Sample records for base pair resolution

  1. High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

    PubMed

    Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2015-11-02

    Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Sequence-dependent base pair stepping dynamics in XPD helicase unwinding

    PubMed Central

    Qi, Zhi; Pugh, Robert A; Spies, Maria; Chemla, Yann R

    2013-01-01

    Helicases couple the chemical energy of ATP hydrolysis to directional translocation along nucleic acids and transient duplex separation. Understanding helicase mechanism requires that the basic physicochemical process of base pair separation be understood. This necessitates monitoring helicase activity directly, at high spatio-temporal resolution. Using optical tweezers with single base pair (bp) resolution, we analyzed DNA unwinding by XPD helicase, a Superfamily 2 (SF2) DNA helicase involved in DNA repair and transcription initiation. We show that monomeric XPD unwinds duplex DNA in 1-bp steps, yet exhibits frequent backsteps and undergoes conformational transitions manifested in 5-bp backward and forward steps. Quantifying the sequence dependence of XPD stepping dynamics with near base pair resolution, we provide the strongest and most direct evidence thus far that forward, single-base pair stepping of a helicase utilizes the spontaneous opening of the duplex. The proposed unwinding mechanism may be a universal feature of DNA helicases that move along DNA phosphodiester backbones. DOI: http://dx.doi.org/10.7554/eLife.00334.001 PMID:23741615

  3. Base pairing and base mis-pairing in nucleic acids

    NASA Technical Reports Server (NTRS)

    Wang, A. H. J.; Rich, A.

    1986-01-01

    In recent years we have learned that DNA is conformationally active. It can exist in a number of different stable conformations including both right-handed and left-handed forms. Using single crystal X-ray diffraction analysis we are able to discover not only additional conformations of the nucleic acids but also different types of hydrogen bonded base-base interactions. Although Watson-Crick base pairings are the predominant type of interaction in double helical DNA, they are not the only types. Recently, we have been able to examine mismatching of guanine-thymine base pairs in left-handed Z-DNA at atomic resolution (1A). A minimum amount of distortion of the sugar phosphate backbone is found in the G x T pairing in which the bases are held together by two hydrogen bonds in the wobble pairing interaction. Because of the high resolution of the analysis we can visualize water molecules which fill in to accommodate the other hydrogen bonding positions in the bases which are not used in the base-base interactions. Studies on other DNA oligomers have revealed that other types of non-Watson-Crick hydrogen bonding interactions can occur. In the structure of a DNA octamer with the sequence d(GCGTACGC) complexed to an antibiotic triostin A, it was found that the two central AT base pairs are held together by Hoogsteen rather than Watson-Crick base pairs. Similarly, the G x C base pairs at the ends are also Hoogsteen rather than Watson-Crick pairing. Hoogsteen base pairs make a modified helix which is distinct from the Watson-Crick double helix.

  4. Hybrid-denovo: a de novo OTU-picking pipeline integrating single-end and paired-end 16S sequence tags.

    PubMed

    Chen, Xianfeng; Johnson, Stephen; Jeraldo, Patricio; Wang, Junwen; Chia, Nicholas; Kocher, Jean-Pierre A; Chen, Jun

    2018-03-01

    Illumina paired-end sequencing has been increasingly popular for 16S rRNA gene-based microbiota profiling. It provides higher phylogenetic resolution than single-end reads due to a longer read length. However, the reverse read (R2) often has significant low base quality, and a large proportion of R2s will be discarded after quality control, resulting in a mixture of paired-end and single-end reads. A typical 16S analysis pipeline usually processes either paired-end or single-end reads but not a mixture. Thus, the quantification accuracy and statistical power will be reduced due to the loss of a large amount of reads. As a result, rare taxa may not be detectable with the paired-end approach, or low taxonomic resolution will result in a single-end approach. To have both the higher phylogenetic resolution provided by paired-end reads and the higher sequence coverage by single-end reads, we propose a novel OTU-picking pipeline, hybrid-denovo, that can process a hybrid of single-end and paired-end reads. Using high-quality paired-end reads as a gold standard, we show that hybrid-denovo achieved the highest correlation with the gold standard and performed better than the approaches based on paired-end or single-end reads in terms of quantifying the microbial diversity and taxonomic abundances. By applying our method to a rheumatoid arthritis (RA) data set, we demonstrated that hybrid-denovo captured more microbial diversity and identified more RA-associated taxa than a paired-end or single-end approach. Hybrid-denovo utilizes both paired-end and single-end 16S sequencing reads and is recommended for 16S rRNA gene targeted paired-end sequencing data.

  5. Spatial, Temporal and Spectral Satellite Image Fusion via Sparse Representation

    NASA Astrophysics Data System (ADS)

    Song, Huihui

    Remote sensing provides good measurements for monitoring and further analyzing the climate change, dynamics of ecosystem, and human activities in global or regional scales. Over the past two decades, the number of launched satellite sensors has been increasing with the development of aerospace technologies and the growing requirements on remote sensing data in a vast amount of application fields. However, a key technological challenge confronting these sensors is that they tradeoff between spatial resolution and other properties, including temporal resolution, spectral resolution, swath width, etc., due to the limitations of hardware technology and budget constraints. To increase the spatial resolution of data with other good properties, one possible cost-effective solution is to explore data integration methods that can fuse multi-resolution data from multiple sensors, thereby enhancing the application capabilities of available remote sensing data. In this thesis, we propose to fuse the spatial resolution with temporal resolution and spectral resolution, respectively, based on sparse representation theory. Taking the study case of Landsat ETM+ (with spatial resolution of 30m and temporal resolution of 16 days) and MODIS (with spatial resolution of 250m ~ 1km and daily temporal resolution) reflectance, we propose two spatial-temporal fusion methods to combine the fine spatial information of Landsat image and the daily temporal resolution of MODIS image. Motivated by that the images from these two sensors are comparable on corresponding bands, we propose to link their spatial information on available Landsat- MODIS image pair (captured on prior date) and then predict the Landsat image from the MODIS counterpart on prediction date. To well-learn the spatial details from the prior images, we use a redundant dictionary to extract the basic representation atoms for both Landsat and MODIS images based on sparse representation. Under the scenario of two prior Landsat-MODIS image pairs, we build the corresponding relationship between the difference images of MODIS and ETM+ by training a low- and high-resolution dictionary pair from the given prior image pairs. In the second scenario, i.e., only one Landsat- MODIS image pair being available, we directly correlate MODIS and ETM+ data through an image degradation model. Then, the fusion stage is achieved by super-resolving the MODIS image combining the high-pass modulation in a two-layer fusion framework. Remarkably, the proposed spatial-temporal fusion methods form a unified framework for blending remote sensing images with phenology change or land-cover-type change. Based on the proposed spatial-temporal fusion models, we propose to monitor the land use/land cover changes in Shenzhen, China. As a fast-growing city, Shenzhen faces the problem of detecting the rapid changes for both rational city planning and sustainable development. However, the cloudy and rainy weather in region Shenzhen located makes the capturing circle of high-quality satellite images longer than their normal revisit periods. Spatial-temporal fusion methods are capable to tackle this problem by improving the spatial resolution of images with coarse spatial resolution but frequent temporal coverage, thereby making the detection of rapid changes possible. On two Landsat-MODIS datasets with annual and monthly changes, respectively, we apply the proposed spatial-temporal fusion methods to the task of multiple change detection. Afterward, we propose a novel spatial and spectral fusion method for satellite multispectral and hyperspectral (or high-spectral) images based on dictionary-pair learning and sparse non-negative matrix factorization. By combining the spectral information from hyperspectral image, which is characterized by low spatial resolution but high spectral resolution and abbreviated as LSHS, and the spatial information from multispectral image, which is featured by high spatial resolution but low spectral resolution and abbreviated as HSLS, this method aims to generate the fused data with both high spatial and high spectral resolutions. Motivated by the observation that each hyperspectral pixel can be represented by a linear combination of a few endmembers, this method first extracts the spectral bases of LSHS and HSLS images by making full use of the rich spectral information in LSHS data. The spectral bases of these two categories data then formulate a dictionary-pair due to their correspondence in representing each pixel spectra of LSHS data and HSLS data, respectively. Subsequently, the LSHS image is spatially unmixed by representing the HSLS image with respect to the corresponding learned dictionary to derive its representation coefficients. Combining the spectral bases of LSHS data and the representation coefficients of HSLS data, we finally derive the fused data characterized by the spectral resolution of LSHS data and the spatial resolution of HSLS data.

  6. Image super-resolution via sparse representation.

    PubMed

    Yang, Jianchao; Wright, John; Huang, Thomas S; Ma, Yi

    2010-11-01

    This paper presents a new approach to single-image super-resolution, based on sparse signal representation. Research on image statistics suggests that image patches can be well-represented as a sparse linear combination of elements from an appropriately chosen over-complete dictionary. Inspired by this observation, we seek a sparse representation for each patch of the low-resolution input, and then use the coefficients of this representation to generate the high-resolution output. Theoretical results from compressed sensing suggest that under mild conditions, the sparse representation can be correctly recovered from the downsampled signals. By jointly training two dictionaries for the low- and high-resolution image patches, we can enforce the similarity of sparse representations between the low resolution and high resolution image patch pair with respect to their own dictionaries. Therefore, the sparse representation of a low resolution image patch can be applied with the high resolution image patch dictionary to generate a high resolution image patch. The learned dictionary pair is a more compact representation of the patch pairs, compared to previous approaches, which simply sample a large amount of image patch pairs, reducing the computational cost substantially. The effectiveness of such a sparsity prior is demonstrated for both general image super-resolution and the special case of face hallucination. In both cases, our algorithm generates high-resolution images that are competitive or even superior in quality to images produced by other similar SR methods. In addition, the local sparse modeling of our approach is naturally robust to noise, and therefore the proposed algorithm can handle super-resolution with noisy inputs in a more unified framework.

  7. An Example-Based Super-Resolution Algorithm for Selfie Images

    PubMed Central

    William, Jino Hans; Venkateswaran, N.; Narayanan, Srinath; Ramachandran, Sandeep

    2016-01-01

    A selfie is typically a self-portrait captured using the front camera of a smartphone. Most state-of-the-art smartphones are equipped with a high-resolution (HR) rear camera and a low-resolution (LR) front camera. As selfies are captured by front camera with limited pixel resolution, the fine details in it are explicitly missed. This paper aims to improve the resolution of selfies by exploiting the fine details in HR images captured by rear camera using an example-based super-resolution (SR) algorithm. HR images captured by rear camera carry significant fine details and are used as an exemplar to train an optimal matrix-value regression (MVR) operator. The MVR operator serves as an image-pair priori which learns the correspondence between the LR-HR patch-pairs and is effectively used to super-resolve LR selfie images. The proposed MVR algorithm avoids vectorization of image patch-pairs and preserves image-level information during both learning and recovering process. The proposed algorithm is evaluated for its efficiency and effectiveness both qualitatively and quantitatively with other state-of-the-art SR algorithms. The results validate that the proposed algorithm is efficient as it requires less than 3 seconds to super-resolve LR selfie and is effective as it preserves sharp details without introducing any counterfeit fine details. PMID:27064500

  8. Super resolution reconstruction of infrared images based on classified dictionary learning

    NASA Astrophysics Data System (ADS)

    Liu, Fei; Han, Pingli; Wang, Yi; Li, Xuan; Bai, Lu; Shao, Xiaopeng

    2018-05-01

    Infrared images always suffer from low-resolution problems resulting from limitations of imaging devices. An economical approach to combat this problem involves reconstructing high-resolution images by reasonable methods without updating devices. Inspired by compressed sensing theory, this study presents and demonstrates a Classified Dictionary Learning method to reconstruct high-resolution infrared images. It classifies features of the samples into several reasonable clusters and trained a dictionary pair for each cluster. The optimal pair of dictionaries is chosen for each image reconstruction and therefore, more satisfactory results is achieved without the increase in computational complexity and time cost. Experiments and results demonstrated that it is a viable method for infrared images reconstruction since it improves image resolution and recovers detailed information of targets.

  9. Database of non-canonical base pairs found in known RNA structures

    NASA Technical Reports Server (NTRS)

    Nagaswamy, U.; Voss, N.; Zhang, Z.; Fox, G. E.

    2000-01-01

    Atomic resolution RNA structures are being published at an increasing rate. It is common to find a modest number of non-canonical base pairs in these structures in addition to the usual Watson-Crick pairs. This database summarizes the occurrence of these rare base pairs in accordance with standard nomenclature. The database, http://prion.bchs.uh.edu/, contains information such as sequence context, sugar pucker conformation, anti / syn base conformations, chemical shift, p K (a)values, melting temperature and free energy. Of the 29 anticipated pairs with two or more hydrogen bonds, 20 have been encountered to date. In addition, four unexpected pairs with two hydrogen bonds have been reported bringing the total to 24. Single hydrogen bond versions of five of the expected geometries have been encountered among the single hydrogen bond interactions. In addition, 18 different types of base triplets have been encountered, each of which involves three to six hydrogen bonds. The vast majority of the rare base pairs are antiparallel with the bases in the anti configuration relative to the ribose. The most common are the GU wobble, the Sheared GA pair, the Reverse Hoogsteen pair and the GA imino pair.

  10. [Can the local energy minimization refine the PDB structures of different resolution universally?].

    PubMed

    Godzi, M G; Gromova, A P; Oferkin, I V; Mironov, P V

    2009-01-01

    The local energy minimization was statistically validated as the refinement strategy for PDB structure pairs of different resolution. Thirteen pairs of structures with the only difference in resolution were extracted from PDB, and the structures of 11 identical proteins obtained by different X-ray diffraction techniques were represented. The distribution of RMSD value was calculated for these pairs before and after the local energy minimization of each structure. The MMFF94 field was used for energy calculations, and the quasi-Newton method was used for local energy minimization. By comparison of these two RMSD distributions, the local energy minimization was proved to statistically increase the structural differences in pairs so that it cannot be used for refinement purposes. To explore the prospects of complex refinement strategies based on energy minimization, randomized structures were obtained by moving the initial PDB structures as far as the minimized structures had been moved in a multidimensional space of atomic coordinates. For these randomized structures, the RMSD distribution was calculated and compared with that for minimized structures. The significant differences in their mean values proved the energy surface of the protein to have only few minima near the conformations of different resolution obtained by X-ray diffraction for PDB. Some other results obtained by exploring the energy surface near these conformations are also presented. These results are expected to be very useful for the development of new protein refinement strategies based on energy minimization.

  11. A resolution measure for three-dimensional microscopy

    PubMed Central

    Chao, Jerry; Ram, Sripad; Abraham, Anish V.; Ward, E. Sally; Ober, Raimund J.

    2009-01-01

    A three-dimensional (3D) resolution measure for the conventional optical microscope is introduced which overcomes the drawbacks of the classical 3D (axial) resolution limit. Formulated within the context of a parameter estimation problem and based on the Cramer-Rao lower bound, this 3D resolution measure indicates the accuracy with which a given distance between two objects in 3D space can be determined from the acquired image. It predicts that, given enough photons from the objects of interest, arbitrarily small distances of separation can be estimated with prespecified accuracy. Using simulated images of point source pairs, we show that the maximum likelihood estimator is capable of attaining the accuracy predicted by the resolution measure. We also demonstrate how different factors, such as extraneous noise sources and the spatial orientation of the imaged object pair, can affect the accuracy with which a given distance of separation can be determined. PMID:20161040

  12. Prototype pre-clinical PET scanner with depth-of-interaction measurements using single-layer crystal array and single-ended readout

    NASA Astrophysics Data System (ADS)

    Lee, Min Sun; Kim, Kyeong Yun; Ko, Guen Bae; Lee, Jae Sung

    2017-05-01

    In this study, we developed a proof-of-concept prototype PET system using a pair of depth-of-interaction (DOI) PET detectors based on the proposed DOI-encoding method and digital silicon photomultiplier (dSiPM). Our novel cost-effective DOI measurement method is based on a triangular-shaped reflector that requires only a single-layer pixelated crystal and single-ended signal readout. The DOI detector consisted of an 18  ×  18 array of unpolished LYSO crystal (1.47  ×  1.47  ×  15 mm3) wrapped with triangular-shaped reflectors. The DOI information was encoded by depth-dependent light distribution tailored by the reflector geometry and DOI correction was performed using four-step depth calibration data and maximum-likelihood (ML) estimation. The detector pair and the object were placed on two motorized rotation stages to demonstrate 12-block ring PET geometry with 11.15 cm diameter. Spatial resolution was measured and phantom and animal imaging studies were performed to investigate imaging performance. All images were reconstructed with and without the DOI correction to examine the impact of our DOI measurement. The pair of dSiPM-based DOI PET detectors showed good physical performances respectively: 2.82 and 3.09 peak-to-valley ratios, 14.30% and 18.95% energy resolution, and 4.28 and 4.24 mm DOI resolution averaged over all crystals and all depths. A sub-millimeter spatial resolution was achieved at the center of the field of view (FOV). After applying ML-based DOI correction, maximum 36.92% improvement was achieved in the radial spatial resolution and a uniform resolution was observed within 5 cm of transverse PET FOV. We successfully acquired phantom and animal images with improved spatial resolution and contrast by using the DOI measurement. The proposed DOI-encoding method was successfully demonstrated in the system level and exhibited good performance, showing its feasibility for animal PET applications with high spatial resolution and sensitivity.

  13. The 5S rRNA loop E: chemical probing and phylogenetic data versus crystal structure.

    PubMed

    Leontis, N B; Westhof, E

    1998-09-01

    A significant fraction of the bases in a folded, structured RNA molecule participate in noncanonical base pairing interactions, often in the context of internal loops or multi-helix junction loops. The appearance of each new high-resolution RNA structure provides welcome data to guide efforts to understand and predict RNA 3D structure, especially when the RNA in question is a functionally conserved molecule. The recent publication of the crystal structure of the "Loop E" region of bacterial 5S ribosomal RNA is such an event [Correll CC, Freeborn B, Moore PB, Steitz TA, 1997, Cell 91:705-712]. In addition to providing more examples of already established noncanonical base pairs, such as purine-purine sheared pairings, trans-Hoogsteen UA, and GU wobble pairs, the structure provides the first high-resolution views of two new purine-purine pairings and a new GU pairing. The goal of the present analysis is to expand the capabilities of both chemical probing and phylogenetic analysis to predict with greater accuracy the structures of RNA molecules. First, in light of existing chemical probing data, we investigate what lessons could be learned regarding the interpretation of this widely used method of RNA structure probing. Then we analyze the 3D structure with reference to molecular phylogeny data (assuming conservation of function) to discover what alternative base pairings are geometrically compatible with the structure. The comparisons between previous modeling efforts and crystal structures show that the intricate involvements of ions and water molecules in the maintenance of non-Watson-Crick pairs render the process of correctly identifying the interacting sites in such pairs treacherous, except in cases of trans-Hoogsteen A/U or sheared A/G pairs for the adenine N1 site. The phylogenetic analysis identifies A/A, A/C, A/U and C/A, C/C, and C/U pairings isosteric with sheared A/G, as well as A/A and A/C pairings isosteric with both G/U and G/G bifurcated pairings. Thus, each non-Watson-Crick pair could be characterized by a phylogenetic signature of variations between isosteric-like pairings. In addition to the conservative changes, which form a dictionary of pairings isosterically compatible with those observed in the crystal structure, concerted changes involving several base pairs also occur. The latter covariations may indicate transitions between related but distinctive motifs within the loop E of 5S ribosomal RNA.

  14. Example-Based Super-Resolution Fluorescence Microscopy.

    PubMed

    Jia, Shu; Han, Boran; Kutz, J Nathan

    2018-04-23

    Capturing biological dynamics with high spatiotemporal resolution demands the advancement in imaging technologies. Super-resolution fluorescence microscopy offers spatial resolution surpassing the diffraction limit to resolve near-molecular-level details. While various strategies have been reported to improve the temporal resolution of super-resolution imaging, all super-resolution techniques are still fundamentally limited by the trade-off associated with the longer image acquisition time that is needed to achieve higher spatial information. Here, we demonstrated an example-based, computational method that aims to obtain super-resolution images using conventional imaging without increasing the imaging time. With a low-resolution image input, the method provides an estimate of its super-resolution image based on an example database that contains super- and low-resolution image pairs of biological structures of interest. The computational imaging of cellular microtubules agrees approximately with the experimental super-resolution STORM results. This new approach may offer potential improvements in temporal resolution for experimental super-resolution fluorescence microscopy and provide a new path for large-data aided biomedical imaging.

  15. An Integrated Photogrammetric and Photoclinometric Approach for Pixel-Resolution 3d Modelling of Lunar Surface

    NASA Astrophysics Data System (ADS)

    Liu, W. C.; Wu, B.

    2018-04-01

    High-resolution 3D modelling of lunar surface is important for lunar scientific research and exploration missions. Photogrammetry is known for 3D mapping and modelling from a pair of stereo images based on dense image matching. However dense matching may fail in poorly textured areas and in situations when the image pair has large illumination differences. As a result, the actual achievable spatial resolution of the 3D model from photogrammetry is limited by the performance of dense image matching. On the other hand, photoclinometry (i.e., shape from shading) is characterised by its ability to recover pixel-wise surface shapes based on image intensity and imaging conditions such as illumination and viewing directions. More robust shape reconstruction through photoclinometry can be achieved by incorporating images acquired under different illumination conditions (i.e., photometric stereo). Introducing photoclinometry into photogrammetric processing can therefore effectively increase the achievable resolution of the mapping result while maintaining its overall accuracy. This research presents an integrated photogrammetric and photoclinometric approach for pixel-resolution 3D modelling of the lunar surface. First, photoclinometry is interacted with stereo image matching to create robust and spatially well distributed dense conjugate points. Then, based on the 3D point cloud derived from photogrammetric processing of the dense conjugate points, photoclinometry is further introduced to derive the 3D positions of the unmatched points and to refine the final point cloud. The approach is able to produce one 3D point for each image pixel within the overlapping area of the stereo pair so that to obtain pixel-resolution 3D models. Experiments using the Lunar Reconnaissance Orbiter Camera - Narrow Angle Camera (LROC NAC) images show the superior performances of the approach compared with traditional photogrammetric technique. The results and findings from this research contribute to optimal exploitation of image information for high-resolution 3D modelling of the lunar surface, which is of significance for the advancement of lunar and planetary mapping.

  16. Vernier-like super resolution with guided correlated photon pairs.

    PubMed

    Nespoli, Matteo; Goan, Hsi-Sheng; Shih, Min-Hsiung

    2016-01-11

    We describe a dispersion-enabled, ultra-low power realization of super-resolution in an integrated Mach-Zehnder interferometer. Our scheme is based on a Vernier-like effect in the coincident detection of frequency correlated, non-degenerate photon pairs at the sensor output in the presence of group index dispersion. We design and simulate a realistic integrated refractive index sensor in a silicon nitride on silica platform and characterize its performance in the proposed scheme. We present numerical results showing a sensitivity improvement upward of 40 times over a traditional sensing scheme. The device we design is well within the reach of modern semiconductor fabrication technology. We believe this is the first metrology scheme that uses waveguide group index dispersion as a resource to attain super-resolution.

  17. Development of the Advanced Energetic Pair Telescope (AdEPT) for Medium-Energy Gamma-Ray Astronomy

    NASA Technical Reports Server (NTRS)

    Hunter, Stanley D.; Bloser, Peter F.; Dion, Michael P.; McConnell, Mark L.; deNolfo, Georgia A.; Son, Seunghee; Ryan, James M.; Stecker, Floyd W.

    2011-01-01

    Progress in high-energy gamma-ray science has been dramatic since the launch of INTEGRAL, AGILE and FERMI. These instruments, however, are not optimized for observations in the medium-energy (approx.0.3< E(sub gamma)< approx.200 MeV) regime where many astrophysical objects exhibit unique, transitory behavior, such as spectral breaks, bursts, and flares. We outline some of the major science goals of a medium-energy mission. These science goals are best achieved with a combination of two telescopes, a Compton telescope and a pair telescope, optimized to provide significant improvements in angular resolution and sensitivity. In this paper we describe the design of the Advanced Energetic Pair Telescope (AdEPT) based on the Three-Dimensional Track Imager (3-DTI) detector. This technology achieves excellent, medium-energy sensitivity, angular resolution near the kinematic limit, and gamma-ray polarization sensitivity, by high resolution 3-D electron tracking. We describe the performance of a 30x30x30 cm3 prototype of the AdEPT instrument.

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Weina; Hellinga, Homme W.; Beese, Lorena S.

    Even though high-fidelity polymerases copy DNA with remarkable accuracy, some base-pair mismatches are incorporated at low frequency, leading to spontaneous mutagenesis. Using high-resolution X-ray crystallographic analysis of a DNA polymerase that catalyzes replication in crystals, we observe that a C {center_dot} A mismatch can mimic the shape of cognate base pairs at the site of incorporation. This shape mimicry enables the mismatch to evade the error detection mechanisms of the polymerase, which would normally either prevent mismatch incorporation or promote its nucleolytic excision. Movement of a single proton on one of the mismatched bases alters the hydrogen-bonding pattern such thatmore » a base pair forms with an overall shape that is virtually indistinguishable from a canonical, Watson-Crick base pair in double-stranded DNA. These observations provide structural evidence for the rare tautomer hypothesis of spontaneous mutagenesis, a long-standing concept that has been difficult to demonstrate directly.« less

  19. Rapid discrimination of Isaria javanica and Isaria poprawskii from Isaria spp. using high resolution DNA melting assays

    USDA-ARS?s Scientific Manuscript database

    The current study evaluates the potential of using high resolution DNA melting assays to discriminate species in the genus, Isaria. The study utilizes a previously identified 103 base pair PCR amplicon, which was reported to be selective for Isaria fumosorosea. Our study finds the amplicon selective...

  20. Hi-C 2.0: An optimized Hi-C procedure for high-resolution genome-wide mapping of chromosome conformation.

    PubMed

    Belaghzal, Houda; Dekker, Job; Gibcus, Johan H

    2017-07-01

    Chromosome conformation capture-based methods such as Hi-C have become mainstream techniques for the study of the 3D organization of genomes. These methods convert chromatin interactions reflecting topological chromatin structures into digital information (counts of pair-wise interactions). Here, we describe an updated protocol for Hi-C (Hi-C 2.0) that integrates recent improvements into a single protocol for efficient and high-resolution capture of chromatin interactions. This protocol combines chromatin digestion and frequently cutting enzymes to obtain kilobase (kb) resolution. It also includes steps to reduce random ligation and the generation of uninformative molecules, such as unligated ends, to improve the amount of valid intra-chromosomal read pairs. This protocol allows for obtaining information on conformational structures such as compartment and topologically associating domains, as well as high-resolution conformational features such as DNA loops. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Computer Simulation of Global Profiles of Carbon Dioxide Using a Pulsed, 2-Micron, Coherent-Detection, Column-Content DIAL System

    NASA Technical Reports Server (NTRS)

    Kavaya, Michael J.; Singh, Upendra N.; Koch, Grady J.; Yu, Jirong; Frehlich, Rod G.

    2009-01-01

    We present preliminary results of computer simulations of the error in measuring carbon dioxide mixing ratio profiles from earth orbit. The simulated sensor is a pulsed, 2-micron, coherent-detection lidar alternately operating on at least two wavelengths. The simulated geometry is a nadir viewing lidar measuring the column content signal. Atmospheric absorption is modeled using FASCODE3P software with the HITRAN 2004 absorption line data base. Lidar shot accumulation is employed up to the horizontal resolution limit. Horizontal resolutions of 50, 100, and 200 km are shown. Assuming a 400 km spacecraft orbit, the horizontal resolutions correspond to measurement times of about 7, 14, and 28 s. We simulate laser pulse-pair repetition frequencies from 1 Hz to 100 kHz. The range of shot accumulation is 7 to 2.8 million pulse-pairs. The resultant error is shown as a function of horizontal resolution, laser pulse-pair repetition frequency, and laser pulse energy. The effect of different on and off pulse energies is explored. The results are compared to simulation results of others and to demonstrated 2-micron operating points at NASA Langley.

  2. Super-Chelators for Advanced Protein Labeling in Living Cells.

    PubMed

    Gatterdam, Karl; Joest, Eike F; Dietz, Marina S; Heilemann, Mike; Tampé, Robert

    2018-05-14

    Live-cell labeling, super-resolution microscopy, single-molecule applications, protein localization, or chemically induced assembly are emerging approaches, which require specific and very small interaction pairs. The minimal disturbance of protein function is essential to derive unbiased insights into cellular processes. Herein, we define a new class of hexavalent N-nitrilotriacetic acid (hexaNTA) chelators, displaying the highest affinity and stability of all NTA-based small interaction pairs described so far. Coupled to bright organic fluorophores with fine-tuned photophysical properties, the super-chelator probes were delivered into human cells by chemically gated nanopores. These super-chelators permit kinetic profiling, multiplexed labeling of His 6 - and His 12 -tagged proteins as well as single-molecule-based super-resolution imaging. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    PubMed Central

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

    2015-01-01

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536

  4. Silver (I) as DNA glue: Ag(+)-mediated guanine pairing revealed by removing Watson-Crick constraints.

    PubMed

    Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G

    2015-05-14

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  5. Anomeric 2'-Deoxycytidines and Silver Ions: Hybrid Base Pairs with Greatly Enhanced Stability and Efficient DNA Mismatch Detection with α-dC.

    PubMed

    Guo, Xiurong; Seela, Frank

    2017-09-04

    α-d-Nucleosides are rare in nature but can develop fascinating properties when incorporated into DNA. This work reports on the first silver-mediated base pair constructed from two anomeric nucleosides: α-dC and β-dC. The hybrid base pair was integrated into the DNA and DNA/RNA double helix. A 12-mer duplex with α-dC and β-dC pair exhibits a higher thermal stability (T m =43 °C) than that incorporating the β-dC-Ag + -β-dC homo pair (T m =34 °C). Furthermore, α-dC shows excellent mismatch discrimination for DNA single nucleotide polymorphism (SNP). All four SNPs were identified on the basis of large T m value differences measured in the presence of silver ions. High resolution melting was not required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Sparse representation-based volumetric super-resolution algorithm for 3D CT images of reservoir rocks

    NASA Astrophysics Data System (ADS)

    Li, Zhengji; Teng, Qizhi; He, Xiaohai; Yue, Guihua; Wang, Zhengyong

    2017-09-01

    The parameter evaluation of reservoir rocks can help us to identify components and calculate the permeability and other parameters, and it plays an important role in the petroleum industry. Until now, computed tomography (CT) has remained an irreplaceable way to acquire the microstructure of reservoir rocks. During the evaluation and analysis, large samples and high-resolution images are required in order to obtain accurate results. Owing to the inherent limitations of CT, however, a large field of view results in low-resolution images, and high-resolution images entail a smaller field of view. Our method is a promising solution to these data collection limitations. In this study, a framework for sparse representation-based 3D volumetric super-resolution is proposed to enhance the resolution of 3D voxel images of reservoirs scanned with CT. A single reservoir structure and its downgraded model are divided into a large number of 3D cubes of voxel pairs and these cube pairs are used to calculate two overcomplete dictionaries and the sparse-representation coefficients in order to estimate the high frequency component. Future more, to better result, a new feature extract method with combine BM4D together with Laplacian filter are introduced. In addition, we conducted a visual evaluation of the method, and used the PSNR and FSIM to evaluate it qualitatively.

  7. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ogle, James M.; Brodersen, Ditlev E.; Clemons, William M.

    Crystal structures of the 30S ribosomal subunit in complex with messenger RNA and cognate transfer RNA in the A site, both in the presence and absence of the antibiotic paromomycin, have been solved at between 3.1 and 3.3 angstroms resolution. Cognate transfer RNA (tRNA) binding induces global domain movements of the 30S subunit and changes in the conformation of the universally conserved and essential bases A1492, A1493, and G530 of 16S RNA. These bases interact intimately with the minor groove of the first two base pairs between the codon and anticodon, thus sensing Watson-Crick base-pairing geometry and discriminating against near-cognatemore » tRNA. The third, or 'wobble,' position of the codon is free to accommodate certain noncanonical base pairs. By partially inducing these structural changes, paromomycin facilitates binding of near-cognate tRNAs.« less

  8. Helicase Stepping Investigated with One-Nucleotide Resolution Fluorescence Resonance Energy Transfer

    NASA Astrophysics Data System (ADS)

    Lin, Wenxia; Ma, Jianbing; Nong, Daguan; Xu, Chunhua; Zhang, Bo; Li, Jinghua; Jia, Qi; Dou, Shuoxing; Ye, Fangfu; Xi, Xuguang; Lu, Ying; Li, Ming

    2017-09-01

    Single-molecule Förster resonance energy transfer is widely applied to study helicases by detecting distance changes between a pair of dyes anchored to overhangs of a forked DNA. However, it has been lacking single-base pair (1-bp) resolution required for revealing stepping kinetics of helicases. We designed a nanotensioner in which a short DNA is bent to exert force on the overhangs, just as in optical or magnetic tweezers. The strategy improved the resolution of Förster resonance energy transfer to 0.5 bp, high enough to uncover differences in DNA unwinding by yeast Pif1 and E. coli RecQ whose unwinding behaviors cannot be differentiated by currently practiced methods. We found that Pif1 exhibits 1-bp-stepping kinetics, while RecQ breaks 1 bp at a time but sequesters the nascent nucleotides and releases them randomly. The high-resolution data allowed us to propose a three-parameter model to quantitatively interpret the apparently different unwinding behaviors of the two helicases which belong to two superfamilies.

  9. High-resolution mapping of transcription factor binding sites on native chromatin

    PubMed Central

    Kasinathan, Sivakanthan; Orsi, Guillermo A.; Zentner, Gabriel E.; Ahmad, Kami; Henikoff, Steven

    2014-01-01

    Sequence-specific DNA-binding proteins including transcription factors (TFs) are key determinants of gene regulation and chromatin architecture. Formaldehyde cross-linking and sonication followed by Chromatin ImmunoPrecipitation (X-ChIP) is widely used for profiling of TF binding, but is limited by low resolution and poor specificity and sensitivity. We present a simple protocol that starts with micrococcal nuclease-digested uncross-linked chromatin and is followed by affinity purification of TFs and paired-end sequencing. The resulting ORGANIC (Occupied Regions of Genomes from Affinity-purified Naturally Isolated Chromatin) profiles of Saccharomyces cerevisiae Abf1 and Reb1 provide highly accurate base-pair resolution maps that are not biased toward accessible chromatin, and do not require input normalization. We also demonstrate the high specificity of our method when applied to larger genomes by profiling Drosophila melanogaster GAGA Factor and Pipsqueak. Our results suggest that ORGANIC profiling is a widely applicable high-resolution method for sensitive and specific profiling of direct protein-DNA interactions. PMID:24336359

  10. Recent advances in 193-nm single-layer photoresists based on alternating copolymers of cycloolefins

    NASA Astrophysics Data System (ADS)

    Houlihan, Francis M.; Wallow, Thomas I.; Timko, Allen G.; Neria, E.; Hutton, Richard S.; Cirelli, Raymond A.; Nalamasu, Omkaram; Reichmanis, Elsa

    1997-07-01

    We report on our recent investigations on the formulation and processing of 193 nm single layer photoresists based on alternating copolymers of cycloolefins with maleic anhydride. Resists formulated with cycloolefin copolymers are compatible with 0.262 N tetramethylammonium developers, have excellent adhesion, sensitivity, etch resistance and thermal flow properties. The effect of polymer structure and composition, dissolution inhibitor structure and loading as well as the effect of the photoacid generator on the resist dissolution properties was investigated. Based on the results high contrast formulations were evaluated on a GCA XLS (NA equals 0.53, 4X reduction optics) deep-UV stepper to exhibit 0.27 micrometer L/S pair resolution with excellent photosensitivity. Based on the dissolution properties and a spectroscopic examination of the resist, we have designed materials that show less than 0.17 micrometer L/S pair resolution with 193 nm exposures. In this paper, the formulation methodology is detailed and the most recent results upon both with 248 and 193 nm irradiation are described.

  11. Analysis of a variety of inorganic and organic additives in food products by ion-pairing liquid chromatography coupled to high-resolution mass spectrometry.

    PubMed

    Kaufmann, Anton; Widmer, Mirjam; Maden, Kathryn; Butcher, Patrick; Walker, Stephan

    2018-03-05

    A reversed-phase ion-pairing chromatographic method was developed for the detection and quantification of inorganic and organic anionic food additives. A single-stage high-resolution mass spectrometer (orbitrap ion trap, Orbitrap) was used to detect the accurate masses of the unfragmented analyte ions. The developed ion-pairing chromatography method was based on a dibutylamine/hexafluoro-2-propanol buffer. Dibutylamine can be charged to serve as a chromatographic ion-pairing agent. This ensures sufficient retention of inorganic and organic anions. Yet, unlike quaternary amines, it can be de-charged in the electrospray to prevent the formation of neutral analyte ion-pairing agent adducts. This process is significantly facilitated by the added hexafluoro-2-propanol. This approach permits the sensitive detection and quantification of additives like nitrate and mono-, di-, and triphosphate as well as citric acid, a number of artificial sweeteners like cyclamate and aspartame, flavor enhancers like glutamate, and preservatives like sorbic acid. This is a major advantage, since the currently used analytical methods as utilized in food safety laboratories are only capable in monitoring a few compounds or a particular category of food additives. Graphical abstract Deptotonation of ion pair agent in the electrospray interface.

  12. Crystal structure of a four-stranded intercalated DNA: d(C4)

    NASA Technical Reports Server (NTRS)

    Chen, L.; Cai, L.; Zhang, X.; Rich, A.

    1994-01-01

    The crystal structure of d(C4) solved at 2.3-A resolution reveals a four-stranded molecule composed of two interdigitated or intercalated duplexes. The duplexes are held together by hemiprotonated cytosine-cytosine base pairs and are parallel stranded, but the two duplexes point in opposite directions. The molecule has a slow right-handed twist of 12.4 degrees between covalently linked cytosine base pairs, and the base stacking distance is 3.1 A. This is in general agreement with the NMR studies. A biological role for DNA in this conformation is suggested.

  13. Crystal structure and sequence-dependent conformation of the A.G mispaired oligonucleotide d(CGCAAGCTGGCG).

    PubMed Central

    Webster, G D; Sanderson, M R; Skelly, J V; Neidle, S; Swann, P F; Li, B F; Tickle, I J

    1990-01-01

    The crystal structure of the dodecanucleotide d(CGCAAGCTGGCG) has been determined to a resolution of 2.5 A and refined to an R factor of 19.3% for 1710 reflections. The sequence crystallizes as a B-type double helix, with two G(anti).A(syn) base pairs. These are stabilized by three-center hydrogen bonds to pyrimidines that induce perturbations in base-pair geometry. The central AGCT region of the helix has a wide (greater than 6 A) minor groove. PMID:2395870

  14. The ChIP-exo Method: Identifying Protein-DNA Interactions with Near Base Pair Precision.

    PubMed

    Perreault, Andrea A; Venters, Bryan J

    2016-12-23

    Chromatin immunoprecipitation (ChIP) is an indispensable tool in the fields of epigenetics and gene regulation that isolates specific protein-DNA interactions. ChIP coupled to high throughput sequencing (ChIP-seq) is commonly used to determine the genomic location of proteins that interact with chromatin. However, ChIP-seq is hampered by relatively low mapping resolution of several hundred base pairs and high background signal. The ChIP-exo method is a refined version of ChIP-seq that substantially improves upon both resolution and noise. The key distinction of the ChIP-exo methodology is the incorporation of lambda exonuclease digestion in the library preparation workflow to effectively footprint the left and right 5' DNA borders of the protein-DNA crosslink site. The ChIP-exo libraries are then subjected to high throughput sequencing. The resulting data can be leveraged to provide unique and ultra-high resolution insights into the functional organization of the genome. Here, we describe the ChIP-exo method that we have optimized and streamlined for mammalian systems and next-generation sequencing-by-synthesis platform.

  15. Resolution enhancement using simultaneous couple illumination

    NASA Astrophysics Data System (ADS)

    Hussain, Anwar; Martínez Fuentes, José Luis

    2016-10-01

    A super-resolution technique based on structured illumination created by a liquid crystal on silicon spatial light modulator (LCOS-SLM) is presented. Single and simultaneous pairs of tilted beams are generated to illuminate a target object. Resolution enhancement of an optical 4f system is demonstrated by using numerical simulations. The resulting intensity images are recorded at a charged couple device (CCD) and stored in the computer memory for further processing. One dimension enhancement can be performed with only 15 images. Two dimensional complete improvement requires 153 different images. The resolution of the optical system is extended three times compared to the band limited system.

  16. An Evaluation of Stereoscopic Digital Mammography for Earlier Detection of Breast Cancer and Reduced Rate of Recall

    DTIC Science & Technology

    2004-08-01

    on a pair of high -resolution, LCD medical monitors. The change to the new workstation has required us to rewrite the software... In the original CRT-based system, the two 7 images forming a stereo pair were displayed alternately on the same CRT face, at a high frame rate (120 Hz...then, separately, receive the stereo screening exam on the research GE digital mammography unit.

