes and transcript abundances is reverse-transcription quantitative real-time PCR (RT-qPCR). It provides accurate, sensitive, reliable, and reproducible results. Several factors can affect the sensitivity and specificity of RT-qPCR. Residual genomic DNA (gDNA) contaminating RNA samples is one of them. In gene expression analysis, non-specific amplification due to gDNA contamination will overestimate the abundance of transcript levels and can affect the RT-qPCR results. Generally, gDNA is detected by qRT-PCR using primer pairs annealing to intergenic regions or an intron of the gene of interest. Unfortunately, intron/exon annotations are not yet known for all genes from vertebrate, bacteria, protist, fungi, plant, and invertebrate metazoan species. Here we present a protocol for detection of gDNA contamination in RNA samples by using ribosomal DNA (rDNA)-based primers. The method is based on the unique features of rDNA: their multigene nature, highly conserved sequences, and high frequency in the genome. Also as a case study, a unique set of primers were designed based on the conserved region of ribosomal DNA (rDNA) in the Poaceae family. The universality of these primer pairs was tested by melt curve analysis and agarose gel electrophoresis. Although our method explains how rDNA-based primers can be applied for the gDNA contamination assay in the Poaceae family, it could be easily used to other prokaryote and eukaryote species PMID:29443017

First description of multivalent ring structures in eutherian mammalian meiosis: new chromosomal characterization of Cormura brevirostris (Emballonuridae, Chiroptera).

PubMed

de Araújo, Ramon Everton Ferreira; Nagamachi, Cleusa Yoshiko; da Costa, Marlyson Jeremias Rodrigues; Noronha, Renata Coelho Rodrigues; Rodrigues, Luís Reginaldo Ribeiro; Pieczarka, Julio César

2016-08-01

Twelve specimens of the bat Cormura brevirostris (Emballonuridae: Chiroptera) were collected from four localities in the Brazilian Amazon region and analyzed by classical and molecular cytogenetics. The diploid number and autosomal fundamental number were as previously reported (2n = 22 and FNa = 40, respectively). Fluorescence in situ hybridization using rDNA probes and silver nitrate technique demonstrated the presence of two NOR sites and the presence of internal telomeric sequences at pericentromeric regions of all chromosomes with exception of Y. Based on meiotic studies and chromosome banding we suggest that the sex chromosome pair of C. brevirostris was equivocally identified as it appears in the literature. Meiotic analysis demonstrated that at diplotene-diakinesis the cells had a ring conformation involving four chromosome pairs. This suggests the occurrence of multiple reciprocal translocations among these chromosomes, which is a very rare phenomenon in vertebrates, and has never been described in Eutheria.

Yoink: An interaction-based partitioning API.

PubMed

Zheng, Min; Waller, Mark P

2018-05-15

Herein, we describe the implementation details of our interaction-based partitioning API (application programming interface) called Yoink for QM/MM modeling and fragment-based quantum chemistry studies. Interactions are detected by computing density descriptors such as reduced density gradient, density overlap regions indicator, and single exponential decay detector. Only molecules having an interaction with a user-definable QM core are added to the QM region of a hybrid QM/MM calculation. Moreover, a set of molecule pairs having density-based interactions within a molecular system can be computed in Yoink, and an interaction graph can then be constructed. Standard graph clustering methods can then be applied to construct fragments for further quantum chemical calculations. The Yoink API is licensed under Apache 2.0 and can be accessed via yoink.wallerlab.org. © 2018 Wiley Periodicals, Inc. © 2018 Wiley Periodicals, Inc.

Description of three new species of Hepatozoon (Apicomplexa, Hepatozoidae) from Rattlesnakes (Crotalus durissus terrificus) based on molecular, morphometric and morphologic characters.

PubMed

O'Dwyer, Lucia Helena; Moço, Tatiana Cristina; Paduan, Karina dos Santos; Spenassatto, Carine; da Silva, Reinaldo José; Ribolla, Paulo Eduardo Martins

2013-10-01

Hepatozoon spp. are commonly found infecting snakes. Since the latter are parasitized by diverse forms and data in the literature show divergence, we studied Hepatozoon spp. diversity on Crotalus durissus terrificus snakes using both molecular and morphological approaches. Naturally infected animals were employed. Blood was collected, blood smears were prepared and an aliquot was stored at -20°C for DNA extraction. Five specimens of C. durissus terrificus were selected, each of them infected with one gamont type. Morphological and morphometric analyses of the found gamonts led to their grouping into three populations. For molecular characterization, seven oligonucleotide pairs that amplify distinct regions of rDNA gene were tested by adopting the PCR technique. Only the oligonucleotide pairs HepF300/Hep900 and HEMO1/HEMO2 were efficient in amplifying and distinguishing different isolates of Hepatozoon spp. from snakes. The better results were obtained when both oligonucleotide pairs were used in association. Based on the molecular and morphologic differences, three new species were proposed: Hepatozoon cuestensis sp. nov.; Hepatozoon cevapii sp. nov. and Hepatozoon massardii sp. nov. This is the first description of new Hepatozoon species from snakes, based on molecular characterization and morphological data, in South America. Copyright © 2013 Elsevier Inc. All rights reserved.

Crystallization and preliminary X-ray diffraction analysis of the Bacillus subtilis replication termination protein in complex with the 37-base-pair TerI-binding site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vivian, J. P.; Porter, C.; Wilce, J. A.

2006-11-01

A preparation of replication terminator protein (RTP) of B. subtilis and a 37-base-pair TerI sequence (comprising two binding sites for RTP) has been purified and crystallized. The replication terminator protein (RTP) of Bacillus subtilis binds to specific DNA sequences that halt the progression of the replisome in a polar manner. These terminator complexes flank a defined region of the chromosome into which they allow replication forks to enter but not exit. Forcing the fusion of replication forks in a specific zone is thought to allow the coordination of post-replicative processes. The functional terminator complex comprises two homodimers each of 29more » kDa bound to overlapping binding sites. A preparation of RTP and a 37-base-pair TerI sequence (comprising two binding sites for RTP) has been purified and crystallized. A data set to 3.9 Å resolution with 97.0% completeness and an R{sub sym} of 12% was collected from a single flash-cooled crystal using synchrotron radiation. The diffraction data are consistent with space group P622, with unit-cell parameters a = b = 118.8, c = 142.6 Å.« less

Molecular recognition of DNA base pairs by the formamido/pyrrole and formamido/imidazole pairings in stacked polyamides

PubMed Central

Buchmueller, Karen L.; Staples, Andrew M.; Uthe, Peter B.; Howard, Cameron M.; Pacheco, Kimberly A. O.; Cox, Kari K.; Henry, James A.; Bailey, Suzanna L.; Horick, Sarah M.; Nguyen, Binh; Wilson, W. David; Lee, Moses

2005-01-01

Polyamides containing an N-terminal formamido (f) group bind to the minor groove of DNA as staggered, antiparallel dimers in a sequence-specific manner. The formamido group increases the affinity and binding site size, and it promotes the molecules to stack in a staggered fashion thereby pairing itself with either a pyrrole (Py) or an imidazole (Im). There has not been a systematic study on the DNA recognition properties of the f/Py and f/Im terminal pairings. These pairings were analyzed here in the context of f-ImPyPy, f-ImPyIm, f-PyPyPy and f-PyPyIm, which contain the central pairing modes, –ImPy– and –PyPy–. The specificity of these triamides towards symmetrical recognition sites allowed for the f/Py and f/Im terminal pairings to be directly compared by SPR, CD and ΔTM experiments. The f/Py pairing, when placed next to the –ImPy– or –PyPy– central pairings, prefers A/T and T/A base pairs to G/C base pairs, suggesting that f/Py has similar DNA recognition specificity to Py/Py. With –ImPy– central pairings, f/Im prefers C/G base pairs (>10 times) to the other Watson–Crick base pairs; therefore, f/Im behaves like the Py/Im pair. However, the f/Im pairing is not selective for the C/G base pair when placed next to the –PyPy– central pairings. PMID:15703305

Base-Pairing Energies of Protonated Nucleoside Base Pairs of dCyd and m5dCyd: Implications for the Stability of DNA i-Motif Conformations

NASA Astrophysics Data System (ADS)

Yang, Bo; Rodgers, M. T.

2015-08-01

Hypermethylation of cytosine in expanded (CCG)n•(CGG)n trinucleotide repeats results in Fragile X syndrome, the most common cause of inherited mental retardation. The (CCG)n•(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of protonated base pairs of cytosine. Here we investigate the effects of 5-methylation and the sugar moiety on the base-pairing energies (BPEs) of protonated cytosine base pairs by examining protonated nucleoside base pairs of 2'-deoxycytidine (dCyd) and 5-methyl-2'-deoxycytidine (m5dCyd) using threshold collision-induced dissociation techniques. 5-Methylation of a single or both cytosine residues leads to very small change in the BPE. However, the accumulated effect may be dramatic in diseased state trinucleotide repeats where many methylated base pairs may be present. The BPEs of the protonated nucleoside base pairs examined here significantly exceed those of Watson-Crick dGuo•dCyd and neutral dCyd•dCyd base pairs, such that these base-pairing interactions provide the major forces responsible for stabilization of DNA i-motif conformations. Compared with isolated protonated nucleobase pairs of cytosine and 1-methylcytosine, the 2'-deoxyribose sugar produces an effect similar to the 1-methyl substituent, and leads to a slight decrease in the BPE. These results suggest that the base-pairing interactions may be slightly weaker in nucleic acids, but that the extended backbone is likely to exert a relatively small effect on the total BPE. The proton affinity (PA) of m5dCyd is also determined by competitive analysis of the primary dissociation pathways that occur in parallel for the protonated (m5dCyd)H+(dCyd) nucleoside base pair and the absolute PA of dCyd previously reported.

Imprints of the quasar structure in time-delay light curves: Microlensing-aided reverberation mapping

NASA Astrophysics Data System (ADS)

Sluse, D.; Tewes, M.

2014-11-01

The advent of large area photometric surveys has raised a great deal of interest in the possibility of using broadband photometric data, instead of spectra, to measure the size of the broad line region of active galactic nuclei. We describe here a new method that uses time-delay lensed quasars where one or several images are affected by microlensing due to stars in the lensing galaxy. Because microlensing decreases (or increases) the flux of the continuum compared to the broad line region, it changes the contrast between these two emission components. We show that this effect can be used to effectively disentangle the intrinsic variability of those two regions, offering the opportunity to perform reverberation mapping based on single-band photometric data. Based on simulated light curves generated using a damped random walk model of quasar variability, we show that measurement of the size of the broad line region can be achieved using this method, provided one spectrum has been obtained independently during the monitoring. This method is complementary to photometric reverberation mapping and could also be extended to multi-band data. Because the effect described above produces a variability pattern in difference light curves between pairs of lensed images that is correlated with the time-lagged continuum variability, it can potentially produce systematic errors in measurement of time delays between pairs of lensed images. Simple simulations indicate that time-delay measurement techniques that use a sufficiently flexible model for the extrinsic variability are not affected by this effect and produce accurate time delays.

Bacterio-opsin mutants of Halobacterium halobium

PubMed Central

Betlach, Mary; Pfeifer, Felicitas; Friedman, James; Boyer, Herbert W.

1983-01-01

The bacterio-opsin (bop) gene of Halobacterium halobium R1 has been cloned with about 40 kilobases of flanking genomic sequence. The 40-kilobase segment is derived from the (G+C)-rich fraction of the chromosome and is not homologous to the major (pHH1) or minor endogenous covalently closed circular DNA species of H. halobium. A 5.1-kilobase Pst I fragment containing the bop gene was subcloned in pBR322 and a partial restriction map was determined. Defined restriction fragments of this clone were used as probes to analyze the defects associated with the bop gene in 12 bacterio-opsin mutants. Eleven out of 12 of the mutants examined had inserts ranging from 350 to 3,000 base pairs either in the bop gene or up to 1,400 base pairs upstream. The positions of the inserts were localized to four regions in the 5.1-kilobase genomic fragment: within the gene (one mutant), in a region that overlaps the 5′ end of the gene (seven mutants), and in two different upstream regions (three mutants). Two revertants of the mutant with the most distal insert had an additional insert in the same region. The polar effects of these inserts are discussed in terms of inactivation of a regulatory gene or disruption of part of a coordinately expressed operon. Given the defined nature of the bop mRNA—i.e., it has a 5′ leader sequence of three ribonucleotides—these observations indicate that the bop mRNA might be processed from a large mRNA transcript. Images PMID:16593291

DOE Office of Scientific and Technical Information (OSTI.GOV)

Otto, C., Thomas, G.A.; Peticolas, W.L.; Rippe, K.

Raman spectra of the parallel-stranded duplex formed from the deoxyoligonucleotides 5{prime}-d-((A){sub 10}TAATTTTAAATATTT)-3{prime} (D1) and 5{prime}-d((T){sub 10}ATTAAAATTTATAAA)-3{prime} (D2) in H{sub 2}O and D{sub 2}O have been acquired. The spectra of the parallel-stranded DNA are then compared to the spectra of the antiparallel double helix formed from the deoxyoligonucleotides D1 and 5{prime}-d(AAATATTTAAAATTA-(T){sub 10})-3{prime} (D3). The Raman spectra of the antiparallel-stranded (aps) duplex are reminiscent of the spectra of poly(d(A)){center dot}poly(d(T)) and a B-form structure similar to that adopted by the homopolymer duplex is assigned to the antiparallel double helix. The spectra of the parallel-stranded (ps) and antiparallel-stranded duplexes differ significantly due tomore » changes in helical organization, i.e., base pairing, base stacking, and backbone conformation. Large changes observed in the carbonyl stretching region implicate the involvement of the C(2) carbonyl of thymine in base pairing. The interaction of adenine with the C(2) carbonyl of thymine is consistent with formation of reverse Watson-Crick base pairing in parallel-stranded DNA. Phosphate-furanose vibrations similar to those observed for B-form DNA of heterogeneous sequence and high A,T content are observed at 843 and 1,092 cm{sup {minus}1} in the spectra of the parallel-stranded duplex.« less

The influence of ENSO on an oceanic eddy pair in the South China Sea

NASA Astrophysics Data System (ADS)

Chu, Xiaoqing; Dong, Changming; Qi, Yiquan

2017-03-01

An eddy pair off the Vietnam coast is one of the most important features of the summertime South China Sea circulation. Its variability is of interest due to its profound impact on regional climate, ecosystems, biological processes, and fisheries. This study examines the influence of the El Niño-Southern Oscillation (ENSO), a basin-scale climatic mode, on the interannual variability of this regional eddy pair using satellite observational data and historical hydrographic measurements. Over the last three decades, the eddy pair strengthened in 1994 and 2002, and weakened in 2006, 2007, and 2008. It was absent in 1988, 1995, 1998, and 2010, coinciding with strong El Nino-to-La Nina transitions. Composite analyses showed that the strong transition events of ENSO led to radical changes in the summer monsoon, through the forcing of a unique sea surface temperature anomaly structure over the tropical Indo-Pacific basin. With weaker zonal wind, a more northward wind direction, and the disappearance of a pair of positive and negative wind stress curls, the eastward current jet turns northward along the Vietnam coast and the eddy pair disappears.

Complete chloroplast genome sequence and comparative analysis of loblolly pine (Pinus taeda L.) with related species

PubMed Central

Khan, Abdul Latif; Khan, Muhammad Aaqil; Shahzad, Raheem; Lubna; Kang, Sang Mo; Al-Harrasi, Ahmed; Al-Rawahi, Ahmed; Lee, In-Jung

2018-01-01

Pinaceae, the largest family of conifers, has a diversified organization of chloroplast (cp) genomes with two typical highly reduced inverted repeats (IRs). In the current study, we determined the complete sequence of the cp genome of an economically and ecologically important conifer tree, the loblolly pine (Pinus taeda L.), using Illumina paired-end sequencing and compared the sequence with those of other pine species. The results revealed a genome size of 121,531 base pairs (bp) containing a pair of 830-bp IR regions, distinguished by a small single copy (42,258 bp) and large single copy (77,614 bp) region. The chloroplast genome of P. taeda encodes 120 genes, comprising 81 protein-coding genes, four ribosomal RNA genes, and 35 tRNA genes, with 151 randomly distributed microsatellites. Approximately 6 palindromic, 34 forward, and 22 tandem repeats were found in the P. taeda cp genome. Whole cp genome comparison with those of other Pinus species exhibited an overall high degree of sequence similarity, with some divergence in intergenic spacers. Higher and lower numbers of indels and single-nucleotide polymorphism substitutions were observed relative to P. contorta and P. monophylla, respectively. Phylogenomic analyses based on the complete genome sequence revealed that 60 shared genes generated trees with the same topologies, and P. taeda was closely related to P. contorta in the subgenus Pinus. Thus, the complete P. taeda genome provided valuable resources for population and evolutionary studies of gymnosperms and can be used to identify related species. PMID:29596414

Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

PubMed

Takezawa, Yusuke; Shionoya, Mitsuhiko

2012-12-18

With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional DNA molecules such as artificial DNAzymes and DNA machines. In addition, the metallo-base pairing system is a powerful tool for the construction of homogeneous and heterogeneous metal arrays, which can lead to DNA-based nanomaterials such as electronic wires and magnetic devices. Recently researchers have investigated these systems as enzyme replacements, which may offer an additional contribution to chemical biology and synthetic biology through the expansion of the genetic alphabet.

Theoretical determination of one-electron redox potentials for DNA bases, base pairs, and stacks.

PubMed

Paukku, Y; Hill, G

2011-05-12

Electron affinities, ionization potentials, and redox potentials for DNA bases, base pairs, and N-methylated derivatives are computed at the DFT/M06-2X/6-31++G(d,p) level of theory. Redox properties of a guanine-guanine stack model are explored as well. Reduction and oxidation potentials are in good agreement with the experimental ones. Electron affinities of base pairs were found to be negative. Methylation of canonical bases affects the ionization potentials the most. Base pair formation and base stacking lower ionization potentials by 0.3 eV. Pairing of guanine with the 5-methylcytosine does not seem to influence the redox properties of this base pair much.

Extraction of dynamic functional connectivity from brain grey matter and white matter for MCI classification.

PubMed

Chen, Xiaobo; Zhang, Han; Zhang, Lichi; Shen, Celina; Lee, Seong-Whan; Shen, Dinggang

2017-10-01

Brain functional connectivity (FC) extracted from resting-state fMRI (RS-fMRI) has become a popular approach for diagnosing various neurodegenerative diseases, including Alzheimer's disease (AD) and its prodromal stage, mild cognitive impairment (MCI). Current studies mainly construct the FC networks between grey matter (GM) regions of the brain based on temporal co-variations of the blood oxygenation level-dependent (BOLD) signals, which reflects the synchronized neural activities. However, it was rarely investigated whether the FC detected within the white matter (WM) could provide useful information for diagnosis. Motivated by the recently proposed functional correlation tensors (FCT) computed from RS-fMRI and used to characterize the structured pattern of local FC in the WM, we propose in this article a novel MCI classification method based on the information conveyed by both the FC between the GM regions and that within the WM regions. Specifically, in the WM, the tensor-based metrics (e.g., fractional anisotropy [FA], similar to the metric calculated based on diffusion tensor imaging [DTI]) are first calculated based on the FCT and then summarized along each of the major WM fiber tracts connecting each pair of the brain GM regions. This could capture the functional information in the WM, in a similar network structure as the FC network constructed for the GM, based only on the same RS-fMRI data. Moreover, a sliding window approach is further used to partition the voxel-wise BOLD signal into multiple short overlapping segments. Then, both the FC and FCT between each pair of the brain regions can be calculated based on the BOLD signal segments in the GM and WM, respectively. In such a way, our method can generate dynamic FC and dynamic FCT to better capture functional information in both GM and WM and further integrate them together by using our developed feature extraction, selection, and ensemble learning algorithms. The experimental results verify that the dynamic FCT can provide valuable functional information in the WM; by combining it with the dynamic FC in the GM, the diagnosis accuracy for MCI subjects can be significantly improved even using RS-fMRI data alone. Hum Brain Mapp 38:5019-5034, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Stability of miRNA 5′terminal and seed regions is correlated with experimentally observed miRNA-mediated silencing efficacy

PubMed Central

Hibio, Naoki; Hino, Kimihiro; Shimizu, Eigo; Nagata, Yoshiro; Ui-Tei, Kumiko

2012-01-01

MicroRNAs (miRNAs) are key regulators of sequence-specific gene silencing. However, crucial factors that determine the efficacy of miRNA-mediated target gene silencing are poorly understood. Here we mathematized base-pairing stability and showed that miRNAs with an unstable 5′ terminal duplex and stable seed-target duplex exhibit strong silencing activity. The results are consistent with the previous findings that an RNA strand with unstable 5′ terminal in miRNA duplex easily loads onto the RNA-induced silencing complex (RISC), and miRNA recognizes target mRNAs with seed-complementary sequences to direct posttranscriptional repression. Our results suggested that both the unwinding and target recognition processes of miRNAs could be proficiently controlled by the thermodynamics of base-pairing in protein-free condition. Interestingly, such thermodynamic parameters might be evolutionarily well adapted to the body temperatures of various species. PMID:23251782

Base pairing and base mis-pairing in nucleic acids

NASA Technical Reports Server (NTRS)

Wang, A. H. J.; Rich, A.

1986-01-01

In recent years we have learned that DNA is conformationally active. It can exist in a number of different stable conformations including both right-handed and left-handed forms. Using single crystal X-ray diffraction analysis we are able to discover not only additional conformations of the nucleic acids but also different types of hydrogen bonded base-base interactions. Although Watson-Crick base pairings are the predominant type of interaction in double helical DNA, they are not the only types. Recently, we have been able to examine mismatching of guanine-thymine base pairs in left-handed Z-DNA at atomic resolution (1A). A minimum amount of distortion of the sugar phosphate backbone is found in the G x T pairing in which the bases are held together by two hydrogen bonds in the wobble pairing interaction. Because of the high resolution of the analysis we can visualize water molecules which fill in to accommodate the other hydrogen bonding positions in the bases which are not used in the base-base interactions. Studies on other DNA oligomers have revealed that other types of non-Watson-Crick hydrogen bonding interactions can occur. In the structure of a DNA octamer with the sequence d(GCGTACGC) complexed to an antibiotic triostin A, it was found that the two central AT base pairs are held together by Hoogsteen rather than Watson-Crick base pairs. Similarly, the G x C base pairs at the ends are also Hoogsteen rather than Watson-Crick pairing. Hoogsteen base pairs make a modified helix which is distinct from the Watson-Crick double helix.

Relative surface wave amplitude and phase anomalies from the Democratic People's Republic of Korea announced nuclear tests

DOE PAGES

Ichinose, G. A.; Myers, S. C.; Ford, S. R.; ...

2017-08-29

Here, we performed relative locations of six event pairs based on surface wave (SW) and body wave (BW) differential traveltimes of the 9 September 2016, 6 January 2016, 12 February 2013, and 25 May 2009 announced North Korea nuclear explosions. The SW relative locations for the 25 May 2009 and 12 February 2013 events were inconsistent with the BWs when paired with other events, and only the 6 January 2016/9 September 2016 pair was consistent. Apparent SW phase shift is investigated with respect to the BW relative locations. The pairs formed with the 25 May 2009 and 12 February 2013more » events, beneath the southeast slope of Mount Mant'ap, have the largest phase shifts and amplitude ratio deviations, whereas the least deviation was from the 6 January 2016 and 9 September 2016 event pair beneath the mountain peak. Regional moment tensors (MTs) predict the amplitude ratios but do not resolve the relative phase. We find that MTs with 10% difference in isotropic and rotated +CLVD can fit both relative phase and amplitude ratios. SW relative locations of highly isotropic and correlated explosion clusters can be affected by topography and small differences in MT.« less

Hidden in Plain Sight: Subtle Effects of the 8-Oxoguanine Lesion on the Structure, Dynamics, and Thermodynamics of a 15-Base-Pair Oligodeoxynucleotide Duplex†

PubMed Central

Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.

2011-01-01

The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242

Genomics of Parallel Ecological Speciation in Lake Victoria Cichlids.

PubMed

Meier, Joana Isabel; Marques, David Alexander; Wagner, Catherine Elise; Excoffier, Laurent; Seehausen, Ole

2018-06-01

The genetic basis of parallel evolution of similar species is of great interest in evolutionary biology. In the adaptive radiation of Lake Victoria cichlid fishes, sister species with either blue or red-back male nuptial coloration have evolved repeatedly, often associated with shallower and deeper water, respectively. One such case is blue and red-backed Pundamilia species, for which we recently showed that a young species pair may have evolved through "hybrid parallel speciation". Coalescent simulations suggested that the older species P. pundamilia (blue) and P. nyererei (red-back) admixed in the Mwanza Gulf and that new "nyererei-like" and "pundamilia-like" species evolved from the admixed population. Here, we use genome scans to study the genomic architecture of differentiation, and assess the influence of hybridization on the evolution of the younger species pair. For each of the two species pairs, we find over 300 genomic regions, widespread across the genome, which are highly differentiated. A subset of the most strongly differentiated regions of the older pair are also differentiated in the younger pair. These shared differentiated regions often show parallel allele frequency differences, consistent with the hypothesis that admixture-derived alleles were targeted by divergent selection in the hybrid population. However, two-thirds of the genomic regions that are highly differentiated between the younger species are not highly differentiated between the older species, suggesting independent evolutionary responses to selection pressures. Our analyses reveal how divergent selection on admixture-derived genetic variation can facilitate new speciation events.

Investigating the neural bases for intra-subject cognitive efficiency changes using functional magnetic resonance imaging

PubMed Central

Rao, Neena K.; Motes, Michael A.; Rypma, Bart

2014-01-01

Several fMRI studies have examined brain regions mediating inter-subject variability in cognitive efficiency, but none have examined regions mediating intra-subject variability in efficiency. Thus, the present study was designed to identify brain regions involved in intra-subject variability in cognitive efficiency via participant-level correlations between trial-level reaction time (RT) and trial-level fMRI BOLD percent signal change on a processing speed task. On each trial, participants indicated whether a digit-symbol probe-pair was present or absent in an array of nine digit-symbol probe-pairs while fMRI data were collected. Deconvolution analyses, using RT time-series models (derived from the proportional scaling of an event-related hemodynamic response function model by trial-level RT), were used to evaluate relationships between trial-level RTs and BOLD percent signal change. Although task-related patterns of activation and deactivation were observed in regions including bilateral occipital, bilateral parietal, portions of the medial wall such as the precuneus, default mode network regions including anterior cingulate, posterior cingulate, bilateral temporal, right cerebellum, and right cuneus, RT-BOLD correlations were observed in a more circumscribed set of regions. Positive RT-BOLD correlations, where fast RTs were associated with lower BOLD percent signal change, were observed in regions including bilateral occipital, bilateral parietal, and the precuneus. RT-BOLD correlations were not observed in the default mode network indicating a smaller set of regions associated with intra-subject variability in cognitive efficiency. The results are discussed in terms of a distributed area of regions that mediate variability in the cognitive efficiency that might underlie processing speed differences between individuals. PMID:25374527

Investigating the neural bases for intra-subject cognitive efficiency changes using functional magnetic resonance imaging.

PubMed

Rao, Neena K; Motes, Michael A; Rypma, Bart

2014-01-01

Several fMRI studies have examined brain regions mediating inter-subject variability in cognitive efficiency, but none have examined regions mediating intra-subject variability in efficiency. Thus, the present study was designed to identify brain regions involved in intra-subject variability in cognitive efficiency via participant-level correlations between trial-level reaction time (RT) and trial-level fMRI BOLD percent signal change on a processing speed task. On each trial, participants indicated whether a digit-symbol probe-pair was present or absent in an array of nine digit-symbol probe-pairs while fMRI data were collected. Deconvolution analyses, using RT time-series models (derived from the proportional scaling of an event-related hemodynamic response function model by trial-level RT), were used to evaluate relationships between trial-level RTs and BOLD percent signal change. Although task-related patterns of activation and deactivation were observed in regions including bilateral occipital, bilateral parietal, portions of the medial wall such as the precuneus, default mode network regions including anterior cingulate, posterior cingulate, bilateral temporal, right cerebellum, and right cuneus, RT-BOLD correlations were observed in a more circumscribed set of regions. Positive RT-BOLD correlations, where fast RTs were associated with lower BOLD percent signal change, were observed in regions including bilateral occipital, bilateral parietal, and the precuneus. RT-BOLD correlations were not observed in the default mode network indicating a smaller set of regions associated with intra-subject variability in cognitive efficiency. The results are discussed in terms of a distributed area of regions that mediate variability in the cognitive efficiency that might underlie processing speed differences between individuals.

A two-dimensional 1H-NMR study of the dam methylase site: comparison between the hemimethylated GATC sequence, its unmethylated analogue and a hemimethylated CATG sequence. The sequence dependence of methylation upon base-pair lifetimes.

PubMed

Fazakerley, G V; Quignard, E; Teoule, R; Guy, A; Guschlbauer, W

1987-09-15

We report two-dimensional NOE (NOESY) spectra on the sequence d(GCGATCATGG).d(CCATGATCGC) which contains the unmethylated dam site. As expected the DNA adopts a B-form conformation but appears to be distorted at the TG step of the second strand. This distorsion, probably bending, is not seen on the opposite strand. When the first strand is methylated on adenine in the GATC or CATG sequence the NOESY spectra indicate little or no change in the conformation. However the single strand-duplex exchange is slowed down to the slow-exchange region on a proton NMR time scale. We have assigned the exchangeable imino and cytidine amino resonances of the three duplexes. From the imino linewidths as a function of temperature, we observe that the unmethylated and the hemimethylated Gm6ATC duplexes melt normally from the ends. However, this is not so for the hemimethylated Cm6ATG duplex which, apart from the terminal base pairs, melts cooperatively and at higher temperature. In spectra recorded in H2O a second duplex is observed, for the Gm6ATC sequence, which we have not been able to identify. It is however unlikely to be a hairpin structure. Ultraviolet-melting curves also indicate the presence of two transitions for this duplex. The effect of methylation upon base-pair lifetimes has been studied by comparing the above three duplexes. Little effect is observed upon methylation in the GATC sequence but a drastic increase in the lifetimes of all base pairs is observed upon methylation in the CATG sequence.

Sympatric occurrence of four cytotypes and one extra chromosome in Bryconamericus ecai (Characidae): 18S rDNA polymorphism and heterochromatin composition.

PubMed

dos Santos, Angélica Rossotti; Rubert, Marceléia; Giuliano-Caetano, Lucia; Dias, Ana Lúcia

2012-02-01

In the present study, specimens of Bryconamericus ecai collected from the Forquetinha River/RS, were cytogenetically analyzed, disclosing a wide karyotypic diversity in this species. All individuals had 2n = 50, with different karyotypic formulae, resulting in four cytotypes and one B macrochromosome observed in cytotype III. Heterochromatin was distributed in the pericentromeric region of most chromosomes on the four cytotypes and also on a chromosome pair with interstitial markings in cytotype IV. Staining with CMA(3) and DAPI fluorochromes revealed a C-band region rich in AT base pairs in cytotypes I, II and III, and a pair with GC-rich heterochromatin in cytotypes II and III. Cytotype IV presented CMA(3) and DAPI positive heterochromatin. Silver nitrate impregnation, in situ hybridization, and fluorochrome staining showed a multiple system of AgNORs, 18S rDNA and CMA(3) sites in cytotypes I, III and IV, with both inter-and intraindividual variability in the number and location of these sites. Cytotype II had only one pair of NORs coincident with the 18S rDNA and CMA(3) sites, indicating a simple system. The chromosomal polymorphism observed among the specimens of B. ecai added to the literature data show that chromosomal rearrangements, especially pericentric inversions, play an important role in the karyotypic evolution of this group of fish. It can also be implied that more than one species of Bryconamericus is probably occurring, living in sympatry in the Forquetinha River/RS. © 2012 The Authors.

Introducing a model of pairing based on base pair specific interactions between identical DNA sequences

NASA Astrophysics Data System (ADS)

(O' Lee, Dominic J.

2018-02-01

At present, there have been suggested two types of physical mechanism that may facilitate preferential pairing between DNA molecules, with identical or similar base pair texts, without separation of base pairs. One mechanism solely relies on base pair specific patterns of helix distortion being the same on the two molecules, discussed extensively in the past. The other mechanism proposes that there are preferential interactions between base pairs of the same composition. We introduce a model, built on this second mechanism, where both thermal stretching and twisting fluctuations are included, as well as the base pair specific helix distortions. Firstly, we consider an approximation for weak pairing interactions, or short molecules. This yields a dependence of the energy on the square root of the molecular length, which could explain recent experimental data. However, analysis suggests that this approximation is no longer valid at large DNA lengths. In a second approximation, for long molecules, we define two adaptation lengths for twisting and stretching, over which the pairing interaction can limit the accumulation of helix disorder. When the pairing interaction is sufficiently strong, both adaptation lengths are finite; however, as we reduce pairing strength, the stretching adaptation length remains finite but the torsional one becomes infinite. This second state persists to arbitrarily weak values of the pairing strength; suggesting that, if the molecules are long enough, the pairing energy scales as length. To probe differences between the two pairing mechanisms, we also construct a model of similar form. However, now, pairing between identical sequences solely relies on the intrinsic helix distortion patterns. Between the two models, we see interesting qualitative differences. We discuss our findings, and suggest new work to distinguish between the two mechanisms.

Effects of HBV Genetic Variability on RNAi Strategies

PubMed Central

Panjaworayan, Nattanan; Brown, Chris M.

2011-01-01

RNAi strategies present promising antiviral strategies against HBV. RNAi strategies require base pairing between short RNAi effectors and targets in the HBV pregenome or other RNAs. Natural variation in HBV genotypes, quasispecies variation, or mutations selected by the RNAi strategy could potentially make these strategies less effective. However, current and proposed antiviral strategies against HBV are being, or could be, designed to avoid this. This would involve simultaneous targeting of multiple regions of the genome, or regions in which variation or mutation is not tolerated. RNAi strategies against single genotypes or against variable regions of the genome would need to have significant other advantages to be part of robust therapies. PMID:21760994

Lone pairs: an electrostatic viewpoint.

PubMed

Kumar, Anmol; Gadre, Shridhar R; Mohan, Neetha; Suresh, Cherumuttathu H

2014-01-16

A clear-cut definition of lone pairs has been offered in terms of characteristics of minima in molecular electrostatic potential (MESP). The largest eigenvalue and corresponding eigenvector of the Hessian at the minima are shown to distinguish lone pair regions from the other types of electron localization (such as π bonds). A comparative study of lone pairs as depicted by various other scalar fields such as the Laplacian of electron density and electron localization function is made. Further, an attempt has been made to generalize the definition of lone pairs to the case of cations.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Walters, William; Hyde, Embriette R.; Berg-Lyons, Donna

ABSTRACT Designing primers for PCR-based taxonomic surveys that amplify a broad range of phylotypes in varied community samples is a difficult challenge, and the comparability of data sets amplified with varied primers requires attention. Here, we examined the performance of modified 16S rRNA gene and internal transcribed spacer (ITS) primers for archaea/bacteria and fungi, respectively, with nonaquatic samples. We moved primer bar codes to the 5′ end, allowing for a range of different 3′ primer pairings, such as the 515f/926r primer pair, which amplifies variable regions 4 and 5 of the 16S rRNA gene. We additionally demonstrated that modifications tomore » the 515f/806r (variable region 4) 16S primer pair, which improves detection ofThaumarchaeotaand clade SAR11 in marine samples, do not degrade performance on taxa already amplified effectively by the original primer set. Alterations to the fungal ITS primers did result in differential but overall improved performance compared to the original primers. In both cases, the improved primers should be widely adopted for amplicon studies. ImportanceWe continue to uncover a wealth of information connecting microbes in important ways to human and environmental ecology. As our scientific knowledge and technical abilities improve, the tools used for microbiome surveys can be modified to improve the accuracy of our techniques, ensuring that we can continue to identify groundbreaking connections between microbes and the ecosystems they populate, from ice caps to the human body. It is important to confirm that modifications to these tools do not cause new, detrimental biases that would inhibit the field rather than continue to move it forward. We therefore demonstrated that two recently modified primer pairs that target taxonomically discriminatory regions of bacterial and fungal genomic DNA do not introduce new biases when used on a variety of sample types, from soil to human skin. This confirms the utility of these primers for maintaining currently recommended microbiome research techniques as the state of the art.« less

Liquid gallium-lead mixture phase diagram, surface tension near the critical mixing point, and prewetting transition.

PubMed

Osman, S M; Grosdidier, B; Ali, I; Abdellah, A Ben

2013-06-01

Quite recently, we reported a semianalytical equation of state (EOS) for the Ga-Pb alloy [Phys. Rev. B 78, 024205 (2008)], which was based on the first-order perturbation theory of fluid mixtures, within the simplified random phase approximation, in conjunction with the Grosdidier et al. model pair potentials for Ga-Ga and Pb-Pb with a suitable nonadditive pair potential between Ga-Pb unlike pairs. In the present work, we employ the present EOS to calculate the Ga-Pb phase diagram along the immiscibility gap region. The accuracy of the EOS is tested by consulting the empirical binodal curve. A statistical-mechanical-based theory for the surface tension is employed to obtain an analytical expression for the alloy surface tension. We calculated the surface tension along the bimodal curve and at extreme conditions of temperatures and pressures. The surface tension exhibits reasonably well the prewetting transition of Pb atoms at the surface of the Ga-rich liquid alloy and could qualitatively explain the prewetting phenomena occurring in the Ga-rich side of the phase diagram. The predicted prewetting line and wetting temperature qualitatively agree with the empirical measurements.

Pairing preferences of the model mono-valence mono-atomic ions investigated by molecular simulation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Qiang; Department of Chemistry, Bohai University, Jinzhou 121000; Zhang, Ruiting

2014-05-14

We carried out a series of potential of mean force calculations to study the pairing preferences of a series of model mono-atomic 1:1 ions with evenly varied sizes. The probabilities of forming the contact ion pair (CIP) and the single water separate ion pair (SIP) were presented in the two-dimensional plots with respect to the ion sizes. The pairing preferences reflected in these plots largely agree with the empirical rule of matching ion sizes in the small and big size regions. In the region that the ion sizes are close to the size of the water molecule; however, a significantmore » deviation from this conventional rule is observed. Our further analysis indicated that this deviation originates from the competition between CIP and the water bridging SIP state. The competition is mainly an enthalpy modulated phenomenon in which the existing of the water bridging plays a significant role.« less

Platypus chain reaction: directional and ordered meiotic pairing of the multiple sex chromosome chain in Ornithorhynchus anatinus.

PubMed

Daish, Tasman; Casey, Aaron; Grützner, Frank

2009-01-01

Monotremes are phylogenetically and phenotypically unique animals with an unusually complex sex chromosome system that is composed of ten chromosomes in platypus and nine in echidna. These chromosomes are alternately linked (X1Y1, X2Y2, ...) at meiosis via pseudoautosomal regions and segregate to form spermatozoa containing either X or Y chromosomes. The physical and epigenetic mechanisms involved in pairing and assembly of the complex sex chromosome chain in early meiotic prophase I are completely unknown. We have analysed the pairing dynamics of specific sex chromosome pseudoautosomal regions in platypus spermatocytes during prophase of meiosis I. Our data show a highly coordinated pairing process that begins at the terminal Y5 chromosome and completes with the union of sex chromosomes X1Y1. The consistency of this ordered assembly of the chain is remarkable and raises questions about the mechanisms and factors that regulate the differential pairing of sex chromosomes and how this relates to potential meiotic silencing mechanisms and alternate segregation.

Application of fluorescence resonance energy transfer techniques to the study of lectin-binding site distribution on Paramecium primaurelia (Protista, Ciliophora) cell surface.

PubMed

Locatelli, D; Delmonte Corrado, M U; Politi, H; Bottiroli, G

1998-01-01

Fluorescence resonance energy transfer (FRET) is a photophysical phenomenon occurring between the molecules of two fluorochromes with suitable spectral characteristics (donor-acceptor dye pair), and consisting in an excitation energy migration through a non-radiative process. Since the efficiency of the process is strictly dependent on the distance and reciprocal orientation of the donor and acceptor molecules, FRET-based techniques can be successfully applied to the study of biomolecules and cell component organisation and distribution. These techniques have been employed in studying Paramecium primaurelia surface membrane for the reciprocal distribution of N-acetylneuraminic acid (NeuAc) and N-acetylglucosamine (GlcNAc) glycosidic residues, which were found to be involved in mating cell pairing. NeuAc and GlcNAc were detected by their specific binding lectins, Limulus polyphemus agglutinin (LPA) and wheat germ agglutinin (WGA), respectively. Microspectrofluorometric analysis afforded the choice of fluorescein isothiocyanate and Texas red conjugated with LPA and WGA, respectively, as a suitable donor-acceptor couple efficiently activating FRET processes. Studies performed both in solution and in cells allowed to define the experimental conditions favourable for a FRET analysis. The comparative study carried out both on the conjugating-region and the non conjugating region of the surface membrane, indicates that FRET distribution appears quite homogeneous in mating-competent mating type (mt) I, whereas, in mating-competent mt II cells, FRET distribution seems to be preferentially localised on the conjugating-region functionally involved in mating cell pairing. This difference in the distribution of lectin-binding sites is suggested to be related to mating-competence acquisition.

Lesser scaup breeding probability and female survival on the yukon flats, Alaska

USGS Publications Warehouse

Martin, K.H.; Lindberg, M.S.; Schmutz, J.A.; Bertram, M.R.

2009-01-01

Information on the ecology of waterfowl breeding in the boreal forest is lacking, despite the boreal region's importance to continental waterfowl populations and to duck species that are currently declining, such as lesser scaup (Aythya affinis). We estimated breeding probability and breeding season survival of female lesser scaup on the Yukon Flats National Wildlife Refuge, Alaska, USA, in 2005 and 2006. We captured and marked 93 lesser scaup with radiotransmitters during prelaying and nesting periods. Although all marked lesser scaup females were paired throughout prelaying and incubation periods, we estimated breeding probability over both years as 0.12 (SE = 0.05, n = 67) using telemetry. Proportion of lesser scaup females undergoing rapid follicle growth at capture in 2006 was 0.46 (SE = 0.11, n = 37), based on concentration of yolk precursors in blood plasma. By combining methods based on telemetry, yolk precursors, and postovulatory follicles, we estimated maximum breeding probability as 0.68 (SE = 0.08, n = 37) in 2006. Notably, breeding probability was positively related to female body mass. Survival of female lesser scaup during the nesting and brood-rearing periods was 0.92 (SE = 0.05) in 2005 and 0.86 (SE = 0.08) in 2006. Our results suggest that breeding probability is lower than expected for lesser scaup. In addition, the implicit assumption of continental duck-monitoring programs that all paired females attempt to breed should be reevaluated. Recruitment estimates based on annual breeding-pair surveys may overestimate productivity of scaup pairs in the boreal forest. ?? The Wildlife Society.

Relationships among basaltic lunar meteorites

NASA Technical Reports Server (NTRS)

Lindstrom, Marilyn M.

1991-01-01

During the past two years four meteorites of dominantly mare basalt composition were identified in the Japanese and US Antarctic collections. Basalts represent a much higher proportion of the lunar meteorites than is expected from photogeologic mapping of mare and highland regions. Also, the basaltic lunar meteorites are all described as VLT mare basalt, which is a relatively uncommon type among returned lunar samples. The significance of the basaltic meteorites to the understanding of the lunar crust depends on the evaluation of possible relationships among the individual meteorites. None of the specimens are paired meteorites. They differ from each other in petrography and composition. It is important to determine whether they might be paired ejecta which were ejected from the same mare region by the same impact. The question of paired ejecta must be addressed using a combination of exposure histories and petrographic/compositional characteristics. It is possible that the basaltic lunar meteorites are paired ejecta from the same region of the Moon. However, the relationships among them are more complicated than the basaltic breccias being simply brecciated mare gabbros.

Screening for Multiple Genes Influencing Dyslexia.

ERIC Educational Resources Information Center

Smith, Shelley D.; And Others

1991-01-01

Examines the "sib pair" method of linkage analysis designed to locate genes influencing dyslexia, which has several advantages over the "LOD" score method. Notes that the sib pair analysis was able to detect the same linkages as the LOD method, plus a possible third region. Confirms that the sib pair method is an effective means of screening. (RS)

pKa shifting in double-stranded RNA is highly dependent upon nearest neighbors and bulge positioning.

PubMed

Wilcox, Jennifer L; Bevilacqua, Philip C

2013-10-22

Shifting of pKa's in RNA is important for many biological processes; however, the driving forces responsible for shifting are not well understood. Herein, we determine how structural environments surrounding protonated bases affect pKa shifting in double-stranded RNA (dsRNA). Using (31)P NMR, we determined the pKa of the adenine in an A(+)·C base pair in various sequence and structural environments. We found a significant dependence of pKa on the base pairing strength of nearest neighbors and the location of a nearby bulge. Increasing nearest neighbor base pairing strength shifted the pKa of the adenine in an A(+)·C base pair higher by an additional 1.6 pKa units, from 6.5 to 8.1, which is well above neutrality. The addition of a bulge two base pairs away from a protonated A(+)·C base pair shifted the pKa by only ~0.5 units less than a perfectly base paired hairpin; however, positioning the bulge just one base pair away from the A(+)·C base pair prohibited formation of the protonated base pair as well as several flanking base pairs. Comparison of data collected at 25 °C and 100 mM KCl to biological temperature and Mg(2+) concentration revealed only slight pKa changes, suggesting that similar sequence contexts in biological systems have the potential to be protonated at biological pH. We present a general model to aid in the determination of the roles protonated bases may play in various dsRNA-mediated processes including ADAR editing, miRNA processing, programmed ribosomal frameshifting, and general acid-base catalysis in ribozymes.

Database of non-canonical base pairs found in known RNA structures

NASA Technical Reports Server (NTRS)

Nagaswamy, U.; Voss, N.; Zhang, Z.; Fox, G. E.

2000-01-01

Atomic resolution RNA structures are being published at an increasing rate. It is common to find a modest number of non-canonical base pairs in these structures in addition to the usual Watson-Crick pairs. This database summarizes the occurrence of these rare base pairs in accordance with standard nomenclature. The database, http://prion.bchs.uh.edu/, contains information such as sequence context, sugar pucker conformation, anti / syn base conformations, chemical shift, p K (a)values, melting temperature and free energy. Of the 29 anticipated pairs with two or more hydrogen bonds, 20 have been encountered to date. In addition, four unexpected pairs with two hydrogen bonds have been reported bringing the total to 24. Single hydrogen bond versions of five of the expected geometries have been encountered among the single hydrogen bond interactions. In addition, 18 different types of base triplets have been encountered, each of which involves three to six hydrogen bonds. The vast majority of the rare base pairs are antiparallel with the bases in the anti configuration relative to the ribose. The most common are the GU wobble, the Sheared GA pair, the Reverse Hoogsteen pair and the GA imino pair.

Energy spectrum of medium energy gamma-rays from the galactic center region. [experimental design

NASA Technical Reports Server (NTRS)

Palmeira, R. A. R.; Ramanujarao, K.; Dutra, S. L. G.; Bertsch, D. L.; Kniffen, D. A.; Morris, D. J.