  17. Compressive Sensing for Radar and Radar Sensor Networks

    DTIC Science & Technology

    2013-12-02

    Zero Correlation Zone Sequence Pair Sets for MIMO Radar Inspired by recent advances in MIMO radar, we apply orthogonal phase coded waveforms to MIMO ...radar system in order to gain better range resolution and target direction finding performance [2]. We provide and investigate a generalized MIMO radar...ZCZ) sequence-Pair Set (ZCZPS). We also study the MIMO radar ambiguity function of the system using phase coded waveforms, based on which we analyze

  18. Real-time spectral characterization of a photon pair source using a chirped supercontinuum seed.

    PubMed

    Erskine, Jennifer; England, Duncan; Kupchak, Connor; Sussman, Benjamin

    2018-02-15

    Photon pair sources have wide ranging applications in a variety of quantum photonic experiments and protocols. Many of these protocols require well controlled spectral correlations between the two output photons. However, due to low cross-sections, measuring the joint spectral properties of photon pair sources has historically been a challenging and time-consuming task. Here, we present an approach for the real-time measurement of the joint spectral properties of a fiber-based four wave mixing source. We seed the four wave mixing process using a broadband chirped pulse, studying the stimulated process to extract information regarding the spontaneous process. In addition, we compare stimulated emission measurements with the spontaneous process to confirm the technique's validity. Joint spectral measurements have taken many hours historically and several minutes with recent techniques. Here, measurements have been demonstrated in 5-30 s depending on resolution, offering substantial improvement. Additional benefits of this approach include flexible resolution, large measurement bandwidth, and reduced experimental overhead.

  19. Evaluation of suitable DNA regions for molecular identification of high value medicinal plants in genus Kaempferia.

    PubMed

    Osathanunkul, Maslin; Dheeranupattana, Srisulak; Rotarayanont, Siriphron; Sookkhee, Siriwoot; Osathanunkul, Khukrit; Madesis, Panagiotis

    2017-12-02

    DNA barcoding coupled high resolution melting (Bar-HRM) is an emerging method for species discrimination based on DNA dissociation kinetics. The aim of this work was to evaluate the suitability of different primer sets, derived from selected DNA regions, for Bar-HRM analysis of species in Kaempferia (Zingiberaceae). Four primer pairs were evaluated (rbcL, rpoC, trnL and ITS1). It was observed that the ITS1 barcode was the most useful DNA barcoding region overall for species discrimination out of all of the regions and primers assessed. Thus, the primer pair derived from the ITS1 region was the single most effective region for the identification of the tested species, whereas the rbcL primer pair gave the lowest resolution. Our Bar-HRM developed here would not only be useful for identification of Kaempferia plant specimens lacking essential parts for morphological identification but will be useful for authenticating products in powdered form of a high value medicinal species Kaempferia parviflora, in particular.

  20. Texton-based super-resolution for achieving high spatiotemporal resolution in hybrid camera system

    NASA Astrophysics Data System (ADS)

    Kamimura, Kenji; Tsumura, Norimichi; Nakaguchi, Toshiya; Miyake, Yoichi

    2010-05-01

    Many super-resolution methods have been proposed to enhance the spatial resolution of images by using iteration and multiple input images. In a previous paper, we proposed the example-based super-resolution method to enhance an image through pixel-based texton substitution to reduce the computational cost. In this method, however, we only considered the enhancement of a texture image. In this study, we modified this texton substitution method for a hybrid camera to reduce the required bandwidth of a high-resolution video camera. We applied our algorithm to pairs of high- and low-spatiotemporal-resolution videos, which were synthesized to simulate a hybrid camera. The result showed that the fine detail of the low-resolution video can be reproduced compared with bicubic interpolation and the required bandwidth could be reduced to about 1/5 in a video camera. It was also shown that the peak signal-to-noise ratios (PSNRs) of the images improved by about 6 dB in a trained frame and by 1.0-1.5 dB in a test frame, as determined by comparison with the processed image using bicubic interpolation, and the average PSNRs were higher than those obtained by the well-known Freeman’s patch-based super-resolution method. Compared with that of the Freeman’s patch-based super-resolution method, the computational time of our method was reduced to almost 1/10.

  1. Super-resolution imaging and tracking of protein-protein interactions in sub-diffraction cellular space

    NASA Astrophysics Data System (ADS)

    Liu, Zhen; Xing, Dong; Su, Qian Peter; Zhu, Yun; Zhang, Jiamei; Kong, Xinyu; Xue, Boxin; Wang, Sheng; Sun, Hao; Tao, Yile; Sun, Yujie

    2014-07-01

    Imaging the location and dynamics of individual interacting protein pairs is essential but often difficult because of the fluorescent background from other paired and non-paired molecules, particularly in the sub-diffraction cellular space. Here we develop a new method combining bimolecular fluorescence complementation and photoactivated localization microscopy for super-resolution imaging and single-molecule tracking of specific protein-protein interactions. The method is used to study the interaction of two abundant proteins, MreB and EF-Tu, in Escherichia coli cells. The super-resolution imaging shows interesting distribution and domain sizes of interacting MreB-EF-Tu pairs as a subpopulation of total EF-Tu. The single-molecule tracking of MreB, EF-Tu and MreB-EF-Tu pairs reveals intriguing localization-dependent heterogonous dynamics and provides valuable insights to understanding the roles of MreB-EF-Tu interactions.

  2. Super-resolution imaging and tracking of protein–protein interactions in sub-diffraction cellular space

    PubMed Central

    Liu, Zhen; Xing, Dong; Su, Qian Peter; Zhu, Yun; Zhang, Jiamei; Kong, Xinyu; Xue, Boxin; Wang, Sheng; Sun, Hao; Tao, Yile; Sun, Yujie

    2014-01-01

    Imaging the location and dynamics of individual interacting protein pairs is essential but often difficult because of the fluorescent background from other paired and non-paired molecules, particularly in the sub-diffraction cellular space. Here we develop a new method combining bimolecular fluorescence complementation and photoactivated localization microscopy for super-resolution imaging and single-molecule tracking of specific protein–protein interactions. The method is used to study the interaction of two abundant proteins, MreB and EF-Tu, in Escherichia coli cells. The super-resolution imaging shows interesting distribution and domain sizes of interacting MreB–EF-Tu pairs as a subpopulation of total EF-Tu. The single-molecule tracking of MreB, EF-Tu and MreB–EF-Tu pairs reveals intriguing localization-dependent heterogonous dynamics and provides valuable insights to understanding the roles of MreB–EF-Tu interactions. PMID:25030837

  3. Resolution enhancement of low-quality videos using a high-resolution frame

    NASA Astrophysics Data System (ADS)

    Pham, Tuan Q.; van Vliet, Lucas J.; Schutte, Klamer

    2006-01-01

    This paper proposes an example-based Super-Resolution (SR) algorithm of compressed videos in the Discrete Cosine Transform (DCT) domain. Input to the system is a Low-Resolution (LR) compressed video together with a High-Resolution (HR) still image of similar content. Using a training set of corresponding LR-HR pairs of image patches from the HR still image, high-frequency details are transferred from the HR source to the LR video. The DCT-domain algorithm is much faster than example-based SR in spatial domain 6 because of a reduction in search dimensionality, which is a direct result of the compact and uncorrelated DCT representation. Fast searching techniques like tree-structure vector quantization 16 and coherence search1 are also key to the improved efficiency. Preliminary results on MJPEG sequence show promising result of the DCT-domain SR synthesis approach.

  4. Sordaria, a model system to uncover links between meiotic pairing and recombination

    PubMed Central

    Zickler, Denise; Espagne, Eric

    2017-01-01

    The mycelial fungus Sordaria macrospora was first used as experimental system for meiotic recombination. This review shows that it provides also a powerful cytological system for dissecting chromosome dynamics in wild-type and mutant meioses. Fundamental cytogenetic findings include: (1) The identification of presynaptic alignment as a key step in pairing of homologous chromosomes. (2) The discovery that biochemical complexes that mediate recombination at the DNA level concomitantly mediate pairing of homologs. (3) This pairing process involves not only resolution but also avoidance of chromosomal entanglements and the resolution system includes dissolution of constraining DNA recombination interactions, achieved by a unique role of Mlh1. (4) Discovery that the central components of the synaptonemal complex directly mediate the re-localization of the recombination proteins from on-axis to in-between homologue axis positions. (5) Identification of putative STUbL protein Hei10 as a structure-based signal transduction molecule that coordinates progression and differentiation of recombinational interactions at multiple stages. (6) Discovery that a single interference process mediates both nucleation of the SC and designation of crossover sites, thereby ensuring even spacing of both features. (7) Discovery of local modulation of sister-chromatid cohesion at sites of crossover recombination. PMID:26877138

  5. Accurate quantification of magnetic particle properties by intra-pair magnetophoresis for nanobiotechnology

    NASA Astrophysics Data System (ADS)

    van Reenen, Alexander; Gao, Yang; Bos, Arjen H.; de Jong, Arthur M.; Hulsen, Martien A.; den Toonder, Jaap M. J.; Prins, Menno W. J.

    2013-07-01

    The application of magnetic particles in biomedical research and in-vitro diagnostics requires accurate characterization of their magnetic properties, with single-particle resolution and good statistics. Here, we report intra-pair magnetophoresis as a method to accurately quantify the field-dependent magnetic moments of magnetic particles and to rapidly generate histograms of the magnetic moments with good statistics. We demonstrate our method with particles of different sizes and from different sources, with a measurement precision of a few percent. We expect that intra-pair magnetophoresis will be a powerful tool for the characterization and improvement of particles for the upcoming field of particle-based nanobiotechnology.

  6. Image Mosaic Method Based on SIFT Features of Line Segment

    PubMed Central

    Zhu, Jun; Ren, Mingwu

    2014-01-01

    This paper proposes a novel image mosaic method based on SIFT (Scale Invariant Feature Transform) feature of line segment, aiming to resolve incident scaling, rotation, changes in lighting condition, and so on between two images in the panoramic image mosaic process. This method firstly uses Harris corner detection operator to detect key points. Secondly, it constructs directed line segments, describes them with SIFT feature, and matches those directed segments to acquire rough point matching. Finally, Ransac method is used to eliminate wrong pairs in order to accomplish image mosaic. The results from experiment based on four pairs of images show that our method has strong robustness for resolution, lighting, rotation, and scaling. PMID:24511326

  7. High resolution time interval counter

    DOEpatents

    Condreva, Kenneth J.

    1994-01-01

    A high resolution counter circuit measures the time interval between the occurrence of an initial and a subsequent electrical pulse to two nanoseconds resolution using an eight megahertz clock. The circuit includes a main counter for receiving electrical pulses and generating a binary word--a measure of the number of eight megahertz clock pulses occurring between the signals. A pair of first and second pulse stretchers receive the signal and generate a pair of output signals whose widths are approximately sixty-four times the time between the receipt of the signals by the respective pulse stretchers and the receipt by the respective pulse stretchers of a second subsequent clock pulse. Output signals are thereafter supplied to a pair of start and stop counters operable to generate a pair of binary output words representative of the measure of the width of the pulses to a resolution of two nanoseconds. Errors associated with the pulse stretchers are corrected by providing calibration data to both stretcher circuits, and recording start and stop counter values. Stretched initial and subsequent signals are combined with autocalibration data and supplied to an arithmetic logic unit to determine the time interval in nanoseconds between the pair of electrical pulses being measured.

  8. High resolution time interval counter

    DOEpatents

    Condreva, K.J.

    1994-07-26

    A high resolution counter circuit measures the time interval between the occurrence of an initial and a subsequent electrical pulse to two nanoseconds resolution using an eight megahertz clock. The circuit includes a main counter for receiving electrical pulses and generating a binary word--a measure of the number of eight megahertz clock pulses occurring between the signals. A pair of first and second pulse stretchers receive the signal and generate a pair of output signals whose widths are approximately sixty-four times the time between the receipt of the signals by the respective pulse stretchers and the receipt by the respective pulse stretchers of a second subsequent clock pulse. Output signals are thereafter supplied to a pair of start and stop counters operable to generate a pair of binary output words representative of the measure of the width of the pulses to a resolution of two nanoseconds. Errors associated with the pulse stretchers are corrected by providing calibration data to both stretcher circuits, and recording start and stop counter values. Stretched initial and subsequent signals are combined with autocalibration data and supplied to an arithmetic logic unit to determine the time interval in nanoseconds between the pair of electrical pulses being measured. 3 figs.

  9. A variable resolution x-ray detector for computed tomography: I. Theoretical basis and experimental verification.

    PubMed

    DiBianca, F A; Gupta, V; Zeman, H D

    2000-08-01

    A computed tomography imaging technique called variable resolution x-ray (VRX) detection provides detector resolution ranging from that of clinical body scanning to that of microscopy (1 cy/mm to 100 cy/mm). The VRX detection technique is based on a new principle denoted as "projective compression" that allows the detector resolution element to scale proportionally to the image field size. Two classes of VRX detector geometry are considered. Theoretical aspects related to x-ray physics and data sampling are presented. Measured resolution parameters (line-spread function and modulation-transfer function) are presented and discussed. A VRX image that resolves a pair of 50 micron tungsten hairs spaced 30 microns apart is shown.

  10. Atomic-scale imaging of DNA using scanning tunnelling microscopy.

    PubMed

    Driscoll, R J; Youngquist, M G; Baldeschwieler, J D

    1990-07-19

    The scanning tunnelling microscope (STM) has been used to visualize DNA under water, under oil and in air. Images of single-stranded DNA have shown that submolecular resolution is possible. Here we describe atomic-resolution imaging of duplex DNA. Topographic STM images of uncoated duplex DNA on a graphite substrate obtained in ultra-high vacuum are presented that show double-helical structure, base pairs, and atomic-scale substructure. Experimental STM profiles show excellent correlation with atomic contours of the van der Waals surface of A-form DNA derived from X-ray crystallography. A comparison of variations in the barrier to quantum mechanical tunnelling (barrier-height) with atomic-scale topography shows correlation over the phosphate-sugar backbone but anticorrelation over the base pairs. This relationship may be due to the different chemical characteristics of parts of the molecule. Further investigation of this phenomenon should lead to a better understanding of the physics of imaging adsorbates with the STM and may prove useful in sequencing DNA. The improved resolution compared with previously published STM images of DNA may be attributable to ultra-high vacuum, high data-pixel density, slow scan rate, a fortuitously clean and sharp tip and/or a relatively dilute and extremely clean sample solution. This work demonstrates the potential of the STM for characterization of large biomolecular structures, but additional development will be required to make such high resolution imaging of DNA and other large molecules routine.

  11. Correlating Transcription Initiation and Conformational Changes by a Single-Subunit RNA Polymerase with Near Base-Pair Resolution.

    PubMed

    Koh, Hye Ran; Roy, Rahul; Sorokina, Maria; Tang, Guo-Qing; Nandakumar, Divya; Patel, Smita S; Ha, Taekjip

    2018-05-17

    We provide a comprehensive analysis of transcription in real time by T7 RNA Polymerase (RNAP) using single-molecule fluorescence resonance energy transfer by monitoring the entire life history of transcription initiation, including stepwise RNA synthesis with near base-pair resolution, abortive cycling, and transition into elongation. Kinetically branching pathways were observed for abortive initiation with an RNAP either recycling on the same promoter or exchanging with another RNAP from solution. We detected fast and slow populations of RNAP in their transition into elongation, consistent with the efficient and delayed promoter release, respectively, observed in ensemble studies. Real-time monitoring of abortive cycling using three-probe analysis showed that the initiation events are stochastically branched into productive and failed transcription. The abortive products are generated primarily from initiation events that fail to progress to elongation, and a majority of the productive events transit to elongation without making abortive products. Copyright © 2018 Elsevier Inc. All rights reserved.

  12. A DNA methylation map of human cancer at single base-pair resolution.

    PubMed

    Vidal, E; Sayols, S; Moran, S; Guillaumet-Adkins, A; Schroeder, M P; Royo, R; Orozco, M; Gut, M; Gut, I; Lopez-Bigas, N; Heyn, H; Esteller, M

    2017-10-05

    Although single base-pair resolution DNA methylation landscapes for embryonic and different somatic cell types provided important insights into epigenetic dynamics and cell-type specificity, such comprehensive profiling is incomplete across human cancer types. This prompted us to perform genome-wide DNA methylation profiling of 22 samples derived from normal tissues and associated neoplasms, including primary tumors and cancer cell lines. Unlike their invariant normal counterparts, cancer samples exhibited highly variable CpG methylation levels in a large proportion of the genome, involving progressive changes during tumor evolution. The whole-genome sequencing results from selected samples were replicated in a large cohort of 1112 primary tumors of various cancer types using genome-scale DNA methylation analysis. Specifically, we determined DNA hypermethylation of promoters and enhancers regulating tumor-suppressor genes, with potential cancer-driving effects. DNA hypermethylation events showed evidence of positive selection, mutual exclusivity and tissue specificity, suggesting their active participation in neoplastic transformation. Our data highlight the extensive changes in DNA methylation that occur in cancer onset, progression and dissemination.

  13. Next generation sequencing applications for microRNA biomarker discovery in toxicological studies

    EPA Science Inventory

    Next Generation Sequencing (NGS) technology will be reviewed for its base pair resolution, wide dynamic range, and insights into the genome and transcriptome, with special focus upon the biomarker potential of microRNAs (miRNAs). The first part of this presentation reviews commo...

  14. A three-wavelength multi-channel brain functional imager based on digital lock-in photon-counting technique

    NASA Astrophysics Data System (ADS)

    Ding, Xuemei; Wang, Bingyuan; Liu, Dongyuan; Zhang, Yao; He, Jie; Zhao, Huijuan; Gao, Feng

    2018-02-01

    During the past two decades there has been a dramatic rise in the use of functional near-infrared spectroscopy (fNIRS) as a neuroimaging technique in cognitive neuroscience research. Diffuse optical tomography (DOT) and optical topography (OT) can be employed as the optical imaging techniques for brain activity investigation. However, most current imagers with analogue detection are limited by sensitivity and dynamic range. Although photon-counting detection can significantly improve detection sensitivity, the intrinsic nature of sequential excitations reduces temporal resolution. To improve temporal resolution, sensitivity and dynamic range, we develop a multi-channel continuous-wave (CW) system for brain functional imaging based on a novel lock-in photon-counting technique. The system consists of 60 Light-emitting device (LED) sources at three wavelengths of 660nm, 780nm and 830nm, which are modulated by current-stabilized square-wave signals at different frequencies, and 12 photomultiplier tubes (PMT) based on lock-in photon-counting technique. This design combines the ultra-high sensitivity of the photon-counting technique with the parallelism of the digital lock-in technique. We can therefore acquire the diffused light intensity for all the source-detector pairs (SD-pairs) in parallel. The performance assessments of the system are conducted using phantom experiments, and demonstrate its excellent measurement linearity, negligible inter-channel crosstalk, strong noise robustness and high temporal resolution.

  15. Reducing Earth Topography Resolution for SMAP Mission Ground Tracks Using K-Means Clustering

    NASA Technical Reports Server (NTRS)

    Rizvi, Farheen

    2013-01-01

    The K-means clustering algorithm is used to reduce Earth topography resolution for the SMAP mission ground tracks. As SMAP propagates in orbit, knowledge of the radar antenna footprints on Earth is required for the antenna misalignment calibration. Each antenna footprint contains a latitude and longitude location pair on the Earth surface. There are 400 pairs in one data set for the calibration model. It is computationally expensive to calculate corresponding Earth elevation for these data pairs. Thus, the antenna footprint resolution is reduced. Similar topographical data pairs are grouped together with the K-means clustering algorithm. The resolution is reduced to the mean of each topographical cluster called the cluster centroid. The corresponding Earth elevation for each cluster centroid is assigned to the entire group. Results show that 400 data points are reduced to 60 while still maintaining algorithm performance and computational efficiency. In this work, sensitivity analysis is also performed to show a trade-off between algorithm performance versus computational efficiency as the number of cluster centroids and algorithm iterations are increased.

  16. Sordaria, a model system to uncover links between meiotic pairing and recombination.

    PubMed

    Zickler, Denise; Espagne, Eric

    2016-06-01

    The mycelial fungus Sordaria macrospora was first used as experimental system for meiotic recombination. This review shows that it provides also a powerful cytological system for dissecting chromosome dynamics in wild-type and mutant meioses. Fundamental cytogenetic findings include: (1) the identification of presynaptic alignment as a key step in pairing of homologous chromosomes. (2) The discovery that biochemical complexes that mediate recombination at the DNA level concomitantly mediate pairing of homologs. (3) This pairing process involves not only resolution but also avoidance of chromosomal entanglements and the resolution system includes dissolution of constraining DNA recombination interactions, achieved by a unique role of Mlh1. (4) Discovery that the central components of the synaptonemal complex directly mediate the re-localization of the recombination proteins from on-axis to in-between homologue axis positions. (5) Identification of putative STUbL protein Hei10 as a structure-based signal transduction molecule that coordinates progression and differentiation of recombinational interactions at multiple stages. (6) Discovery that a single interference process mediates both nucleation of the SC and designation of crossover sites, thereby ensuring even spacing of both features. (7) Discovery of local modulation of sister-chromatid cohesion at sites of crossover recombination. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Automatic Sub-Pixel Co-Registration of LandSat-8 OLI and Sentinel-2A MSI Images Using Phase Correlation and Machine Learning Based Mapping

    NASA Technical Reports Server (NTRS)

    Skakun, Sergii; Roger, Jean-Claude; Vermote, Eric F.; Masek, Jeffrey G.; Justice, Christopher O.

    2017-01-01

    This study investigates misregistration issues between Landsat-8/OLI and Sentinel-2A/MSI at 30 m resolution, and between multi-temporal Sentinel-2A images at 10 m resolution using a phase correlation approach and multiple transformation functions. Co-registration of 45 Landsat-8 to Sentinel-2A pairs and 37 Sentinel-2A to Sentinel-2A pairs were analyzed. Phase correlation proved to be a robust approach that allowed us to identify hundreds and thousands of control points on images acquired more than 100 days apart. Overall, misregistration of up to 1.6 pixels at 30 m resolution between Landsat-8 and Sentinel-2A images, and 1.2 pixels and 2.8 pixels at 10 m resolution between multi-temporal Sentinel-2A images from the same and different orbits, respectively, were observed. The non-linear Random Forest regression used for constructing the mapping function showed best results in terms of root mean square error (RMSE), yielding an average RMSE error of 0.07+/-0.02 pixels at 30 m resolution, and 0.09+/-0.05 and 0.15+/-0.06 pixels at 10 m resolution for the same and adjacent Sentinel-2A orbits, respectively, for multiple tiles and multiple conditions. A simpler 1st order polynomial function (affine transformation) yielded RMSE of 0.08+/-0.02 pixels at 30 m resolution and 0.12+/-0.06 (same Sentinel-2A orbits) and 0.20+/-0.09 (adjacent orbits) pixels at 10 m resolution.

  18. A high resolution InSAR topographic reconstruction research in urban area based on TerraSAR-X data

    NASA Astrophysics Data System (ADS)

    Qu, Feifei; Qin, Zhang; Zhao, Chaoying; Zhu, Wu

    2011-10-01

    Aiming at the problems of difficult unwrapping and phase noise in InSAR DEM reconstruction, especially for the high-resolution TerraSAR-X data, this paper improved the height reconstruction algorithm in view of "remove-restore" based on external coarse DEM and multi-interferogram processing, proposed a height calibration method based on CR+GPS data. Several measures have been taken for urban high resolution DEM reconstruction with TerraSAR data. The SAR interferometric pairs with long spatial and short temporal baselines are served for the DEM. The external low resolution and low accuracy DEM is applied for the "remove-restore" concept to ease the phase unwrapping. The stochastic errors including atmospheric effects and phase noise are suppressed by weighted averaging of DEM phases. Six TerraSAR-X data are applied to create the twelve-meter's resolution DEM over Xian, China with the newly-proposed method. The heights in discrete GPS benchmarks are used to calibrate the result, and the RMS of 3.29 meter is achieved by comparing with 1:50000 DEM.

  19. Single-image super-resolution based on Markov random field and contourlet transform

    NASA Astrophysics Data System (ADS)

    Wu, Wei; Liu, Zheng; Gueaieb, Wail; He, Xiaohai

    2011-04-01

    Learning-based methods are well adopted in image super-resolution. In this paper, we propose a new learning-based approach using contourlet transform and Markov random field. The proposed algorithm employs contourlet transform rather than the conventional wavelet to represent image features and takes into account the correlation between adjacent pixels or image patches through the Markov random field (MRF) model. The input low-resolution (LR) image is decomposed with the contourlet transform and fed to the MRF model together with the contourlet transform coefficients from the low- and high-resolution image pairs in the training set. The unknown high-frequency components/coefficients for the input low-resolution image are inferred by a belief propagation algorithm. Finally, the inverse contourlet transform converts the LR input and the inferred high-frequency coefficients into the super-resolved image. The effectiveness of the proposed method is demonstrated with the experiments on facial, vehicle plate, and real scene images. A better visual quality is achieved in terms of peak signal to noise ratio and the image structural similarity measurement.

  20. The Advanced Energetic Pair Telescope (AdEPT}: A Future Medium-Energy Gamma-Ray Balloon (and Explorer?) Mission

    NASA Technical Reports Server (NTRS)

    Hunter, Stanley D.

    2011-01-01

    Gamma-ray astrophysics probes the highest energy, exotic phenomena in astrophysics. In the medium-energy regime, 0.1-200 MeV, many astrophysical objects exhibit unique and transitory behavior such as the transition from electron dominated to hadron dominated processes, spectral breaks, bursts, and flares. Medium-energy gamma-ray imaging however, continues to be a major challenge particularly because of high background, low effective area, and low source intensities. The sensitivity and angular resolution required to address these challenges requires a leap in technology. The Advance Energetic Pair Telescope (AdEPT) being developed at GSFC is designed to image gamma rays above 5 MeV via pair production with angular resolution of 1-10 deg. In addition AdEPT will, for the first time, provide high polarization sensitivity in this energy range. This performance is achieved by reducing the effective area in favor of enhanced angular resolution through the use of a low-density gaseous conversion medium. AdEPT is based on the Three-Dimensional Track Imager (3-DTI) technology that combines a large volume Negative Ion Time Projection Chamber (NITPC) with 2-D Micro-Well Detector (MWD) readout. I will review the major science topics addressable with medium-energy gamma-rays and discuss the current status of the AdEPT technology, a proposed balloon instrument, and the design of a future satellite mission.

  1. Automatic Traffic Advisory and Resolution Service (ATARS) Algorithms Including Resolution-Advisory-Register Logic. Volume 2. Sections 12 through 19. Appendices,

    DTIC Science & Technology

    1981-06-01

    pairwise conflict or an indication of BCAS control . A Pair Record is also created when an aircraft receives a resolution advisory from BCAS or from a non ...replying site: Update track numbers: ILS!I’ (pair record shows a non -connected site in control ) T"_N CALL AI!CPAFTPAIRriwTIFICRTaOI: ( both aircraft...Springfield, Virginia 22161 a>- U S Department of Transportain Systems Research & Development Service LWashington, D.C. 20590 94 This document is

  2. Nine pairs of megastigmane enantiomers from the leaves of Eucommia ulmoides Oliver.

    PubMed

    Yan, Jiankun; Shi, Xuliu; Donkor, Paul Owusu; Zhu, Huajie; Gao, Xiumei; Ding, Liqin; Qiu, Feng

    2017-10-01

    Nine pairs of megastigmane enantiomers (1a/1b-9a/9b), comprising two new compounds (6S,9R)-blumenol C (7b), (6S,9S)-blumenol C (8b), two pairs of enantiomers (+)-(6R)-eucomegastigmane A (1a), (-)-(6S)-eucomegastigmane A (1b), (+)-(3S,4S)-eucomegastigmane B (5a), (-)-(3R,4R)-eucomegastigmane B (5b) isolated by chiral resolution firstly, and twelve known compounds, were isolated from the leaves of Eucommia ulmoides Oliver. Their structures were elucidated based on extensive spectroscopic analysis. Absolute configurations of the megastigmane enantiomers were assigned by comparing experimental ECD and OR with calculated ECD and OR. Docking-based virtual screening of all compounds showed that megastigmane enantiomers have weak intermolecular interactions with the binding site residues of angiotensin-converting enzyme (ACE) and angiotensin II type 1 receptor (AT 1 R).

  3. Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yeo, Hyun Koo; Lee, Jae Young

    2012-04-18

    The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

  4. Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

    PubMed

    Yeo, Hyun Koo; Lee, Jae Young

    2010-05-01

    The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

  5. Simultaneous deblurring and iterative reconstruction of CBCT for image guided brain radiosurgery.

    PubMed

    Hashemi, SayedMasoud; Song, William Y; Sahgal, Arjun; Lee, Young; Huynh, Christopher; Grouza, Vladimir; Nordström, Håkan; Eriksson, Markus; Dorenlot, Antoine; Régis, Jean Marie; Mainprize, James G; Ruschin, Mark

    2017-04-07

    One of the limiting factors in cone-beam CT (CBCT) image quality is system blur, caused by detector response, x-ray source focal spot size, azimuthal blurring, and reconstruction algorithm. In this work, we develop a novel iterative reconstruction algorithm that improves spatial resolution by explicitly accounting for image unsharpness caused by different factors in the reconstruction formulation. While the model-based iterative reconstruction techniques use prior information about the detector response and x-ray source, our proposed technique uses a simple measurable blurring model. In our reconstruction algorithm, denoted as simultaneous deblurring and iterative reconstruction (SDIR), the blur kernel can be estimated using the modulation transfer function (MTF) slice of the CatPhan phantom or any other MTF phantom, such as wire phantoms. The proposed image reconstruction formulation includes two regularization terms: (1) total variation (TV) and (2) nonlocal regularization, solved with a split Bregman augmented Lagrangian iterative method. The SDIR formulation preserves edges, eases the parameter adjustments to achieve both high spatial resolution and low noise variances, and reduces the staircase effect caused by regular TV-penalized iterative algorithms. The proposed algorithm is optimized for a point-of-care head CBCT unit for image-guided radiosurgery and is tested with CatPhan phantom, an anthropomorphic head phantom, and 6 clinical brain stereotactic radiosurgery cases. Our experiments indicate that SDIR outperforms the conventional filtered back projection and TV penalized simultaneous algebraic reconstruction technique methods (represented by adaptive steepest-descent POCS algorithm, ASD-POCS) in terms of MTF and line pair resolution, and retains the favorable properties of the standard TV-based iterative reconstruction algorithms in improving the contrast and reducing the reconstruction artifacts. It improves the visibility of the high contrast details in bony areas and the brain soft-tissue. For example, the results show the ventricles and some brain folds become visible in SDIR reconstructed images and the contrast of the visible lesions is effectively improved. The line-pair resolution was improved from 12 line-pair/cm in FBP to 14 line-pair/cm in SDIR. Adjusting the parameters of the ASD-POCS to achieve 14 line-pair/cm caused the noise variance to be higher than the SDIR. Using these parameters for ASD-POCS, the MTF of FBP and ASD-POCS were very close and equal to 0.7 mm -1 which was increased to 1.2 mm -1 by SDIR, at half maximum.

  6. Simultaneous deblurring and iterative reconstruction of CBCT for image guided brain radiosurgery

    NASA Astrophysics Data System (ADS)

    Hashemi, SayedMasoud; Song, William Y.; Sahgal, Arjun; Lee, Young; Huynh, Christopher; Grouza, Vladimir; Nordström, Håkan; Eriksson, Markus; Dorenlot, Antoine; Régis, Jean Marie; Mainprize, James G.; Ruschin, Mark

    2017-04-01

    One of the limiting factors in cone-beam CT (CBCT) image quality is system blur, caused by detector response, x-ray source focal spot size, azimuthal blurring, and reconstruction algorithm. In this work, we develop a novel iterative reconstruction algorithm that improves spatial resolution by explicitly accounting for image unsharpness caused by different factors in the reconstruction formulation. While the model-based iterative reconstruction techniques use prior information about the detector response and x-ray source, our proposed technique uses a simple measurable blurring model. In our reconstruction algorithm, denoted as simultaneous deblurring and iterative reconstruction (SDIR), the blur kernel can be estimated using the modulation transfer function (MTF) slice of the CatPhan phantom or any other MTF phantom, such as wire phantoms. The proposed image reconstruction formulation includes two regularization terms: (1) total variation (TV) and (2) nonlocal regularization, solved with a split Bregman augmented Lagrangian iterative method. The SDIR formulation preserves edges, eases the parameter adjustments to achieve both high spatial resolution and low noise variances, and reduces the staircase effect caused by regular TV-penalized iterative algorithms. The proposed algorithm is optimized for a point-of-care head CBCT unit for image-guided radiosurgery and is tested with CatPhan phantom, an anthropomorphic head phantom, and 6 clinical brain stereotactic radiosurgery cases. Our experiments indicate that SDIR outperforms the conventional filtered back projection and TV penalized simultaneous algebraic reconstruction technique methods (represented by adaptive steepest-descent POCS algorithm, ASD-POCS) in terms of MTF and line pair resolution, and retains the favorable properties of the standard TV-based iterative reconstruction algorithms in improving the contrast and reducing the reconstruction artifacts. It improves the visibility of the high contrast details in bony areas and the brain soft-tissue. For example, the results show the ventricles and some brain folds become visible in SDIR reconstructed images and the contrast of the visible lesions is effectively improved. The line-pair resolution was improved from 12 line-pair/cm in FBP to 14 line-pair/cm in SDIR. Adjusting the parameters of the ASD-POCS to achieve 14 line-pair/cm caused the noise variance to be higher than the SDIR. Using these parameters for ASD-POCS, the MTF of FBP and ASD-POCS were very close and equal to 0.7 mm-1 which was increased to 1.2 mm-1 by SDIR, at half maximum.

  7. Optimized multiple linear mappings for single image super-resolution

    NASA Astrophysics Data System (ADS)

    Zhang, Kaibing; Li, Jie; Xiong, Zenggang; Liu, Xiuping; Gao, Xinbo

    2017-12-01

    Learning piecewise linear regression has been recognized as an effective way for example learning-based single image super-resolution (SR) in literature. In this paper, we employ an expectation-maximization (EM) algorithm to further improve the SR performance of our previous multiple linear mappings (MLM) based SR method. In the training stage, the proposed method starts with a set of linear regressors obtained by the MLM-based method, and then jointly optimizes the clustering results and the low- and high-resolution subdictionary pairs for regression functions by using the metric of the reconstruction errors. In the test stage, we select the optimal regressor for SR reconstruction by accumulating the reconstruction errors of m-nearest neighbors in the training set. Thorough experimental results carried on six publicly available datasets demonstrate that the proposed SR method can yield high-quality images with finer details and sharper edges in terms of both quantitative and perceptual image quality assessments.

  8. Design Considerations for a Dedicated Gravity Recovery Satellite Mission Consisting of Two Pairs of Satellites

    NASA Technical Reports Server (NTRS)

    Wiese, D. N.; Nerem, R. S.; Lemoine, F. G.

    2011-01-01

    Future satellite missions dedicated to measuring time-variable gravity will need to address the concern of temporal aliasing errors; i.e., errors due to high-frequency mass variations. These errors have been shown to be a limiting error source for future missions with improved sensors. One method of reducing them is to fly multiple satellite pairs, thus increasing the sampling frequency of the mission. While one could imagine a system architecture consisting of dozens of satellite pairs, this paper explores the more economically feasible option of optimizing the orbits of two pairs of satellites. While the search space for this problem is infinite by nature, steps have been made to reduce it via proper assumptions regarding some parameters and a large number of numerical simulations exploring appropriate ranges for other parameters. A search space originally consisting of 15 variables is reduced to two variables with the utmost impact on mission performance: the repeat period of both pairs of satellites (shown to be near-optimal when they are equal to each other), as well as the inclination of one of the satellite pairs (the other pair is assumed to be in a polar orbit). To arrive at this conclusion, we assume circular orbits, repeat groundtracks for both pairs of satellites, a 100-km inter-satellite separation distance, and a minimum allowable operational satellite altitude of 290 km based on a projected 10-year mission lifetime. Given the scientific objectives of determining time-variable hydrology, ice mass variations, and ocean bottom pressure signals with higher spatial resolution, we find that an optimal architecture consists of a polar pair of satellites coupled with a pair inclined at 72deg, both in 13-day repeating orbits. This architecture provides a 67% reduction in error over one pair of satellites, in addition to reducing the longitudinal striping to such a level that minimal post-processing is required, permitting a substantial increase in the spatial resolution of the gravity field products. It should be emphasized that given different sets of scientific objectives for the mission, or a different minimum allowable satellite altitude, different architectures might be selected.

  9. A big data geospatial analytics platform - Physical Analytics Integrated Repository and Services (PAIRS)

    NASA Astrophysics Data System (ADS)

    Hamann, H.; Jimenez Marianno, F.; Klein, L.; Albrecht, C.; Freitag, M.; Hinds, N.; Lu, S.

    2015-12-01

    A big data geospatial analytics platform:Physical Analytics Information Repository and Services (PAIRS)Fernando Marianno, Levente Klein, Siyuan Lu, Conrad Albrecht, Marcus Freitag, Nigel Hinds, Hendrik HamannIBM TJ Watson Research Center, Yorktown Heights, NY 10598A major challenge in leveraging big geospatial data sets is the ability to quickly integrate multiple data sources into physical and statistical models and be run these models in real time. A geospatial data platform called Physical Analytics Information and Services (PAIRS) is developed on top of open source hardware and software stack to manage Terabyte of data. A new data interpolation and re gridding is implemented where any geospatial data layers can be associated with a set of global grid where the grid resolutions is doubling for consecutive layers. Each pixel on the PAIRS grid have an index that is a combination of locations and time stamp. The indexing allow quick access to data sets that are part of a global data layers and allowing to retrieve only the data of interest. PAIRS takes advantages of parallel processing framework (Hadoop) in a cloud environment to digest, curate, and analyze the data sets while being very robust and stable. The data is stored on a distributed no-SQL database (Hbase) across multiple server, data upload and retrieval is parallelized where the original analytics task is broken up is smaller areas/volume, analyzed independently, and then reassembled for the original geographical area. The differentiating aspect of PAIRS is the ability to accelerate model development across large geographical regions and spatial resolution ranging from 0.1 m up to hundreds of kilometer. System performance is benchmarked on real time automated data ingestion and retrieval of Modis and Landsat data layers. The data layers are curated for sensor error, verified for correctness, and analyzed statistically to detect local anomalies. Multi-layer query enable PAIRS to filter different data layers based on specific conditions (e.g analyze flooding risk of a property based on topography, soil ability to hold water, and forecasted precipitation) or retrieve information about locations that share similar weather and vegetation patterns during extreme weather events like heat wave.

  10. The crystal structure of an oligo(U):pre-mRNA duplex from a trypanosome RNA editing substrate

    PubMed Central

    Mooers, Blaine H.M.; Singh, Amritanshu

    2011-01-01

    Guide RNAs bind antiparallel to their target pre-mRNAs to form editing substrates in reaction cycles that insert or delete uridylates (Us) in most mitochondrial transcripts of trypanosomes. The 5′ end of each guide RNA has an anchor sequence that binds to the pre-mRNA by base-pair complementarity. The template sequence in the middle of the guide RNA directs the editing reactions. The 3′ ends of most guide RNAs have ∼15 contiguous Us that bind to the purine-rich unedited pre-mRNA upstream of the editing site. The resulting U-helix is rich in G·U wobble base pairs. To gain insights into the structure of the U-helix, we crystallized 8 bp of the U-helix in one editing substrate for the A6 mRNA of Trypanosoma brucei. The fragment provides three samples of the 5′-AGA-3′/5′-UUU-3′ base-pair triple. The fusion of two identical U-helices head-to-head promoted crystallization. We obtained X-ray diffraction data with a resolution limit of 1.37 Å. The U-helix had low and high twist angles before and after each G·U wobble base pair; this variation was partly due to shearing of the wobble base pairs as revealed in comparisons with a crystal structure of a 16-nt RNA with all Watson–Crick base pairs. Both crystal structures had wider major grooves at the junction between the poly(U) and polypurine tracts. This junction mimics the junction between the template helix and the U-helix in RNA-editing substrates and may be a site of major groove invasion by RNA editing proteins. PMID:21878548

  11. A DNA methylation map of human cancer at single base-pair resolution

    PubMed Central

    Vidal, E; Sayols, S; Moran, S; Guillaumet-Adkins, A; Schroeder, M P; Royo, R; Orozco, M; Gut, M; Gut, I; Lopez-Bigas, N; Heyn, H; Esteller, M

    2017-01-01

    Although single base-pair resolution DNA methylation landscapes for embryonic and different somatic cell types provided important insights into epigenetic dynamics and cell-type specificity, such comprehensive profiling is incomplete across human cancer types. This prompted us to perform genome-wide DNA methylation profiling of 22 samples derived from normal tissues and associated neoplasms, including primary tumors and cancer cell lines. Unlike their invariant normal counterparts, cancer samples exhibited highly variable CpG methylation levels in a large proportion of the genome, involving progressive changes during tumor evolution. The whole-genome sequencing results from selected samples were replicated in a large cohort of 1112 primary tumors of various cancer types using genome-scale DNA methylation analysis. Specifically, we determined DNA hypermethylation of promoters and enhancers regulating tumor-suppressor genes, with potential cancer-driving effects. DNA hypermethylation events showed evidence of positive selection, mutual exclusivity and tissue specificity, suggesting their active participation in neoplastic transformation. Our data highlight the extensive changes in DNA methylation that occur in cancer onset, progression and dissemination. PMID:28581523

  12. γ-ray telescopes using conversions to e+e- pairs: event generators, angular resolution and polarimetry

    NASA Astrophysics Data System (ADS)

    Gros, P.; Bernard, D.

    2017-02-01

    We benchmark various available event generators in Geant4 and EGS5 in the light of ongoing projects for high angular-resolution pair-conversion telescopes at low energy. We compare the distributions of key kinematic variables extracted from the geometry of the three final state particles. We validate and use as reference an exact generator using the full 5D differential cross-section of the conversion process. We focus in particular on the effect of the unmeasured recoiling nucleus on the angular resolution. We show that for high resolution trackers, the choice of the generator affects the estimated resolution of the telescope. We also show that the current available generator are unable to describe accurately a linearly polarised photon source.

  13. Blind prediction of noncanonical RNA structure at atomic accuracy.

    PubMed

    Watkins, Andrew M; Geniesse, Caleb; Kladwang, Wipapat; Zakrevsky, Paul; Jaeger, Luc; Das, Rhiju

    2018-05-01

    Prediction of RNA structure from nucleotide sequence remains an unsolved grand challenge of biochemistry and requires distinct concepts from protein structure prediction. Despite extensive algorithmic development in recent years, modeling of noncanonical base pairs of new RNA structural motifs has not been achieved in blind challenges. We report a stepwise Monte Carlo (SWM) method with a unique add-and-delete move set that enables predictions of noncanonical base pairs of complex RNA structures. A benchmark of 82 diverse motifs establishes the method's general ability to recover noncanonical pairs ab initio, including multistrand motifs that have been refractory to prior approaches. In a blind challenge, SWM models predicted nucleotide-resolution chemical mapping and compensatory mutagenesis experiments for three in vitro selected tetraloop/receptors with previously unsolved structures (C7.2, C7.10, and R1). As a final test, SWM blindly and correctly predicted all noncanonical pairs of a Zika virus double pseudoknot during a recent community-wide RNA-Puzzle. Stepwise structure formation, as encoded in the SWM method, enables modeling of noncanonical RNA structure in a variety of previously intractable problems.

  14. Precision mechanical structure of an ultra-high-resolution spectrometer for inelastic X-ray scattering instrument

    DOEpatents

    Shu, Deming; Shvydko, Yuri; Stoupin, Stanislav A.; Khachatryan, Ruben; Goetze, Kurt A.; Roberts, Timothy

    2015-04-14

    A method and an ultrahigh-resolution spectrometer including a precision mechanical structure for positioning inelastic X-ray scattering optics are provided. The spectrometer includes an X-ray monochromator and an X-ray analyzer, each including X-ray optics of a collimating (C) crystal, a pair of dispersing (D) element crystals, anomalous transmission filter (F) and a wavelength (W) selector crystal. A respective precision mechanical structure is provided with the X-ray monochromator and the X-ray analyzer. The precision mechanical structure includes a base plate, such as an aluminum base plate; positioning stages for D-crystal alignment; positioning stages with an incline sensor for C/F/W-crystal alignment, and the positioning stages including flexure-based high-stiffness structure.

  15. Diffractive shear interferometry for extreme ultraviolet high-resolution lensless imaging

    NASA Astrophysics Data System (ADS)

    Jansen, G. S. M.; de Beurs, A.; Liu, X.; Eikema, K. S. E.; Witte, S.

    2018-05-01

    We demonstrate a novel imaging approach and associated reconstruction algorithm for far-field coherent diffractive imaging, based on the measurement of a pair of laterally sheared diffraction patterns. The differential phase profile retrieved from such a measurement leads to improved reconstruction accuracy, increased robustness against noise, and faster convergence compared to traditional coherent diffractive imaging methods. We measure laterally sheared diffraction patterns using Fourier-transform spectroscopy with two phase-locked pulse pairs from a high harmonic source. Using this approach, we demonstrate spectrally resolved imaging at extreme ultraviolet wavelengths between 28 and 35 nm.

  16. Studying Spatial Resolution of CZT Detectors Using Sub-Pixel Positioning for SPECT

    NASA Astrophysics Data System (ADS)

    Montémont, Guillaume; Lux, Silvère; Monnet, Olivier; Stanchina, Sylvain; Verger, Loïck

    2014-10-01

    CZT detectors are the basic building block of a variety of new SPECT systems. Their modularity allows adapting system architecture to specific applications such as cardiac, breast, brain or small animal imaging. In semiconductors, a high number of electron-hole pairs is produced by a single interaction. This direct conversion process allows better energy and spatial resolutions than usual scintillation detectors based on NaI(Tl). However, it remains often unclear if SPECT imaging can really benefit of that performance gain. We investigate the system performance of a detection module, which is based on 5 mm thick CZT with a segmented anode having a 2.5 mm pitch by simulation and experimentation. This pitch allows an easy assembly of the crystal on the readout board and limits the space occupied by electronics without significantly degrading energy and spatial resolution.

  17. Detecting cm-scale hot spot over 24-km-long single-mode fiber by using differential pulse pair BOTDA based on double-peak spectrum.

    PubMed

    Diakaridia, Sanogo; Pan, Yue; Xu, Pengbai; Zhou, Dengwang; Wang, Benzhang; Teng, Lei; Lu, Zhiwei; Ba, Dexin; Dong, Yongkang

    2017-07-24

    In distributed Brillouin optical fiber sensor when the length of the perturbation to be detected is much smaller than the spatial resolution that is defined by the pulse width, the measured Brillouin gain spectrum (BGS) experiences two or multiple peaks. In this work, we propose and demonstrate a technique using differential pulse pair Brillouin optical time-domain analysis (DPP-BOTDA) based on double-peak BGS to enhance small-scale events detection capability, where two types of single mode fiber (main fiber and secondary fiber) with 116 MHz Brillouin frequency shift (BFS) difference have been used. We have realized detection of a 5-cm hot spot at the far end of 24-km single mode fiber by employing a 50-cm spatial resolution DPP-BOTDA with only 1GS/s sampling rate (corresponding to 10 cm/point). The BFS at the far end of 24-km sensing fiber has been measured with 0.54 MHz standard deviation which corresponds to a 0.5°C temperature accuracy. This technique is simple and cost effective because it is implemented using the similar experimental setup of the standard BOTDA, however, it should be noted that the consecutive small-scale events have to be separated by a minimum length corresponding to the spatial resolution defined by the pulse width difference.

  18. Visualization of drug-nucleic acid interactions at atomic resolution v. structure of two aminoacridine/dinucleoside monophosphate crystalline complexes, proflavine: 5-iodocytidylyl(3'-5') guanosine and acridine orange: 5-iodocytidylyl(3'-5') guanosine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Reddy, B.S.; Seshadri, T.P.; Sakore, T.D.

    1979-01-01

    Acridine orange and proflavine form complexes with the dinucleoside monophosphate, 5-iodocytidylyl(3'-5') guanosine (iodoCpG). The acridine orange-iodoCpG crystals are monoclinic, space group P2/sub 1/, with unit cell dimensions a = 14.36 A, b = 19.64 A, c = 20.67 A, ..beta.. = 102.5. The proflavine-iodoCpG crystals are monoclinic, space group C2, with unit cell dimensions a = 32.14 A, b = 22.23 A, c = 18.42 A, ..beta.. = 123.3. Both structures have been solved to atomic resolution by Patterson and Fourier methods, and refined by full matrix least squares. Acridine orange forms an intercalative structure with iodoCpG but the acridinemore » nucleus lies asymmetrically in the intercalation site. This asymmetric intercalation is accompanied by a sliding of base-pairs upon the acridine nucleus. Base-pairs above and below the drug are separated by about 6.8 A and are twisted about 10/sup 0/. Proflavine demonstrates symmetric intercalation with iodoCpG. Hydrogen bonds connect amino- groups on proflavine with phosphate oxygen atoms on the dinucleotide. Base-pairs above and below the intercalative proflavine molecule are twisted about 36/sup 0/. The altered magnitude of this angular twist reflects the sugar puckering pattern that is observed. We propose a proflavine-DNA and an acridine orange-DNA binding model. We will describe these models in detail in this paper.« less

  19. Distinguishing Individual DNA Bases in a Network by Non-Resonant Tip-Enhanced Raman Scattering.

    PubMed

    Zhang, Rui; Zhang, Xianbiao; Wang, Huifang; Zhang, Yao; Jiang, Song; Hu, Chunrui; Zhang, Yang; Luo, Yi; Dong, Zhenchao

    2017-05-08

    The importance of identifying DNA bases at the single-molecule level is well recognized for many biological applications. Although such identification can be achieved by electrical measurements using special setups, it is still not possible to identify single bases in real space by optical means owing to the diffraction limit. Herein, we demonstrate the outstanding ability of scanning tunneling microscope (STM)-controlled non-resonant tip-enhanced Raman scattering (TERS) to unambiguously distinguish two individual complementary DNA bases (adenine and thymine) with a spatial resolution down to 0.9 nm. The distinct Raman fingerprints identified for the two molecules allow to differentiate in real space individual DNA bases in coupled base pairs. The demonstrated ability of non-resonant Raman scattering with super-high spatial resolution will significantly extend the applicability of TERS, opening up new routes for single-molecule DNA sequencing. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Reversed-phase ion-pair liquid chromatography method for purification of duplex DNA with single base pair resolution

    PubMed Central

    Wysoczynski, Christina L.; Roemer, Sarah C.; Dostal, Vishantie; Barkley, Robert M.; Churchill, Mair E. A.; Malarkey, Christopher S.

    2013-01-01

    Obtaining quantities of highly pure duplex DNA is a bottleneck in the biophysical analysis of protein–DNA complexes. In traditional DNA purification methods, the individual cognate DNA strands are purified separately before annealing to form DNA duplexes. This approach works well for palindromic sequences, in which top and bottom strands are identical and duplex formation is typically complete. However, in cases where the DNA is non-palindromic, excess of single-stranded DNA must be removed through additional purification steps to prevent it from interfering in further experiments. Here we describe and apply a novel reversed-phase ion-pair liquid chromatography purification method for double-stranded DNA ranging in lengths from 17 to 51 bp. Both palindromic and non-palindromic DNA can be readily purified. This method has the unique ability to separate blunt double-stranded DNA from pre-attenuated (n-1, n-2, etc) synthesis products, and from DNA duplexes with single base pair overhangs. Additionally, palindromic DNA sequences with only minor differences in the central spacer sequence of the DNA can be separated, and the purified DNA is suitable for co-crystallization of protein–DNA complexes. Thus, double-stranded ion-pair liquid chromatography is a useful approach for duplex DNA purification for many applications. PMID:24013567

  1. The Advanced Pair Telescope (APT) Mission Concept

    NASA Technical Reports Server (NTRS)

    Hunter, Stanley; Buckley, James H.

    2008-01-01

    We present a mission concept for the Advanced Pair Telescope (APT), a high-energy gamma-ray instrument with an order of magnitude improvement in sensitivity, 6 sr field of view, and angular resolution a factor of 3-10 times that of GLAST. With its very wide instantaneous field-of-view and large effective area, this instrument would be capable of detecting GRBs at very large redshifts, would enable a very high resolution study of SNRs and PWN, and could provide hour-scale temporal resolution of transients from many AGN and galactic sources. The APT instrument will consist of a Xe time-projection-chamber tracker that bridges the energy regime between Compton scattering and pair production and will provide an unprecedented improvement in angular resolution; a thick scintillating-fiber trackerlcalorimeter that will provide sensitivity and energy resolution to higher energies and will possess a factor of 10 improvement in geometric factor over GLAST; and an anticoincidence detector using scintillator-tiles to reject charged particles. After the anticipated 10-years of GLAST operation , the APT instrument would provide continued coverage of the critial high-energy gamma-ray band (between 30 MeV to 100 GeV), providing an essential component of broad-band multiwavelength studies of the high-energy universe.

  2. MCORES: a system for noun phrase coreference resolution for clinical records.

    PubMed

    Bodnari, Andreea; Szolovits, Peter; Uzuner, Özlem

    2012-01-01

    Narratives of electronic medical records contain information that can be useful for clinical practice and multi-purpose research. This information needs to be put into a structured form before it can be used by automated systems. Coreference resolution is a step in the transformation of narratives into a structured form. This study presents a medical coreference resolution system (MCORES) for noun phrases in four frequently used clinical semantic categories: persons, problems, treatments, and tests. MCORES treats coreference resolution as a binary classification task. Given a pair of concepts from a semantic category, it determines coreferent pairs and clusters them into chains. MCORES uses an enhanced set of lexical, syntactic, and semantic features. Some MCORES features measure the distance between various representations of the concepts in a pair and can be asymmetric. MCORES was compared with an in-house baseline that uses only single-perspective 'token overlap' and 'number agreement' features. MCORES was shown to outperform the baseline; its enhanced features contribute significantly to performance. In addition to the baseline, MCORES was compared against two available third-party, open-domain systems, RECONCILE(ACL09) and the Beautiful Anaphora Resolution Toolkit (BART). MCORES was shown to outperform both of these systems on clinical records.

  3. Energy correlations of photon pairs generated by a silicon microring resonator probed by Stimulated Four Wave Mixing.

    PubMed

    Grassani, Davide; Simbula, Angelica; Pirotta, Stefano; Galli, Matteo; Menotti, Matteo; Harris, Nicholas C; Baehr-Jones, Tom; Hochberg, Michael; Galland, Christophe; Liscidini, Marco; Bajoni, Daniele

    2016-04-01

    Compact silicon integrated devices, such as micro-ring resonators, have recently been demonstrated as efficient sources of quantum correlated photon pairs. The mass production of integrated devices demands the implementation of fast and reliable techniques to monitor the device performances. In the case of time-energy correlations, this is particularly challenging, as it requires high spectral resolution that is not currently achievable in coincidence measurements. Here we reconstruct the joint spectral density of photons pairs generated by spontaneous four-wave mixing in a silicon ring resonator by studying the corresponding stimulated process, namely stimulated four wave mixing. We show that this approach, featuring high spectral resolution and short measurement times, allows one to discriminate between nearly-uncorrelated and highly-correlated photon pairs.

  4. Hierarchical graphical-based human pose estimation via local multi-resolution convolutional neural network

    NASA Astrophysics Data System (ADS)

    Zhu, Aichun; Wang, Tian; Snoussi, Hichem

    2018-03-01

    This paper addresses the problems of the graphical-based human pose estimation in still images, including the diversity of appearances and confounding background clutter. We present a new architecture for estimating human pose using a Convolutional Neural Network (CNN). Firstly, a Relative Mixture Deformable Model (RMDM) is defined by each pair of connected parts to compute the relative spatial information in the graphical model. Secondly, a Local Multi-Resolution Convolutional Neural Network (LMR-CNN) is proposed to train and learn the multi-scale representation of each body parts by combining different levels of part context. Thirdly, a LMR-CNN based hierarchical model is defined to explore the context information of limb parts. Finally, the experimental results demonstrate the effectiveness of the proposed deep learning approach for human pose estimation.

  5. Multiscale registration algorithm for alignment of meshes

    NASA Astrophysics Data System (ADS)

    Vadde, Srikanth; Kamarthi, Sagar V.; Gupta, Surendra M.

    2004-03-01

    Taking a multi-resolution approach, this research work proposes an effective algorithm for aligning a pair of scans obtained by scanning an object's surface from two adjacent views. This algorithm first encases each scan in the pair with an array of cubes of equal and fixed size. For each scan in the pair a surrogate scan is created by the centroids of the cubes that encase the scan. The Gaussian curvatures of points across the surrogate scan pair are compared to find the surrogate corresponding points. If the difference between the Gaussian curvatures of any two points on the surrogate scan pair is less than a predetermined threshold, then those two points are accepted as a pair of surrogate corresponding points. The rotation and translation values between the surrogate scan pair are determined by using a set of surrogate corresponding points. Using the same rotation and translation values the original scan pairs are aligned. The resulting registration (or alignment) error is computed to check the accuracy of the scan alignment. When the registration error becomes acceptably small, the algorithm is terminated. Otherwise the above process is continued with cubes of smaller and smaller sizes until the algorithm is terminated. However at each finer resolution the search space for finding the surrogate corresponding points is restricted to the regions in the neighborhood of the surrogate points that were at found at the preceding coarser level. The surrogate corresponding points, as the resolution becomes finer and finer, converge to the true corresponding points on the original scans. This approach offers three main benefits: it improves the chances of finding the true corresponding points on the scans, minimize the adverse effects of noise in the scans, and reduce the computational load for finding the corresponding points.

  6. Method of incident low-energy gamma-ray direction reconstruction in the GAMMA-400 gamma-ray space telescope

    NASA Astrophysics Data System (ADS)

    Kheymits, M. D.; Leonov, A. A.; Zverev, V. G.; Galper, A. M.; Arkhangelskaya, I. V.; Arkhangelskiy, A. I.; Suchkov, S. I.; Topchiev, N. P.; Yurkin, Yu T.; Bakaldin, A. V.; Dalkarov, O. D.

    2016-02-01

    The GAMMA-400 gamma-ray space-based telescope has as its main goals to measure cosmic γ-ray fluxes and the electron-positron cosmic-ray component produced, theoretically, in dark-matter-particles decay or annihilation processes, to search for discrete γ-ray sources and study them in detail, to examine the energy spectra of diffuse γ-rays — both galactic and extragalactic — and to study gamma-ray bursts (GRBs) and γ-rays from the active Sun. Scientific goals of GAMMA-400 telescope require fine angular resolution. The telescope is of a pair-production type. In the converter-tracker, the incident gamma-ray photon converts into electron-positron pair in the tungsten layer and then the tracks are detected by silicon- strip position-sensitive detectors. Multiple scattering processes become a significant obstacle in the incident-gamma direction reconstruction for energies below several gigaelectronvolts. The method of utilising this process to improve the resolution is proposed in the presented work.

  7. Detecting reciprocity at a global scale

    PubMed Central

    Frank, Morgan R.; Obradovich, Nick; Sun, Lijun; Woon, Wei Lee; LeVeck, Brad L.; Rahwan, Iyad

    2018-01-01

    Reciprocity stabilizes cooperation from the level of microbes all the way up to humans interacting in small groups, but does reciprocity also underlie stable cooperation between larger human agglomerations, such as nation states? Famously, evolutionary models show that reciprocity could emerge as a widespread strategy for achieving international cooperation. However, existing studies have only detected reciprocity-driven cooperation in a small number of country pairs. We apply a new method for detecting mutual influence in dynamical systems to a new large-scale data set that records state interactions with high temporal resolution. Doing so, we detect reciprocity between many country pairs in the international system and find that these reciprocating country pairs exhibit qualitatively different cooperative dynamics when compared to nonreciprocating pairs. Consistent with evolutionary theories of cooperation, reciprocating country pairs exhibit higher levels of stable cooperation and are more likely to punish instances of noncooperation. However, countries in reciprocity-based relationships are also quicker to forgive single acts of noncooperation by eventually returning to previous levels of mutual cooperation. By contrast, nonreciprocating pairs are more likely to exploit each other’s cooperation via higher rates of defection. Together, these findings provide the strongest evidence to date that reciprocity is a widespread mechanism for achieving international cooperation. PMID:29326983

  8. Detecting reciprocity at a global scale.

    PubMed

    Frank, Morgan R; Obradovich, Nick; Sun, Lijun; Woon, Wei Lee; LeVeck, Brad L; Rahwan, Iyad

    2018-01-01

    Reciprocity stabilizes cooperation from the level of microbes all the way up to humans interacting in small groups, but does reciprocity also underlie stable cooperation between larger human agglomerations, such as nation states? Famously, evolutionary models show that reciprocity could emerge as a widespread strategy for achieving international cooperation. However, existing studies have only detected reciprocity-driven cooperation in a small number of country pairs. We apply a new method for detecting mutual influence in dynamical systems to a new large-scale data set that records state interactions with high temporal resolution. Doing so, we detect reciprocity between many country pairs in the international system and find that these reciprocating country pairs exhibit qualitatively different cooperative dynamics when compared to nonreciprocating pairs. Consistent with evolutionary theories of cooperation, reciprocating country pairs exhibit higher levels of stable cooperation and are more likely to punish instances of noncooperation. However, countries in reciprocity-based relationships are also quicker to forgive single acts of noncooperation by eventually returning to previous levels of mutual cooperation. By contrast, nonreciprocating pairs are more likely to exploit each other's cooperation via higher rates of defection. Together, these findings provide the strongest evidence to date that reciprocity is a widespread mechanism for achieving international cooperation.

  9. A versatile genome-scale PCR-based pipeline for high-definition DNA FISH.

    PubMed

    Bienko, Magda; Crosetto, Nicola; Teytelman, Leonid; Klemm, Sandy; Itzkovitz, Shalev; van Oudenaarden, Alexander

    2013-02-01

    We developed a cost-effective genome-scale PCR-based method for high-definition DNA FISH (HD-FISH). We visualized gene loci with diffraction-limited resolution, chromosomes as spot clusters and single genes together with transcripts by combining HD-FISH with single-molecule RNA FISH. We provide a database of over 4.3 million primer pairs targeting the human and mouse genomes that is readily usable for rapid and flexible generation of probes.

  10. A curved RNA helix incorporating an internal loop with G·A and A·A non-Watson–Crick base pairing

    PubMed Central

    Baeyens, Katrien J.; De Bondt, Hendrik L.; Pardi, Arthur; Holbrook, Stephen R.

    1996-01-01

    The crystal structure of the RNA dodecamer 5′-GGCC(GAAA)GGCC-3′ has been determined from x-ray diffraction data to 2.3-Å resolution. In the crystal, these oligomers form double helices around twofold symmetry axes. Four consecutive non-Watson–Crick base pairs make up an internal loop in the middle of the duplex, including sheared G·A pairs and novel asymmetric A·A pairs. This internal loop sequence produces a significant curvature and narrowing of the double helix. The helix is curved by 34° from end to end and the diameter is narrowed by 24% in the internal loop. A Mn2+ ion is bound directly to the N7 of the first guanine in the Watson–Crick region following the internal loop and the phosphate of the preceding residue. This Mn2+ location corresponds to a metal binding site observed in the hammerhead catalytic RNA. PMID:8917508

  11. Altering the Electrostatic Potential in the Major Groove: Thermodynamic and Structural Characterization of 7-Deaza-2;#8242;-deoxyadenosine:dT Base Pairing in DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kowal, Ewa A.; Ganguly, Manjori; Pallan, Pradeep S.

    As part of an ongoing effort to explore the effect of major groove electrostatics on the thermodynamic stability and structure of DNA, a 7-deaza-2'-deoxyadenosine:dT (7-deaza-dA:dT) base pair in the Dickerson-Drew dodecamer (DDD) was studied. The removal of the electronegative N7 atom on dA and the replacement with an electropositive C-H in the major groove was expected to have a significant effect on major groove electrostatics. The structure of the 7-deaza-dA:dT base pair was determined at 1.1 {angstrom} resolution in the presence of Mg{sup 2+}. The 7-deaza-dA, which is isosteric for dA, had minimal effect on the base pairing geometry andmore » the conformation of the DDD in the crystalline state. There was no major groove cation association with the 7-deaza-dA heterocycle. In solution, circular dichroism showed a positive Cotton effect centered at 280 nm and a negative Cotton effect centered at 250 nm that were characteristic of a right-handed helix in the B-conformation. However, temperature-dependent NMR studies showed increased exchange between the thymine N3 imino proton of the 7-deaza-dA:dT base pair and water, suggesting reduced stacking interactions and an increased rate of base pair opening. This correlated with the observed thermodynamic destabilization of the 7-deaza-dA modified duplex relative to the DDD. A combination of UV melting and differential scanning calorimetry experiments were conducted to evaluate the relative contributions of enthalpy and entropy in the thermodynamic destabilization of the DDD. The most significant contribution arose from an unfavorable enthalpy term, which probably results from less favorable stacking interactions in the modified duplex, which was accompanied by a significant reduction in the release of water and cations from the 7-deaza-dA modified DNA.« less

  12. Altering the Electrostatic Potential in the Major Groove: Thermodynamic and Structural Characterization of 7-Deaza-2′-deoxyadenosine:dT Base Pairing in DNA

    PubMed Central

    2011-01-01

    As part of an ongoing effort to explore the effect of major groove electrostatics on the thermodynamic stability and structure of DNA, a 7-deaza-2′-deoxyadenosine:dT (7-deaza-dA:dT) base pair in the Dickerson–Drew dodecamer (DDD) was studied. The removal of the electronegative N7 atom on dA and the replacement with an electropositive C–H in the major groove was expected to have a significant effect on major groove electrostatics. The structure of the 7-deaza-dA:dT base pair was determined at 1.1 Å resolution in the presence of Mg2+. The 7-deaza-dA, which is isosteric for dA, had minimal effect on the base pairing geometry and the conformation of the DDD in the crystalline state. There was no major groove cation association with the 7-deaza-dA heterocycle. In solution, circular dichroism showed a positive Cotton effect centered at 280 nm and a negative Cotton effect centered at 250 nm that were characteristic of a right-handed helix in the B-conformation. However, temperature-dependent NMR studies showed increased exchange between the thymine N3 imino proton of the 7-deaza-dA:dT base pair and water, suggesting reduced stacking interactions and an increased rate of base pair opening. This correlated with the observed thermodynamic destabilization of the 7-deaza-dA modified duplex relative to the DDD. A combination of UV melting and differential scanning calorimetry experiments were conducted to evaluate the relative contributions of enthalpy and entropy in the thermodynamic destabilization of the DDD. The most significant contribution arose from an unfavorable enthalpy term, which probably results from less favorable stacking interactions in the modified duplex, which was accompanied by a significant reduction in the release of water and cations from the 7-deaza-dA modified DNA. PMID:22059929

  13. Comparison of different "along the track" high resolution satellite stereo-pair for DSM extraction

    NASA Astrophysics Data System (ADS)

    Nikolakopoulos, Konstantinos G.

    2013-10-01

    The possibility to create DEM from stereo pairs is based on the Pythagoras theorem and on the principles of photogrammetry that are applied to aerial photographs stereo pairs for the last seventy years. The application of these principles to digital satellite stereo data was inherent in the first satellite missions. During the last decades the satellite stereo-pairs were acquired across the track in different days (SPOT, ERS etc.). More recently the same-date along the track stereo-data acquisition seems to prevail (Terra ASTER, SPOT5 HRS, Cartosat, ALOS Prism) as it reduces the radiometric image variations (refractive effects, sun illumination, temporal changes) and thus increases the correlation success rate in any image matching.Two of the newest satellite sensors with stereo collection capability is Cartosat and ALOS Prism. Both of them acquire stereopairs along the track with a 2,5m spatial resolution covering areas of 30X30km. In this study we compare two different satellite stereo-pair collected along the track for DSM creation. The first one is created from a Cartosat stereopair and the second one from an ALOS PRISM triplet. The area of study is situated in Chalkidiki Peninsula, Greece. Both DEMs were created using the same ground control points collected with a Differential GPS. After a first control for random or systematic errors a statistical analysis was done. Points of certified elevation have been used to estimate the accuracy of these two DSMs. The elevation difference between the different DEMs was calculated. 2D RMSE, correlation and the percentile value were also computed and the results are presented.

  14. Easy way to determine quantitative spatial resolution distribution for a general inverse problem

    NASA Astrophysics Data System (ADS)

    An, M.; Feng, M.

    2013-12-01

    The spatial resolution computation of a solution was nontrivial and more difficult than solving an inverse problem. Most geophysical studies, except for tomographic studies, almost uniformly neglect the calculation of a practical spatial resolution. In seismic tomography studies, a qualitative resolution length can be indicatively given via visual inspection of the restoration of a synthetic structure (e.g., checkerboard tests). An effective strategy for obtaining quantitative resolution length is to calculate Backus-Gilbert resolution kernels (also referred to as a resolution matrix) by matrix operation. However, not all resolution matrices can provide resolution length information, and the computation of resolution matrix is often a difficult problem for very large inverse problems. A new class of resolution matrices, called the statistical resolution matrices (An, 2012, GJI), can be directly determined via a simple one-parameter nonlinear inversion performed based on limited pairs of random synthetic models and their inverse solutions. The total procedure were restricted to forward/inversion processes used in the real inverse problem and were independent of the degree of inverse skill used in the solution inversion. Spatial resolution lengths can be directly given during the inversion. Tests on 1D/2D/3D model inversion demonstrated that this simple method can be at least valid for a general linear inverse problem.

  15. Dual Resolution Images from Paired Fingerprint Cards

    National Institute of Standards and Technology Data Gateway

    NIST Dual Resolution Images from Paired Fingerprint Cards (Web, free access)   NIST Special Database 30 is being distributed for use in development and testing of fingerprint compression and fingerprint matching systems. The database allows the user to develop and evaluate data compression algorithms for fingerprint images scanned at both 19.7 ppmm (500 dpi) and 39.4 ppmm (1000 dpi). The data consist of 36 ten-print paired cards with both the rolled and plain images scanned at 19.7 and 39.4 pixels per mm. A newer version of the compression/decompression software on the CDROM can be found at the website http://www.nist.gov/itl/iad/ig/nigos.cfm as part of the NBIS package.

  16. Unusual target site disruption by the rare-cutting HNH restriction endonuclease PacI

    PubMed Central

    Shen, Betty; Heiter, Daniel F.; Chan, Siu-Hong; Wang, Hua; Xu, Shuang-Yong; Morgan, Richard D.; Wilson, Geoffrey G.; Stoddard, Barry L.

    2010-01-01

    The crystal structure of the rare-cutting HNH restriction endonuclease PacI in complex with its eight base pair target recognition sequence 5'-TTAATTAA-3' has been determined to 1.9 Å resolution. The enzyme forms an extended homodimer, with each subunit containing two zinc-bound motifs surrounding a ββα-metal catalytic site. The latter is unusual in that a tyrosine residue likely initiates strand-cleavage. PacI dramatically distorts its target sequence from Watson-Crick duplex DNA basepairing, with every base separated from its original partner. Two bases on each strand are unpaired, four are engaged in non-canonical A:A and T:T base pairs, and the remaining two bases are matched with new Watson-Crick partners. This represents a highly unusual DNA binding mechanism for a restriction endonuclease, and implies that initial recognition of the target site might involve significantly different contacts from those visualized in the DNA-bound cocrystal structures. PMID:20541511

  17. Effects of pure and hybrid iterative reconstruction algorithms on high-resolution computed tomography in the evaluation of interstitial lung disease.

    PubMed

    Katsura, Masaki; Sato, Jiro; Akahane, Masaaki; Mise, Yoko; Sumida, Kaoru; Abe, Osamu

    2017-08-01

    To compare image quality characteristics of high-resolution computed tomography (HRCT) in the evaluation of interstitial lung disease using three different reconstruction methods: model-based iterative reconstruction (MBIR), adaptive statistical iterative reconstruction (ASIR), and filtered back projection (FBP). Eighty-nine consecutive patients with interstitial lung disease underwent standard-of-care chest CT with 64-row multi-detector CT. HRCT images were reconstructed in 0.625-mm contiguous axial slices using FBP, ASIR, and MBIR. Two radiologists independently assessed the images in a blinded manner for subjective image noise, streak artifacts, and visualization of normal and pathologic structures. Objective image noise was measured in the lung parenchyma. Spatial resolution was assessed by measuring the modulation transfer function (MTF). MBIR offered significantly lower objective image noise (22.24±4.53, P<0.01 among all pairs, Student's t-test) compared with ASIR (39.76±7.41) and FBP (51.91±9.71). MTF (spatial resolution) was increased using MBIR compared with ASIR and FBP. MBIR showed improvements in visualization of normal and pathologic structures over ASIR and FBP, while ASIR was rated quite similarly to FBP. MBIR significantly improved subjective image noise (P<0.01 among all pairs, the sign test), and streak artifacts (P<0.01 each for MBIR vs. the other 2 image data sets). MBIR provides high-quality HRCT images for interstitial lung disease by reducing image noise and streak artifacts and improving spatial resolution compared with ASIR and FBP. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Building Change Detection in Very High Resolution Satellite Stereo Image Time Series

    NASA Astrophysics Data System (ADS)

    Tian, J.; Qin, R.; Cerra, D.; Reinartz, P.

    2016-06-01

    There is an increasing demand for robust methods on urban sprawl monitoring. The steadily increasing number of high resolution and multi-view sensors allows producing datasets with high temporal and spatial resolution; however, less effort has been dedicated to employ very high resolution (VHR) satellite image time series (SITS) to monitor the changes in buildings with higher accuracy. In addition, these VHR data are often acquired from different sensors. The objective of this research is to propose a robust time-series data analysis method for VHR stereo imagery. Firstly, the spatial-temporal information of the stereo imagery and the Digital Surface Models (DSMs) generated from them are combined, and building probability maps (BPM) are calculated for all acquisition dates. In the second step, an object-based change analysis is performed based on the derivative features of the BPM sets. The change consistence between object-level and pixel-level are checked to remove any outlier pixels. Results are assessed on six pairs of VHR satellite images acquired within a time span of 7 years. The evaluation results have proved the efficiency of the proposed method.

  19. The Crystal Structure of Non-Modified and Bipyridine-Modified PNA Duplexes

    PubMed Central

    Yeh, Joanne I.; Pohl, Ehmke; Truan, Daphne; He, Wei; Sheldrick, George M.; Du, Shoucheng; Achim, Catalina

    2011-01-01

    Peptide nucleic acid (PNA) is a synthetic analogue of DNA that commonly has an N-aminoethlyl-glycine backbone. The crystal structure of two PNA duplexes, one containing eight standard nucleobase pairs (GGCATCGG)2 (pdb: 3MBS), and the other containing the same nucleobase pairs and a central pair of bipyridine ligands (pdb: 3MBU), has been solved with a resolution of 1.2 Å and 1.05 Å, respectively. The non-modified PNA duplex adopts a P-type helical structure s i m i l a r t o that of previously characterized PNAs. The atomic-level resolution of the structures allowed us to observe for the first time specific modes of interaction between the terminal lysines of the PNA and the backbone and nucleobases situated in the vicinity of the lysines, which are considered an important factor in the induction of a preferred handedness in PNA duplexes. These results support the notion that while PNA typically adopts a P-type helical structure, its flexibility is relatively high. For example, the base pair rise in the bipyridine-containing PNA is the largest measured to date in a PNA homoduplex. The two bipyridines are bulged out of the duplex and are aligned parallel to the minor groove of the PNA. In the case of the bipyridine-containing PNA, two bipyridines from adjacent PNA duplexes form a π-stacked pair that relates the duplexes within the crystal. The bulging out of the bipyridines causes bending of the PNA duplex, which is in contrast to the structure previously reported for biphenyl-modified DNA duplexes in solution, where the biphenyls are π-stacking with adjacent nucleobase pairs and adopt an intrahelical geometry [Johar et al., Chem. Eur. J., 2008, 14, 2080]. This difference shows that relatively small perturbations can significantly impact the relative position of nucleobase analogues in nucleic acid duplexes. PMID:20859960

  20. Image-receptor performance: a comparison of Trophy RVG UI sensor and Kodak Ektaspeed Plus film.

    PubMed

    Ludlow, J; Mol, A

    2001-01-01

    Objective. This study compares the physical characteristics of the RVG UI sensor (RVG) with Ektaspeed Plus film. Dose-response curves were generated for film and for each of 6 available RVG modes. An aluminum step-wedge was used to evaluate exposure latitude. Spatial resolution was assessed by using a line-pair test tool. Latitude and resolution were assessed by observers for both modalities. The RVG was further characterized by its modulation transfer function. Exposure latitude was equal for film and RVG in the periodontal mode. Other gray scale modes demonstrated much lower latitude. The average maximum resolution was 15.3 line-pairs per millimeter (lp/mm) for RVG in high-resolution mode, 10.5 lp/mm for RVG in low-resolution mode, and 20 lp/mm for film (P <.0001). Modulation transfer function measurements supported the subjective assessments. In periodontal mode, the RVG UI sensor demonstrates exposure latitude similar to that of Ektaspeed Plus film. Film images exhibit significantly higher spatial resolution than the RVG images acquired in high-resolution mode.

  1. Myotonic Dystrophy Type 1 RNA Crystal Structures Reveal Heterogeneous 1×1 Nucleotide UU Internal Loop Conformations⊥

    PubMed Central

    Kumar, Amit; Park, HaJeung; Fang, Pengfei; Parkesh, Raman; Guo, Min; Nettles, Kendall W.; Disney, Matthew D.

    2011-01-01

    RNA internal loops often display a variety of conformations in solution. Herein, we visualize conformational heterogeneity in the context of the 5′CUG/3′GUC repeat motif present in the RNA that causes myotonic dystrophy type 1 (DM1). Specifically, two crystal structures are disclosed of a model DM1 triplet repeating construct, 5′r(UUGGGC(CUG)3GUCC)2, refined to 2.20 Å and 1.52 Å resolution. Here, differences in orientation of the 5′ dangling UU end between the two structures induce changes in the backbone groove width, which reveals that non-canonical 1×1 nucleotide UU internal loops can display an ensemble of pairing conformations. In the 2.20 Å structure, CUGa, the 5′UU forms one hydrogen-bonded pairs with a 5′UU of a neighboring helix in the unit cell to form a pseudo-infinite helix. The central 1×1 nucleotide UU internal loop has no hydrogen bonds, while the terminal 1×1 nucleotide UU internal loops each form a one hydrogen-bonded pair. In the 1.52 Å structure, CUGb, the 5′ UU dangling end is tucked into the major groove of the duplex. While the canonical paired bases show no change in base pairing, in CUGb the terminal 1×1 nucleotide UU internal loops form now two hydrogen-bonded pairs. Thus, the shift in major groove induced by the 5′UU dangling end alters non-canonical base patterns. Collectively, these structures indicate that 1×1 nucleotide UU internal loops in DM1 may sample multiple conformations in vivo. This observation has implications for the recognition of this RNA, and other repeating transcripts, by protein and small molecule ligands. PMID:21988728

  2. Myotonic dystrophy type 1 RNA crystal structures reveal heterogeneous 1 × 1 nucleotide UU internal loop conformations.

    PubMed

    Kumar, Amit; Park, HaJeung; Fang, Pengfei; Parkesh, Raman; Guo, Min; Nettles, Kendall W; Disney, Matthew D

    2011-11-15

    RNA internal loops often display a variety of conformations in solution. Herein, we visualize conformational heterogeneity in the context of the 5'CUG/3'GUC repeat motif present in the RNA that causes myotonic dystrophy type 1 (DM1). Specifically, two crystal structures of a model DM1 triplet repeating construct, 5'r[UUGGGC(CUG)(3)GUCC](2), refined to 2.20 and 1.52 Å resolution are disclosed. Here, differences in the orientation of the 5' dangling UU end between the two structures induce changes in the backbone groove width, which reveals that noncanonical 1 × 1 nucleotide UU internal loops can display an ensemble of pairing conformations. In the 2.20 Å structure, CUGa, the 5' UU forms a one hydrogen-bonded pair with a 5' UU of a neighboring helix in the unit cell to form a pseudoinfinite helix. The central 1 × 1 nucleotide UU internal loop has no hydrogen bonds, while the terminal 1 × 1 nucleotide UU internal loops each form a one-hydrogen bond pair. In the 1.52 Å structure, CUGb, the 5' UU dangling end is tucked into the major groove of the duplex. While the canonically paired bases show no change in base pairing, in CUGb the terminal 1 × 1 nucleotide UU internal loops now form two hydrogen-bonded pairs. Thus, the shift in the major groove induced by the 5' UU dangling end alters noncanonical base patterns. Collectively, these structures indicate that 1 × 1 nucleotide UU internal loops in DM1 may sample multiple conformations in vivo. This observation has implications for the recognition of this RNA, and other repeating transcripts, by protein and small molecule ligands.