1978-01-01

A balloon-borne magnetic core digitized spark chamber with two assemblies of spark-chambers above and below the scintillation counters was used to measure the medium energy gamma ray flux from the galactic center region. Gamma ray calculations are based on the multiple scattering of the pair electrons in 15 aluminum plates interleaved in the spark chamber modules. Counting rates determined during ascent and at ceiling indicate the presence of diffuse component in this energy range. Preliminary results give an integral flux between 15 and 70 MeV compared to the differential points in other results.

Mapping of Heavy Chain Genes for Mouse Immunoglobulins M and D

NASA Astrophysics Data System (ADS)

Liu, Chih-Ping; Tucker, Philip W.; Mushinski, J. Frederic; Blattner, Frederick R.

1980-09-01

A single DNA fragment containing both μ and δ immunoglobulin heavy chain genes has been cloned from normal BALB/c mouse liver DNA with a new λ phage vector Charon 28. The physical distance between the membrane terminal exon of μ and the first domain of δ is 2466 base pairs, with δ on the 3' side of μ . A single transcript could contain a variable region and both μ and δ constant regions. The dual expression of immunoglobulins M and D on spleen B cells may be due to alternate splicing of this transcript.

Somatic Pairing of Chromosome 19 in Renal Oncocytoma Is Associated with Deregulated ELGN2-Mediated Oxygen-Sensing Response

PubMed Central

Petillo, David; Westphal, Michael; Koelzer, Katherine; Metcalf, Julie L.; Zhang, Zhongfa; Matsuda, Daisuke; Dykema, Karl J.; Houseman, Heather L.; Kort, Eric J.; Furge, Laura L.; Kahnoski, Richard J.; Richard, Stéphane; Vieillefond, Annick; Swiatek, Pamela J.; Teh, Bin Tean; Ohh, Michael; Furge, Kyle A.

2008-01-01

Chromosomal abnormalities, such as structural and numerical abnormalities, are a common occurrence in cancer. The close association of homologous chromosomes during interphase, a phenomenon termed somatic chromosome pairing, has been observed in cancerous cells, but the functional consequences of somatic pairing have not been established. Gene expression profiling studies revealed that somatic pairing of chromosome 19 is a recurrent chromosomal abnormality in renal oncocytoma, a neoplasia of the adult kidney. Somatic pairing was associated with significant disruption of gene expression within the paired regions and resulted in the deregulation of the prolyl-hydroxylase ELGN2, a key protein that regulates the oxygen-dependent degradation of hypoxia-inducible factor (HIF). Overexpression of ELGN2 in renal oncocytoma increased ubiquitin-mediated destruction of HIF and concomitantly suppressed the expression of several HIF-target genes, including the pro-death BNIP3L gene. The transcriptional changes that are associated with somatic pairing of chromosome 19 mimic the transcriptional changes that occur following DNA amplification. Therefore, in addition to numerical and structural chromosomal abnormalities, alterations in chromosomal spatial dynamics should be considered as genomic events that are associated with tumorigenesis. The identification of EGLN2 as a significantly deregulated gene that maps within the paired chromosome region directly implicates defects in the oxygen-sensing network to the biology of renal oncocytoma. PMID:18773095

Neural Correlates of Encoding Within- and Across-Domain Inter-Item Associations

PubMed Central

Park, Heekyeong; Rugg, Michael D.

2012-01-01

The neural correlates of the encoding of associations between pairs of words, pairs of pictures, and word-picture pairs were compared. The aims were to determine first, whether the neural correlates of associative encoding vary according to study material and second, whether encoding of across- versus within-material item pairs is associated with dissociable patterns of hippocampal and perirhinal activity, as predicted by the ‘domain dichotomy’ hypothesis of medial temporal lobe (MTL) function. While undergoing fMRI scanning, subjects (n = 24) were presented with the three classes of study pairs, judging which of the denoted objects fit into the other. Outside of the scanner, subjects then undertook an associative recognition task, discriminating between intact study pairs, rearranged pairs comprising items that had been presented on different study trials, and unstudied item pairs. The neural correlates of successful associative encoding – subsequent associative memory effects – were operationalized as the difference in activity between study pairs correctly judged intact versus pairs incorrectly judged rearranged on the subsequent memory test. Pair type-independent subsequent memory effects were evident in the left inferior frontal gyrus (IFG) and the hippocampus. Picture-picture pairs elicited material-selective effects in regions of fusiform cortex that were also activated to a greater extent on picture trials than word trials, while word-word pairs elicited material-selective subsequent memory effects in left lateral temporal cortex. Contrary to the domain-dichotomy hypothesis, neither hippocampal nor perirhinal subsequent memory effects differed depending on whether they were elicited by within- versus across-material study pairs. It is proposed that the left IFG plays a domain-general role in associative encoding, that associative encoding can also be facilitated by enhanced processing in material-selective cortical regions, and that the hippocampus and perirhinal cortex contribute equally to the formation of inter-item associations regardless of whether the items belong to the same or to different processing domains. PMID:21254802

Interphase Chromosome Conformation and Chromatin-chromatin Interactions in Human Epithelial Cells Cultured Under Different Gravity Conditions

NASA Technical Reports Server (NTRS)

Zhang, Ye; Hada, Megumi; Wu, Honglu

2014-01-01

On a multi-mega base pair scale of the DNA, the arrangement of chromatin is non-random. In M10 epithelial cells, both telomere regions tend to be located towards the exterior of the chromosome domain, whereas the rest p-arm of the chromatin region towards the interior. In contrast, most of the q-arm of the chromatin is found in the peripheral of the domain. In lymphocytes, the p-arm chromatin regions towards the interior in close proximity with each other, whereas two q-arm regions are nearness in space. It indicates that G0 lymphocytes may lack secondary 3D chromatin folding. There chromatin folding patterns are consistent with our previous finding of non-random distribution of intra-chromosomal exchanges. In simulated microgravity conditions, the chromosome conformation may be altered and new regions in close proximity, especially to region 2 are suggested.

Precision 3d Surface Reconstruction from Lro Nac Images Using Semi-Global Matching with Coupled Epipolar Rectification

NASA Astrophysics Data System (ADS)

Hu, H.; Wu, B.

2017-07-01

The Narrow-Angle Camera (NAC) on board the Lunar Reconnaissance Orbiter (LRO) comprises of a pair of closely attached high-resolution push-broom sensors, in order to improve the swath coverage. However, the two image sensors do not share the same lenses and cannot be modelled geometrically using a single physical model. Thus, previous works on dense matching of stereo pairs of NAC images would generally create two to four stereo models, each with an irregular and overlapping region of varying size. Semi-Global Matching (SGM) is a well-known dense matching method and has been widely used for image-based 3D surface reconstruction. SGM is a global matching algorithm relying on global inference in a larger context rather than individual pixels to establish stable correspondences. The stereo configuration of LRO NAC images causes severe problem for image matching methods such as SGM, which emphasizes global matching strategy. Aiming at using SGM for image matching of LRO NAC stereo pairs for precision 3D surface reconstruction, this paper presents a coupled epipolar rectification methods for LRO NAC stereo images, which merges the image pair in the disparity space and in this way, only one stereo model will be estimated. For a stereo pair (four) of NAC images, the method starts with the boresight calibration by finding correspondence in the small overlapping stripe between each pair of NAC images and bundle adjustment of the stereo pair, in order to clean the vertical disparities. Then, the dominate direction of the images are estimated by project the center of the coverage area to the reference image and back-projected to the bounding box plane determined by the image orientation parameters iteratively. The dominate direction will determine an affine model, by which the pair of NAC images are warped onto the object space with a given ground resolution and in the meantime, a mask is produced indicating the owner of each pixel. SGM is then used to generate a disparity map for the stereo pair and each correspondence is transformed back to the owner and 3D points are derived through photogrammetric space intersection. Experimental results reveal that the proposed method is able to reduce gaps and inconsistencies caused by the inaccurate boresight offsets between the two NAC cameras and the irregular overlapping regions, and finally generate precise and consistent 3D surface models from the NAC stereo images automatically.

Cytogenetic and Molecular Data Support the Occurrence of Three Gymnotus Species (Gymnotiformes: Gymnotidae) Used as Live Bait in Corumbá, Brazil: Implications for Conservation and Management of Professional Fishing.

PubMed

de Sousa, Tatiane Pires; Marques, Débora Karla Silvestre; Vitorino, Carla de Andrade; Faria, Karina de Cassia; Braga, Gisele da Silva Ferreira; Ferreira, Daniela Cristina; Venere, Paulo Cesar

2017-04-01

In the Pantanal of Mato Grosso do Sul, electric fish (Gymnotus spp.) are the primary source of live bait, accounting for more than three-quarters of total sales. Based on chromosomal and molecular markers, the present study attempted to identify the Gymnotus species used as bait in the region of Corumbá, Mato Grosso do Sul, Brazil. Three species were detected, based on their distinct karyotypes: G. paraguensis (2n = 54), G. sylvius (2n = 40), and G. pantanal (2n = 39-40, X 1 X 2 Y/X 1 X 1 X 2 X 2 ), with no evidence being found of interspecific hybrids. All three species presented a single nucleolar organizer regions (NOR) (heterochromatin CMA 3 + /DAPI - ) and pericentromeric heterochromatin in almost all chromosomes, with a few distal and/or interstitial blocks. G. sylvius and G. pantanal had one and two pairs of chromosomes with 5S rDNA sites, respectively, while G. paraguensis had 17 chromosome pairs with these markers. The three species formed well-defined clusters in the DNA barcoding analysis. The integrated analysis of the cytogenetic and DNA barcoding data confirmed that the diversity of Gymnotus species exploited as live bait in the study region has been underestimated. These findings indicate that the markers analyzed represent valuable tools for the conservation and fishery management of the Gymnotus stocks exploited.

The Weak Lensing Masses of Filaments between Luminous Red Galaxies

NASA Astrophysics Data System (ADS)

Epps, Seth D.; Hudson, Michael J.

2017-07-01

In the standard model of non-linear structure formation, a cosmic web of dark-matter-dominated filaments connects dark matter haloes. In this paper, we stack the weak lensing signal of an ensemble of filaments between groups and clusters of galaxies. Specifically, we detect the weak lensing signal, using CFHTLenS galaxy ellipticities, from stacked filaments between Sloan Digital Sky Survey (SDSS)-III/Baryon Oscillation Spectroscopic Survey luminous red galaxies (LRGs). As a control, we compare the physical LRG pairs with projected LRG pairs that are more widely separated in redshift space. We detect the excess filament mass density in the projected pairs at the 5σ level, finding a mass of (1.6 ± 0.3) × 1013 M⊙ for a stacked filament region 7.1 h-1 Mpc long and 2.5 h-1 Mpc wide. This filament signal is compared with a model based on the three-point galaxy-galaxy-convergence correlation function, as developed in Clampitt et al., yielding reasonable agreement.

DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

PubMed

Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

2012-10-11

Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

The analysis of GEOS-3 altimeter data in the Tasman and Coral seas

NASA Technical Reports Server (NTRS)

Mather, R. S.

1977-01-01

A technique was developed for preprocessing GEOS-3 altimetry data to establish a model of the regional sea surface. The algorithms developed models for a 35,000,000 sq km area with an internal precision of + or - 1 m. There were discrepancies between the sea surface model so obtained and GEM6 based geoid profiles with wavelengths of approximately 2500 km and amplitudes of up to 5 m in this region. The amplitudes were smaller when compared with GEM10-based geoid determinations. However, the comparison of 14 pairs of overlapping passes in the region indicated altimeter resolution of the + or - 25 cm level if the wavelength corresponding to the Nyquist frequency were 30 km. The spectral analysis of such comparisons indicated the existence of significant signal strength in the discrepancies after least squares fitting, with wavelengths in excess of 200 km.

The registration of non-cooperative moving targets laser point cloud in different view point

NASA Astrophysics Data System (ADS)

Wang, Shuai; Sun, Huayan; Guo, Huichao

2018-01-01

Non-cooperative moving target multi-view cloud registration is the key technology of 3D reconstruction of laser threedimension imaging. The main problem is that the density changes greatly and noise exists under different acquisition conditions of point cloud. In this paper, firstly, the feature descriptor is used to find the most similar point cloud, and then based on the registration algorithm of region segmentation, the geometric structure of the point is extracted by the geometric similarity between point and point, The point cloud is divided into regions based on spectral clustering, feature descriptors are created for each region, searching to find the most similar regions in the most similar point of view cloud, and then aligning the pair of point clouds by aligning their minimum bounding boxes. Repeat the above steps again until registration of all point clouds is completed. Experiments show that this method is insensitive to the density of point clouds and performs well on the noise of laser three-dimension imaging.

Structure-guided statistical textural distinctiveness for salient region detection in natural images.

PubMed

Scharfenberger, Christian; Wong, Alexander; Clausi, David A

2015-01-01

We propose a simple yet effective structure-guided statistical textural distinctiveness approach to salient region detection. Our method uses a multilayer approach to analyze the structural and textural characteristics of natural images as important features for salient region detection from a scale point of view. To represent the structural characteristics, we abstract the image using structured image elements and extract rotational-invariant neighborhood-based textural representations to characterize each element by an individual texture pattern. We then learn a set of representative texture atoms for sparse texture modeling and construct a statistical textural distinctiveness matrix to determine the distinctiveness between all representative texture atom pairs in each layer. Finally, we determine saliency maps for each layer based on the occurrence probability of the texture atoms and their respective statistical textural distinctiveness and fuse them to compute a final saliency map. Experimental results using four public data sets and a variety of performance evaluation metrics show that our approach provides promising results when compared with existing salient region detection approaches.

Incorporating a guanidine-modified cytosine base into triplex-forming PNAs for the recognition of a C-G pyrimidine–purine inversion site of an RNA duplex

PubMed Central

Toh, Desiree-Faye Kaixin; Devi, Gitali; Patil, Kiran M.; Qu, Qiuyu; Maraswami, Manikantha; Xiao, Yunyun; Loh, Teck Peng; Zhao, Yanli; Chen, Gang

2016-01-01

RNA duplex regions are often involved in tertiary interactions and protein binding and thus there is great potential in developing ligands that sequence-specifically bind to RNA duplexes. We have developed a convenient synthesis method for a modified peptide nucleic acid (PNA) monomer with a guanidine-modified 5-methyl cytosine base. We demonstrated by gel electrophoresis, fluorescence and thermal melting experiments that short PNAs incorporating the modified residue show high binding affinity and sequence specificity in the recognition of an RNA duplex containing an internal inverted Watson-Crick C-G base pair. Remarkably, the relatively short PNAs show no appreciable binding to DNA duplexes or single-stranded RNAs. The attached guanidine group stabilizes the base triple through hydrogen bonding with the G base in a C-G pair. Selective binding towards an RNA duplex over a single-stranded RNA can be rationalized by the fact that alkylation of the amine of a 5-methyl C base blocks the Watson–Crick edge. PNAs incorporating multiple guanidine-modified cytosine residues are able to enter HeLa cells without any transfection agent. PMID:27596599

MR-assisted PET motion correction in simultaneous PET/MRI studies of dementia subjects.

PubMed

Chen, Kevin T; Salcedo, Stephanie; Chonde, Daniel B; Izquierdo-Garcia, David; Levine, Michael A; Price, Julie C; Dickerson, Bradford C; Catana, Ciprian

2018-03-08

Subject motion in positron emission tomography (PET) studies leads to image blurring and artifacts; simultaneously acquired magnetic resonance imaging (MRI) data provides a means for motion correction (MC) in integrated PET/MRI scanners. To assess the effect of realistic head motion and MR-based MC on static [ 18 F]-fluorodeoxyglucose (FDG) PET images in dementia patients. Observational study. Thirty dementia subjects were recruited. 3T hybrid PET/MR scanner where EPI-based and T 1 -weighted sequences were acquired simultaneously with the PET data. Head motion parameters estimated from high temporal resolution MR volumes were used for PET MC. The MR-based MC method was compared to PET frame-based MC methods in which motion parameters were estimated by coregistering 5-minute frames before and after accounting for the attenuation-emission mismatch. The relative changes in standardized uptake value ratios (SUVRs) between the PET volumes processed with the various MC methods, without MC, and the PET volumes with simulated motion were compared in relevant brain regions. The absolute value of the regional SUVR relative change was assessed with pairwise paired t-tests testing at the P = 0.05 level, comparing the values obtained through different MR-based MC processing methods as well as across different motion groups. The intraregion voxelwise variability of regional SUVRs obtained through different MR-based MC processing methods was also assessed with pairwise paired t-tests testing at the P = 0.05 level. MC had a greater impact on PET data quantification in subjects with larger amplitude motion (higher than 18% in the medial orbitofrontal cortex) and greater changes were generally observed for the MR-based MC method compared to the frame-based methods. Furthermore, a mean relative change of ∼4% was observed after MC even at the group level, suggesting the importance of routinely applying this correction. The intraregion voxelwise variability of regional SUVRs was also decreased using MR-based MC. All comparisons were significant at the P = 0.05 level. Incorporating temporally correlated MR data to account for intraframe motion has a positive impact on the FDG PET image quality and data quantification in dementia patients. 3 Technical Efficacy: Stage 1 J. Magn. Reson. Imaging 2018. © 2018 International Society for Magnetic Resonance in Medicine.

Mechanical spin bearings

NASA Technical Reports Server (NTRS)

Vranish, John M. (Inventor)

1998-01-01

A spin bearing assembly including, a pair of mutually opposing complementary bearing support members having mutually spaced apart bearing support surfaces which may be, for example, bearing races and a set of spin bearings located therebetween. Each spin bearing includes a pair of end faces, a central rotational axis passing through the end faces, a waist region substantially mid-way between the end faces and having a first thickness dimension, and discrete side surface regions located between the waist region and the end faces and having a second thickness dimension different from the first thickness dimension of the waist region and wherein the side surface regions further have respective curvilinear contact surfaces adapted to provide a plurality of bearing contact points on the bearing support members.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tripathi, S.; Zhang, D.; Paukstelis, P. J.

DNA has proved to be an excellent material for nanoscale construction because complementary DNA duplexes are programmable and structurally predictable. However, in the absence of Watson–Crick pairings, DNA can be structurally more diverse. Here, we describe the crystal structures of d(ACTCGGATGAT) and the brominated derivative, d(AC BrUCGGA BrUGAT). These oligonucleotides form parallel-stranded duplexes with a crystallographically equivalent strand, resulting in the first examples of DNA crystal structures that contains four different symmetric homo base pairs. Two of the parallel-stranded duplexes are coaxially stacked in opposite directions and locked together to form a tetraplex through intercalation of the 5'-most A–A basemore » pairs between adjacent G–G pairs in the partner duplex. The intercalation region is a new type of DNA tertiary structural motif with similarities to the i-motif. 1H– 1H nuclear magnetic resonance and native gel electrophoresis confirmed the formation of a parallel-stranded duplex in solution. Finally, we modified specific nucleotide positions and added d(GAY) motifs to oligonucleotides and were readily able to obtain similar crystals. This suggests that this parallel-stranded DNA structure may be useful in the rational design of DNA crystals and nanostructures.« less

An intercalation-locked parallel-stranded DNA tetraplex

DOE PAGES

Tripathi, S.; Zhang, D.; Paukstelis, P. J.

2015-01-27

DNA has proved to be an excellent material for nanoscale construction because complementary DNA duplexes are programmable and structurally predictable. However, in the absence of Watson–Crick pairings, DNA can be structurally more diverse. Here, we describe the crystal structures of d(ACTCGGATGAT) and the brominated derivative, d(AC BrUCGGA BrUGAT). These oligonucleotides form parallel-stranded duplexes with a crystallographically equivalent strand, resulting in the first examples of DNA crystal structures that contains four different symmetric homo base pairs. Two of the parallel-stranded duplexes are coaxially stacked in opposite directions and locked together to form a tetraplex through intercalation of the 5'-most A–A basemore » pairs between adjacent G–G pairs in the partner duplex. The intercalation region is a new type of DNA tertiary structural motif with similarities to the i-motif. 1H– 1H nuclear magnetic resonance and native gel electrophoresis confirmed the formation of a parallel-stranded duplex in solution. Finally, we modified specific nucleotide positions and added d(GAY) motifs to oligonucleotides and were readily able to obtain similar crystals. This suggests that this parallel-stranded DNA structure may be useful in the rational design of DNA crystals and nanostructures.« less

Anisotropy in pair dispersion of inertial particles in turbulent channel flow

NASA Astrophysics Data System (ADS)

Pitton, Enrico; Marchioli, Cristian; Lavezzo, Valentina; Soldati, Alfredo; Toschi, Federico

2012-07-01

The rate at which two particles separate in turbulent flows is of central importance to predict the inhomogeneities of particle spatial distribution and to characterize mixing. Pair separation is analyzed for the specific case of small, inertial particles in turbulent channel flow to examine the role of mean shear and small-scale turbulent velocity fluctuations. To this aim an Eulerian-Lagrangian approach based on pseudo-spectral direct numerical simulation (DNS) of fully developed gas-solid flow at shear Reynolds number Reτ = 150 is used. Pair separation statistics have been computed for particles with different inertia (and for inertialess tracers) released from different regions of the channel. Results confirm that shear-induced effects predominate when the pair separation distance becomes comparable to the largest scale of the flow. Results also reveal the fundamental role played by particles-turbulence interaction at the small scales in triggering separation during the initial stages of pair dispersion. These findings are discussed examining Lagrangian observables, including the mean square separation, which provide prima facie evidence that pair dispersion in non-homogeneous anisotropic turbulence has a superdiffusive nature and may generate non-Gaussian number density distributions of both particles and tracers. These features appear to persist even when the effects of shear dispersion are filtered out, and exhibit strong dependency on particle inertia. Application of present results is discussed in the context of modelling approaches for particle dispersion in wall-bounded turbulent flows.

Electric Field Screening with Backflow at Pulsar Polar Cap

NASA Astrophysics Data System (ADS)

Kisaka, Shota; Asano, Katsuaki; Terasawa, Toshio

2016-09-01

Recent γ-ray observations suggest that particle acceleration occurs at the outer region of the pulsar magnetosphere. The magnetic field lines in the outer acceleration region (OAR) are connected to the neutron star surface (NSS). If copious electron-positron pairs are produced near the NSS, such pairs flow into the OAR and screen the electric field there. To activate the OAR, the electromagnetic cascade due to the electric field near the NSS should be suppressed. However, since a return current is expected along the field lines through the OAR, the outflow extracted from the NSS alone cannot screen the electric field just above the NSS. In this paper, we analytically and numerically study the electric field screening at the NSS, taking into account the effects of the backflowing particles from the OAR. In certain limited cases, the electric field is screened without significant pair cascade if only ultra-relativistic particles (γ \\gg 1) flow back to the NSS. On the other hand, if electron-positron pairs with a significant number density and mildly relativistic temperature, expected to distribute in a wide region of the magnetosphere, flow back to the NSS, these particles adjust the current and charge densities so that the electric field can be screened without pair cascade. We obtain the condition needed for the number density of particles to screen the electric field at the NSS. We also find that in the ion-extracted case from the NSS, bunches of particles are ejected to the outer region quasi-periodically, which is a possible mechanism of observed radio emission.

Detection and Identification of Decay Fungi in Spruce Wood by Restriction Fragment Length Polymorphism Analysis of Amplified Genes Encoding rRNA†

PubMed Central

Jasalavich, Claudia A.; Ostrofsky, Andrea; Jellison, Jody

2000-01-01

We have developed a DNA-based assay to reliably detect brown rot and white rot fungi in wood at different stages of decay. DNA, isolated by a series of CTAB (cetyltrimethylammonium bromide) and organic extractions, was amplified by the PCR using published universal primers and basidiomycete-specific primers derived from ribosomal DNA sequences. We surveyed 14 species of wood-decaying basidiomycetes (brown-rot and white-rot fungi), as well as 25 species of wood-inhabiting ascomycetes (pathogens, endophytes, and saprophytes). DNA was isolated from pure cultures of these fungi and also from spruce wood blocks colonized by individual isolates of wood decay basidiomycetes or wood-inhabiting ascomycetes. The primer pair ITS1-F (specific for higher fungi) and ITS4 (universal primer) amplified the internal transcribed spacer region from both ascomycetes and basidiomycetes from both pure culture and wood, as expected. The primer pair ITS1-F (specific for higher fungi) and ITS4-B (specific for basidiomycetes) was shown to reliably detect the presence of wood decay basidiomycetes in both pure culture and wood; ascomycetes were not detected by this primer pair. We detected the presence of decay fungi in wood by PCR before measurable weight loss had occurred to the wood. Basidiomycetes were identified to the species level by restriction fragment length polymorphisms of the internal transcribed spacer region. PMID:11055916

PCR-based identification of Erysiphe pulchra and Phyllactinia guttata from Cornus florida using ITS-specific primers

Treesearch

M. T. Mmbaga; N. B. Klopfenstein; M. -S. Kim; N. C. Mmbaga

2004-01-01

The internal transcribed spacer (ITS) regions of rDNA and the intervening 5.8S rRNA gene for the powdery mildew fungi Erysiphe (sect. Microsphaera) pulchra and Phyllactinia guttata were amplified using standard polymerase chain reaction (PCR) protocols and the universal primer pairs, ITS1 and ITS4. PCR products for ITS were analysed by electrophoresis in a 1.5% agarose...

DsrA regulatory RNA represses both hns and rbsD mRNAs through distinct mechanisms in Escherichia coli.

PubMed

Lalaouna, David; Morissette, Audrey; Carrier, Marie-Claude; Massé, Eric

2015-10-01

The 87 nucleotide long DsrA sRNA has been mostly studied for its translational activation of the transcriptional regulator RpoS. However, it also represses hns mRNA, which encodes H-NS, a major regulator that affects expression of nearly 5% of Escherichia coli genes. A speculative model previously suggested that DsrA would block hns mRNA translation by binding simultaneously to start and stop codon regions of hns mRNA (coaxial model). Here, we show that DsrA efficiently blocked translation of hns mRNA by base-pairing immediately downstream of the start codon. In addition, DsrA induced hns mRNA degradation by actively recruiting the RNA degradosome complex. Data presented here led to a model of DsrA action on hns mRNA, which supports a canonical mechanism of sRNA-induced mRNA degradation by binding to the translation initiation region. Furthermore, using MS2-affinity purification coupled with RNA sequencing technology (MAPS), we also demonstrated that DsrA targets rbsD mRNA, involved in ribose utilization. Surprisingly, DsrA base pairs far downstream of rbsD start codon and induces rapid degradation of the transcript. Thus, our study enables us to draw an extended DsrA targetome. © 2015 John Wiley & Sons Ltd.

Detection and genotyping of bovine diarrhea virus by reverse transcription-polymerase chain amplification of the 5' untranslated region.

PubMed

Letellier, C; Kerkhofs, P; Wellemans, G; Vanopdenbosch, E

1999-01-01

A reverse-transcription polymerase chain reaction (RT-PCR) was developed to differentiate the bovine diarrhea virus (BVDV) from other pestiviruses, and to determine the genotype of the BVDV isolates. For this purpose, primer pairs were selected in the 5' untranslated region (5'UTR). The primers BE and B2 were located in highly conserved regions and were pestivirus-specific. Two primer pairs named B3B4 and B5B6 were specific of BVDV genotypes I and II, respectively. With this technique, an amplification product of the expected size was obtained with either the B3B4 or the B5B6 primer pairs for the 107 BVDV isolates tested but not for BDV or CSFV. For some isolates that were grouped in the genotype II, sequence analysis of the PCR fragments confirmed their classification into this genotype.

Inferring the risk factors behind the geographical spread and transmission of Zika in the Americas.

PubMed

Gardner, Lauren M; Bóta, András; Gangavarapu, Karthik; Kraemer, Moritz U G; Grubaugh, Nathan D

2018-01-01

An unprecedented Zika virus epidemic occurred in the Americas during 2015-2016. The size of the epidemic in conjunction with newly recognized health risks associated with the virus attracted significant attention across the research community. Our study complements several recent studies which have mapped epidemiological elements of Zika, by introducing a newly proposed methodology to simultaneously estimate the contribution of various risk factors for geographic spread resulting in local transmission and to compute the risk of spread (or re-introductions) between each pair of regions. The focus of our analysis is on the Americas, where the set of regions includes all countries, overseas territories, and the states of the US. We present a novel application of the Generalized Inverse Infection Model (GIIM). The GIIM model uses real observations from the outbreak and seeks to estimate the risk factors driving transmission. The observations are derived from the dates of reported local transmission of Zika virus in each region, the network structure is defined by the passenger air travel movements between all pairs of regions, and the risk factors considered include regional socioeconomic factors, vector habitat suitability, travel volumes, and epidemiological data. The GIIM relies on a multi-agent based optimization method to estimate the parameters, and utilizes a data driven stochastic-dynamic epidemic model for evaluation. As expected, we found that mosquito abundance, incidence rate at the origin region, and human population density are risk factors for Zika virus transmission and spread. Surprisingly, air passenger volume was less impactful, and the most significant factor was (a negative relationship with) the regional gross domestic product (GDP) per capita. Our model generates country level exportation and importation risk profiles over the course of the epidemic and provides quantitative estimates for the likelihood of introduced Zika virus resulting in local transmission, between all origin-destination travel pairs in the Americas. Our findings indicate that local vector control, rather than travel restrictions, will be more effective at reducing the risks of Zika virus transmission and establishment. Moreover, the inverse relationship between Zika virus transmission and GDP suggests that Zika cases are more likely to occur in regions where people cannot afford to protect themselves from mosquitoes. The modeling framework is not specific for Zika virus, and could easily be employed for other vector-borne pathogens with sufficient epidemiological and entomological data.

Paired β-sheet structure of an Aβ(1-40) amyloid fibril revealed by electron microscopy

PubMed Central

Sachse, Carsten; Fändrich, Marcus; Grigorieff, Nikolaus

2008-01-01

Alzheimer's disease is a neurodegenerative disorder that is characterized by the cerebral deposition of amyloid fibrils formed by Aβ peptide. Despite their prevalence in Alzheimer's and other neurodegenerative diseases, important details of the structure of amyloid fibrils remain unknown. Here, we present a three-dimensional structure of a mature amyloid fibril formed by Aβ(1-40) peptide, determined by electron cryomicroscopy at ≈8-Å resolution. The fibril consists of two protofilaments, each containing ≈5-nm-long regions of β-sheet structure. A local twofold symmetry within each region suggests that pairs of β-sheets are formed from equivalent parts of two Aβ(1-40) peptides contained in each protofilament. The pairing occurs via tightly packed interfaces, reminiscent of recently reported steric zipper structures. However, unlike these previous structures, the β-sheet pairing is observed within an amyloid fibril and includes significantly longer amino acid sequences. PMID:18483195

Karyotypic similarities between two species of Rhamphichthys (Rhamphichthyidae, Gymnotiformes) from the Amazon basin

PubMed Central

da Silva, Patrícia Corrêa; Nagamachi, Cleusa Yoshiko; Silva, Danillo dos Santos; Milhomem, Susana Suely Rodrigues; Cardoso, Adauto Lima; de Oliveira, Jonas Alves; Pieczarka, Julio Cesar

2013-01-01

Abstract The family Rhamphichthyidae includes three genera: Rhamphichthys Müller et Troschel, 1846, Gymnorhamphichthys M. M. Ellis, 1912 and Iracema Triques, 1996. From this family, only the species Rhamphichthys hanni Meinken, 1937 has had its karyotype described. Here, we describe the karyotypes of two additional Rhamphichthys species: Rhamphichthys marmoratus Castelnau, 1855 from the Reserva de Desenvolvimento Sustentável Mamirauá, Amazonas state and Rhamphichthys prope rostratus Linnaeus, 1766 from Pará state, both in Brazil. Our karyotypic analyses demonstrated that the diploid number is conserved for the genus (2n = 50), but the karyotypic formulas (KFs) differed between Rhamphichthys marmoratus (44m/sm+6a) and Rhamphichthys prope rostratus (42m/sm+8a). In both species, the constitutive heterochromatin (CH) was located in the centromeric region of most chromosomes. Large heterochromatic blocks were found on the long arms of pairs 4 and 14 in Rhamphichthys marmoratus and on chromosomes 3, 4 and 19 in Rhamphichthys prope rostratus, which also has a heteromorphism in chromosome pair 1. The CH was DAPI positive, indicating that it is rich in AT base pairs. The Nucleolus Organizer Region (NOR) showed staining at a single location in both species: the long arm of pair 1 in Rhamphichthys marmoratus and the long arm of pair 12 in Rhamphichthys prope rostratus, where it showed a size heteromorphism. CMA3 staining coincided with that of Ag-NOR, indicating that the ribosomal genes contain interspaced GC-rich sequences. FISH with an 18S rDNA probe confirmed that there is only one NOR site in each species. These results can be used as potential cytogenetic markers for fish populations, and comparative analysis of the karyotypes of Hypopygus Hoedman, 1962, Rhamphichthys and Steatogenys Boulenger, 1898 suggests that the first two genera diverged later that the third. PMID:24455102

Rotational-translational fourier imaging system

NASA Technical Reports Server (NTRS)

Campbell, Jonathan W. (Inventor)

2004-01-01

This invention has the ability to create Fourier-based images with only two grid pairs. The two grid pairs are manipulated in a manner that allows (1) a first grid pair to provide multiple real components of the Fourier-based image and (2) a second grid pair to provide multiple imaginary components of the Fourier-based image. The novelty of this invention resides in the use of only two grid pairs to provide the same imaging information that has been traditionally collected with multiple grid pairs.

Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

PubMed

Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

2011-03-14

We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

Development of a PCR protocol to detect aflatoxigenic molds in food products.

PubMed

Luque, M Isabel; Rodríguez, Alicia; Andrade, María J; Martín, Alberto; Córdoba, Juan J

2012-01-01

Aflatoxins are secondary metabolites produced mainly by Aspergillus species growing in foodstuffs. Because aflatoxins have important health effects, the detection of early contamination of foods by aflatoxigenic molds should be useful. In the present work, a reliable conventional PCR method for detecting aflatoxigenic molds of various species was developed. Fifty-six aflatoxigenic and nonaflatoxigenic strains commonly reported in foodstuffs were tested. Aflatoxin production was first confirmed by micellar electrokinetic capillary electrophoresis or/and high-pressure liquid chromatography-mass spectrometry. Based on the conserved regions of the O-methyltransferase gene (omt-1) involved in the aflatoxin biosynthetic pathway, six primer pairs were designed. With only the designed primer pair AFF1-AFR3, the expected PCR product (381 bp) was obtained in all of the tested aflatoxigenic strains of various species and genera. Amplification products were not obtained with this primer pair for any of the nonaflatoxigenic reference molds. However, an amplicon of 453 bp was obtained for all aflatoxigenic and nonaflatoxigenic mold reference strains with a PCR protocol based on the constitutive fungal β-tubulin gene, which was used as a positive fungal control. The PCR protocol based on omt-1 detected as little as 15 pg of DNA from aflatoxigenic molds and 10(2) to 10(3) CFU/g in contaminated food samples. This PCR protocol should be used as a routine technique to detect aflatoxigenic molds in foods.

Rapid identification of the Asian gypsy moth and its related species based on mitochondrial DNA.

PubMed

Wu, Ying; Du, Qiuyang; Qin, Haiwen; Shi, Juan; Wu, Zhiyi; Shao, Weidong

2018-02-01

The gypsy moth- Lymantria dispar (Linnaeus)-is a worldwide forest defoliator and is of two types: the European gypsy moth and the Asian gypsy moth. Because of multiple invasions of the Asian gypsy moth, the North American Plant Protection Organization officially approved Regional Standards for Phytosanitary Measures No. 33. Accordingly, special quarantine measures have been implemented for 30 special focused ports in the epidemic areas of the Asian gypsy moth, including China, which has imposed great inconvenience on export trade. The Asian gypsy moth and its related species (i.e., Lymantria monocha and Lymantria xylina ) intercepted at ports are usually at different life stages, making their identification difficult. Furthermore, Port quarantine requires speedy clearance. As such, it is difficult to identify the Asian gypsy moth and its related species only by their morphological characteristics in a speedy measure. Therefore, this study aimed to use molecular biology technology to rapidly identify the Asian gypsy moth and its related species based on the consistency of mitochondrial DNA in different life stages. We designed 10 pairs of specific primers from different fragments of the Asian gypsy moth and its related species, and their detection sensitivity met the need for rapid identification. In addition, we determined the optimal polymerase chain reaction amplification temperature of the 10 pairs of specific primers, including three pairs of specific primers for the Asian gypsy moth ( L. dispar asiatic ), four pairs of specific primers for the nun moth ( L. monocha ), and three pairs of specific primers for the casuarina moth ( L. xylina ). In conclusion, using our designed primers, direct rapid identification of the Asian gypsy moth and its related species is possible, and this advancement can help improve export trade in China.

Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

PubMed

Kryachko, E S; Remacle, F

2005-12-08

The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

PAPERS DEVOTED TO THE MEMORY OF ACADEMICIAN A M PROKHOROV: Immunosensor systems with the Langmuir-film-based fluorescence detection

NASA Astrophysics Data System (ADS)

Chudinova, G. K.; Nagovitsyn, I. A.; Karpov, R. E.; Savranskii, V. V.

2003-09-01

A method is developed for detecting protein antigens for fluorescent immunoassay using a model system based on the technique for preparation of Langmuir films. Fluorescein isothiocyanate and donor-acceptor energy-transfer pairs of markers (the Yb complex of tetraphenyl porphyrin — benzoyl trifluoroacetoneisothiocyanate and derivatives of tetra(carboxyphenyl) porphyrin — cyanine dye containing a five-membered polyene chain), which were nor studied earlier, were used as markers for detecting the binding of an antigen on the surface of Langmuir films of antibodies. Fluorescence was detected in the near-IR region (for the first pair) and in the visible spectral range (for the second pair). To reduce the nonspecific sorption of a protein (antigen), a method was proposed for the preparation of a nonpolar surface by applying an even number of layers of stearic acid as a substrate for the Langmuir — Blodgett film. A high sensitivity of model systems to a protein antigen in solution was achieved (~10-11 M), the assay time being 6 — 8 min. The model system with the first donor — acceptor pair was tested in analysis of the blood plasma. The fluorescence of the Dy3+, Tm3+, and Yb3+ complexes of tetraphenyl porphyrin sensitised by diketonate complexes of lanthanides was studied for the first time and the enhancement of the IR fluorescence of these complexes in a Langmuir film was demonstrated.

Stochastic parameterization of shallow cumulus convection estimated from high-resolution model data

NASA Astrophysics Data System (ADS)

Dorrestijn, Jesse; Crommelin, Daan T.; Siebesma, A. Pier.; Jonker, Harm J. J.

2013-02-01

In this paper, we report on the development of a methodology for stochastic parameterization of convective transport by shallow cumulus convection in weather and climate models. We construct a parameterization based on Large-Eddy Simulation (LES) data. These simulations resolve the turbulent fluxes of heat and moisture and are based on a typical case of non-precipitating shallow cumulus convection above sea in the trade-wind region. Using clustering, we determine a finite number of turbulent flux pairs for heat and moisture that are representative for the pairs of flux profiles observed in these simulations. In the stochastic parameterization scheme proposed here, the convection scheme jumps randomly between these pre-computed pairs of turbulent flux profiles. The transition probabilities are estimated from the LES data, and they are conditioned on the resolved-scale state in the model column. Hence, the stochastic parameterization is formulated as a data-inferred conditional Markov chain (CMC), where each state of the Markov chain corresponds to a pair of turbulent heat and moisture fluxes. The CMC parameterization is designed to emulate, in a statistical sense, the convective behaviour observed in the LES data. The CMC is tested in single-column model (SCM) experiments. The SCM is able to reproduce the ensemble spread of the temperature and humidity that was observed in the LES data. Furthermore, there is a good similarity between time series of the fractions of the discretized fluxes produced by SCM and observed in LES.

Ionic micelles and aromatic additives: a closer look at the molecular packing parameter.

PubMed

Lutz-Bueno, Viviane; Isabettini, Stéphane; Walker, Franziska; Kuster, Simon; Liebi, Marianne; Fischer, Peter

2017-08-16

Wormlike micellar aggregates formed from the mixture of ionic surfactants with aromatic additives result in solutions with impressive viscoelastic properties. These properties are of high interest for numerous industrial applications and are often used as model systems for soft matter physics. However, robust and simple models for tailoring the viscoelastic response of the solution based on the molecular structure of the employed additive are required to fully exploit the potential of these systems. We address this shortcoming with a modified packing parameter based model, considering the additive-surfactant pair. The role of charge neutralization on anisotropic micellar growth was investigated with derivatives of sodium salicylate. The impact of the additives on the morphology of the micellar aggregates is explained from the molecular level to the macroscopic viscoelasticity. Changes in the micelle's volume, headgroup area and additive structure are explored to redefine the packing parameter. Uncharged additives penetrated deeper into the hydrophobic region of the micelle, whilst charged additives remained trapped in the polar region, as revealed by a combination of 1 H-NMR, SAXS and rheological measurements. A deeper penetration of the additives densified the hydrophobic core of the micelle and induced anisotropic growth by increasing the effective volume of the additive-surfactant pair. This phenomenon largely influenced the viscosity of the solutions. Partially penetrating additives reduced the electrostatic repulsions between surfactant headgroups and neighboring micelles. The resulting increased network density governed the elasticity of the solutions. Considering a packing parameter composed of the additive-surfactant pair proved to be a facile means of engineering the viscoelastic response of surfactant solutions. The self-assembly of the wormlike micellar aggregates could be tailored to desired morphologies resulting in a specific and predictable rheological response.

CAB-Align: A Flexible Protein Structure Alignment Method Based on the Residue-Residue Contact Area.

PubMed

Terashi, Genki; Takeda-Shitaka, Mayuko

2015-01-01

Proteins are flexible, and this flexibility has an essential functional role. Flexibility can be observed in loop regions, rearrangements between secondary structure elements, and conformational changes between entire domains. However, most protein structure alignment methods treat protein structures as rigid bodies. Thus, these methods fail to identify the equivalences of residue pairs in regions with flexibility. In this study, we considered that the evolutionary relationship between proteins corresponds directly to the residue-residue physical contacts rather than the three-dimensional (3D) coordinates of proteins. Thus, we developed a new protein structure alignment method, contact area-based alignment (CAB-align), which uses the residue-residue contact area to identify regions of similarity. The main purpose of CAB-align is to identify homologous relationships at the residue level between related protein structures. The CAB-align procedure comprises two main steps: First, a rigid-body alignment method based on local and global 3D structure superposition is employed to generate a sufficient number of initial alignments. Then, iterative dynamic programming is executed to find the optimal alignment. We evaluated the performance and advantages of CAB-align based on four main points: (1) agreement with the gold standard alignment, (2) alignment quality based on an evolutionary relationship without 3D coordinate superposition, (3) consistency of the multiple alignments, and (4) classification agreement with the gold standard classification. Comparisons of CAB-align with other state-of-the-art protein structure alignment methods (TM-align, FATCAT, and DaliLite) using our benchmark dataset showed that CAB-align performed robustly in obtaining high-quality alignments and generating consistent multiple alignments with high coverage and accuracy rates, and it performed extremely well when discriminating between homologous and nonhomologous pairs of proteins in both single and multi-domain comparisons. The CAB-align software is freely available to academic users as stand-alone software at http://www.pharm.kitasato-u.ac.jp/bmd/bmd/Publications.html.

The phylogenetic position of the roughskin skate Dipturus trachyderma (Krefft & Stehmann, 1975) (Rajiformes, Rajidae) inferred from the mitochondrial genome.

PubMed

Vargas-Caro, Carolina; Bustamante, Carlos; Lamilla, Julio; Bennett, Michael B; Ovenden, Jennifer R

2016-07-01

The complete mitochondrial genome of the roughskin skate Dipturus trachyderma is described from 1 455 724 sequences obtained using Illumina NGS technology. Total length of the mitogenome was 16 909 base pairs, comprising 2 rRNAs, 13 protein-coding genes, 22 tRNAs and 2 non-coding regions. Phylogenetic analysis based on mtDNA revealed low genetic divergence among longnose skates, in particular, those dwelling the continental shelf and slope off the coasts of Chile and Argentina.

Efficient Implementation of the Pairing on Mobilephones Using BREW

NASA Astrophysics Data System (ADS)

Yoshitomi, Motoi; Takagi, Tsuyoshi; Kiyomoto, Shinsaku; Tanaka, Toshiaki

Pairing based cryptosystems can accomplish novel security applications such as ID-based cryptosystems, which have not been constructed efficiently without the pairing. The processing speed of the pairing based cryptosystems is relatively slow compared with the other conventional public key cryptosystems. However, several efficient algorithms for computing the pairing have been proposed, namely Duursma-Lee algorithm and its variant ηT pairing. In this paper, we present an efficient implementation of the pairing over some mobilephones. Moreover, we compare the processing speed of the pairing with that of the other standard public key cryptosystems, i. e. RSA cryptosystem and elliptic curve cryptosystem. Indeed the processing speed of our implementation in ARM9 processors on BREW achieves under 100 milliseconds using the supersingular curve over F397. In addition, the pairing is more efficient than the other public key cryptosystems, and the pairing can be achieved enough also on BREW mobilephones. It has become efficient enough to implement security applications, such as short signature, ID-based cryptosystems or broadcast encryption, using the pairing on BREW mobilephones.

Recombinant transfer in the basic genome of E. coli

DOE PAGES

Dixit, Purushottam; Studier, F. William; Pang, Tin Yau; ...

2015-07-07

An approximation to the ~4-Mbp basic genome shared by 32 strains of E. coli representing six evolutionary groups has been derived and analyzed computationally. A multiple-alignment of the 32 complete genome sequences was filtered to remove mobile elements and identify the most reliable ~90% of the aligned length of each of the resulting 496 basic-genome pairs. Patterns of single bp mutations (SNPs) in aligned pairs distinguish clonally inherited regions from regions where either genome has acquired DNA fragments from diverged genomes by homologous recombination since their last common ancestor. Such recombinant transfer is pervasive across the basic genome, mostly betweenmore » genomes in the same evolutionary group, and generates many unique mosaic patterns. The six least-diverged genome-pairs have one or two recombinant transfers of length ~40–115 kbp (and few if any other transfers), each containing one or more gene clusters known to confer strong selective advantage in some environments. Moderately diverged genome pairs (0.4–1% SNPs) show mosaic patterns of interspersed clonal and recombinant regions of varying lengths throughout the basic genome, whereas more highly diverged pairs within an evolutionary group or pairs between evolutionary groups having >1.3% SNPs have few clonal matches longer than a few kbp. Many recombinant transfers appear to incorporate fragments of the entering DNA produced by restriction systems of the recipient cell. A simple computational model can closely fit the data. As a result, most recombinant transfers seem likely to be due to generalized transduction by co-evolving populations of phages, which could efficiently distribute variability throughout bacterial genomes.« less

Recombinant transfer in the basic genome of E. coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dixit, Purushottam; Studier, F. William; Pang, Tin Yau

An approximation to the ~4-Mbp basic genome shared by 32 strains of E. coli representing six evolutionary groups has been derived and analyzed computationally. A multiple-alignment of the 32 complete genome sequences was filtered to remove mobile elements and identify the most reliable ~90% of the aligned length of each of the resulting 496 basic-genome pairs. Patterns of single bp mutations (SNPs) in aligned pairs distinguish clonally inherited regions from regions where either genome has acquired DNA fragments from diverged genomes by homologous recombination since their last common ancestor. Such recombinant transfer is pervasive across the basic genome, mostly betweenmore » genomes in the same evolutionary group, and generates many unique mosaic patterns. The six least-diverged genome-pairs have one or two recombinant transfers of length ~40–115 kbp (and few if any other transfers), each containing one or more gene clusters known to confer strong selective advantage in some environments. Moderately diverged genome pairs (0.4–1% SNPs) show mosaic patterns of interspersed clonal and recombinant regions of varying lengths throughout the basic genome, whereas more highly diverged pairs within an evolutionary group or pairs between evolutionary groups having >1.3% SNPs have few clonal matches longer than a few kbp. Many recombinant transfers appear to incorporate fragments of the entering DNA produced by restriction systems of the recipient cell. A simple computational model can closely fit the data. As a result, most recombinant transfers seem likely to be due to generalized transduction by co-evolving populations of phages, which could efficiently distribute variability throughout bacterial genomes.« less

UGC 4703 Interacting Pair Near the Isolated Spiral Galaxy NGC 2718: A Milky Way Magellanic Cloud Analog

NASA Astrophysics Data System (ADS)

Paudel, Sanjaya; Sengupta, C.