  3. Myotonic Dystrophy Type 1 RNA Crystal Structures Reveal Heterogeneous 1 × 1 Nucleotide UU Internal Loop Conformations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kumar, Amit; Park, HaJeung; Fang, Pengfei

    2012-03-27

    RNA internal loops often display a variety of conformations in solution. Herein, we visualize conformational heterogeneity in the context of the 5'CUG/3'GUC repeat motif present in the RNA that causes myotonic dystrophy type 1 (DM1). Specifically, two crystal structures of a model DM1 triplet repeating construct, 5'r[{und UU}GGGC(C{und U}G){sub 3}GUCC]{sub 2}, refined to 2.20 and 1.52 {angstrom} resolution are disclosed. Here, differences in the orientation of the 5' dangling UU end between the two structures induce changes in the backbone groove width, which reveals that noncanonical 1 x 1 nucleotide UU internal loops can display an ensemble of pairing conformations.more » In the 2.20 {angstrom} structure, CUGa, the 5' UU forms a one hydrogen-bonded pair with a 5' UU of a neighboring helix in the unit cell to form a pseudoinfinite helix. The central 1 x 1 nucleotide UU internal loop has no hydrogen bonds, while the terminal 1 x 1 nucleotide UU internal loops each form a one-hydrogen bond pair. In the 1.52 {angstrom} structure, CUGb, the 5' UU dangling end is tucked into the major groove of the duplex. While the canonically paired bases show no change in base pairing, in CUGb the terminal 1 x 1 nucleotide UU internal loops now form two hydrogen-bonded pairs. Thus, the shift in the major groove induced by the 5' UU dangling end alters noncanonical base patterns. Collectively, these structures indicate that 1 x 1 nucleotide UU internal loops in DM1 may sample multiple conformations in vivo. This observation has implications for the recognition of this RNA, and other repeating transcripts, by protein and small molecule ligands.« less

  4. Effects of Scan Resolutions and Element Sizes on Bovine Vertebral Mechanical Parameters from Quantitative Computed Tomography-Based Finite Element Analysis

    PubMed Central

    Zhang, Meng; Gao, Jiazi; Huang, Xu; Zhang, Min; Liu, Bei

    2017-01-01

    Quantitative computed tomography-based finite element analysis (QCT/FEA) has been developed to predict vertebral strength. However, QCT/FEA models may be different with scan resolutions and element sizes. The aim of this study was to explore the effects of scan resolutions and element sizes on QCT/FEA outcomes. Nine bovine vertebral bodies were scanned using the clinical CT scanner and reconstructed from datasets with the two-slice thickness, that is, 0.6 mm (PA resolution) and 1 mm (PB resolution). There were significantly linear correlations between the predicted and measured principal strains (R2 > 0.7, P < 0.0001), and the predicted vertebral strength and stiffness were modestly correlated with the experimental values (R2 > 0.6, P < 0.05). Two different resolutions and six different element sizes were combined in pairs, and finite element (FE) models of bovine vertebral cancellous bones in the 12 cases were obtained. It showed that the mechanical parameters of FE models with the PB resolution were similar to those with the PA resolution. The computational accuracy of FE models with the element sizes of 0.41 × 0.41 × 0.6 mm3 and 0.41 × 0.41 × 1 mm3 was higher by comparing the apparent elastic modulus and yield strength. Therefore, scan resolution and element size should be chosen optimally to improve the accuracy of QCT/FEA. PMID:29065624

  5. Conflict Probability Estimation for Free Flight

    NASA Technical Reports Server (NTRS)

    Paielli, Russell A.; Erzberger, Heinz

    1996-01-01

    The safety and efficiency of free flight will benefit from automated conflict prediction and resolution advisories. Conflict prediction is based on trajectory prediction and is less certain the farther in advance the prediction, however. An estimate is therefore needed of the probability that a conflict will occur, given a pair of predicted trajectories and their levels of uncertainty. A method is developed in this paper to estimate that conflict probability. The trajectory prediction errors are modeled as normally distributed, and the two error covariances for an aircraft pair are combined into a single equivalent covariance of the relative position. A coordinate transformation is then used to derive an analytical solution. Numerical examples and Monte Carlo validation are presented.

  6. Stable loop in the crystal structure of the intercalated four-stranded cytosine-rich metazoan telomere

    NASA Technical Reports Server (NTRS)

    Kang, C.; Berger, I.; Lockshin, C.; Ratliff, R.; Moyzis, R.; Rich, A.

    1995-01-01

    In most metazoans, the telomeric cytosine-rich strand repeating sequence is d(TAACCC). The crystal structure of this sequence was solved to 1.9-A resolution. Four strands associate via the cytosine-containing parts to form a four-stranded intercalated structure held together by C.C+ hydrogen bonds. The base-paired strands are parallel to each other, and the two duplexes are intercalated into each other in opposite orientations. One TAA end forms a highly stabilized loop with the 5' thymine Hoogsteen-base-paired to the third adenine. The 5' end of this loop is in close proximity to the 3' end of one of the other intercalated cytosine strands. Instead of being entirely in a DNA duplex, this structure suggests the possibility of an alternative conformation for the cytosine-rich telomere strands.

  7. Hydration sites of unpaired RNA bases: a statistical analysis of the PDB structures.

    PubMed

    Kirillova, Svetlana; Carugo, Oliviero

    2011-10-19

    Hydration is crucial for RNA structure and function. X-ray crystallography is the most commonly used method to determine RNA structures and hydration and, therefore, statistical surveys are based on crystallographic results, the number of which is quickly increasing. A statistical analysis of the water molecule distribution in high-resolution X-ray structures of unpaired RNA nucleotides showed that: different bases have the same penchant to be surrounded by water molecules; clusters of water molecules indicate possible hydration sites, which, in some cases, match those of the major and minor grooves of RNA and DNA double helices; complex hydrogen bond networks characterize the solvation of the nucleotides, resulting in a significant rigidity of the base and its surrounding water molecules. Interestingly, the hydration sites around unpaired RNA bases do not match, in general, the positions that are occupied by the second nucleotide when the base-pair is formed. The hydration sites around unpaired RNA bases were found. They do not replicate the atom positions of complementary bases in the Watson-Crick pairs.

  8. Hydration sites of unpaired RNA bases: a statistical analysis of the PDB structures

    PubMed Central

    2011-01-01

    Background Hydration is crucial for RNA structure and function. X-ray crystallography is the most commonly used method to determine RNA structures and hydration and, therefore, statistical surveys are based on crystallographic results, the number of which is quickly increasing. Results A statistical analysis of the water molecule distribution in high-resolution X-ray structures of unpaired RNA nucleotides showed that: different bases have the same penchant to be surrounded by water molecules; clusters of water molecules indicate possible hydration sites, which, in some cases, match those of the major and minor grooves of RNA and DNA double helices; complex hydrogen bond networks characterize the solvation of the nucleotides, resulting in a significant rigidity of the base and its surrounding water molecules. Interestingly, the hydration sites around unpaired RNA bases do not match, in general, the positions that are occupied by the second nucleotide when the base-pair is formed. Conclusions The hydration sites around unpaired RNA bases were found. They do not replicate the atom positions of complementary bases in the Watson-Crick pairs. PMID:22011380

  9. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kondo, Takeshi; Palczewski, Ari; Hamaya, Yoichiro

    We use angle-resolved photoemission spectroscopy and a new quantitative approach based on the partial density of states to study properties of seemingly disconnected portions of the Fermi surface (FS) that are present in the pseudogap state of cuprates called Fermi arcs. We find that the normal state FS collapses very abruptly into Fermi arcs at the pseudogap temperature (T*). Surprisingly, the length of the Fermi arcs remains constant over an extended temperature range between (T*) and T pair, consistent with the presence of an ordered state below T*. These arcs collapse again at the temperature below which pair formation occursmore » (T pair) either to a point or a very short arc, whose length is limited by our experimental resolution. The tips of the arcs span between points defining a set of wave vectors in momentum space, which are the fingerprints of the ordered state that causes the pseudogap.« less

  10. Ultrahigh-resolution mapping of peatland microform using ground-based structure from motion with multiview stereo

    NASA Astrophysics Data System (ADS)

    Mercer, Jason J.; Westbrook, Cherie J.

    2016-11-01

    Microform is important in understanding wetland functions and processes. But collecting imagery of and mapping the physical structure of peatlands is often expensive and requires specialized equipment. We assessed the utility of coupling computer vision-based structure from motion with multiview stereo photogrammetry (SfM-MVS) and ground-based photos to map peatland topography. The SfM-MVS technique was tested on an alpine peatland in Banff National Park, Canada, and guidance was provided on minimizing errors. We found that coupling SfM-MVS with ground-based photos taken with a point and shoot camera is a viable and competitive technique for generating ultrahigh-resolution elevations (i.e., <0.01 m, mean absolute error of 0.083 m). In evaluating 100+ viable SfM-MVS data collection and processing scenarios, vegetation was found to considerably influence accuracy. Vegetation class, when accounted for, reduced absolute error by as much as 50%. The logistic flexibility of ground-based SfM-MVS paired with its high resolution, low error, and low cost makes it a research area worth developing as well as a useful addition to the wetland scientists' toolkit.

  11. Dipping-interface mapping using mode-separated Rayleigh waves

    USGS Publications Warehouse

    Luo, Y.; Xia, J.; Xu, Y.; Zeng, C.; Miller, R.D.; Liu, Q.

    2009-01-01

    Multichannel analysis of surface waves (MASW) method is a non-invasive geophysical technique that uses the dispersive characteristic of Rayleigh waves to estimate a vertical shear (S)-wave velocity profile. A pseudo-2D S-wave velocity section is constructed by aligning 1D S-wave velocity profiles at the midpoint of each receiver spread that are contoured using a spatial interpolation scheme. The horizontal resolution of the section is therefore most influenced by the receiver spread length and the source interval. Based on the assumption that a dipping-layer model can be regarded as stepped flat layers, high-resolution linear Radon transform (LRT) has been proposed to image Rayleigh-wave dispersive energy and separate modes of Rayleigh waves from a multichannel record. With the mode-separation technique, therefore, a dispersion curve that possesses satisfactory accuracy can be calculated using a pair of consecutive traces within a mode-separated shot gather. In this study, using synthetic models containing a dipping layer with a slope of 5, 10, 15, 20, or 30 degrees and a real-world example, we assess the ability of using high-resolution LRT to image and separate fundamental-mode Rayleigh waves from raw surface-wave data and accuracy of dispersion curves generated by a pair of consecutive traces within a mode-separated shot gather. Results of synthetic and real-world examples demonstrate that a dipping interface with a slope smaller than 15 degrees can be successfully mapped by separated fundamental waves using high-resolution LRT. ?? Birkh??user Verlag, Basel 2009.

  12. Sequence Effect on the Formation of DNA Minidumbbells.

    PubMed

    Liu, Yuan; Lam, Sik Lok

    2017-11-16

    The DNA minidumbbell (MDB) is a recently identified non-B structure. The reported MDBs contain two TTTA, CCTG, or CTTG type II loops. At present, the knowledge and understanding of the sequence criteria for MDB formation are still limited. In this study, we performed a systematic high-resolution nuclear magnetic resonance (NMR) and native gel study to investigate the effect of sequence variations in tandem repeats on the formation of MDBs. Our NMR results reveal the importance of hydrogen bonds, base-base stacking, and hydrophobic interactions from each of the participating residues. We conclude that in the MDBs formed by tandem repeats, C-G loop-closing base pairs are more stabilizing than T-A loop-closing base pairs, and thymine residues in both the second and third loop positions are more stabilizing than cytosine residues. The results from this study enrich our knowledge on the sequence criteria for the formation of MDBs, paving a path for better exploring their potential roles in biological systems and DNA nanotechnology.

  13. Base pairing and structural insights into the 5-formylcytosine in RNA duplex

    PubMed Central

    Wang, Rui; Luo, Zhipu; He, Kaizhang; Delaney, Michael O.; Chen, Doris; Sheng, Jia

    2016-01-01

    Abstract 5-Formylcytidine (f5C), a previously discovered natural nucleotide in the mitochondrial tRNA of many species including human, has been recently detected as the oxidative product of 5-methylcytidine (m5C) through 5-hydroxymethylcytidine (hm5C) in total RNA of mammalian cells. The discovery indicated that these cytosine derivatives in RNA might also play important epigenetic roles similar as in DNA, which has been intensively investigated in the past few years. In this paper, we studied the base pairing specificity of f5C in different RNA duplex contexts. We found that the 5-formyl group could increase duplex thermal stability and enhance base pairing specificity. We present three high-resolution crystal structures of an octamer RNA duplex [5′-GUA(f5C)GUAC-3′]2 that have been solved under three crystallization conditions with different buffers and pH values. Our results showed that the 5-formyl group is located in the same plane as the cytosine base and forms an intra-residue hydrogen bond with the amino group in the N4 position. In addition, this modification increases the base stacking between the f5C and the neighboring bases while not causing significant global and local structure perturbations. This work provides insights into the effects of 5-formylcytosine on RNA duplex. PMID:27079978

  14. SU-F-J-205: Effect of Cone Beam Factor On Cone Beam CT Number Accuracy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yao, W; Hua, C; Farr, J

    Purpose: To examine the suitability of a Catphan™ 700 phantom for image quality QA of a cone beam computed tomography (CBCT) system deployed for proton therapy. Methods: Catphan phantoms, particularly Catphan™ 504, are commonly used in image quality QA for CBCT. As a newer product, Catphan™ 700 offers more tissue equivalent inserts which may be useful for generating the electron density – CT number curve for CBCT based treatment planning. The sensitometry-and-geometry module used in Catphan™ 700 is located at the end of the phantom and after the resolution line pair module. In Catphan™ 504 the line pair module ismore » located at the end of the phantom and after the sensitometry-and-geometry module. To investigate the effect of difference in location on CT number accuracy due to the cone beam factor, we scanned the Catphan™ 700 with the central plane of CBCT at the center of the phantom, line pair and sensitometry-andgeometry modules of the phantom, respectively. The protocol head and thorax scan modes were used. For each position, scans were repeated 4 times. Results: For the head scan mode, the standard deviation (SD) of the CT numbers of each insert under 4 repeated scans was up to 20 HU, 11 HU, and 11 HU, respectively, for the central plane of CBCT located at the center of the phantom, line pair, and sensitometry-and-geometry modules of the phantom. The mean of the SD was 9.9 HU, 5.7 HU, and 5.9 HU, respectively. For the thorax mode, the mean of the SD was 4.5 HU, 4.4 HU, and 4.4 HU, respectively. The assessment of image quality based on resolution and spatial linearity was not affected by imaging location changes. Conclusion: When the Catphan™ 700 was aligned to the center of imaging region, the CT number accuracy test may not meet expectations. We recommend reconfiguration of the modules.« less

  15. Mapping the zebrafish brain methylome using reduced representation bisulfite sequencing

    PubMed Central

    Chatterjee, Aniruddha; Ozaki, Yuichi; Stockwell, Peter A; Horsfield, Julia A; Morison, Ian M; Nakagawa, Shinichi

    2013-01-01

    Reduced representation bisulfite sequencing (RRBS) has been used to profile DNA methylation patterns in mammalian genomes such as human, mouse and rat. The methylome of the zebrafish, an important animal model, has not yet been characterized at base-pair resolution using RRBS. Therefore, we evaluated the technique of RRBS in this model organism by generating four single-nucleotide resolution DNA methylomes of adult zebrafish brain. We performed several simulations to show the distribution of fragments and enrichment of CpGs in different in silico reduced representation genomes of zebrafish. Four RRBS brain libraries generated 98 million sequenced reads and had higher frequencies of multiple mapping than equivalent human RRBS libraries. The zebrafish methylome indicates there is higher global DNA methylation in the zebrafish genome compared with its equivalent human methylome. This observation was confirmed by RRBS of zebrafish liver. High coverage CpG dinucleotides are enriched in CpG island shores more than in the CpG island core. We found that 45% of the mapped CpGs reside in gene bodies, and 7% in gene promoters. This analysis provides a roadmap for generating reproducible base-pair level methylomes for zebrafish using RRBS and our results provide the first evidence that RRBS is a suitable technique for global methylation analysis in zebrafish. PMID:23975027

  16. ChIP-seq and ChIP-exo profiling of Pol II, H2A.Z, and H3K4me3 in human K562 cells.

    PubMed

    Mchaourab, Zenab F; Perreault, Andrea A; Venters, Bryan J

    2018-03-06

    The human K562 chronic myeloid leukemia cell line has long served as an experimental paradigm for functional genomic studies. To systematically and functionally annotate the human genome, the ENCODE consortium generated hundreds of functional genomic data sets, such as chromatin immunoprecipitation coupled to sequencing (ChIP-seq). While ChIP-seq analyses have provided tremendous insights into gene regulation, spatiotemporal insights were limited by a resolution of several hundred base pairs. ChIP-exonuclease (ChIP-exo) is a refined version of ChIP-seq that overcomes this limitation by providing higher precision mapping of protein-DNA interactions. To study the interplay of transcription initiation and chromatin, we profiled the genome-wide locations for RNA polymerase II (Pol II), the histone variant H2A.Z, and the histone modification H3K4me3 using ChIP-seq and ChIP-exo. In this Data Descriptor, we present detailed information on parallel experimental design, data generation, quality control analysis, and data validation. We discuss how these data lay the foundation for future analysis to understand the relationship between the occupancy of Pol II and nucleosome positions at near base pair resolution.

  17. Improving the accuracy of walking piezo motors.

    PubMed

    den Heijer, M; Fokkema, V; Saedi, A; Schakel, P; Rost, M J

    2014-05-01

    Many application areas require ultraprecise, stiff, and compact actuator systems with a high positioning resolution in combination with a large range as well as a high holding and pushing force. One promising solution to meet these conflicting requirements is a walking piezo motor that works with two pairs of piezo elements such that the movement is taken over by one pair, once the other pair reaches its maximum travel distance. A resolution in the pm-range can be achieved, if operating the motor within the travel range of one piezo pair. However, applying the typical walking drive signals, we measure jumps in the displacement up to 2.4 μm, when the movement is given over from one piezo pair to the other. We analyze the reason for these large jumps and propose improved drive signals. The implementation of our new drive signals reduces the jumps to less than 42 nm and makes the motor ideally suitable to operate as a coarse approach motor in an ultra-high vacuum scanning tunneling microscope. The rigidity of the motor is reflected in its high pushing force of 6.4 N.

  18. Multi-Sensor Fusion of Infrared and Electro-Optic Signals for High Resolution Night Images

    PubMed Central

    Huang, Xiaopeng; Netravali, Ravi; Man, Hong; Lawrence, Victor

    2012-01-01

    Electro-optic (EO) image sensors exhibit the properties of high resolution and low noise level at daytime, but they do not work in dark environments. Infrared (IR) image sensors exhibit poor resolution and cannot separate objects with similar temperature. Therefore, we propose a novel framework of IR image enhancement based on the information (e.g., edge) from EO images, which improves the resolution of IR images and helps us distinguish objects at night. Our framework superimposing/blending the edges of the EO image onto the corresponding transformed IR image improves their resolution. In this framework, we adopt the theoretical point spread function (PSF) proposed by Hardie et al. for the IR image, which has the modulation transfer function (MTF) of a uniform detector array and the incoherent optical transfer function (OTF) of diffraction-limited optics. In addition, we design an inverse filter for the proposed PSF and use it for the IR image transformation. The framework requires four main steps: (1) inverse filter-based IR image transformation; (2) EO image edge detection; (3) registration; and (4) blending/superimposing of the obtained image pair. Simulation results show both blended and superimposed IR images, and demonstrate that blended IR images have better quality over the superimposed images. Additionally, based on the same steps, simulation result shows a blended IR image of better quality when only the original IR image is available. PMID:23112602

  19. Multi-sensor fusion of infrared and electro-optic signals for high resolution night images.

    PubMed

    Huang, Xiaopeng; Netravali, Ravi; Man, Hong; Lawrence, Victor

    2012-01-01

    Electro-optic (EO) image sensors exhibit the properties of high resolution and low noise level at daytime, but they do not work in dark environments. Infrared (IR) image sensors exhibit poor resolution and cannot separate objects with similar temperature. Therefore, we propose a novel framework of IR image enhancement based on the information (e.g., edge) from EO images, which improves the resolution of IR images and helps us distinguish objects at night. Our framework superimposing/blending the edges of the EO image onto the corresponding transformed IR image improves their resolution. In this framework, we adopt the theoretical point spread function (PSF) proposed by Hardie et al. for the IR image, which has the modulation transfer function (MTF) of a uniform detector array and the incoherent optical transfer function (OTF) of diffraction-limited optics. In addition, we design an inverse filter for the proposed PSF and use it for the IR image transformation. The framework requires four main steps: (1) inverse filter-based IR image transformation; (2) EO image edge detection; (3) registration; and (4) blending/superimposing of the obtained image pair. Simulation results show both blended and superimposed IR images, and demonstrate that blended IR images have better quality over the superimposed images. Additionally, based on the same steps, simulation result shows a blended IR image of better quality when only the original IR image is available.

  20. Identification of a t(3;4)(p1.3;q1.5) translocation breakpoint in pigs using somatic cell hybrid mapping and high-resolution mate-pair sequencing

    PubMed Central

    Fève, Katia; Foissac, Sylvain; Pinton, Alain; Mompart, Florence; Esquerré, Diane; Faraut, Thomas; Yerle, Martine

    2017-01-01

    Reciprocal translocations are the most frequently occurring constitutional structural rearrangements in mammalian genomes. In phenotypically normal pigs, an incidence of 1/200 is estimated for such rearrangements. Even if constitutional translocations do not necessarily induce defects and diseases, they are responsible for significant economic losses in domestic animals due to reproduction failures. Over the last 30 years, advances in molecular and cytogenetic technologies have led to major improvements in the resolution of the characterization of translocation events. Characterization of translocation breakpoints helps to decipher the mechanisms that lead to such rearrangements and the functions of the genes that are involved in the translocation. Here, we describe the fine characterization of a reciprocal translocation t(3;4) (p1.3;q1.5) detected in a pig line. The breakpoint was identified at the base-pair level using a positional cloning and chromosome walking strategy in somatic cell hybrids that were generated from an animal that carries this translocation. We show that this translocation occurs within the ADAMTSL4 gene and results in a loss of expression in homozygous carriers. In addition, by taking this translocation as a model, we used a whole-genome next-generation mate-pair sequencing approach on pooled individuals to evaluate this strategy for high-throughput screening of structural rearrangements. PMID:29121641

  1. Breakpoint Features of Genomic Rearrangements in Neuroblastoma with Unbalanced Translocations and Chromothripsis

    PubMed Central

    Daveau, Romain; Combaret, Valérie; Pierre-Eugène, Cécile; Cazes, Alex; Louis-Brennetot, Caroline; Schleiermacher, Gudrun; Ferrand, Sandrine; Pierron, Gaëlle; Lermine, Alban; Frio, Thomas Rio; Raynal, Virginie; Vassal, Gilles; Barillot, Emmanuel; Delattre, Olivier; Janoueix-Lerosey, Isabelle

    2013-01-01

    Neuroblastoma is a pediatric cancer of the peripheral nervous system in which structural chromosome aberrations are emblematic of aggressive tumors. In this study, we performed an in-depth analysis of somatic rearrangements in two neuroblastoma cell lines and two primary tumors using paired-end sequencing of mate-pair libraries and RNA-seq. The cell lines presented with typical genetic alterations of neuroblastoma and the two tumors belong to the group of neuroblastoma exhibiting a profile of chromothripsis. Inter and intra-chromosomal rearrangements were identified in the four samples, allowing in particular characterization of unbalanced translocations at high resolution. Using complementary experiments, we further characterized 51 rearrangements at the base pair resolution that revealed 59 DNA junctions. In a subset of cases, complex rearrangements were observed with templated insertion of fragments of nearby sequences. Although we did not identify known particular motifs in the local environment of the breakpoints, we documented frequent microhomologies at the junctions in both chromothripsis and non-chromothripsis associated breakpoints. RNA-seq experiments confirmed expression of several predicted chimeric genes and genes with disrupted exon structure including ALK, NBAS, FHIT, PTPRD and ODZ4. Our study therefore indicates that both non-homologous end joining-mediated repair and replicative processes may account for genomic rearrangements in neuroblastoma. RNA-seq analysis allows the identification of the subset of abnormal transcripts expressed from genomic rearrangements that may be involved in neuroblastoma oncogenesis. PMID:23991058

  2. Super resolution reconstruction of μ-CT image of rock sample using neighbour embedding algorithm

    NASA Astrophysics Data System (ADS)

    Wang, Yuzhu; Rahman, Sheik S.; Arns, Christoph H.

    2018-03-01

    X-ray computed tomography (μ-CT) is considered to be the most effective way to obtain the inner structure of rock sample without destructions. However, its limited resolution hampers its ability to probe sub-micro structures which is critical for flow transportation of rock sample. In this study, we propose an innovative methodology to improve the resolution of μ-CT image using neighbour embedding algorithm where low frequency information is provided by μ-CT image itself while high frequency information is supplemented by high resolution scanning electron microscopy (SEM) image. In order to obtain prior for reconstruction, a large number of image patch pairs contain high- and low- image patches are extracted from the Gaussian image pyramid generated by SEM image. These image patch pairs contain abundant information about tomographic evolution of local porous structures under different resolution spaces. Relying on the assumption of self-similarity of porous structure, this prior information can be used to supervise the reconstruction of high resolution μ-CT image effectively. The experimental results show that the proposed method is able to achieve the state-of-the-art performance.

  3. Integrated microfluidic card with TaqMan probes and high-resolution melt analysis to detect tuberculosis drug resistance mutations across 10 genes.

    PubMed

    Pholwat, Suporn; Liu, Jie; Stroup, Suzanne; Gratz, Jean; Banu, Sayera; Rahman, S M Mazidur; Ferdous, Sara Sabrina; Foongladda, Suporn; Boonlert, Duangjai; Ogarkov, Oleg; Zhdanova, Svetlana; Kibiki, Gibson; Heysell, Scott; Houpt, Eric

    2015-02-24

    Genotypic methods for drug susceptibility testing of Mycobacterium tuberculosis are desirable to speed the diagnosis and proper therapy of tuberculosis (TB). However, the numbers of genes and polymorphisms implicated in resistance have proliferated, challenging diagnostic design. We developed a microfluidic TaqMan array card (TAC) that utilizes both sequence-specific probes and high-resolution melt analysis (HRM), providing two layers of detection of mutations. Twenty-seven primer pairs and 40 probes were designed to interrogate 3,200 base pairs of critical regions of the inhA, katG, rpoB, embB, rpsL, rrs, eis, gyrA, gyrB, and pncA genes. The method was evaluated on 230 clinical M. tuberculosis isolates from around the world, and it yielded 96.1% accuracy (2,431/2,530) in comparison to that of Sanger sequencing and 87% accuracy in comparison to that of the slow culture-based susceptibility testing. This TAC-HRM method integrates assays for 10 genes to yield fast, comprehensive, and accurate drug susceptibility results for the 9 major antibiotics used to treat TB and could be deployed to improve treatment outcomes. Multidrug-resistant tuberculosis threatens global tuberculosis control efforts. Optimal therapy utilizes susceptibility test results to guide individualized treatment regimens; however, the susceptibility testing methods in use are technically difficult and slow. We developed an integrated TaqMan array card method with high-resolution melt analysis that interrogates 10 genes to yield a fast, comprehensive, and accurate drug susceptibility result for the 9 major antituberculosis antibiotics. Copyright © 2015 Pholwat et al.

  4. Module for multiphoton high-resolution hyperspectral imaging and spectroscopy

    NASA Astrophysics Data System (ADS)

    Zeytunyan, Aram; Baldacchini, Tommaso; Zadoyan, Ruben

    2018-02-01

    We developed a module for dual-output, dual-wavelength lasers that facilitates multiphoton imaging and spectroscopy experiments and enables hyperspectral imaging with spectral resolution up to 5 cm-1. High spectral resolution is achieved by employing spectral focusing. Specifically, two sets of grating pairs are used to control the chirps in each laser beam. In contrast with the approach that uses fixed-length glass rods, grating pairs allow matching the spectral resolution and the linewidths of the Raman lines of interest. To demonstrate the performance of the module, we report the results of spectral focusing CARS and SRS microscopy experiments for various test samples and Raman shifts. The developed module can be used for a variety of multimodal imaging and spectroscopy applications, such as single- and multi-color two-photon fluorescence, second harmonic generation, third harmonic generation, pump-probe, transient absorption, and others.

  5. Cationic permethylated 6-monoamino-6-monodeoxy-β-cyclodextrin as chiral selector of dansylated amino acids in capillary electrophoresis.

    PubMed

    Németh, Krisztina; Domonkos, Celesztina; Sarnyai, Virág; Szemán, Julianna; Jicsinszky, László; Szente, Lajos; Visy, Júlia

    2014-10-01

    The resolution power of permethylated 6-monoamino-6-monodeoxy-βCD (PMMABCD) - a single isomer, cationic CD derivative - developed previously for chiral analyses in capillary electrophoresis was further studied here. Dansylated amino acids (Dns-AA) were chosen as amphoteric chiral model compounds. Changes in the resolutions of Dns-AAs by varying pH and selector concentrations were investigated and correlated with their structures and chemical properties (isoelectric point and lipophilicity). Maximal resolutions could be achieved at pH 6 or pH 4. The separations improved with increasing concentration of the selector. Baseline or substantially better resolution for 8 pairs of these Dns-AAs could be achieved. Low CD concentration was enough for the separation of the most apolar Dns-AAs. Chiral discrimination ability of PMMABCD was demonstrated by the separation of an artificial mixture of 8 Dns-AA pairs. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Deriving high-resolution protein backbone structure propensities from all crystal data using the information maximization device.

    PubMed

    Solis, Armando D

    2014-01-01

    The most informative probability distribution functions (PDFs) describing the Ramachandran phi-psi dihedral angle pair, a fundamental descriptor of backbone conformation of protein molecules, are derived from high-resolution X-ray crystal structures using an information-theoretic approach. The Information Maximization Device (IMD) is established, based on fundamental information-theoretic concepts, and then applied specifically to derive highly resolved phi-psi maps for all 20 single amino acid and all 8000 triplet sequences at an optimal resolution determined by the volume of current data. The paper shows that utilizing the latent information contained in all viable high-resolution crystal structures found in the Protein Data Bank (PDB), totaling more than 77,000 chains, permits the derivation of a large number of optimized sequence-dependent PDFs. This work demonstrates the effectiveness of the IMD and the superiority of the resulting PDFs by extensive fold recognition experiments and rigorous comparisons with previously published triplet PDFs. Because it automatically optimizes PDFs, IMD results in improved performance of knowledge-based potentials, which rely on such PDFs. Furthermore, it provides an easy computational recipe for empirically deriving other kinds of sequence-dependent structural PDFs with greater detail and precision. The high-resolution phi-psi maps derived in this work are available for download.

  7. A Parallel Spectroscopic Method for Examining Dynamic Phenomena on the Millisecond Time Scale

    PubMed Central

    Snively, Christopher M.; Chase, D. Bruce; Rabolt, John F.

    2009-01-01

    An infrared spectroscopic technique based on planar array infrared (PAIR) spectroscopy has been developed that allows the acquisition of spectra from multiple samples simultaneously. Using this technique, it is possible to acquire spectra over a spectral range of 950–1900cm−1 with a temporal resolution of 2.2ms. The performance of this system was demonstrated by determining the shear-induced orientational response of several low molecular weight liquid crystals. Five different liquid crystals were examined in combination with five different alignment layers, and both primary and secondary screens were demonstrated. Implementation of this high throughput PAIR technique resulted in a reduction in acquisition time as compared to both step-scan and ultra-rapid-scanning FTIR spectroscopy. PMID:19239197

  8. Two-colour live-cell nanoscale imaging of intracellular targets

    NASA Astrophysics Data System (ADS)

    Bottanelli, Francesca; Kromann, Emil B.; Allgeyer, Edward S.; Erdmann, Roman S.; Wood Baguley, Stephanie; Sirinakis, George; Schepartz, Alanna; Baddeley, David; Toomre, Derek K.; Rothman, James E.; Bewersdorf, Joerg

    2016-03-01

    Stimulated emission depletion (STED) nanoscopy allows observations of subcellular dynamics at the nanoscale. Applications have, however, been severely limited by the lack of a versatile STED-compatible two-colour labelling strategy for intracellular targets in living cells. Here we demonstrate a universal labelling method based on the organic, membrane-permeable dyes SiR and ATTO590 as Halo and SNAP substrates. SiR and ATTO590 constitute the first suitable dye pair for two-colour STED imaging in living cells below 50 nm resolution. We show applications with mitochondria, endoplasmic reticulum, plasma membrane and Golgi-localized proteins, and demonstrate continuous acquisition for up to 3 min at 2-s time resolution.

  9. In Situ Detection of MicroRNA Expression with RNAscope Probes.

    PubMed

    Yin, Viravuth P

    2018-01-01

    Elucidating the spatial resolution of gene transcripts provides important insight into potential gene function. MicroRNAs are short, singled-stranded noncoding RNAs that control gene expression through base-pair complementarity with target mRNAs in the 3' untranslated region (UTR) and inhibiting protein expression. However, given their small size of ~22- to 24-nt and low expression levels, standard in situ hybridization detection methods are not amendable for microRNA spatial resolution. Here, I describe a technique that employs RNAscope probe design and propriety amplification technology that provides simultaneous single molecule detection of individual microRNA and its target gene. This method allows for rapid and sensitive detection of noncoding RNA transcripts in frozen tissue sections.

  10. Colposcopic imaging using visible-light optical coherence tomography.

    PubMed

    Duan, Lian; McRaven, Michael D; Liu, Wenzhong; Shu, Xiao; Hu, Jianmin; Sun, Cheng; Veazey, Ronald S; Hope, Thomas J; Zhang, Hao F

    2017-05-01

    High-resolution colposcopic optical coherence tomography (OCT) provides key anatomical measures, such as thickness and minor traumatic injury of vaginal epithelium, of the female reproductive tract noninvasively. This information can be helpful in both fundamental investigations in animal models and disease screenings in humans. We present a fiber-based visible-light OCT and two probe designs for colposcopic application. One probe conducts circular scanning using a DC motor, and the other probe is capable of three-dimensional imaging over a 4.6 × 4.6 - mm 2 area using a pair of galvo scanners. Using this colposcopic vis-OCT with both probes, we acquired high-resolution images from whole isolated macaque vaginal samples and identified biopsy lesions.

  11. Colposcopic imaging using visible-light optical coherence tomography

    NASA Astrophysics Data System (ADS)

    Duan, Lian; McRaven, Michael D.; Liu, Wenzhong; Shu, Xiao; Hu, Jianmin; Sun, Cheng; Veazey, Ronald S.; Hope, Thomas J.; Zhang, Hao F.

    2017-05-01

    High-resolution colposcopic optical coherence tomography (OCT) provides key anatomical measures, such as thickness and minor traumatic injury of vaginal epithelium, of the female reproductive tract noninvasively. This information can be helpful in both fundamental investigations in animal models and disease screenings in humans. We present a fiber-based visible-light OCT and two probe designs for colposcopic application. One probe conducts circular scanning using a DC motor, and the other probe is capable of three-dimensional imaging over a 4.6×4.6-mm2 area using a pair of galvo scanners. Using this colposcopic vis-OCT with both probes, we acquired high-resolution images from whole isolated macaque vaginal samples and identified biopsy lesions.

  12. A novel single-ended readout depth-of-interaction PET detector fabricated using sub-surface laser engraving.

    PubMed

    Uchida, H; Sakai, T; Yamauchi, H; Hakamata, K; Shimizu, K; Yamashita, T

    2016-09-21

    We propose a novel scintillation detector design for positron emission tomography (PET), which has depth of interaction (DOI) capability and uses a single-ended readout scheme. The DOI detector contains a pair of crystal bars segmented using sub-surface laser engraving (SSLE). The two crystal bars are optically coupled to each other at their top segments and are coupled to two photo-sensors at their bottom segments. Initially, we evaluated the performance of different designs of single crystal bars coupled to photomultiplier tubes at both ends. We found that segmentation by SSLE results in superior performance compared to the conventional method. As the next step, we constructed a crystal unit composed of a 3  ×  3  ×  20 mm 3 crystal bar pair, with each bar containing four layers segmented using the SSLE. We measured the DOI performance by changing the optical conditions for the crystal unit. Based on the experimental results, we then assessed the detector performance in terms of the DOI capability by evaluating the position error, energy resolution, and light collection efficiency for various crystal unit designs with different bar sizes and a different number of layers (four to seven layers). DOI encoding with small position error was achieved for crystal units composed of a 3  ×  3  ×  20 mm 3 LYSO bar pair having up to seven layers, and with those composed of a 2  ×  2  ×  20 mm 3 LYSO bar pair having up to six layers. The energy resolution of the segment in the seven-layer 3  ×  3  ×  20 mm 3 crystal bar pair was 9.3%-15.5% for 662 keV gamma-rays, where the segments closer to the photo-sensors provided better energy resolution. SSLE provides high geometrical accuracy at low production cost due to the simplicity of the crystal assembly. Therefore, the proposed DOI detector is expected to be an attractive choice for practical small-bore PET systems dedicated to imaging of the brain, breast, and small animals.

  13. Generation of a pseudo-2D shear-wave velocity section by inversion of a series of 1D dispersion curves

    USGS Publications Warehouse

    Luo, Y.; Xia, J.; Liu, J.; Xu, Y.; Liu, Q.

    2008-01-01

    Multichannel Analysis of Surface Waves utilizes a multichannel recording system to estimate near-surface shear (S)-wave velocities from high-frequency Rayleigh waves. A pseudo-2D S-wave velocity (vS) section is constructed by aligning 1D models at the midpoint of each receiver spread and using a spatial interpolation scheme. The horizontal resolution of the section is therefore most influenced by the receiver spread length and the source interval. The receiver spread length sets the theoretical lower limit and any vS structure with its lateral dimension smaller than this length will not be properly resolved in the final vS section. A source interval smaller than the spread length will not improve the horizontal resolution because spatial smearing has already been introduced by the receiver spread. In this paper, we first analyze the horizontal resolution of a pair of synthetic traces. Resolution analysis shows that (1) a pair of traces with a smaller receiver spacing achieves higher horizontal resolution of inverted S-wave velocities but results in a larger relative error; (2) the relative error of the phase velocity at a high frequency is smaller than at a low frequency; and (3) a relative error of the inverted S-wave velocity is affected by the signal-to-noise ratio of data. These results provide us with a guideline to balance the trade-off between receiver spacing (horizontal resolution) and accuracy of the inverted S-wave velocity. We then present a scheme to generate a pseudo-2D S-wave velocity section with high horizontal resolution using multichannel records by inverting high-frequency surface-wave dispersion curves calculated through cross-correlation combined with a phase-shift scanning method. This method chooses only a pair of consecutive traces within a shot gather to calculate a dispersion curve. We finally invert surface-wave dispersion curves of synthetic and real-world data. Inversion results of both synthetic and real-world data demonstrate that inverting high-frequency surface-wave dispersion curves - by a pair of traces through cross-correlation with phase-shift scanning method and with the damped least-square method and the singular-value decomposition technique - can feasibly achieve a reliable pseudo-2D S-wave velocity section with relatively high horizontal resolution. ?? 2008 Elsevier B.V. All rights reserved.

  14. Hybridization and sequencing of nucleic acids using base pair mismatches

    DOEpatents

    Fodor, Stephen P. A.; Lipshutz, Robert J.; Huang, Xiaohua

    2001-01-01

    Devices and techniques for hybridization of nucleic acids and for determining the sequence of nucleic acids. Arrays of nucleic acids are formed by techniques, preferably high resolution, light-directed techniques. Positions of hybridization of a target nucleic acid are determined by, e.g., epifluorescence microscopy. Devices and techniques are proposed to determine the sequence of a target nucleic acid more efficiently and more quickly through such synthesis and detection techniques.

  15. High resolution MR based polymer dosimetry versus film densitometry: a systematic study based on the modulation transfer function approach.

    PubMed

    Berg, A; Pernkopf, M; Waldhäusl, C; Schmidt, W; Moser, E

    2004-09-07

    Precise methods of modem radiation therapy such as intensity modulated radiotherapy (IMRT), brachytherapy (BT) and high LET irradiation allow for high dose localization in volumes of a few mm3. However, most dosimetry methods-ionization chambers, TLD arrangements or silicon detectors, for example-are not capable of detecting sub-mm dose variations or do not allow for simple dose imaging. Magnetic resonance based polymer dosimetry (MRPD) appears to be well suited to three-dimensional high resolution relative dosimetry but the spatial resolution based on a systematic modulation transfer function (MTF) approach has not yet been investigated. We offer a theoretical construct for addressing the spatial resolution in different dose imaging systems, i.e. the dose modulation transfer function (DMTF) approach, an experimental realization of this concept with a phantom and quantitative comparisons between two dosimetric systems: polymer gel and film dosimetry. Polymer gel samples were irradiated by Co-60 photons through an absorber grid which is characterized by periodic structures of different spatial period (a), the smallest one at width of a/2 = 280 microm. The modulation in dose under the grid is visualized via calibrated, high resolution, parameter-selective (T2) and dose images based on multi-echo MR imaging. The DMTF is obtained from the modulation depth of the spin-spin relaxation time (T2) after calibration. Voxel sizes below 0.04 mm3 could be achieved, which are significantly smaller than those reported in MR based dose imaging on polymer gels elsewhere, using a powerful gradient system and a highly sensitive small birdcage resonator on a whole-body 3T MR scanner. Dose modulations at 22% of maximum dose amplitude could be observed at about 2 line pairs per mm. The polymer DMTF results are compared to those of a typical clinical film-scanner system. This study demonstrates that MR based gel dosimetry at 200 microm pixel resolution might even be superior, with reference to relative spatial resolution, to the results of a standard film-scanner system offering a nominal scan resolution of 200 microm.

  16. Crystallization and preliminary X-ray diffraction analysis of the Bacillus subtilis replication termination protein in complex with the 37-base-pair TerI-binding site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vivian, J. P.; Porter, C.; Wilce, J. A.

    2006-11-01

    A preparation of replication terminator protein (RTP) of B. subtilis and a 37-base-pair TerI sequence (comprising two binding sites for RTP) has been purified and crystallized. The replication terminator protein (RTP) of Bacillus subtilis binds to specific DNA sequences that halt the progression of the replisome in a polar manner. These terminator complexes flank a defined region of the chromosome into which they allow replication forks to enter but not exit. Forcing the fusion of replication forks in a specific zone is thought to allow the coordination of post-replicative processes. The functional terminator complex comprises two homodimers each of 29more » kDa bound to overlapping binding sites. A preparation of RTP and a 37-base-pair TerI sequence (comprising two binding sites for RTP) has been purified and crystallized. A data set to 3.9 Å resolution with 97.0% completeness and an R{sub sym} of 12% was collected from a single flash-cooled crystal using synchrotron radiation. The diffraction data are consistent with space group P622, with unit-cell parameters a = b = 118.8, c = 142.6 Å.« less

  17. Investigation of digital timing resolution and further improvement by using constant fraction signal time marker slope for fast scintillator detectors

    NASA Astrophysics Data System (ADS)

    Singh, Kundan; Siwal, Davinder

    2018-04-01

    A digital timing algorithm is explored for fast scintillator detectors, viz. LaBr3, BaF2, and BC501A. Signals were collected with CAEN 250 mega samples per second (MSPS) and 500 MSPS digitizers. The zero crossing time markers (TM) were obtained with a standard digital constant fraction timing (DCF) method. Accurate timing information is obtained using cubic spline interpolation of a DCF transient region sample points. To get the best time-of-flight (TOF) resolution, an optimization of DCF parameters is performed (delay and constant fraction) for each pair of detectors: (BaF2-LaBr3), (BaF2-BC501A), and (LaBr3-BC501A). In addition, the slope information of an interpolated DCF signal is extracted at TM position. This information gives a new insight to understand the broadening in TOF, obtained for a given detector pair. For a pair of signals having small relative slope and interpolation deviations at TM, leads to minimum time broadening. However, the tailing in TOF spectra is dictated by the interplay between the interpolation error and slope variations. Best TOF resolution achieved at the optimum DCF parameters, can be further improved by using slope parameter. Guided by the relative slope parameter, events selection can be imposed which leads to reduction in TOF broadening. While the method sets a trade-off between timing response and coincidence efficiency, it provides an improvement in TOF. With the proposed method, the improved TOF resolution (FWHM) for the aforementioned detector pairs are; 25% (0.69 ns), 40% (0.74 ns), 53% (0.6 ns) respectively, obtained with 250 MSPS, and corresponds to 12% (0.37 ns), 33% (0.72 ns), 35% (0.69 ns) respectively with 500 MSPS digitizers. For the same detector pair, event survival probabilities are; 57%, 58%, 51% respectively with 250 MSPS and becomes 63%, 57%, 68% using 500 MSPS digitizers.

  18. Satellite-based high-resolution PM2.5 estimation over the Beijing-Tianjin-Hebei region of China using an improved geographically and temporally weighted regression model.

    PubMed

    He, Qingqing; Huang, Bo

    2018-05-01

    Ground fine particulate matter (PM2.5) concentrations at high spatial resolution are substantially required for determining the population exposure to PM2.5 over densely populated urban areas. However, most studies for China have generated PM2.5 estimations at a coarse resolution (≥10 km) due to the limitation of satellite aerosol optical depth (AOD) product in spatial resolution. In this study, the 3 km AOD data fused using the Moderate Resolution Imaging Spectroradiometer (MODIS) Collection 6 AOD products were employed to estimate the ground PM2.5 concentrations over the Beijing-Tianjin-Hebei (BTH) region of China from January 2013 to December 2015. An improved geographically and temporally weighted regression (iGTWR) model incorporating seasonal characteristics within the data was developed, which achieved comparable performance to the standard GTWR model for the days with paired PM 2.5 - AOD samples (Cross-validation (CV) R 2  = 0.82) and showed better predictive power for the days without PM 2.5 - AOD pairs (the R 2 increased from 0.24 to 0.46 in CV). Both iGTWR and GTWR (CV R 2  = 0.84) significantly outperformed the daily geographically weighted regression model (CV R 2  = 0.66). Also, the fused 3 km AODs improved data availability and presented more spatial gradients, thereby enhancing model performance compared with the MODIS original 3/10 km AOD product. As a result, ground PM2.5 concentrations at higher resolution were well represented, allowing, e.g., short-term pollution events and long-term PM2.5 trend to be identified, which, in turn, indicated that concerns about air pollution in the BTH region are justified despite its decreasing trend from 2013 to 2015. Copyright © 2018 Elsevier Ltd. All rights reserved.

  19. Local structure of In0.5Ga0.5As from joint high-resolution and differential pair distribution function analysis

    NASA Astrophysics Data System (ADS)

    Petkov, V.; Jeong, I.-K.; Mohiuddin-Jacobs, F.; Proffen, Th.; Billinge, S. J. L.; Dmowski, W.

    2000-07-01

    High resolution total and indium differential atomic pair distribution functions (PDFs) for In0.5Ga0.5As alloys have been obtained by high energy and anomalous x-ray diffraction experiments, respectively. The first peak in the total PDF is resolved as a doublet due to the presence of two distinct bond lengths, In-As and Ga-As. The In differential PDF, which involves only atomic pairs containing In, yields chemical specific information and helps ease the structure data interpretation. Both PDFs have been fit with structure models and the way in that the underlying cubic zinc-blende lattice of In0.5Ga0.5As semiconductor alloy distorts locally to accommodate the distinct In-As and Ga-As bond lengths present has been quantified.

  20. Multicolor Super-Resolution Fluorescence Imaging via Multi-Parameter Fluorophore Detection

    PubMed Central

    Bates, Mark; Dempsey, Graham T; Chen, Kok Hao; Zhuang, Xiaowei

    2012-01-01

    Understanding the complexity of the cellular environment will benefit from the ability to unambiguously resolve multiple cellular components, simultaneously and with nanometer-scale spatial resolution. Multicolor super-resolution fluorescence microscopy techniques have been developed to achieve this goal, yet challenges remain in terms of the number of targets that can be simultaneously imaged and the crosstalk between color channels. Herein, we demonstrate multicolor stochastic optical reconstruction microscopy (STORM) based on a multi-parameter detection strategy, which uses both the fluorescence activation wavelength and the emission color to discriminate between photo-activatable fluorescent probes. First, we obtained two-color super-resolution images using the near-infrared cyanine dye Alexa 750 in conjunction with a red cyanine dye Alexa 647, and quantified color crosstalk levels and image registration accuracy. Combinatorial pairing of these two switchable dyes with fluorophores which enhance photo-activation enabled multi-parameter detection of six different probes. Using this approach, we obtained six-color super-resolution fluorescence images of a model sample. The combination of multiple fluorescence detection parameters for improved fluorophore discrimination promises to substantially enhance our ability to visualize multiple cellular targets with sub-diffraction-limit resolution. PMID:22213647

  1. Precision 3d Surface Reconstruction from Lro Nac Images Using Semi-Global Matching with Coupled Epipolar Rectification

    NASA Astrophysics Data System (ADS)

    Hu, H.; Wu, B.

    2017-07-01

    The Narrow-Angle Camera (NAC) on board the Lunar Reconnaissance Orbiter (LRO) comprises of a pair of closely attached high-resolution push-broom sensors, in order to improve the swath coverage. However, the two image sensors do not share the same lenses and cannot be modelled geometrically using a single physical model. Thus, previous works on dense matching of stereo pairs of NAC images would generally create two to four stereo models, each with an irregular and overlapping region of varying size. Semi-Global Matching (SGM) is a well-known dense matching method and has been widely used for image-based 3D surface reconstruction. SGM is a global matching algorithm relying on global inference in a larger context rather than individual pixels to establish stable correspondences. The stereo configuration of LRO NAC images causes severe problem for image matching methods such as SGM, which emphasizes global matching strategy. Aiming at using SGM for image matching of LRO NAC stereo pairs for precision 3D surface reconstruction, this paper presents a coupled epipolar rectification methods for LRO NAC stereo images, which merges the image pair in the disparity space and in this way, only one stereo model will be estimated. For a stereo pair (four) of NAC images, the method starts with the boresight calibration by finding correspondence in the small overlapping stripe between each pair of NAC images and bundle adjustment of the stereo pair, in order to clean the vertical disparities. Then, the dominate direction of the images are estimated by project the center of the coverage area to the reference image and back-projected to the bounding box plane determined by the image orientation parameters iteratively. The dominate direction will determine an affine model, by which the pair of NAC images are warped onto the object space with a given ground resolution and in the meantime, a mask is produced indicating the owner of each pixel. SGM is then used to generate a disparity map for the stereo pair and each correspondence is transformed back to the owner and 3D points are derived through photogrammetric space intersection. Experimental results reveal that the proposed method is able to reduce gaps and inconsistencies caused by the inaccurate boresight offsets between the two NAC cameras and the irregular overlapping regions, and finally generate precise and consistent 3D surface models from the NAC stereo images automatically.

  2. Three-dimensionality of the bulk electronic structure in WTe 2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wu, Yun; Jo, Na Hyun; Mou, Daixiang

    Inmore » this paper, we use temperature- and field-dependent resistivity measurements (Shubnikov–de Haas quantum oscillations) and ultrahigh-resolution, tunable, vacuum ultraviolet laser-based angle-resolved photoemission spectroscopy (ARPES) to study the three-dimensionality (3D) of the bulk electronic structure in WTe 2 , a type II Weyl semimetal. The bulk Fermi surface (FS) consists of two pairs of electron pockets and two pairs of hole pockets along the Χ–Γ–Χ direction as detected by using an incident photon energy of 6.7 eV, which is consistent with the previously reported data. However, if using an incident photon energy of 6.36 eV, another pair of tiny electron pockets is detected on both sides of the Γ point, which is in agreement with the small quantum oscillation frequency peak observed in the magnetoresistance. Therefore, the bulk, 3D FS consists of three pairs of electron pockets and two pairs of hole pockets in total. With the ability of fine tuning the incident photon energy, we demonstrate the strong three-dimensionality of the bulk electronic structure in WTe 2 . Finally, the combination of resistivity and ARPES measurements reveals the complete, and consistent, picture of the bulk electronic structure of this material.« less

  3. Three-dimensionality of the bulk electronic structure in WTe 2

    DOE PAGES

    Wu, Yun; Jo, Na Hyun; Mou, Daixiang; ...

    2017-05-18

    Inmore » this paper, we use temperature- and field-dependent resistivity measurements (Shubnikov–de Haas quantum oscillations) and ultrahigh-resolution, tunable, vacuum ultraviolet laser-based angle-resolved photoemission spectroscopy (ARPES) to study the three-dimensionality (3D) of the bulk electronic structure in WTe 2 , a type II Weyl semimetal. The bulk Fermi surface (FS) consists of two pairs of electron pockets and two pairs of hole pockets along the Χ–Γ–Χ direction as detected by using an incident photon energy of 6.7 eV, which is consistent with the previously reported data. However, if using an incident photon energy of 6.36 eV, another pair of tiny electron pockets is detected on both sides of the Γ point, which is in agreement with the small quantum oscillation frequency peak observed in the magnetoresistance. Therefore, the bulk, 3D FS consists of three pairs of electron pockets and two pairs of hole pockets in total. With the ability of fine tuning the incident photon energy, we demonstrate the strong three-dimensionality of the bulk electronic structure in WTe 2 . Finally, the combination of resistivity and ARPES measurements reveals the complete, and consistent, picture of the bulk electronic structure of this material.« less

  4. Whole genome DNA methylation: beyond genes silencing.

    PubMed

    Tirado-Magallanes, Roberto; Rebbani, Khadija; Lim, Ricky; Pradhan, Sriharsa; Benoukraf, Touati

    2017-01-17

    The combination of DNA bisulfite treatment with high-throughput sequencing technologies has enabled investigation of genome-wide DNA methylation at near base pair level resolution, far beyond that of the kilobase-long canonical CpG islands that initially revealed the biological relevance of this covalent DNA modification. The latest high-resolution studies have revealed a role for very punctual DNA methylation in chromatin plasticity, gene regulation and splicing. Here, we aim to outline the major biological consequences of DNA methylation recently discovered. We also discuss the necessity of tuning DNA methylation resolution into an adequate scale to ease the integration of the methylome information with other chromatin features and transcription events such as gene expression, nucleosome positioning, transcription factors binding dynamic, gene splicing and genomic imprinting. Finally, our review sheds light on DNA methylation heterogeneity in cell population and the different approaches used for its assessment, including the contribution of single cell DNA analysis technology.

  5. Whole genome DNA methylation: beyond genes silencing

    PubMed Central

    Tirado-Magallanes, Roberto; Rebbani, Khadija; Lim, Ricky; Pradhan, Sriharsa; Benoukraf, Touati

    2017-01-01

    The combination of DNA bisulfite treatment with high-throughput sequencing technologies has enabled investigation of genome-wide DNA methylation at near base pair level resolution, far beyond that of the kilobase-long canonical CpG islands that initially revealed the biological relevance of this covalent DNA modification. The latest high-resolution studies have revealed a role for very punctual DNA methylation in chromatin plasticity, gene regulation and splicing. Here, we aim to outline the major biological consequences of DNA methylation recently discovered. We also discuss the necessity of tuning DNA methylation resolution into an adequate scale to ease the integration of the methylome information with other chromatin features and transcription events such as gene expression, nucleosome positioning, transcription factors binding dynamic, gene splicing and genomic imprinting. Finally, our review sheds light on DNA methylation heterogeneity in cell population and the different approaches used for its assessment, including the contribution of single cell DNA analysis technology. PMID:27895318

  6. High resolution scintillation detector with semiconductor readout

    DOEpatents

    Levin, Craig S.; Hoffman, Edward J.

    2000-01-01

    A novel high resolution scintillation detector array for use in radiation imaging such as high resolution Positron Emission Tomography (PET) which comprises one or more parallelepiped crystals with at least one long surface of each crystal being in intimate contact with a semiconductor photodetector such that photons generated within each crystal by gamma radiation passing therethrough is detected by the photodetector paired therewith.

  7. Sub-Terrahertz Spectroscopy of E.COLI Dna: Experiment, Statistical Model, and MD Simulations

    NASA Astrophysics Data System (ADS)

    Sizov, I.; Dorofeeva, T.; Khromova, T.; Gelmont, B.; Globus, T.

    2012-06-01

    We will present result of combined experimental and computational study of sub-THz absorption spectra from Escherichia coli (E.coli) DNA. Measurements were conducted using a Bruker FTIR spectrometer with a liquid helium cooled bolometer and a recently developed frequency domain sensor operating at room temperature, with spectral resolution of 0.25 cm-1 and 0.03 cm-1, correspondingly. We have earlier demonstrated that molecular dynamics (MD) simulation can be effectively applied for characterizing relatively small biological molecules, such as transfer RNA or small protein thioredoxin from E. coli , and help to understand and predict their absorption spectra. Large size of DNA macromolecules ( 5 million base pairs for E. coli DNA) prevents, however, direct application of MD simulation at the current level of computational capabilities. Therefore, by applying a second order Markov chain approach and Monte-Carlo technique, we have developed a new statistical model to construct DNA sequences from biological cells. These short representative sequences (20-60 base pairs) are built upon the most frequently repeated fragments (2-10 base pairs) in the original DNA. Using this new approach, we constructed DNA sequences for several non-pathogenic strains of E.coli, including a well-known strain BL21, uro-pathogenic strain, CFT073, and deadly EDL933 strain (O157:H7), and used MD simulations to calculate vibrational absorption spectra of these strains. Significant differences are clearly present in spectra of strains in averaged spectra and in all components for particular orientations. The mechanism of interaction of THz radiation with a biological molecule is studied by analyzing dynamics of atoms and correlation of local vibrations in the modeled molecule. Simulated THz vibrational spectra of DNA are compared with experimental results. With the spectral resolution of 0.1 cm-1 or better, which is now available in experiments, the very easy discrimination between different strains of the same bacteria becomes possible.

  8. Fabrication and characterization of a 0.5-mm lutetium oxyorthosilicate detector array for high-resolution PET applications.

    PubMed

    Stickel, Jennifer R; Qi, Jinyi; Cherry, Simon R

    2007-01-01

    With the increasing use of in vivo imaging in mouse models of disease, there are many interesting applications that demand imaging of organs and tissues with submillimeter resolution. Though there are other contributing factors, the spatial resolution in small-animal PET is still largely determined by the detector pixel dimensions. In this work, a pair of lutetium oxyorthosilicate (LSO) arrays with 0.5-mm pixels was coupled to multichannel photomultiplier tubes and evaluated for use as high-resolution PET detectors. Flood histograms demonstrated that most crystals were clearly identifiable. Energy resolution varied from 22% to 38%. The coincidence timing resolution was 1.42-ns full width at half maximum (FWHM). The intrinsic spatial resolution was 0.68-mm FWHM as measured with a 30-gauge needle filled with (18)F. The improvement in spatial resolution in a tomographic setting is demonstrated using images of a line source phantom reconstructed with filtered backprojection and compared with images obtained from 2 dedicated small-animal PET scanners. Finally, a projection image of the mouse foot is shown to demonstrate the application of these 0.5-mm LSO detectors to a biologic task. A pair of highly pixelated LSO detections has been constructed and characterized for use as high-spatial-resolution PET detectors. It appears that small-animal PET systems capable of a FWHM spatial resolution of 600 microm or less are feasible and should be pursued.

  9. Mapping the geographic distribution of canopy species communities in lowland Amazon rainforest with CAO-AToMS (Invited)

    NASA Astrophysics Data System (ADS)

    Feret, J.; Asner, G. P.

    2013-12-01

    Mapping regional canopy diversity will greatly advance our understanding as well as the conservation of tropical rainforests. Changes in species composition across space and time are particularly important to understand the influence of climate, human activity and environmental factors on these ecosystems, but to date such monitoring is extremely challenging and is facing a scale gap between small-scale, highly detailed field studies and large-scale, low-resolution satellite observations. Advances were recently made in the field of spectroscopic imagery for the estimation of canopy alpha-diversity, and an original approach based on the segmentation of the spectral space proved its ability to estimate Shannon diversity index with unprecedented accuracy. We adapted this method in order to estimate spectral dissimilarity across landscape as a proxy for changes in species composition. We applied this approach and mapped species composition over four sites located in lowland rainforest of Peruvian Amazon. This study was based on spectroscopic imagery acquired using the Carnegie Airborne Observatory (CAO) Airborne Taxonomic Mapping System (AToMS), operating a unique sensor combining the fine spectral and spatial resolution required for such task. We obtained accurate estimation of Bray-Curtis distance between pairs of plots, which is the most commonly used metric to estimate dissimilarity in species composition (n=497 pairs, r=0.63). The maps of species composition were then compared to topo-hydrographic properties. Our results indicated a strong shift in species composition and community diversity between floodplain and terra firme terrain conditions as well as a significantly higher diversity of species communities within Amazonian floodplains. These results pave the way for global mapping of tropical canopy diversity at fine geographic resolution.

  10. Coincidence detection of spatially correlated photon pairs with a monolithic time-resolving detector array.

    PubMed

    Unternährer, Manuel; Bessire, Bänz; Gasparini, Leonardo; Stoppa, David; Stefanov, André

    2016-12-12

    We demonstrate coincidence measurements of spatially entangled photons by means of a multi-pixel based detection array. The sensor, originally developed for positron emission tomography applications, is a fully digital 8×16 silicon photomultiplier array allowing not only photon counting but also per-pixel time stamping of the arrived photons with an effective resolution of 265 ps. Together with a frame rate of 500 kfps, this property exceeds the capabilities of conventional charge-coupled device cameras which have become of growing interest for the detection of transversely correlated photon pairs. The sensor is used to measure a second-order correlation function for various non-collinear configurations of entangled photons generated by spontaneous parametric down-conversion. The experimental results are compared to theory.

  11. Coherent States for Kronecker Products of Non Compact Groups: Formulation and Applications

    NASA Technical Reports Server (NTRS)

    Bambah, Bindu A.; Agarwal, Girish S.

    1996-01-01

    We introduce and study the properties of a class of coherent states for the group SU(1,1) X SU(1,1) and derive explicit expressions for these using the Clebsch-Gordan algebra for the SU(1,1) group. We restrict ourselves to the discrete series representations of SU(1,1). These are the generalization of the 'Barut Girardello' coherent states to the Kronecker Product of two non-compact groups. The resolution of the identity and the analytic phase space representation of these states is presented. This phase space representation is based on the basis of products of 'pair coherent states' rather than the standard number state canonical basis. We discuss the utility of the resulting 'bi-pair coherent states' in the context of four-mode interactions in quantum optics.

  12. Easy Words: Reference Resolution in a Malevolent Referent World.

    PubMed

    Gleitman, Lila R; Trueswell, John C

    2018-06-15

    This article describes early stages in the acquisition of a first vocabulary by infants and young children. It distinguishes two major stages, the first of which operates by a stand-alone word-to-world pairing procedure and the second of which, using the evidence so acquired, builds a domain-specific syntax-sensitive structure-to-world pairing procedure. As we show, the first stage of learning is slow, restricted in character, and to some extent errorful, whereas the second procedure is determinative, rapid, and essentially errorless. Our central claim here is that the early, referentially based learning procedure succeeds at all because it is reined in by attention-focusing properties of word-to-world timing and related indicants of referential intent. Copyright © 2018 Cognitive Science Society, Inc.

  13. Improving urban land use and land cover classification from high-spatial-resolution hyperspectral imagery using contextual information

    NASA Astrophysics Data System (ADS)

    Yang, He; Ma, Ben; Du, Qian; Yang, Chenghai

    2010-08-01

    In this paper, we propose approaches to improve the pixel-based support vector machine (SVM) classification for urban land use and land cover (LULC) mapping from airborne hyperspectral imagery with high spatial resolution. Class spatial neighborhood relationship is used to correct the misclassified class pairs, such as roof and trail, road and roof. These classes may be difficult to be separated because they may have similar spectral signatures and their spatial features are not distinct enough to help their discrimination. In addition, misclassification incurred from within-class trivial spectral variation can be corrected by using pixel connectivity information in a local window so that spectrally homogeneous regions can be well preserved. Our experimental results demonstrate the efficiency of the proposed approaches in classification accuracy improvement. The overall performance is competitive to the object-based SVM classification.

  14. “Ultra-high resolution optical trap with single fluorophore sensitivity”

    PubMed Central

    Comstock, Matthew J; Ha, Taekjip; Chemla, Yann R

    2013-01-01

    We present a single-molecule instrument that combines a timeshared ultra-high resolution dual optical trap interlaced with a confocal fluorescence microscope. In a demonstration experiment, individual single-fluorophore labeled DNA oligonucleotides were observed to bind and unbind to complementary DNA suspended between two trapped beads. Simultaneous with the single-fluorophore detection, coincident angstrom-scale changes in tether extension could be clearly observed. Fluorescence readout allowed us to determine the duplex melting rate as a function of force. The new instrument will enable the simultaneous measurement of angstrom-scale mechanical motion of individual DNA-binding proteins (e.g., single base pair stepping of DNA translocases) along with the detection of fluorescently labeled protein properties (e.g., internal configuration). PMID:21336286

  15. DQE simulation of a-Se x-ray detectors using ARTEMIS

    NASA Astrophysics Data System (ADS)

    Fang, Yuan; Badano, Aldo

    2016-03-01

    Detective Quantum Efficiency (DQE) is one of the most important image quality metrics for evaluating the spatial resolution performance of flat-panel x-ray detectors. In this work, we simulate the DQE of amorphous selenium (a-Se) xray detectors with a detailed Monte Carlo transport code (ARTEMIS) for modeling semiconductor-based direct x-ray detectors. The transport of electron-hole pairs is achieved with a spatiotemporal model that accounts for recombination and trapping of carriers and Coulombic effects of space charge and external applied electric field. A range of x-ray energies has been simulated from 10 to 100 keV. The DQE results can be used to study the spatial resolution characteristics of detectors at different energies.

  16. How to test for partially predictable chaos.

    PubMed

    Wernecke, Hendrik; Sándor, Bulcsú; Gros, Claudius

    2017-04-24

    For a chaotic system pairs of initially close-by trajectories become eventually fully uncorrelated on the attracting set. This process of decorrelation can split into an initial exponential decrease and a subsequent diffusive process on the chaotic attractor causing the final loss of predictability. Both processes can be either of the same or of very different time scales. In the latter case the two trajectories linger within a finite but small distance (with respect to the overall extent of the attractor) for exceedingly long times and remain partially predictable. Standard tests for chaos widely use inter-orbital correlations as an indicator. However, testing partially predictable chaos yields mostly ambiguous results, as this type of chaos is characterized by attractors of fractally broadened braids. For a resolution we introduce a novel 0-1 indicator for chaos based on the cross-distance scaling of pairs of initially close trajectories. This test robustly discriminates chaos, including partially predictable chaos, from laminar flow. Additionally using the finite time cross-correlation of pairs of initially close trajectories, we are able to identify laminar flow as well as strong and partially predictable chaos in a 0-1 manner solely from the properties of pairs of trajectories.

  17. Dictionary learning based noisy image super-resolution via distance penalty weight model

    PubMed Central

    Han, Yulan; Zhao, Yongping; Wang, Qisong

    2017-01-01

    In this study, we address the problem of noisy image super-resolution. Noisy low resolution (LR) image is always obtained in applications, while most of the existing algorithms assume that the LR image is noise-free. As to this situation, we present an algorithm for noisy image super-resolution which can achieve simultaneously image super-resolution and denoising. And in the training stage of our method, LR example images are noise-free. For different input LR images, even if the noise variance varies, the dictionary pair does not need to be retrained. For the input LR image patch, the corresponding high resolution (HR) image patch is reconstructed through weighted average of similar HR example patches. To reduce computational cost, we use the atoms of learned sparse dictionary as the examples instead of original example patches. We proposed a distance penalty model for calculating the weight, which can complete a second selection on similar atoms at the same time. Moreover, LR example patches removed mean pixel value are also used to learn dictionary rather than just their gradient features. Based on this, we can reconstruct initial estimated HR image and denoised LR image. Combined with iterative back projection, the two reconstructed images are applied to obtain final estimated HR image. We validate our algorithm on natural images and compared with the previously reported algorithms. Experimental results show that our proposed method performs better noise robustness. PMID:28759633

  18. A Multi-Resolution Data Structure for Two-Dimensional Morse Functions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bremer, P-T; Edelsbrunner, H; Hamann, B

    2003-07-30

    The efficient construction of simplified models is a central problem in the field of visualization. We combine topological and geometric methods to construct a multi-resolution data structure for functions over two-dimensional domains. Starting with the Morse-Smale complex we build a hierarchy by progressively canceling critical points in pairs. The data structure supports mesh traversal operations similar to traditional multi-resolution representations.

  19. The Alignment Test System for AXAF-I's High Resolution Mirror Assembly

    NASA Technical Reports Server (NTRS)

    Waldman, Mark

    1995-01-01

    The AXAF-1 High Resolution Mirror Assembly (HRMA) consists of four nested mirror pairs of Wolter Type-1 grazing incidence optics. The HRMA assembly and alignment will take place in a vibration-isolated, cleanliness class 100, 18 meter high tower at an Eastman Kodak Company facility in Rochester, NY. Each mirror pair must be aligned such that its image is coma-free, and the four pairs must be aligned such that their images are coincident. In addition, both the HRMA optical axis and focal point must be precisely known with respect to physical references on the HRMA. The alignment of the HRMA mirrors is measured by the HRMA Alignment Test System (HATS), which is an integral part of the tower facility. The HATS is configured as a double-pass, autocollimating Hartmann test where each mirror aperture is scanned to determine the state of alignment. This paper will describe the design and operation of the HATS.

  20. [High-contrast resolution of film-screen systems in oral and maxillofacial radiology].

    PubMed

    Kaeppler, G; Reinert, S

    2007-11-01

    The aim was to determine differences in high-contrast resolution of film-screen systems used in dental panoramic and cephalometric radiography by calculating the modulation transfer function (MTF). The radiographs used to determine the MTF should be taken by the same x-ray units as those used for patient radiographs. The MTF was determined using a lead grid and according to DIN 6867-2 for 11 film-screen systems (speed 250, speed class 200 and 400) used in dental radiographic diagnostics. The optical density was measured using a microdensitometer developed by PTB. With 10% of the modulation transfer factor, newly developed film-screen systems (speed class 200 and 400) demonstrated a resolution of 4.9 to 6 line pairs per mm (panoramic radiography). In cephalometric radiography a film-screen system (speed class 400 and green-sensitive film) had a resolution of 4.2 line pairs per mm and surpassed two film-screen systems (speed class 400, resolution of 3 line pairs per mm, blue-sensitive films). The relevance of this study is underlined by the diagnostic reference doses defined in the German X-ray Ordinance (RöV) which are also intended for dentistry. Film-screen systems (speed 250, speed class 200) previously used in dental panoramic and cephalometric radiography can be replaced by newly developed film-screen systems (speed class 400). In dental radiography dose reductions are possible with film-screen systems (speed class 400) without impairing diagnostic accuracy. The introduction of newly developed film-screen systems (speed class 400) requires lower milliampere-seconds and therefore an adjustment of the x-ray units to lower milliampere settings.

  1. Exit and Voice: Organizational Loyalty and Dispute Resolution Strategies

    ERIC Educational Resources Information Center

    Hoffmann, Elizabeth A.

    2006-01-01

    This study compares workplace dispute resolution strategies (exit, voice and toleration) in matched pairs of conventional and worker-owned cooperative organizations operating in three industries--coal mining, taxicab driving and organic food distribution. Building on Hirschman's classic exit, voice and loyalty thesis, this research demonstrates…

  2. HPLC separation of triacylglycerol positional isomers on a polymeric ODS column.

    PubMed

    Kuroda, Ikuma; Nagai, Toshiharu; Mizobe, Hoyo; Yoshimura, Nobuhito; Gotoh, Naohiro; Wada, Shun

    2008-07-01

    A polymeric ODS column was applied to the resolution of triacylglycerol positional isomers (TAG-PI), i.e. 1,3-dioleoyl-2-palmitoyl-glycerol (OPO) and 1,2-dioleoyl-3-palmitoyl-rac-glycerol (OOP), with a recycle HPLC system. To investigate the ODS column species and the column temperatures for the resolution of a TAG-PI pair, a mixture of OPO and OOP was subjected to an HPLC system equipped with a non-endcapped polymeric, endcapped monomeric, endcapped intermediate, or non-endcapped monomeric ODS column at three different column temperatures (40, 25, or 10 degrees C). Only the non-endcapped polymeric ODS column achieved the separation of OPO and OOP, and the lowest column temperature (10 degrees C) showed the best resolution for them. The other pair of TAG-PI, a mixture of 1,3-dipalmitoyl-2-oleoyl-glycerol (POP) and 1,2-dipalmitoyl-3-oleoyl-rac-glycerol (PPO) was also subjected to the system equipped with a non-endcapped polymeric or monomeric ODS column at five different column temperatures (40, 32, 25, 17, and 10 degrees C). Thus, POP and PPO were also separated on only the non-endcapped polymeric ODS column at 25 degrees C. However, no clear peak appeared at 10 degrees C. These results would indicate that the polymeric ODS stationary phase has an ability to recognize the structural differences between TAG-PI pairs. Also, the column temperature is a very important factor for separating the TAG-PI pair, and the optimal temperature would relate to the solubility of TAG-PI in the mobile phase. Furthermore, the recycle HPLC system provided measurements for the separation and analysis of TAG-PI pairs.

  3. HI properties and star formation history of a fly-by pair of blue compact dwarf galaxies

    NASA Astrophysics Data System (ADS)

    Kim, Jinhyub; Chung, Aeree; Wong, O. Ivy; Lee, Bumhyun; Sung, Eon-Chang; Staveley-Smith, Lister

    2017-09-01

    A fly-by interaction has been suggested to be one of the major explanations for enhanced star formation in blue compact dwarf (BCD) galaxies, yet no direct evidence for this scenario has been found to date. In the Hi Parkes all-sky survey (HIPASS), ESO 435-IG 020 and ESO 435-G 016, a BCD pair were found in a common, extended gas envelope of atomic hydrogen, providing an ideal case to test the hypothesis that the starburst in BCDs can be indeed triggered by a fly-by interaction. Using high-resolution data from the Australia Telescope Compact Array (ATCA), we investigated Hi properties and the spectral energy distribution (SED) of the BCD pair to study their interaction and star formation histories. The high-resolution Hi data of both BCDs reveal a number of peculiarities, which are suggestive of tidal perturbation. Meanwhile, 40% of the HIPASS flux is not accounted for in the ATCA observations with no Hi gas bridge found between the two BCDs. Intriguingly, in the residual of the HIPASS and the ATCA data, 10% of the missing flux appears to be located between the two BCDs. While the SED-based age of the most dominant young stellar population is old enough to have originated from the interaction with any neighbors (including the other of the two BCDs), the most recent star formation activity traced by strong Hα emission in ESO 435-IG 020 and the shear motion of gas in ESO 435-G 016, suggest a more recent or current tidal interaction. Based on these and the residual emission between the HIPASS and the ATCA data, we propose an interaction between the two BCDs as the origin of their recently enhanced star formation activity. The shear motion on the gas disk, potentially with re-accretion of the stripped gas, could be responsible for the active star formation in this BCD pair. The reduced datacube (FITS file) is only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (http://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/605/A54

  4. High-resolution HLA haplotype frequencies of stem cell donors in Germany with foreign parentage: how can they be used to improve unrelated donor searches?

    PubMed

    Pingel, Julia; Solloch, Ute V; Hofmann, Jan A; Lange, Vinzenz; Ehninger, Gerhard; Schmidt, Alexander H

    2013-03-01

    In hematopoietic stem cell transplantation, human leukocyte antigens (HLA), usually HLA loci A, B, C, DRB1 and DQB1, are required to check histocompatibility between a potential donor and the recipient suffering from a malignant or non-malignant blood disease. As databases of potential unrelated donors are very heterogeneous with respect to typing resolution and number of typed loci, donor registries make use of haplotype frequency-based algorithms to provide matching probabilities for each potentially matching recipient/donor pair. However, it is well known that HLA allele and haplotype frequencies differ significantly between populations. We estimated high-resolution HLA-A, -B, -C, -DRB1 haplotype and allele frequencies of donors within DKMS German Bone Marrow Donor Center with parentage from 17 different countries: Turkey, Poland, Italy, Russian Federation, Croatia, Greece, Austria, Kazakhstan, France, The Netherlands, Republic of China, Romania, Portugal, USA, Spain, United Kingdom and Bosnia and Herzegovina. 5-locus haplotypes including HLA-DQB1 are presented for Turkey, Poland, Italy and Russian Federation. We calculated linkage disequilibria for each sample. Genetic distances between included countries could be shown to reflect geography. We further demonstrate how genetic differences between populations are reflected in matching probabilities of recipient/donor pairs and how they influence the search for unrelated donors as well as strategic donor center typings. Copyright © 2012 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  5. Epigenome data release: a participant-centered approach to privacy protection.

    PubMed

    Dyke, Stephanie O M; Cheung, Warren A; Joly, Yann; Ammerpohl, Ole; Lutsik, Pavlo; Rothstein, Mark A; Caron, Maxime; Busche, Stephan; Bourque, Guillaume; Rönnblom, Lars; Flicek, Paul; Beck, Stephan; Hirst, Martin; Stunnenberg, Henk; Siebert, Reiner; Walter, Jörn; Pastinen, Tomi

    2015-07-17

    Large-scale epigenome mapping by the NIH Roadmap Epigenomics Project, the ENCODE Consortium and the International Human Epigenome Consortium (IHEC) produces genome-wide DNA methylation data at one base-pair resolution. We examine how such data can be made open-access while balancing appropriate interpretation and genomic privacy. We propose guidelines for data release that both reduce ambiguity in the interpretation of open-access data and limit immediate access to genetic variation data that are made available through controlled access.

  6. Development of a Diagnostic Tool to Detect DNA Methylation Biomarkers for Early-Stage Lung Cancer

    DTIC Science & Technology

    2015-02-01

    include: 1) a DNA recognition domain that recognizes the specific DNA sequence of interest and 2) one half of the leucine zipper pair. The second...piece will include 1) the second half of the leucine zipper pair, 2) a flexible linker flanked by a FRET pair that determines the local (within 30 bp...each other to determine the resolution of our probes. All DNA fragments are methylated using bacterial methyltransferase. Since only a single CG

  7. Light-Sharing Interface for dMiCE Detectors Using Sub-Surface Laser Engraving

    PubMed Central

    Hunter, William C. J.; Miyaoka, Robert S.; MacDonald, Lawrence; McDougald, Wendy; Lewellen, Thomas K.

    2015-01-01

    We have previously reported on dMiCE, a method of resolving depth or interaction (DOI) in a pair of discrete crystals by encoding light sharing properties as a function of depth in the interface of a crystal-element pair. A challenge for this method is the cost and repeatability of interface treatment for each crystal pair. In this work, we report our preliminary results on using sub-surface laser engraving (SSLE) as a means of forming this depth-dependent interface in a dMiCE detector. A surplus first-generation SSLE system was used to create a partially reflective layer 100-microns thick at the boundary between two halves of a 1.4-by-2.9-by-20 mm3 LYSO crystal. The boundary of these paired crystal elements was positioned between two 3-mm wide Silicon photomultiplier arrays. The responses of these two photodetectors were acquired for an ensemble of 511-keV photons collimated to interact at a fixed depth in just one crystal element. Interaction position was then varied to measure detector response as a function of depth, which was then used to maximum-likelihood positions. Despite use of sub-optimal SSLE processing we found an average DOI resolution of 3.4 mm for front-sided readout and 3.9 mm for back-sided readout while obtaining energy resolutions on the order of 10%. We expect DOI resolution can be improved significantly by optimizing the SSLE process and pattern. PMID:25914421

  8. Light-Sharing Interface for dMiCE Detectors Using Sub-Surface Laser Engraving.

    PubMed

    Hunter, William C J; Miyaoka, Robert S; MacDonald, Lawrence; McDougald, Wendy; Lewellen, Thomas K

    2015-02-06

    We have previously reported on dMiCE, a method of resolving depth or interaction (DOI) in a pair of discrete crystals by encoding light sharing properties as a function of depth in the interface of a crystal-element pair. A challenge for this method is the cost and repeatability of interface treatment for each crystal pair. In this work, we report our preliminary results on using sub-surface laser engraving (SSLE) as a means of forming this depth-dependent interface in a dMiCE detector. A surplus first-generation SSLE system was used to create a partially reflective layer 100-microns thick at the boundary between two halves of a 1.4-by-2.9-by-20 mm 3 LYSO crystal. The boundary of these paired crystal elements was positioned between two 3-mm wide Silicon photomultiplier arrays. The responses of these two photodetectors were acquired for an ensemble of 511-keV photons collimated to interact at a fixed depth in just one crystal element. Interaction position was then varied to measure detector response as a function of depth, which was then used to maximum-likelihood positions. Despite use of sub-optimal SSLE processing we found an average DOI resolution of 3.4 mm for front-sided readout and 3.9 mm for back-sided readout while obtaining energy resolutions on the order of 10%. We expect DOI resolution can be improved significantly by optimizing the SSLE process and pattern.

  9. Minor groove binding of a bis-quaternary ammonium compound: the crystal structure of SN 7167 bound to d(CGCGAATTCGCG)2.

    PubMed Central

    Squire, C J; Clark, G R; Denny, W A

    1997-01-01

    The X-ray crystal structure of the complex between the synthetic antitumour and antiviral DNA binding ligand SN 7167 and the DNA oligonucleotide d(CGCGAATTCGCG)2 has been determined to an R factor of 18.3% at 2.6 A resolution. The ligand is located within the minor groove and covers almost 6 bp with the 1-methylpyridinium ring extending as far as the C9-G16 base pair and the 1-methylquinolinium ring lying between the G4-C21 and A5-T20 base pairs. The ligand interacts only weakly with the DNA, as evidenced by long range contacts and shallow penetration into the groove. This structure is compared with that of the complex between the parent compound SN 6999 and the alkylated DNA sequence d(CGC[e6G]AATTCGCG)2. There are significant differences between the two structures in the extent of DNA bending, ligand conformation and groove binding. PMID:9321660

  10. Similarity of High-Resolution Tandem Mass Spectrometry Spectra of Structurally Related Micropollutants and Transformation Products

    NASA Astrophysics Data System (ADS)

    Schollée, Jennifer E.; Schymanski, Emma L.; Stravs, Michael A.; Gulde, Rebekka; Thomaidis, Nikolaos S.; Hollender, Juliane

    2017-12-01

    High-resolution tandem mass spectrometry (HRMS2) with electrospray ionization is frequently applied to study polar organic molecules such as micropollutants. Fragmentation provides structural information to confirm structures of known compounds or propose structures of unknown compounds. Similarity of HRMS2 spectra between structurally related compounds has been suggested to facilitate identification of unknown compounds. To test this hypothesis, the similarity of reference standard HRMS2 spectra was calculated for 243 pairs of micropollutants and their structurally related transformation products (TPs); for comparison, spectral similarity was also calculated for 219 pairs of unrelated compounds. Spectra were measured on Orbitrap and QTOF mass spectrometers and similarity was calculated with the dot product. The influence of different factors on spectral similarity [e.g., normalized collision energy (NCE), merging fragments from all NCEs, and shifting fragments by the mass difference of the pair] was considered. Spectral similarity increased at higher NCEs and highest similarity scores for related pairs were obtained with merged spectra including measured fragments and shifted fragments. Removal of the monoisotopic peak was critical to reduce false positives. Using a spectral similarity score threshold of 0.52, 40% of related pairs and 0% of unrelated pairs were above this value. Structural similarity was estimated with the Tanimoto coefficient and pairs with higher structural similarity generally had higher spectral similarity. Pairs where one or both compounds contained heteroatoms such as sulfur often resulted in dissimilar spectra. This work demonstrates that HRMS2 spectral similarity may indicate structural similarity and that spectral similarity can be used in the future to screen complex samples for related compounds such as micropollutants and TPs, assisting in the prioritization of non-target compounds. [Figure not available: see fulltext.