2017-11-01

We present an analysis of physical and morphological properties of an interacting pair of dwarf galaxies, UGC 4703, located in the vicinity of an isolated Milky Way (MW) type spiral galaxy NGC 2718. Based on the comparison of physical and morphological properties with that of the Large and Small Magellanic Clouds (LMC and SMC), we report that the UGC 4703 pair-NGC 2718 system is probably an LMC-SMC-MW analog. Located at a sky-projected distance of 81 kpc from NGC 2718, we find that UGC 4703 is clearly interacting with its nearby lower-mass companion UGC 4703B, forming a bridge of stellar stream between them. Total B-band luminosity of UGC 4703 and its companion is -17.75 and -16.25 mag, respectively. We obtained H I 21 cm line data of UGC 4703 using the GMRT to get a more detailed view of neutral hydrogen (H I) emission. The H I image revealed evidence of interaction between the dwarf galaxy pair but no extended emission, such as the Magellanic Stream. We also detected star-forming regions along the UGC 4703/4703B bridge with stellar mass exceeding 107 M ⊙. While comparing the optical and H I morphology of the interacting dwarf pairs (UGC 4703-4703B and LMC-SMC), we discuss possible differences in interaction histories of these systems.

An ensemble of SVM classifiers based on gene pairs.

PubMed

Tong, Muchenxuan; Liu, Kun-Hong; Xu, Chungui; Ju, Wenbin

2013-07-01

In this paper, a genetic algorithm (GA) based ensemble support vector machine (SVM) classifier built on gene pairs (GA-ESP) is proposed. The SVMs (base classifiers of the ensemble system) are trained on different informative gene pairs. These gene pairs are selected by the top scoring pair (TSP) criterion. Each of these pairs projects the original microarray expression onto a 2-D space. Extensive permutation of gene pairs may reveal more useful information and potentially lead to an ensemble classifier with satisfactory accuracy and interpretability. GA is further applied to select an optimized combination of base classifiers. The effectiveness of the GA-ESP classifier is evaluated on both binary-class and multi-class datasets. Copyright © 2013 Elsevier Ltd. All rights reserved.

Evidence for degenerate tetraploidy in bdelloid rotifers.

PubMed

Mark Welch, David B; Mark Welch, Jessica L; Meselson, Matthew

2008-04-01

Rotifers of class Bdelloidea have evolved for millions of years apparently without sexual reproduction. We have sequenced 45- to 70-kb regions surrounding the four copies of the hsp82 gene of the bdelloid rotifer Philodina roseola, each of which is on a separate chromosome. The four regions comprise two colinear gene-rich pairs with gene content, order, and orientation conserved within each pair. Only a minority of genes are common to both pairs, also in the same orientation and order, but separated by gene-rich segments present in only one or the other pair. The pattern is consistent with degenerate tetraploidy with numerous segmental deletions, some in one pair of colinear chromosomes and some in the other. Divergence in 1,000-bp windows varies along an alignment of a colinear pair, from zero to as much as 20% in a pattern consistent with gene conversion associated with recombinational repair of DNA double-strand breaks. Although pairs of colinear chromosomes are a characteristic of sexually reproducing diploids and polyploids, a quite different explanation for their presence in bdelloids is suggested by the recent finding that bdelloid rotifers can recover and resume reproduction after suffering hundreds of radiation-induced DNA double-strand breaks per oocyte nucleus. Because bdelloid primary oocytes are in G(1) and therefore lack sister chromatids, we propose that bdelloid colinear chromosome pairs are maintained as templates for the repair of DNA double-strand breaks caused by the frequent desiccation and rehydration characteristic of bdelloid habitats.

Fingerprinting of HLA class I genes for improved selection of unrelated bone marrow donors.

PubMed

Martinelli, G; Farabegoli, P; Buzzi, M; Panzica, G; Zaccaria, A; Bandini, G; Calori, E; Testoni, N; Rosti, G; Conte, R; Remiddi, C; Salvucci, M; De Vivo, A; Tura, S

1996-02-01

The degree of matching of HLA genes between the selected donor and recipient is an important aspect of the selection of unrelated donors for allogeneic bone marrow transplantation (UBMT). The most sensitive methods currently used are serological typing of HLA class I genes, mixed lymphocyte culture (MLC), IEF and molecular genotyping of HLA class II genes by direct sequencing of PCR products. Serological typing of class I antigenes (A, B and C) fails to detect minor differences demonstrated by direct sequencing of DNA polymorphic regions. Molecular genotyping of HLA class I genes by DNA analysis is costly and work-intensive. To improve compatibility between donor and recipient, we have set up a new rapid and non-radioisotopic application of the 'fingerprinting PCR' technique for the analysis of the polymorphic second exon of the HLA class I A, B and C genes. This technique is based on the formation of specific patterns (PCR fingerprints) of homoduplexes and heteroduplexes between heterologous amplified DNA sequences. After an electrophoretic run on non-denaturing polyacrylamide gel, different HLA class I types give allele-specific banding patterns. HLA class I matching is performed, after the gel has been soaked in ethidium bromide or silver-stained, by visual comparison of patients' fingerprints with those of donors. Identity can be confirmed by mixing donor and recipient DNAs in an amplification cross-match. To assess the technique, 10 normal samples, 22 related allogeneic bone marrow transplanted pairs and 10 unrelated HLA-A and HLA-B serologically matched patient-donor pairs were analysed for HLA class I polymorphic regions. In all the related pairs and in 1/10 unrelated pairs, matched donor-recipient patterns were identified. This new application of PCR fingerprinting may confirm the HLA class I serological selection of unrelated marrow donors.

Development of a suspension microarray for the genotyping of African swine fever virus targeting the SNPs in the C-terminal end of the p72 gene region of the genome.

PubMed

Leblanc, N; Cortey, M; Fernandez Pinero, J; Gallardo, C; Masembe, C; Okurut, A R; Heath, L; van Heerden, J; Sánchez-Vizcaino, J M; Ståhl, K; Belák, S

2013-08-01

African swine fever virus (ASFV) causes one of the most dreaded transboundary animal diseases (TADs) in Suidae. African swine fever (ASF) often causes high rates of morbidity and mortality, which can reach 100% in domestic swine. To date, serological diagnosis has the drawback of not being able to differentiate variants of this virus. Previous studies have identified the 22 genotypes based on sequence variation in the C-terminal region of the p72 gene, which has become the standard for categorizing ASFVs. This article describes a genotyping assay developed using a segment of PCR-amplified genomic DNA of approximately 450 bp, which encompasses the C-terminal end of the p72 gene. Complementary paired DNA probes of 15 or 17 bp in length, which are identical except for a single nucleotide polymorphism (SNP) in the central position, were designed to either individually or in combination differentiate between the 22 genotypes. The assay was developed using xMAP technology; probes were covalently linked to microspheres, hybridized to PCR product, labelled with a reporter and read in the Luminex 200 analyzer. Characterization of the sample was performed by comparing fluorescence of the paired SNP probes, that is, the probe with higher fluorescence in a complementary pair identified the SNP that a particular sample possessed. In the final assay, a total of 52 probes were employed, 24 SNP pairs and 4 for general detection. One or more samples from each of the 22 genotypes were tested. The assay was able to detect and distinguish all 22 genotypes. This novel assay provides a powerful novel tool for the simultaneous rapid diagnosis and genotypic differentiation of ASF. © 2012 Blackwell Verlag GmbH.

Pairing and recombination features during meiosis in Cebus paraguayanus (Primates: Platyrrhini)

PubMed Central

Garcia-Cruz, Raquel; Robles, Pedro; Steinberg, Eliana R; Camats, Nuria; Brieño, Miguel A; Garcia-Caldés, Montserrat; Mudry, Marta D

2009-01-01

Background Among neotropical Primates, the Cai monkey Cebus paraguayanus (CPA) presents long, conserved chromosome syntenies with the human karyotype (HSA) as well as numerous C+ blocks in different chromosome pairs. In this study, immunofluorescence (IF) against two proteins of the Synaptonemal Complex (SC), namely REC8 and SYCP1, two recombination protein markers (RPA and MLH1), and one protein involved in the pachytene checkpoint machinery (BRCA1) was performed in CPA spermatocytes in order to analyze chromosome meiotic behavior in detail. Results Although in the vast majority of pachytene cells all autosomes were paired and synapsed, in a small number of nuclei the heterochromatic C-positive terminal region of bivalent 11 remained unpaired. The analysis of 75 CPA cells at pachytene revealed a mean of 43.22 MLH1 foci per nucleus and 1.07 MLH1 foci in each CPA bivalent 11, always positioned in the region homologous to HSA chromosome 21. Conclusion Our results suggest that C blocks undergo delayed pairing and synapsis, although they do not interfere with the general progress of pairing and synapsis. PMID:19500368

Evaluation of six primer pairs targeting the nuclear rRNA operon for characterization of arbuscular mycorrhizal fungal (AMF) communities using 454 pyrosequencing.

PubMed

Van Geel, Maarten; Busschaert, Pieter; Honnay, Olivier; Lievens, Bart

2014-11-01

In the last few years, 454 pyrosequencing-based analysis of arbuscular mycorrhizal fungal (AMF; Glomeromycota) communities has tremendously increased our knowledge of the distribution and diversity of AMF. Nonetheless, comparing results between different studies is difficult, as different target genes (or regions thereof) and primer combinations, with potentially dissimilar specificities and efficacies, are being utilized. In this study we evaluated six primer pairs that have previously been used in AMF studies (NS31-AM1, AMV4.5NF-AMDGR, AML1-AML2, NS31-AML2, FLR3-LSUmBr and Glo454-NDL22) for their use in 454 pyrosequencing based on both an in silico approach and 454 pyrosequencing of AMF communities from apple tree roots. Primers were evaluated in terms of (i) in silico coverage of Glomeromycota fungi, (ii) the number of high-quality sequences obtained, (iii) selectivity for AMF species, (iv) reproducibility and (v) ability to accurately describe AMF communities. We show that primer pairs AMV4.5NF-AMDGR, AML1-AML2 and NS31-AML2 outperformed the other tested primer pairs in terms of number of Glomeromycota reads (AMF specificity and coverage). Additionally, these primer pairs were found to have no or only few mismatches to AMF sequences and were able to consistently describe AMF communities from apple roots. However, whereas most high-quality AMF sequences were obtained for AMV4.5NF-AMDGR, our results also suggest that this primer pair favored amplification of Glomeraceae sequences at the expense of Ambisporaceae, Claroideoglomeraceae and Paraglomeraceae sequences. Furthermore, we demonstrate the complementary specificity of AMV4.5NF-AMDGR with AML1-AML2, and of AMV4.5NF-AMDGR with NS31-AML2, making these primer combinations highly suitable for tandem use in covering the diversity of AMF communities. Copyright © 2014 Elsevier B.V. All rights reserved.

Envisaging quantum transport phenomenon in a muddled base pair of DNA

NASA Astrophysics Data System (ADS)

Vohra, Rajan; Sawhney, Ravinder Singh

2018-05-01

The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.

Higher order structural effects stabilizing the reverse Watson–Crick Guanine-Cytosine base pair in functional RNAs

PubMed Central

Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi

2014-01-01

The G:C reverse Watson–Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. PMID:24121683

Identification of a novel mutation in the paired domain of PAX3 in an Iranian family with waardenburg syndrome type I.

PubMed

Sotirova, V N; Rezaie, T M; Khoshsorour, M M; Sarfarazi, M

2000-03-01

Waardenburg syndrome Type I (WS1) is an autosomal dominant disorder that has previously been associated with mutations in the PAX3 gene on the 2q35 region. In this study, we used an Iranian WS1 family with seven affected individuals in three generations. The phenotypic characteristics of the family include sensorineural deafness, dystopia canthorum, hypopigmented skin patches of the upper limbs, congenital white forelock, confluent white eyebrows, nonpigmented iris, poliosis, and hypopigmentation of the retina. Herein, we report a previously unidentified single-base substitution in exon II (C-->T at position 218) that results in a change of serine to leucine (S73L) in this family. This change was not observed in 100 chromosomes of healthy unrelated individuals. This mutation is within the PAX3 paired domain region, a structure that is highly conserved and implicated in DNA binding. This is the first identification of a PAX3 mutation for this phenotype in the Iranian population. This also provides additional confirmation for the involvement of this gene in the etiology of WS1.

Search for Higgsino pair production in p p collisions at s = 13 TeV in final states with large missing transverse momentum and two Higgs bosons decaying via H → b b ¯

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sirunyan, A. M.; Tumasyan, A.; Adam, W.

Results are reported from a search for new physics in 13 TeV proton-proton collisions in the final state with large missing transverse momentum and two Higgs bosons decaying via H→more » $$b\\bar{b}$$. The search uses a data sample accumulated by the CMS experiment at the LHC in 2016, corresponding to an integrated luminosity of 35.9 fb -1. The search is motivated by models based on gauge-mediated supersymmetry breaking, which predict the electroweak production of a pair of Higgsinos, each of which can decay via a cascade process to a Higgs boson and an undetected lightest supersymmetric particle. The observed event yields in the signal regions are consistent with the standard model background expectation obtained from control regions in data. Higgsinos in the mass range 230–770 GeV are excluded at 95% confidence level in the context of a simplified model for the production and decay of approximately degenerate Higgsinos.« less

Search for Higgsino pair production in p p collisions at √{s }=13 TeV in final states with large missing transverse momentum and two Higgs bosons decaying via H →b b ¯

NASA Astrophysics Data System (ADS)

Sirunyan, A. M.; Tumasyan, A.; Adam, W.; Ambrogi, F.; Asilar, E.; Bergauer, T.; Brandstetter, J.; Brondolin, E.; Dragicevic, M.; Erö, J.; Flechl, M.; Friedl, M.; Frühwirth, R.; Ghete, V. M.; Grossmann, J.; Hrubec, J.; Jeitler, M.; König, A.; Krammer, N.; Krätschmer, I.; Liko, D.; Madlener, T.; Mikulec, I.; Pree, E.; Rabady, D.; Rad, N.; Rohringer, H.; Schieck, J.; Schöfbeck, R.; Spanring, M.; Spitzbart, D.; Strauss, J.; Waltenberger, W.; Wittmann, J.; Wulz, C.-E.; Zarucki, M.; Chekhovsky, V.; Mossolov, V.; Suarez Gonzalez, J.; De Wolf, E. A.; Di Croce, D.; Janssen, X.; Lauwers, J.; Van De Klundert, M.; Van Haevermaet, H.; Van Mechelen, P.; Van Remortel, N.; Abu Zeid, S.; Blekman, F.; D'Hondt, J.; De Bruyn, I.; De Clercq, J.; Deroover, K.; Flouris, G.; Lontkovskyi, D.; Lowette, S.; Moortgat, S.; Moreels, L.; Olbrechts, A.; Python, Q.; Skovpen, K.; Tavernier, S.; Van Doninck, W.; Van Mulders, P.; Van Parijs, I.; Brun, H.; Clerbaux, B.; De Lentdecker, G.; Delannoy, H.; Fasanella, G.; Favart, L.; Goldouzian, R.; Grebenyuk, A.; Karapostoli, G.; Lenzi, T.; Luetic, J.; Maerschalk, T.; Marinov, A.; Randle-conde, A.; Seva, T.; Vander Velde, C.; Vanlaer, P.; Vannerom, D.; Yonamine, R.; Zenoni, F.; Zhang, F.; Cimmino, A.; Cornelis, T.; Dobur, D.; Fagot, A.; Gul, M.; Khvastunov, I.; Poyraz, D.; Roskas, C.; Salva, S.; Tytgat, M.; Verbeke, W.; Zaganidis, N.; Bakhshiansohi, H.; Bondu, O.; Brochet, S.; Bruno, G.; Caudron, A.; De Visscher, S.; Delaere, C.; Delcourt, M.; Francois, B.; Giammanco, A.; Jafari, A.; Komm, M.; Krintiras, G.; Lemaitre, V.; Magitteri, A.; Mertens, A.; Musich, M.; Piotrzkowski, K.; Quertenmont, L.; Vidal Marono, M.; Wertz, S.; Beliy, N.; Aldá Júnior, W. L.; Alves, F. L.; Alves, G. A.; Brito, L.; Correa Martins Junior, M.; Hensel, C.; Moraes, A.; Pol, M. E.; Rebello Teles, P.; Belchior Batista Das Chagas, E.; Carvalho, W.; Chinellato, J.; Custódio, A.; Da Costa, E. M.; Da Silveira, G. G.; De Jesus Damiao, D.; Fonseca De Souza, S.; Huertas Guativa, L. M.; Malbouisson, H.; Melo De Almeida, M.; Mora Herrera, C.; Mundim, L.; Nogima, H.; Santoro, A.; Sznajder, A.; Tonelli Manganote, E. J.; Torres Da Silva De Araujo, F.; Vilela Pereira, A.; Ahuja, S.; Bernardes, C. A.; Fernandez Perez Tomei, T. R.; Gregores, E. M.; Mercadante, P. G.; Novaes, S. F.; Padula, Sandra S.; Romero Abad, D.; Ruiz Vargas, J. C.; Aleksandrov, A.; Hadjiiska, R.; Iaydjiev, P.; Misheva, M.; Rodozov, M.; Shopova, M.; Stoykova, S.; Sultanov, G.; Dimitrov, A.; Glushkov, I.; Litov, L.; Pavlov, B.; Petkov, P.; Fang, W.; Gao, X.; Ahmad, M.; Bian, J. G.; Chen, G. M.; Chen, H. S.; Chen, M.; Chen, Y.; Jiang, C. H.; Leggat, D.; Liao, H.; Liu, Z.; Romeo, F.; Shaheen, S. M.; Spiezia, A.; Tao, J.; Wang, C.; Wang, Z.; Yazgan, E.; Zhang, H.; Zhao, J.; Ban, Y.; Chen, G.; Li, Q.; Liu, S.; Mao, Y.; Qian, S. J.; Wang, D.; Xu, Z.; Avila, C.; Cabrera, A.; Chaparro Sierra, L. F.; Florez, C.; González Hernández, C. F.; Ruiz Alvarez, J. D.; Courbon, B.; Godinovic, N.; Lelas, D.; Puljak, I.; Ribeiro Cipriano, P. M.; Sculac, T.; Antunovic, Z.; Kovac, M.; Brigljevic, V.; Ferencek, D.; Kadija, K.; Mesic, B.; Starodumov, A.; Susa, T.; Ather, M. W.; Attikis, A.; Mavromanolakis, G.; Mousa, J.; Nicolaou, C.; Ptochos, F.; Razis, P. A.; Rykaczewski, H.; Finger, M.; Finger, M.; Carrera Jarrin, E.; Assran, Y.; Mahmoud, M. A.; Mahrous, A.; Dewanjee, R. K.; Kadastik, M.; Perrini, L.; Raidal, M.; Tiko, A.; Veelken, C.; Eerola, P.; Pekkanen, J.; Voutilainen, M.; Härkönen, J.; Järvinen, T.; Karimäki, V.; Kinnunen, R.; Lampén, T.; Lassila-Perini, K.; Lehti, S.; Lindén, T.; Luukka, P.; Tuominen, E.; Tuominiemi, J.; Tuovinen, E.; Talvitie, J.; Tuuva, T.; Besancon, M.; Couderc, F.; Dejardin, M.; Denegri, D.; Faure, J. L.; Ferri, F.; Ganjour, S.; Ghosh, S.; Givernaud, A.; Gras, P.; Hamel de Monchenault, G.; Jarry, P.; Kucher, I.; Locci, E.; Machet, M.; Malcles, J.; Negro, G.; Rander, J.; Rosowsky, A.; Sahin, M. Ö.; Titov, M.; Abdulsalam, A.; Antropov, I.; Baffioni, S.; Beaudette, F.; Busson, P.; Cadamuro, L.; Charlot, C.; Granier de Cassagnac, R.; Jo, M.; Lisniak, S.; Lobanov, A.; Martin Blanco, J.; Nguyen, M.; Ochando, C.; Ortona, G.; Paganini, P.; Pigard, P.; Regnard, S.; Salerno, R.; Sauvan, J. B.; Sirois, Y.; Stahl Leiton, A. G.; Strebler, T.; Yilmaz, Y.; Zabi, A.; Zghiche, A.; Agram, J.-L.; Andrea, J.; Bloch, D.; Brom, J.-M.; Buttignol, M.; Chabert, E. C.; Chanon, N.; Collard, C.; Conte, E.; Coubez, X.; Fontaine, J.-C.; Gelé, D.; Goerlach, U.; Jansová, M.; Le Bihan, A.-C.; Tonon, N.; Van Hove, P.; Gadrat, S.; Beauceron, S.; Bernet, C.; Boudoul, G.; Chierici, R.; Contardo, D.; Depasse, P.; El Mamouni, H.; Fay, J.; Finco, L.; Gascon, S.; Gouzevitch, M.; Grenier, G.; Ille, B.; Lagarde, F.; Laktineh, I. B.; Lethuillier, M.; Mirabito, L.; Pequegnot, A. L.; Perries, S.; Popov, A.; Sordini, V.; Vander Donckt, M.; Viret, S.; Khvedelidze, A.; Bagaturia, I.; Autermann, C.; Beranek, S.; Feld, L.; Kiesel, M. K.; Klein, K.; Lipinski, M.; Preuten, M.; Schomakers, C.; Schulz, J.; Verlage, T.; Albert, A.; Brodski, M.; Dietz-Laursonn, E.; Duchardt, D.; Endres, M.; Erdmann, M.; Erdweg, S.; Esch, T.; Fischer, R.; Güth, A.; Hamer, M.; Hebbeker, T.; Heidemann, C.; Hoepfner, K.; Knutzen, S.; Merschmeyer, M.; Meyer, A.; Millet, P.; Mukherjee, S.; Olschewski, M.; Padeken, K.; Pook, T.; Radziej, M.; Reithler, H.; Rieger, M.; Scheuch, F.; Teyssier, D.; Thüer, S.; Flügge, G.; Kargoll, B.; Kress, T.; Künsken, A.; Lingemann, J.; Müller, T.; Nehrkorn, A.; Nowack, A.; Pistone, C.; Pooth, O.; Stahl, A.; Aldaya Martin, M.; Arndt, T.; Asawatangtrakuldee, C.; Beernaert, K.; Behnke, O.; Behrens, U.; Bermúdez Martínez, A.; Bin Anuar, A. A.; Borras, K.; Botta, V.; Campbell, A.; Connor, P.; Contreras-Campana, C.; Costanza, F.; Diez Pardos, C.; Eckerlin, G.; Eckstein, D.; Eichhorn, T.; Eren, E.; Gallo, E.; Garay Garcia, J.; Geiser, A.; Gizhko, A.; Grados Luyando, J. M.; Grohsjean, A.; Gunnellini, P.; Harb, A.; Hauk, J.; Hempel, M.; Jung, H.; Kalogeropoulos, A.; Kasemann, M.; Keaveney, J.; Kleinwort, C.; Korol, I.; Krücker, D.; Lange, W.; Lelek, A.; Lenz, T.; Leonard, J.; Lipka, K.; Lohmann, W.; Mankel, R.; Melzer-Pellmann, I.-A.; Meyer, A. B.; Mittag, G.; Mnich, J.; Mussgiller, A.; Ntomari, E.; Pitzl, D.; Placakyte, R.; Raspereza, A.; Roland, B.; Savitskyi, M.; Saxena, P.; Shevchenko, R.; Spannagel, S.; Stefaniuk, N.; Van Onsem, G. P.; Walsh, R.; Wen, Y.; Wichmann, K.; Wissing, C.; Zenaiev, O.; Bein, S.; Blobel, V.; Centis Vignali, M.; Draeger, A. R.; Dreyer, T.; Garutti, E.; Gonzalez, D.; Haller, J.; Hinzmann, A.; Hoffmann, M.; Karavdina, A.; Klanner, R.; Kogler, R.; Kovalchuk, N.; Kurz, S.; Lapsien, T.; Marchesini, I.; Marconi, D.; Meyer, M.; Niedziela, M.; Nowatschin, D.; Pantaleo, F.; Peiffer, T.; Perieanu, A.; Scharf, C.; Schleper, P.; Schmidt, A.; Schumann, S.; Schwandt, J.; Sonneveld, J.; Stadie, H.; Steinbrück, G.; Stober, F. M.; Stöver, M.; Tholen, H.; Troendle, D.; Usai, E.; Vanelderen, L.; Vanhoefer, A.; Vormwald, B.; Akbiyik, M.; Barth, C.; Baur, S.; Butz, E.; Caspart, R.; Chwalek, T.; Colombo, F.; De Boer, W.; Dierlamm, A.; Freund, B.; Friese, R.; Giffels, M.; Gilbert, A.; Haitz, D.; Hartmann, F.; Heindl, S. M.; Husemann, U.; Kassel, F.; Kudella, S.; Mildner, H.; Mozer, M. U.; Müller, Th.; Plagge, M.; Quast, G.; Rabbertz, K.; Schröder, M.; Shvetsov, I.; Sieber, G.; Simonis, H. J.; Ulrich, R.; Wayand, S.; Weber, M.; Weiler, T.; Williamson, S.; Wöhrmann, C.; Wolf, R.; Anagnostou, G.; Daskalakis, G.; Geralis, T.; Giakoumopoulou, V. A.; Kyriakis, A.; Loukas, D.; Topsis-Giotis, I.; Kesisoglou, S.; Panagiotou, A.; Saoulidou, N.; Evangelou, I.; Foudas, C.; Kokkas, P.; Manthos, N.; Papadopoulos, I.; Paradas, E.; Strologas, J.; Triantis, F. A.; Csanad, M.; Filipovic, N.; Pasztor, G.; Bencze, G.; Hajdu, C.; Horvath, D.; Hunyadi, Á.; Sikler, F.; Veszpremi, V.; Vesztergombi, G.; Zsigmond, A. J.; Beni, N.; Czellar, S.; Karancsi, J.; Makovec, A.; Molnar, J.; Szillasi, Z.; Bartók, M.; Raics, P.; Trocsanyi, Z. L.; Ujvari, B.; Choudhury, S.; Komaragiri, J. R.; Bahinipati, S.; Bhowmik, S.; Mal, P.; Mandal, K.; Nayak, A.; Sahoo, D. K.; Sahoo, N.; Swain, S. K.; Bansal, S.; Beri, S. B.; Bhatnagar, V.; Bhawandeep, U.; Chawla, R.; Dhingra, N.; Kalsi, A. K.; Kaur, A.; Kaur, M.; Kumar, R.; Kumari, P.; Mehta, A.; Singh, J. B.; Walia, G.; Kumar, Ashok; Shah, Aashaq; Bhardwaj, A.; Chauhan, S.; Choudhary, B. C.; Garg, R. B.; Keshri, S.; Kumar, A.; Malhotra, S.; Naimuddin, M.; Ranjan, K.; Sharma, R.; Sharma, V.; Bhardwaj, R.; Bhattacharya, R.; Bhattacharya, S.; Dey, S.; Dutt, S.; Dutta, S.; Ghosh, S.; Majumdar, N.; Modak, A.; Mondal, K.; Mukhopadhyay, S.; Nandan, S.; Purohit, A.; Roy, A.; Roy, D.; Roy Chowdhury, S.; Sarkar, S.; Sharan, M.; Thakur, S.; Behera, P. K.; Chudasama, R.; Dutta, D.; Jha, V.; Kumar, V.; Mohanty, A. K.; Netrakanti, P. K.; Pant, L. M.; Shukla, P.; Topkar, A.; Aziz, T.; Dugad, S.; Mahakud, B.; Mitra, S.; Mohanty, G. B.; Parida, B.; Sur, N.; Sutar, B.; Banerjee, S.; Bhattacharya, S.; Chatterjee, S.; Das, P.; Guchait, M.; Jain, Sa.; Kumar, S.; Maity, M.; Majumder, G.; Mazumdar, K.; Sarkar, T.; Wickramage, N.; Chauhan, S.; Dube, S.; Hegde, V.; Kapoor, A.; Kothekar, K.; Pandey, S.; Rane, A.; Sharma, S.; Chenarani, S.; Eskandari Tadavani, E.; Etesami, S. M.; Khakzad, M.; Mohammadi Najafabadi, M.; Naseri, M.; Paktinat Mehdiabadi, S.; Rezaei Hosseinabadi, F.; Safarzadeh, B.; Zeinali, M.; Felcini, M.; Grunewald, M.; Abbrescia, M.; Calabria, C.; Caputo, C.; Colaleo, A.; Creanza, D.; Cristella, L.; De Filippis, N.; De Palma, M.; Errico, F.; Fiore, L.; Iaselli, G.; Lezki, S.; Maggi, G.; Maggi, M.; Miniello, G.; My, S.; Nuzzo, S.; Pompili, A.; Pugliese, G.; Radogna, R.; Ranieri, A.; Selvaggi, G.; Sharma, A.; Silvestris, L.; Venditti, R.; Verwilligen, P.; Abbiendi, G.; Battilana, C.; Bonacorsi, D.; Braibant-Giacomelli, S.; Campanini, R.; Capiluppi, P.; Castro, A.; Cavallo, F. R.; Chhibra, S. S.; Codispoti, G.; Cuffiani, M.; Dallavalle, G. M.; Fabbri, F.; Fanfani, A.; Fasanella, D.; Giacomelli, P.; Grandi, C.; Guiducci, L.; Marcellini, S.; Masetti, G.; Montanari, A.; Navarria, F. L.; Perrotta, A.; Rossi, A. M.; Rovelli, T.; Siroli, G. P.; Tosi, N.; Albergo, S.; Costa, S.; Di Mattia, A.; Giordano, F.; Potenza, R.; Tricomi, A.; Tuve, C.; Barbagli, G.; Chatterjee, K.; Ciulli, V.; Civinini, C.; D'Alessandro, R.; Focardi, E.; Lenzi, P.; Meschini, M.; Russo, L.; Sguazzoni, G.; Strom, D.; Viliani, L.; Benussi, L.; Bianco, S.; Fabbri, F.; Piccolo, D.; Primavera, F.; Calvelli, V.; Ferro, F.; Robutti, E.; Tosi, S.; Brianza, L.; Brivio, F.; Ciriolo, V.; Dinardo, M. E.; Fiorendi, S.; Gennai, S.; Ghezzi, A.; Govoni, P.; Malberti, M.; Malvezzi, S.; Manzoni, R. A.; Menasce, D.; Moroni, L.; Paganoni, M.; Pauwels, K.; Pedrini, D.; Pigazzini, S.; Ragazzi, S.; Tabarelli de Fatis, T.; Buontempo, S.; Cavallo, N.; Di Guida, S.; Esposito, M.; Fabozzi, F.; Fienga, F.; Iorio, A. O. M.; Khan, W. A.; Lanza, G.; Lista, L.; Meola, S.; Paolucci, P.; Sciacca, C.; Thyssen, F.; Azzi, P.; Bacchetta, N.; Benato, L.; Bisello, D.; Boletti, A.; Carlin, R.; Carvalho Antunes De Oliveira, A.; Checchia, P.; De Castro Manzano, P.; Dorigo, T.; Dosselli, U.; Gasparini, F.; Gasparini, U.; Gozzelino, A.; Lacaprara, S.; Margoni, M.; Meneguzzo, A. T.; Pozzobon, N.; Ronchese, P.; Rossin, R.; Simonetto, F.; Torassa, E.; Zanetti, M.; Zotto, P.; Zumerle, G.; Braghieri, A.; Fallavollita, F.; Magnani, A.; Montagna, P.; Ratti, S. P.; Re, V.; Ressegotti, M.; Riccardi, C.; Salvini, P.; Vai, I.; Vitulo, P.; Alunni Solestizi, L.; Biasini, M.; Bilei, G. M.; Cecchi, C.; Ciangottini, D.; Fanò, L.; Lariccia, P.; Leonardi, R.; Manoni, E.; Mantovani, G.; Mariani, V.; Menichelli, M.; Rossi, A.; Santocchia, A.; Spiga, D.; Androsov, K.; Azzurri, P.; Bagliesi, G.; Bernardini, J.; Boccali, T.; Borrello, L.; Castaldi, R.; Ciocci, M. A.; Dell'Orso, R.; Fedi, G.; Giannini, L.; Giassi, A.; Grippo, M. T.; Ligabue, F.; Lomtadze, T.; Manca, E.; Mandorli, G.; Martini, L.; Messineo, A.; Palla, F.; Rizzi, A.; Savoy-Navarro, A.; Spagnolo, P.; Tenchini, R.; Tonelli, G.; Venturi, A.; Verdini, P. G.; Barone, L.; Cavallari, F.; Cipriani, M.; Del Re, D.; Diemoz, M.; Gelli, S.; Longo, E.; Margaroli, F.; Marzocchi, B.; Meridiani, P.; Organtini, G.; Paramatti, R.; Preiato, F.; Rahatlou, S.; Rovelli, C.; Santanastasio, F.; Amapane, N.; Arcidiacono, R.; Argiro, S.; Arneodo, M.; Bartosik, N.; Bellan, R.; Biino, C.; Cartiglia, N.; Cenna, F.; Costa, M.; Covarelli, R.; Degano, A.; Demaria, N.; Kiani, B.; Mariotti, C.; Maselli, S.; Migliore, E.; Monaco, V.; Monteil, E.; Monteno, M.; Obertino, M. M.; Pacher, L.; Pastrone, N.; Pelliccioni, M.; Pinna Angioni, G. L.; Ravera, F.; Romero, A.; Ruspa, M.; Sacchi, R.; Shchelina, K.; Sola, V.; Solano, A.; Staiano, A.; Traczyk, P.; Belforte, S.; Casarsa, M.; Cossutti, F.; Della Ricca, G.; Zanetti, A.; Kim, D. H.; Kim, G. N.; Kim, M. S.; Lee, J.; Lee, S.; Lee, S. W.; Moon, C. S.; Oh, Y. D.; Sekmen, S.; Son, D. C.; Yang, Y. C.; Lee, A.; Kim, H.; Moon, D. H.; Oh, G.; Brochero Cifuentes, J. A.; Goh, J.; Kim, T. J.; Cho, S.; Choi, S.; Go, Y.; Gyun, D.; Ha, S.; Hong, B.; Jo, Y.; Kim, Y.; Lee, K.; Lee, K. S.; Lee, S.; Lim, J.; Park, S. K.; Roh, Y.; Almond, J.; Kim, J.; Kim, J. S.; Lee, H.; Lee, K.; Nam, K.; Oh, S. B.; Radburn-Smith, B. C.; Seo, S. h.; Yang, U. K.; Yoo, H. D.; Yu, G. B.; Choi, M.; Kim, H.; Kim, J. H.; Lee, J. S. H.; Park, I. C.; Ryu, G.; Choi, Y.; Hwang, C.; Lee, J.; Yu, I.; Dudenas, V.; Juodagalvis, A.; Vaitkus, J.; Ahmed, I.; Ibrahim, Z. A.; Md Ali, M. A. B.; Mohamad Idris, F.; Wan Abdullah, W. A. T.; Yusli, M. N.; Zolkapli, Z.; Castilla-Valdez, H.; De La Cruz-Burelo, E.; Heredia-De La Cruz, I.; Lopez-Fernandez, R.; Mejia Guisao, J.; Sanchez-Hernandez, A.; Carrillo Moreno, S.; Oropeza Barrera, C.; Vazquez Valencia, F.; Pedraza, I.; Salazar Ibarguen, H. A.; Uribe Estrada, C.; Morelos Pineda, A.; Krofcheck, D.; Butler, P. H.; Ahmad, A.; Ahmad, M.; Hassan, Q.; Hoorani, H. R.; Saddique, A.; Shah, M. A.; Shoaib, M.; Waqas, M.; Bialkowska, H.; Bluj, M.; Boimska, B.; Frueboes, T.; Górski, M.; Kazana, M.; Nawrocki, K.; Romanowska-Rybinska, K.; Szleper, M.; Zalewski, P.; Bunkowski, K.; Byszuk, A.; Doroba, K.; Kalinowski, A.; Konecki, M.; Krolikowski, J.; Misiura, M.; Olszewski, M.; Pyskir, A.; Walczak, M.; Bargassa, P.; Beirão Da Cruz E Silva, C.; Calpas, B.; Di Francesco, A.; Faccioli, P.; Gallinaro, M.; Hollar, J.; Leonardo, N.; Lloret Iglesias, L.; Nemallapudi, M. V.; Seixas, J.; Toldaiev, O.; Vadruccio, D.; Varela, J.; Afanasiev, S.; Bunin, P.; Gavrilenko, M.; Golutvin, I.; Gorbunov, I.; Kamenev, A.; Karjavin, V.; Lanev, A.; Malakhov, A.; Matveev, V.; Palichik, V.; Perelygin, V.; Shmatov, S.; Shulha, S.; Skatchkov, N.; Smirnov, V.; Voytishin, N.; Zarubin, A.; Ivanov, Y.; Kim, V.; Kuznetsova, E.; Levchenko, P.; Murzin, V.; Oreshkin, V.; Smirnov, I.; Sulimov, V.; Uvarov, L.; Vavilov, S.; Vorobyev, A.; Andreev, Yu.; Dermenev, A.; Gninenko, S.; Golubev, N.; Karneyeu, A.; Kirsanov, M.; Krasnikov, N.; Pashenkov, A.; Tlisov, D.; Toropin, A.; Epshteyn, V.; Gavrilov, V.; Lychkovskaya, N.; Popov, V.; Pozdnyakov, I.; Safronov, G.; Spiridonov, A.; Stepennov, A.; Toms, M.; Vlasov, E.; Zhokin, A.; Aushev, T.; Bylinkin, A.; Chistov, R.; Danilov, M.; Parygin, P.; Philippov, D.; Polikarpov, S.; Tarkovskii, E.; Andreev, V.; Azarkin, M.; Dremin, I.; Kirakosyan, M.; Terkulov, A.; Baskakov, A.; Belyaev, A.; Boos, E.; Dubinin, M.; Dudko, L.; Ershov, A.; Gribushin, A.; Klyukhin, V.; Kodolova, O.; Lokhtin, I.; Miagkov, I.; Obraztsov, S.; Petrushanko, S.; Savrin, V.; Snigirev, A.; Blinov, V.; Skovpen, Y.; Shtol, D.; Azhgirey, I.; Bayshev, I.; Bitioukov, S.; Elumakhov, D.; Kachanov, V.; Kalinin, A.; Konstantinov, D.; Krychkine, V.; Petrov, V.; Ryutin, R.; Sobol, A.; Troshin, S.; Tyurin, N.; Uzunian, A.; Volkov, A.; Adzic, P.; Cirkovic, P.; Devetak, D.; Dordevic, M.; Milosevic, J.; Rekovic, V.; Alcaraz Maestre, J.; Barrio Luna, M.; Cerrada, M.; Colino, N.; De La Cruz, B.; Delgado Peris, A.; Escalante Del Valle, A.; Fernandez Bedoya, C.; Fernández Ramos, J. P.; Flix, J.; Fouz, M. C.; Garcia-Abia, P.; Gonzalez Lopez, O.; Goy Lopez, S.; Hernandez, J. M.; Josa, M. I.; Pérez-Calero Yzquierdo, A.; Puerta Pelayo, J.; Quintario Olmeda, A.; Redondo, I.; Romero, L.; Soares, M. S.; Álvarez Fernández, A.; de Trocóniz, J. F.; Missiroli, M.; Moran, D.; Cuevas, J.; Erice, C.; Fernandez Menendez, J.; Gonzalez Caballero, I.; González Fernández, J. R.; Palencia Cortezon, E.; Sanchez Cruz, S.; Suárez Andrés, I.; Vischia, P.; Vizan Garcia, J. M.; Cabrillo, I. J.; Calderon, A.; Chazin Quero, B.; Curras, E.; Fernandez, M.; Garcia-Ferrero, J.; Gomez, G.; Lopez Virto, A.; Marco, J.; Martinez Rivero, C.; Martinez Ruiz del Arbol, P.; Matorras, F.; Piedra Gomez, J.; Rodrigo, T.; Ruiz-Jimeno, A.; Scodellaro, L.; Trevisani, N.; Vila, I.; Vilar Cortabitarte, R.; Abbaneo, D.; Auffray, E.; Baillon, P.; Ball, A. H.; Barney, D.; Bianco, M.; Bloch, P.; Bocci, A.; Botta, C.; Camporesi, T.; Castello, R.; Cepeda, M.; Cerminara, G.; Chapon, E.; Chen, Y.; d'Enterria, D.; Dabrowski, A.; Daponte, V.; David, A.; De Gruttola, M.; De Roeck, A.; Di Marco, E.; Dobson, M.; Dorney, B.; du Pree, T.; Dünser, M.; Dupont, N.; Elliott-Peisert, A.; Everaerts, P.; Franzoni, G.; Fulcher, J.; Funk, W.; Gigi, D.; Gill, K.; Glege, F.; Gulhan, D.; Gundacker, S.; Guthoff, M.; Harris, P.; Hegeman, J.; Innocente, V.; Janot, P.; Karacheban, O.; Kieseler, J.; Kirschenmann, H.; Knünz, V.; Kornmayer, A.; Kortelainen, M. J.; Lange, C.; Lecoq, P.; Lourenço, C.; Lucchini, M. T.; Malgeri, L.; Mannelli, M.; Martelli, A.; Meijers, F.; Merlin, J. A.; Mersi, S.; Meschi, E.; Milenovic, P.; Moortgat, F.; Mulders, M.; Neugebauer, H.; Orfanelli, S.; Orsini, L.; Pape, L.; Perez, E.; Peruzzi, M.; Petrilli, A.; Petrucciani, G.; Pfeiffer, A.; Pierini, M.; Racz, A.; Reis, T.; Rolandi, G.; Rovere, M.; Sakulin, H.; Schäfer, C.; Schwick, C.; Seidel, M.; Selvaggi, M.; Sharma, A.; Silva, P.; Sphicas, P.; Steggemann, J.; Stoye, M.; Tosi, M.; Treille, D.; Triossi, A.; Tsirou, A.; Veckalns, V.; Veres, G. I.; Verweij, M.; Wardle, N.; Zeuner, W. D.; Bertl, W.; Caminada, L.; Deiters, K.; Erdmann, W.; Horisberger, R.; Ingram, Q.; Kaestli, H. C.; Kotlinski, D.; Langenegger, U.; Rohe, T.; Wiederkehr, S. A.; Bachmair, F.; Bäni, L.; Berger, P.; Bianchini, L.; Casal, B.; Dissertori, G.; Dittmar, M.; Donegà, M.; Grab, C.; Heidegger, C.; Hits, D.; Hoss, J.; Kasieczka, G.; Klijnsma, T.; Lustermann, W.; Mangano, B.; Marionneau, M.; Meinhard, M. T.; Meister, D.; Micheli, F.; Musella, P.; Nessi-Tedaldi, F.; Pandolfi, F.; Pata, J.; Pauss, F.; Perrin, G.; Perrozzi, L.; Quittnat, M.; Schönenberger, M.; Shchutska, L.; Tavolaro, V. R.; Theofilatos, K.; Vesterbacka Olsson, M. L.; Wallny, R.; Zagozdzinska, A.; Zhu, D. H.; Aarrestad, T. K.; Amsler, C.; Canelli, M. F.; De Cosa, A.; Donato, S.; Galloni, C.; Hreus, T.; Kilminster, B.; Ngadiuba, J.; Pinna, D.; Rauco, G.; Robmann, P.; Salerno, D.; Seitz, C.; Zucchetta, A.; Candelise, V.; Doan, T. H.; Jain, Sh.; Khurana, R.; Kuo, C. M.; Lin, W.; Pozdnyakov, A.; Yu, S. S.; Kumar, Arun; Chang, P.; Chao, Y.; Chen, K. F.; Chen, P. H.; Fiori, F.; Hou, W.-S.; Hsiung, Y.; Liu, Y. F.; Lu, R.-S.; Miñano Moya, M.; Paganis, E.; Psallidas, A.; Tsai, J. f.; Asavapibhop, B.; Kovitanggoon, K.; Singh, G.; Srimanobhas, N.; Adiguzel, A.; Bakirci, M. N.; Boran, F.; Damarseckin, S.; Demiroglu, Z. S.; Dozen, C.; Eskut, E.; Girgis, S.; Gokbulut, G.; Guler, Y.; Hos, I.; Kangal, E. E.; Kara, O.; Kiminsu, U.; Oglakci, M.; Onengut, G.; Ozdemir, K.; Ozturk, S.; Polatoz, A.; Sunar Cerci, D.; Turkcapar, S.; Zorbakir, I. S.; Zorbilmez, C.; Bilin, B.; Karapinar, G.; Ocalan, K.; Yalvac, M.; Zeyrek, M.; Gülmez, E.; Kaya, M.; Kaya, O.; Tekten, S.; Yetkin, E. A.; Agaras, M. N.; Atay, S.; Cakir, A.; Cankocak, K.; Grynyov, B.; Levchuk, L.; Sorokin, P.; Aggleton, R.; Ball, F.; Beck, L.; Brooke, J. J.; Burns, D.; Clement, E.; Cussans, D.; Davignon, O.; Flacher, H.; Goldstein, J.; Grimes, M.; Heath, G. P.; Heath, H. F.; Jacob, J.; Kreczko, L.; Lucas, C.; Newbold, D. M.; Paramesvaran, S.; Poll, A.; Sakuma, T.; Seif El Nasr-storey, S.; Smith, D.; Smith, V. J.; Bell, K. W.; Belyaev, A.; Brew, C.; Brown, R. M.; Calligaris, L.; Cieri, D.; Cockerill, D. J. A.; Coughlan, J. A.; Harder, K.; Harper, S.; Olaiya, E.; Petyt, D.; Shepherd-Themistocleous, C. H.; Thea, A.; Tomalin, I. R.; Williams, T.; Bainbridge, R.; Breeze, S.; Buchmuller, O.; Bundock, A.; Casasso, S.; Citron, M.; Colling, D.; Corpe, L.; Dauncey, P.; Davies, G.; De Wit, A.; Della Negra, M.; Di Maria, R.; Elwood, A.; Haddad, Y.; Hall, G.; Iles, G.; James, T.; Lane, R.; Laner, C.; Lyons, L.; Magnan, A.-M.; Malik, S.; Mastrolorenzo, L.; Matsushita, T.; Nash, J.; Nikitenko, A.; Palladino, V.; Pesaresi, M.; Raymond, D. M.; Richards, A.; Rose, A.; Scott, E.; Seez, C.; Shtipliyski, A.; Summers, S.; Tapper, A.; Uchida, K.; Vazquez Acosta, M.; Virdee, T.; Winterbottom, D.; Wright, J.; Zenz, S. C.; Cole, J. E.; Hobson, P. R.; Khan, A.; Kyberd, P.; Reid, I. D.; Symonds, P.; Teodorescu, L.; Turner, M.; Borzou, A.; Call, K.; Dittmann, J.; Hatakeyama, K.; Liu, H.; Pastika, N.; Smith, C.; Bartek, R.; Dominguez, A.; Buccilli, A.; Cooper, S. I.; Henderson, C.; Rumerio, P.; West, C.; Arcaro, D.; Avetisyan, A.; Bose, T.; Gastler, D.; Rankin, D.; Richardson, C.; Rohlf, J.; Sulak, L.; Zou, D.; Benelli, G.; Cutts, D.; Garabedian, A.; Hakala, J.; Heintz, U.; Hogan, J. M.; Kwok, K. H. M.; Laird, E.; Landsberg, G.; Mao, Z.; Narain, M.; Pazzini, J.; Piperov, S.; Sagir, S.; Syarif, R.; Yu, D.; Band, R.; Brainerd, C.; Burns, D.; Calderon De La Barca Sanchez, M.; Chertok, M.; Conway, J.; Conway, R.; Cox, P. T.; Erbacher, R.; Flores, C.; Funk, G.; Gardner, M.; Ko, W.; Lander, R.; Mclean, C.; Mulhearn, M.; Pellett, D.; Pilot, J.; Shalhout, S.; Shi, M.; Smith, J.; Squires, M.; Stolp, D.; Tos, K.; Tripathi, M.; Wang, Z.; Bachtis, M.; Bravo, C.; Cousins, R.; Dasgupta, A.; Florent, A.; Hauser, J.; Ignatenko, M.; Mccoll, N.; Saltzberg, D.; Schnaible, C.; Valuev, V.; Bouvier, E.; Burt, K.; Clare, R.; Ellison, J.; Gary, J. W.; Ghiasi Shirazi, S. M. A.; Hanson, G.; Heilman, J.; Jandir, P.; Kennedy, E.; Lacroix, F.; Long, O. R.; Olmedo Negrete, M.; Paneva, M. I.; Shrinivas, A.; Si, W.; Wang, L.; Wei, H.; Wimpenny, S.; Yates, B. R.; Branson, J. G.; Cittolin, S.; Derdzinski, M.; Hashemi, B.; Holzner, A.; Klein, D.; Kole, G.; Krutelyov, V.; Letts, J.; Macneill, I.; Masciovecchio, M.; Olivito, D.; Padhi, S.; Pieri, M.; Sani, M.; Sharma, V.; Simon, S.; Tadel, M.; Vartak, A.; Wasserbaech, S.; Wood, J.; Würthwein, F.; Yagil, A.; Zevi Della Porta, G.; Amin, N.; Bhandari, R.; Bradmiller-Feld, J.; Campagnari, C.; Dishaw, A.; Dutta, V.; Franco Sevilla, M.; George, C.; Golf, F.; Gouskos, L.; Gran, J.; Heller, R.; Incandela, J.; Mullin, S. D.; Ovcharova, A.; Qu, H.; Richman, J.; Stuart, D.; Suarez, I.; Yoo, J.; Anderson, D.; Bendavid, J.; Bornheim, A.; Lawhorn, J. M.; Newman, H. B.; Nguyen, T.; Pena, C.; Spiropulu, M.; Vlimant, J. R.; Xie, S.; Zhang, Z.; Zhu, R. Y.; Andrews, M. B.; Ferguson, T.; Mudholkar, T.; Paulini, M.; Russ, J.; Sun, M.; Vogel, H.; Vorobiev, I.; Weinberg, M.; Cumalat, J. P.; Ford, W. T.; Jensen, F.; Johnson, A.; Krohn, M.; Leontsinis, S.; Mulholland, T.; Stenson, K.; Wagner, S. R.; Alexander, J.; Chaves, J.; Chu, J.; Dittmer, S.; Mcdermott, K.; Mirman, N.; Patterson, J. R.; Rinkevicius, A.; Ryd, A.; Skinnari, L.; Soffi, L.; Tan, S. M.; Tao, Z.; Thom, J.; Tucker, J.; Wittich, P.; Zientek, M.; Abdullin, S.; Albrow, M.; Apollinari, G.; Apresyan, A.; Apyan, A.; Banerjee, S.; Bauerdick, L. A. T.; Beretvas, A.; Berryhill, J.; Bhat, P. C.; Bolla, G.; Burkett, K.; Butler, J. N.; Canepa, A.; Cerati, G. B.; Cheung, H. W. K.; Chlebana, F.; Cremonesi, M.; Duarte, J.; Elvira, V. D.; Freeman, J.; Gecse, Z.; Gottschalk, E.; Gray, L.; Green, D.; Grünendahl, S.; Gutsche, O.; Harris, R. M.; Hasegawa, S.; Hirschauer, J.; Hu, Z.; Jayatilaka, B.; Jindariani, S.; Johnson, M.; Joshi, U.; Klima, B.; Kreis, B.; Lammel, S.; Lincoln, D.; Lipton, R.; Liu, M.; Liu, T.; Lopes De Sá, R.; Lykken, J.; Maeshima, K.; Magini, N.; Marraffino, J. M.; Maruyama, S.; Mason, D.; McBride, P.; Merkel, P.; Mrenna, S.; Nahn, S.; O'Dell, V.; Pedro, K.; Prokofyev, O.; Rakness, G.; Ristori, L.; Schneider, B.; Sexton-Kennedy, E.; Soha, A.; Spalding, W. J.; Spiegel, L.; Stoynev, S.; Strait, J.; Strobbe, N.; Taylor, L.; Tkaczyk, S.; Tran, N. V.; Uplegger, L.; Vaandering, E. W.; Vernieri, C.; Verzocchi, M.; Vidal, R.; Wang, M.; Weber, H. A.; Whitbeck, A.; Acosta, D.; Avery, P.; Bortignon, P.; Bourilkov, D.; Brinkerhoff, A.; Carnes, A.; Carver, M.; Curry, D.; Das, S.; Field, R. D.; Furic, I. K.; Konigsberg, J.; Korytov, A.; Kotov, K.; Ma, P.; Matchev, K.; Mei, H.; Mitselmakher, G.; Rank, D.; Sperka, D.; Terentyev, N.; Thomas, L.; Wang, J.; Wang, S.; Yelton, J.; Joshi, Y. R.; Linn, S.; Markowitz, P.; Martinez, G.; Rodriguez, J. L.; Ackert, A.; Adams, T.; Askew, A.; Hagopian, S.; Hagopian, V.; Johnson, K. F.; Kolberg, T.; Perry, T.; Prosper, H.; Saha, A.; Santra, A.; Yohay, R.; Baarmand, M. M.; Bhopatkar, V.; Colafranceschi, S.; Hohlmann, M.; Noonan, D.; Roy, T.; Yumiceva, F.; Adams, M. R.; Apanasevich, L.; Berry, D.; Betts, R. R.; Cavanaugh, R.; Chen, X.; Evdokimov, O.; Gerber, C. E.; Hangal, D. A.; Hofman, D. J.; Jung, K.; Kamin, J.; Sandoval Gonzalez, I. D.; Tonjes, M. B.; Trauger, H.; Varelas, N.; Wang, H.; Wu, Z.; Zhang, J.; Bilki, B.; Clarida, W.; Dilsiz, K.; Durgut, S.; Gandrajula, R. P.; Haytmyradov, M.; Khristenko, V.; Merlo, J.-P.; Mermerkaya, H.; Mestvirishvili, A.; Moeller, A.; Nachtman, J.; Ogul, H.; Onel, Y.; Ozok, F.; Penzo, A.; Snyder, C.; Tiras, E.; Wetzel, J.; Yi, K.; Blumenfeld, B.; Cocoros, A.; Eminizer, N.; Fehling, D.; Feng, L.; Gritsan, A. V.; Maksimovic, P.; Roskes, J.; Sarica, U.; Swartz, M.; Xiao, M.; You, C.; Al-bataineh, A.; Baringer, P.; Bean, A.; Boren, S.; Bowen, J.; Castle, J.; Khalil, S.; Kropivnitskaya, A.; Majumder, D.; Mcbrayer, W.; Murray, M.; Royon, C.; Sanders, S.; Schmitz, E.; Stringer, R.; Tapia Takaki, J. D.; Wang, Q.; Ivanov, A.; Kaadze, K.; Maravin, Y.; Mohammadi, A.; Saini, L. K.; Skhirtladze, N.; Toda, S.; Rebassoo, F.; Wright, D.; Anelli, C.; Baden, A.; Baron, O.; Belloni, A.; Calvert, B.; Eno, S. C.; Ferraioli, C.; Hadley, N. J.; Jabeen, S.; Jeng, G. Y.; Kellogg, R. G.; Kunkle, J.; Mignerey, A. C.; Ricci-Tam, F.; Shin, Y. H.; Skuja, A.; Tonwar, S. C.; Abercrombie, D.; Allen, B.; Azzolini, V.; Barbieri, R.; Baty, A.; Bi, R.; Brandt, S.; Busza, W.; Cali, I. A.; D'Alfonso, M.; Demiragli, Z.; Gomez Ceballos, G.; Goncharov, M.; Hsu, D.; Iiyama, Y.; Innocenti, G. M.; Klute, M.; Kovalskyi, D.; Lai, Y. S.; Lee, Y.-J.; Levin, A.; Luckey, P. D.; Maier, B.; Marini, A. C.; Mcginn, C.; Mironov, C.; Narayanan, S.; Niu, X.; Paus, C.; Roland, C.; Roland, G.; Salfeld-Nebgen, J.; Stephans, G. S. F.; Tatar, K.; Velicanu, D.; Wang, J.; Wang, T. W.; Wyslouch, B.; Benvenuti, A. C.; Chatterjee, R. M.; Evans, A.; Hansen, P.; Kalafut, S.; Kubota, Y.; Lesko, Z.; Mans, J.; Nourbakhsh, S.; Ruckstuhl, N.; Rusack, R.; Turkewitz, J.; Acosta, J. G.; Oliveros, S.; Avdeeva, E.; Bloom, K.; Claes, D. R.; Fangmeier, C.; Gonzalez Suarez, R.; Kamalieddin, R.; Kravchenko, I.; Monroy, J.; Siado, J. E.; Snow, G. R.; Stieger, B.; Alyari, M.; Dolen, J.; Godshalk, A.; Harrington, C.; Iashvili, I.; Nguyen, D.; Parker, A.; Rappoccio, S.; Roozbahani, B.; Alverson, G.; Barberis, E.; Hortiangtham, A.; Massironi, A.; Morse, D. M.; Nash, D.; Orimoto, T.; Teixeira De Lima, R.; Trocino, D.; Wang, R.-J.; Wood, D.; Bhattacharya, S.; Charaf, O.; Hahn, K. A.; Mucia, N.; Odell, N.; Pollack, B.; Schmitt, M. H.; Sung, K.; Trovato, M.; Velasco, M.; Dev, N.; Hildreth, M.; Hurtado Anampa, K.; Jessop, C.; Karmgard, D. J.; Kellams, N.; Lannon, K.; Loukas, N.; Marinelli, N.; Meng, F.; Mueller, C.; Musienko, Y.; Planer, M.; Reinsvold, A.; Ruchti, R.; Smith, G.; Taroni, S.; Wayne, M.; Wolf, M.; Woodard, A.; Alimena, J.; Antonelli, L.; Bylsma, B.; Durkin, L. S.; Flowers, S.; Francis, B.; Hart, A.; Hill, C.; Ji, W.; Liu, B.; Luo, W.; Puigh, D.; Winer, B. L.; Wulsin, H. W.; Benaglia, A.; Cooperstein, S.; Driga, O.; Elmer, P.; Hardenbrook, J.; Hebda, P.; Higginbotham, S.; Lange, D.; Luo, J.; Marlow, D.; Mei, K.; Ojalvo, I.; Olsen, J.; Palmer, C.; Piroué, P.; Stickland, D.; Tully, C.; Malik, S.; Norberg, S.; Barker, A.; Barnes, V. E.; Folgueras, S.; Gutay, L.; Jha, M. K.; Jones, M.; Jung, A. W.; Khatiwada, A.; Miller, D. H.; Neumeister, N.; Peng, C. C.; Schulte, J. F.; Sun, J.; Wang, F.; Xie, W.; Cheng, T.; Parashar, N.; Stupak, J.; Adair, A.; Akgun, B.; Chen, Z.; Ecklund, K. M.; Geurts, F. J. M.; Guilbaud, M.; Li, W.; Michlin, B.; Northup, M.; Padley, B. P.; Roberts, J.; Rorie, J.; Tu, Z.; Zabel, J.; Bodek, A.; de Barbaro, P.; Demina, R.; Duh, Y. t.; Ferbel, T.; Galanti, M.; Garcia-Bellido, A.; Han, J.; Hindrichs, O.; Khukhunaishvili, A.; Lo, K. H.; Tan, P.; Verzetti, M.; Ciesielski, R.; Goulianos, K.; Mesropian, C.; Agapitos, A.; Chou, J. P.; Gershtein, Y.; Gómez Espinosa, T. A.; Halkiadakis, E.; Heindl, M.; Hughes, E.; Kaplan, S.; Kunnawalkam Elayavalli, R.; Kyriacou, S.; Lath, A.; Montalvo, R.; Nash, K.; Osherson, M.; Saka, H.; Salur, S.; Schnetzer, S.; Sheffield, D.; Somalwar, S.; Stone, R.; Thomas, S.; Thomassen, P.; Walker, M.; Delannoy, A. G.; Foerster, M.; Heideman, J.; Riley, G.; Rose, K.; Spanier, S.; Thapa, K.; Bouhali, O.; Castaneda Hernandez, A.; Celik, A.; Dalchenko, M.; De Mattia, M.; Delgado, A.; Dildick, S.; Eusebi, R.; Gilmore, J.; Huang, T.; Kamon, T.; Mueller, R.; Pakhotin, Y.; Patel, R.; Perloff, A.; Perniè, L.; Rathjens, D.; Safonov, A.; Tatarinov, A.; Ulmer, K. A.; Akchurin, N.; Damgov, J.; De Guio, F.; Dudero, P. R.; Faulkner, J.; Gurpinar, E.; Kunori, S.; Lamichhane, K.; Lee, S. W.; Libeiro, T.; Peltola, T.; Undleeb, S.; Volobouev, I.; Wang, Z.; Greene, S.; Gurrola, A.; Janjam, R.; Johns, W.; Maguire, C.; Melo, A.; Ni, H.; Sheldon, P.; Tuo, S.; Velkovska, J.; Xu, Q.; Arenton, M. W.; Barria, P.; Cox, B.; Hirosky, R.; Ledovskoy, A.; Li, H.; Neu, C.; Sinthuprasith, T.; Sun, X.; Wang, Y.; Wolfe, E.; Xia, F.; Clarke, C.; Harr, R.; Karchin, P. E.; Sturdy, J.; Zaleski, S.; Buchanan, J.; Caillol, C.; Dasu, S.; Dodd, L.; Duric, S.; Gomber, B.; Grothe, M.; Herndon, M.; Hervé, A.; Hussain, U.; Klabbers, P.; Lanaro, A.; Levine, A.; Long, K.; Loveless, R.; Pierro, G. A.; Polese, G.; Ruggles, T.; Savin, A.; Smith, N.; Smith, W. H.; Taylor, D.; Woods, N.; CMS Collaboration