  11. Optimization of high count rate event counting detector with Microchannel Plates and quad Timepix readout

    NASA Astrophysics Data System (ADS)

    Tremsin, A. S.; Vallerga, J. V.; McPhate, J. B.; Siegmund, O. H. W.

    2015-07-01

    Many high resolution event counting devices process one event at a time and cannot register simultaneous events. In this article a frame-based readout event counting detector consisting of a pair of Microchannel Plates and a quad Timepix readout is described. More than 104 simultaneous events can be detected with a spatial resolution of 55 μm, while >103 simultaneous events can be detected with <10 μm spatial resolution when event centroiding is implemented. The fast readout electronics is capable of processing >1200 frames/sec, while the global count rate of the detector can exceed 5×108 particles/s when no timing information on every particle is required. For the first generation Timepix readout, the timing resolution is limited by the Timepix clock to 10-20 ns. Optimization of the MCP gain, rear field voltage and Timepix threshold levels are crucial for the device performance and that is the main subject of this article. These devices can be very attractive for applications where the photon/electron/ion/neutron counting with high spatial and temporal resolution is required, such as energy resolved neutron imaging, Time of Flight experiments in lidar applications, experiments on photoelectron spectroscopy and many others.

  12. Characterization of non-endcapped polymeric ODS column for the separation of triacylglycerol positional isomers.

    PubMed

    Gotoh, Naohiro; Matsumoto, Yumiko; Yuji, Hiromi; Nagai, Toshiharu; Mizobe, Hoyo; Ichioka, Kenji; Kuroda, Ikuma; Noguchi, Noriko; Wada, Shun

    2010-01-01

    The characteristics of a non-endcapped polymeric ODS column for the resolution of triacylglycerol positional isomers (TAG-PI) were examined using a recycle HPLC-atmospheric pressure chemical ionization/mass spectrometry system. A pair of TAG-PI containing saturated fatty acids at least 12 carbons was separated. Except for TAG-PI containing elaidic acid, pairs of TAG-PI containing three unsaturated fatty acids were not separated, even by recycle runs. These results indicate that the resolution of TAG-PI on a non-endcapped polymeric ODS stationary phase is realized by the recognition of the linear structure of the fatty acid and the binding position of the saturated fatty acid in TAG-PI. Chain length was also an important factor for resolution. This method may be a useful and simple for measuring the abundance ratio of TAG-PI containing saturated fatty acids in natural oils.

  13. Development and assessment of a higher-spatial-resolution (4.4 km) MISR aerosol optical depth product using AERONET-DRAGON data

    NASA Astrophysics Data System (ADS)

    Garay, Michael J.; Kalashnikova, Olga V.; Bull, Michael A.

    2017-04-01

    Since early 2000, the Multi-angle Imaging SpectroRadiometer (MISR) instrument on NASA's Terra satellite has been acquiring data that have been used to produce aerosol optical depth (AOD) and particle property retrievals at 17.6 km spatial resolution. Capitalizing on the capabilities provided by multi-angle viewing, the current operational (Version 22) MISR algorithm performs well, with about 75 % of MISR AOD retrievals globally falling within 0.05 or 20 % × AOD of paired validation data from the ground-based Aerosol Robotic Network (AERONET). This paper describes the development and assessment of a prototype version of a higher-spatial-resolution 4.4 km MISR aerosol optical depth product compared against multiple AERONET Distributed Regional Aerosol Gridded Observations Network (DRAGON) deployments around the globe. In comparisons with AERONET-DRAGON AODs, the 4.4 km resolution retrievals show improved correlation (r = 0. 9595), smaller RMSE (0.0768), reduced bias (-0.0208), and a larger fraction within the expected error envelope (80.92 %) relative to the Version 22 MISR retrievals.

  14. New concepts for scintillator/HgI[sub 2] gamma ray spectroscopy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Y.J.; Iwanczyk, J.S.; Patt, B.E.

    The construction of a high energy resolution gamma ray detector consisting of a scintillator/mercuric iodide photodetector combination has been investigated. Several HgI[sub 2] photodetectors have been fabricated and tested with standard NIM electronics. The energy resolution of a scintillator/HgI[sub 2] pair was found to be 4.75%, full width at half maximum, for 662 keV [sup 137]Cs gamma ray photons. Of five detectors fabricated with the new technique, all produced resolutions better than 5.6% FWHM. This technology makes it possible to reliably produce high quality HgI[sub 2] photodetectors. New design concepts for the HgI[sub 2] photocell, including the transparent entrance electrode,more » detector geometry, and detector packaging, are described in the paper. Advantages of gamma ray spectrometers based upon crystal scintillators optically coupled to HgI[sub 2] photodetectors (in contrast to coupling the scintillators to the more conventional light sensors, i.e., photomultiplier tubes (PMTs)) include greater ruggedness, improved energy resolution, markedly smaller size and weight, reduced power, and insensitivity to magnetic field perturbations.« less

  15. Stochastic parameterization of shallow cumulus convection estimated from high-resolution model data

    NASA Astrophysics Data System (ADS)

    Dorrestijn, Jesse; Crommelin, Daan T.; Siebesma, A. Pier.; Jonker, Harm J. J.

    2013-02-01

    In this paper, we report on the development of a methodology for stochastic parameterization of convective transport by shallow cumulus convection in weather and climate models. We construct a parameterization based on Large-Eddy Simulation (LES) data. These simulations resolve the turbulent fluxes of heat and moisture and are based on a typical case of non-precipitating shallow cumulus convection above sea in the trade-wind region. Using clustering, we determine a finite number of turbulent flux pairs for heat and moisture that are representative for the pairs of flux profiles observed in these simulations. In the stochastic parameterization scheme proposed here, the convection scheme jumps randomly between these pre-computed pairs of turbulent flux profiles. The transition probabilities are estimated from the LES data, and they are conditioned on the resolved-scale state in the model column. Hence, the stochastic parameterization is formulated as a data-inferred conditional Markov chain (CMC), where each state of the Markov chain corresponds to a pair of turbulent heat and moisture fluxes. The CMC parameterization is designed to emulate, in a statistical sense, the convective behaviour observed in the LES data. The CMC is tested in single-column model (SCM) experiments. The SCM is able to reproduce the ensemble spread of the temperature and humidity that was observed in the LES data. Furthermore, there is a good similarity between time series of the fractions of the discretized fluxes produced by SCM and observed in LES.

  16. Mapping shallow waters habitats using OBIA by applying several approaches of depth invariant index in North Kepulauan Seribu

    NASA Astrophysics Data System (ADS)

    Siregar, V. P.; Agus, S. B.; Subarno, T.; Prabowo, N. W.

    2018-05-01

    The availability of satellite imagery with a variety of spatial resolution, both free access and commercial become as an option in utilizing the remote sensing technology. Variability of the water column is one of the factors affecting the interpretation results when mapping marine shallow waters. This study aimed to evaluate the influence of water column correction (depth-invariant index) on the accuracy of shallow water habitat classification results using OBIA. This study was conducted in North of Kepulauan Seribu, precisely in Harapan Island and its surrounding areas. Habitat class schemes were based on field observations, which were then used to build habitat classes on satellite imagery. The water column correction was applied to the three pairs of SPOT-7 multispectral bands, which were subsequently used in object-based classification. Satellite image classification was performed with four different approaches, namely (i) using DII transformed bands with single pair band input (B1B2), (ii) multi pairs bands (B1B2, B1B3, and B2B3), (iii) combination of multi pairs band and initial bands, and (iv) only using initial bands. The accuracy test results of the four inputs show the values of Overall Accuracy and Kappa Statistics, respectively 55.84 and 0.48; 68.53 and 0.64; 78.68 and 0.76; 77.66 and 0.74. It shows that the best results when using DII and initial band combination for shallow water benthic classification in this study site.

  17. The SeaQuest Spectrometer at Fermilab

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aidala, C.A.; et al.

    The SeaQuest spectrometer at Fermilab was designed to detect oppositely-charged pairs of muons (dimuons) produced by interactions between a 120 GeV proton beam and liquid hydrogen, liquid deuterium and solid nuclear targets. The primary physics program uses the Drell-Yan process to probe antiquark distributions in the target nucleon. The spectrometer consists of a target system, two dipole magnets and four detector stations. The upstream magnet is a closed-aperture solid iron magnet which also serves as the beam dump, while the second magnet is an open aperture magnet. Each of the detector stations consists of scintillator hodoscopes and a high-resolution trackingmore » device. The FPGA-based trigger compares the hodoscope signals to a set of pre-programmed roads to determine if the event contains oppositely-signed, high-mass muon pairs.« less

  18. Quantum Theory of Three-Dimensional Superresolution Using Rotating-PSF Imagery

    NASA Astrophysics Data System (ADS)

    Prasad, S.; Yu, Z.

    The inverse of the quantum Fisher information (QFI) matrix (and extensions thereof) provides the ultimate lower bound on the variance of any unbiased estimation of a parameter from statistical data, whether of intrinsically quantum mechanical or classical character. We calculate the QFI for Poisson-shot-noise-limited imagery using the rotating PSF that can localize and resolve point sources fully in all three dimensions. We also propose an experimental approach based on the use of computer generated hologram and projective measurements to realize the QFI-limited variance for the problem of super-resolving a closely spaced pair of point sources at a highly reduced photon cost. The paper presents a preliminary analysis of quantum-limited three-dimensional (3D) pair optical super-resolution (OSR) problem with potential applications to astronomical imaging and 3D space-debris localization.

  19. Estimation of Cirrus and Stratus Cloud Heights Using Landsat Imagery

    NASA Technical Reports Server (NTRS)

    Inomata, Yasushi; Feind, R. E.; Welch, R. M.

    1996-01-01

    A new method based upon high-spatial-resolution imagery is presented that matches cloud and shadow regions to estimate cirrus and stratus cloud heights. The distance between the cloud and the matching shadow pattern is accomplished using the 2D cross-correlation function from which the cloud height is derived. The distance between the matching cloud-shadow patterns is verified manually. The derived heights also are validated through comparison with a temperature-based retrieval of cloud height. It is also demonstrated that an estimate of cloud thickness can be retrieved if both the sunside and anti-sunside of the cloud-shadow pair are apparent. The technique requires some intepretation to determine the cloud height level retrieved (i.e., the top, base, or mid-level). It is concluded that the method is accurate to within several pixels, equivalent to cloud height variations of about +/- 250 m. The results show that precise placement of the templates is unnecessary, so that the development of a semi-automated procedure is possible. Cloud templates of about 64 pixels on a side or larger produce consistent results. The procedure was repeated for imagery degraded to simulate lower spatial resolutions. The results suggest that spatial resolution of 150-200 m or better is necessary in order to obtain stable cloud height retrievals.

  20. A resolution approach of racemic phenylalanine with aqueous two-phase systems of chiral tropine ionic liquids.

    PubMed

    Wu, Haoran; Yao, Shun; Qian, Guofei; Yao, Tian; Song, Hang

    2015-10-30

    Aqueous two-phase systems (ATPS) based on tropine type chiral ionic liquids and inorganic salt solution were designed and prepared for the enantiomeric separation of racemic phenylalanine. The phase behavior of IL-based ATPS was comprehensive investigated, and phase equilibrium data were correlated by Merchuk equation. Various factors were also systematically investigated for their influence on separation efficiency. Under the appropriate conditions (0.13g/g [C8Tropine]pro, 35mg/g Cu(Ac)2, 20mg/g d,l-phenylalanine, 0.51g/g H2O and 0.30g/g K2HPO4), the enantiomeric excess value of phenylalanine in solid phase (mainly containing l-enantiomer) was 65%. Finally, the interaction mechanism was studied via 1D and 2D NMR. The results indicate that d-enantiomer of phenylalanine interacts more strongly with chiral ILs and Cu(2+) based on the chiral ion-pairs space coordination mechanism, which makes it tend to remain in the top IL-rich phase. By contrast, l-enantiomer is transferred into the solid phase. Above chiral ionic liquids aqueous two-phase systems have demonstrated obvious resolution to racemic phenylalanine and could be promising alterative resolution approach for racemic amino acids in aqueous circumstance. Copyright © 2015. Published by Elsevier B.V.

  1. Preliminary Assessment of Detection Efficiency for the Geostationary Lightning Mapper Using Intercomparisons with Ground-Based Systems

    NASA Technical Reports Server (NTRS)

    Bateman, Monte; Mach, Douglas; Blakeslee, Richard J.; Koshak, William

    2018-01-01

    As part of the calibration/validation (cal/val) effort for the Geostationary Lightning Mapper (GLM) on GOES-16, we need to assess instrument performance (detection efficiency and accuracy). One major effort is to calculate the detection efficiency of GLM by comparing to multiple ground-based systems. These comparisons will be done pair-wise between GLM and each other source. A complication in this process is that the ground-based systems sense different properties of the lightning signal than does GLM (e.g., RF vs. optical). Also, each system has a different time and space resolution and accuracy. Preliminary results indicate that GLM is performing at or above its specification.

  2. Enhanced Isotopic Ratio Outlier Analysis (IROA) Peak Detection and Identification with Ultra-High Resolution GC-Orbitrap/MS: Potential Application for Investigation of Model Organism Metabolomes.

    PubMed

    Qiu, Yunping; Moir, Robyn D; Willis, Ian M; Seethapathy, Suresh; Biniakewitz, Robert C; Kurland, Irwin J

    2018-01-18

    Identifying non-annotated peaks may have a significant impact on the understanding of biological systems. In silico methodologies have focused on ESI LC/MS/MS for identifying non-annotated MS peaks. In this study, we employed in silico methodology to develop an Isotopic Ratio Outlier Analysis (IROA) workflow using enhanced mass spectrometric data acquired with the ultra-high resolution GC-Orbitrap/MS to determine the identity of non-annotated metabolites. The higher resolution of the GC-Orbitrap/MS, together with its wide dynamic range, resulted in more IROA peak pairs detected, and increased reliability of chemical formulae generation (CFG). IROA uses two different 13 C-enriched carbon sources (randomized 95% 12 C and 95% 13 C) to produce mirror image isotopologue pairs, whose mass difference reveals the carbon chain length (n), which aids in the identification of endogenous metabolites. Accurate m/z, n, and derivatization information are obtained from our GC/MS workflow for unknown metabolite identification, and aids in silico methodologies for identifying isomeric and non-annotated metabolites. We were able to mine more mass spectral information using the same Saccharomyces cerevisiae growth protocol (Qiu et al. Anal. Chem 2016) with the ultra-high resolution GC-Orbitrap/MS, using 10% ammonia in methane as the CI reagent gas. We identified 244 IROA peaks pairs, which significantly increased IROA detection capability compared with our previous report (126 IROA peak pairs using a GC-TOF/MS machine). For 55 selected metabolites identified from matched IROA CI and EI spectra, using the GC-Orbitrap/MS vs. GC-TOF/MS, the average mass deviation for GC-Orbitrap/MS was 1.48 ppm, however, the average mass deviation was 32.2 ppm for the GC-TOF/MS machine. In summary, the higher resolution and wider dynamic range of the GC-Orbitrap/MS enabled more accurate CFG, and the coupling of accurate mass GC/MS IROA methodology with in silico fragmentation has great potential in unknown metabolite identification, with applications for characterizing model organism networks.

  3. Cross-calibration of the Terra MODIS, Landsat 7 ETM+ and EO-1 ALI sensors using near-simultaneous surface observation over the Railroad Valley Playa, Nevada, test site

    USGS Publications Warehouse

    Chander, G.; Angal, A.; Choi, T.; Meyer, D.J.; Xiong, X.; Teillet, P.M.

    2007-01-01

    A cross-calibration methodology has been developed using coincident image pairs from the Terra Moderate Resolution Imaging Spectroradiometer (MODIS), the Landsat 7 (L7) Enhanced Thematic Mapper Plus (ETM+) and the Earth Observing EO-1 Advanced Land Imager (ALI) to verify the absolute radiometric calibration accuracy of these sensors with respect to each other. To quantify the effects due to different spectral responses, the Relative Spectral Responses (RSR) of these sensors were studied and compared by developing a set of "figures-of-merit." Seven cloud-free scenes collected over the Railroad Valley Playa, Nevada (RVPN), test site were used to conduct the cross-calibration study. This cross-calibration approach was based on image statistics from near-simultaneous observations made by different satellite sensors. Homogeneous regions of interest (ROI) were selected in the image pairs, and the mean target statistics were converted to absolute units of at-sensor reflectance. Using these reflectances, a set of cross-calibration equations were developed giving a relative gain and bias between the sensor pair.

  4. Effective deep learning training for single-image super-resolution in endomicroscopy exploiting video-registration-based reconstruction.

    PubMed

    Ravì, Daniele; Szczotka, Agnieszka Barbara; Shakir, Dzhoshkun Ismail; Pereira, Stephen P; Vercauteren, Tom

    2018-06-01

    Probe-based confocal laser endomicroscopy (pCLE) is a recent imaging modality that allows performing in vivo optical biopsies. The design of pCLE hardware, and its reliance on an optical fibre bundle, fundamentally limits the image quality with a few tens of thousands fibres, each acting as the equivalent of a single-pixel detector, assembled into a single fibre bundle. Video registration techniques can be used to estimate high-resolution (HR) images by exploiting the temporal information contained in a sequence of low-resolution (LR) images. However, the alignment of LR frames, required for the fusion, is computationally demanding and prone to artefacts. In this work, we propose a novel synthetic data generation approach to train exemplar-based Deep Neural Networks (DNNs). HR pCLE images with enhanced quality are recovered by the models trained on pairs of estimated HR images (generated by the video registration algorithm) and realistic synthetic LR images. Performance of three different state-of-the-art DNNs techniques were analysed on a Smart Atlas database of 8806 images from 238 pCLE video sequences. The results were validated through an extensive image quality assessment that takes into account different quality scores, including a Mean Opinion Score (MOS). Results indicate that the proposed solution produces an effective improvement in the quality of the obtained reconstructed image. The proposed training strategy and associated DNNs allows us to perform convincing super-resolution of pCLE images.

  5. Comparison of GC stationary phases for the separation of fatty acid methyl esters in biodiesel fuels.

    PubMed

    Goding, Julian C; Ragon, Dorisanne Y; O'Connor, Jack B; Boehm, Sarah J; Hupp, Amber M

    2013-07-01

    The fatty acid methyl ester (FAME) content of biodiesel fuels has traditionally been determined using gas chromatography with a polar stationary phase. In this study, a direct comparison of the separation of FAMEs present in various biodiesel samples on three polar stationary phases and one moderately polar stationary phase (with comparable column dimensions) was performed. Retention on each column was based on solubility in and polarity of the phase. Quantitative metrics describing the resolution of important FAME pairs indicate high resolution on all polar columns, yet the best resolution, particularly of geometric isomers, is achieved on the cyanopropyl column. In addition, the separation of four C18 monounsaturated isomers was optimized and the elution order determined on each column. FAME composition of various biodiesel fuel types was determined on each column to illustrate (1) chemical differences in biodiesels produced from different feedstocks and (2) chemical similarities in biodiesels of the same feedstock type produced in different locations and harvest seasons.

  6. Wideband Spectroscopy: The Design and Implementation of a 3 GHz Bandwidth, 8192 Channel, Polyphase Digital Spectrometer

    NASA Technical Reports Server (NTRS)

    Monroe, Ryan M.

    2011-01-01

    A family of state-of-the-art digital Fourier transform spectrometers has been developed, with a combination of high bandwidth and fine resolution unavailable elsewhere. Analog signals consisting of radiation emitted by constituents in planetary atmospheres or galactic sources are downconverted and subsequently digitized by a pair of interleaved Analog-to-Digital Converters, (ADC). This 6 Gsps (giga-sample per second) digital representation of the analog signal is then processed through an FPGA-based streaming Fast Fourier Transform (FFT), the key development described below. Digital spectrometers have many advantages over previously used analog spectrometers, especially in terms of accuracy and resolution, both of which are particularly important for the type of scientific questions to be addressed with next-generation radiometers. the implementation, results and underlying math for this spectrometer, as well as, potential for future extension to even higher bandwidth, resolution and channel orthogonality, needed to support proposed future advanced atmospheric science and radioastronomy, are discussed.

  7. Wideband Spectroscopy: The Design and Implementation of a 3 GHz, 2048 Channel Digital Spectrometer

    NASA Technical Reports Server (NTRS)

    Monroe, Ryan M.

    2011-01-01

    A state-of-the-art digital Fourier Transform spectrometer has been developed, with a combination of high bandwidth and fine resolution unavailable elsewhere. Analog signals consisting of radiation emitted by constituents in planetary atmospheres or galactic sources are downconverted and subsequently digitized by a pair of interleaved Analog-to-Digital Converters (ADC). This 6 Gsps (giga sample per second) digital representation of the analog signal is then processed through an FPGA-based streaming Fast Fourier Transform (FFT), the key development described below. Digital spectrometers have many advantages over previously used analog spectrometers, especially in terms of accuracy and resolution, both of which are particularly important for the type of scientific questions to be addressed with next-generation radiometers. The implementation, results and underlying math for this spectrometer, as well as potential for future extension to even higher bandwidth, resolution and channel orthogonality, needed to support proposed future advanced atmospheric science and radioastronomy, are discussed.

  8. An efficient multi-resolution GA approach to dental image alignment

    NASA Astrophysics Data System (ADS)

    Nassar, Diaa Eldin; Ogirala, Mythili; Adjeroh, Donald; Ammar, Hany

    2006-02-01

    Automating the process of postmortem identification of individuals using dental records is receiving an increased attention in forensic science, especially with the large volume of victims encountered in mass disasters. Dental radiograph alignment is a key step required for automating the dental identification process. In this paper, we address the problem of dental radiograph alignment using a Multi-Resolution Genetic Algorithm (MR-GA) approach. We use location and orientation information of edge points as features; we assume that affine transformations suffice to restore geometric discrepancies between two images of a tooth, we efficiently search the 6D space of affine parameters using GA progressively across multi-resolution image versions, and we use a Hausdorff distance measure to compute the similarity between a reference tooth and a query tooth subject to a possible alignment transform. Testing results based on 52 teeth-pair images suggest that our algorithm converges to reasonable solutions in more than 85% of the test cases, with most of the error in the remaining cases due to excessive misalignments.

  9. High-resolution in-situ thermal imaging of microbial mats at El Tatio Geyser, Chile shows coupling between community color and temperature

    NASA Astrophysics Data System (ADS)

    Dunckel, Anne E.; Cardenas, M. Bayani; Sawyer, Audrey H.; Bennett, Philip C.

    2009-12-01

    Microbial mats have spatially heterogeneous structured communities that manifest visually through vibrant color zonation often associated with environmental gradients. We report the first use of high-resolution thermal infrared imaging to map temperature at four hot springs within the El Tatio Geyser Field, Chile. Thermal images with millimeter resolution show drastic variability and pronounced patterning in temperature, with changes on the order of 30°C within a square decimeter. Paired temperature and visual images show that zones with specific coloration occur within distinct temperature ranges. Unlike previous studies where maximum, minimum, and optimal temperatures for microorganisms are based on isothermally-controlled laboratory cultures, thermal imaging allows for mapping thousands of temperature values in a natural setting. This allows for efficiently constraining natural temperature bounds for visually distinct mat zones. This approach expands current understanding of thermophilic microbial communities and opens doors for detailed analysis of biophysical controls on microbial ecology.

  10. Knowledge-based iterative model reconstruction: comparative image quality and radiation dose with a pediatric computed tomography phantom.

    PubMed

    Ryu, Young Jin; Choi, Young Hun; Cheon, Jung-Eun; Ha, Seongmin; Kim, Woo Sun; Kim, In-One

    2016-03-01

    CT of pediatric phantoms can provide useful guidance to the optimization of knowledge-based iterative reconstruction CT. To compare radiation dose and image quality of CT images obtained at different radiation doses reconstructed with knowledge-based iterative reconstruction, hybrid iterative reconstruction and filtered back-projection. We scanned a 5-year anthropomorphic phantom at seven levels of radiation. We then reconstructed CT data with knowledge-based iterative reconstruction (iterative model reconstruction [IMR] levels 1, 2 and 3; Philips Healthcare, Andover, MA), hybrid iterative reconstruction (iDose(4), levels 3 and 7; Philips Healthcare, Andover, MA) and filtered back-projection. The noise, signal-to-noise ratio and contrast-to-noise ratio were calculated. We evaluated low-contrast resolutions and detectability by low-contrast targets and subjective and objective spatial resolutions by the line pairs and wire. With radiation at 100 peak kVp and 100 mAs (3.64 mSv), the relative doses ranged from 5% (0.19 mSv) to 150% (5.46 mSv). Lower noise and higher signal-to-noise, contrast-to-noise and objective spatial resolution were generally achieved in ascending order of filtered back-projection, iDose(4) levels 3 and 7, and IMR levels 1, 2 and 3, at all radiation dose levels. Compared with filtered back-projection at 100% dose, similar noise levels were obtained on IMR level 2 images at 24% dose and iDose(4) level 3 images at 50% dose, respectively. Regarding low-contrast resolution, low-contrast detectability and objective spatial resolution, IMR level 2 images at 24% dose showed comparable image quality with filtered back-projection at 100% dose. Subjective spatial resolution was not greatly affected by reconstruction algorithm. Reduced-dose IMR obtained at 0.92 mSv (24%) showed similar image quality to routine-dose filtered back-projection obtained at 3.64 mSv (100%), and half-dose iDose(4) obtained at 1.81 mSv.

  11. WebGIVI: a web-based gene enrichment analysis and visualization tool.

    PubMed

    Sun, Liang; Zhu, Yongnan; Mahmood, A S M Ashique; Tudor, Catalina O; Ren, Jia; Vijay-Shanker, K; Chen, Jian; Schmidt, Carl J

    2017-05-04

    A major challenge of high throughput transcriptome studies is presenting the data to researchers in an interpretable format. In many cases, the outputs of such studies are gene lists which are then examined for enriched biological concepts. One approach to help the researcher interpret large gene datasets is to associate genes and informative terms (iTerm) that are obtained from the biomedical literature using the eGIFT text-mining system. However, examining large lists of iTerm and gene pairs is a daunting task. We have developed WebGIVI, an interactive web-based visualization tool ( http://raven.anr.udel.edu/webgivi/ ) to explore gene:iTerm pairs. WebGIVI was built via Cytoscape and Data Driven Document JavaScript libraries and can be used to relate genes to iTerms and then visualize gene and iTerm pairs. WebGIVI can accept a gene list that is used to retrieve the gene symbols and corresponding iTerm list. This list can be submitted to visualize the gene iTerm pairs using two distinct methods: a Concept Map or a Cytoscape Network Map. In addition, WebGIVI also supports uploading and visualization of any two-column tab separated data. WebGIVI provides an interactive and integrated network graph of gene and iTerms that allows filtering, sorting, and grouping, which can aid biologists in developing hypothesis based on the input gene lists. In addition, WebGIVI can visualize hundreds of nodes and generate a high-resolution image that is important for most of research publications. The source code can be freely downloaded at https://github.com/sunliang3361/WebGIVI . The WebGIVI tutorial is available at http://raven.anr.udel.edu/webgivi/tutorial.php .

  12. A system for extracting 3-dimensional measurements from a stereo pair of TV cameras

    NASA Technical Reports Server (NTRS)

    Yakimovsky, Y.; Cunningham, R.

    1976-01-01

    Obtaining accurate three-dimensional (3-D) measurement from a stereo pair of TV cameras is a task requiring camera modeling, calibration, and the matching of the two images of a real 3-D point on the two TV pictures. A system which models and calibrates the cameras and pairs the two images of a real-world point in the two pictures, either manually or automatically, was implemented. This system is operating and provides three-dimensional measurements resolution of + or - mm at distances of about 2 m.

  13. Modeling of light distribution in the brain for topographical imaging

    NASA Astrophysics Data System (ADS)

    Okada, Eiji; Hayashi, Toshiyuki; Kawaguchi, Hiroshi

    2004-07-01

    Multi-channel optical imaging system can obtain a topographical distribution of the activated region in the brain cortex by a simple mapping algorithm. Near-infrared light is strongly scattered in the head and the volume of tissue that contributes to the change in the optical signal detected with source-detector pair on the head surface is broadly distributed in the brain. This scattering effect results in poor resolution and contrast in the topographic image of the brain activity. We report theoretical investigations on the spatial resolution of the topographic imaging of the brain activity. The head model for the theoretical study consists of five layers that imitate the scalp, skull, subarachnoid space, gray matter and white matter. The light propagation in the head model is predicted by Monte Carlo simulation to obtain the spatial sensitivity profile for a source-detector pair. The source-detector pairs are one dimensionally arranged on the surface of the model and the distance between the adjoining source-detector pairs are varied from 4 mm to 32 mm. The change in detected intensity caused by the absorption change is obtained by Monte Carlo simulation. The position of absorption change is reconstructed by the conventional mapping algorithm and the reconstruction algorithm using the spatial sensitivity profiles. We discuss the effective interval between the source-detector pairs and the choice of reconstruction algorithms to improve the topographic images of brain activity.

  14. The Effect of Illumination on Stereo DTM Quality: Simulations in Support of Europa Exploration

    NASA Astrophysics Data System (ADS)

    Kirk, R. L.; Howington-Kraus, E.; Hare, T. M.; Jorda, L.

    2016-06-01

    We have investigated how the quality of stereoscopically measured topography degrades with varying illumination, in particular the ranges of incidence angles and illumination differences over which useful digital topographic models (DTMs) can be recovered. Our approach is to make high-fidelity simulated image pairs of known topography and compare DTMs from stereoanalysis of these images with the input data. Well-known rules of thumb for horizontal resolution (>3-5 pixels) and matching precision (~0.2-0.3 pixels) are generally confirmed, but the best achievable resolution at high incidence angles is ~15 pixels, probably as a result of smoothing internal to the matching algorithm. Single-pass stereo imaging of Europa is likely to yield DTMs of consistent (optimal) quality for all incidence angles ≤85°, and certainly for incidence angles between 40° and 85°. Simulations with pairs of images in which the illumination is not consistent support the utility of shadow tip distance (STD) as a measure of illumination difference, but also suggest new and simpler criteria for evaluating the suitability of stereopairs based on illumination geometry. Our study was motivated by the needs of a mission to Europa, but the approach and (to first order) the results described here are relevant to a wide range of planetary investigations.

  15. A multimodel intercomparison of resolution effects on precipitation: simulations and theory

    NASA Astrophysics Data System (ADS)

    Rauscher, Sara A.; O'Brien, Travis A.; Piani, Claudio; Coppola, Erika; Giorgi, Filippo; Collins, William D.; Lawston, Patricia M.

    2016-10-01

    An ensemble of six pairs of RCM experiments performed at 25 and 50 km for the period 1961-2000 over a large European domain is examined in order to evaluate the effects of resolution on the simulation of daily precipitation statistics. Application of the non-parametric two-sample Kolmorgorov-Smirnov test, which tests for differences in the location and shape of the probability distributions of two samples, shows that the distribution of daily precipitation differs between the pairs of simulations over most land areas in both summer and winter, with the strongest signal over southern Europe. Two-dimensional histograms reveal that precipitation intensity increases with resolution over almost the entire domain in both winter and summer. In addition, the 25 km simulations have more dry days than the 50 km simulations. The increase in dry days with resolution is indicative of an improvement in model performance at higher resolution, while the more intense precipitation exceeds observed values. The systematic increase in precipitation extremes with resolution across all models suggests that this response is fundamental to model formulation. Simple theoretical arguments suggest that fluid continuity, combined with the emergent scaling properties of the horizontal wind field, results in an increase in resolved vertical transport as grid spacing decreases. This increase in resolution-dependent vertical mass flux then drives an intensification of convergence and resolvable-scale precipitation as grid spacing decreases. This theoretical result could help explain the increasingly, and often anomalously, large stratiform contribution to total rainfall observed with increasing resolution in many regional and global models.

  16. High-Resolution Melting (HRM) of the Cytochrome B Gene: A Powerful Approach to Identify Blood-Meal Sources in Chagas Disease Vectors

    PubMed Central

    Peña, Victor H.; Fernández, Geysson J.; Gómez-Palacio, Andrés M.; Mejía-Jaramillo, Ana M.; Cantillo, Omar; Triana-Chávez, Omar

    2012-01-01

    Methods to determine blood-meal sources of hematophagous Triatominae bugs (Chagas disease vectors) are serological or based on PCR employing species-specific primers or heteroduplex analysis, but these are expensive, inaccurate, or problematic when the insect has fed on more than one species. To solve those problems, we developed a technique based on HRM analysis of the mitochondrial gene cytochrome B (Cyt b). This technique recognized 14 species involved in several ecoepidemiological cycles of the transmission of Trypanosoma cruzi and it was suitable with DNA extracted from intestinal content and feces 30 days after feeding, revealing a resolution power that can display mixed feedings. Field samples were analyzed showing blood meal sources corresponding to domestic, peridomiciliary and sylvatic cycles. The technique only requires a single pair of primers that amplify the Cyt b gene in vertebrates and no other standardization, making it quick, easy, relatively inexpensive, and highly accurate. PMID:22389739

  17. The simple perfection of quantum correlation in human vision.

    PubMed

    Bouman, Maarten A

    2006-01-01

    A theory is presented that specifies the amount of light that is needed for the perception of any stimulus that is defined in space, time and color. For detection and discrimination mechanistic neural elements with deterministic procedures exist. Twin pairs of red and green cones are ordered in three sets along clockwise and counter clockwise revolving spirals and along circles around the center of the fovea. In the rod-free fovea the red pairs are ordered along the spirals and the green along the circles. Each cone is accompanied by--dependent on retinal eccentricity--up to 100 satellite rods. For the retinal signal processing such a receptor group constitutes a space-quantum in analogy with time-quanta of about 0.04 s. In the peripheral retina the red and green twin pairs of space-quanta are roughly ordered along and at random distributed over the spirals and circles. Over each time-quantum, the cone and rods of a space-quantum sum their responses in a common nerve circuit of the luminosity channel. The summation's results from twin pairs of the same set of space-quanta are correlated by two-fold spatio-temporal coincidence mechanisms in the retina. Their outcome signals the perception of light, movement and edge. In the fused binocular visual field the movement and edge signals of the three sets from both eyes perfectly join vectorially together, provided the responding pairs of space-quanta are binocularly in perfect register as they normally are. The receptor's Weber gain control makes the receptor an all-or-none-system. The space-quantum's De Vries gain control makes its sensitivity equal to the average of the poisson fluctuations in quantum absorption per time-quantum. The controls are based on, respectively, arithmetically feed forward and backward inhibitive nerve mechanisms. The thermal noise of the photo-pigment resets the controls. The response to the second quantum absorption in a time-quantum in the individual rod, red or green cone has accession to the white, red or green nerve color circuit, respectively, and produces there a corresponding color signal. Already a single absorption in a blue cone is for a blue signal. In the retina, for the generation of yellow signals, the color circuits of individual red and green cones of each mixed entwined triple of red and green twin pairs of space-quanta are cross-connected through a nerve opponent color circuit. In the lateral geniculate nucleus in groups of seven neighboring triples, through two nerve opponent color circuits that are common for the two eyes together, the red and green signals as well as the yellow and blue mutually annihilate each other's color. White signals remain. In anomalous trichromacy, the space-quanta of some pairs have different cones or in one of them the cone is missing. In dichromacy, all pairs have different cones or one type of cones is missing. For perceptive resolution the periodic scanning of the retinal image by the eye tremor in synchrony with the time-quanta, overrules the limit of optical resolution as set by diffraction in the eye optics. Dependent on pupil diameter the scanning contributes up to a factor of about 30 to resolution. The action potentials of the Purkinje cells in the myocardium generate the time-quanta of the central nervous system as well as the mechanical scanning of the retinal image through the synchronic periodic variation of the tonus in the eye muscles.

  18. Performance and effects of land cover type on synthetic surface reflectance data and NDVI estimates for assessment and monitoring of semi-arid rangeland

    USGS Publications Warehouse

    Olexa, Edward M.; Lawrence, Rick L

    2014-01-01

    Federal land management agencies provide stewardship over much of the rangelands in the arid andsemi-arid western United States, but they often lack data of the proper spatiotemporal resolution andextent needed to assess range conditions and monitor trends. Recent advances in the blending of com-plementary, remotely sensed data could provide public lands managers with the needed information.We applied the Spatial and Temporal Adaptive Reflectance Fusion Model (STARFM) to five Landsat TMand concurrent Terra MODIS scenes, and used pixel-based regression and difference image analyses toevaluate the quality of synthetic reflectance and NDVI products associated with semi-arid rangeland. Pre-dicted red reflectance data consistently demonstrated higher accuracy, less bias, and stronger correlationwith observed data than did analogous near-infrared (NIR) data. The accuracy of both bands tended todecline as the lag between base and prediction dates increased; however, mean absolute errors (MAE)were typically ≤10%. The quality of area-wide NDVI estimates was less consistent than either spectra lband, although the MAE of estimates predicted using early season base pairs were ≤10% throughout the growing season. Correlation between known and predicted NDVI values and agreement with the 1:1regression line tended to decline as the prediction lag increased. Further analyses of NDVI predictions,based on a 22 June base pair and stratified by land cover/land use (LCLU), revealed accurate estimates through the growing season; however, inter-class performance varied. This work demonstrates the successful application of the STARFM algorithm to semi-arid rangeland; however, we encourage evaluation of STARFM’s performance on a per product basis, stratified by LCLU, with attention given to the influence of base pair selection and the impact of the time lag.

  19. Nucleic acid binding drugs. Part XIII. Molecular motion in a drug-nucleic acid model system: thermal motion analysis of a proflavine-dinucleoside crystal structure.

    PubMed Central

    Aggarwal, A K; Neidle, S

    1985-01-01

    The high-resolution crystal structure of the intercalation complex between proflavine and cytidylyl-3',5'-guanosine (CpG) has been studied by thermalmotion analysis. This has provided information on the translational and librational motions of individual groups in the complex. Many of these motions are similar to, though of larger magnitude than in uncomplexed dinucleosides. Pronounced librational effects were observed along the base pairs and in the plane of the drug chromophore. PMID:4034394

  20. [High-resolution GTG-banding and nucleolar organizer regions of chromosomes of two vole species: Microtus rossiaemeridonionalis and M. transcaspicus (Rodentia, Arvicolidae)].

    PubMed

    Mazurok, N A; Rubtsova, N V; Isaenko, A A; Nesterova, T B; Meĭer, M N; Zakiian, S M

    1998-08-01

    With the use of the GTG-banding of prometaphase chromosomes, 503 and 402 segments were revealed in haploid chromosome sets of voles Microtus rossiaemeridionalis and M. transcaspicus, respectively. Based on a detailed study of chromosomes at different condensation levels, idiograms of M. rossiaemeridionalis and M. transcaspicus chromosomes were constructed. Sequential Ag-staining and GTG-banding allowed nucleolar organizer regions (NORs) to be localized in 16 and 11 chromosome pairs of M. rossiaemeridionalis and M. transcaspicus, respectively.

  1. Bacterial community structure analysis of sediment in the Sagami River, Japan using a rapid approach based on two-dimensional DNA gel electrophoresis mapping with selective primer pairs.

    PubMed

    Liu, Guo-hua; Rajendran, Narasimmalu; Amemiya, Takashi; Itoh, Kiminori

    2011-11-01

    A rapid approach based on two-dimensional DNA gel electrophroesis (2-DGE) mapping with selective primer pairs was employed to analyze bacterial community structure in sediments from upstream, midstream and downstream of Sagami River in Japan. The 2-DGE maps indicated that Alpha- and Delta-proteobacteria were major bacterial populations in the upstream and midstream sediments. Further bacterial community structure analysis showed that richness proportion of Alpha- and Delta-proteobacterial groups reflected a trend toward decreasing from the upstream to downstream sediments. The biomass proportion of bacterial populations in the midstream sediment showed a significantly difference from that in the other sediments, suggesting that there may be an environmental pressure on the midstream bacterial community. Lorenz curves, together with Gini coefficients were successfully applied to the 2-DGE mapping data for resolving evenness of bacterial populations, and showed that the plotted curve from high-resolution 2-DGE mapping became less linear and more an exponential function than that of the 1-DGE methods such as chain length analysis and denaturing gradient gel electrophoresis, suggesting that the 2-DGE mapping may achieve a more detailed evaluation of bacterial community. In conclusion, the 2-DGE mapping combined with the selective primer pairs enables bacterial community structure analysis in river sediment and thus it can also monitor sediment pollution based on the change of bacterial community structure.