2018-02-01

Results are reported from a search for new physics in 13 TeV proton-proton collisions in the final state with large missing transverse momentum and two Higgs bosons decaying via H →b b ¯ . The search uses a data sample accumulated by the CMS experiment at the LHC in 2016, corresponding to an integrated luminosity of 35.9 fb-1 . The search is motivated by models based on gauge-mediated supersymmetry breaking, which predict the electroweak production of a pair of Higgsinos, each of which can decay via a cascade process to a Higgs boson and an undetected lightest supersymmetric particle. The observed event yields in the signal regions are consistent with the standard model background expectation obtained from control regions in data. Higgsinos in the mass range 230-770 GeV are excluded at 95% confidence level in the context of a simplified model for the production and decay of approximately degenerate Higgsinos.

Longitudinal differentiation in Melipona mandacaia (Hymenoptera, Meliponini) chromosomes.

PubMed

Rocha, M P; Cruz, M P; Fernandes, A; Waldschmidt, A M; Silva-Júnior, J C; Pompolo, S G

2003-01-01

Melipona mandacaia is a stingless bee endemic to northeast Brasil. We describe the M. mandacaia karyotype using C-banding technique. fluorochrome staining and treatment with restriction enzymes and discuss the position of this species in the context of the phylogeny of the genus. Melipona mandacaia has 2n = 18 (14 SM + 2 M + 2 A). Heterochromatin was detected in the pericentromeric region of pairs 1, 2 and 8 and in the form of small blocks in the remaining pairs. Staining with base-specific fluorochromes showed that this heterochromatin was rich AT (QM and DAPI), except in the region corresponding to the NOR which was rich GC (CMA3) and was cleaved by the HaeIII enzyme. Melipona mandacaia is a member of Group I Melipona. Treatment with DraI/Giemsa discloses a larger number of bands than treatment with DraI/QM. Pre-cleavage with DraI gave rise to a larger number of bands following QM staining; a circumstance evidently due to a removal of the DNA-protein complex that prevented the association of the fluorochrome with AT-rich DNA. The results highlight the complex nature of heterochromatin.

Search for Higgsino pair production in p p collisions at s = 13 TeV in final states with large missing transverse momentum and two Higgs bosons decaying via H → b b ¯

DOE PAGES

Sirunyan, A. M.; Tumasyan, A.; Adam, W.; ...

2018-02-08

Results are reported from a search for new physics in 13 TeV proton-proton collisions in the final state with large missing transverse momentum and two Higgs bosons decaying via H→more » $$b\\bar{b}$$. The search uses a data sample accumulated by the CMS experiment at the LHC in 2016, corresponding to an integrated luminosity of 35.9 fb -1. The search is motivated by models based on gauge-mediated supersymmetry breaking, which predict the electroweak production of a pair of Higgsinos, each of which can decay via a cascade process to a Higgs boson and an undetected lightest supersymmetric particle. The observed event yields in the signal regions are consistent with the standard model background expectation obtained from control regions in data. Higgsinos in the mass range 230–770 GeV are excluded at 95% confidence level in the context of a simplified model for the production and decay of approximately degenerate Higgsinos.« less

Anticancer property of sediment actinomycetes against MCF-7 and MDA-MB-231 cell lines.

PubMed

Ravikumar, S; Fredimoses, M; Gnanadesigan, M

2012-02-01

To investigate the anticancer property of marine sediment actinomycetes against two different breast cancer cell lines. In vitro anticancer activity was carried out against breast (MCF-7 and MDA-MB-231) cancer cell lines. Partial sequences of the 16s rRNA gene, phylogenetic tree construction, multiple sequence analysis and secondary structure analysis were also carried out with the actinomycetes isolates. Of the selected five actinomycete isolates, ACT01 and ACT02 showed the IC50 value with (10.13±0.92) and (22.34±5.82) µg/mL concentrations, respectively for MCF-7 cell line at 48 h, but ACT01 showed the minimum (18.54±2.49 µg/mL) level of IC50 value with MDA-MB-231 cell line. Further, the 16s rRNA partial sequences of ACT01, ACT02, ACT03, ACT04 and ACT05 isolates were also deposited in NCBI data bank with the accession numbers of GQ478246, GQ478247, GQ478248, GQ478249 and GQ478250, respectively. The phylogenetic tree analysis showed that, the isolates of ACT02 and ACT03 were represented in group I and III, respectively, but ACT01 and ACT02 were represented in group II. The multiple sequence alignment of the actinomycete isolates showed that, the maximum identical conserved regions were identified with the nucleotide regions of 125 to 221st base pairs, 65 to 119th base pairs and 55, 48 and 31st base pairs. Secondary structure prediction of the 16s rRNA showed that, the maximum free energy was consumed with ACT03 isolate (-45.4 kkal/mol) and the minimum free energy was consumed with ACT04 isolate (-57.6 kkal/mol). The actinomycete isolates of ACT01 and ACT02 (GQ478246 and GQ478247) which are isolated from sediment sample can be further used as anticancer agents against breast cancer cell lines.

Bifacial Base-Pairing Behaviors of 5-Hydroxyuracil DNA Bases through Hydrogen Bonding and Metal Coordination.

PubMed

Takezawa, Yusuke; Nishiyama, Kotaro; Mashima, Tsukasa; Katahira, Masato; Shionoya, Mitsuhiko

2015-10-12

A novel bifacial ligand-bearing nucleobase, 5-hydroxyuracil (U(OH) ), which forms both a hydrogen-bonded base pair (U(OH) -A) and a metal-mediated base pair (U(OH) -M-U(OH) ) has been developed. The U(OH) -M-U(OH) base pairs were quantitatively formed in the presence of lanthanide ions such as Gd(III) when U(OH) -U(OH) pairs were consecutively incorporated into DNA duplexes. This result established metal-assisted duplex stabilization as well as DNA-templated assembly of lanthanide ions. Notably, a duplex possessing U(OH) -A base pairs was destabilized by addition of Gd(III) ions. This observation suggests that the hybridization behaviors of the U(OH) -containing DNA strands are altered by metal complexation. Thus, the U(OH) nucleobase with a bifacial base-pairing property holds great promise as a component for metal-responsive DNA materials. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Molecular switching behavior in isosteric DNA base pairs.

PubMed

Jissy, A K; Konar, Sukanya; Datta, Ayan

2013-04-15

The structures and proton-coupled behavior of adenine-thymine (A-T) and a modified base pair containing a thymine isostere, adenine-difluorotoluene (A-F), are studied in different solvents by dispersion-corrected density functional theory. The stability of the canonical Watson-Crick base pair and the mismatched pair in various solvents with low and high dielectric constants is analyzed. It is demonstrated that A-F base pairing is favored in solvents with low dielectric constant. The stabilization and conformational changes induced by protonation are also analyzed for the natural as well as the mismatched base pair. DNA sequences capable of changing their sequence conformation on protonation are used in the construction of pH-based molecular switches. An acidic medium has a profound influence in stabilizing the isostere base pair. Such a large gain in stability on protonation leads to an interesting pH-controlled molecular switch, which can be incorporated in a natural DNA tract. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

A gp41-based heteroduplex mobility assay provides rapid and accurate assessment of intrasubtype epidemiological linkage in HIV type 1 heterosexual transmission Pairs.

PubMed

Manigart, Olivier; Boeras, Debrah I; Karita, Etienne; Hawkins, Paulina A; Vwalika, Cheswa; Makombe, Nathan; Mulenga, Joseph; Derdeyn, Cynthia A; Allen, Susan; Hunter, Eric

2012-12-01

A critical step in HIV-1 transmission studies is the rapid and accurate identification of epidemiologically linked transmission pairs. To date, this has been accomplished by comparison of polymerase chain reaction (PCR)-amplified nucleotide sequences from potential transmission pairs, which can be cost-prohibitive for use in resource-limited settings. Here we describe a rapid, cost-effective approach to determine transmission linkage based on the heteroduplex mobility assay (HMA), and validate this approach by comparison to nucleotide sequencing. A total of 102 HIV-1-infected Zambian and Rwandan couples, with known linkage, were analyzed by gp41-HMA. A 400-base pair fragment within the envelope gp41 region of the HIV proviral genome was PCR amplified and HMA was applied to both partners' amplicons separately (autologous) and as a mixture (heterologous). If the diversity between gp41 sequences was low (<5%), a homoduplex was observed upon gel electrophoresis and the transmission was characterized as having occurred between partners (linked). If a new heteroduplex formed, within the heterologous migration, the transmission was determined to be unlinked. Initial blind validation of gp-41 HMA demonstrated 90% concordance between HMA and sequencing with 100% concordance in the case of linked transmissions. Following validation, 25 newly infected partners in Kigali and 12 in Lusaka were evaluated prospectively using both HMA and nucleotide sequences. Concordant results were obtained in all but one case (97.3%). The gp41-HMA technique is a reliable and feasible tool to detect linked transmissions in the field. All identified unlinked results should be confirmed by sequence analyses.

Sex-related difference in human white matter volumes studied: Inspection of the corpus callosum and other white matter by VBM

NASA Astrophysics Data System (ADS)

Shiino, Akihiko; Chen, Yen-Wei; Tanigaki, Kenji; Yamada, Atsushi; Vigers, Piers; Watanabe, Toshiyuki; Tooyama, Ikuo; Akiguchi, Ichiro

2017-01-01

It has been contended that any observed difference of the corpus callosum (CC) size between men and women is not sex-related but brain-size-related. A recent report, however, showed that the midsagittal CC area was significantly larger in women in 37 brain-size-matched pairs of normal young adults. Since this constituted strong evidence of sexual dimorphism and was obtained from publicly available data in OASIS, we examined volume differences within the CC and in other white matter using voxel-based morphometry (VBM). We created a three-dimensional region of interest of the CC and measured its volume. The VBM statistics were analyzed by permutation test and threshold-free cluster enhancement (TFCE) with the significance levels at FWER < 0.05. The CC volume was significantly larger in women in the same 37 brain-size-matched pairs. We found that the CC genu was the subregion showing the most significant sex-related difference. We also found that white matter in the bilateral anterior frontal regions and the left lateral white matter near to Broca’s area were larger in women, whereas there were no significant larger regions in men. Since we used brain-size-matched subjects, our results gave strong volumetric evidence of localized sexual dimorphism of white matter.

[Development of specific and degenerated primers to CesA genes encoding flax (Linum usitatissimum L.) cellulose synthase].

PubMed

Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V

2010-01-01

Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.

Detailed analysis of stem I and its 5' and 3' neighbor regions in the trans-acting HDV ribozyme.

PubMed Central

Nishikawa, F; Roy, M; Fauzi, H; Nishikawa, S

1999-01-01

To determine the stem I structure of the human hepatitis delta virus (HDV) ribozyme, which is related to the substrate sequence in the trans -acting system, we kinetically studied stem I length and sequences. Stem I extension from 7 to 8 or 9 bp caused a loss of activity and a low amount of active complex with 9 bp in the trans -acting system. In a previous report, we presented cleavage in a 6 bp stem I. The observed reaction rates indicate that the original 7 bp stem I is in the most favorable location for catalytic reaction among the possible 6-8 bp stems. To test base specificity, we replaced the original GC-rich sequence in stem I with AU-rich sequences containing six AU or UA base pairs with the natural +1G.U wobble base pair at the cleavage site. The cis -acting AU-rich molecules demonstrated similar catalytic activity to that of the wild-type. In trans -acting molecules, due to stem I instability, reaction efficiency strongly depended on the concentration of the ribozyme-substrate complex and reaction temperature. Multiple turnover was observed at 37 degreesC, strongly suggesting that stem I has no base specificity and more efficient activity can be expected under multiple turnover conditions by substituting several UA or AU base pairs into stem I. We also studied the substrate damaging sequences linked to both ends of stem I for its development in therapeutic applications and confirmed the functions of the unique structure. PMID:9862958

Epigenomic profiling of DNA methylation in paired prostate cancer versus adjacent benign tissue

PubMed Central

Geybels, Milan S.; Zhao, Shanshan; Wong, Chao-Jen; Bibikova, Marina; Klotzle, Brandy; Wu, Michael; Ostrander, Elaine A.; Fan, Jian-Bing; Feng, Ziding; Stanford, Janet L.

2016-01-01

Background Aberrant DNA methylation may promote prostate carcinogenesis. We investigated epigenome-wide DNA methylation profiles in prostate cancer (PCa) compared to adjacent benign tissue to identify differentially methylated CpG sites. Methods The study included paired PCa and adjacent benign tissue samples from 20 radical prostatectomy patients. Epigenetic profiling was done using the Infinium HumanMethylation450 BeadChip. Linear models that accounted for the paired study design and False Discovery Rate Q-values were used to evaluate differential CpG methylation. mRNA expression levels of the genes with the most differentially methylated CpG sites were analyzed. Results In total, 2,040 differentially methylated CpG sites were identified in PCa versus adjacent benign tissue (Q-value <0.001), the majority of which were hypermethylated (n = 1,946; 95%). DNA methylation profiles accurately distinguished between PCa and benign tissue samples. Twenty-seven top-ranked hypermethylated CpGs had a mean methylation difference of at least 40% between tissue types, which included 25 CpGs in 17 genes. Furthermore, for ten genes over 50% of promoter region CpGs were hypermethylated in PCa versus benign tissue. The top-ranked differentially methylated genes included three genes that were associated with both promoter hypermethylation and reduced gene expression: SCGB3A1, HIF3A, and AOX1. Analysis of The Cancer Genome Atlas (TCGA) data provided confirmatory evidence for our findings. Conclusions This study of PCa versus adjacent benign tissue showed many differentially methylated CpGs and regions in and outside gene promoter regions, which may potentially be used for the development of future epigenetic-based diagnostic tests or as therapeutic targets. PMID:26383847

Epigenomic profiling of DNA methylation in paired prostate cancer versus adjacent benign tissue.

PubMed

Geybels, Milan S; Zhao, Shanshan; Wong, Chao-Jen; Bibikova, Marina; Klotzle, Brandy; Wu, Michael; Ostrander, Elaine A; Fan, Jian-Bing; Feng, Ziding; Stanford, Janet L

2015-12-01

Aberrant DNA methylation may promote prostate carcinogenesis. We investigated epigenome-wide DNA methylation profiles in prostate cancer (PCa) compared to adjacent benign tissue to identify differentially methylated CpG sites. The study included paired PCa and adjacent benign tissue samples from 20 radical prostatectomy patients. Epigenetic profiling was done using the Infinium HumanMethylation450 BeadChip. Linear models that accounted for the paired study design and False Discovery Rate Q-values were used to evaluate differential CpG methylation. mRNA expression levels of the genes with the most differentially methylated CpG sites were analyzed. In total, 2,040 differentially methylated CpG sites were identified in PCa versus adjacent benign tissue (Q-value < 0.001), the majority of which were hypermethylated (n = 1,946; 95%). DNA methylation profiles accurately distinguished between PCa and benign tissue samples. Twenty-seven top-ranked hypermethylated CpGs had a mean methylation difference of at least 40% between tissue types, which included 25 CpGs in 17 genes. Furthermore, for 10 genes over 50% of promoter region CpGs were hypermethylated in PCa versus benign tissue. The top-ranked differentially methylated genes included three genes that were associated with both promoter hypermethylation and reduced gene expression: SCGB3A1, HIF3A, and AOX1. Analysis of The Cancer Genome Atlas (TCGA) data provided confirmatory evidence for our findings. This study of PCa versus adjacent benign tissue showed many differentially methylated CpGs and regions in and outside gene promoter regions, which may potentially be used for the development of future epigenetic-based diagnostic tests or as therapeutic targets. © 2015 Wiley Periodicals, Inc.

Molecular dynamics of the frame-shifting pseudoknot from beet western yellows virus: the role of non-Watson-Crick base-pairing, ordered hydration, cation binding and base mutations on stability and unfolding.

PubMed

Csaszar, K; Spacková, N; Stefl, R; Sponer, J; Leontis, N B

2001-11-09

Molecular dynamics simulations of the frame-shifting pseudoknot from beet western yellows virus (BWYV, NDB file UR0004) were performed with explicit inclusion of solvent and counterions. In all, 33 ns of simulation were carried out, including 10 ns of the native structure with protonation of the crucial cytosine residue, C8(N3+). The native structure exhibited stable trajectories retaining all Watson-Crick and tertiary base-pairs, except for fluctuations or transient disruptions at specific sites. The most significant fluctuations involved the change or disruption of hydrogen-bonding between C8(N3+) and bases G12, A25, and C26, as well as disruption of the water bridges linking C8(N3+) with A25 and C26. To increase sampling of rare events, the native simulation was continued at 400 K. A partial, irreversible unfolding of the molecule was initiated by slippage of C8(N3+) relative to G12 and continued by sudden concerted changes in hydrogen-bonding involving A23, A24, and A25. These events were followed by a gradual loss of stacking interactions in loop 2. Of the Watson-Crick base-pairs, only the 5'-terminal pair of stem 1 dissociated at 400 K, while the trans sugar-edge/sugar-edge A20.G4 interaction remained surprisingly stable. Four additional room-temperature simulations were carried out to obtain insights into the structural and dynamic effects of selected mutations. In two of these, C8 was left unprotonated. Considerable local rearrangements occurred that were not observed in the crystal structure, thus confirming N3-protonation of C8 in the native molecule. We also investigated the effect of mutating C8(N3+) to U8, to correlate with experimental and phylogenetic studies, and of changing the G4 x C17 base-pair to A4 x U17 to weaken the trans sugar-edge interaction between positions 4 and 20 and to test models of unfolding. The simulations indicate that the C8 x G12 x C26 base-triple at the junction is the most labile region of the frame-shifting pseudoknot. They provide insights into the roles of the other non-Watson-Crick base-pairs in the early stages of unfolding of the pseudoknot, which must occur to allow readthrough of the message by the ribosome. The simulations revealed several critical, highly ordered hydration sites with close to 100 % occupancies and residency times of individual water molecules of up to 5 ns. Sodium cation coordination sites with occupancies above 50 % were also observed. Copyright 2001 Academic Press.

Local Genetic Correlation Gives Insights into the Shared Genetic Architecture of Complex Traits.

PubMed

Shi, Huwenbo; Mancuso, Nicholas; Spendlove, Sarah; Pasaniuc, Bogdan

2017-11-02

Although genetic correlations between complex traits provide valuable insights into epidemiological and etiological studies, a precise quantification of which genomic regions disproportionately contribute to the genome-wide correlation is currently lacking. Here, we introduce ρ-HESS, a technique to quantify the correlation between pairs of traits due to genetic variation at a small region in the genome. Our approach requires GWAS summary data only and makes no distributional assumption on the causal variant effect sizes while accounting for linkage disequilibrium (LD) and overlapping GWAS samples. We analyzed large-scale GWAS summary data across 36 quantitative traits, and identified 25 genomic regions that contribute significantly to the genetic correlation among these traits. Notably, we find 6 genomic regions that contribute to the genetic correlation of 10 pairs of traits that show negligible genome-wide correlation, further showcasing the power of local genetic correlation analyses. Finally, we report the distribution of local genetic correlations across the genome for 55 pairs of traits that show putative causal relationships. Copyright © 2017 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Generation of field-aligned currents and Alfven waves by 3D magnetic reconnection

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ma, Z.W.; Lee, L.C.; Otto, A.

1995-07-01

The authors have carried out a three-dimensional compressible MHD simulation to study the generation of field-aligned currents (FAC`s) and Alfven waves by magnetic reconnection for locally antiparallel magnetic fields across the current sheet. Reconnection is triggered by a localized resistivity. The results indicate that both FAC`s and Alfven waves are generated by the three-dimensional reconnection process. Two pairs of FAC`s are generated on each side of current sheet. The polarities of the resulting FAC pair in the leading bulge region are opposite to those of a FAC pair in the trailing quasi-steady region. It is further found that a largemore » portion of the FAC`s ({approximately}40%) is located in the closed field line region. They examine the Walen relation between FAC and parallel vorticity and find that Alfven waves are generated and propagate away from the reconnection site. They discuss the relevance of the results to the observed Region 1 FAC`s at noon. 15 refs., 4 figs.« less

Museum specimens reveal changes in the population structure of northern Fennoscandian domestic reindeer in the past one hundred years.

PubMed

Bjørnstad, G; Røed, K H

2010-06-01

Traditional reindeer herding of northern Fennoscandia has been based on seasonal movements independent of national borders. At the beginning of the 19th century, these yearly movements of reindeer were excessive, but during that century the borders between the Fennoscandian countries were closed. By analysing a 190-base pair fragment of the mitochondrial DNA control region in 79 museum samples, we show that the reindeer of northern Fennoscandia were one homogenous population shortly after the national borders were closed. However, anthropogenic activity has effectively ended genetic exchange within northern Fennoscandia and has made the reindeer population within this region heterogeneous. Genetic input of eastern origin is also suggested within the extant Russian reindeer of the Kola Peninsula.

Sensitization of photoconductivity in ferrocene-containing oligomer by squarylium and merocyanine dyes

NASA Astrophysics Data System (ADS)

Davidenko, N. A.; Ishchenko, A. A.; Kozinets, A. V.; Kostenko, L. I.; Kurdyukova, I. V.; Mokrinskaya, E. V.; Studzinskii, S. L.; Chuprina, N. G.

2011-03-01

We have studied the photoconducting properties of films of ferrocene-containing oligomer with additives of squarylium and merocyanine dyes based on ferrocene and tetranitrofluorene in the dye absorption region. We have studied the characteristic features of the effect of an external magnetic field on the photocurrents. After the magnetic field is turned on, the photocurrent increases in the samples with squarylium dye and decreases in the samples with merocyanine dye. We discuss the hypothesis that in the first case, as a result of an internal photoelectric effect, predominantly triplet charge pairs are formed, while in the second case predominantly singlet charge pairs are formed. The latter may be one of the reasons for the higher photoconductivity of films with squarylium dye compared with merocyanine dye.

1,8-Naphthyridine-2,7-diamine: a potential universal reader of Watson-Crick base pairs for DNA sequencing by electron tunneling.

PubMed

Liang, Feng; Lindsay, Stuart; Zhang, Peiming

2012-11-21

With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.

1,8-Naphthyridine-2,7-diamine: A Potential Universal Reader of the Watson-Crick Base Pairs for DNA Sequencing by Electron Tunneling

PubMed Central

Liang, Feng; Lindsay, Stuart; Zhang, Peiming

2013-01-01

With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read the DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A:T and G:C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs. PMID:23038027

Full-genome sequences of hepatitis B virus subgenotype D3 isolates from the Brazilian Amazon Region.

PubMed

Spitz, Natália; Mello, Francisco C A; Araujo, Natalia Motta

2015-02-01

The Brazilian Amazon Region is a highly endemic area for hepatitis B virus (HBV). However, little is known regarding the genetic variability of the strains circulating in this geographical region. Here, we describe the first full-length genomes of HBV isolated in the Brazilian Amazon Region; these genomes are also the first complete HBV subgenotype D3 genomes reported for Brazil. The genomes of the five Brazilian isolates were all 3,182 base pairs in length and the isolates were classified as belonging to subgenotype D3, subtypes ayw2 (n = 3) and ayw3 (n = 2). Phylogenetic analysis suggested that the Brazilian sequences are not likely to be closely related to European D3 sequences. Such results will contribute to further epidemiological and evolutionary studies of HBV.

Protonation-dependent base flipping in the catalytic triad of a small RNA

NASA Astrophysics Data System (ADS)

Sun, Zhaoxi; Wang, Xiaohui; Zhang, John Z. H.

2017-09-01

Protonation dependent base flipping in RNA has never been studied theoretically. In this work we studied protonation-dependent behavior of the base flipping in the catalytic triad of a single-stranded RNA which was previously characterized by NMR experiment. Molecular dynamics simulation reveals that the GA mismatch in this region accounts for this behavior. Free energy profiles show that the stable point for flipping dihedral shifts about 35° and the free energy barrier along the flipping pathway is elevated upon protonation. The orientation of Guanine from syn to anti conformation is coupled with protonation-dependent base flipping and G-HA+ base pair is formed under acidic condition.

Matrilineage differentiation of the genus Tetragonisca using mitochondrial DNA markers and the polymerase chain reaction-restriction fragment length polymorphism technique.

PubMed

Santos, S A; Bronzato, A R; Moreira, B M T; Araujo, K F; Ronqui, L; Mangolin, C A; Toledo, V A A; Ruvolo-Takasusuki, M C C

2015-10-21

The Meliponinae are important pollinators of plant species, and one of the most managed species is Tetragonisca angustula. Initially, two subspecies were identified in T. angustula: T. angustula angustula and T. angustula fiebrigi. Subsequently, T. a. fiebrigi was considered a species, based on the coloration of its mesepisternum. The objective of the present study was to obtain genetic markers that could differentiate the two species by amplifying regions of mitochondrial DNA and conducting polymerase chain reaction-restriction fragment length polymorphism analysis. Worker bees were collected in three Brazilian states: Paraná (Maringá, Altônia, and Foz do Iguaçu), São Paulo (Dracena, São Carlos, and Santa Cruz do Rio Pardo), and Rondônia (Ariquemes). Ten pairs of insect heterologous primers were tested and four were used (primer pair 1, ND2 and COI; primer pair 2, COI; primer pair 8, 16S and 12S; and primer pair 9, COII). For the restriction analysis, 13 enzymes were tested: EcoRI, EcoRV, HindIII, HinfI, RsaI, PstI, XbaI, HaeIII, ClaI, XhoI, BglII, PvuII, and ScaI. Markers were obtained (primer pair 8 cleaved with EcoRV and XbaI and primer pair 9 cleaved with HaeIII, RsaI, and XbaI) that enabled matrilineage identification in the nests studied, which confirmed that hybridization could occur between both Tetragonisca species. The beginning of speciation was probably recent, and secondary contact has resulted in crosses between T. angustula females and T. fiebrigi males. Because of this hybridization, it would be appropriate to consider them as two subspecies of T. angustula.

The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

PubMed

Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

2013-06-17

Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Multilayer checkpoints for microRNA authenticity during RISC assembly.

PubMed

Kawamata, Tomoko; Yoda, Mayuko; Tomari, Yukihide

2011-09-01

MicroRNAs (miRNAs) function through the RNA-induced silencing complex (RISC), which contains an Argonaute (Ago) protein at the core. RISC assembly follows a two-step pathway: miRNA/miRNA* duplex loading into Ago, and separation of the two strands within Ago. Here we show that the 5' phosphate of the miRNA strand is essential for duplex loading into Ago, whereas the preferred 5' nucleotide of the miRNA strand and the base-pairing status in the seed region and the middle of the 3' region function as additive anchors to Ago. Consequently, the miRNA authenticity is inspected at multiple steps during RISC assembly.

The mini-exon genes of three Phytomonas isolates that differ in plant tissue tropism.

PubMed

Sturm, N R; Fernandes, O; Campbell, D A

1995-08-01

The tandem mini-exon gene repeat is an ideal diagnostic target for trypanosomatids because it includes sequences that are conserved absolutely coupled with regions of extreme variability. We have exploited these features and the polymerase chain reaction to differentiate Phytomonas strains isolated from phloem, fruit or latex of various host plants. While the transcribed regions are nearly identical, the intergenic sequences are variable in size and content (130-332 base pairs). The mini-exon genes of these phytomonads can therefore be distinguished from each other and from the corresponding genes in insect trypanosomes, with which they are oft confused.

A Study of Dean Vortex Development and Structure in a Curved Rectangular Channel with Aspect Ratio of 40 at Dean Numbers up to 430

NASA Technical Reports Server (NTRS)

Ligrani, Phillip M.

1994-01-01

Flow in a curved channel with mild curvature, an aspect ratio of 40 to 1, and an inner to outer radius ratio of 0.979 is studied at Dean numbers De ranging from 35 to 430. For positions from the start of curvature ranging from 85 to 145 degrees, the sequence of transition events begins with curved channel Poiseuille flow at De less than 40-64. As the Dean number increases, observations show initial development of Dean vortex pairs, followed by symmetric vortex pairs which, when viewed in spanwise/radial planes, cover the entire channel height (De=90-100). At De from 40 to 125-130, the vortex pairs often develop intermittent waviness in the form of vortex undulations. Splitting and merging of vortex pairs is also observed over the same experimental conditions as well as at higher De. When Dean numbers range from 130 to 185-200, the undulating wavy mode is replaced by a twisting mode with higher amplitudes of oscillation and shorter wavelengths. The twisting wavy mode results in the development of regions where turbulence intensity is locally augmented at Dean numbers from 150 to 185-200, principally in the upwash regions between the two individual vortices which make up each vortex pair. These turbulent regions eventually increase in intensity and spatial extent as the Dean number increases further, until individual regions merge together so that the entire cross section of the channel contains chaotic turbulent motions. When Dean numbers then reach 400-435, spectra of velocity fluctuations then evidence fully turbulent flow.

A Thiazole Coumarin (TC) Turn-On Fluorescence Probe for AT-Base Pair Detection and Multipurpose Applications in Different Biological Systems

NASA Astrophysics Data System (ADS)

Narayanaswamy, Nagarjun; Kumar, Manoj; Das, Sadhan; Sharma, Rahul; Samanta, Pralok K.; Pati, Swapan K.; Dhar, Suman K.; Kundu, Tapas K.; Govindaraju, T.

2014-09-01

Sequence-specific recognition of DNA by small turn-on fluorescence probes is a promising tool for bioimaging, bioanalytical and biomedical applications. Here, the authors report a novel cell-permeable and red fluorescent hemicyanine-based thiazole coumarin (TC) probe for DNA recognition, nuclear staining and cell cycle analysis. TC exhibited strong fluorescence enhancement in the presence of DNA containing AT-base pairs, but did not fluoresce with GC sequences, single-stranded DNA, RNA and proteins. The fluorescence staining of HeLa S3 and HEK 293 cells by TC followed by DNase and RNase digestion studies depicted the selective staining of DNA in the nucleus over the cytoplasmic region. Fluorescence-activated cell sorting (FACS) analysis by flow cytometry demonstrated the potential application of TC in cell cycle analysis in HEK 293 cells. Metaphase chromosome and malaria parasite DNA imaging studies further confirmed the in vivo diagnostic and therapeutic applications of probe TC. Probe TC may find multiple applications in fluorescence spectroscopy, diagnostics, bioimaging and molecular and cell biology.

A Thiazole Coumarin (TC) Turn-On Fluorescence Probe for AT-Base Pair Detection and Multipurpose Applications in Different Biological Systems

PubMed Central

Narayanaswamy, Nagarjun; Kumar, Manoj; Das, Sadhan; Sharma, Rahul; Samanta, Pralok K.; Pati, Swapan K.; Dhar, Suman K.; Kundu, Tapas K.; Govindaraju, T.

2014-01-01

Sequence-specific recognition of DNA by small turn-on fluorescence probes is a promising tool for bioimaging, bioanalytical and biomedical applications. Here, the authors report a novel cell-permeable and red fluorescent hemicyanine-based thiazole coumarin (TC) probe for DNA recognition, nuclear staining and cell cycle analysis. TC exhibited strong fluorescence enhancement in the presence of DNA containing AT-base pairs, but did not fluoresce with GC sequences, single-stranded DNA, RNA and proteins. The fluorescence staining of HeLa S3 and HEK 293 cells by TC followed by DNase and RNase digestion studies depicted the selective staining of DNA in the nucleus over the cytoplasmic region. Fluorescence-activated cell sorting (FACS) analysis by flow cytometry demonstrated the potential application of TC in cell cycle analysis in HEK 293 cells. Metaphase chromosome and malaria parasite DNA imaging studies further confirmed the in vivo diagnostic and therapeutic applications of probe TC. Probe TC may find multiple applications in fluorescence spectroscopy, diagnostics, bioimaging and molecular and cell biology. PMID:25252596

Stereo Correspondence Using Moment Invariants

NASA Astrophysics Data System (ADS)

Premaratne, Prashan; Safaei, Farzad

Autonomous navigation is seen as a vital tool in harnessing the enormous potential of Unmanned Aerial Vehicles (UAV) and small robotic vehicles for both military and civilian use. Even though, laser based scanning solutions for Simultaneous Location And Mapping (SLAM) is considered as the most reliable for depth estimation, they are not feasible for use in UAV and land-based small vehicles due to their physical size and weight. Stereovision is considered as the best approach for any autonomous navigation solution as stereo rigs are considered to be lightweight and inexpensive. However, stereoscopy which estimates the depth information through pairs of stereo images can still be computationally expensive and unreliable. This is mainly due to some of the algorithms used in successful stereovision solutions require high computational requirements that cannot be met by small robotic vehicles. In our research, we implement a feature-based stereovision solution using moment invariants as a metric to find corresponding regions in image pairs that will reduce the computational complexity and improve the accuracy of the disparity measures that will be significant for the use in UAVs and in small robotic vehicles.

SAR image change detection using watershed and spectral clustering

NASA Astrophysics Data System (ADS)

Niu, Ruican; Jiao, L. C.; Wang, Guiting; Feng, Jie

2011-12-01

A new method of change detection in SAR images based on spectral clustering is presented in this paper. Spectral clustering is employed to extract change information from a pair images acquired on the same geographical area at different time. Watershed transform is applied to initially segment the big image into non-overlapped local regions, leading to reduce the complexity. Experiments results and system analysis confirm the effectiveness of the proposed algorithm.

Design and efficacy of an Ecohealth competency-based course on the prevention and control of vector diseases in Latin America.

PubMed

Magaña-Valladares, Laura; Rodríguez, Mario Henry; Betanzos-Reyes, Ángel Francisco; Riojas-Rodríguez, Horacio; Quezada-Jiménez, María Laura; Suárez-Conejero, Juana Elvira; Lamadrid-Figueroa, Héctor

2018-01-01

To design and analyze the efficacy of an Ecohealth competency-based course on the prevention and control of vector-borne-diseases for specific stakeholders. Multiple stakeholders and sectors of the region were consulted to identify Ecohealth group-specific competencies using an adjusted analysis matrix. Eight courses based on the competencies were implemented to train EA tutors. The effectiveness of the course was evaluated through the use of paired- t-tests by intervention group. Strategic, tactical, academia and community stakeholder groups and their competencies were identified. An overall gain of 43 percentage points (p<0.001) was observed in terms of competencies score in trained tutors, which further trained 1 033 people. The identification of the stakeholders and their competencies proved to be useful to guide training courses to significantly improve the initial competencies and create a critical mass to further advance the EA in the region.

A big data geospatial analytics platform - Physical Analytics Integrated Repository and Services (PAIRS)

NASA Astrophysics Data System (ADS)

Hamann, H.; Jimenez Marianno, F.; Klein, L.; Albrecht, C.; Freitag, M.; Hinds, N.; Lu, S.

2015-12-01

A big data geospatial analytics platform:Physical Analytics Information Repository and Services (PAIRS)Fernando Marianno, Levente Klein, Siyuan Lu, Conrad Albrecht, Marcus Freitag, Nigel Hinds, Hendrik HamannIBM TJ Watson Research Center, Yorktown Heights, NY 10598A major challenge in leveraging big geospatial data sets is the ability to quickly integrate multiple data sources into physical and statistical models and be run these models in real time. A geospatial data platform called Physical Analytics Information and Services (PAIRS) is developed on top of open source hardware and software stack to manage Terabyte of data. A new data interpolation and re gridding is implemented where any geospatial data layers can be associated with a set of global grid where the grid resolutions is doubling for consecutive layers. Each pixel on the PAIRS grid have an index that is a combination of locations and time stamp. The indexing allow quick access to data sets that are part of a global data layers and allowing to retrieve only the data of interest. PAIRS takes advantages of parallel processing framework (Hadoop) in a cloud environment to digest, curate, and analyze the data sets while being very robust and stable. The data is stored on a distributed no-SQL database (Hbase) across multiple server, data upload and retrieval is parallelized where the original analytics task is broken up is smaller areas/volume, analyzed independently, and then reassembled for the original geographical area. The differentiating aspect of PAIRS is the ability to accelerate model development across large geographical regions and spatial resolution ranging from 0.1 m up to hundreds of kilometer. System performance is benchmarked on real time automated data ingestion and retrieval of Modis and Landsat data layers. The data layers are curated for sensor error, verified for correctness, and analyzed statistically to detect local anomalies. Multi-layer query enable PAIRS to filter different data layers based on specific conditions (e.g analyze flooding risk of a property based on topography, soil ability to hold water, and forecasted precipitation) or retrieve information about locations that share similar weather and vegetation patterns during extreme weather events like heat wave.

Control of myogenesis by rodent SINE-containing lncRNAs

PubMed Central

Wang, Jiashi; Gong, Chenguang; Maquat, Lynne E.

2013-01-01

Staufen1-mediated mRNA decay (SMD) degrades mRNAs that harbor a Staufen1-binding site (SBS) in their 3′ untranslated regions (UTRs). Human SBSs can form by intermolecular base-pairing between a 3′ UTR Alu element and an Alu element within a long noncoding RNA (lncRNA) called a ½-sbsRNA. Since Alu elements are confined to primates, it was unclear how SMD occurs in rodents. Here we identify mouse mRNA 3′ UTRs and lncRNAs that contain a B1, B2, B4, or identifier (ID) element. We show that SMD occurs in mouse cells via mRNA–lncRNA base-pairing of partially complementary elements and that mouse ½-sbsRNA (m½-sbsRNA)-triggered SMD regulates C2C12 cell myogenesis. Our findings define new roles for lncRNAs as well as B and ID short interspersed elements (SINEs) in mice that undoubtedly influence many developmental and homeostatic pathways. PMID:23558772

mRNA–mRNA duplexes that auto-elicit Staufen1-mediated mRNA decay

PubMed Central

Gong, Chenguang; Tang, Yalan; Maquat, Lynne E.

2013-01-01

We report a new mechanism by which human mRNAs crosstalk: an Alu element in the 3'-untranslated region (3' UTR) of one mRNA can base-pair with a partially complementary Alu element in the 3' UTR of a different mRNA thereby creating a Staufen1 (STAU1)-binding site (SBS). STAU1 binding to a 3' UTR SBS was previously shown to trigger STAU1-mediated mRNA decay (SMD) by directly recruiting the ATP-dependent RNA helicase UPF1, which is also a key factor in the mechanistically related nonsense-mediated mRNA decay (NMD) pathway. In the case of a 3' UTR SBS created via mRNA–mRNA base-pairing, we show that SMD targets both mRNAs in the duplex provided that both mRNAs are translated. If only one mRNA is translated, then it alone is targeted for SMD. We demonstrate the importance of mRNA–mRNA-triggered SMD to the processes of cell migration and invasion. PMID:24056942

Human immunodeficiency virus type 1 LTR TATA and TAR region sequences required for transcriptional regulation.

PubMed Central

Garcia, J A; Harrich, D; Soultanakis, E; Wu, F; Mitsuyasu, R; Gaynor, R B

1989-01-01

The human immunodeficiency virus (HIV) type 1 LTR is regulated at the transcriptional level by both cellular and viral proteins. Using HeLa cell extracts, multiple regions of the HIV LTR were found to serve as binding sites for cellular proteins. An untranslated region binding protein UBP-1 has been purified and fractions containing this protein bind to both the TAR and TATA regions. To investigate the role of cellular proteins binding to both the TATA and TAR regions and their potential interaction with other HIV DNA binding proteins, oligonucleotide-directed mutagenesis of both these regions was performed followed by DNase I footprinting and transient expression assays. In the TATA region, two direct repeats TC/AAGC/AT/AGCTGC surround the TATA sequence. Mutagenesis of both of these direct repeats or of the TATA sequence interrupted binding over the TATA region on the coding strand, but only a mutation of the TATA sequence affected in vivo assays for tat-activation. In addition to TAR serving as the site of binding of cellular proteins, RNA transcribed from TAR is capable of forming a stable stem-loop structure. To determine the relative importance of DNA binding proteins as compared to secondary structure, oligonucleotide-directed mutations in the TAR region were studied. Local mutations that disrupted either the stem or loop structure were defective in gene expression. However, compensatory mutations which restored base pairing in the stem resulted in complete tat-activation. This indicated a significant role for the stem-loop structure in HIV gene expression. To determine the role of TAR binding proteins, mutations were constructed which extensively changed the primary structure of the TAR region, yet left stem base pairing, stem energy and the loop sequence intact. These mutations resulted in decreased protein binding to TAR DNA and defects in tat-activation, and revealed factor binding specifically to the loop DNA sequence. Further mutagenesis which inverted this stem and loop mutation relative to the HIV LTR mRNA start site resulted in even larger decreases in tat-activation. This suggests that multiple determinants, including protein binding, the loop sequence, and RNA or DNA secondary structure, are important in tat-activation and suggests that tat may interact with cellular proteins binding to DNA to increase HIV gene expression. Images PMID:2721501

Diversity of chloroplast genome among local clones of cocoa (Theobroma cacao, L.) from Central Sulawesi

NASA Astrophysics Data System (ADS)

Suwastika, I. Nengah; Pakawaru, Nurul Aisyah; Rifka, Rahmansyah, Muslimin, Ishizaki, Yoko; Cruz, André Freire; Basri, Zainuddin; Shiina, Takashi

2017-02-01

Chloroplast genomes typically range in size from 120 to 170 kilo base pairs (kb), which relatively conserved among plant species. Recent evaluation on several species, certain unique regions showed high variability which can be utilized in the phylogenetic analysis. Many fragments of coding regions, introns, and intergenic spacers, such as atpB-rbcL, ndhF, rbcL, rpl16, trnH-psbA, trnL-F, trnS-G, etc., have been used for phylogenetic reconstructions at various taxonomic levels. Based on that status, we would like to analysis the diversity of chloroplast genome within species of local cacao (Theobroma cacao L.) from Central Sulawesi. Our recent data showed, there were more than 20 clones from local farming in Central Sulawesi, and it can be detected based on phenotypic and nuclear-genome-based characterization (RAPD- Random Amplified Polymorphic DNA and SSR- Simple Sequences Repeat) markers. In developing DNA marker for this local cacao, here we also included analysis based on the variation of chloroplast genome. At least several regions such as rpl32-TurnL, it can be considered as chloroplast markers on our local clone of cocoa. Furthermore, we could develop phylogenetic analysis in between clones of cocoa.

The Lumbar Artery Perforator Flap: 3-Dimensional Anatomical Study and Clinical Applications.

PubMed

Bissell, Mary Beth; Greenspun, David T; Levine, Josh; Rahal, William; Al-Dhamin, Ammar; AlKhawaji, Ali; Morris, Steven F

2016-10-01

The lumbar region is a potential donor site for perforator-based rotational or free flaps or as a recipient site for free flaps to obtain coverage for deficits in the sacral region. Because of the lack of consensus regarding the microvascular anatomy of this potential flap site, a robust investigation of the anatomy of this region is required. Three-dimensional reconstructions (n = 6) of the microvasculature of the lumbar region were generated using MIMICS software (Materialise, Belgium) for each of the four paired lumbar vessels. Diameter, course, and pedicle length were recorded for all lumbar artery (LA) perforators. Statistical analysis was performed using SigmaStat 4.0 and graphs were generated using GraphPad Prism 6 Software. Perforators arising from the first pair of LAs are reliably detected along the inferior margin of the 12th rib, extending inferiorly and laterally from the midline while perforators arising from the fourth pair of LA perforate the fascia along a horizontal plane connecting the posterior iliac crests. There are significantly more cutaneous perforators arising from the first (L1) and fourth (L4) pairs of LA than from the second (L2) and third (L3) (mean ± SD: L1, 5.5 ± 1.2; L2, 1.4 ± 0.7; L3, 1.3 ± 0.7; L4, 4.8 ± 1.0; P < 0.05). The average perforator diameter arising from L1 is greater than those arising from L4 (diameter ± SD: L1, 1.2 mm ± 0.2 >L4, 0.8 mm ± 0.2; P < 0.0001). L1 and L4 perforators have longer pedicle lengths than those arising from L2 and L3 (length ± SD: L1, 98.2 mm ± 57.8; L4, 106.1 mm ± 23.3 >L2, 67.5 mm ± 27.4; L3, 78.5 mm ± 30.3; P < 0.05). Perforators arising from the first and fourth LAs arise in a predictable fashion, have adequate pedicle lengths, and are of suitable diameter to support a perforator flap. We present a case to support the potential use of this flap for microvascular breast reconstruction.

Comparison of clinical knowledge bases for summarization of electronic health records.

PubMed

McCoy, Allison B; Sittig, Dean F; Wright, Adam

2013-01-01

Automated summarization tools that create condition-specific displays may improve clinician efficiency. These tools require new kinds of knowledge that is difficult to obtain. We compared five problem-medication pair knowledge bases generated using four previously described knowledge base development approaches. The number of pairs in the resulting mapped knowledge bases varied widely due to differing mapping techniques from the source terminologies, ranging from 2,873 to 63,977,738 pairs. The number of overlapping pairs across knowledge bases was low, with one knowledge base having half of the pairs overlapping with another knowledge base, and most having less than a third overlapping. Further research is necessary to better evaluate the knowledge bases independently in additional settings, and to identify methods to integrate the knowledge bases.

Functional Effects of Genetic Polymorphisms in the N-acetyltransferase 1 Coding and 3′ Untranslated Regions

PubMed Central

Zhu, Yuanqi; States, J. Christopher; Wang, Yang; Hein, David W.

2011-01-01

BACKGROUND The functional effects of N-acetyltransferase 1 (NAT1) polymorphisms and haplotypes are poorly understood, compromising the validity of associations reported with diseases including birth defects and numerous cancers. METHODS We investigated the effects of genetic polymorphisms within the NAT1 coding region and the 3′-untranslated region (3′-UTR) and their associated haplotypes on N- and O-acetyltransferase catalytic activities, and NAT1 mRNA and protein levels following recombinant expression in COS-1 cells. RESULTS 1088T>A (rs1057126; 3′-UTR) and 1095C>A (rs15561; 3′-UTR) each slightly reduced NAT1 catalytic activity and NAT1 mRNA and protein levels. A 9-base pair (TAATAATAA) deletion between nucleotides 1065-1090 (3′-UTR) reduced NAT1 catalytic activity and NAT1 mRNA and protein levels. In contrast, a 445G>A (rs4987076; V149I), 459G>A (rs4986990; T153T), 640T>G (rs4986783; S214A) coding region haplotype present in NAT1*11 increased NAT1 catalytic activity and NAT1 protein, but not NAT1 mRNA levels. A combination of the 9-base pair (TAATAATAA) deletion and the 445G>A, 459G>A, 640T>G coding region haplotypes, both present in NAT1*11, appeared to neutralize the opposing effects on NAT1 protein and catalytic activity, resulting in levels of NAT1 protein and catalytic activity that did not differ significantly from the NAT1*4 reference. CONCLUSIONS Since 1095C>A (3′-UTR) is the sole polymorphism present in NAT1*3, our data suggests that NAT1*3 is not functionally equivalent to the NAT1*4 reference. Furthermore, our findings provide biological support for reported associations of 1088T>A and 1095C>A polymorphisms with birth defects. PMID:21290563

The DEAH-box helicase Dhr1 dissociates U3 from the pre-rRNA to promote formation of the central pseudoknot.

PubMed

Sardana, Richa; Liu, Xin; Granneman, Sander; Zhu, Jieyi; Gill, Michael; Papoulas, Ophelia; Marcotte, Edward M; Tollervey, David; Correll, Carl C; Johnson, Arlen W

2015-02-01

In eukaryotes, the highly conserved U3 small nucleolar RNA (snoRNA) base-pairs to multiple sites in the pre-ribosomal RNA (pre-rRNA) to promote early cleavage and folding events. Binding of the U3 box A region to the pre-rRNA is mutually exclusive with folding of the central pseudoknot (CPK), a universally conserved rRNA structure of the small ribosomal subunit essential for protein synthesis. Here, we report that the DEAH-box helicase Dhr1 (Ecm16) is responsible for displacing U3. An active site mutant of Dhr1 blocked release of U3 from the pre-ribosome, thereby trapping a pre-40S particle. This particle had not yet achieved its mature structure because it contained U3, pre-rRNA, and a number of early-acting ribosome synthesis factors but noticeably lacked ribosomal proteins (r-proteins) that surround the CPK. Dhr1 was cross-linked in vivo to the pre-rRNA and to U3 sequences flanking regions that base-pair to the pre-rRNA including those that form the CPK. Point mutations in the box A region of U3 suppressed a cold-sensitive mutation of Dhr1, strongly indicating that U3 is an in vivo substrate of Dhr1. To support the conclusions derived from in vivo analysis we showed that Dhr1 unwinds U3-18S duplexes in vitro by using a mechanism reminiscent of DEAD box proteins.

The DEAH-box Helicase Dhr1 Dissociates U3 from the Pre-rRNA to Promote Formation of the Central Pseudoknot

PubMed Central

Granneman, Sander; Zhu, Jieyi; Gill, Michael; Papoulas, Ophelia; Marcotte, Edward M.; Tollervey, David; Correll, Carl C.; Johnson, Arlen W.

2015-01-01

In eukaryotes, the highly conserved U3 small nucleolar RNA (snoRNA) base-pairs to multiple sites in the pre-ribosomal RNA (pre-rRNA) to promote early cleavage and folding events. Binding of the U3 box A region to the pre-rRNA is mutually exclusive with folding of the central pseudoknot (CPK), a universally conserved rRNA structure of the small ribosomal subunit essential for protein synthesis. Here, we report that the DEAH-box helicase Dhr1 (Ecm16) is responsible for displacing U3. An active site mutant of Dhr1 blocked release of U3 from the pre-ribosome, thereby trapping a pre-40S particle. This particle had not yet achieved its mature structure because it contained U3, pre-rRNA, and a number of early-acting ribosome synthesis factors but noticeably lacked ribosomal proteins (r-proteins) that surround the CPK. Dhr1 was cross-linked in vivo to the pre-rRNA and to U3 sequences flanking regions that base-pair to the pre-rRNA including those that form the CPK. Point mutations in the box A region of U3 suppressed a cold-sensitive mutation of Dhr1, strongly indicating that U3 is an in vivo substrate of Dhr1. To support the conclusions derived from in vivo analysis we showed that Dhr1 unwinds U3-18S duplexes in vitro by using a mechanism reminiscent of DEAD box proteins. PMID:25710520

Electrodynamic parameters in the nighttime sector during auroral substorms

NASA Technical Reports Server (NTRS)

Fujii, R.; Hoffman, R. A.; Anderson, P. C.; Craven, J. D.; Sugiura, M.; Frank, L. A.; Maynard, N. C.

1994-01-01

The characteristics of the large-scale electrodynamic parameters, field-aligned currents (FACs), electric fields, and electron precipitation, which are associated with auroral substorm events in the nighttime sector, have been obtained through a unique analysis which places the ionospheric measurements of these parameters into the context of a generic substorm determined from global auroral images. A generic bulge-type auroral emission region has been deduced from auroral images taken by the Dynamics Explorer 1 (DE 1) satellite during a number of isolated substorms, and the form has been divided into six sectors, based on the peculiar emission characteristics in each sector: west of bulge, surge horn, surge, middle surge, eastern bulge, and east of bulge. By comparing the location of passes of the Dynamics Explorer 2 (DE 2) satellite to the simultaneously obtained auroral images, each pass is placed onto the generic aurora. The organization of DE 2 data in this way has systematically clarified peculiar characteristics in the electrodynamic parameters. An upward net current mainly appears in the surge, with little net current in the surge horn and the west of bulge. The downward net current is distributed over wide longitudinal regions from the eastern bulge to the east of bulge. Near the poleward boundary of the expanding auroral bulge, a pair of oppositely directed FAC sheets is observed, with the downward FAC on the poleward side. This downward FAC and most of the upward FAC in the surge and the middle surge are assoc iated with narrow, intense antisunwqard convection, corresponding to an equatorward directed spikelike electric field. This pair of currents decreases in amplitude and latitudinal width toward dusk in the surge and the west of bulge, and the region 1 and 2 FACs become embedded in the sunward convection region. The upward FAC region associated with the spikelike field on the poleward edge of the bulge coincides well with intense electron precipitation and aurora appearing in this western and poleward protion of the bulge. The convection reversal is sharp in the west of bulge and surge horn sectors, and near the high-latitude boundary of the upward region 1, with a near stagnation region often extending over a large interval of latitude. In the eastern bulge and east of bulge sectors, the region 1 and 2 FACs are located in the sunward convection region, while a spikelike electric field occasionally appears poleward of the aurora but usually not associated with a pair of FAC sheets. In the eastern bulge, magnetic field data show complicated FAC distributions which correspond to current segments and filamentary currents.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Okutsu, N.; Shimamura, K.; Shimizu, E.

To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH{sub 2} group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH{sub 2} group of G-Cmore » base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes.« less

Using multi-level Bayesian lesion-symptom mapping to probe the body-part-specificity of gesture imitation skills.

PubMed

Achilles, Elisabeth I S; Weiss, Peter H; Fink, Gereon R; Binder, Ellen; Price, Cathy J; Hope, Thomas M H

2017-11-01

Past attempts to identify the neural substrates of hand and finger imitation skills in the left hemisphere of the brain have yielded inconsistent results. Here, we analyse those associations in a large sample of 257 left hemisphere stroke patients. By introducing novel Bayesian methods, we characterise lesion symptom associations at three levels: the voxel-level, the single-region level (using anatomically defined regions), and the region-pair level. The results are inconsistent across those three levels and we argue that each level of analysis makes assumptions which constrain the results it can produce. Regardless of the inconsistencies across levels, and contrary to past studies which implicated differential neural substrates for hand and finger imitation, we find no consistent voxels or regions, where damage affects one imitation skill and not the other, at any of the three analysis levels. Our novel Bayesian approach indicates that any apparent differences appear to be driven by an increased sensitivity of hand imitation skills to lesions that also impair finger imitation. In our analyses, the results of the highest level of analysis (region-pairs) emphasise a role of the primary somatosensory and motor cortices, and the occipital lobe in imitation. We argue that this emphasis supports an account of both imitation tasks based on direct sensor-motor connections, which throws doubt on past accounts which imply the need for an intermediate (e.g. body-part-coding) system of representation. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

Optimizing digital elevation models (DEMs) accuracy for planning and design of mobile communication networks

NASA Astrophysics Data System (ADS)

Hassan, Mahmoud A.

2004-02-01

Digital elevation models (DEMs) are important tools in the planning, design and maintenance of mobile communication networks. This research paper proposes a method for generating high accuracy DEMs based on SPOT satellite 1A stereo pair images, ground control points (GCP) and Erdas OrthoBASE Pro image processing software. DEMs with 0.2911 m mean error were achieved for the hilly and heavily populated city of Amman. The generated DEM was used to design a mobile communication network resulted in a minimum number of radio base transceiver stations, maximum number of covered regions and less than 2% of dead zones.

Molecular cytogenetic map of the central bearded dragon, Pogona vitticeps (Squamata: Agamidae).

PubMed

Young, M J; O'Meally, D; Sarre, S D; Georges, A; Ezaz, T

2013-07-01

Reptiles, as the sister group to birds and mammals, are particularly valuable for comparative genomic studies among amniotes. The Australian central bearded dragon (Pogona vitticeps) is being developed as a reptilian model for such comparisons, with whole-genome sequencing near completion. The karyotype consists of 6 pairs of macrochromosomes and 10 pairs microchromosomes (2n = 32), including a female heterogametic ZW sex microchromosome pair. Here, we present a molecular cytogenetic map for P. vitticeps comprising 87 anchor bacterial artificial chromosome clones that together span each macro- and microchromosome. It is the first comprehensive cytogenetic map for any non-avian reptile. We identified an active nucleolus organizer region (NOR) on the sub-telomeric region of 2q by mapping 18S rDNA and Ag-NOR staining. We identified interstitial telomeric sequences in two microchromosome pairs and the W chromosome, indicating that microchromosome fusion has been a mechanism of karyotypic evolution in Australian agamids within the last 21 to 19 million years. Orthology searches against the chicken genome revealed an intrachromosomal rearrangement of P. vitticeps 1q, identified regions orthologous to chicken Z on P. vitticeps 2q, snake Z on P. vitticeps 6q and the autosomal microchromosome pair in P. vitticeps orthologous to turtle Pelodiscus sinensis ZW and lizard Anolis carolinensis XY. This cytogenetic map will be a valuable reference tool for future gene mapping studies and will provide the framework for the work currently underway to physically anchor genome sequences to chromosomes for this model Australian squamate.

Large-scale sequence and structural comparisons of human naive and antigen-experienced antibody repertoires.

PubMed

DeKosky, Brandon J; Lungu, Oana I; Park, Daechan; Johnson, Erik L; Charab, Wissam; Chrysostomou, Constantine; Kuroda, Daisuke; Ellington, Andrew D; Ippolito, Gregory C; Gray, Jeffrey J; Georgiou, George

2016-05-10

Elucidating how antigen exposure and selection shape the human antibody repertoire is fundamental to our understanding of B-cell immunity. We sequenced the paired heavy- and light-chain variable regions (VH and VL, respectively) from large populations of single B cells combined with computational modeling of antibody structures to evaluate sequence and structural features of human antibody repertoires at unprecedented depth. Analysis of a dataset comprising 55,000 antibody clusters from CD19(+)CD20(+)CD27(-) IgM-naive B cells, >120,000 antibody clusters from CD19(+)CD20(+)CD27(+) antigen-experienced B cells, and >2,000 RosettaAntibody-predicted structural models across three healthy donors led to a number of key findings: (i) VH and VL gene sequences pair in a combinatorial fashion without detectable pairing restrictions at the population level; (ii) certain VH:VL gene pairs were significantly enriched or depleted in the antigen-experienced repertoire relative to the naive repertoire; (iii) antigen selection increased antibody paratope net charge and solvent-accessible surface area; and (iv) public heavy-chain third complementarity-determining region (CDR-H3) antibodies in the antigen-experienced repertoire showed signs of convergent paired light-chain genetic signatures, including shared light-chain third complementarity-determining region (CDR-L3) amino acid sequences and/or Vκ,λ-Jκ,λ genes. The data reported here address several longstanding questions regarding antibody repertoire selection and development and provide a benchmark for future repertoire-scale analyses of antibody responses to vaccination and disease.

Hybrid region merging method for segmentation of high-resolution remote sensing images

NASA Astrophysics Data System (ADS)

Zhang, Xueliang; Xiao, Pengfeng; Feng, Xuezhi; Wang, Jiangeng; Wang, Zuo

2014-12-01

Image segmentation remains a challenging problem for object-based image analysis. In this paper, a hybrid region merging (HRM) method is proposed to segment high-resolution remote sensing images. HRM integrates the advantages of global-oriented and local-oriented region merging strategies into a unified framework. The globally most-similar pair of regions is used to determine the starting point of a growing region, which provides an elegant way to avoid the problem of starting point assignment and to enhance the optimization ability for local-oriented region merging. During the region growing procedure, the merging iterations are constrained within the local vicinity, so that the segmentation is accelerated and can reflect the local context, as compared with the global-oriented method. A set of high-resolution remote sensing images is used to test the effectiveness of the HRM method, and three region-based remote sensing image segmentation methods are adopted for comparison, including the hierarchical stepwise optimization (HSWO) method, the local-mutual best region merging (LMM) method, and the multiresolution segmentation (MRS) method embedded in eCognition Developer software. Both the supervised evaluation and visual assessment show that HRM performs better than HSWO and LMM by combining both their advantages. The segmentation results of HRM and MRS are visually comparable, but HRM can describe objects as single regions better than MRS, and the supervised and unsupervised evaluation results further prove the superiority of HRM.

The timing of associative memory formation: frontal lobe and anterior medial temporal lobe activity at associative binding predicts memory

PubMed Central

Hales, J. B.

2011-01-01

The process of associating items encountered over time and across variable time delays is fundamental for creating memories in daily life, such as for stories and episodes. Forming associative memory for temporally discontiguous items involves medial temporal lobe structures and additional neocortical processing regions, including prefrontal cortex, parietal lobe, and lateral occipital regions. However, most prior memory studies, using concurrently presented stimuli, have failed to examine the temporal aspect of successful associative memory formation to identify when activity in these brain regions is predictive of associative memory formation. In the current study, functional MRI data were acquired while subjects were shown pairs of sequentially presented visual images with a fixed interitem delay within pairs. This design allowed the entire time course of the trial to be analyzed, starting from onset of the first item, across the 5.5-s delay period, and through offset of the second item. Subjects then completed a postscan recognition test for the items and associations they encoded during the scan and their confidence for each. After controlling for item-memory strength, we isolated brain regions selectively involved in associative encoding. Consistent with prior findings, increased regional activity predicting subsequent associative memory success was found in anterior medial temporal lobe regions of left perirhinal and entorhinal cortices and in left prefrontal cortex and lateral occipital regions. The temporal separation within each pair, however, allowed extension of these findings by isolating the timing of regional involvement, showing that increased response in these regions occurs during binding but not during maintenance. PMID:21248058

Functionally segregated neural substrates for arbitrary audiovisual paired-association learning.

PubMed

Tanabe, Hiroki C; Honda, Manabu; Sadato, Norihiro

2005-07-06

To clarify the neural substrates and their dynamics during crossmodal association learning, we conducted functional magnetic resonance imaging (MRI) during audiovisual paired-association learning of delayed matching-to-sample tasks. Thirty subjects were involved in the study; 15 performed an audiovisual paired-association learning task, and the remainder completed a control visuo-visual task. Each trial consisted of the successive presentation of a pair of stimuli. Subjects were asked to identify predefined audiovisual or visuo-visual pairs by trial and error. Feedback for each trial was given regardless of whether the response was correct or incorrect. During the delay period, several areas showed an increase in the MRI signal as learning proceeded: crossmodal activity increased in unimodal areas corresponding to visual or auditory areas, and polymodal responses increased in the occipitotemporal junction and parahippocampal gyrus. This pattern was not observed in the visuo-visual intramodal paired-association learning task, suggesting that crossmodal associations might be formed by binding unimodal sensory areas via polymodal regions. In both the audiovisual and visuo-visual tasks, the MRI signal in the superior temporal sulcus (STS) in response to the second stimulus and feedback peaked during the early phase of learning and then decreased, indicating that the STS might be key to the creation of paired associations, regardless of stimulus type. In contrast to the activity changes in the regions discussed above, there was constant activity in the frontoparietal circuit during the delay period in both tasks, implying that the neural substrates for the formation and storage of paired associates are distinct from working memory circuits.

Recognition of Watson-Crick base pairs: constraints and limits due to geometric selection and tautomerism

PubMed Central

Yusupov, Marat; Yusupova, Gulnara

2014-01-01

The natural bases of nucleic acids have a strong preference for one tautomer form, guaranteeing fidelity in their hydrogen bonding potential. However, base pairs observed in recent crystal structures of polymerases and ribosomes are best explained by an alternative base tautomer, leading to the formation of base pairs with Watson-Crick-like geometries. These observations set limits to geometric selection in molecular recognition of complementary Watson-Crick pairs for fidelity in replication and translation processes. PMID:24765524

Urban growth in American cities : glimpses of U.S. urbanization

USGS Publications Warehouse

Auch, Roger; Taylor, Janis; Acevedo, William

2004-01-01

The Earth's surface is changing rapidly. Changes are local, regional, national, and even global in scope. Some changes have natural causes, such as earthquakes or drought. Other changes, such as urban expansion, agricultural intensification, resource extraction, and water resources development, are examples of human-induced change that have significant impact upon people, the economy, and resources. The consequences that result from these changes are often dramatic and widespread (Buchanan, Acevedo, and Zirbes, 2002)It is the role of the U.S. Geological Survey (USGS) to provide useful and relevant scientific information both to the agencies within the Department of the Interior and to the Nation in general. In an effort to comply with this task, USGS scientists are assessing the status of, and the trends in, the Nation's land surface. This assessment provides useful information for regional and national land use decisionmaking. This knowledge can be used to deal with issues of significance to the Nation, such as quality-of-life, ecology of urban environments, ecosystem health, ecological integrity, water quality and quantity concerns, resource availability, vulnerability to natural hazards, safeguards to human health, air and land quality, and accessibility to scientific information. Results of these assessments can also be analyzed to reveal rates and trends in land use change. Results from urban growth studies provide a firm foundation for continuing research that explores the consequences of human modification of the landscape.The USGS seeks to illustrate and explain the spatial history of urban growth and corresponding land use change. Scientists are studying urban environments from a regional perspective and a time scale of decades to measure the changes that have occurred in order to help understand the impact of anticipated changes in the future.Within this booklet are pairs of images of selected urbanized regions from across the Nation. These image pairs illustrate the transformation that these areas have undergone over two decades. Specifically, they depict changes in the extent of urban land. Each change pair is composed of one image from the 1970s and one image from the 1990s. Accompanying each image pair is a brief historical geography of factors that helped facilitate major changes that have occurred since the founding of the main city and the consequences and challenges of regional urban growth. The goal of this publication is to provide an illustration of urban change that is easily understood by a broad audience.The images used throughout this booklet were generated from land cover data developed by the USGS. The data sources include the Geographic Information Retrieval and Analysis System (GIRAS) for the 1970s images and the National Land Cover Dataset (NLCD) for the 1990s images. GIRAS digital maps are based on photointerpretations completed in the mid-1970s. The NLCD is a land cover dataset for the conterminous United States based on 1992 Landsat thematic mapper (TM) satellite imagery and supplemental data (fig. 1a and fig. 1b). The USGS distributes both of these land use and land cover digital datasets.The images were developed by using a geographic information system (GIS). The GIRAS and NLCD datasets were used to identify urban land within each region. In the final images all urban areas are shown in red. A shaded-relief map of each region was used to display the topographic context of the red polygon coverage. For all of these images, urban land is defined as areas transformed into a built-up environment for human use. It includes residential areas, commercial and industrial developments, transportation features, and institutions.

Gene regulatory network analysis reveals differences in site-specific cell fate determination in mammalian brain

PubMed Central

Ertaylan, Gökhan; Okawa, Satoshi; Schwamborn, Jens C.; del Sol, Antonio

2014-01-01

Neurogenesis—the generation of new neurons—is an ongoing process that persists in the adult mammalian brain of several species, including humans. In this work we analyze two discrete brain regions: the subventricular zone (SVZ) lining the walls of the lateral ventricles; and the subgranular zone (SGZ) of the dentate gyrus (DG) of the hippocampus in mice and shed light on the SVZ and SGZ specific neurogenesis. We propose a computational model that relies on the construction and analysis of region specific gene regulatory networks (GRNs) from the publicly available data on these two regions. Using this model a number of putative factors involved in neuronal stem cell (NSC) identity and maintenance were identified. We also demonstrate potential gender and niche-derived differences based on cell surface and nuclear receptors via Ar, Hif1a, and Nr3c1. We have also conducted cell fate determinant analysis for SVZ NSC populations to Olfactory Bulb interneurons and SGZ NSC populations to the granule cells of the Granular Cell Layer. We report 31 candidate cell fate determinant gene pairs, ready to be validated. We focus on Ar—Pax6 in SVZ and Sox2—Ncor1 in SGZ. Both pairs are expressed and localized in the suggested anatomical structures as shown by in situ hybridization and found to physically interact. Finally, we conclude that there are fundamental differences between SGZ and SVZ neurogenesis. We argue that these regulatory mechanisms are linked to the observed differential neurogenic potential of these regions. The presence of nuclear and cell surface receptors in the region specific regulatory circuits indicate the significance of niche derived extracellular factors, hormones and region specific factors such as the oxygen sensitivity, dictating SGZ and SVZ specific neurogenesis. PMID:25565969

Tunable hybridization of Majorana bound states at the quantum spin Hall edge

NASA Astrophysics Data System (ADS)

Keidel, Felix; Burset, Pablo; Trauzettel, Björn

2018-02-01

Confinement at the helical edge of a topological insulator is possible in the presence of proximity-induced magnetic (F) or superconducting (S) order. The interplay of both phenomena leads to the formation of localized Majorana bound states (MBS) or likewise (under certain resonance conditions) the formation of ordinary Andreev bound states (ABS). We investigate the properties of bound states in junctions composed of alternating regions of F or S barriers. Interestingly, the direction of magnetization in F regions and the relative superconducting phase between S regions can be exploited to hybridize MBS or ABS at will. We show that the local properties of MBS translate into a particular nonlocal superconducting pairing amplitude. Remarkably, the symmetry of the pairing amplitude contains information about the nature of the bound state that it stems from. Hence this symmetry can in principle be used to distinguish MBS from ABS, owing to the strong connection between local density of states and nonlocal pairing in our setup.

Electron-pair-production cross section in the tip region of the positron spectrum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sud, K.K.; Sharma, D.K.

1984-11-01

The radial integrals for electron-pair production in a point Coulomb potential have been expressed by Sud, Sharma, and Sud in terms of the matrix generalization of the GAMMA function. Two new partial differential equations in photon energy satisfied by the matrix GAMMA function are obtained. We have obtained, on integrating the partial differential equations, accurate radial integrals as a function of photon energy for the pair production by intermediate-energy photons. The cross section in the tip region of the spectrum are calculated for photons of energy 5.0 to 10.0 MeV for /sup 92/U. The new technique results in extensive savingmore » in computer time as the basic radial integrals in terms of the hypergeometric function F/sub 2/ are computed at one photon energy for each pair of partial waves. The results of our calculations are compared with plane-wave Born-approximation results and with the calculations of Dugne and of Deck, Moroi, and Alling.« less

Plasmid origin of replication of herpesvirus papio: DNA sequence and enhancer function.

PubMed Central

Loeb, D D; Sung, N S; Pesano, R L; Sexton, C J; Hutchison, C; Pagano, J S

1990-01-01

Herpesvirus papio (HVP) is a lymphotropic virus of baboons which is related to Epstein-Barr virus (EBV) and produces latent infection. The nucleotide sequence of the 5,775-base-pair (bp) EcoRI K fragment of HVP, which has previously been shown to confer the ability to replicate autonomously, has been determined. Within this DNA fragment is a region which bears structural and sequence similarity to the ori-P region of EBV. The HVP ori-P region has a 10- by 26-bp tandem array which is related to the 20- by 30-bp tandem array from the EBV ori-P region. In HVP there is an intervening region of 764 bp followed by five partial copies of the 26-bp monomer. Both the EBV and HVP 3' regions have the potential to form dyad structures which, however, differ in arrangement. We also demonstrate that a transcriptional enhancer which requires transactivation by a virus-encoded factor is present in the HVP ori-P. Images PMID:2159548

A software to measure phase-velocity dispersion from ambient-noise correlations and its application to the SNSN data

NASA Astrophysics Data System (ADS)

Sadeghisorkhani, Hamzeh; Gudmundsson, Ólafur

2017-04-01

Graphical software for phase-velocity dispersion measurements of surface waves in noise-correlation traces, called GSpecDisp, is presented. It is an interactive environment for the measurements and presentation of the results. It measures phase-velocity dispersion curves in the frequency domain based on matching of the real part of the cross-correlation spectrum with the appropriate Bessel function. The inputs are time-domain cross-correlations in SAC format. It can measure two types of phase-velocity dispersion curves; 1- average phase-velocity of a region, and 2- single-pair phase velocity. The average phase-velocity dispersion curve of a region can be used as a reference curve to automatically select the dispersion curves from each single-pair cross-correlation in that region. It also allows the users to manually refine the selections. Therefore, no prior knowledge is needed for an unknown region. GSpecDisp can measure the phase velocity of Rayleigh and Love waves from all possible components of the noise correlation tensor, including diagonal and off-diagonal components of the tensor. First, we explain how GSpecDisp is applied to measure phase-velocity dispersion curves. Then, we demonstrate measurement results on synthetic and real data from the Swedish National Seismic Network (SNSN). We compare the results with two other methods of phase-velocity dispersion measurements. Finally, we compare phase-velocity dispersion curves of Rayleigh waves obtained from different components of the correlation tensor.

Hexon based PCRs combined with restriction enzyme analysis for rapid detection and differentiation of fowl adenoviruses and egg drop syndrome virus.

PubMed

Raue, R; Hess, M

1998-08-01

Three different polymerase chain reactions (PCRs), two of them combined with restriction enzyme analysis (REA), were developed for detection and differentiation of all 12 fowl adenovirus (FAV) serotypes and the egg drop syndrome (EDS) virus. For primer construction FAV1, FAV10 and EDS virus hexon proteins were aligned and conserved and variable regions were determined. Two primer sets (H1/H2 and H3/H4) for single use were constructed which hybridize in three conserved regions of hexon genes. Each primer pair amplifies approximately half of the hexon gene including two loop regions. An amplification product was detected with both primer sets using purified DNA from all FAV1-12 reference strains. Viral EDS DNA was negative using the H1/H2 or H3/H4 primer pair. HaeII digestion of the H1/H2 amplification products differentiates between all viruses except FAV4 and FAV5. In comparison, much more clustering among genomic closely related FAV serotypes was seen after HpaII digestion of the H3/H4 PCR products. Oligonucleotides H5/H6 located in the variable regions of EDS virus hexon gene do not detect any of the FAV serotypes. The PCRs and REA described are suitable to detect all avian adenoviruses infecting chickens, to distinguish all 12 FAV reference strains and to differentiate FAVs from the EDS virus.

FISHtrees 3.0: Tumor Phylogenetics Using a Ploidy Probe.

PubMed

Gertz, E Michael; Chowdhury, Salim Akhter; Lee, Woei-Jyh; Wangsa, Darawalee; Heselmeyer-Haddad, Kerstin; Ried, Thomas; Schwartz, Russell; Schäffer, Alejandro A

2016-01-01

Advances in fluorescence in situ hybridization (FISH) make it feasible to detect multiple copy-number changes in hundreds of cells of solid tumors. Studies using FISH, sequencing, and other technologies have revealed substantial intra-tumor heterogeneity. The evolution of subclones in tumors may be modeled by phylogenies. Tumors often harbor aneuploid or polyploid cell populations. Using a FISH probe to estimate changes in ploidy can guide the creation of trees that model changes in ploidy and individual gene copy-number variations. We present FISHtrees 3.0, which implements a ploidy-based tree building method based on mixed integer linear programming (MILP). The ploidy-based modeling in FISHtrees includes a new formulation of the problem of merging trees for changes of a single gene into trees modeling changes in multiple genes and the ploidy. When multiple samples are collected from each patient, varying over time or tumor regions, it is useful to evaluate similarities in tumor progression among the samples. Therefore, we further implemented in FISHtrees 3.0 a new method to build consensus graphs for multiple samples. We validate FISHtrees 3.0 on a simulated data and on FISH data from paired cases of cervical primary and metastatic tumors and on paired breast ductal carcinoma in situ (DCIS) and invasive ductal carcinoma (IDC). Tests on simulated data show improved accuracy of the ploidy-based approach relative to prior ploidyless methods. Tests on real data further demonstrate novel insights these methods offer into tumor progression processes. Trees for DCIS samples are significantly less complex than trees for paired IDC samples. Consensus graphs show substantial divergence among most paired samples from both sets. Low consensus between DCIS and IDC trees may help explain the difficulty in finding biomarkers that predict which DCIS cases are at most risk to progress to IDC. The FISHtrees software is available at ftp://ftp.ncbi.nih.gov/pub/FISHtrees.

FISHtrees 3.0: Tumor Phylogenetics Using a Ploidy Probe

PubMed Central

Chowdhury, Salim Akhter; Lee, Woei-Jyh; Wangsa, Darawalee; Heselmeyer-Haddad, Kerstin; Ried, Thomas; Schwartz, Russell; Schäffer, Alejandro A.

2016-01-01

Advances in fluorescence in situ hybridization (FISH) make it feasible to detect multiple copy-number changes in hundreds of cells of solid tumors. Studies using FISH, sequencing, and other technologies have revealed substantial intra-tumor heterogeneity. The evolution of subclones in tumors may be modeled by phylogenies. Tumors often harbor aneuploid or polyploid cell populations. Using a FISH probe to estimate changes in ploidy can guide the creation of trees that model changes in ploidy and individual gene copy-number variations. We present FISHtrees 3.0, which implements a ploidy-based tree building method based on mixed integer linear programming (MILP). The ploidy-based modeling in FISHtrees includes a new formulation of the problem of merging trees for changes of a single gene into trees modeling changes in multiple genes and the ploidy. When multiple samples are collected from each patient, varying over time or tumor regions, it is useful to evaluate similarities in tumor progression among the samples. Therefore, we further implemented in FISHtrees 3.0 a new method to build consensus graphs for multiple samples. We validate FISHtrees 3.0 on a simulated data and on FISH data from paired cases of cervical primary and metastatic tumors and on paired breast ductal carcinoma in situ (DCIS) and invasive ductal carcinoma (IDC). Tests on simulated data show improved accuracy of the ploidy-based approach relative to prior ploidyless methods. Tests on real data further demonstrate novel insights these methods offer into tumor progression processes. Trees for DCIS samples are significantly less complex than trees for paired IDC samples. Consensus graphs show substantial divergence among most paired samples from both sets. Low consensus between DCIS and IDC trees may help explain the difficulty in finding biomarkers that predict which DCIS cases are at most risk to progress to IDC. The FISHtrees software is available at ftp://ftp.ncbi.nih.gov/pub/FISHtrees. PMID:27362268

Sub-Network Kernels for Measuring Similarity of Brain Connectivity Networks in Disease Diagnosis.

PubMed

Jie, Biao; Liu, Mingxia; Zhang, Daoqiang; Shen, Dinggang

2018-05-01

As a simple representation of interactions among distributed brain regions, brain networks have been widely applied to automated diagnosis of brain diseases, such as Alzheimer's disease (AD) and its early stage, i.e., mild cognitive impairment (MCI). In brain network analysis, a challenging task is how to measure the similarity between a pair of networks. Although many graph kernels (i.e., kernels defined on graphs) have been proposed for measuring the topological similarity of a pair of brain networks, most of them are defined using general graphs, thus ignoring the uniqueness of each node in brain networks. That is, each node in a brain network denotes a particular brain region, which is a specific characteristics of brain networks. Accordingly, in this paper, we construct a novel sub-network kernel for measuring the similarity between a pair of brain networks and then apply it to brain disease classification. Different from current graph kernels, our proposed sub-network kernel not only takes into account the inherent characteristic of brain networks, but also captures multi-level (from local to global) topological properties of nodes in brain networks, which are essential for defining the similarity measure of brain networks. To validate the efficacy of our method, we perform extensive experiments on subjects with baseline functional magnetic resonance imaging data obtained from the Alzheimer's disease neuroimaging initiative database. Experimental results demonstrate that the proposed method outperforms several state-of-the-art graph-based methods in MCI classification.

Population Level Purifying Selection and Gene Expression Shape Subgenome Evolution in Maize.