  2. Phase-driven collapse of the Cooper condensate in a nanosized superconductor

    NASA Astrophysics Data System (ADS)

    Ronzani, Alberto; D'Ambrosio, Sophie; Virtanen, Pauli; Giazotto, Francesco; Altimiras, Carles

    2017-12-01

    Superconductivity can be understood in terms of a phase transition from an uncorrelated electron gas to a condensate of Cooper pairs in which the relative phases of the constituent electrons are coherent over macroscopic length scales. The degree of correlation is quantified by a complex-valued order parameter, whose amplitude is proportional to the strength of the pairing potential in the condensate. Supercurrent-carrying states are associated with nonzero values of the spatial gradient of the phase. The pairing potential and several physical observables of the Cooper condensate can be manipulated by means of temperature, current bias, dishomogeneities in the chemical composition, or application of a magnetic field. Here we show evidence of complete suppression of the energy gap in the local density of quasiparticle states (DOS) of a superconducting nanowire upon establishing a phase difference equal to π over a length scale comparable to the superconducting coherence length. These observations are consistent with a complete collapse of the pairing potential in the center of the wire, in accordance with theoretical modeling based on the quasiclassical theory of superconductivity in diffusive systems. Our spectroscopic data, fully exploring the phase-biased states of the condensate, highlight the profound effect that extreme phase gradients exert on the amplitude of the pairing potential. Moreover, the sharp magnetic response (up to 27 mV/Φ0) observed near the onset of the superconducting gap collapse regime is exploited to realize magnetic flux detectors with noise-equivalent resolution as low as 260 n Φ0/√{Hz} .

  3. Single-shot spiral imaging at 7 T.

    PubMed

    Engel, Maria; Kasper, Lars; Barmet, Christoph; Schmid, Thomas; Vionnet, Laetitia; Wilm, Bertram; Pruessmann, Klaas P

    2018-03-25

    The purpose of this work is to explore the feasibility and performance of single-shot spiral MRI at 7 T, using an expanded signal model for reconstruction. Gradient-echo brain imaging is performed on a 7 T system using high-resolution single-shot spiral readouts and half-shot spirals that perform dual-image acquisition after a single excitation. Image reconstruction is based on an expanded signal model including the encoding effects of coil sensitivity, static off-resonance, and magnetic field dynamics. The latter are recorded concurrently with image acquisition, using NMR field probes. The resulting image resolution is assessed by point spread function analysis. Single-shot spiral imaging is achieved at a nominal resolution of 0.8 mm, using spiral-out readouts of 53-ms duration. High depiction fidelity is achieved without conspicuous blurring or distortion. Effective resolutions are assessed as 0.8, 0.94, and 0.98 mm in CSF, gray matter and white matter, respectively. High image quality is also achieved with half-shot acquisition yielding image pairs at 1.5-mm resolution. Use of an expanded signal model enables single-shot spiral imaging at 7 T with unprecedented image quality. Single-shot and half-shot spiral readouts deploy the sensitivity benefit of high field for rapid high-resolution imaging, particularly for functional MRI and arterial spin labeling. © 2018 International Society for Magnetic Resonance in Medicine.

  4. Quantitative differential phase contrast imaging at high resolution with radially asymmetric illumination.

    PubMed

    Lin, Yu-Zi; Huang, Kuang-Yuh; Luo, Yuan

    2018-06-15

    Half-circle illumination-based differential phase contrast (DPC) microscopy has been utilized to recover phase images through a pair of images along multiple axes. Recently, the half-circle based DPC using 12-axis measurements significantly provides a circularly symmetric phase transfer function to improve accuracy for more stable phase recovery. Instead of using half-circle-based DPC, we propose a new scheme of DPC under radially asymmetric illumination to achieve circularly symmetric phase transfer function and enhance the accuracy of phase recovery in a more stable and efficient fashion. We present the design, implementation, and experimental image data demonstrating the ability of our method to obtain quantitative phase images of microspheres, as well as live fibroblast cell samples.

  5. Reducible dictionaries for single image super-resolution based on patch matching and mean shifting

    NASA Astrophysics Data System (ADS)

    Rasti, Pejman; Nasrollahi, Kamal; Orlova, Olga; Tamberg, Gert; Moeslund, Thomas B.; Anbarjafari, Gholamreza

    2017-03-01

    A single-image super-resolution (SR) method is proposed. The proposed method uses a generated dictionary from pairs of high resolution (HR) images and their corresponding low resolution (LR) representations. First, HR images and the corresponding LR ones are divided into patches of HR and LR, respectively, and then they are collected into separate dictionaries. Afterward, when performing SR, the distance between every patch of the input LR image and those of available LR patches in the LR dictionary is calculated. The minimum distance between the input LR patch and those in the LR dictionary is taken, and its counterpart from the HR dictionary is passed through an illumination enhancement process. By this technique, the noticeable change of illumination between neighbor patches in the super-resolved image is significantly reduced. The enhanced HR patch represents the HR patch of the super-resolved image. Finally, to remove the blocking effect caused by merging the patches, an average of the obtained HR image and the interpolated image obtained using bicubic interpolation is calculated. The quantitative and qualitative analyses show the superiority of the proposed technique over the conventional and state-of-art methods.

  6. A tale of two sequences: microRNA-target chimeric reads.

    PubMed

    Broughton, James P; Pasquinelli, Amy E

    2016-04-04

    In animals, a functional interaction between a microRNA (miRNA) and its target RNA requires only partial base pairing. The limited number of base pair interactions required for miRNA targeting provides miRNAs with broad regulatory potential and also makes target prediction challenging. Computational approaches to target prediction have focused on identifying miRNA target sites based on known sequence features that are important for canonical targeting and may miss non-canonical targets. Current state-of-the-art experimental approaches, such as CLIP-seq (cross-linking immunoprecipitation with sequencing), PAR-CLIP (photoactivatable-ribonucleoside-enhanced CLIP), and iCLIP (individual-nucleotide resolution CLIP), require inference of which miRNA is bound at each site. Recently, the development of methods to ligate miRNAs to their target RNAs during the preparation of sequencing libraries has provided a new tool for the identification of miRNA target sites. The chimeric, or hybrid, miRNA-target reads that are produced by these methods unambiguously identify the miRNA bound at a specific target site. The information provided by these chimeric reads has revealed extensive non-canonical interactions between miRNAs and their target mRNAs, and identified many novel interactions between miRNAs and noncoding RNAs.

  7. A metallo-DNA nanowire with uninterrupted one-dimensional silver array

    NASA Astrophysics Data System (ADS)

    Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Hattori, Yoshikazu; Saneyoshi, Hisao; Ono, Akira; Tanaka, Yoshiyuki

    2017-10-01

    The double-helix structure of DNA, in which complementary strands reversibly hybridize to each other, not only explains how genetic information is stored and replicated, but also has proved very attractive for the development of nanomaterials. The discovery of metal-mediated base pairs has prompted the generation of short metal-DNA hybrid duplexes by a bottom-up approach. Here we describe a metallo-DNA nanowire—whose structure was solved by high-resolution X-ray crystallography—that consists of dodecamer duplexes held together by four different metal-mediated base pairs (the previously observed C-Ag-C, as well as G-Ag-G, G-Ag-C and T-Ag-T) and linked to each other through G overhangs involved in interduplex G-Ag-G. The resulting hybrid nanowires are 2 nm wide with a length of the order of micrometres to millimetres, and hold the silver ions in uninterrupted one-dimensional arrays along the DNA helical axis. The hybrid nanowires are further assembled into three-dimensional lattices by interactions between adenine residues, fully bulged out of the double helix.

  8. Identification and Differentiation of Monilinia Species Causing Brown Rot of Pome and Stone Fruit using High-Resolution Melting (HRM) Analysis.

    PubMed

    Papavasileiou, Antonios; Madesis, Panagiotis B; Karaoglanidis, George S

    2016-09-01

    Brown rot is a devastating disease of stone fruit caused by Monilinia spp. Among these species, Monilinia fructicola is a quarantine pathogen in Europe but has recently been detected in several European countries. Identification of brown rot agents relies on morphological differences or use of molecular methods requiring fungal isolation. The current study was initiated to develop and validate a high-resolution melting (HRM) method for the identification of the Monilinia spp. and for the detection of M. fructicola among other brown rot pathogens. Based on the sequence of the cytb intron from M. laxa, M. fructicola, M. fructigena, M. mumecola, M. linhartiana, and M. yunnanensis isolates originating from several countries, a pair of universal primers for species identification and a pair of primers specific to M. fructicola were designed. The specificity of the primers was verified to ensure against cross-reaction with other fungal species. The melting curve analysis using the universal primers generated six different HRM curve profiles, each one specific for each species. Τhe HRM analysis primers specific to M. fructicola amplified a 120-bp region with a distinct melt profile corresponding to the presence of M. fructicola, regardless of the presence of other species. HRM analysis can be a useful tool for rapid identification and differentiation of the six Monilinia spp. using a single primer pair. This novel assay has the potential for simultaneous identification and differentiation of the closely related Monilinia spp. as well as for the differentiation of M. fructicola from other common pathogens or saprophytes that may occur on the diseased fruit.

  9. A dynamic structural model of expanded RNA CAG repeats: A refined X-ray structure and computational investigations using molecular dynamics and umbrella sampling simulations

    PubMed Central

    Yildirim, Ilyas; Park, Hajeung; Disney, Matthew D.; Schatz, George C.

    2013-01-01

    One class of functionally important RNA is repeating transcripts that cause disease through various mechanisms. For example, expanded r(CAG) repeats can cause Huntington’s and other disease through translation of toxic proteins. Herein, crystal structure of r[5ʹUUGGGC(CAG)3GUCC]2, a model of CAG expanded transcripts, refined to 1.65 Å resolution is disclosed that show both anti-anti and syn-anti orientations for 1×1 nucleotide AA internal loops. Molecular dynamics (MD) simulations using Amber force field in explicit solvent were run for over 500 ns on model systems r(5ʹGCGCAGCGC)2 (MS1) and r(5ʹCCGCAGCGG)2 (MS2). In these MD simulations, both anti-anti and syn-anti AA base pairs appear to be stable. While anti-anti AA base pairs were dynamic and sampled multiple anti-anti conformations, no syn-anti↔anti-anti transformations were observed. Umbrella sampling simulations were run on MS2, and a 2D free energy surface was created to extract transformation pathways. In addition, over 800 ns explicit solvent MD simulation was run on r[5ʹGGGC(CAG)3GUCC]2, which closely represents the refined crystal structure. One of the terminal AA base pairs (syn-anti conformation), transformed to anti-anti conformation. The pathway followed in this transformation was the one predicted by umbrella sampling simulations. Further analysis showed a binding pocket near AA base pairs in syn-anti conformations. Computational results combined with the refined crystal structure show that global minimum conformation of 1×1 nucleotide AA internal loops in r(CAG) repeats is anti-anti but can adopt syn-anti depending on the environment. These results are important to understand RNA dynamic-function relationships and develop small molecules that target RNA dynamic ensembles. PMID:23441937

  10. Sequence specificity of mutagen-nucleic acid complexes in solution: intercalation and mutagen-base pair overlap geometries for proflavine binding to dC-dC-dG-dG and dG-dG-dC-dC self-complementary duplexes.

    PubMed

    Patel, D J; Canuel, L L

    1977-07-01

    The complex formed between the mutagen proflavine and the dC-dC-dG-dG and dG-dG-dC-dC self-complementary tetranucleotide duplexes has been monitored by proton high resolution nuclear magnetic resonance spectroscopy in 0.1 M phosphate solution at high nucleotide/drug ratios. The large upfield shifts (0.5 to 0.85 ppm) observed at all the proflavine ring nonexchangeable protons on complex formation are consistent with intercalation of the mutagen between base pairs of the tetranucleotide duplex. We have proposed an approximate overlap geometry between the proflavine ring and nearest neighbor base pairs at the intercalation site from a comparison between experimental shifts and those calculated for various stacking orientations. We have compared the binding of actinomycin D, propidium diiodide, and proflavine to self-complementary tetranucleotide sequences dC-dC-dG-dG and dG-dG-dC-dC by UV absorbance changes in the drug bands between 400 and 500 nm. Actinomycin D exhibits a pronounced specificity for sequences with dG-dC sites (dG-dG-dC-dC), while propidium diiodide and proflavine exhibit a specificity for sequences with dC-dG sites (dC-dC-dG-dG). Actinomycin D binds more strongly than propidium diiodide and proflavine to dC-dG-dC-dG (contains dC-dG and dG-dC binding sites), indicative of the additional stabilization from hydrogen bonding and hydrophobic interactions between the pentapeptide lactone rings of actinomycin D and the base pair edges and sugar-phosphate backbone of the tetranucleotide duplex.

  11. Sequence specificity of mutagen-nucleic acid complexes in solution: Intercalation and mutagen-base pair overlap geometries for proflavine binding to dC-dC-dG-dG and dG-dG-dC-dC self-complementary duplexes

    PubMed Central

    Patel, Dinshaw J.; Canuel, Lita L.

    1977-01-01

    The complex formed between the mutagen proflavine and the dC-dC-dG-dG and dG-dG-dC-dC self-complementary tetranucleotide duplexes has been monitored by proton high resolution nuclear magnetic resonance spectroscopy in 0.1 M phosphate solution at high nucleotide/drug ratios. The large upfield shifts (0.5 to 0.85 ppm) observed at all the proflavine ring nonexchangeable protons on complex formation are consistent with intercalation of the mutagen between base pairs of the tetranucleotide duplex. We have proposed an approximate overlap geometry between the proflavine ring and nearest neighbor base pairs at the intercalation site from a comparison between experimental shifts and those calculated for various stacking orientations. We have compared the binding of actinomycin D, propidium diiodide, and proflavine to self-complementary tetranucleotide sequences dC-dC-dG-dG and dG-dG-dC-dC by UV absorbance changes in the drug bands between 400 and 500 nm. Actinomycin D exhibits a pronounced specificity for sequences with dG-dC sites (dG-dG-dC-dC), while propidium diiodide and proflavine exhibit a specificity for sequences with dC-dG sites (dC-dC-dG-dG). Actinomycin D binds more strongly than propidium diiodide and proflavine to dC-dG-dC-dG (contains dC-dG and dG-dC binding sites), indicative of the additional stabilization from hydrogen bonding and hydrophobic interactions between the pentapeptide lactone rings of actinomycin D and the base pair edges and sugar-phosphate backbone of the tetranucleotide duplex. PMID:268613

  12. Phylogenetic species identification in Rattus highlights rapid radiation and morphological similarity of New Guinean species.

    PubMed

    Robins, Judith H; Tintinger, Vernon; Aplin, Ken P; Hingston, Melanie; Matisoo-Smith, Elizabeth; Penny, David; Lavery, Shane D

    2014-01-01

    The genus Rattus is highly speciose, the taxonomy is complex, and individuals are often difficult to identify to the species level. Previous studies have demonstrated the usefulness of phylogenetic approaches to identification in Rattus but some species, especially among the endemics of the New Guinean region, showed poor resolution. Possible reasons for this are simple misidentification, incomplete gene lineage sorting, hybridization, and phylogenetically distinct lineages that are unrecognised taxonomically. To assess these explanations we analysed 217 samples, representing nominally 25 Rattus species, collected in New Guinea, Asia, Australia and the Pacific. To reduce misidentification problems we sequenced museum specimens from earlier morphological studies and recently collected tissues from samples with associated voucher specimens. We also reassessed vouchers from previously sequenced specimens. We inferred combined and separate phylogenies from two mitochondrial DNA regions comprising 550 base pair D-loop sequences and both long (655 base pair) and short (150 base pair) cytochrome oxidase I sequences. Our phylogenetic species identification for 17 species was consistent with morphological designations and current taxonomy thus reinforcing the usefulness of this approach. We reduced misidentifications and consequently the number of polyphyletic species in our phylogenies but the New Guinean Rattus clades still exhibited considerable complexity. Only three of our eight New Guinean species were monophyletic. We found good evidence for either incomplete mitochondrial lineage sorting or hybridization between species within two pairs, R. leucopus/R. cf. verecundus and R. steini/R. praetor. Additionally, our results showed that R. praetor, R. niobe and R. verecundus each likely encompass more than one species. Our study clearly points to the need for a revised taxonomy of the rats of New Guinea, based on broader sampling and informed by both morphology and phylogenetics. The remaining taxonomic complexity highlights the recent and rapid radiation of Rattus in the Australo-Papuan region.

  13. Phylogenetic Species Identification in Rattus Highlights Rapid Radiation and Morphological Similarity of New Guinean Species

    PubMed Central

    Robins, Judith H.; Tintinger, Vernon; Aplin, Ken P.; Hingston, Melanie; Matisoo-Smith, Elizabeth; Penny, David; Lavery, Shane D.

    2014-01-01

    The genus Rattus is highly speciose, the taxonomy is complex, and individuals are often difficult to identify to the species level. Previous studies have demonstrated the usefulness of phylogenetic approaches to identification in Rattus but some species, especially among the endemics of the New Guinean region, showed poor resolution. Possible reasons for this are simple misidentification, incomplete gene lineage sorting, hybridization, and phylogenetically distinct lineages that are unrecognised taxonomically. To assess these explanations we analysed 217 samples, representing nominally 25 Rattus species, collected in New Guinea, Asia, Australia and the Pacific. To reduce misidentification problems we sequenced museum specimens from earlier morphological studies and recently collected tissues from samples with associated voucher specimens. We also reassessed vouchers from previously sequenced specimens. We inferred combined and separate phylogenies from two mitochondrial DNA regions comprising 550 base pair D-loop sequences and both long (655 base pair) and short (150 base pair) cytochrome oxidase I sequences. Our phylogenetic species identification for 17 species was consistent with morphological designations and current taxonomy thus reinforcing the usefulness of this approach. We reduced misidentifications and consequently the number of polyphyletic species in our phylogenies but the New Guinean Rattus clades still exhibited considerable complexity. Only three of our eight New Guinean species were monophyletic. We found good evidence for either incomplete mitochondrial lineage sorting or hybridization between species within two pairs, R. leucopus/R. cf. verecundus and R. steini/R. praetor. Additionally, our results showed that R. praetor, R. niobe and R. verecundus each likely encompass more than one species. Our study clearly points to the need for a revised taxonomy of the rats of New Guinea, based on broader sampling and informed by both morphology and phylogenetics. The remaining taxonomic complexity highlights the recent and rapid radiation of Rattus in the Australo-Papuan region. PMID:24865350

  14. A New Sparse Representation Framework for Reconstruction of an Isotropic High Spatial Resolution MR Volume From Orthogonal Anisotropic Resolution Scans.

    PubMed

    Jia, Yuanyuan; Gholipour, Ali; He, Zhongshi; Warfield, Simon K

    2017-05-01

    In magnetic resonance (MR), hardware limitations, scan time constraints, and patient movement often result in the acquisition of anisotropic 3-D MR images with limited spatial resolution in the out-of-plane views. Our goal is to construct an isotropic high-resolution (HR) 3-D MR image through upsampling and fusion of orthogonal anisotropic input scans. We propose a multiframe super-resolution (SR) reconstruction technique based on sparse representation of MR images. Our proposed algorithm exploits the correspondence between the HR slices and the low-resolution (LR) sections of the orthogonal input scans as well as the self-similarity of each input scan to train pairs of overcomplete dictionaries that are used in a sparse-land local model to upsample the input scans. The upsampled images are then combined using wavelet fusion and error backprojection to reconstruct an image. Features are learned from the data and no extra training set is needed. Qualitative and quantitative analyses were conducted to evaluate the proposed algorithm using simulated and clinical MR scans. Experimental results show that the proposed algorithm achieves promising results in terms of peak signal-to-noise ratio, structural similarity image index, intensity profiles, and visualization of small structures obscured in the LR imaging process due to partial volume effects. Our novel SR algorithm outperforms the nonlocal means (NLM) method using self-similarity, NLM method using self-similarity and image prior, self-training dictionary learning-based SR method, averaging of upsampled scans, and the wavelet fusion method. Our SR algorithm can reduce through-plane partial volume artifact by combining multiple orthogonal MR scans, and thus can potentially improve medical image analysis, research, and clinical diagnosis.

  15. Emission line galaxy pairs up to z=1.5 from the WISP survey

    NASA Astrophysics Data System (ADS)

    Teplitz, Harry I.; Dai, Yu Sophia; Malkan, Matthew Arnold; Scarlata, Claudia; Colbert, James W.; Atek, Hakim; Bagley, Micaela B.; Baronchelli, Ivano; Bedregal, Alejandro; Beck, Melanie; Bunker, Andrew; Dominguez, Alberto; Hathi, Nimish P.; Henry, Alaina L.; Mehta, Vihang; Pahl, Anthony; Rafelski, Marc; Ross, Nathaniel; Rutkowski, Michael J.; Siana, Brian D.; WISPs Team

    2016-01-01

    We present a sample of spectroscopically identified emission line galaxy pairs up to z=1.5 from WISPs (WFC3 Infrared Spectroscopic Parallel survey) using high resolution direct and grism images from HST. We searched ~150 fields with a covered area of ~600 arcmin^2, and a comoving volume of > 400 Gpc^3 at z=1-2, and found ~80 very close physical pairs (projected separation Dp < 50 h^{-1}kpc, relative velocity d_v < 500 kms^{-1}), and ~100 close physical pairs (50 < Dp < 100 h^{-1}kpc, d_v < 1000 kms^{-1}) of emission line galaxies, including two dozen triplets and quadruples. In this poster we present the multi-wavelength data, star formation rate (SFR), mass ratio, and study the merger rate evolution with this special galaxy pair sample.

  16. Monitoring of surface deformation in open pit mine using DInSAR time-series: a case study in the N5W iron mine (Carajás, Brazil) using TerraSAR-X data

    NASA Astrophysics Data System (ADS)

    Mura, José C.; Paradella, Waldir R.; Gama, Fabio F.; Santos, Athos R.; Galo, Mauricio; Camargo, Paulo O.; Silva, Arnaldo Q.; Silva, Guilherme G.

    2014-10-01

    We present an investigation of surface deformation using Differential SAR Interferometry (DInSAR) time-series carried out in an active open pit iron mine, the N5W, located in the Carajás Mineral Province (Brazilian Amazon region), using 33 TerraSAR-X (TSX-1) scenes. This mine has presented a historical of instability and surface monitoring measurements over sectors of the mine (pit walls) have been done based on ground based radar. Two complementary approaches were used: the standard DInSAR configuration, as an early warning of the slope instability conditions, and the DInSAR timeseries analysis. In order to decrease the topographic phase error a high resolution DEM was generated based on a stereo GeoEye-1 pair. Despite the fact that a DinSAR contains atmospheric and topographic phase artifacts and noise, it was possible to detect deformation in some interferometric pairs, covering pit benches, road ramps and waste piles. The timeseries analysis was performed using the 31 interferometric pairs, which were selected based on the highest mean coherence of a stack of 107 interferograms, presenting less phase unwrapping errors. The time-series deformation was retrieved by the Least-Squares (LS) solution using an extension of the Singular Value Decomposition (SVD), with a set of additional weighted constrain on the acceleration deformation. The atmospheric phase artifacts were filtered in the space-time domain and the DEM height errors were estimated based on the normal baseline diversity. The DInSAR time-series investigation showed good results for monitoring surface displacement in the N5W mine located in a tropical rainforest environment, providing very useful information about the ground movement for alarm, planning and risk assessment.

  17. Radioembolization and the Dynamic Role of 90Y PET/CT

    PubMed Central

    Pasciak, Alexander S.; Bourgeois, Austin C.; McKinney, J. Mark; Chang, Ted T.; Osborne, Dustin R.; Acuff, Shelley N.; Bradley, Yong C.

    2014-01-01

    Before the advent of tomographic imaging, it was postulated that decay of 90 Y to the 0+ excited state of 90Zr may result in emission of a positron–electron pair. While the branching ratio for pair-production is small (~32 × 10−6), PET has been successfully used to image 90 Y in numerous recent patients and phantom studies. 90 Y PET imaging has been performed on a variety of PET/CT systems, with and without time-of-flight (TOF) and/or resolution recovery capabilities as well as on both bismuth-germanate and lutetium yttrium orthosilicate (LYSO)-based scanners. On all systems, resolution and contrast superior to bremsstrahlung SPECT has been reported. The intrinsic radioactivity present in LYSO-based PET scanners is a potential limitation associated with accurate quantification of 90 Y. However, intrinsic radioactivity has been shown to have a negligible effect at the high activity concentrations common in 90 Y radioembolization. Accurate quantification is possible on a variety of PET scanner models, with or without TOF, although TOF improves accuracy at lower activity concentrations. Quantitative 90 Y PET images can be transformed into 3-dimensional (3D) maps of absorbed dose based on the premise that the 90 Y activity distribution does not change after infusion. This transformation has been accomplished in several ways, although the most common is with the use of 3D dose-point-kernel convolution. From a clinical standpoint, 90 Y PET provides a superior post-infusion evaluation of treatment technical success owing to its improved resolution. Absorbed dose maps generated from quantitative PET data can be used to predict treatment efficacy and manage patient follow-up. For patients who receive multiple treatments, this information can also be used to provide patient-specific treatment-planning for successive therapies, potentially improving response. The broad utilization of 90 Y PET has the potential to provide a wealth of dose–response information, which may lead to development of improved radioembolization treatment-planning models in the future. PMID:24579065

  18. A multimodel intercomparison of resolution effects on precipitation: simulations and theory

    DOE PAGES

    Rauscher, Sara A.; O?Brien, Travis A.; Piani, Claudio; ...

    2016-02-27

    An ensemble of six pairs of RCM experiments performed at 25 and 50 km for the period 1961–2000 over a large European domain is examined in order to evaluate the effects of resolution on the simulation of daily precipitation statistics. Application of the non-parametric two-sample Kolmorgorov–Smirnov test, which tests for differences in the location and shape of the probability distributions of two samples, shows that the distribution of daily precipitation differs between the pairs of simulations over most land areas in both summer and winter, with the strongest signal over southern Europe. Two-dimensional histograms reveal that precipitation intensity increases with resolutionmore » over almost the entire domain in both winter and summer. In addition, the 25 km simulations have more dry days than the 50 km simulations. The increase in dry days with resolution is indicative of an improvement in model performance at higher resolution, while the more intense precipitation exceeds observed values. The systematic increase in precipitation extremes with resolution across all models suggests that this response is fundamental to model formulation. Simple theoretical arguments suggest that fluid continuity, combined with the emergent scaling properties of the horizontal wind field, results in an increase in resolved vertical transport as grid spacing decreases. This increase in resolution-dependent vertical mass flux then drives an intensification of convergence and resolvable-scale precipitation as grid spacing decreases. In conclusion, this theoretical result could help explain the increasingly, and often anomalously, large stratiform contribution to total rainfall observed with increasing resolution in many regional and global models.« less

  19. A Pair Production Telescope for Medium-Energy Gamma-Ray Polarimetry

    NASA Technical Reports Server (NTRS)

    Hunter, Stanley D.; Bloser, Peter F.; Depaola, Gerardo; Dion, Michael P.; DeNolfo, Georgia A.; Hanu, Andrei; Iparraguirre, Marcos; Legere, Jason; Longo, Francesco; McConnell, Mark L.; hide

    2014-01-01

    We describe the science motivation and development of a pair production telescope for medium-energy (approximately 5-200 Mega electron Volts) gamma-ray polarimetry. Our instrument concept, the Advanced Energetic Pair Telescope (AdEPT), takes advantage of the Three-Dimensional Track Imager, a low-density gaseous time projection chamber, to achieve angular resolution within a factor of two of the pair production kinematics limit (approximately 0.6 deg at 70 Mega electron Volts), continuum sensitivity comparable with the Fermi-LAT front detector (is less than 3 x 10(exp -6) Mega electron Volts per square centimeter per second at 70 Mega electron Volts), and minimum detectable polarization less than 10% for a 10 milliCrab source in 10(exp 6) s.

  20. Absolute x-ray energy calibration and monitoring using a diffraction-based method

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hong, Xinguo, E-mail: xhong@bnl.gov; Weidner, Donald J.; Duffy, Thomas S.

    2016-07-27

    In this paper, we report some recent developments of the diffraction-based absolute X-ray energy calibration method. In this calibration method, high spatial resolution of the measured detector offset is essential. To this end, a remotely controlled long-translation motorized stage was employed instead of the less convenient gauge blocks. It is found that the precision of absolute X-ray energy calibration (ΔE/E) is readily achieved down to the level of 10{sup −4} for high-energy monochromatic X-rays (e.g. 80 keV). Examples of applications to pair distribution function (PDF) measurements and energy monitoring for high-energy X-rays are presented.

  1. Neutron resonance spin echo with longitudinal DC fields

    NASA Astrophysics Data System (ADS)

    Krautloher, Maximilian; Kindervater, Jonas; Keller, Thomas; Häußler, Wolfgang

    2016-12-01

    We report on the design, construction, and performance of a neutron resonance spin echo (NRSE) instrument employing radio frequency (RF) spin flippers combining RF fields with DC fields, the latter oriented parallel (longitudinal) to the neutron propagation direction (longitudinal NRSE (LNRSE)). The advantage of the longitudinal configuration is the inherent homogeneity of the effective magnetic path integrals. In the center of the RF coils, the sign of the spin precession phase is inverted by a π flip of the neutron spins, such that non-uniform spin precession at the boundaries of the RF flippers is canceled. The residual inhomogeneity can be reduced by Fresnel- or Pythagoras-coils as in the case of conventional spin echo instruments (neutron spin echo (NSE)). Due to the good intrinsic homogeneity of the B0 coils, the current densities required for the correction coils are at least a factor of three less than in conventional NSE. As the precision and the current density of the correction coils are the limiting factors for the resolution of both NSE and LNRSE, the latter has the intrinsic potential to surpass the energy resolution of present NSE instruments. Our prototype LNRSE spectrometer described here was implemented at the resonance spin echo for diverse applications (RESEDA) beamline at the MLZ in Garching, Germany. The DC fields are generated by B0 coils, based on resistive split-pair solenoids with an active shielding for low stray fields along the beam path. One pair of RF flippers at a distance of 2 m generates a field integral of ˜0.5 Tm. The LNRSE technique is a future alternative for high-resolution spectroscopy of quasi-elastic excitations. In addition, it also incorporates the MIEZE technique, which allows to achieve spin echo resolution for spin depolarizing samples and sample environments. Here we present the results of numerical optimization of the coil geometry and first data from the prototype instrument.

  2. Search for pair production of vector-like quarks in the bW b ‾ W channel from proton-proton collisions at √{ s } = 13TeV

    NASA Astrophysics Data System (ADS)