PubMed

Pophaly, Saurabh D; Tellier, Aurélien

2015-12-01

The maize ancestor experienced a recent whole-genome duplication (WGD) followed by gene erosion which generated two subgenomes, the dominant subgenome (maize1) experiencing fewer deletions than maize2. We take advantage of available extensive polymorphism and gene expression data in maize to study purifying selection and gene expression divergence between WGD retained paralog pairs. We first report a strong correlation in nucleotide diversity between duplicate pairs, except for upstream regions. We then show that maize1 genes are under stronger purifying selection than maize2. WGD retained genes have higher gene dosage and biased Gene Ontologies consistent with previous studies. The relative gene expression of paralogs across tissues demonstrates that 98% of duplicate pairs have either subfunctionalized in a tissuewise manner or have diverged consistently in their expression thereby preventing functional complementation. Tissuewise subfunctionalization seems to be a hallmark of transcription factors, whereas consistent repression occurs for macromolecular complexes. We show that dominant gene expression is a strong determinant of the strength of purifying selection, explaining the inferred stronger negative selection on maize1 genes. We propose a novel expression-based classification of duplicates which is more robust to explain observed polymorphism patterns than the subgenome location. Finally, upstream regions of repressed genes exhibit an enrichment in transposable elements which indicates a possible mechanism for expression divergence. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

The complete chloroplast genome of Sinopodophyllum hexandrum Ying (Berberidaceae).

PubMed

Meng, Lihua; Liu, Ruijuan; Chen, Jianbing; Ding, Chenxu

2017-05-01

The complete nucleotide sequence of the Sinopodophyllum hexandrum Ying chloroplast genome (cpDNA) was determined based on next-generation sequencing technologies in this study. The genome was 157 203 bp in length, containing a pair of inverted repeat (IRa and IRb) regions of 25 960 bp, which were separated by a large single-copy (LSC) region of 87 065 bp and a small single-copy (SSC) region of 18 218 bp, respectively. The cpDNA contained 148 genes, including 96 protein-coding genes, 8 ribosomal RNA genes, and 44 tRNA genes. In these genes, eight harbored a single intron, and two (ycf3 and clpP) contained a couple of introns. The cpDNA AT content of S. hexandrum cpDNA is 61.5%.

F-region neutral winds from ionosonde measurements of h/sub mF2/ at low-latitude magnetic conjugate regions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bittencourt, J.A.

1977-08-01

The behavior of the F2-peak height difference, delta h/sub F2/, between low-latitude magnetic conjugate points, is known to be governed by thermospheric winds blowing along the magnetic meridian. Ground-based ionosonde measurement of h/sub m F2/, at two pairs of magnetic conjugate stations, were analyzed in conjunction with the results of a realistic dynamic computer model of the tropical ionospheric F-region, to determine thermospheric wind velocities. The behavior of monthly average values of the sun, at conjugate points, of the thermospheric horizontal wind velocity component in the magnetic meridian, at low latitudes, is inferred for months of solstice and equinox, asmore » well as for periods of low and high solar activity.« less

High-Spin Structures as the Probes of Proton-Neutron Pairing

NASA Astrophysics Data System (ADS)

Afanasjev, A. V.

Rotating N = Z nuclei in the mass A = 58-80 region have been studied within the framework of isovector mean field theory. Available data is well and systematically described in the calculations. The present study supports the presence of strong isovector np pair field at low spin, which is, however, destroyed at high spin. No clear evidence for the existence of the isoscalar t = 0 np pairing has been found.

Optimal retinal cyst segmentation from OCT images

NASA Astrophysics Data System (ADS)

Oguz, Ipek; Zhang, Li; Abramoff, Michael D.; Sonka, Milan

2016-03-01

Accurate and reproducible segmentation of cysts and fluid-filled regions from retinal OCT images is an important step allowing quantification of the disease status, longitudinal disease progression, and response to therapy in wet-pathology retinal diseases. However, segmentation of fluid-filled regions from OCT images is a challenging task due to their inhomogeneous appearance, the unpredictability of their number, size and location, as well as the intensity profile similarity between such regions and certain healthy tissue types. While machine learning techniques can be beneficial for this task, they require large training datasets and are often over-fitted to the appearance models of specific scanner vendors. We propose a knowledge-based approach that leverages a carefully designed cost function and graph-based segmentation techniques to provide a vendor-independent solution to this problem. We illustrate the results of this approach on two publicly available datasets with a variety of scanner vendors and retinal disease status. Compared to a previous machine-learning based approach, the volume similarity error was dramatically reduced from 81:3+/-56:4% to 22:2+/-21:3% (paired t-test, p << 0:001).

Cross-calibration of the Terra MODIS, Landsat 7 ETM+ and EO-1 ALI sensors using near-simultaneous surface observation over the Railroad Valley Playa, Nevada, test site

USGS Publications Warehouse

Chander, G.; Angal, A.; Choi, T.; Meyer, D.J.; Xiong, X.; Teillet, P.M.

2007-01-01

A cross-calibration methodology has been developed using coincident image pairs from the Terra Moderate Resolution Imaging Spectroradiometer (MODIS), the Landsat 7 (L7) Enhanced Thematic Mapper Plus (ETM+) and the Earth Observing EO-1 Advanced Land Imager (ALI) to verify the absolute radiometric calibration accuracy of these sensors with respect to each other. To quantify the effects due to different spectral responses, the Relative Spectral Responses (RSR) of these sensors were studied and compared by developing a set of "figures-of-merit." Seven cloud-free scenes collected over the Railroad Valley Playa, Nevada (RVPN), test site were used to conduct the cross-calibration study. This cross-calibration approach was based on image statistics from near-simultaneous observations made by different satellite sensors. Homogeneous regions of interest (ROI) were selected in the image pairs, and the mean target statistics were converted to absolute units of at-sensor reflectance. Using these reflectances, a set of cross-calibration equations were developed giving a relative gain and bias between the sensor pair.

Investigation of focused and unfocused transducer beam patterns in moderately nonlinear absorbing media

NASA Astrophysics Data System (ADS)

Kharin, Nikolay A.

2001-05-01

The novel solution of the KZK equation for acoustic pressure of the second harmonic in slightly focused beam of a circular transducer was obtained in a closed form for moderately nonlinear absorbing media (Gol'dberg numbers ~ 1). The solution is based on the method of slowly changing wave profile in combination with the method of successive approximations. Two pairs of transducers (Valpey-Fisher Corp.) Were compared to investigate the influence of focusing on the applicability of the moderate nonlinearity approach. The first pair was of 0.25' diameter and the second was of 0.5' diameter. Both pairs has one transducer with flat surface and the other geometrically focused at 4'. The central frequency for all transducers was 5 MHz. Measurements were undertaken in the blood-mimicking solution of water and glycerine. The results demonstrated that for slightly focused transducers with circular apertures, the moderate nonlinearity approach is still valid, as it was proved for flat sources with the same source level, despite the higher pressures in the focal region. The peak pressure for the weakly focused system occurs at a shorter range than focal length.

Production of W + W - pairs via γ * γ * → W + W - subprocess with photon transverse momenta

NASA Astrophysics Data System (ADS)

Łuszczak, Marta; Schäfer, Wolfgang; Szczurek, Antoni

2018-05-01

We discuss production of W + W - pairs in proton-proton collisions induced by two-photon fusion including, for a first time, transverse momenta of incoming photons. The unintegrated inelastic fluxes (related to proton dissociation) of photons are calculated based on modern parametrizations of deep inelastic structure functions in a broad range of their arguments ( x and Q 2). In our approach we can get separate contributions of different W helicities states. Several one- and two-dimensional differential distributions are shown and discussed. The present results are compared to the results of previous calculations within collinear factorization approach. Similar results are found except of some observables such as e.g. transverse momentum of the pair of W + and W -. We find large contributions to the cross section from the region of large photon virtualities. We show decomposition of the total cross section as well as invariant mass distribution into the polarisation states of both W bosons. The role of the longitudinal F L structure function is quantified. Its inclusion leads to a 4-5% decrease of the cross section, almost independent of M WW .

Opiates and cerebral functional activity in rats

DOE Office of Scientific and Technical Information (OSTI.GOV)

Trusk, T.C.

1986-01-01

Cerebral activity was measured using the free-fatty acid (1-/sup 14/C) octanoate as a fast functional tracer in conscious, unrestrained rats 5 minutes after intravenous injection of heroin, cocaine or saline vehicle. Regional changes of octanoate labeling density in the autoradiograms relative to saline-injected animals were used to determine the functional activity effects of each drug. Heroin and cocaine each produced a distinctive pattern of activity increases and suppression throughout the rat brain. Similar regional changes induced by both drugs were found in limbic brain regions implicated in drug reinforcement. Labeled octanoate autoradiography was used to measure the cerebral functional responsemore » to a tone that had previously been paired to heroin injections. Rats were trained in groups of three consisting of one heroin self-administration animal, and two animals receiving yoked infusion of heroin or saline. A tone was paired with each infusion during training. Behavioral experiments in similarly trained rats demonstrated that these training conditions impart secondary reinforcing properties to the tone in animals previously self-administering heroin, while the tone remains behaviorally neutral in yoked-infusion rats. Cerebral functional activity was measured during presentation of the tone without drug infusion. Octanoate labeling density changed in fifteen brain areas in response to the tone previously paired to heroin without response contingency. Labeling density was significantly modified in sixteen regions as a result of previously pairing the tone to response-contingent heroin infusions.« less

The first large population based twin study of coeliac disease

PubMed Central

Greco, L; Romino, R; Coto, I; Di Cosmo, N; Percopo, S; Maglio, M; Paparo, F; Gasperi, V; Limongelli, M G; Cotichini, R; D'Agate, C; Tinto, N; Sacchetti, L; Tosi, R; Stazi, M A

2002-01-01

Background and aims: The genetic load in coeliac disease has hitherto been inferred from case series or anecdotally referred twin pairs. We have evaluated the genetic component in coeliac disease by estimating the concordance rate for the disease among twin pairs in a large population based study. Methods: The Italian Twin Registry was matched with the membership lists of a patient support group. Forty seven twin pairs were recruited and screened for antiendomysial (EMA) and antihuman-tissue transglutaminase (anti-tTG) antibodies; zygosity was verified by DNA fingerprinting and twins were typed for HLA class II DRB1 and DQB1 molecules. Results: Concordance rates for coeliac disease differ significantly between monozygotic (MZ) (0.86 probandwise and 0.75 pairwise) and dizygotic (DZ) (0.20 probandwise and 0.11 pairwise) twins. This is the highest concordance so far reported for a multifactorial disease. A logistic regression model, adjusted for age, sex, number of shared HLA haplotypes, and zygosity, showed that genotypes DQA1*0501/DQB1*0201 and DQA1*0301/DQB1*0302 (encoding for heterodimers DQ2 and DQ8, respectively) conferred to the non-index twin a risk of contracting the disease of 3.3 and 1.4, respectively. The risk of being concordant for coeliac disease estimated for the non-index twin of MZ pairs was 17 (95% confidence interval 2.1–134), independent of the DQ at risk genotype. Conclusion: This study provides substantial evidence for a very strong genetic component in coeliac disease, which is only partially due to the HLA region. PMID:11950806

Genomewide significant linkage to recurrent, early-onset major depressive disorder on chromosome 15q.

PubMed

Holmans, Peter; Zubenko, George S; Crowe, Raymond R; DePaulo, J Raymond; Scheftner, William A; Weissman, Myrna M; Zubenko, Wendy N; Boutelle, Sandra; Murphy-Eberenz, Kathleen; MacKinnon, Dean; McInnis, Melvin G; Marta, Diana H; Adams, Philip; Knowles, James A; Gladis, Madeleine; Thomas, Jo; Chellis, Jennifer; Miller, Erin; Levinson, Douglas F

2004-06-01

A genome scan was performed on the first phase sample of the Genetics of Recurrent Early-Onset Depression (GenRED) project. The sample consisted of 297 informative families containing 415 independent affected sibling pairs (ASPs), or, counting all possible pairs, 685 informative affected relative pairs (555 ASPs and 130 other pair types). Affected cases had recurrent major depressive disorder (MDD) with onset before age 31 years for probands or age 41 years for other affected relatives; the mean age at onset was 18.5 years, and the mean number of depressive episodes was 7.3. The Center for Inherited Disease Research genotyped 389 microsatellite markers (mean spacing of 9.3 cM). The primary linkage analysis considered allele sharing in all possible affected relative pairs with the use of the Z(lr) statistic computed by the ALLEGRO program. A secondary logistic regression analysis considered the effect of the sex of the pair as a covariate. Genomewide significant linkage was observed on chromosome 15q25.3-26.2 (Zlr=4.14, equivalent LOD = 3.73, empirical genomewide P=.023). The linkage was not sex specific. No other suggestive or significant results were observed in the primary analysis. The secondary analysis produced three regions of suggestive linkage, but these results should be interpreted cautiously because they depended primarily on the small subsample of 42 male-male pairs. Chromosome 15q25.3-26.2 deserves further study as a candidate region for susceptibility to MDD.

A label-free DNA hairpin biosensor for colorimetric detection of target with suitable functional DNA partners.

PubMed

Nie, Ji; Zhang, De-Wen; Tie, Cai; Zhou, Ying-Lin; Zhang, Xin-Xiang

2013-11-15

The combination of aptamer and peroxidase-mimicking DNAzyme within a hairpin structure can form a functional DNA probe. The activities of both aptamer (as biorecognition element) and DNAzyme (as signal amplification element) are blocked via base pairing in the hairpin structure. The presence of target triggers the opening of the hairpin to form target/aptamer complex and releases G-quadruplex sequence which can generate amplified colorimetric signals. In this work, we elaborated a universal and simple procedure to design an efficient and sensitive hairpin probe with suitable functional DNA partners. A fill-in-the-blank process was developed for sequence design, and two key points including the pretreatment of the hairpin probe and the selection of suitable signal transducer sequence were proved to enhance the detection sensitivity. Cocaine was chosen as a model target for a proof of concept. A series of hairpins with different numbers of base pairs in the stem region were prepared. Hairpin-C10 with ten base pairs was screened out and a lowest detectable cocaine concentration of 5 μM by colorimetry was obtained. The proposed functional DNA hairpin showed good selectivity and satisfactory analysis in spiked biologic fluid. The whole "mix-and-measure" detection based on DNA hairpin without the need of immobilization and labeling was indicated to be time and labor saving. The strategy has potential to be transplanted into more smart hairpins toward other targets for general application in bioanalytical chemistry. Copyright © 2013 Elsevier B.V. All rights reserved.

Structure based alignment and clustering of proteins (STRALCP)

DOEpatents

Zemla, Adam T.; Zhou, Carol E.; Smith, Jason R.; Lam, Marisa W.

2013-06-18

Disclosed are computational methods of clustering a set of protein structures based on local and pair-wise global similarity values. Pair-wise local and global similarity values are generated based on pair-wise structural alignments for each protein in the set of protein structures. Initially, the protein structures are clustered based on pair-wise local similarity values. The protein structures are then clustered based on pair-wise global similarity values. For each given cluster both a representative structure and spans of conserved residues are identified. The representative protein structure is used to assign newly-solved protein structures to a group. The spans are used to characterize conservation and assign a "structural footprint" to the cluster.

Pairs of galaxies in low density regions of a combined redshift catalog

NASA Technical Reports Server (NTRS)

Charlton, Jane C.; Salpeter, Edwin E.

1990-01-01

The distributions of projected separations and radial velocity differences of pairs of galaxies in the CfA and Southern Sky Redshift Survey (SSRS) redshift catalogs are examined. The authors focus on pairs that fall in low density environments rather than in clusters or large groups. The projected separation distribution is nearly flat, while uncorrelated galaxies would have given one linearly rising with r sub p. There is no break in this curve even below 50 kpc, the minimum halo size consistent with measured galaxy rotation curves. The significant number of pairs at small separations is inconsistent with the N-body result that galaxies with overlapping halos will rapidly merge, unless there are significant amounts of matter distributed out to a few hundred kpc of the galaxies. This dark matter may either be in distinct halos or more loosely distributed. Large halos would allow pairs at initially large separations to head toward merger, replenishing the distribution at small separations. In the context of this model, the authors estimate that roughly 10 to 25 percent of these low density galaxies are the product of a merger, compared with the elliptical/SO fraction of 18 percent, observed in low density regions of the sample.

The Spectral and Environment Properties of z ∼ 2.0–2.5 Quasar Pairs

NASA Astrophysics Data System (ADS)

Lusso, Elisabeta; Fumagalli, Michele; Rafelski, Marc; Neeleman, Marcel; Prochaska, Jason X.; Hennawi, Joseph F.; O’Meara, John M.; Theuns, Tom

2018-06-01

We present the first results from our survey of intervening and proximate Lyman limit systems (LLSs) at z ∼ 2.0–2.5 using the Wide Field Camera 3 on board the Hubble Space Telescope. The quasars in our sample are projected pairs with proper transverse separations R ⊥ ≤ 150 kpc and line-of-sight velocity separations ≲11,000 km s‑1. We construct a stacked ultraviolet (rest-frame wavelengths 700–2000 Å) spectrum of pairs corrected for the intervening Lyman forest and Lyman continuum absorption. The observed spectral composite presents a moderate flux excess for the most prominent broad emission lines, a ∼30% decrease in flux at λ = 800–900 Å compared to a stack of brighter quasars not in pairs at similar redshifts, and lower values of the mean free path of the H I ionizing radiation for pairs ({λ }mfp}912 = 140.7 ± 20.2 {h}70-1 Mpc) compared to single quasars ({λ }mfp}912 = 213.8 ± 28 {h}70-1 Mpc) at the average redshift z ≃ 2.44. From the modeling of LLS absorption in these pairs, we find a higher (∼20%) incidence of proximate LLSs with log {N}{{H}{{I}}} ≥ 17.2 at δv < 5000 km s‑1 compared to single quasars (∼6%). These two rates are different at the 5σ level. Moreover, we find that optically thick absorbers are equally shared between foreground and background quasars. Based on these pieces of evidence, we conclude that there is a moderate excess of gas-absorbing Lyman continuum photons in our closely projected quasar pairs compared to single quasars. We argue that this gas arises mostly within large-scale structures or partially neutral regions inside the dark matter halos where these close pairs reside.

The complete mitogenome of the river blackfish, Gadopsis marmoratus (Richardson, 1848) (Teleostei: Percichthyidae).

PubMed

Gan, Han Ming; Tan, Mun Hua; Lee, Yin Peng; Austin, Christopher M

2016-05-01

The mitogenome of the Australian freshwater blackfish, Gadopsis marmoratus was recovered coverage by genome skimming using the MiSeq sequencer (GenBank Accession Number: NC_024436). The blackfish mitogenome has 16,407 base pairs made up of 13 protein-coding genes, 2 ribosomal subunit genes, 22 transfer RNAs, and a 819 bp non-coding AT-rich region. This is the 5th mitogenome sequence to be reported for the family Percichthyidae.

The Telecommunications and Data Acquisition

NASA Technical Reports Server (NTRS)

Renzetti, N. A. (Editor)

1981-01-01

Progress in the development and operations of the Deep Space Network is reported including developments in Earth based radio technology as applied to other research programs. These programs include application of radio interferometry at microwave frequencies to geodetic measurements and geodynamics, use of deep space stations individually and in pairs as an interferometer by radio astronomers for astrophysics research by direct observations of radio sources, and radio search for extraterrestrial intelligence in the microwave region of the electromagnetic spectrum.

Design and isolation of ribozyme-substrate pairs using RNase P-based ribozymes containing altered substrate binding sites.

PubMed Central

Mobley, E M; Pan, T

1999-01-01

Substrate recognition and cleavage by the bacterial RNase P RNA requires two domains, a specificity domain, or S-domain, and a catalytic domain, or C-domain. The S-domain binds the T stem-loop region in a pre-tRNA substrate to confer specificity for tRNA substrates. In this work, the entire S-domain of the Bacillus subtilis RNase P RNA is replaced with an artificial substrate binding module. New RNA substrates are isolated by in vitro selection using two libraries containing random regions of 60 nt. At the end of the selection, the cleavage rates of the substrate library are approximately 0.7 min(-1)in 10 mM MgCl(2)at 37 degrees C, approximately 4-fold better than the cleavage of a pre-tRNA substrate by the wild-type RNase P RNA under the same conditions. The contribution of the S-domain replacement to the catalytic efficiency is from 6- to 22 000-fold. Chemical and nuclease mapping of two ribozyme-product complexes shows that this contribution correlates with direct interactions between the S-domain replacement and the selected substrate. These results demonstrate the feasibility of design and isolation of RNase P-based, matching ribozyme-substrate pairs without prior knowledge of the sequence or structure of the interactive modules in the ribozyme or substrate. PMID:10518624

Partial covariance based functional connectivity computation using Ledoit-Wolf covariance regularization.

PubMed

Brier, Matthew R; Mitra, Anish; McCarthy, John E; Ances, Beau M; Snyder, Abraham Z

2015-11-01

Functional connectivity refers to shared signals among brain regions and is typically assessed in a task free state. Functional connectivity commonly is quantified between signal pairs using Pearson correlation. However, resting-state fMRI is a multivariate process exhibiting a complicated covariance structure. Partial covariance assesses the unique variance shared between two brain regions excluding any widely shared variance, hence is appropriate for the analysis of multivariate fMRI datasets. However, calculation of partial covariance requires inversion of the covariance matrix, which, in most functional connectivity studies, is not invertible owing to rank deficiency. Here we apply Ledoit-Wolf shrinkage (L2 regularization) to invert the high dimensional BOLD covariance matrix. We investigate the network organization and brain-state dependence of partial covariance-based functional connectivity. Although RSNs are conventionally defined in terms of shared variance, removal of widely shared variance, surprisingly, improved the separation of RSNs in a spring embedded graphical model. This result suggests that pair-wise unique shared variance plays a heretofore unrecognized role in RSN covariance organization. In addition, application of partial correlation to fMRI data acquired in the eyes open vs. eyes closed states revealed focal changes in uniquely shared variance between the thalamus and visual cortices. This result suggests that partial correlation of resting state BOLD time series reflect functional processes in addition to structural connectivity. Copyright © 2015 Elsevier Inc. All rights reserved.

Partial covariance based functional connectivity computation using Ledoit-Wolf covariance regularization

PubMed Central

Brier, Matthew R.; Mitra, Anish; McCarthy, John E.; Ances, Beau M.; Snyder, Abraham Z.

2015-01-01

Functional connectivity refers to shared signals among brain regions and is typically assessed in a task free state. Functional connectivity commonly is quantified between signal pairs using Pearson correlation. However, resting-state fMRI is a multivariate process exhibiting a complicated covariance structure. Partial covariance assesses the unique variance shared between two brain regions excluding any widely shared variance, hence is appropriate for the analysis of multivariate fMRI datasets. However, calculation of partial covariance requires inversion of the covariance matrix, which, in most functional connectivity studies, is not invertible owing to rank deficiency. Here we apply Ledoit-Wolf shrinkage (L2 regularization) to invert the high dimensional BOLD covariance matrix. We investigate the network organization and brain-state dependence of partial covariance-based functional connectivity. Although RSNs are conventionally defined in terms of shared variance, removal of widely shared variance, surprisingly, improved the separation of RSNs in a spring embedded graphical model. This result suggests that pair-wise unique shared variance plays a heretofore unrecognized role in RSN covariance organization. In addition, application of partial correlation to fMRI data acquired in the eyes open vs. eyes closed states revealed focal changes in uniquely shared variance between the thalamus and visual cortices. This result suggests that partial correlation of resting state BOLD time series reflect functional processes in addition to structural connectivity. PMID:26208872

FLASHFLOOD: A 3D Field-based similarity search and alignment method for flexible molecules

NASA Astrophysics Data System (ADS)

Pitman, Michael C.; Huber, Wolfgang K.; Horn, Hans; Krämer, Andreas; Rice, Julia E.; Swope, William C.

2001-07-01

A three-dimensional field-based similarity search and alignment method for flexible molecules is introduced. The conformational space of a flexible molecule is represented in terms of fragments and torsional angles of allowed conformations. A user-definable property field is used to compute features of fragment pairs. Features are generalizations of CoMMA descriptors (Silverman, B.D. and Platt, D.E., J. Med. Chem., 39 (1996) 2129.) that characterize local regions of the property field by its local moments. The features are invariant under coordinate system transformations. Features taken from a query molecule are used to form alignments with fragment pairs in the database. An assembly algorithm is then used to merge the fragment pairs into full structures, aligned to the query. Key to the method is the use of a context adaptive descriptor scaling procedure as the basis for similarity. This allows the user to tune the weights of the various feature components based on examples relevant to the particular context under investigation. The property fields may range from simple, phenomenological fields, to fields derived from quantum mechanical calculations. We apply the method to the dihydrofolate/methotrexate benchmark system, and show that when one injects relevant contextual information into the descriptor scaling procedure, better results are obtained more efficiently. We also show how the method works and include computer times for a query from a database that represents approximately 23 million conformers of seventeen flexible molecules.

Microchromosome polymorphism in the sand lizard, Lacerta agilis Linnaeus, 1758 (Reptilia, Squamata)

PubMed Central

Lisachov, Artem P.; Borodin, Pavel M.

2016-01-01

Abstract Most true lizards (Lacertidae) share a conservative karyotype, consisting of 18 pairs of macrochromosomes and one microchromosome pair. Homeologues of the microchromosome are present in other squamates and even in chickens. No structural autosomal microchromosome polymorphisms have been described previously in lizards. We found homozygous and heterozygous carriers of a microchromosome variant in a Siberian population of the sand lizard, Lacerta agilis Linnaeus, 1758. The variant microchromosome was almost twice as long as the standard one. In heterozygotes at pachytene, the microchromosomes firstly pair in proximal regions and the central part of the longer axial element undergoes foldback synapsis, then its distal region pairs with the distal region of the standard partner. At metaphase-I, the heteromorphic microchromosome bivalents have a proximal chiasma. The content of the additional segment was Ag-NOR, C-like DAPI, CMA3 negative. FISH with telomere PNA probe did not detect interstitial (TTAGGG)n sequences in the heteromorphic and any other bivalents. Both homo- and heterozygous carriers were phenotypically normal. The presence of homozygotes shows that heterozygotes are fertile. Reduction in the number of microchromosomes is a clear trend in squamate evolution, as a result of microchromosomes fusing together or with macrochromosomes. Our findings indicate that gaining additional DNA may lead to a transformation of microchromosomes into small macrochromosomes without fusion. PMID:27830048

Karyotype Plasticity in Crickets: Numerical, Morphological, and Nucleolar Organizer Region Distribution Pattern of Anurogryllus sp.

PubMed Central

Cristina Schneider, Marielle; Ariza Zacaro, Adilson; Ferreira, Amilton; Maria Cella, Doralice

2010-01-01

Within the Orthopteran species, those of the suborder Ensifera have been rarely studied from the cytogenetic point of view, mainly due to the difficulties for taxonomic identification of its species. The Gryllidae is the second largest family of this suborder and possesses some genera, such as Anurogryllus, that occur only on the American continents. The aim of this work was to determine the karyotype characteristics, the meiotic chromosome behaviour, and the nucleolar organizer region (NOR) pattern of Anurogryllus sp (Orthoptera: Gryllidae). In the analyzed sample, high levels of numerical, morphological, and NORs polymorphisms were detected. Within five distinct karyotypes that were found, the basic karyotype of Anurogryllus sp. showed 2n(♂) = 22 + X0 with acrocentric autosomes and a metacentric X sex chromosome; furthermore, a conspicuous secondary constriction related to the NOR was present along the entire short arm on pair 5. The other four types of karyotypes arose from centric fusions between elements of pairs 1/3, 2/6, 4/7 and a NOR partial translocation from pair 5 onto the long arm terminal region of one element of the fused pair 2/6. Such intraspecific variability and the consequences of high levels of polymorphism are discussed, leading to conjectures about the mechanisms that led to these chromosome rearrangements. PMID:20673072

Sequence dependency of canonical base pair opening in the DNA double helix

PubMed Central

Villa, Alessandra

2017-01-01

The flipping-out of a DNA base from the double helical structure is a key step of many cellular processes, such as DNA replication, modification and repair. Base pair opening is the first step of base flipping and the exact mechanism is still not well understood. We investigate sequence effects on base pair opening using extensive classical molecular dynamics simulations targeting the opening of 11 different canonical base pairs in two DNA sequences. Two popular biomolecular force fields are applied. To enhance sampling and calculate free energies, we bias the simulation along a simple distance coordinate using a newly developed adaptive sampling algorithm. The simulation is guided back and forth along the coordinate, allowing for multiple opening pathways. We compare the calculated free energies with those from an NMR study and check assumptions of the model used for interpreting the NMR data. Our results further show that the neighboring sequence is an important factor for the opening free energy, but also indicates that other sequence effects may play a role. All base pairs are observed to have a propensity for opening toward the major groove. The preferred opening base is cytosine for GC base pairs, while for AT there is sequence dependent competition between the two bases. For AT opening, we identify two non-canonical base pair interactions contributing to a local minimum in the free energy profile. For both AT and CG we observe long-lived interactions with water and with sodium ions at specific sites on the open base pair. PMID:28369121

Sequence Variation in the Small-Subunit rRNA Gene of Plasmodium malariae and Prevalence of Isolates with the Variant Sequence in Sichuan, China

PubMed Central

Liu, Qing; Zhu, Shenghua; Mizuno, Sahoko; Kimura, Masatsugu; Liu, Peina; Isomura, Shin; Wang, Xingzhen; Kawamoto, Fumihiko

1998-01-01

By two PCR-based diagnostic methods, Plasmodium malariae infections have been rediscovered at two foci in the Sichuan province of China, a region where no cases of P. malariae have been officially reported for the last 2 decades. In addition, a variant form of P. malariae which has a deletion of 19 bp and seven substitutions of base pairs in the target sequence of the small-subunit (SSU) rRNA gene was detected with high frequency. Alignment analysis of Plasmodium sp. SSU rRNA gene sequences revealed that the 5′ region of the variant sequence is identical to that of P. vivax or P. knowlesi and its 3′ region is identical to that of P. malariae. The same sequence variations were also found in P. malariae isolates collected along the Thai-Myanmar border, suggesting a wide distribution of this variant form from southern China to Southeast Asia. PMID:9774600

Genetic and environmental influences on height from infancy to early adulthood: An individual-based pooled analysis of 45 twin cohorts.

PubMed

Jelenkovic, Aline; Sund, Reijo; Hur, Yoon-Mi; Yokoyama, Yoshie; Hjelmborg, Jacob V B; Möller, Sören; Honda, Chika; Magnusson, Patrik K E; Pedersen, Nancy L; Ooki, Syuichi; Aaltonen, Sari; Stazi, Maria A; Fagnani, Corrado; D'Ippolito, Cristina; Freitas, Duarte L; Maia, José Antonio; Ji, Fuling; Ning, Feng; Pang, Zengchang; Rebato, Esther; Busjahn, Andreas; Kandler, Christian; Saudino, Kimberly J; Jang, Kerry L; Cozen, Wendy; Hwang, Amie E; Mack, Thomas M; Gao, Wenjing; Yu, Canqing; Li, Liming; Corley, Robin P; Huibregtse, Brooke M; Derom, Catherine A; Vlietinck, Robert F; Loos, Ruth J F; Heikkilä, Kauko; Wardle, Jane; Llewellyn, Clare H; Fisher, Abigail; McAdams, Tom A; Eley, Thalia C; Gregory, Alice M; He, Mingguang; Ding, Xiaohu; Bjerregaard-Andersen, Morten; Beck-Nielsen, Henning; Sodemann, Morten; Tarnoki, Adam D; Tarnoki, David L; Knafo-Noam, Ariel; Mankuta, David; Abramson, Lior; Burt, S Alexandra; Klump, Kelly L; Silberg, Judy L; Eaves, Lindon J; Maes, Hermine H; Krueger, Robert F; McGue, Matt; Pahlen, Shandell; Gatz, Margaret; Butler, David A; Bartels, Meike; van Beijsterveldt, Toos C E M; Craig, Jeffrey M; Saffery, Richard; Dubois, Lise; Boivin, Michel; Brendgen, Mara; Dionne, Ginette; Vitaro, Frank; Martin, Nicholas G; Medland, Sarah E; Montgomery, Grant W; Swan, Gary E; Krasnow, Ruth; Tynelius, Per; Lichtenstein, Paul; Haworth, Claire M A; Plomin, Robert; Bayasgalan, Gombojav; Narandalai, Danshiitsoodol; Harden, K Paige; Tucker-Drob, Elliot M; Spector, Timothy; Mangino, Massimo; Lachance, Genevieve; Baker, Laura A; Tuvblad, Catherine; Duncan, Glen E; Buchwald, Dedra; Willemsen, Gonneke; Skytthe, Axel; Kyvik, Kirsten O; Christensen, Kaare; Öncel, Sevgi Y; Aliev, Fazil; Rasmussen, Finn; Goldberg, Jack H; Sørensen, Thorkild I A; Boomsma, Dorret I; Kaprio, Jaakko; Silventoinen, Karri

2016-06-23

Height variation is known to be determined by both genetic and environmental factors, but a systematic description of how their influences differ by sex, age and global regions is lacking. We conducted an individual-based pooled analysis of 45 twin cohorts from 20 countries, including 180,520 paired measurements at ages 1-19 years. The proportion of height variation explained by shared environmental factors was greatest in early childhood, but these effects remained present until early adulthood. Accordingly, the relative genetic contribution increased with age and was greatest in adolescence (up to 0.83 in boys and 0.76 in girls). Comparing geographic-cultural regions (Europe, North-America and Australia, and East-Asia), genetic variance was greatest in North-America and Australia and lowest in East-Asia, but the relative proportion of genetic variation was roughly similar across these regions. Our findings provide further insights into height variation during childhood and adolescence in populations representing different ethnicities and exposed to different environments.

Fitting of hearing aids with different technical parameters to a patient with dead regions

NASA Astrophysics Data System (ADS)

Hojan-Jezierska, Dorota; Skrodzka, Ewa

2009-01-01

The purpose of the study was to determine an optimal hearing aid fitting procedure for a patient with well diagnosed high-frequency ‘dead regions’ in both cochleas. The patient reported non-symmetrical hearing problems of sensorineural origin. For binaural amplification two similar independent hearing aids were used as well as a pair of dependent devices with an ear-to-ear function. Two fitting methods were used: DSLi/o and NAL-NL1, and four different strategies of fitting were tested: the initial fitting based on the DSLi/o or NAL-NL1 method with necessary loudness corrections, the second fitting taking into account all the available functions of hearing instruments, the third fitting (based on the second one) but with significantly reduced amplification well above one octave of frequency inside dead region, and the final fitting with significantly reduced gain slightly below one octave inside dead regions. The results of hearing aids fitting were assessed using an APHAB procedure.

MatchGUI: A Graphical MATLAB-Based Tool for Automatic Image Co-Registration

NASA Technical Reports Server (NTRS)

Ansar, Adnan I.

2011-01-01

MatchGUI software, based on MATLAB, automatically matches two images and displays the match result by superimposing one image on the other. A slider bar allows focus to shift between the two images. There are tools for zoom, auto-crop to overlap region, and basic image markup. Given a pair of ortho-rectified images (focused primarily on Mars orbital imagery for now), this software automatically co-registers the imagery so that corresponding image pixels are aligned. MatchGUI requires minimal user input, and performs a registration over scale and inplane rotation fully automatically

Natural antisense RNAs as mRNA regulatory elements in bacteria: a review on function and applications.

PubMed

Saberi, Fatemeh; Kamali, Mehdi; Najafi, Ali; Yazdanparast, Alavieh; Moghaddam, Mehrdad Moosazadeh

2016-01-01

Naturally occurring antisense RNAs are small, diffusible, untranslated transcripts that pair to target RNAs at specific regions of complementarity to control their biological function by regulating gene expression at the post-transcriptional level. This review focuses on known cases of antisense RNA control in prokaryotes and provides an overview of some natural RNA-based mechanisms that bacteria use to modulate gene expression, such as mRNA sensors, riboswitches and antisense RNAs. We also highlight recent advances in RNA-based technology. The review shows that studies on both natural and synthetic systems are reciprocally beneficial.

Theoretical study on the binding mechanism between N6-methyladenine and natural DNA bases.

PubMed

Song, Qi-Xia; Ding, Zhen-Dong; Liu, Jian-Hua; Li, Yan; Wang, Hai-Jun

2013-03-01

N6-methyladenine (m(6)A) is a rare base naturally occurring in DNA. It is different from the base adenine due to its N-CH(3). Therefore, the base not only pairs with thymine, but also with other DNA bases (cytosine, adenine and guanine). In this work, Møller-Plesset second-order (MP2) method has been used to investigate the binding mechanism between m(6)A and natural DNA bases in gas phase and in aqueous solution. The results show that N-CH(3) changed the way of N6-methyladenine binding to natural DNA bases. The binding style significantly influences the stability of base pairs. The trans-m(6)A:G and trans-m(6)A:C conformers are the most stable among all the base pairs. The existence of solvent can remarkably reduce the stability of the base pairs, and the DNA bases prefer pairing with trans-m(6)A to cis-m(6)A. Besides, the properties of these hydrogen bonds have been analyzed by atom in molecules (AIM) theory, natural bond orbital (NBO) analysis and Wiberg bond indexes (WBI). In addition, pairing with m(6)A decreases the binding energies compared to the normal Watson-Crick base pairs, it may explain the instability of the N6 site methylated DNA in theory.

Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs.

PubMed

McCoy, A B; Wright, A; Krousel-Wood, M; Thomas, E J; McCoy, J A; Sittig, D F

2015-01-01

Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes.

Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs

PubMed Central

Wright, A.; Krousel-Wood, M.; Thomas, E. J.; McCoy, J. A.; Sittig, D. F.

2015-01-01

Summary Background Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. Objective We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. Methods We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. Results The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. Conclusions We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes. PMID:26171079

Estimation of occupancy, breeding success, and predicted abundance of golden eagles (Aquila chrysaetos) in the Diablo Range, California, 2014

USGS Publications Warehouse

Wiens, J. David; Kolar, Patrick S.; Fuller, Mark R.; Hunt, W. Grainger; Hunt, Teresa

2015-01-01

We used a multistate occupancy sampling design to estimate occupancy, breeding success, and abundance of territorial pairs of golden eagles (Aquila chrysaetos) in the Diablo Range, California, in 2014. This method uses the spatial pattern of detections and non-detections over repeated visits to survey sites to estimate probabilities of occupancy and successful reproduction while accounting for imperfect detection of golden eagles and their young during surveys. The estimated probability of detecting territorial pairs of golden eagles and their young was less than 1 and varied with time of the breeding season, as did the probability of correctly classifying a pair’s breeding status. Imperfect detection and breeding classification led to a sizeable difference between the uncorrected, naïve estimate of the proportion of occupied sites where successful reproduction was observed (0.20) and the model-based estimate (0.30). The analysis further indicated a relatively high overall probability of landscape occupancy by pairs of golden eagles (0.67, standard error = 0.06), but that areas with the greatest occupancy and reproductive potential were patchily distributed. We documented a total of 138 territorial pairs of golden eagles during surveys completed in the 2014 breeding season, which represented about one-half of the 280 pairs we estimated to occur in the broader 5,169-square kilometer region sampled. The study results emphasize the importance of accounting for imperfect detection and spatial heterogeneity in studies of site occupancy, breeding success, and abundance of golden eagles.

Development of chloroplast simple sequence repeats (cpSSRs) for the intraspecific study of Gracilaria tenuistipitata (Gracilariales, Rhodophyta) from different populations

PubMed Central

2014-01-01

Background Gracilaria tenuistipitata is an agarophyte with substantial economic potential because of its high growth rate and tolerance to a wide range of environment factors. This red seaweed is intensively cultured in China for the production of agar and fodder for abalone. Microsatellite markers were developed from the chloroplast genome of G. tenuistipitata var. liui to differentiate G. tenuistipitata obtained from six different localities: four from Peninsular Malaysia, one from Thailand and one from Vietnam. Eighty G. tenuistipitata specimens were analyzed using eight simple sequence repeat (SSR) primer-pairs that we developed for polymerase chain reaction (PCR) amplification. Findings Five mononucleotide primer-pairs and one trinucleotide primer-pair exhibited monomorphic alleles, whereas the other two primer-pairs separated the G. tenuistipitata specimens into two main clades. G. tenuistipitata from Thailand and Vietnam were grouped into one clade, and the populations from Batu Laut, Middle Banks and Kuah (Malaysia) were grouped into another clade. The combined dataset of these two primer-pairs separated G. tenuistipitata obtained from Kelantan, Malaysia from that obtained from other localities. Conclusions Based on the variations in repeated nucleotides of microsatellite markers, our results suggested that the populations of G. tenuistipitata were distributed into two main geographical regions: (i) populations in the west coast of Peninsular Malaysia and (ii) populations facing the South China Sea. The correct identification of G. tenuistipitata strains with traits of high economic potential will be advantageous for the mass cultivation of seaweeds. PMID:24490797

Joint Pairing and Structured Mapping of Convolutional Brain Morphological Multiplexes for Early Dementia Diagnosis.

PubMed

Lisowska, Anna; Rekik, Islem

2018-06-21

Diagnosis of brain dementia, particularly early mild cognitive impairment (eMCI), is critical for early intervention to prevent the onset of Alzheimer's Disease (AD), where cognitive decline is severe and irreversible. There is a large body of machine-learning based research investigating how dementia alters brain connectivity, mainly using structural (derived from diffusion MRI) and functional (derived from resting-state functional MRI) brain connectomic data. However, how early dementia affects cortical brain connections in morphology remains largely unexplored. To fill this gap, we propose a joint morphological brain multiplexes pairing and mapping strategy for early MCI detection, where a brain multiplex not only encodes the similarity in morphology between pairs of brain regions, but also a pair of brain morphological networks. Experimental results confirm that the proposed framework outperforms in classification accuracy several state-of-the-art methods. More importantly, we unprecedentedly identified most discriminative brain morphological networks between eMCI and NC, which included the paired views derived from maximum principal curvature and the sulcal depth for the left hemisphere and sulcal depth and the average curvature for the right hemisphere. We also identified the most highly correlated morphological brain connections in our cohort, which included the (pericalcarine cortex, insula cortex) on the maximum principal curvature view, (entorhinal cortex, insula cortex) on the mean sulcal depth view, and (entorhinal cortex, pericalcarine cortex) on the mean average curvature view, for both hemispheres. These highly correlated morphological connections might serve as biomarkers for early MCI diagnosis.

Role of Cysteines in Stabilizing the Randomized Receptor Binding Domains within Feline Leukemia Virus Envelope Proteins.

PubMed

Valdivieso-Torres, Leonardo; Sarangi, Anindita; Whidby, Jillian; Marcotrigiano, Joseph; Roth, Monica J

2015-12-30

Retargeting of gammaretroviral envelope proteins has shown promising results in the isolation of novel isolates with therapeutic potential. However, the optimal conditions required to obtain high-affinity retargeted envelope proteins with narrow tropism are not understood. This study highlights the advantage of constrained peptides within receptor binding domains and validates the random library screening technique of obtaining novel retargeted Env proteins. Using a modified vector backbone to screen the envelope libraries on 143B osteosarcoma cells, three novel and unique retargeted envelopes were isolated. The use of complex disulfide bonds within variable regions required for receptor binding is found within natural gammaretroviral envelope isolates. Interestingly, two of the isolates, named AII and BV2, have a pair of cysteines located within the randomized region of 11 amino acids similar to that identified within the CP Env, an isolate identified in a previous Env library screen on the human renal carcinoma Caki-1 cell line. The amino acids within the randomized region of AII and BV2 envelopes that are essential for viral infection have been identified in this study and include these cysteine residues. Through mutagenesis studies, the putative disulfide bond pairs including and beyond the randomized region were examined. In parallel, the disulfide bonds of CP Env were identified using mass spectrometry. The results indicate that this pair of cysteines creates the structural context to position key hydrophobic (F and W) and basic (K and H) residues critical for viral titer and suggest that AII, BV2, and CP internal cysteines bond together in distinct ways. Retargeted gammaretroviral particles have broad applications for therapeutic use. Although great advances have been achieved in identifying new Env-host cell receptor pairs, the rules for designing optimal Env libraries are still unclear. We have found that isolates with an additional pair of cysteines within the randomized region have the highest transduction efficiencies. This emphasizes the importance of considering cysteine pairs in the design of new libraries. Furthermore, our data clearly indicate that these cysteines are essential for viral infectivity by presenting essential residues to the host cell receptor. These studies facilitate the screening of Env libraries for functional entry into target cells, allowing the identification of novel gammaretroviral Envs targeting alternative host cell receptors for gene and protein delivery. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Nucleotide sequencing analysis of a LEU gene of Candida maltosa which complements leuB mutation of Escherichia coli and leu2 mutation of Saccharomyces cerevisiae.

PubMed

Takagi, M; Kobayashi, N; Sugimoto, M; Fujii, T; Watari, J; Yano, K

1987-01-01

The expression of a LEU gene from Candida maltosa (designated as C-LEU2) isolated previously (Kawamura et al. 1983) was shown to be regulated, when transferred into Saccharomyces cerevisiae, by leucine and threonine in the medium, as in the case of LEU2 gene of S. cerevisiae. The coding region together with the regulatory region was subcloned and the nucleotide sequence was determined. When the sequence of the coding region was compared with that of LEU2, the homology was 72% for base pairs and 76% for deduced amino acids. Comparison of the regulatory region of C-LEU2 with those of LEU1 and LEU2 suggested a few short consensus sequences which are involved in regulation of gene expression by leucine and threonine in the medium.

New calculations and measurements of the Coulomb cross-section for the production of direct electron pairs by high energy nuclei

NASA Technical Reports Server (NTRS)

Derrickson, J. H.; Dake, S.; Dong, B. L.; Eby, P. B.; Fountain, W. F.; Fuki, M.; Gregory, J. C.; Hayashi, T.; Iyono, A.; King, D. T.

1989-01-01

Recently, new calculations were made of the direct Coulomb pair cross section that rely less in arbitrary parameters. More accurate calculations of the cross section down to low pair energies were made. New measurements of the total direct electron pair yield, and the energy and angular distribution of the electron pairs in emulsion were made for O-16 at 60 and 200 GeV/amu at S-32 at 200 GeV/amu which give satisfactory agreement with the new calculations. These calculations and measurements are presented along with previous accelerator measurements made of this effect during the last 40 years. The microscope scanning criteria used to identify the direct electron pairs is described. Prospects for application of the pair method to cosmic ray energy measurements in the region 10 (exp 13) to 10 (exp 15) eV/amu are discussed.

Image Segmentation Analysis for NASA Earth Science Applications

NASA Technical Reports Server (NTRS)

Tilton, James C.

2010-01-01

NASA collects large volumes of imagery data from satellite-based Earth remote sensing sensors. Nearly all of the computerized image analysis of this data is performed pixel-by-pixel, in which an algorithm is applied directly to individual image pixels. While this analysis approach is satisfactory in many cases, it is usually not fully effective in extracting the full information content from the high spatial resolution image data that s now becoming increasingly available from these sensors. The field of object-based image analysis (OBIA) has arisen in recent years to address the need to move beyond pixel-based analysis. The Recursive Hierarchical Segmentation (RHSEG) software developed by the author is being used to facilitate moving from pixel-based image analysis to OBIA. The key unique aspect of RHSEG is that it tightly intertwines region growing segmentation, which produces spatially connected region objects, with region object classification, which groups sets of region objects together into region classes. No other practical, operational image segmentation approach has this tight integration of region growing object finding with region classification This integration is made possible by the recursive, divide-and-conquer implementation utilized by RHSEG, in which the input image data is recursively subdivided until the image data sections are small enough to successfully mitigat the combinatorial explosion caused by the need to compute the dissimilarity between each pair of image pixels. RHSEG's tight integration of region growing object finding and region classification is what enables the high spatial fidelity of the image segmentations produced by RHSEG. This presentation will provide an overview of the RHSEG algorithm and describe how it is currently being used to support OBIA or Earth Science applications such as snow/ice mapping and finding archaeological sites from remotely sensed data.

Anomalous resonances of an optical microcavity with a hyperbolic metamaterial core

NASA Astrophysics Data System (ADS)

Travkin, Evgenij; Kiel, Thomas; Sadofev, Sergey; Busch, Kurt; Benson, Oliver; Kalusniak, Sascha

2018-05-01

We embed a hyperbolic metamaterial based on stacked layer pairs of epitaxially grown ZnO/ZnO:Ga in a monolithic optical microcavity, and we investigate the arising unique resonant effects experimentally and theoretically. Unlike traditional metals, the semiconductor-based approach allows us to utilize all three permittivity regions of the hyperbolic metamaterial in the near-infrared spectral range. This configuration gives rise to modes of identical orders appearing at different frequencies, a zeroth-order resonance in an all-positive permittivity region, and a continuum of high-order modes. In addition, an unusual lower cutoff frequency is introduced to the resonator mode spectrum. The observed effects expand the possibilities for customization of optical resonators; in particular, the zeroth-order and high-order modes hold strong potential for the realization of deeply subwavelength cavity sizes.

New powerful statistics for alignment-free sequence comparison under a pattern transfer model.

PubMed

Liu, Xuemei; Wan, Lin; Li, Jing; Reinert, Gesine; Waterman, Michael S; Sun, Fengzhu

2011-09-07

Alignment-free sequence comparison is widely used for comparing gene regulatory regions and for identifying horizontally transferred genes. Recent studies on the power of a widely used alignment-free comparison statistic D2 and its variants D*2 and D(s)2 showed that their power approximates a limit smaller than 1 as the sequence length tends to infinity under a pattern transfer model. We develop new alignment-free statistics based on D2, D*2 and D(s)2 by comparing local sequence pairs and then summing over all the local sequence pairs of certain length. We show that the new statistics are much more powerful than the corresponding statistics and the power tends to 1 as the sequence length tends to infinity under the pattern transfer model. Copyright © 2011 Elsevier Ltd. All rights reserved.

Parton shower and NLO-matching uncertainties in Higgs boson pair production

NASA Astrophysics Data System (ADS)

Jones, Stephen; Kuttimalai, Silvan

2018-02-01

We perform a detailed study of NLO parton shower matching uncertainties in Higgs boson pair production through gluon fusion at the LHC based on a generic and process independent implementation of NLO subtraction and parton shower matching schemes for loop-induced processes in the Sherpa event generator. We take into account the full top-quark mass dependence in the two-loop virtual corrections and compare the results to an effective theory approximation. In the full calculation, our findings suggest large parton shower matching uncertainties that are absent in the effective theory approximation. We observe large uncertainties even in regions of phase space where fixed-order calculations are theoretically well motivated and parton shower effects expected to be small. We compare our results to NLO matched parton shower simulations and analytic resummation results that are available in the literature.

New Powerful Statistics for Alignment-free Sequence Comparison Under a Pattern Transfer Model

PubMed Central

Liu, Xuemei; Wan, Lin; Li, Jing; Reinert, Gesine; Waterman, Michael S.; Sun, Fengzhu

2011-01-01

Alignment-free sequence comparison is widely used for comparing gene regulatory regions and for identifying horizontally transferred genes. Recent studies on the power of a widely used alignment-free comparison statistic D2 and its variants D2∗ and D2s showed that their power approximates a limit smaller than 1 as the sequence length tends to infinity under a pattern transfer model. We develop new alignment-free statistics based on D2, D2∗ and D2s by comparing local sequence pairs and then summing over all the local sequence pairs of certain length. We show that the new statistics are much more powerful than the corresponding statistics and the power tends to 1 as the sequence length tends to infinity under the pattern transfer model. PMID:21723298

Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

PubMed

Kondo, Jiro; Westhof, Eric

2011-10-01

Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes

PubMed Central

Kondo, Jiro; Westhof, Eric

2011-01-01

Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

The identification and functional annotation of RNA structures conserved in vertebrates

PubMed Central

Seemann, Stefan E.; Mirza, Aashiq H.; Hansen, Claus; Bang-Berthelsen, Claus H.; Garde, Christian; Christensen-Dalsgaard, Mikkel; Torarinsson, Elfar; Yao, Zizhen; Workman, Christopher T.; Pociot, Flemming; Nielsen, Henrik; Tommerup, Niels; Ruzzo, Walter L.; Gorodkin, Jan

2017-01-01

Structured elements of RNA molecules are essential in, e.g., RNA stabilization, localization, and protein interaction, and their conservation across species suggests a common functional role. We computationally screened vertebrate genomes for conserved RNA structures (CRSs), leveraging structure-based, rather than sequence-based, alignments. After careful correction for sequence identity and GC content, we predict ∼516,000 human genomic regions containing CRSs. We find that a substantial fraction of human–mouse CRS regions (1) colocalize consistently with binding sites of the same RNA binding proteins (RBPs) or (2) are transcribed in corresponding tissues. Additionally, a CaptureSeq experiment revealed expression of many of our CRS regions in human fetal brain, including 662 novel ones. For selected human and mouse candidate pairs, qRT-PCR and in vitro RNA structure probing supported both shared expression and shared structure despite low abundance and low sequence identity. About 30,000 CRS regions are located near coding or long noncoding RNA genes or within enhancers. Structured (CRS overlapping) enhancer RNAs and extended 3′ ends have significantly increased expression levels over their nonstructured counterparts. Our findings of transcribed uncharacterized regulatory regions that contain CRSs support their RNA-mediated functionality. PMID:28487280

Analysis of events with b-jets and a pair of leptons of the same charge in pp collisions at √s = 8 TeV with the ATLAS detector

DOE PAGES

Aad, G.; Abbott, B.; Abdallah, J.; ...

2015-10-22

An analysis is presented of events containing jets including at least one b -tagged jet, sizeable missing transverse momentum, and at least two leptons including a pair of the same electric charge, with the scalar sum of the jet and lepton transverse momenta being large. A data sample with an integrated luminosity of 20.3 fb –1 of pp collisions at √s = 8 TeV recorded by the ATLAS detector at the Large Hadron Collider is used. Standard Model processes rarely produce these final states, but there are several models of physics beyond the Standard Model that predict an enhanced ratemore » of production of such events; the ones considered here are production of vector-like quarks, enhanced four-top-quark production, pair production of chiral b'-quarks, and production of two positively charged top quarks. Eleven signal regions are defined; subsets of these regions are combined when searching for each class of models. In the three signal regions primarily sensitive to positively charged top quark pair production, the data yield is consistent with the background expectation. There are more data events than expected from background in the set of eight signal regions defined for searching for vector-like quarks and chiral b'-quarks, but the significance of the discrepancy is less than two standard deviations. Furthermore, the discrepancy reaches 2.5 standard deviations in the set of five signal regions defined for searching for four-top-quark production. The results are used to set 95% CL limits on various models.« less

Electrophysiological measurement of binaural beats: effects of primary tone frequency and observer age.

PubMed

Grose, John H; Mamo, Sara K

2012-01-01

The purpose of this study was to determine the reliability of the electrophysiological binaural beat steady state response as a gauge of temporal fine structure coding, particularly as it relates to the aging auditory system. The hypothesis was that the response would be more robust in a lower, than in a higher, frequency region and in younger, than in older, adults. Two experiments were undertaken. The first measured the 40 Hz binaural beat steady state response elicited by tone pairs in two frequency regions: lower (390 and 430 Hz tone pair) and higher (810 and 850 Hz tone pair). Frequency following responses (FFRs) evoked by the tones were also recorded. Ten young adults with normal hearing participated. The second experiment measured the binaural beat and FFRs in older adults but only in the lower frequency region. Fourteen older adults with relatively normal hearing participated. Response metrics in both experiments included response component signal-to-noise ratio (F statistic) and magnitude-squared coherence. Experiment 1 showed that FFRs were elicited in both frequency regions but were more robust in the lower frequency region. Binaural beat responses elicited by the lower frequency pair of tones showed greater amplitude fluctuation within a participant than the respective FFRs. Experiment 2 showed that older adults exhibited similar FFRs to younger adults, but proportionally fewer older participants showed binaural beat responses. Age differences in onset responses were also observed. The lower prevalence of the binaural beat response in older adults, despite the presence of FFRs, provides tentative support for the sensitivity of this measure to age-related deficits in temporal processing. However, the lability of the binaural beat response advocates caution in its use as an objective measure of fine structure coding.

Evidence of protein-free homology recognition in magnetic bead force-extension experiments

NASA Astrophysics Data System (ADS)

O'Lee, D. J.; Danilowicz, C.; Rochester, C.; Kornyshev, A. A.; Prentiss, M.

2016-07-01

Earlier theoretical studies have proposed that the homology-dependent pairing of large tracts of dsDNA may be due to physical interactions between homologous regions. Such interactions could contribute to the sequence-dependent pairing of chromosome regions that may occur in the presence or the absence of double-strand breaks. Several experiments have indicated the recognition of homologous sequences in pure electrolytic solutions without proteins. Here, we report single-molecule force experiments with a designed 60 kb long dsDNA construct; one end attached to a solid surface and the other end to a magnetic bead. The 60 kb constructs contain two 10 kb long homologous tracts oriented head to head, so that their sequences match if the two tracts fold on each other. The distance between the bead and the surface is measured as a function of the force applied to the bead. At low forces, the construct molecules extend substantially less than normal, control dsDNA, indicating the existence of preferential interaction between the homologous regions. The force increase causes no abrupt but continuous unfolding of the paired homologous regions. Simple semi-phenomenological models of the unfolding mechanics are proposed, and their predictions are compared with the data.

Effects of Aging on the Neural Correlates of Successful Item and Source Memory Encoding

PubMed Central

Dennis, Nancy A.; Hayes, Scott M.; Prince, Steven E.; Madden, David J.; Huettel, Scott A.; Cabeza, Roberto

2009-01-01

To investigate the neural basis of age-related source memory (SM) deficits, young and older adults were scanned with fMRI while encoding faces, scenes, and face-scene pairs. Successful encoding activity was identified by comparing encoding activity for subsequently remembered versus forgotten items or pairs. Age deficits in successful encoding activity in hippocampal and prefrontal regions were more pronounced for SM (pairs) compared to item memory (faces and scenes). Age-related reductions were also found in regions specialized in processing faces (fusiform face area) and scenes (parahippocampal place area), but these reductions were similar for item and SM. Functional connectivity between the hippocampus and the rest of the brain was also affected by aging; whereas connections with posterior cortices were weaker in older adults, connections with anterior cortices including prefrontal regions were stronger in older adults. Taken together, the results provide a link between SM deficits in older adults and reduced recruitment of hippocampal and prefrontal regions during encoding. The functional connectivity findings are consistent with a posterior-anterior shift with aging (PASA), previously reported in several cognitive domains and linked to functional compensation. PMID:18605869

Closing loop base pairs in RNA loop-loop complexes: structural behavior, interaction energy and solvation analysis through molecular dynamics simulations.

PubMed

Golebiowski, Jérôme; Antonczak, Serge; Fernandez-Carmona, Juan; Condom, Roger; Cabrol-Bass, Daniel

2004-12-01

Nanosecond molecular dynamics using the Ewald summation method have been performed to elucidate the structural and energetic role of the closing base pair in loop-loop RNA duplexes neutralized by Mg2+ counterions in aqueous phases. Mismatches GA, CU and Watson-Crick GC base pairs have been considered for closing the loop of an RNA in complementary interaction with HIV-1 TAR. The simulations reveal that the mismatch GA base, mediated by a water molecule, leads to a complex that presents the best compromise between flexibility and energetic contributions. The mismatch CU base pair, in spite of the presence of an inserted water molecule, is too short to achieve a tight interaction at the closing-loop junction and seems to force TAR to reorganize upon binding. An energetic analysis has allowed us to quantify the strength of the interactions of the closing and the loop-loop pairs throughout the simulations. Although the water-mediated GA closing base pair presents an interaction energy similar to that found on fully geometry-optimized structure, the water-mediated CU closing base pair energy interaction reaches less than half the optimal value.

Inferring the risk factors behind the geographical spread and transmission of Zika in the Americas

PubMed Central

Bóta, András; Gangavarapu, Karthik; Kraemer, Moritz U. G.; Grubaugh, Nathan D.

2018-01-01

Background An unprecedented Zika virus epidemic occurred in the Americas during 2015-2016. The size of the epidemic in conjunction with newly recognized health risks associated with the virus attracted significant attention across the research community. Our study complements several recent studies which have mapped epidemiological elements of Zika, by introducing a newly proposed methodology to simultaneously estimate the contribution of various risk factors for geographic spread resulting in local transmission and to compute the risk of spread (or re-introductions) between each pair of regions. The focus of our analysis is on the Americas, where the set of regions includes all countries, overseas territories, and the states of the US. Methodology/Principal findings We present a novel application of the Generalized Inverse Infection Model (GIIM). The GIIM model uses real observations from the outbreak and seeks to estimate the risk factors driving transmission. The observations are derived from the dates of reported local transmission of Zika virus in each region, the network structure is defined by the passenger air travel movements between all pairs of regions, and the risk factors considered include regional socioeconomic factors, vector habitat suitability, travel volumes, and epidemiological data. The GIIM relies on a multi-agent based optimization method to estimate the parameters, and utilizes a data driven stochastic-dynamic epidemic model for evaluation. As expected, we found that mosquito abundance, incidence rate at the origin region, and human population density are risk factors for Zika virus transmission and spread. Surprisingly, air passenger volume was less impactful, and the most significant factor was (a negative relationship with) the regional gross domestic product (GDP) per capita. Conclusions/Significance Our model generates country level exportation and importation risk profiles over the course of the epidemic and provides quantitative estimates for the likelihood of introduced Zika virus resulting in local transmission, between all origin-destination travel pairs in the Americas. Our findings indicate that local vector control, rather than travel restrictions, will be more effective at reducing the risks of Zika virus transmission and establishment. Moreover, the inverse relationship between Zika virus transmission and GDP suggests that Zika cases are more likely to occur in regions where people cannot afford to protect themselves from mosquitoes. The modeling framework is not specific for Zika virus, and could easily be employed for other vector-borne pathogens with sufficient epidemiological and entomological data. PMID:29346387

Apparatus for tensile testing plate-type ceramic specimens

DOEpatents

Liu, K.C.

1993-08-24

Apparatus is described for gripping a plate-type tensile specimen having generally T-shaped end regions in a dynamic tension fatigue testing apparatus comprising an annular housing having an open-ended elongated cavity therein, a plurality of hydraulic piston means supported by the housing in a spaced array about the cavity, and a specimen-supporting plate means overlying the piston means at one end of the elongated cavity and displaceable by said piston means in a longitudinal direction with respect to the longitudinal axis of the cavity, said apparatus for gripping a flat plate-type tensile specimen comprising: a pair of elongated pull rods each having oppositely disposed first and second end regions; a pair of mounting means carried by said plate means with each mounting means for pivotally attaching the first end region of each of said pull rods in a central region of said plate means for supporting said pair of elongated pull rods in a side-by-side relationship along a common longitudinal centerline within said cavity; recess means in the second end region of each of said pull rods in adjacently disposed surface regions thereof with said recess means facing one another and each adapted to receive one side of one of the generally T-shaped end regions of the plate-type tensile specimen; and load-bearing means positionable in each of said recess means and adapted to bear against a shoulder on each side of the generally T-shaped end region of the plate-type tensile specimen when a tensile loading is applied thereon.

Monitoring of surface deformation in open pit mine using DInSAR time-series: a case study in the N5W iron mine (Carajás, Brazil) using TerraSAR-X data

NASA Astrophysics Data System (ADS)

Mura, José C.; Paradella, Waldir R.; Gama, Fabio F.; Santos, Athos R.; Galo, Mauricio; Camargo, Paulo O.; Silva, Arnaldo Q.; Silva, Guilherme G.

2014-10-01

We present an investigation of surface deformation using Differential SAR Interferometry (DInSAR) time-series carried out in an active open pit iron mine, the N5W, located in the Carajás Mineral Province (Brazilian Amazon region), using 33 TerraSAR-X (TSX-1) scenes. This mine has presented a historical of instability and surface monitoring measurements over sectors of the mine (pit walls) have been done based on ground based radar. Two complementary approaches were used: the standard DInSAR configuration, as an early warning of the slope instability conditions, and the DInSAR timeseries analysis. In order to decrease the topographic phase error a high resolution DEM was generated based on a stereo GeoEye-1 pair. Despite the fact that a DinSAR contains atmospheric and topographic phase artifacts and noise, it was possible to detect deformation in some interferometric pairs, covering pit benches, road ramps and waste piles. The timeseries analysis was performed using the 31 interferometric pairs, which were selected based on the highest mean coherence of a stack of 107 interferograms, presenting less phase unwrapping errors. The time-series deformation was retrieved by the Least-Squares (LS) solution using an extension of the Singular Value Decomposition (SVD), with a set of additional weighted constrain on the acceleration deformation. The atmospheric phase artifacts were filtered in the space-time domain and the DEM height errors were estimated based on the normal baseline diversity. The DInSAR time-series investigation showed good results for monitoring surface displacement in the N5W mine located in a tropical rainforest environment, providing very useful information about the ground movement for alarm, planning and risk assessment.

Data discretization for novel resource discovery in large medical data sets.

PubMed Central

Benoît, G.; Andrews, J. E.

2000-01-01

This paper is motivated by the problems of dealing with large data sets in information retrieval. The authors suggest an information retrieval framework based on mathematical principles to organize and permit end-user manipulation of a retrieval set. By adjusting through the interface the weights and types of relationships between query and set members, it is possible to expose unanticipated, novel relationships between the query/document pair. The retrieval set as a whole is parsed into discrete concept-oriented subsets (based on within-set similarity measures) and displayed on screen as interactive "graphic nodes" in an information space, distributed at first based on the vector model (similarity measure of set to query). The result is a visualized map wherein it is possible to identify main concept regions and multiple sub-regions as dimensions of the same data. Users may examine the membership within sub-regions. Based on this framework, a data visualization user interface was designed to encourage users to work with the data on multiple levels to find novel relationships between the query and retrieval set members. Space constraints prohibit addressing all aspects of this project. PMID:11079845

TH-E-BRF-02: 4D-CT Ventilation Image-Based IMRT Plans Are Dosimetrically Comparable to SPECT Ventilation Image-Based Plans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kida, S; University of Tokyo Hospital, Bunkyo, Tokyo; Bal, M

Purpose: An emerging lung ventilation imaging method based on 4D-CT can be used in radiotherapy to selectively avoid irradiating highly-functional lung regions, which may reduce pulmonary toxicity. Efforts to validate 4DCT ventilation imaging have been focused on comparison with other imaging modalities including SPECT and xenon CT. The purpose of this study was to compare 4D-CT ventilation image-based functional IMRT plans with SPECT ventilation image-based plans as reference. Methods: 4D-CT and SPECT ventilation scans were acquired for five thoracic cancer patients in an IRB-approved prospective clinical trial. The ventilation images were created by quantitative analysis of regional volume changes (amore » surrogate for ventilation) using deformable image registration of the 4D-CT images. A pair of 4D-CT ventilation and SPECT ventilation image-based IMRT plans was created for each patient. Regional ventilation information was incorporated into lung dose-volume objectives for IMRT optimization by assigning different weights on a voxel-by-voxel basis. The objectives and constraints of the other structures in the plan were kept identical. The differences in the dose-volume metrics have been evaluated and tested by a paired t-test. SPECT ventilation was used to calculate the lung functional dose-volume metrics (i.e., mean dose, V20 and effective dose) for both 4D-CT ventilation image-based and SPECT ventilation image-based plans. Results: Overall there were no statistically significant differences in any dose-volume metrics between the 4D-CT and SPECT ventilation imagebased plans. For example, the average functional mean lung dose of the 4D-CT plans was 26.1±9.15 (Gy), which was comparable to 25.2±8.60 (Gy) of the SPECT plans (p = 0.89). For other critical organs and PTV, nonsignificant differences were found as well. Conclusion: This study has demonstrated that 4D-CT ventilation image-based functional IMRT plans are dosimetrically comparable to SPECT ventilation image-based plans, providing evidence to use 4D-CT ventilation imaging for clinical applications. Supported in part by Free to Breathe Young Investigator Research Grant and NIH/NCI R01 CA 093626. The authors thank Philips Radiation Oncology Systems for the Pinnacle3 treatment planning systems.« less

[Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

PubMed

Brovarets', O O

2013-01-01

At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leszczynski, Jerzy; Sponer, Judit; Sponer, Jiri

Recent experimental studies on the Watson Crick type base pairing of triazine and aminopyrimidine derivatives suggest that acid/base properties of the constituent bases might be related to the duplex stabilities measured in solution. Herein we use high-level quantum chemical calculations and molecular dynamics simulations to evaluate the base pairing and stacking interactions of seven selected base pairs, which are common in that they are stabilized by two NH O hydrogen bonds separated by one NH N hydrogen bond. We show that neither the base pairing nor the base stacking interaction energies correlate with the reported pKa data of the basesmore » and the melting points of the duplexes. This suggests that the experimentally observed correlation between the melting point data of the duplexes and the pKa values of the constituent bases is not rooted in the intrinsic base pairing and stacking properties. The physical chemistry origin of the observed experimental correlation thus remains unexplained and requires further investigations. In addition, since our calculations are carried out with extrapolation to the complete basis set of atomic orbitals and with inclusion of higher electron correlation effects, they provide reference data for stacking and base pairing energies of non-natural bases.« less

Flavor network and the principles of food pairing

NASA Astrophysics Data System (ADS)

Ahn, Yong-Yeol; Ahnert, Sebastian; Bagrow, James; Barabasi, Albert-Laszlo

2011-03-01

We construct and investigate a flavor network capturing the chemical similarity between the culinary ingredients. We found that Western cuisines have a statistically significant tendency to use ingredient pairs that share many flavor compounds, in line with the food pairing hypothesis used by some chefs and molecular gastronmists. By contrast, East Asian cuisine tend to avoid compound sharing ingredients. We identify key ingredients in each cuisine that help us to explore the differences and similarities between regional cuisines.

Thermal transport in topological-insulator-based superconducting hybrid structures with mixed singlet and triplet pairing states.

PubMed

Li, Hai; Zhao, Yuan Yuan

2017-11-22

In the framework of the Bogoliubov-de Gennes equation, we investigate the thermal transport properties in topological-insulator-based superconducting hybrid structures with mixed spin-singlet and spin-triplet pairing states, and emphasize the different manifestations of the spin-singlet and spin-triplet pairing states in the thermal transport signatures. It is revealed that the temperature-dependent differential thermal conductance strongly depends on the components of the pairing state, and the negative differential thermal conductance only occurs in the spin-singlet pairing state dominated regime. It is also found that the thermal conductance is profoundly sensitive to the components of the pairing state. In the spin-singlet pairing state controlled regime, the thermal conductance obviously oscillates with the phase difference and junction length. With increasing the proportion of the spin-triplet pairing state, the oscillating characteristic of the thermal conductance fades out distinctly. These results suggest an alternative route for distinguishing the components of pairing states in topological-insulator-based superconducting hybrid structures.

Twisting Right to Left: A…A Mismatch in a CAG Trinucleotide Repeat Overexpansion Provokes Left-Handed Z-DNA Conformation

PubMed Central

2015-01-01

Conformational polymorphism of DNA is a major causative factor behind several incurable trinucleotide repeat expansion disorders that arise from overexpansion of trinucleotide repeats located in coding/non-coding regions of specific genes. Hairpin DNA structures that are formed due to overexpansion of CAG repeat lead to Huntington’s disorder and spinocerebellar ataxias. Nonetheless, DNA hairpin stem structure that generally embraces B-form with canonical base pairs is poorly understood in the context of periodic noncanonical A…A mismatch as found in CAG repeat overexpansion. Molecular dynamics simulations on DNA hairpin stems containing A…A mismatches in a CAG repeat overexpansion show that A…A dictates local Z-form irrespective of starting glycosyl conformation, in sharp contrast to canonical DNA duplex. Transition from B-to-Z is due to the mechanistic effect that originates from its pronounced nonisostericity with flanking canonical base pairs facilitated by base extrusion, backbone and/or base flipping. Based on these structural insights we envisage that such an unusual DNA structure of the CAG hairpin stem may have a role in disease pathogenesis. As this is the first study that delineates the influence of a single A…A mismatch in reversing DNA helicity, it would further have an impact on understanding DNA mismatch repair. PMID:25876062

Electric Field Quantitative Measurement System and Method

NASA Technical Reports Server (NTRS)

Generazio, Edward R. (Inventor)

2016-01-01

A method and system are provided for making a quantitative measurement of an electric field. A plurality of antennas separated from one another by known distances are arrayed in a region that extends in at least one dimension. A voltage difference between at least one selected pair of antennas is measured. Each voltage difference is divided by the known distance associated with the selected pair of antennas corresponding thereto to generate a resulting quantity. The plurality of resulting quantities defined over the region quantitatively describe an electric field therein.

Comparative physical mapping of 18S rDNA in the karyotypes of six leafcutter ant species of the genera Atta and Acromyrmex (Formicidae: Myrmicinae).

PubMed

Teixeira, Gisele Amaro; Barros, Luísa Antônia Campos; de Aguiar, Hilton Jeferson Alves Cardoso; das Graças Pompolo, Silvia

2017-10-01

Leafcutter ants of the Atta and Acromyrmex genera are important plagues in different cultures. Cytogenetic data on chromosome number, morphology, and chromosomal banding pattern are only available for 17 species of leafcutter ants. Molecular cytogenetic data for the detection of ribosomal genes by the FISH technique are scarce, and only 15 Neotropical ant species have been studied. This study aimed to physically map the 18S ribosomal RNA genes (rDNA) of six leafcutter ants belonging to the genera Atta and Acromyrmex using FISH. The results were compared with data on the fluorochrome CMA 3 currently available for these species. All analyzed species presented the 18S rDNA on one pair of chromosomes. In Acromyrmex subterraneus molestans and Ac. aspersus, FISH signals were observed in the terminal region of the short arm of the largest subtelocentric pair, while in Atta bisphaerica, A. laevigata, and A. sexdens, FISH signals were observed in the interstitial region of the long arm of the fourth metacentric pair. In Acromyrmex striatus, 18S rDNA was located in the interstitial region of the second metacentric pair. The karyotypic formula for Ac. aspersus was 2n = 38 (8m + 10sm + 16st + 4a), representing the first report in this species. The observed 18S rDNA regions in A. laevigata, A. sexdens, A. bisphaerica, Ac. aspersus, and Ac. subterraneus molestans corresponded to the CMA 3 + bands, while in Ac. striatus, several GC-rich bands and one pair of 18S rDNA bands were observed. No differential bands were visible using the DAPI fluorochrome. Karyotype uniformity with previously studied Atta spp. was also observed at the level of molecular cytogenetics using 18S rDNA FISH. A difference in the size of the chromosomal pair carrying the 18S rDNA gene was observed in Ac. striatus (2n = 22) and Atta spp. (2n = 22) highlighting the dissimilarity between these species. The results from the present study contribute to the description of 18S rDNA clusters in Neotropical ants.

Internal twisting motion dependent conductance of an aperiodic DNA molecule

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

Multilayer checkpoints for microRNA authenticity during RISC assembly

PubMed Central

Kawamata, Tomoko; Yoda, Mayuko; Tomari, Yukihide

2011-01-01

MicroRNAs (miRNAs) function through the RNA-induced silencing complex (RISC), which contains an Argonaute (Ago) protein at the core. RISC assembly follows a two-step pathway: miRNA/miRNA* duplex loading into Ago, and separation of the two strands within Ago. Here we show that the 5′ phosphate of the miRNA strand is essential for duplex loading into Ago, whereas the preferred 5′ nucleotide of the miRNA strand and the base-pairing status in the seed region and the middle of the 3′ region function as additive anchors to Ago. Consequently, the miRNA authenticity is inspected at multiple steps during RISC assembly. PMID:21738221

Nucleotide sequence of a cluster of early and late genes in a conserved segment of the vaccinia virus genome.

PubMed Central

Plucienniczak, A; Schroeder, E; Zettlmeissl, G; Streeck, R E

1985-01-01

The nucleotide sequence of a 7.6 kb vaccinia DNA segment from a genomic region conserved among different orthopox virus has been determined. This segment contains a tight cluster of 12 partly overlapping open reading frames most of which can be correlated with previously identified early and late proteins and mRNAs. Regulatory signals used by vaccinia virus have been studied. Presumptive promoter regions are rich in A, T and carry the consensus sequences TATA and AATAA spaced at 20-24 base pairs. Tandem repeats of a CTATTC consensus sequence are proposed to be involved in the termination of early transcription. PMID:2987815

Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

PubMed

Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

2018-03-26

DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

PubMed

Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

2014-01-08

The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

Comparable Stability of Hoogsteen and Watson–Crick Base Pairs in Ionic Liquid Choline Dihydrogen Phosphate

PubMed Central

Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

2014-01-01

The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194

m1A and m1G Potently Disrupt A-RNA Structure Due to the Intrinsic Instability of Hoogsteen Base Pairs

PubMed Central

Zhou, Huiqing; Kimsey, Isaac J.; Nikolova, Evgenia N.; Sathyamoorthy, Bharathwaj; Grazioli, Gianmarc; McSally, James; Bai, Tianyu; Wunderlich, Christoph H.; Kreutz, Christoph; Andricioaei, Ioan; Al-Hashimi, Hashim M.

2016-01-01

The B-DNA double helix can dynamically accommodate G–C and A–T base pairs in either Watson-Crick or Hoogsteen configurations. Here, we show that G–C+ and A–U Hoogsteen base pairs are strongly disfavored in A-RNA. As a result, N1-methyl adenosine and N1-methyl guanosine, which occur in DNA as a form of alkylation damage, and in RNA as a posttranscriptional modification, have dramatically different consequences. They create G–C+ and A–U Hoogsteen base pairs in duplex DNA that maintain the structural integrity of the double helix, but block base pairing all together and induce local duplex melting in RNA, providing a mechanism for potently disrupting RNA structure through posttranscriptional modifications. The markedly different propensities to form Hoogsteen base pairs in B-DNA and A-RNA may help meet the opposing requirements of maintaining genome stability on one hand, and dynamically modulating the structure of the epitranscriptome on the other. PMID:27478929

Indicators of wetland condition for the prairie pothole region of the United States.

PubMed

Guntenspergen, G R; Peterson, S A; Leibowitz, S G; Cowardin, L M

2002-09-01

We describe a study designed to evaluate the performance of wetland condition indicators of the Prairie Pothole Region (PPR) of the north central United States. Basin and landscape scale indicators were tested in 1992 and 1993 to determine their ability to discriminate between the influences of grassland dominated and cropland dominated landscapes in the PPR. Paired plots were selected from each of the major regions of the PPR. Among the landscape scale indicators tested, those most capable of distinguishing between the two landscapes were: 1) frequency of drained wetland basins. 2) total length of drainage ditch per plot, 3) amount of exposed soil in the upland subject to erosion, 4) indices of change in area of wetland covered by water, and 5) number of breeding duck pairs. Basin scale indicators including soil phosphorus concentrations and invertebrate taxa richness showed some promise: however, plant species richness was the only statistically significant basin scale indicator distinguishing grassland dominated from cropland dominated landscapes. Although our study found a number of promising candidate indicators, one of our conclusions is that basin scale indicators present a number of implementation problems. including: skill level requirements, site access denials, and recession of site access by landowners. Alternatively, we suggest that the use of landscape indicators based on remote sensing can be an effective means of assessing wetland integrity.

Optimal parameters for near infrared fluorescence imaging of amyloid plaques in Alzheimer’s disease mouse models

PubMed Central

Raymond, S B; Kumar, A T N; Boas, D A; Bacskai, B J

2012-01-01

Amyloid-β plaques are an Alzheimer’s disease biomarker which present unique challenges for near-infrared fluorescence tomography because of size (<50 μm diameter) and distribution. We used high-resolution simulations of fluorescence in a digital Alzheimer’s disease mouse model to investigate the optimal fluorophore and imaging parameters for near-infrared fluorescence tomography of amyloid plaques. Fluorescence was simulated for amyloid-targeted probes with emission at 630 and 800 nm, plaque-to-background ratios from 1–1000, amyloid burden from 0–10%, and for transmission and reflection measurement geometries. Fluorophores with high plaque-to-background contrast ratios and 800 nm emission performed significantly better than current amyloid imaging probes. We tested idealized fluorophores in transmission and full-angle tomographic measurement schemes (900 source–detector pairs), with and without anatomical priors. Transmission reconstructions demonstrated strong linear correlation with increasing amyloid burden, but underestimated fluorescence yield and suffered from localization artifacts. Full-angle measurements did not improve upon the transmission reconstruction qualitatively or in semi-quantitative measures of accuracy; anatomical and initial-value priors did improve reconstruction localization and accuracy for both transmission and full-angle schemes. Region-based reconstructions, in which the unknowns were reduced to a few distinct anatomical regions, produced highly accurate yield estimates for cortex, hippocampus and brain regions, even with a reduced number of measurements (144 source–detector pairs). PMID:19794239

The electron localization as the information content of the conditional pair density

DOE Office of Scientific and Technical Information (OSTI.GOV)

Urbina, Andres S.; Torres, F. Javier; Universidad San Francisco de Quito

2016-06-28

In the present work, the information gained by an electron for “knowing” about the position of another electron with the same spin is calculated using the Kullback-Leibler divergence (D{sub KL}) between the same-spin conditional pair probability density and the marginal probability. D{sub KL} is proposed as an electron localization measurement, based on the observation that regions of the space with high information gain can be associated with strong correlated localized electrons. Taking into consideration the scaling of D{sub KL} with the number of σ-spin electrons of a system (N{sup σ}), the quantity χ = (N{sup σ} − 1) D{sub KL}f{submore » cut} is introduced as a general descriptor that allows the quantification of the electron localization in the space. f{sub cut} is defined such that it goes smoothly to zero for negligible densities. χ is computed for a selection of atomic and molecular systems in order to test its capability to determine the region in space where electrons are localized. As a general conclusion, χ is able to explain the electron structure of molecules on the basis of chemical grounds with a high degree of success and to produce a clear differentiation of the localization of electrons that can be traced to the fluctuation in the average number of electrons in these regions.« less

MDMA (Ecstasy) association with impaired fMRI BOLD thalamic coherence and functional connectivity*

PubMed Central

Salomon, Ronald M.; Karageorgiou, John; Dietrich, Mary S.; McLellan, Jessica Y.; Charboneau, Evonne J.; Blackford, Jennifer U.; Cowan, Ronald L.

2011-01-01

Background MDMA exposure is associated with chronic serotonergic dysfunction in preclinical and clinical studies. A recent functional magnetic resonance imaging (fMRI) comparison of past MDMA users to non-MDMA-using controls revealed increased spatial extent and amplitude of activation in the supplementary motor area during motor tasks (Karageorgiou et al., 2009). Blood oxygenation level dependent (BOLD) data from that study were reanalyzed for intraregional coherence and for inter-regional temporal correlations between time series, as functional connectivity. Methods Fourteen MDMA users and ten controls reporting similar non-MDMA abuse performed finger taps during fMRI. Fourteen motor pathway regions plus a pontine raphé region were examined. Coherence was expressed as percent of voxels positively correlated with an intraregional index voxel. Functional connectivity was determined using wavelet correlations. Results Intraregional thalamic coherence was significantly diminished at low frequencies in MDMA users compared to controls (p=0.009). Inter-regional functional connectivity was significantly weaker for right thalamo - left caudate (p=0.002), right thalamo - left thalamus (p=0.007), right caudate - right postcentral (p=0.007) and right supplementary motor area - right precentral gyrus (p=0.011) region pairs compared to controls. When stratified by lifetime exposure, significant negative associations were observed between cumulative MDMA use and functional connectivity in seven other region-pairs, while only one region-pair showed a positive association. Conclusions Reported prior MDMA use was associated with deficits in BOLD intraregional coherence and inter-regional functional connectivity, even among functionally robust pathways involving motor regions. This suggests that MDMA use is associated with long-lasting effects on brain neurophysiology beyond the cognitive domain. PMID:21807471

Large-scale sequence and structural comparisons of human naive and antigen-experienced antibody repertoires

PubMed Central

DeKosky, Brandon J.; Lungu, Oana I.; Park, Daechan; Johnson, Erik L.; Charab, Wissam; Chrysostomou, Constantine; Kuroda, Daisuke; Ellington, Andrew D.; Ippolito, Gregory C.; Gray, Jeffrey J.; Georgiou, George

2016-01-01

Elucidating how antigen exposure and selection shape the human antibody repertoire is fundamental to our understanding of B-cell immunity. We sequenced the paired heavy- and light-chain variable regions (VH and VL, respectively) from large populations of single B cells combined with computational modeling of antibody structures to evaluate sequence and structural features of human antibody repertoires at unprecedented depth. Analysis of a dataset comprising 55,000 antibody clusters from CD19+CD20+CD27− IgM-naive B cells, >120,000 antibody clusters from CD19+CD20+CD27+ antigen–experienced B cells, and >2,000 RosettaAntibody-predicted structural models across three healthy donors led to a number of key findings: (i) VH and VL gene sequences pair in a combinatorial fashion without detectable pairing restrictions at the population level; (ii) certain VH:VL gene pairs were significantly enriched or depleted in the antigen-experienced repertoire relative to the naive repertoire; (iii) antigen selection increased antibody paratope net charge and solvent-accessible surface area; and (iv) public heavy-chain third complementarity-determining region (CDR-H3) antibodies in the antigen-experienced repertoire showed signs of convergent paired light-chain genetic signatures, including shared light-chain third complementarity-determining region (CDR-L3) amino acid sequences and/or Vκ,λ–Jκ,λ genes. The data reported here address several longstanding questions regarding antibody repertoire selection and development and provide a benchmark for future repertoire-scale analyses of antibody responses to vaccination and disease. PMID:27114511

Description of rotating N=Z nuclei in terms of isovector pairing

NASA Astrophysics Data System (ADS)

Afanasjev, A. V.; Frauendorf, S.

2005-06-01

A systematic investigation of the rotating N=Z even-even nuclei in the mass A=68-80 region has been performed within the frameworks of the cranked relativistic mean field, cranked relativistic Hartree-Bogoliubov theories, and cranked Nilsson-Strutinsky approach. Most of the experimental data are well accounted for in the calculations. The present study suggests the presence of strong isovector np pair field at low spin, whose strength is defined by the isospin symmetry. At high spin, the isovector pair field is destroyed and the data are well described by the calculations assuming zero pairing. No clear evidence for the existence of the isoscalar t=0 np pairing has been obtained in the present investigation performed at the mean field level.

Morphologies and ages of star cluster pairs and multiplets in the Small Magellanic Cloud

NASA Astrophysics Data System (ADS)

de Oliveira, M. R.; Dutra, C. M.; Bica, E.; Dottori, H.

2000-10-01

An isophotal atlas of 75 star cluster pairs and multiplets in the Small Magellanic Cloud is presented, comprising 176 objects. They are concentrated in the SMC main body. The isophotal contours were made from Digitized Sky Survey* images and showed relevant structural features possibly related to interactions in about 25% of the sample. Previous N-body simulations indicate that such shapes could be due to tidal tails, bridges or common envelopes. The diameter ratio between the members of a pair is preferentially in the range 1 - 2, with a peak at 1. The projected separation is in the range ~ 3 - 22 pc with a pronounced peak at ~ 13 pc. For 91 objects it was possible to derive ages from Colour-Magnitude Diagrams using the OGLE-II photometric survey. The cluster multiplets in general occur in OB stellar associations and/or HII region complexes. This indicates a common origin and suggests that multiplets coalesce into pairs or single clusters in a short time scale. Pairs in the SMC appear to be mostly coeval and consequently captures are a rare phenomenon. We find evidence that star cluster pairs and multiplets may have had an important role in the dynamical history of clusters presently seen as large single objects. The images in this study are based on photographic data obtained using the UK Schmidt Telescope, which was operated by the Royal Observatory Edinburgh, with funding from the UK Science and Engineering Research Council, until 1988 June, and thereafter by the Anglo-Australian Observatory. Original plate material is copyright by the Royal Observatory Edinburgh and the Anglo-Australian Observatory. The plates were processed into the present compressed digital form with their permission. The Digitized Sky Survey was produced at the Space Telescope Science Institute under US Government grant NAG W-2166.

Multimodal sparse reconstruction in guided wave imaging of defects in plates

NASA Astrophysics Data System (ADS)

Golato, Andrew; Santhanam, Sridhar; Ahmad, Fauzia; Amin, Moeness G.

2016-07-01

A multimodal sparse reconstruction approach is proposed for localizing defects in thin plates in Lamb wave-based structural health monitoring. The proposed approach exploits both the sparsity of the defects and the multimodal nature of Lamb wave propagation in plates. It takes into account the variation of the defects' aspect angles across the various transducer pairs. At low operating frequencies, only the fundamental symmetric and antisymmetric Lamb modes emanate from a transmitting transducer. Asymmetric defects scatter these modes and spawn additional converted fundamental modes. Propagation models are developed for each of these scattered and spawned modes arriving at the various receiving transducers. This enables the construction of modal dictionary matrices spanning a two-dimensional array of pixels representing potential defect locations in the region of interest. Reconstruction of the region of interest is achieved by inverting the resulting linear model using the group sparsity constraint, where the groups extend across the various transducer pairs and the different modes. The effectiveness of the proposed approach is established with finite-element scattering simulations of the fundamental Lamb wave modes by crack-like defects in a plate. The approach is subsequently validated with experimental results obtained from an aluminum plate with asymmetric defects.

Functional characteristics of the calcium modulated proteins seen from an evolutionary perspective

NASA Technical Reports Server (NTRS)

Kretsinger, R. H.; Nakayama, S.; Moncrief, N. D.

1991-01-01

We have constructed dendrograms relating 173 EF-hand proteins of known amino acid sequence. We aligned all of these proteins by their EF-hand domains, omitting interdomain regions. Initial dendrograms were computed by minimum mutation distance methods. Using these as starting points, we determined the best dendrogram by the method of maximum parsimony, scored by minimum mutation distance. We identified 14 distinct subfamilies as well as 6 unique proteins that are perhaps the sole representatives of other subfamilies. This information is given in tabular form. Within subfamilies one can easily align interdomain regions. The resulting dendrograms are very similar to those computed using domains only. Dendrograms constructed using pairs of domains show general congruence. However, there are enough exceptions to caution against an overly simple scheme in which one pair of gene duplications leads from one domain precurser to a four domain prototype from which all other forms evolved. The ability to bind calcium was lost and acquired several times during evolution. The distribution of introns does not conform to the dendrogram based on amino acid sequences. The rates of evolution appear to be much slower within subfamilies, especially within calmodulin, than those prior to the definition of subfamily.

NATpipe: an integrative pipeline for systematical discovery of natural antisense transcripts (NATs) and phase-distributed nat-siRNAs from de novo assembled transcriptomes

PubMed Central

Yu, Dongliang; Meng, Yijun; Zuo, Ziwei; Xue, Jie; Wang, Huizhong

2016-01-01

Nat-siRNAs (small interfering RNAs originated from natural antisense transcripts) are a class of functional small RNA (sRNA) species discovered in both plants and animals. These siRNAs are highly enriched within the annealed regions of the NAT (natural antisense transcript) pairs. To date, great research efforts have been taken for systematical identification of the NATs in various organisms. However, developing a freely available and easy-to-use program for NAT prediction is strongly demanded by researchers. Here, we proposed an integrative pipeline named NATpipe for systematical discovery of NATs from de novo assembled transcriptomes. By utilizing sRNA sequencing data, the pipeline also allowed users to search for phase-distributed nat-siRNAs within the perfectly annealed regions of the NAT pairs. Additionally, more reliable nat-siRNA loci could be identified based on degradome sequencing data. A case study on the non-model plant Dendrobium officinale was performed to illustrate the utility of NATpipe. Finally, we hope that NATpipe would be a useful tool for NAT prediction, nat-siRNA discovery, and related functional studies. NATpipe is available at www.bioinfolab.cn/NATpipe/NATpipe.zip. PMID:26858106

Optimal sensor placement for active guided wave interrogation of complex metallic components

NASA Astrophysics Data System (ADS)

Coelho, Clyde K.; Kim, Seung Bum; Chattopadhyay, Aditi

2011-04-01

With research in structural health monitoring (SHM) moving towards increasingly complex structures for damage interrogation, the placement of sensors is becoming a key issue in the performance of the damage detection methodologies. For ultrasonic wave based approaches, this is especially important because of the sensitivity of the travelling Lamb waves to material properties, geometry and boundary conditions that may obscure the presence of damage if they are not taken into account during sensor placement. The framework proposed in this paper defines a sensing region for a pair of piezoelectric transducers in a pitch-catch damage detection approach by taking into account the material attenuation and probability of false alarm. Using information about the region interrogated by a sensoractuator pair, a simulated annealing optimization framework was implemented in order to place sensors on complex metallic geometries such that a selected minimum damage type and size could be detected with an acceptable probability of false alarm anywhere on the structure. This approach was demonstrated on a lug joint to detect a crack and on a large Naval SHM test bed and resulted in a placement of sensors that was able to interrogate all parts of the structure using the minimum number of transducers.

Correlated inter-regional variations in low frequency local field potentials and resting state BOLD signals within S1 cortex of monkeys.

PubMed

Wilson, George H; Yang, Pai-Feng; Gore, John C; Chen, Li Min

2016-08-01

The hypothesis that specific frequency components of the spontaneous local field potentials (LFPs) underlie low frequency fluctuations of resting state fMRI (rsfMRI) signals was tested. The previous analyses of rsfMRI signals revealed differential inter-regional correlations among areas 3a, 3b, and 1 of primary somatosensory cortex (S1) in anesthetized monkeys (Wang et al. [2013]: Neuron 78:1116-1126). Here LFP band(s) which correlated between S1 regions, and how these inter-regional correlation differences covaried with rsfMRI signals were examined. LFP signals were filtered into seven bands (delta, theta, alpha, beta, gamma low, gamma high, and gamma very high), and then a Hilbert transformation was applied to obtain measures of instantaneous amplitudes and temporal lags between regions of interest (ROI) digit-digit pairs (areas 3b-area 1, area 3a-area 1, area 3a-area 3b) and digit-face pairs (area 3b-face, area 1-face, and area 3a-face). It was found that variations in the inter-regional correlation strengths between digit-digit and digit-face pairs in the delta (1-4 Hz), alpha (9-14 Hz), beta (15-30 Hz), and gamma (31-50 Hz) bands parallel those of rsfMRI signals to varying degrees. Temporal lags between digit-digit area pairs varied across LFP bands, with area 3a mostly leading areas 1/2 and 3b. In summary, the data demonstrates that the low and middle frequency range (1-50 Hz) of spontaneous LFP signals similarly covary with the low frequency fluctuations of rsfMRI signals within local circuits of S1, supporting a neuronal electrophysiological basis of rsfMRI signals. Inter-areal LFP temporal lag differences provided novel insights into the directionality of information flow among S1 areas at rest. Hum Brain Mapp 37:2755-2766, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Benchmarking database performance for genomic data.

PubMed

Khushi, Matloob

2015-06-01

Genomic regions represent features such as gene annotations, transcription factor binding sites and epigenetic modifications. Performing various genomic operations such as identifying overlapping/non-overlapping regions or nearest gene annotations are common research needs. The data can be saved in a database system for easy management, however, there is no comprehensive database built-in algorithm at present to identify overlapping regions. Therefore I have developed a novel region-mapping (RegMap) SQL-based algorithm to perform genomic operations and have benchmarked the performance of different databases. Benchmarking identified that PostgreSQL extracts overlapping regions much faster than MySQL. Insertion and data uploads in PostgreSQL were also better, although general searching capability of both databases was almost equivalent. In addition, using the algorithm pair-wise, overlaps of >1000 datasets of transcription factor binding sites and histone marks, collected from previous publications, were reported and it was found that HNF4G significantly co-locates with cohesin subunit STAG1 (SA1).Inc. © 2015 Wiley Periodicals, Inc.

Base Pair Opening in a Deoxynucleotide Duplex Containing a cis-syn Thymine Cyclobutane Dimer Lesion

PubMed Central

Wenke, Belinda B.; Huiting, Leah N.; Frankel, Elisa B.; Lane, Benjamin F.; Núñez, Megan E.

2014-01-01

The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair Kop. In the normal duplex Kop decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a Kop of 8×10−7. In contrast, base pair opening at the 5’T of the thymine dimer is facile. The 5’T of the dimer has the largest equilibrium constant (Kop =3×10−4) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3’T of the dimer is much more stable than by the 5’T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5’ side more than on the 3’ side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions. PMID:24328089

Mapping interactions between the RNA chaperone FinO and its RNA targets

PubMed Central

Arthur, David C.; Tsutakawa, Susan; Tainer, John A.; Frost, Laura S.; Glover, J. N. Mark

2011-01-01

Bacterial conjugation is regulated by two-component repression comprising the antisense RNA FinP, and its protein co-factor FinO. FinO mediates base-pairing of FinP to the 5′-untranslated region (UTR) of traJ mRNA, which leads to translational inhibition of the transcriptional activator TraJ and subsequent down regulation of conjugation genes. Yet, little is known about how FinO binds to its RNA targets or how this interaction facilitates FinP and traJ mRNA pairing. Here, we use solution methods to determine how FinO binds specifically to its minimal high affinity target, FinP stem–loop II (SLII), and its complement SLIIc from traJ mRNA. Ribonuclease footprinting reveals that FinO contacts the base of the stem and the 3′ single-stranded tails of these RNAs. The phosphorylation or oxidation of the 3′-nucleotide blocks FinO binding, suggesting FinO binds the 3′-hydroxyl of its RNA targets. The collective results allow the generation of an energy-minimized model of the FinO–SLII complex, consistent with small-angle X-ray scattering data. The repression complex model was constrained using previously reported cross-linking data and newly developed footprinting results. Together, these data lead us to propose a model of how FinO mediates FinP/traJ mRNA pairing to down regulate bacterial conjugation. PMID:21278162

Working better together: joint leadership development for doctors and managers.

PubMed

Kelly, Nicola

2014-01-01

Traditionally, there have been tensions between frontline healthcare professionals and managers, with well-known stereotypes of difficult consultants and pen-pushing managers. Many junior doctors have limited management experience and have often never even met a manager prior to taking on a consultant role. Based on a successful programme pioneered by Dr Robert Klaber (Imperial, London) we have set-up an innovative scheme for Birmingham Children's Hospital, pairing junior doctors and managers to learn and work together. Our aim was to cultivate positive attitudes and understanding between the two groups, break down inter-professional barriers, and to provide practical leadership experience and education. We recruited 60 managers and doctors to participate in shadowing, conversation, and quality improvement projects. Thought-provoking online materials, blogs, socials, and popular monthly workshops consisting of patient-focused debate and discussion around key leadership themes, have helped to support learning and cement shared values. Formal evaluation has demonstrated an improvement in how participants perceive their knowledge and ability based on key NHS Leadership Framework competencies. Participant feedback has been extremely positive, and everyone plans to continue to incorporate Paired Learning into their continuing professional development. We are now embedding Paired Learning in the on-going educational programme offered at Birmingham Children's Hospital, whilst looking at extending the scheme to include different professional groups and other trusts across the region and nationally.

Brain substrates of unhealthy versus healthy food choices: influence of homeostatic status and body mass index.

PubMed

Harding, I H; Andrews, Z B; Mata, F; Orlandea, S; Martínez-Zalacaín, I; Soriano-Mas, C; Stice, E; Verdejo-Garcia, A

2018-03-01

Unhealthy dietary choices are a major contributor to harmful weight gain and obesity. This study interrogated the brain substrates of unhealthy versus healthy food choices in vivo, and evaluated the influence of hunger state and body mass index (BMI) on brain activation and connectivity. Thirty adults (BMI: 18-38 kg m -2 ) performed a food-choice task involving preference-based selection between beverage pairs consisting of high-calorie (unhealthy) or low-calorie (healthy) options, concurrent with functional magnetic resonance imaging (fMRI). Selected food stimuli were delivered to participants using an MRI-compatible gustometer. fMRI scans were performed both after 10-h fasting and when sated. Brain activation and hypothalamic functional connectivity were assessed when selecting between unhealthy-healthy beverage pairings, relative to unhealthy-unhealthy and healthy-healthy options. Results were considered significant at cluster-based family-wise error corrected P<0.05. Selecting between unhealthy and healthy foods elicited significant activation in the hypothalamus, the medial and dorsolateral prefrontal cortices, the anterior insula and the posterior cingulate. Hunger was associated with higher activation within the ventromedial and dorsolateral prefrontal cortices, as well as lower connectivity between the hypothalamus and both the ventromedial prefrontal cortex and dorsal striatum. Critically, people with higher BMI showed lower activation of the hypothalamus-regardless of hunger state-and higher activation of the ventromedial prefrontal cortex when hungry. People who are overweight and obese have weaker activation of brain regions involved in energy regulation and greater activation of reward valuation regions while making choices between unhealthy and healthy foods. These results provide evidence for a shift towards hedonic-based, and away from energy-based, food selection in obesity.

A basis for bias in geographical judgments.

PubMed

Friedman, Alinda; Brown, Norman R; McGaffey, Aaron P

2002-03-01

To determine why North Americans tend to locate European cities south of North American cities at similar latitudes (Tversky, 1981), we had observers provide bearing estimates between cities in the U.S. and Europe. Earlier research using latitude estimates of these cities has indicated that each continent has several subjective regions (Friedman & Brown, 2000a). Participants judged cities from two subjectively northern regions (Milwaukee-Munich), two subjectively southern regions (Memphis-Lisbon), and the two "crossed" regions (Albuquerque-Geneva; Minneapolis-Rome). Estimates were biased only when cities from the subjectively northern regions of North America were paired with cities from the subjectively southern region of Europe. In contrast to the view that biases are derived from distorted or aligned map-like representations, the data provide evidence that the subjective representation of global geography is principally categorical. Biases in numerical location estimates of individual cities and in bearing estimates between city pairs are derived from plausible reasoning processes operating on the same categorical representations.

Ten-Meter Scale Topography and Roughness of Mars Exploration Rovers Landing Sites and Martian Polar Regions

NASA Technical Reports Server (NTRS)

Ivanov, Anton B.

2003-01-01

The Mars Orbiter Camera (MOC) has been operating on board of the Mars Global Surveyor (MGS) spacecraft since 1998. It consists of three cameras - Red and Blue Wide Angle cameras (FOV=140 deg.) and Narrow Angle camera (FOV=0.44 deg.). The Wide Angle camera allows surface resolution down to 230 m/pixel and the Narrow Angle camera - down to 1.5 m/pixel. This work is a continuation of the project, which we have reported previously. Since then we have refined and improved our stereo correlation algorithm and have processed many more stereo pairs. We will discuss results of our stereo pair analysis located in the Mars Exploration rovers (MER) landing sites and address feasibility of recovering topography from stereo pairs (especially in the polar regions), taken during MGS 'Relay-16' mode.

Giant oscillating magnetoresistance in silicene-based structures

NASA Astrophysics Data System (ADS)

Oubram, O.; Navarro, O.; Rodríguez-Vargas, I.; Guzman, E. J.; Cisneros-Villalobos, L.; Velásquez-Aguilar, J. G.

2018-02-01

Ballistic electron transport in a silicene structure, composed of a pair of magnetic gates, in the ferromagnetic and an-tiferromagnetic configuration is studied. This theoretical study has been done using the matrix transfer method to calculate the transmission, the conductance for parallel and antiparallel magnetic alignment and the magnetoresistance. Results show that conductance and magnetoresistance oscillate as a function of the length between the two magnetic domains. The forbidden transmission region also increases as a function of the barrier separation distance.

Promoters, toll like receptors and microRNAs: a strange association.

PubMed

Korla, Kalyani; Arrigo, Patrizio; Mitra, Chanchal K

2013-06-01

Toll-like receptors (TLRs) are proteins that play key role in the innate immune system. In the present study, -1000 base pairs upstream are taken from the transcription start site of the various TLR genes (10 known) in human. About 40 microRNAs have been identified that share 12-19 nucleotide sequence similarity with the promoter regions of 10 TLRs. It is proposed that the microRNA performs potential role in identification of promoter sequence and initiation of transcription.

Understanding the Double Quantum Muonium RF Resonance

NASA Astrophysics Data System (ADS)

Kreitzman, S. R.; Cottrell, S. P.; Fleming, D. G.; Sun-Mack, S.

A physically intuitive analytical solution to the Mu + RF Hamiltonian and lineshape is developed. The method is based on reformulating the problem in a basis set that explicitly accounts for the 1q RF transitions and identifying an isolated upper 1q quasi-eigenstate within that basis. Subsequently the double quantum resonance explicitly manifests itself via the non-zero interaction term between the pair of lower ortho-normalized 1q basis states, which in this field region are substantially the | \\uparrow \\uparrow > and | \\downarrow \\downarrow > Mu states.

Imidazopyridine/Pyrrole and hydroxybenzimidazole/pyrrole pairs for DNA minor groove recognition.

PubMed

Renneberg, Dorte; Dervan, Peter B

2003-05-14

The DNA binding properties of fused heterocycles imidazo[4,5-b]pyridine (Ip) and hydroxybenzimidazole (Hz) paired with pyrrole (Py) in eight-ring hairpin polyamides are reported. The recognition profile of Ip/Py and Hz/Py pairs were compared to the five-membered ring pairs Im/Py and Hp/Py on a DNA restriction fragment at four 6-base pair recognition sites which vary at a single position 5'-TGTNTA-3', where N = G, C, T, A. The Ip/Py pair distinguishes G.C from C.G, T.A, and A.T, and the Hz/Py pair distinguishes T.A from A.T, G.C, and C.G, affording a new set of heterocycle pairs to target the four Watson-Crick base pairs in the minor groove of DNA.

Mapping heritability and molecular genetic associations with cortical features using probabilistic brain atlases: methods and applications to schizophrenia.

PubMed

Cannon, Tyrone D; Thompson, Paul M; van Erp, Theo G M; Huttunen, Matti; Lonnqvist, Jouko; Kaprio, Jaakko; Toga, Arthur W

2006-01-01

There is an urgent need to decipher the complex nature of genotype-phenotype relationships within the multiple dimensions of brain structure and function that are compromised in neuropsychiatric syndromes such as schizophrenia. Doing so requires sophisticated methodologies to represent population variability in neural traits and to probe their heritable and molecular genetic bases. We have recently developed and applied computational algorithms to map the heritability of, as well as genetic linkage and association to, neural features encoded using brain imaging in the context of three-dimensional (3D), populationbased, statistical brain atlases. One set of algorithms builds on our prior work using classical twin study methods to estimate heritability by fitting biometrical models for additive genetic, unique, and common environmental influences. Another set of algorithms performs regression-based (Haseman-Elston) identical-bydescent linkage analysis and genetic association analysis of DNA polymorphisms in relation to neural traits of interest in the same 3D population-based brain atlas format. We demonstrate these approaches using samples of healthy monozygotic (MZ) and dizygotic (DZ) twin pairs, as well as MZ and DZ twin pairs discordant for schizophrenia, but the methods can be generalized to other classes of relatives and to other diseases. The results confirm prior evidence of genetic influences on gray matter density in frontal brain regions. They also provide converging evidence that the chromosome 1q42 region is relevant to schizophrenia by demonstrating linkage and association of markers of the Transelin-Associated-Factor-X and Disrupted-In- Schizophrenia-1 genes with prefrontal cortical gray matter deficits in twins discordant for schizophrenia.

Sequence periodicity in nucleosomal DNA and intrinsic curvature.

PubMed

Nair, T Murlidharan

2010-05-17

Most eukaryotic DNA contained in the nucleus is packaged by wrapping DNA around histone octamers. Histones are ubiquitous and bind most regions of chromosomal DNA. In order to achieve smooth wrapping of the DNA around the histone octamer, the DNA duplex should be able to deform and should possess intrinsic curvature. The deformability of DNA is a result of the non-parallelness of base pair stacks. The stacking interaction between base pairs is sequence dependent. The higher the stacking energy the more rigid the DNA helix, thus it is natural to expect that sequences that are involved in wrapping around the histone octamer should be unstacked and possess intrinsic curvature. Intrinsic curvature has been shown to be dictated by the periodic recurrence of certain dinucleotides. Several genome-wide studies directed towards mapping of nucleosome positions have revealed periodicity associated with certain stretches of sequences. In the current study, these sequences have been analyzed with a view to understand their sequence-dependent structures. Higher order DNA structures and the distribution of molecular bend loci associated with 146 base nucleosome core DNA sequence from C. elegans and chicken have been analyzed using the theoretical model for DNA curvature. The curvature dispersion calculated by cyclically permuting the sequences revealed that the molecular bend loci were delocalized throughout the nucleosome core region and had varying degrees of intrinsic curvature. The higher order structures associated with nucleosomes of C.elegans and chicken calculated from the sequences revealed heterogeneity with respect to the deviation of the DNA axis. The results points to the possibility of context dependent curvature of varying degrees to be associated with nucleosomal DNA.

Pair bond formation leads to a sustained increase in global cerebral glucose metabolism in monogamous male titi monkeys (Callicebus cupreus).

PubMed

Maninger, Nicole; Hinde, Katie; Mendoza, Sally P; Mason, William A; Larke, Rebecca H; Ragen, Benjamin J; Jarcho, Michael R; Cherry, Simon R; Rowland, Douglas J; Ferrer, Emilio; Bales, Karen L

2017-04-21

Social bonds, especially attachment relationships, are crucial to our health and happiness. However, what we know about the neural substrates of these bonds is almost exclusively limited to rodent models and correlational experiments in humans. Here, we used socially monogamous non-human primates, titi monkeys (Callicebus cupreus) to experimentally examine changes in regional and global cerebral glucose metabolism (GCGM) during the formation and maintenance of pair bonds. Baseline positron emission tomography (PET) scans were taken of thirteen unpaired male titi monkeys. Seven males were then experimentally paired with females, scanned and compared, after one week, to six age-matched control males. Five of the six control males were then also paired and scanned after one week. Scans were repeated on all males after four months of pairing. PET scans were coregistered with structural magnetic resonance imaging (MRI), and region of interest (ROI) analysis was carried out. A primary finding was that paired males showed a significant increase in [ 18 F]-fluorodeoxyglucose (FDG) uptake in whole brain following one week of pairing, which is maintained out to four months. Dopaminergic, "motivational" areas and those involved in social behavior showed the greatest change in glucose uptake. In contrast, control areas changed only marginally more than GCGM. These findings confirm the large effects of social bonds on GCGM. They also suggest that more studies should examine how social manipulations affect whole-brain FDG uptake, as opposed to assuming that it does not change across condition. Copyright © 2017 IBRO. Published by Elsevier Ltd. All rights reserved.

Pair bond Formation Leads to a Sustained Increase in Global Cerebral Glucose Metabolism in Monogamous Male Titi Monkeys (Callicebus cupreus)

PubMed Central

Maninger, Nicole; Hinde, Katie; Mendoza, Sally P.; Mason, William A.; Larke, Rebecca H.; Ragen, Benjamin J; Jarcho, Michael R.; Cherry, Simon R.; Rowland, Douglas J.; Ferrer, Emilio; Bales, Karen L.

2017-01-01

Social bonds, especially attachment relationships, are crucial to our health and happiness. However, what we know about the neural substrates of these bonds is almost exclusively limited to rodent models and correlational experiments in humans. Here, we used socially monogamous non-human primates, titi monkeys (Callicebus cupreus) to experimentally examine changes in regional and global cerebral glucose metabolism during the formation and maintenance of pair bonds. Baseline positron emission tomography (PET) scans were taken of thirteen unpaired male titi monkeys. Seven males were then experimentally paired with females, scanned and compared, after one week, to six age-matched control males. Five of the six control males were then also paired and scanned after one week. Scans were repeated on all males after four months of pairing. PET scans were coregistered with structural magnetic resonance imaging (MRI), and region of interest (ROI) analysis was carried out. A primary finding was that paired males showed a significant increase in FDG uptake in whole brain following one week of pairing, which is maintained out to four months. Dopaminergic, “motivational” areas and those involved in social behavior showed the greatest change in glucose uptake. In contrast, control areas changed only marginally more than GCGM. These findings confirm the large effects of social bonds on global cerebral glucose metabolism. They also suggest that more studies should examine how social manipulations affect whole brain FDG uptake, as opposed to assuming that it does not change across condition. PMID:28242440

Hydrological Footprints of Urban Developments in the Lake Simcoe Watershed, Canada: A Combined Paired-Catchment and Change Detection Modeling Approach

NASA Astrophysics Data System (ADS)

Oni, S. K.; Futter, M. N.; Buttle, J. M.; Dillon, P.

2014-12-01

Urban sprawl and regional climate variability are major stresses on surface water resources in many places. The Lake Simcoe watershed (LSW) Ontario, Canada, is no exception. The LSW is predominantly agricultural but is experiencing rapid population growth due to its proximity to the greater Toronto area. This has led to extensive land use changes which have impacted its water resources and altered runoff patterns in some rivers draining to the lake. Here, we use a paired-catchment approach, hydrological change detection modelling and remote sensing analysis of satellite images to evaluate the impacts of land use change on the hydrology of the LSW (1994 to 2008). Results show that urbanization increased up to 16% in Lovers Creek, the most-urban impacted catchment. Annual runoff from Lovers Creek increased from 239 to 442 mm/yr in contrast to the reference catchment (Black River at Washago) where runoff was relatively stable with an annual mean of 474 mm/yr. Increased annual runoff from Lovers Creek was not accompanied by an increase in annual precipitation. Discriminant function analysis suggests that early (1992-1997; pre-major development) and late (2004-2009; fully urbanized) periods for Lovers Creek separated mainly based on model parameter sets related to runoff flashiness and evapotranspiration. As a result, parameterization in either period cannot be used interchangeably to produce credible runoff simulations in Lovers Creek due to greater scatter between the parameters in canonical space. Separation of early and late period parameter sets for the reference catchment was based on climate and snowmelt related processes. This suggests that regional climatic variability could be influencing hydrologic change in the reference catchment whereas urbanization amplified the regional natural hydrologic changes in urbanizing catchments of the LSW.

Semantic congruence affects hippocampal response to repetition of visual associations.

PubMed

McAndrews, Mary Pat; Girard, Todd A; Wilkins, Leanne K; McCormick, Cornelia

2016-09-01

Recent research has shown complementary engagement of the hippocampus and medial prefrontal cortex (mPFC) in encoding and retrieving associations based on pre-existing or experimentally-induced schemas, such that the latter supports schema-congruent information whereas the former is more engaged for incongruent or novel associations. Here, we attempted to explore some of the boundary conditions in the relative involvement of those structures in short-term memory for visual associations. The current literature is based primarily on intentional evaluation of schema-target congruence and on study-test paradigms with relatively long delays between learning and retrieval. We used a continuous recognition paradigm to investigate hippocampal and mPFC activation to first and second presentations of scene-object pairs as a function of semantic congruence between the elements (e.g., beach-seashell versus schoolyard-lamp). All items were identical at first and second presentation and the context scene, which was presented 500ms prior to the appearance of the target object, was incidental to the task which required a recognition response to the central target only. Very short lags 2-8 intervening stimuli occurred between presentations. Encoding the targets with congruent contexts was associated with increased activation in visual cortical regions at initial presentation and faster response time at repetition, but we did not find enhanced activation in mPFC relative to incongruent stimuli at either presentation. We did observe enhanced activation in the right anterior hippocampus, as well as regions in visual and lateral temporal and frontal cortical regions, for the repetition of incongruent scene-object pairs. This pattern demonstrates rapid and incidental effects of schema processing in hippocampal, but not mPFC, engagement during continuous recognition. Copyright © 2016 Elsevier Ltd. All rights reserved.

Stacking interactions and DNA intercalation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Dr. Shen; Cooper, Valentino R; Thonhauser, Prof. Timo

2009-01-01

The relationship between stacking interactions and the intercalation of proflavine and ellipticine within DNA is investigated using a nonempirical van der Waals density functional for the correlation energy. Our results, employing a binary stack model, highlight fundamental, qualitative differences between base-pair base-pair interactions and that of the stacked intercalator base pair system. Most notable result is the paucity of torque which so distinctively defines the Twist of DNA. Surprisingly, this model, when combined with a constraint on the twist of the surrounding base-pair steps to match the observed unwinding of the sugar-phosphate backbone, was sufficient for explaining the experimentally observedmore » proflavine intercalator configuration. Our extensive mapping of the potential energy surface of base-pair intercalator interactions can provide valuable information for future nonempirical studies of DNA intercalation dynamics.« less

Repetitive DNAs highlight the role of chromosomal fusions in the karyotype evolution of Dascyllus species (Pomacentridae, Perciformes).

PubMed

Getlekha, Nuntaporn; Molina, Wagner Franco; de Bello Cioffi, Marcelo; Yano, Cassia Fernanda; Maneechot, Nuntiya; Bertollo, Luiz Antonio Carlos; Supiwong, Weerayuth; Tanomtong, Alongklod

2016-04-01

The Dascyllus genus consists of 11 species spread over vast regions of the Indo-Pacific, showing remarkable reductions in the diploid chromosome numbers (2n). The present study analyzed the karyotypes and other chromosomal characteristics of D. trimaculatus (2n = 48; 2st + 46a; NF = 50), D. carneus (2n = 48; 2st + 46a; NF = 50) and D. aruanus (2n = 30; 18m + 2st + 10a; NF = 50) from the Thailand Gulf (Pacific Ocean) and D. melanurus (2n = 48; 2st + 46a; NF = 50) from the Andaman Sea (Indian Ocean), employing conventional cytogenetic analyses and the chromosomal mapping of repetitive DNAs, using 18S and 5S rDNA, telomeric sequences and (CA)15, (GA)15, and (CAA)10 microsatellites as probes. The C-positive heterochromatin was found in the centromeric regions of most chromosomal pairs and 18S rDNA phenotypes were single in all species. However, in D. aruanus (2n = 30), which harbors nine metacentric pairs; the 5S rDNA sites were located in the centromeric region of the shortest one. The mapping of the telomeric sequences in D. aruanus revealed the presence of interstitial telomeric sites (ITS) in the centromeric region of four metacentric pairs, with one of these pairs also displaying an additional ITS in the long arms. Distinct chromosomal markers confirmed the reduction of the 2n by chromosomal fusions, highlighting the precise characterization of these rearrangements by the cytogenetic mapping of the repetitive DNAs.

Regional and local species richness in an insular environment: Serpentine plants in California

USGS Publications Warehouse

Harrison, S.; Safford, H.D.; Grace, J.B.; Viers, J.H.; Davies, K.F.

2006-01-01

We asked how the richness of the specialized (endemic) flora of serpentine rock outcrops in California varies at both the regional and local scales. Our study had two goals: first, to test whether endemic richness is affected by spatial habitat structure (e.g., regional serpentine area, local serpentine outcrop area, regional and local measures of outcrop isolation), and second, to conduct this test in the context of a broader assessment of environmental influences (e.g., climate, soils, vegetation, disturbance) and historical influences (e.g., geologic age, geographic province) on local and regional species richness. We measured endemic and total richness and environmental variables in 109 serpentine sites (1000-m2 paired plots) in 78 serpentine-containing regions of the state. We used structural equation modeling (SEM) to simultaneously relate regional richness to regionalscale predictors, and local richness to both local-scale and regional-scale predictors. Our model for serpentine endemics explained 66% of the variation in local endemic richness based on local environment (vegetation, soils, rock cover) and on regional endemic richness. It explained 73% of the variation in regional endemic richness based on regional environment (climate and productivity), historical factors (geologic age and geographic province), and spatial structure (regional total area of serpentine, the only significant spatial variable in our analysis). We did not find a strong influence of spatial structure on species richness. However, we were able to distinguish local vs. regional influences on species richness to a novel extent, despite the existence of correlations between local and regional conditions. ?? 2006 by the Ecological Society of America.

Elaboration versus suppression of cued memories: influence of memory recall instruction and success on parietal lobe, default network, and hippocampal activity.

PubMed

Gimbel, Sarah I; Brewer, James B

2014-01-01

Functional imaging studies of episodic memory retrieval consistently report task-evoked and memory-related activity in the medial temporal lobe, default network and parietal lobe subregions. Associated components of memory retrieval, such as attention-shifts, search, retrieval success, and post-retrieval processing also influence regional activity, but these influences remain ill-defined. To better understand how top-down control affects the neural bases of memory retrieval, we examined how regional activity responses were modulated by task goals during recall success or failure. Specifically, activity was examined during memory suppression, recall, and elaborative recall of paired-associates. Parietal lobe was subdivided into dorsal (BA 7), posterior ventral (BA 39), and anterior ventral (BA 40) regions, which were investigated separately to examine hypothesized distinctions in sub-regional functional responses related to differential attention-to-memory and memory strength. Top-down suppression of recall abolished memory strength effects in BA 39, which showed a task-negative response, and BA 40, which showed a task-positive response. The task-negative response in default network showed greater negatively-deflected signal for forgotten pairs when task goals required recall. Hippocampal activity was task-positive and was influenced by memory strength only when task goals required recall. As in previous studies, we show a memory strength effect in parietal lobe and hippocampus, but we show that this effect is top-down controlled and sensitive to whether the subject is trying to suppress or retrieve a memory. These regions are all implicated in memory recall, but their individual activity patterns show distinct memory-strength-related responses when task goals are varied. In parietal lobe, default network, and hippocampus, top-down control can override the commonly identified effects of memory strength.

Pervasive pleiotropy between psychiatric disorders and immune disorders revealed by integrative analysis of multiple GWAS

PubMed Central

Wang, Qian; Yang, Can; Gelernter, Joel; Zhao, Hongyu

2015-01-01

Although some existing epidemiological observations and molecular experiments suggested that brain disorders in the realm of psychiatry may be influenced by immune dysregulation, the degree of genetic overlap between psychiatric disorders and immune disorders has not been well established. We investigated this issue by integrative analysis of genome-wide association studies of 18 complex human traits/diseases (five psychiatric disorders, seven immune disorders, and others) and multiple genome-wide annotation resources (Central nervous system genes, immune-related expression-quantitative trait loci (eQTL) and DNase I hypertensive sites from 98 cell-lines). We detected pleiotropy in 24 of the 35 psychiatric-immune disorder pairs. The strongest pleiotropy was observed for schizophrenia-rheumatoid arthritis with MHC region included in the analysis (p = 3.9 × 10−285), and schizophrenia-Crohns disease with MHC region excluded (p = 1.1 × 10−36). Significant enrichment (>1.4 fold) of immune-related eQTL was observed in four psychiatric disorders. Genomic regions responsible for pleiotropy between psychiatric disorders and immune disorders were detected. The MHC region on chromosome 6 appears to be the most important with other regions, such as cytoband 1p13.2, also playing significant roles in pleiotropy. We also found that most alleles shared between schizophrenia and Crohns disease have the same effect direction, with similar trend found for other disorder pairs, such as bipolar-Crohn’s disease. Our results offer a novel birds-eye view of the genetic relationship and demonstrate strong evidence for pervasive pleiotropy between psychiatric disorders and immune disorders. Our findings might open new routes for prevention and treatment strategies for these disorders based on a new appreciation of the importance of immunological mechanisms in mediating risk of many psychiatric diseases. PMID:26340901

Elaboration versus Suppression of Cued Memories: Influence of Memory Recall Instruction and Success on Parietal Lobe, Default Network, and Hippocampal Activity

PubMed Central

Gimbel, Sarah I.; Brewer, James B.

2014-01-01

Functional imaging studies of episodic memory retrieval consistently report task-evoked and memory-related activity in the medial temporal lobe, default network and parietal lobe subregions. Associated components of memory retrieval, such as attention-shifts, search, retrieval success, and post-retrieval processing also influence regional activity, but these influences remain ill-defined. To better understand how top-down control affects the neural bases of memory retrieval, we examined how regional activity responses were modulated by task goals during recall success or failure. Specifically, activity was examined during memory suppression, recall, and elaborative recall of paired-associates. Parietal lobe was subdivided into dorsal (BA 7), posterior ventral (BA 39), and anterior ventral (BA 40) regions, which were investigated separately to examine hypothesized distinctions in sub-regional functional responses related to differential attention-to-memory and memory strength. Top-down suppression of recall abolished memory strength effects in BA 39, which showed a task-negative response, and BA 40, which showed a task-positive response. The task-negative response in default network showed greater negatively-deflected signal for forgotten pairs when task goals required recall. Hippocampal activity was task-positive and was influenced by memory strength only when task goals required recall. As in previous studies, we show a memory strength effect in parietal lobe and hippocampus, but we show that this effect is top-down controlled and sensitive to whether the subject is trying to suppress or retrieve a memory. These regions are all implicated in memory recall, but their individual activity patterns show distinct memory-strength-related responses when task goals are varied. In parietal lobe, default network, and hippocampus, top-down control can override the commonly identified effects of memory strength. PMID:24586492

Pairing states of superfluid 3He in uniaxially anisotropic aerogel

NASA Astrophysics Data System (ADS)

Aoyama, Kazushi; Ikeda, Ryusuke

2006-02-01

Stable pairing states of superfluid 3He in aerogel are examined in the case with a global uniaxial anisotropy which may be created by applying a uniaxial stress to the aerogel. Due to such a global anisotropy, the stability region of an Anderson-Brinkman-Morel (ABM) pairing state becomes wider. In a uniaxially stretched aerogel, the pure polar pairing state with a horizontal line node is predicted to occur, as a three-dimensional superfluid phase, over a measurable width just below the superfluid transition at Tc (P) . A possible relevance of the present results to the case with no global anisotropy is also discussed.

Spin singlet and spin triplet pairing correlations on shape evolution in s d -shell N =Z Nuclei

NASA Astrophysics Data System (ADS)

Ha, Eunja; Cheoun, Myung-Ki; Sagawa, H.

2018-02-01

We study the shape evolution of N =Z nuclei 24Mg,28Si, and 32S in the axially symmetric deformed Woods-Saxon model, taking into account both T =0 and T =1 pairing interactions. We find the coexistence of T =0 and T =1 superfluidity phases in the large deformation region | β2|>0.3 in these three nuclei. The interplay between the two pairing interactions has an important effect on determining the deformation of the ground states in these nuclei. The self-energy contributions from the pairing correlations to the single particle (s.p.) energies are also examined.

Hop stunt viroid: molecular cloning and nucleotide sequence of the complete cDNA copy.

PubMed Central

Ohno, T; Takamatsu, N; Meshi, T; Okada, Y

1983-01-01

The complete cDNA of hop stunt viroid (HSV) has been cloned by the method of Okayama and Berg (Mol.Cell.Biol.2,161-170. (1982] and the complete nucleotide sequence has been established. The covalently closed circular single-stranded HSV RNA consists of 297 nucleotides. The secondary structure predicted for HSV contains 67% of its residues base-paired. The native HSV can possess an extended rod-like structure characteristic of viroids previously established. The central region of the native HSV has a similar structure to the conserved region found in all viroids sequenced so far except for avocado sunblotch viroid. The sequence homologous to the 5'-end of U1a RNA is also found in the sequence of HSV but not in the central conserved region. Images PMID:6312412

Design, development, and evaluation of a novel microneedle array-based continuous glucose monitor.

PubMed

Jina, Arvind; Tierney, Michael J; Tamada, Janet A; McGill, Scott; Desai, Shashi; Chua, Beelee; Chang, Anna; Christiansen, Mark

2014-05-01

The development of accurate, minimally invasive continuous glucose monitoring (CGM) devices has been the subject of much work by several groups, as it is believed that a less invasive and more user-friendly device will result in greater adoption of CGM by persons with insulin-dependent diabetes. This article presents the results of preliminary clinical studies in subjects with diabetes of a novel prototype microneedle-based continuous glucose monitor. In this device, an array of tiny hollow microneedles is applied into the epidermis from where glucose in interstitial fluid (ISF) is transported via passive diffusion to an amperometric glucose sensor external to the body. Comparison of 1396 paired device glucose measurements and fingerstick blood glucose readings for up to 72-hour wear in 10 diabetic subjects shows the device to be accurate and well tolerated by the subjects. Overall mean absolute relative difference (MARD) is 15% with 98.4% of paired points in the A+B region of the Clarke error grid. The prototype device has demonstrated clinically accurate glucose readings over 72 hours, the first time a microneedle-based device has achieved such performance. © 2014 Diabetes Technology Society.

Intrinsic flexibility of B-DNA: the experimental TRX scale.

PubMed

Heddi, Brahim; Oguey, Christophe; Lavelle, Christophe; Foloppe, Nicolas; Hartmann, Brigitte

2010-01-01

B-DNA flexibility, crucial for DNA-protein recognition, is sequence dependent. Free DNA in solution would in principle be the best reference state to uncover the relation between base sequences and their intrinsic flexibility; however, this has long been hampered by a lack of suitable experimental data. We investigated this relationship by compiling and analyzing a large dataset of NMR (31)P chemical shifts in solution. These measurements reflect the BI <--> BII equilibrium in DNA, intimately correlated to helicoidal descriptors of the curvature, winding and groove dimensions. Comparing the ten complementary DNA dinucleotide steps indicates that some steps are much more flexible than others. This malleability is primarily controlled at the dinucleotide level, modulated by the tetranucleotide environment. Our analyses provide an experimental scale called TRX that quantifies the intrinsic flexibility of the ten dinucleotide steps in terms of Twist, Roll, and X-disp (base pair displacement). Applying the TRX scale to DNA sequences optimized for nucleosome formation reveals a 10 base-pair periodic alternation of stiff and flexible regions. Thus, DNA flexibility captured by the TRX scale is relevant to nucleosome formation, suggesting that this scale may be of general interest to better understand protein-DNA recognition.

Electron holes appear to trigger cancer-implicated mutations

NASA Astrophysics Data System (ADS)

Miller, John; Villagran, Martha

Malignant tumors are caused by mutations, which also affect their subsequent growth and evolution. We use a novel approach, computational DNA hole spectroscopy [M.Y. Suarez-Villagran & J.H. Miller, Sci. Rep. 5, 13571 (2015)], to compute spectra of enhanced hole probability based on actual sequence data. A hole is a mobile site of positive charge created when an electron is removed, for example by radiation or contact with a mutagenic agent. Peaks in the hole spectrum depict sites where holes tend to localize and potentially trigger a base pair mismatch during replication. Our studies of reveal a correlation between hole spectrum peaks and spikes in human mutation frequencies. Importantly, we also find that hole peak positions that do not coincide with large variant frequencies often coincide with cancer-implicated mutations and/or (for coding DNA) encoded conserved amino acids. This enables combining hole spectra with variant data to identify critical base pairs and potential cancer `driver' mutations. Such integration of DNA hole and variance spectra could also prove invaluable for pinpointing critical regions, and sites of driver mutations, in the vast non-protein-coding genome. Supported by the State of Texas through the Texas Ctr. for Superconductivity.

Mismatch cleavage by single-strand specific nucleases

PubMed Central

Till, Bradley J.; Burtner, Chris; Comai, Luca; Henikoff, Steven

2004-01-01

We have investigated the ability of single-strand specific (sss) nucleases from different sources to cleave single base pair mismatches in heteroduplex DNA templates used for mutation and single-nucleotide polymorphism analysis. The TILLING (Targeting Induced Local Lesions IN Genomes) mismatch cleavage protocol was used with the LI-COR gel detection system to assay cleavage of amplified heteroduplexes derived from a variety of induced mutations and naturally occurring polymorphisms. We found that purified nucleases derived from celery (CEL I), mung bean sprouts and Aspergillus (S1) were able to specifically cleave nearly all single base pair mismatches tested. Optimal nicking of heteroduplexes for mismatch detection was achieved using higher pH, temperature and divalent cation conditions than are routinely used for digestion of single-stranded DNA. Surprisingly, crude plant extracts performed as well as the highly purified preparations for this application. These observations suggest that diverse members of the S1 family of sss nucleases act similarly in cleaving non-specifically at bulges in heteroduplexes, and single-base mismatches are the least accessible because they present the smallest single-stranded region for enzyme binding. We conclude that a variety of sss nucleases and extracts can be effectively used for high-throughput mutation and polymorphism discovery. PMID:15141034

Improving detection of copy-number variation by simultaneous bias correction and read-depth segmentation.

PubMed

Szatkiewicz, Jin P; Wang, WeiBo; Sullivan, Patrick F; Wang, Wei; Sun, Wei

2013-02-01

Structural variation is an important class of genetic variation in mammals. High-throughput sequencing (HTS) technologies promise to revolutionize copy-number variation (CNV) detection but present substantial analytic challenges. Converging evidence suggests that multiple types of CNV-informative data (e.g. read-depth, read-pair, split-read) need be considered, and that sophisticated methods are needed for more accurate CNV detection. We observed that various sources of experimental biases in HTS confound read-depth estimation, and note that bias correction has not been adequately addressed by existing methods. We present a novel read-depth-based method, GENSENG, which uses a hidden Markov model and negative binomial regression framework to identify regions of discrete copy-number changes while simultaneously accounting for the effects of multiple confounders. Based on extensive calibration using multiple HTS data sets, we conclude that our method outperforms existing read-depth-based CNV detection algorithms. The concept of simultaneous bias correction and CNV detection can serve as a basis for combining read-depth with other types of information such as read-pair or split-read in a single analysis. A user-friendly and computationally efficient implementation of our method is freely available.

A practical salient region feature based 3D multi-modality registration method for medical images

NASA Astrophysics Data System (ADS)

Hahn, Dieter A.; Wolz, Gabriele; Sun, Yiyong; Hornegger, Joachim; Sauer, Frank; Kuwert, Torsten; Xu, Chenyang

2006-03-01

We present a novel representation of 3D salient region features and its integration into a hybrid rigid-body registration framework. We adopt scale, translation and rotation invariance properties of those intrinsic 3D features to estimate a transform between underlying mono- or multi-modal 3D medical images. Our method combines advantageous aspects of both feature- and intensity-based approaches and consists of three steps: an automatic extraction of a set of 3D salient region features on each image, a robust estimation of correspondences and their sub-pixel accurate refinement with outliers elimination. We propose a region-growing based approach for the extraction of 3D salient region features, a solution to the problem of feature clustering and a reduction of the correspondence search space complexity. Results of the developed algorithm are presented for both mono- and multi-modal intra-patient 3D image pairs (CT, PET and SPECT) that have been acquired for change detection, tumor localization, and time based intra-person studies. The accuracy of the method is clinically evaluated by a medical expert with an approach that measures the distance between a set of selected corresponding points consisting of both anatomical and functional structures or lesion sites. This demonstrates the robustness of the proposed method to image overlap, missing information and artefacts. We conclude by discussing potential medical applications and possibilities for integration into a non-rigid registration framework.

Development and evaluation of a crowdsourcing methodology for knowledge base construction: identifying relationships between clinical problems and medications

PubMed Central

Wright, Adam; Laxmisan, Archana; Ottosen, Madelene J; McCoy, Jacob A; Butten, David; Sittig, Dean F

2012-01-01

Objective We describe a novel, crowdsourcing method for generating a knowledge base of problem–medication pairs that takes advantage of manually asserted links between medications and problems. Methods Through iterative review, we developed metrics to estimate the appropriateness of manually entered problem–medication links for inclusion in a knowledge base that can be used to infer previously unasserted links between problems and medications. Results Clinicians manually linked 231 223 medications (55.30% of prescribed medications) to problems within the electronic health record, generating 41 203 distinct problem–medication pairs, although not all were accurate. We developed methods to evaluate the accuracy of the pairs, and after limiting the pairs to those meeting an estimated 95% appropriateness threshold, 11 166 pairs remained. The pairs in the knowledge base accounted for 183 127 total links asserted (76.47% of all links). Retrospective application of the knowledge base linked 68 316 medications not previously linked by a clinician to an indicated problem (36.53% of unlinked medications). Expert review of the combined knowledge base, including inferred and manually linked problem–medication pairs, found a sensitivity of 65.8% and a specificity of 97.9%. Conclusion Crowdsourcing is an effective, inexpensive method for generating a knowledge base of problem–medication pairs that is automatically mapped to local terminologies, up-to-date, and reflective of local prescribing practices and trends. PMID:22582202

Reliability of horizontal and vertical tube shift techniques in the localisation of supernumerary teeth.

PubMed

Mallineni, S K; Anthonappa, R P; King, N M

2016-12-01

To assess the reliability of the vertical tube shift technique (VTST) and horizontal tube shift technique (HTST) for the localisation of unerupted supernumerary teeth (ST) in the anterior region of the maxilla. A convenience sample of 83 patients who attended a major teaching hospital because of unerupted ST was selected. Only non-syndromic patients with ST and who had complete clinical and radiographic and surgical records were included in the study. Ten examiners independently rated the paired set of radiographs for each technique. Chi-square test, paired t test and kappa statistics were employed to assess the intra- and inter-examiner reliability. Paired sets of 1660 radiographs (830 pairs for each technique) were available for the analysis. The overall sensitivity for VTST and HTST was 80.6 and 72.1% respectively, with slight inter-examiner and good intra-examiner reliability. Statistically significant differences were evident between the two localisation techniques (p < 0.05). Localisation of unerupted ST using VTST was more successful than HTST in the anterior region of the maxilla.

A sequence-based genetic map of Medicago truncatula and comparison of marker colinearity with M. sativa.

PubMed Central

Choi, Hong-Kyu; Kim, Dongjin; Uhm, Taesik; Limpens, Eric; Lim, Hyunju; Mun, Jeong-Hwan; Kalo, Peter; Penmetsa, R Varma; Seres, Andrea; Kulikova, Olga; Roe, Bruce A; Bisseling, Ton; Kiss, Gyorgy B; Cook, Douglas R

2004-01-01

A core genetic map of the legume Medicago truncatula has been established by analyzing the segregation of 288 sequence-characterized genetic markers in an F(2) population composed of 93 individuals. These molecular markers correspond to 141 ESTs, 80 BAC end sequence tags, and 67 resistance gene analogs, covering 513 cM. In the case of EST-based markers we used an intron-targeted marker strategy with primers designed to anneal in conserved exon regions and to amplify across intron regions. Polymorphisms were significantly more frequent in intron vs. exon regions, thus providing an efficient mechanism to map transcribed genes. Genetic and cytogenetic analysis produced eight well-resolved linkage groups, which have been previously correlated with eight chromosomes by means of FISH with mapped BAC clones. We anticipated that mapping of conserved coding regions would have utility for comparative mapping among legumes; thus 60 of the EST-based primer pairs were designed to amplify orthologous sequences across a range of legume species. As an initial test of this strategy, we used primers designed against M. truncatula exon sequences to rapidly map genes in M. sativa. The resulting comparative map, which includes 68 bridging markers, indicates that the two Medicago genomes are highly similar and establishes the basis for a Medicago composite map. PMID:15082563

Structure modulation of helix 69 from Escherichia coli 23S ribosomal RNA by pseudouridylations.

PubMed

Jiang, Jun; Aduri, Raviprasad; Chow, Christine S; SantaLucia, John

2014-04-01

Helix 69 (H69) is a 19-nt stem-loop region from the large subunit ribosomal RNA. Three pseudouridine (Ψ) modifications clustered in H69 are conserved across phylogeny and known to affect ribosome function. To explore the effects of Ψ on the conformations of Escherichia coli H69 in solution, nuclear magnetic resonance spectroscopy was used to reveal the structural differences between H69 with (ΨΨΨ) and without (UUU) Ψ modifications. Comparison of the two structures shows that H69 ΨΨΨ has the following unique features: (i) the loop region is closed by a Watson-Crick base pair between Ψ1911 and A1919, which is potentially reinforced by interactions involving Ψ1911N1H and (ii) Ψ modifications at loop residues 1915 and 1917 promote base stacking from Ψ1915 to A1918. In contrast, the H69 UUU loop region, which lacks Ψ modifications, is less organized. Structure modulation by Ψ leads to alteration in conformational behavior of the 5' half of the H69 loop region, observed as broadening of C1914 non-exchangeable base proton resonances in the H69 ΨΨΨ nuclear magnetic resonance spectra, and plays an important biological role in establishing the ribosomal intersubunit bridge B2a and mediating translational fidelity.

S-adenosylmethionine directly inhibits binding of 30S ribosomal subunits to the SMK box translational riboswitch RNA

PubMed Central

Fuchs, Ryan T.; Grundy, Frank J.; Henkin, Tina M.

2007-01-01

The SMK box is a conserved riboswitch motif found in the 5′ untranslated region of metK genes [encoding S-adenosylmethionine (SAM) synthetase] in lactic acid bacteria, including Enterococcus, Streptococcus, and Lactococcus sp. Previous studies showed that this RNA element binds SAM in vitro, and SAM binding causes a structural rearrangement that sequesters the Shine–Dalgarno (SD) sequence by pairing with an anti-SD (ASD) element. A model was proposed in which SAM binding inhibits metK translation by preventing binding of the ribosome to the SD region of the mRNA. In the current work, the addition of SAM was shown to inhibit binding of 30S ribosomal subunits to SMK box RNA; in contrast, the addition of S-adenosylhomocysteine (SAH) had no effect. A mutant RNA, which has a disrupted SD-ASD pairing, was defective in SAM binding and showed no reduction of ribosome binding in the presence of SAM, whereas a compensatory mutation that restored SD-ASD pairing restored the response to SAM. Primer extension inhibition assays provided further evidence for SD-ASD pairing in the presence of SAM. These results strongly support the model that SMK box translational repression operates through occlusion of the ribosome binding site and that SAM binding requires the SD-ASD pairing. PMID:17360376