    Sirunyan, A. M.; Tumasyan, A.; Adam, W.; Ambrogi, F.; Asilar, E.; Bergauer, T.; Brandstetter, J.; Brondolin, E.; Dragicevic, M.; Erö, J.; Flechl, M.; Friedl, M.; Frühwirth, R.; Ghete, V. M.; Grossmann, J.; Hrubec, J.; Jeitler, M.; König, A.; Krammer, N.; Krätschmer, I.; Liko, D.; Madlener, T.; Mikulec, I.; Pree, E.; Rabady, D.; Rad, N.; Rohringer, H.; Schieck, J.; Schöfbeck, R.; Spanring, M.; Spitzbart, D.; Waltenberger, W.; Wittmann, J.; Wulz, C.-E.; Zarucki, M.; Chekhovsky, V.; Mossolov, V.; Suarez Gonzalez, J.; De Wolf, E. A.; Di Croce, D.; Janssen, X.; Lauwers, J.; Van De Klundert, M.; Van Haevermaet, H.; Van Mechelen, P.; Van Remortel, N.; Abu Zeid, S.; Blekman, F.; D'Hondt, J.; De Bruyn, I.; De Clercq, J.; Deroover, K.; Flouris, G.; Lontkovskyi, D.; Lowette, S.; Moortgat, S.; Moreels, L.; Python, Q.; Skovpen, K.; Tavernier, S.; Van Doninck, W.; Van Mulders, P.; Van Parijs, I.; Brun, H.; Clerbaux, B.; De Lentdecker, G.; Delannoy, H.; Fasanella, G.; Favart, L.; Goldouzian, R.; Grebenyuk, A.; Karapostoli, G.; Lenzi, T.; Luetic, J.; Maerschalk, T.; Marinov, A.; Randle-conde, A.; Seva, T.; Vander Velde, C.; Vanlaer, P.; Vannerom, D.; Yonamine, R.; Zenoni, F.; Zhang, F.; Cimmino, A.; Cornelis, T.; Dobur, D.; Fagot, A.; Gul, M.; Khvastunov, I.; Poyraz, D.; Roskas, C.; Salva, S.; Tytgat, M.; Verbeke, W.; Zaganidis, N.; Bakhshiansohi, H.; Bondu, O.; Brochet, S.; Bruno, G.; Caputo, C.; Caudron, A.; De Visscher, S.; Delaere, C.; Delcourt, M.; Francois, B.; Giammanco, A.; Jafari, A.; Komm, M.; Krintiras, G.; Lemaitre, V.; Magitteri, A.; Mertens, A.; Musich, M.; Piotrzkowski, K.; Quertenmont, L.; Vidal Marono, M.; Wertz, S.; Beliy, N.; Aldá Júnior, W. L.; Alves, F. L.; Alves, G. A.; Brito, L.; Correa Martins Junior, M.; Hensel, C.; Moraes, A.; Pol, M. E.; Rebello Teles, P.; Belchior Batista Das Chagas, E.; Carvalho, W.; Chinellato, J.; Custódio, A.; Da Costa, E. M.; Da Silveira, G. G.; De Jesus Damiao, D.; Fonseca De Souza, S.; Huertas Guativa, L. M.; Malbouisson, H.; Melo De Almeida, M.; Mora Herrera, C.; Mundim, L.; Nogima, H.; Santoro, A.; Sznajder, A.; Tonelli Manganote, E. J.; Torres Da Silva De Araujo, F.; Vilela Pereira, A.; Ahuja, S.; Bernardes, C. A.; Fernandez Perez Tomei, T. R.; Gregores, E. M.; Mercadante, P. G.; Novaes, S. F.; Padula, Sandra S.; Romero Abad, D.; Ruiz Vargas, J. C.; Aleksandrov, A.; Hadjiiska, R.; Iaydjiev, P.; Misheva, M.; Rodozov, M.; Shopova, M.; Stoykova, S.; Sultanov, G.; Dimitrov, A.; Glushkov, I.; Litov, L.; Pavlov, B.; Petkov, P.; Fang, W.; Gao, X.; Ahmad, M.; Bian, J. G.; Chen, G. M.; Chen, H. S.; Chen, M.; Chen, Y.; Jiang, C. H.; Leggat, D.; Liao, H.; Liu, Z.; Romeo, F.; Shaheen, S. M.; Spiezia, A.; Tao, J.; Wang, C.; Wang, Z.; Yazgan, E.; Zhang, H.; Zhang, S.; Zhao, J.; Ban, Y.; Chen, G.; Li, Q.; Liu, S.; Mao, Y.; Qian, S. J.; Wang, D.; Xu, Z.; Avila, C.; Cabrera, A.; Chaparro Sierra, L. F.; Florez, C.; González Hernández, C. F.; Ruiz Alvarez, J. D.; Courbon, B.; Godinovic, N.; Lelas, D.; Puljak, I.; Ribeiro Cipriano, P. M.; Sculac, T.; Antunovic, Z.; Kovac, M.; Brigljevic, V.; Ferencek, D.; Kadija, K.; Mesic, B.; Starodumov, A.; Susa, T.; Ather, M. W.; Attikis, A.; Mavromanolakis, G.; Mousa, J.; Nicolaou, C.; Ptochos, F.; Razis, P. A.; Rykaczewski, H.; Finger, M.; Finger, M.; Carrera Jarrin, E.; El-khateeb, E.; Elgammal, S.; Ellithi Kamel, A.; Dewanjee, R. K.; Kadastik, M.; Perrini, L.; Raidal, M.; Tiko, A.; Veelken, C.; Eerola, P.; Pekkanen, J.; Voutilainen, M.; Härkönen, J.; Järvinen, T.; Karimäki, V.; Kinnunen, R.; Lampén, T.; Lassila-Perini, K.; Lehti, S.; Lindén, T.; Luukka, P.; Tuominen, E.; Tuominiemi, J.; Tuovinen, E.; Talvitie, J.; Tuuva, T.; Besancon, M.; Couderc, F.; Dejardin, M.; Denegri, D.; Faure, J. L.; Ferri, F.; Ganjour, S.; Ghosh, S.; Givernaud, A.; Gras, P.; Hamel de Monchenault, G.; Jarry, P.; Kucher, I.; Locci, E.; Machet, M.; Malcles, J.; Negro, G.; Rander, J.; Rosowsky, A.; Sahin, M. Ö.; Titov, M.; Abdulsalam, A.; Antropov, I.; Baffioni, S.; Beaudette, F.; Busson, P.; Cadamuro, L.; Charlot, C.; Granier de Cassagnac, R.; Jo, M.; Lisniak, S.; Lobanov, A.; Martin Blanco, J.; Nguyen, M.; Ochando, C.; Ortona, G.; Paganini, P.; Pigard, P.; Salerno, R.; Sauvan, J. B.; Sirois, Y.; Stahl Leiton, A. G.; Strebler, T.; Yilmaz, Y.; Zabi, A.; Zghiche, A.; Agram, J.-L.; Andrea, J.; Bloch, D.; Brom, J.-M.; Buttignol, M.; Chabert, E. C.; Chanon, N.; Collard, C.; Conte, E.; Coubez, X.; Fontaine, J.-C.; Gelé, D.; Goerlach, U.; Jansová, M.; Le Bihan, A.-C.; Tonon, N.; Van Hove, P.; Gadrat, S.; Beauceron, S.; Bernet, C.; Boudoul, G.; Chierici, R.; Contardo, D.; Depasse, P.; El Mamouni, H.; Fay, J.; Finco, L.; Gascon, S.; Gouzevitch, M.; Grenier, G.; Ille, B.; Lagarde, F.; Laktineh, I. B.; Lethuillier, M.; Mirabito, L.; Pequegnot, A. L.; Perries, S.; Popov, A.; Sordini, V.; Vander Donckt, M.; Viret, S.; Khvedelidze, A.; Tsamalaidze, Z.; Autermann, C.; Feld, L.; Kiesel, M. K.; Klein, K.; Lipinski, M.; Preuten, M.; Schomakers, C.; Schulz, J.; Verlage, T.; Zhukov, V.; Albert, A.; Dietz-Laursonn, E.; Duchardt, D.; Endres, M.; Erdmann, M.; Erdweg, S.; Esch, T.; Fischer, R.; Güth, A.; Hamer, M.; Hebbeker, T.; Heidemann, C.; Hoepfner, K.; Knutzen, S.; Merschmeyer, M.; Meyer, A.; Millet, P.; Mukherjee, S.; Pook, T.; Radziej, M.; Reithler, H.; Rieger, M.; Scheuch, F.; Teyssier, D.; Thüer, S.; Flügge, G.; Kargoll, B.; Kress, T.; Künsken, A.; Lingemann, J.; Müller, T.; Nehrkorn, A.; Nowack, A.; Pistone, C.; Pooth, O.; Stahl, A.; Aldaya Martin, M.; Arndt, T.; Asawatangtrakuldee, C.; Beernaert, K.; Behnke, O.; Behrens, U.; Bermúdez Martínez, A.; Bin Anuar, A. A.; Borras, K.; Botta, V.; Campbell, A.; Connor, P.; Contreras-Campana, C.; Costanza, F.; Diez Pardos, C.; Eckerlin, G.; Eckstein, D.; Eichhorn, T.; Eren, E.; Gallo, E.; Garay Garcia, J.; Geiser, A.; Gizhko, A.; Grados Luyando, J. M.; Grohsjean, A.; Gunnellini, P.; Guthoff, M.; Harb, A.; Hauk, J.; Hempel, M.; Jung, H.; Kalogeropoulos, A.; Kasemann, M.; Keaveney, J.; Kleinwort, C.; Korol, I.; Krücker, D.; Lange, W.; Lelek, A.; Lenz, T.; Leonard, J.; Lipka, K.; Lohmann, W.; Mankel, R.; Melzer-Pellmann, I.-A.; Meyer, A. B.; Mittag, G.; Mnich, J.; Mussgiller, A.; Ntomari, E.; Pitzl, D.; Raspereza, A.; Roland, B.; Savitskyi, M.; Saxena, P.; Shevchenko, R.; Spannagel, S.; Stefaniuk, N.; Van Onsem, G. P.; Walsh, R.; Wen, Y.; Wichmann, K.; Wissing, C.; Zenaiev, O.; Bein, S.; Blobel, V.; Centis Vignali, M.; Dreyer, T.; Garutti, E.; Gonzalez, D.; Haller, J.; Hinzmann, A.; Hoffmann, M.; Karavdina, A.; Klanner, R.; Kogler, R.; Kovalchuk, N.; Kurz, S.; Lapsien, T.; Marchesini, I.; Marconi, D.; Meyer, M.; Niedziela, M.; Nowatschin, D.; Pantaleo, F.; Peiffer, T.; Perieanu, A.; Scharf, C.; Schleper, P.; Schmidt, A.; Schumann, S.; Schwandt, J.; Sonneveld, J.; Stadie, H.; Steinbrück, G.; Stober, F. M.; Stöver, M.; Tholen, H.; Troendle, D.; Usai, E.; Vanelderen, L.; Vanhoefer, A.; Vormwald, B.; Akbiyik, M.; Barth, C.; Baur, S.; Butz, E.; Caspart, R.; Chwalek, T.; Colombo, F.; De Boer, W.; Dierlamm, A.; Freund, B.; Friese, R.; Giffels, M.; Gilbert, A.; Haitz, D.; Hartmann, F.; Heindl, S. M.; Husemann, U.; Kassel, F.; Kudella, S.; Mildner, H.; Mozer, M. U.; Müller, Th.; Plagge, M.; Quast, G.; Rabbertz, K.; Schröder, M.; Shvetsov, I.; Sieber, G.; Simonis, H. J.; Ulrich, R.; Wayand, S.; Weber, M.; Weiler, T.; Williamson, S.; Wöhrmann, C.; Wolf, R.; Anagnostou, G.; Daskalakis, G.; Geralis, T.; Giakoumopoulou, V. A.; Kyriakis, A.; Loukas, D.; Topsis-Giotis, I.; Karathanasis, G.; Kesisoglou, S.; Panagiotou, A.; Saoulidou, N.; Kousouris, K.; Evangelou, I.; Foudas, C.; Kokkas, P.; Mallios, S.; Manthos, N.; Papadopoulos, I.; Paradas, E.; Strologas, J.; Triantis, F. A.; Csanad, M.; Filipovic, N.; Pasztor, G.; Veres, G. I.; Bencze, G.; Hajdu, C.; Horvath, D.; Hunyadi, Á.; Sikler, F.; Veszpremi, V.; Zsigmond, A. J.; Beni, N.; Czellar, S.; Karancsi, J.; Makovec, A.; Molnar, J.; Szillasi, Z.; Bartók, M.; Raics, P.; Trocsanyi, Z. L.; Ujvari, B.; Choudhury, S.; Komaragiri, J. R.; Bahinipati, S.; Bhowmik, S.; Mal, P.; Mandal, K.; Nayak, A.; Sahoo, D. K.; Sahoo, N.; Swain, S. K.; Bansal, S.; Beri, S. B.; Bhatnagar, V.; Chawla, R.; Dhingra, N.; Kalsi, A. K.; Kaur, A.; Kaur, M.; Kumar, R.; Kumari, P.; Mehta, A.; Singh, J. B.; Walia, G.; Kumar, Ashok; Shah, Aashaq; Bhardwaj, A.; Chauhan, S.; Choudhary, B. C.; Garg, R. B.; Keshri, S.; Kumar, A.; Malhotra, S.; Naimuddin, M.; Ranjan, K.; Sharma, R.; Bhardwaj, R.; Bhattacharya, R.; Bhattacharya, S.; Bhawandeep, U.; Dey, S.; Dutt, S.; Dutta, S.; Ghosh, S.; Majumdar, N.; Modak, A.; Mondal, K.; Mukhopadhyay, S.; Nandan, S.; Purohit, A.; Roy, A.; Roy, D.; Roy Chowdhury, S.; Sarkar, S.; Sharan, M.; Thakur, S.; Behera, P. K.; Chudasama, R.; Dutta, D.; Jha, V.; Kumar, V.; Mohanty, A. K.; Netrakanti, P. K.; Pant, L. M.; Shukla, P.; Topkar, A.; Aziz, T.; Dugad, S.; Mahakud, B.; Mitra, S.; Mohanty, G. B.; Sur, N.; Sutar, B.; Banerjee, S.; Bhattacharya, S.; Chatterjee, S.; Das, P.; Guchait, M.; Jain, Sa.; Kumar, S.; Maity, M.; Majumder, G.; Mazumdar, K.; Sarkar, T.; Wickramage, N.; Chauhan, S.; Dube, S.; Hegde, V.; Kapoor, A.; Kothekar, K.; Pandey, S.; Rane, A.; Sharma, S.; Chenarani, S.; Eskandari Tadavani, E.; Etesami, S. M.; Khakzad, M.; Mohammadi Najafabadi, M.; Naseri, M.; Paktinat Mehdiabadi, S.; Rezaei Hosseinabadi, F.; Safarzadeh, B.; Zeinali, M.; Felcini, M.; Grunewald, M.; Abbrescia, M.; Calabria, C.; Colaleo, A.; Creanza, D.; Cristella, L.; De Filippis, N.; De Palma, M.; Errico, F.; Fiore, L.; Iaselli, G.; Lezki, S.; Maggi, G.; Maggi, M.; Miniello, G.; My, S.; Nuzzo, S.; Pompili, A.; Pugliese, G.; Radogna, R.; Ranieri, A.; Selvaggi, G.; Sharma, A.; Silvestris, L.; Venditti, R.; Verwilligen, P.; Abbiendi, G.; Battilana, C.; Bonacorsi, D.; Braibant-Giacomelli, S.; Campanini, R.; Capiluppi, P.; Castro, A.; Cavallo, F. R.; Chhibra, S. S.; Codispoti, G.; Cuffiani, M.; Dallavalle, G. M.; Fabbri, F.; Fanfani, A.; Fasanella, D.; Giacomelli, P.; Grandi, C.; Guiducci, L.; Marcellini, S.; Masetti, G.; Montanari, A.; Navarria, F. L.; Perrotta, A.; Rossi, A. M.; Rovelli, T.; Siroli, G. P.; Tosi, N.; Albergo, S.; Costa, S.; Di Mattia, A.; Giordano, F.; Potenza, R.; Tricomi, A.; Tuve, C.; Barbagli, G.; Chatterjee, K.; Ciulli, V.; Civinini, C.; D'Alessandro, R.; Focardi, E.; Lenzi, P.; Meschini, M.; Paoletti, S.; Russo, L.; Sguazzoni, G.; Strom, D.; Viliani, L.; Benussi, L.; Bianco, S.; Fabbri, F.; Piccolo, D.; Primavera, F.; Calvelli, V.; Ferro, F.; Robutti, E.; Tosi, S.; Benaglia, A.; Brianza, L.; Brivio, F.; Ciriolo, V.; Dinardo, M. E.; Fiorendi, S.; Gennai, S.; Ghezzi, A.; Govoni, P.; Malberti, M.; Malvezzi, S.; Manzoni, R. A.; Menasce, D.; Moroni, L.; Paganoni, M.; Pauwels, K.; Pedrini, D.; Pigazzini, S.; Ragazzi, S.; Redaelli, N.; Tabarelli de Fatis, T.; Buontempo, S.; Cavallo, N.; Di Guida, S.; Fabozzi, F.; Fienga, F.; Iorio, A. O. M.; Khan, W. A.; Lista, L.; Meola, S.; Paolucci, P.; Sciacca, C.; Thyssen, F.; Azzi, P.; Bacchetta, N.; Benato, L.; Bisello, D.; Boletti, A.; Carlin, R.; Carvalho Antunes De Oliveira, A.; Checchia, P.; Dall'Osso, M.; De Castro Manzano, P.; Dorigo, T.; Gasparini, F.; Gasparini, U.; Gozzelino, A.; Lacaprara, S.; Lujan, P.; Meneguzzo, A. T.; Pozzobon, N.; Ronchese, P.; Rossin, R.; Simonetto, F.; Torassa, E.; Ventura, S.; Zanetti, M.; Zotto, P.; Zumerle, G.; Braghieri, A.; Magnani, A.; Montagna, P.; Ratti, S. P.; Re, V.; Ressegotti, M.; Riccardi, C.; Salvini, P.; Vai, I.; Vitulo, P.; Alunni Solestizi, L.; Biasini, M.; Bilei, G. M.; Cecchi, C.; Ciangottini, D.; Fanò, L.; Lariccia, P.; Leonardi, R.; Manoni, E.; Mantovani, G.; Mariani, V.; Menichelli, M.; Rossi, A.; Santocchia, A.; Spiga, D.; Androsov, K.; Azzurri, P.; Bagliesi, G.; Boccali, T.; Borrello, L.; Castaldi, R.; Ciocci, M. A.; Dell'Orso, R.; Fedi, G.; Giannini, L.; Giassi, A.; Grippo, M. T.; Ligabue, F.; Lomtadze, T.; Manca, E.; Mandorli, G.; Martini, L.; Messineo, A.; Palla, F.; Rizzi, A.; Savoy-Navarro, A.; Spagnolo, P.; Tenchini, R.; Tonelli, G.; Venturi, A.; Verdini, P. G.; Barone, L.; Cavallari, F.; Cipriani, M.; Daci, N.; Del Re, D.; Di Marco, E.; Diemoz, M.; Gelli, S.; Longo, E.; Margaroli, F.; Marzocchi, B.; Meridiani, P.; Organtini, G.; Paramatti, R.; Preiato, F.; Rahatlou, S.; Rovelli, C.; Santanastasio, F.; Amapane, N.; Arcidiacono, R.; Argiro, S.; Arneodo, M.; Bartosik, N.; Bellan, R.; Biino, C.; Cartiglia, N.; Cenna, F.; Costa, M.; Covarelli, R.; Degano, A.; Demaria, N.; Kiani, B.; Mariotti, C.; Maselli, S.; Migliore, E.; Monaco, V.; Monteil, E.; Monteno, M.; Obertino, M. M.; Pacher, L.; Pastrone, N.; Pelliccioni, M.; Pinna Angioni, G. L.; Ravera, F.; Romero, A.; Ruspa, M.; Sacchi, R.; Shchelina, K.; Sola, V.; Solano, A.; Staiano, A.; Traczyk, P.; Belforte, S.; Casarsa, M.; Cossutti, F.; Della Ricca, G.; Zanetti, A.; Kim, D. H.; Kim, G. N.; Kim, M. S.; Lee, J.; Lee, S.; Lee, S. W.; Moon, C. S.; Oh, Y. D.; Sekmen, S.; Son, D. C.; Yang, Y. C.; Lee, A.; Kim, H.; Moon, D. H.; Oh, G.; Brochero Cifuentes, J. A.; Goh, J.; Kim, T. J.; Cho, S.; Choi, S.; Go, Y.; Gyun, D.; Ha, S.; Hong, B.; Jo, Y.; Kim, Y.; Lee, K.; Lee, K. S.; Lee, S.; Lim, J.; Park, S. K.; Roh, Y.; Almond, J.; Kim, J.; Kim, J. S.; Lee, H.; Lee, K.; Nam, K.; Oh, S. B.; Radburn-Smith, B. C.; Seo, S. h.; Yang, U. K.; Yoo, H. D.; Yu, G. B.; Choi, M.; Kim, H.; Kim, J. H.; Lee, J. S. H.; Park, I. C.; Choi, Y.; Hwang, C.; Lee, J.; Yu, I.; Dudenas, V.; Juodagalvis, A.; Vaitkus, J.; Ahmed, I.; Ibrahim, Z. A.; Md Ali, M. A. B.; Mohamad Idris, F.; Wan Abdullah, W. A. T.; Yusli, M. N.; Zolkapli, Z.; Reyes-Almanza, R.; Ramirez-Sanchez, G.; Duran-Osuna, M. C.; Castilla-Valdez, H.; De La Cruz-Burelo, E.; Heredia-De La Cruz, I.; Rabadan-Trejo, R. I.; Lopez-Fernandez, R.; Mejia Guisao, J.; Sanchez-Hernandez, A.; Carrillo Moreno, S.; Oropeza Barrera, C.; Vazquez Valencia, F.; Pedraza, I.; Salazar Ibarguen, H. A.; Uribe Estrada, C.; Morelos Pineda, A.; Krofcheck, D.; Butler, P. H.; Ahmad, A.; Ahmad, M.; Hassan, Q.; Hoorani, H. R.; Saddique, A.; Shah, M. A.; Shoaib, M.; Waqas, M.; Bialkowska, H.; Bluj, M.; Boimska, B.; Frueboes, T.; Górski, M.; Kazana, M.; Nawrocki, K.; Szleper, M.; Zalewski, P.; Bunkowski, K.; Byszuk, A.; Doroba, K.; Kalinowski, A.; Konecki, M.; Krolikowski, J.; Misiura, M.; Olszewski, M.; Pyskir, A.; Walczak, M.; Bargassa, P.; Beirão Da Cruz E Silva, C.; Di Francesco, A.; Faccioli, P.; Galinhas, B.; Gallinaro, M.; Hollar, J.; Leonardo, N.; Lloret Iglesias, L.; Nemallapudi, M. V.; Seixas, J.; Strong, G.; Toldaiev, O.; Vadruccio, D.; Varela, J.; Afanasiev, S.; Bunin, P.; Gavrilenko, M.; Golutvin, I.; Gorbunov, I.; Kamenev, A.; Karjavin, V.; Lanev, A.; Malakhov, A.; Matveev, V.; Palichik, V.; Perelygin, V.; Shmatov, S.; Shulha, S.; Skatchkov, N.; Smirnov, V.; Voytishin, N.; Zarubin, A.; Ivanov, Y.; Kim, V.; Kuznetsova, E.; Levchenko, P.; Murzin, V.; Oreshkin, V.; Smirnov, I.; Sulimov, V.; Uvarov, L.; Vavilov, S.; Vorobyev, A.; Andreev, Yu.; Dermenev, A.; Gninenko, S.; Golubev, N.; Karneyeu, A.; Kirsanov, M.; Krasnikov, N.; Pashenkov, A.; Tlisov, D.; Toropin, A.; Epshteyn, V.; Gavrilov, V.; Lychkovskaya, N.; Popov, V.; Pozdnyakov, I.; Safronov, G.; Spiridonov, A.; Stepennov, A.; Toms, M.; Vlasov, E.; Zhokin, A.; Aushev, T.; Bylinkin, A.; Chistov, R.; Danilov, M.; Parygin, P.; Philippov, D.; Polikarpov, S.; Tarkovskii, E.; Andreev, V.; Azarkin, M.; Dremin, I.; Kirakosyan, M.; Terkulov, A.; Baskakov, A.; Belyaev, A.; Boos, E.; Bunichev, V.; Dubinin, M.; Dudko, L.; Ershov, A.; Klyukhin, V.; Kodolova, O.; Lokhtin, I.; Miagkov, I.; Obraztsov, S.; Perfilov, M.; Savrin, V.; Snigirev, A.; Blinov, V.; Skovpen, Y.; Shtol, D.; Azhgirey, I.; Bayshev, I.; Bitioukov, S.; Elumakhov, D.; Kachanov, V.; Kalinin, A.; Konstantinov, D.; Petrov, V.; Ryutin, R.; Sobol, A.; Troshin, S.; Tyurin, N.; Uzunian, A.; Volkov, A.; Adzic, P.; Cirkovic, P.; Devetak, D.; Dordevic, M.; Milosevic, J.; Rekovic, V.; Alcaraz Maestre, J.; Barrio Luna, M.; Cerrada, M.; Colino, N.; De La Cruz, B.; Delgado Peris, A.; Escalante Del Valle, A.; Fernandez Bedoya, C.; Fernández Ramos, J. P.; Flix, J.; Fouz, M. C.; Garcia-Abia, P.; Gonzalez Lopez, O.; Goy Lopez, S.; Hernandez, J. M.; Josa, M. I.; Moran, D.; Pérez-Calero Yzquierdo, A.; Puerta Pelayo, J.; Quintario Olmeda, A.; Redondo, I.; Romero, L.; Soares, M. S.; Álvarez Fernández, A.; Albajar, C.; de Trocóniz, J. F.; Missiroli, M.; Cuevas, J.; Erice, C.; Fernandez Menendez, J.; Gonzalez Caballero, I.; González Fernández, J. R.; Palencia Cortezon, E.; Sanchez Cruz, S.; Vischia, P.; Vizan Garcia, J. M.; Cabrillo, I. J.; Calderon, A.; Chazin Quero, B.; Curras, E.; Duarte Campderros, J.; Fernandez, M.; Garcia-Ferrero, J.; Gomez, G.; Lopez Virto, A.; Marco, J.; Martinez Rivero, C.; Martinez Ruiz del Arbol, P.; Matorras, F.; Piedra Gomez, J.; Rodrigo, T.; Ruiz-Jimeno, A.; Scodellaro, L.; Trevisani, N.; Vila, I.; Vilar Cortabitarte, R.; Abbaneo, D.; Auffray, E.; Baillon, P.; Ball, A. H.; Barney, D.; Bianco, M.; Bloch, P.; Bocci, A.; Botta, C.; Camporesi, T.; Castello, R.; Cepeda, M.; Cerminara, G.; Chapon, E.; Chen, Y.; d'Enterria, D.; Dabrowski, A.; Daponte, V.; David, A.; De Gruttola, M.; De Roeck, A.; Dobson, M.; Dorney, B.; du Pree, T.; Dünser, M.; Dupont, N.; Elliott-Peisert, A.; Everaerts, P.; Fallavollita, F.; Franzoni, G.; Fulcher, J.; Funk, W.; Gigi, D.; Gill, K.; Glege, F.; Gulhan, D.; Harris, P.; Hegeman, J.; Innocente, V.; Janot, P.; Karacheban, O.; Kieseler, J.; Kirschenmann, H.; Knünz, V.; Kornmayer, A.; Kortelainen, M. J.; Krammer, M.; Lange, C.; Lecoq, P.; Lourenço, C.; Lucchini, M. T.; Malgeri, L.; Mannelli, M.; Martelli, A.; Meijers, F.; Merlin, J. A.; Mersi, S.; Meschi, E.; Milenovic, P.; Moortgat, F.; Mulders, M.; Neugebauer, H.; Ngadiuba, J.; Orfanelli, S.; Orsini, L.; Pape, L.; Perez, E.; Peruzzi, M.; Petrilli, A.; Petrucciani, G.; Pfeiffer, A.; Pierini, M.; Racz, A.; Reis, T.; Rolandi, G.; Rovere, M.; Sakulin, H.; Schäfer, C.; Schwick, C.; Seidel, M.; Selvaggi, M.; Sharma, A.; Silva, P.; Sphicas, P.; Stakia, A.; Steggemann, J.; Stoye, M.; Tosi, M.; Treille, D.; Triossi, A.; Tsirou, A.; Veckalns, V.; Verweij, M.; Zeuner, W. D.; Bertl, W.; Caminada, L.; Deiters, K.; Erdmann, W.; Horisberger, R.; Ingram, Q.; Kaestli, H. C.; Kotlinski, D.; Langenegger, U.; Rohe, T.; Wiederkehr, S. A.; Bachmair, F.; Bäni, L.; Berger, P.; Bianchini, L.; Casal, B.; Dissertori, G.; Dittmar, M.; Donegà, M.; Grab, C.; Heidegger, C.; Hits, D.; Hoss, J.; Kasieczka, G.; Klijnsma, T.; Lustermann, W.; Mangano, B.; Marionneau, M.; Meinhard, M. T.; Meister, D.; Micheli, F.; Musella, P.; Nessi-Tedaldi, F.; Pandolfi, F.; Pata, J.; Pauss, F.; Perrin, G.; Perrozzi, L.; Quittnat, M.; Reichmann, M.; Schönenberger, M.; Shchutska, L.; Tavolaro, V. R.; Theofilatos, K.; Vesterbacka Olsson, M. L.; Wallny, R.; Zhu, D. H.; Aarrestad, T. K.; Amsler, C.; Canelli, M. F.; De Cosa, A.; Del Burgo, R.; Donato, S.; Galloni, C.; Hreus, T.; Kilminster, B.; Pinna, D.; Rauco, G.; Robmann, P.; Salerno, D.; Seitz, C.; Takahashi, Y.; Zucchetta, A.; Candelise, V.; Doan, T. H.; Jain, Sh.; Khurana, R.; Kuo, C. M.; Lin, W.; Pozdnyakov, A.; Yu, S. S.; Kumar, Arun; Chang, P.; Chao, Y.; Chen, K. F.; Chen, P. H.; Fiori, F.; Hou, W.-S.; Hsiung, Y.; Liu, Y. F.; Lu, R.-S.; Paganis, E.; Psallidas, A.; Steen, A.; Tsai, J. f.; Asavapibhop, B.; Kovitanggoon, K.; Singh, G.; Srimanobhas, N.; Bakirci, M. N.; Boran, F.; Damarseckin, S.; Demiroglu, Z. S.; Dozen, C.; Eskut, E.; Girgis, S.; Gokbulut, G.; Guler, Y.; Hos, I.; Kangal, E. E.; Kara, O.; Kiminsu, U.; Oglakci, M.; Onengut, G.; Ozdemir, K.; Ozturk, S.; Polatoz, A.; Tali, B.; Turkcapar, S.; Zorbakir, I. S.; Zorbilmez, C.; Bilin, B.; Karapinar, G.; Ocalan, K.; Yalvac, M.; Zeyrek, M.; Gülmez, E.; Kaya, M.; Kaya, O.; Tekten, S.; Yetkin, E. A.; Agaras, M. N.; Atay, S.; Cakir, A.; Cankocak, K.; Grynyov, B.; Levchuk, L.; Aggleton, R.; Ball, F.; Beck, L.; Brooke, J. J.; Burns, D.; Clement, E.; Cussans, D.; Davignon, O.; Flacher, H.; Goldstein, J.; Grimes, M.; Heath, G. P.; Heath, H. F.; Jacob, J.; Kreczko, L.; Lucas, C.; Newbold, D. M.; Paramesvaran, S.; Poll, A.; Sakuma, T.; Seif El Nasr-storey, S.; Smith, D.; Smith, V. J.; Bell, K. W.; Belyaev, A.; Brew, C.; Brown, R. M.; Calligaris, L.; Cieri, D.; Cockerill, D. J. A.; Coughlan, J. A.; Harder, K.; Harper, S.; Olaiya, E.; Petyt, D.; Shepherd-Themistocleous, C. H.; Thea, A.; Tomalin, I. R.; Williams, T.; Auzinger, G.; Bainbridge, R.; Breeze, S.; Buchmuller, O.; Bundock, A.; Casasso, S.; Citron, M.; Colling, D.; Corpe, L.; Dauncey, P.; Davies, G.; De Wit, A.; Della Negra, M.; Di Maria, R.; Elwood, A.; Haddad, Y.; Hall, G.; Iles, G.; James, T.; Lane, R.; Laner, C.; Lyons, L.; Magnan, A.-M.; Malik, S.; Mastrolorenzo, L.; Matsushita, T.; Nash, J.; Nikitenko, A.; Palladino, V.; Pesaresi, M.; Raymond, D. M.; Richards, A.; Rose, A.; Scott, E.; Seez, C.; Shtipliyski, A.; Summers, S.; Tapper, A.; Uchida, K.; Vazquez Acosta, M.; Virdee, T.; Wardle, N.; Winterbottom, D.; Wright, J.; Zenz, S. C.; Cole, J. E.; Hobson, P. R.; Khan, A.; Kyberd, P.; Reid, I. D.; Symonds, P.; Teodorescu, L.; Turner, M.; Borzou, A.; Call, K.; Dittmann, J.; Hatakeyama, K.; Liu, H.; Pastika, N.; Smith, C.; Bartek, R.; Dominguez, A.; Buccilli, A.; Cooper, S. I.; Henderson, C.; Rumerio, P.; West, C.; Arcaro, D.; Avetisyan, A.; Bose, T.; Gastler, D.; Rankin, D.; Richardson, C.; Rohlf, J.; Sulak, L.; Zou, D.; Benelli, G.; Cutts, D.; Garabedian, A.; Hakala, J.; Heintz, U.; Hogan, J. M.; Kwok, K. H. M.; Laird, E.; Landsberg, G.; Mao, Z.; Narain, M.; Pazzini, J.; Piperov, S.; Sagir, S.; Syarif, R.; Yu, D.; Band, R.; Brainerd, C.; Burns, D.; Calderon De La Barca Sanchez, M.; Chertok, M.; Conway, J.; Conway, R.; Cox, P. T.; Erbacher, R.; Flores, C.; Funk, G.; Gardner, M.; Ko, W.; Lander, R.; Mclean, C.; Mulhearn, M.; Pellett, D.; Pilot, J.; Shalhout, S.; Shi, M.; Smith, J.; Stolp, D.; Tos, K.; Tripathi, M.; Wang, Z.; Bachtis, M.; Bravo, C.; Cousins, R.; Dasgupta, A.; Florent, A.; Hauser, J.; Ignatenko, M.; Mccoll, N.; Regnard, S.; Saltzberg, D.; Schnaible, C.; Valuev, V.; Bouvier, E.; Burt, K.; Clare, R.; Ellison, J.; Gary, J. W.; Ghiasi Shirazi, S. M. A.; Hanson, G.; Heilman, J.; Jandir, P.; Kennedy, E.; Lacroix, F.; Long, O. R.; Olmedo Negrete, M.; Paneva, M. I.; Shrinivas, A.; Si, W.; Wang, L.; Wei, H.; Wimpenny, S.; Yates, B. R.; Branson, J. G.; Cittolin, S.; Derdzinski, M.; Gerosa, R.; Hashemi, B.; Holzner, A.; Klein, D.; Kole, G.; Krutelyov, V.; Letts, J.; Macneill, I.; Masciovecchio, M.; Olivito, D.; Padhi, S.; Pieri, M.; Sani, M.; Sharma, V.; Simon, S.; Tadel, M.; Vartak, A.; Wasserbaech, S.; Wood, J.; Würthwein, F.; Yagil, A.; Zevi Della Porta, G.; Amin, N.; Bhandari, R.; Bradmiller-Feld, J.; Campagnari, C.; Dishaw, A.; Dutta, V.; Franco Sevilla, M.; George, C.; Golf, F.; Gouskos, L.; Gran, J.; Heller, R.; Incandela, J.; Mullin, S. D.; Ovcharova, A.; Qu, H.; Richman, J.; Stuart, D.; Suarez, I.; Yoo, J.; Anderson, D.; Bendavid, J.; Bornheim, A.; Lawhorn, J. M.; Newman, H. B.; Nguyen, T.; Pena, C.; Spiropulu, M.; Vlimant, J. R.; Xie, S.; Zhang, Z.; Zhu, R. Y.; Andrews, M. B.; Ferguson, T.; Mudholkar, T.; Paulini, M.; Russ, J.; Sun, M.; Vogel, H.; Vorobiev, I.; Weinberg, M.; Cumalat, J. P.; Ford, W. T.; Jensen, F.; Johnson, A.; Krohn, M.; Leontsinis, S.; Mulholland, T.; Stenson, K.; Wagner, S. R.; Alexander, J.; Chaves, J.; Chu, J.; Dittmer, S.; Mcdermott, K.; Mirman, N.; Patterson, J. R.; Rinkevicius, A.; Ryd, A.; Skinnari, L.; Soffi, L.; Tan, S. M.; Tao, Z.; Thom, J.; Tucker, J.; Wittich, P.; Zientek, M.; Abdullin, S.; Albrow, M.; Apollinari, G.; Apresyan, A.; Apyan, A.; Banerjee, S.; Bauerdick, L. A. T.; Beretvas, A.; Berryhill, J.; Bhat, P. C.; Bolla, G.; Burkett, K.; Butler, J. N.; Canepa, A.; Cerati, G. B.; Cheung, H. W. K.; Chlebana, F.; Cremonesi, M.; Duarte, J.; Elvira, V. D.; Freeman, J.; Gecse, Z.; Gottschalk, E.; Gray, L.; Green, D.; Grünendahl, S.; Gutsche, O.; Harris, R. M.; Hasegawa, S.; Hirschauer, J.; Hu, Z.; Jayatilaka, B.; Jindariani, S.; Johnson, M.; Joshi, U.; Klima, B.; Kreis, B.; Lammel, S.; Lincoln, D.; Lipton, R.; Liu, M.; Liu, T.; Lopes De Sá, R.; Lykken, J.; Maeshima, K.; Magini, N.; Marraffino, J. M.; Maruyama, S.; Mason, D.; McBride, P.; Merkel, P.; Mrenna, S.; Nahn, S.; O'Dell, V.; Pedro, K.; Prokofyev, O.; Rakness, G.; Ristori, L.; Schneider, B.; Sexton-Kennedy, E.; Soha, A.; Spalding, W. J.; Spiegel, L.; Stoynev, S.; Strait, J.; Strobbe, N.; Taylor, L.; Tkaczyk, S.; Tran, N. V.; Uplegger, L.; Vaandering, E. W.; Vernieri, C.; Verzocchi, M.; Vidal, R.; Wang, M.; Weber, H. A.; Whitbeck, A.; Acosta, D.; Avery, P.; Bortignon, P.; Bourilkov, D.; Brinkerhoff, A.; Carnes, A.; Carver, M.; Curry, D.; Field, R. D.; Furic, I. K.; Konigsberg, J.; Korytov, A.; Kotov, K.; Ma, P.; Matchev, K.; Mei, H.; Mitselmakher, G.; Rank, D.; Sperka, D.; Terentyev, N.; Thomas, L.; Wang, J.; Wang, S.; Yelton, J.; Joshi, Y. R.; Linn, S.; Markowitz, P.; Rodriguez, J. L.; Ackert, A.; Adams, T.; Askew, A.; Hagopian, S.; Hagopian, V.; Johnson, K. F.; Kolberg, T.; Martinez, G.; Perry, T.; Prosper, H.; Saha, A.; Santra, A.; Sharma, V.; Yohay, R.; Baarmand, M. M.; Bhopatkar, V.; Colafranceschi, S.; Hohlmann, M.; Noonan, D.; Roy, T.; Yumiceva, F.; Adams, M. R.; Apanasevich, L.; Berry, D.; Betts, R. R.; Cavanaugh, R.; Chen, X.; Evdokimov, O.; Gerber, C. E.; Hangal, D. A.; Hofman, D. J.; Jung, K.; Kamin, J.; Sandoval Gonzalez, I. D.; Tonjes, M. B.; Trauger, H.; Varelas, N.; Wang, H.; Wu, Z.; Zhang, J.; Bilki, B.; Clarida, W.; Dilsiz, K.; Durgut, S.; Gandrajula, R. P.; Haytmyradov, M.; Khristenko, V.; Merlo, J.-P.; Mermerkaya, H.; Mestvirishvili, A.; Moeller, A.; Nachtman, J.; Ogul, H.; Onel, Y.; Ozok, F.; Penzo, A.; Snyder, C.; Tiras, E.; Wetzel, J.; Yi, K.; Blumenfeld, B.; Cocoros, A.; Eminizer, N.; Fehling, D.; Feng, L.; Gritsan, A. V.; Maksimovic, P.; Roskes, J.; Sarica, U.; Swartz, M.; Xiao, M.; You, C.; Al-bataineh, A.; Baringer, P.; Bean, A.; Boren, S.; Bowen, J.; Castle, J.; Khalil, S.; Kropivnitskaya, A.; Majumder, D.; Mcbrayer, W.; Murray, M.; Royon, C.; Sanders, S.; Schmitz, E.; Tapia Takaki, J. D.; Wang, Q.; Ivanov, A.; Kaadze, K.; Maravin, Y.; Mohammadi, A.; Saini, L. K.; Skhirtladze, N.; Toda, S.; Rebassoo, F.; Wright, D.; Anelli, C.; Baden, A.; Baron, O.; Belloni, A.; Calvert, B.; Eno, S. C.; Ferraioli, C.; Hadley, N. J.; Jabeen, S.; Jeng, G. Y.; Kellogg, R. G.; Kunkle, J.; Mignerey, A. C.; Ricci-Tam, F.; Shin, Y. H.; Skuja, A.; Tonwar, S. C.; Abercrombie, D.; Allen, B.; Azzolini, V.; Barbieri, R.; Baty, A.; Bi, R.; Brandt, S.; Busza, W.; Cali, I. A.; D'Alfonso, M.; Demiragli, Z.; Gomez Ceballos, G.; Goncharov, M.; Hsu, D.; Iiyama, Y.; Innocenti, G. M.; Klute, M.; Kovalskyi, D.; Lai, Y. S.; Lee, Y.-J.; Levin, A.; Luckey, P. D.; Maier, B.; Marini, A. C.; Mcginn, C.; Mironov, C.; Narayanan, S.; Niu, X.; Paus, C.; Roland, C.; Roland, G.; Salfeld-Nebgen, J.; Stephans, G. S. F.; Tatar, K.; Velicanu, D.; Wang, J.; Wang, T. W.; Wyslouch, B.; Benvenuti, A. C.; Chatterjee, R. M.; Evans, A.; Hansen, P.; Kalafut, S.; Kubota, Y.; Lesko, Z.; Mans, J.; Nourbakhsh, S.; Ruckstuhl, N.; Rusack, R.; Turkewitz, J.; Acosta, J. G.; Oliveros, S.; Avdeeva, E.; Bloom, K.; Claes, D. R.; Fangmeier, C.; Gonzalez Suarez, R.; Kamalieddin, R.; Kravchenko, I.; Monroy, J.; Siado, J. E.; Snow, G. R.; Stieger, B.; Alyari, M.; Dolen, J.; Godshalk, A.; Harrington, C.; Iashvili, I.; Nguyen, D.; Parker, A.; Rappoccio, S.; Roozbahani, B.; Alverson, G.; Barberis, E.; Hortiangtham, A.; Massironi, A.; Morse, D. M.; Nash, D.; Orimoto, T.; Teixeira De Lima, R.; Trocino, D.; Wood, D.; Bhattacharya, S.; Charaf, O.; Hahn, K. A.; Mucia, N.; Odell, N.; Pollack, B.; Schmitt, M. H.; Sung, K.; Trovato, M.; Velasco, M.; Dev, N.; Hildreth, M.; Hurtado Anampa, K.; Jessop, C.; Karmgard, D. J.; Kellams, N.; Lannon, K.; Loukas, N.; Marinelli, N.; Meng, F.; Mueller, C.; Musienko, Y.; Planer, M.; Reinsvold, A.; Ruchti, R.; Smith, G.; Taroni, S.; Wayne, M.; Wolf, M.; Woodard, A.; Alimena, J.; Antonelli, L.; Bylsma, B.; Durkin, L. S.; Flowers, S.; Francis, B.; Hart, A.; Hill, C.; Ji, W.; Liu, B.; Luo, W.; Puigh, D.; Winer, B. L.; Wulsin, H. W.; Cooperstein, S.; Driga, O.; Elmer, P.; Hardenbrook, J.; Hebda, P.; Higginbotham, S.; Lange, D.; Luo, J.; Marlow, D.; Mei, K.; Ojalvo, I.; Olsen, J.; Palmer, C.; Piroué, P.; Stickland, D.; Tully, C.; Malik, S.; Norberg, S.; Barker, A.; Barnes, V. E.; Das, S.; Folgueras, S.; Gutay, L.; Jha, M. K.; Jones, M.; Jung, A. W.; Khatiwada, A.; Miller, D. H.; Neumeister, N.; Peng, C. C.; Schulte, J. F.; Sun, J.; Wang, F.; Xie, W.; Cheng, T.; Parashar, N.; Stupak, J.; Adair, A.; Akgun, B.; Chen, Z.; Ecklund, K. M.; Geurts, F. J. M.; Guilbaud, M.; Li, W.; Michlin, B.; Northup, M.; Padley, B. P.; Roberts, J.; Rorie, J.; Tu, Z.; Zabel, J.; Bodek, A.; de Barbaro, P.; Demina, R.; Duh, Y. t.; Ferbel, T.; Galanti, M.; Garcia-Bellido, A.; Han, J.; Hindrichs, O.; Khukhunaishvili, A.; Lo, K. H.; Tan, P.; Verzetti, M.; Ciesielski, R.; Goulianos, K.; Mesropian, C.; Agapitos, A.; Chou, J. P.; Gershtein, Y.; Gómez Espinosa, T. A.; Halkiadakis, E.; Heindl, M.; Hughes, E.; Kaplan, S.; Kunnawalkam Elayavalli, R.; Kyriacou, S.; Lath, A.; Montalvo, R.; Nash, K.; Osherson, M.; Saka, H.; Salur, S.; Schnetzer, S.; Sheffield, D.; Somalwar, S.; Stone, R.; Thomas, S.; Thomassen, P.; Walker, M.; Delannoy, A. G.; Foerster, M.; Heideman, J.; Riley, G.; Rose, K.; Spanier, S.; Thapa, K.; Bouhali, O.; Castaneda Hernandez, A.; Celik, A.; Dalchenko, M.; De Mattia, M.; Delgado, A.; Dildick, S.; Eusebi, R.; Gilmore, J.; Huang, T.; Kamon, T.; Mueller, R.; Pakhotin, Y.; Patel, R.; Perloff, A.; Perniè, L.; Rathjens, D.; Safonov, A.; Tatarinov, A.; Ulmer, K. A.; Akchurin, N.; Damgov, J.; De Guio, F.; Dudero, P. R.; Faulkner, J.; Gurpinar, E.; Kunori, S.; Lamichhane, K.; Lee, S. W.; Libeiro, T.; Peltola, T.; Undleeb, S.; Volobouev, I.; Wang, Z.; Greene, S.; Gurrola, A.; Janjam, R.; Johns, W.; Maguire, C.; Melo, A.; Ni, H.; Padeken, K.; Sheldon, P.; Tuo, S.; Velkovska, J.; Xu, Q.; Arenton, M. W.; Barria, P.; Cox, B.; Hirosky, R.; Joyce, M.; Ledovskoy, A.; Li, H.; Neu, C.; Sinthuprasith, T.; Wang, Y.; Wolfe, E.; Xia, F.; Harr, R.; Karchin, P. E.; Sturdy, J.; Zaleski, S.; Brodski, M.; Buchanan, J.; Caillol, C.; Dasu, S.; Dodd, L.; Duric, S.; Gomber, B.; Grothe, M.; Herndon, M.; Hervé, A.; Hussain, U.; Klabbers, P.; Lanaro, A.; Levine, A.; Long, K.; Loveless, R.; Pierro, G. A.; Polese, G.; Ruggles, T.; Savin, A.; Smith, N.; Smith, W. H.; Taylor, D.; Woods, N.; CMS Collaboration

    2018-04-01

    A search is presented for the production of vector-like quark pairs, T T ‾ or Y Y ‾, with electric charge of 2/3 (T) or - 4 / 3 (Y), in proton-proton collisions at √{ s } = 13TeV. The data were collected by the CMS experiment at the LHC in 2016 and correspond to an integrated luminosity of 35.8fb-1. The T and Y quarks are assumed to decay exclusively to a W boson and a b quark. The search is based on events with a single isolated electron or muon, large missing transverse momentum, and at least four jets with large transverse momenta. In the search, a kinematic reconstruction of the final state observables is performed, which would permit a signal to be detected as a narrow mass peak (≈7% resolution). The observed number of events is consistent with the standard model prediction. Assuming strong pair production of the vector-like quarks and a 100% branching fraction to bW, a lower limit of 1295 GeV at 95% confidence level is set on the T and Y quark masses.

  3. Age Differences in Memory Retrieval Shift: Governed by Feeling-of-Knowing?

    PubMed Central

    Hertzog, Christopher; Touron, Dayna R.

    2010-01-01

    The noun-pair lookup (NP) task was used to evaluate strategic shift from visual scanning to retrieval. We investigated whether age differences in feeling-of-knowing (FOK) account for older adults' delayed retrieval shift. Participants were randomly assigned to one of three conditions: (1) standard NP learning, (2) fast binary FOK judgments, or (3) Choice, where participants had to choose in advance whether to see the look-up table or respond from memory. We found small age differences in FOK magnitudes, but major age differences in memory retrieval choices that mirrored retrieval use in the standard NP task. Older adults showed lower resolution in their confidence judgments (CJs) for recognition memory tests on the NP items, and this difference appeared to influence rates of retrieval shift, given that retrieval use was correlated with CJ magnitudes in both age groups. Older adults had particular difficulty with accuracy and confidence for rearranged pairs, relative to intact pairs. Older adults' slowed retrieval shift appears to be due to (a) impaired associative learning early in practice, not just a lower FOK; but also (b) retrieval reluctance later in practice after the degree of associative learning would afford memory-based responding. PMID:21401263

  4. Assessment of the short-term radiometric stability between Terra MODIS and Landsat 7 ETM+ sensors

    USGS Publications Warehouse

    Choi, Taeyoung; Xiong, Xiaoxiong; Chander, Gyanesh; Angal, A.

    2009-01-01

    Short-term radiometric stability was evaluated using continuous ETM+ scenes within a single orbit (contact period) and the corresponding MODIS scenes for the four matching solar reflective visible and near-infrared (VNIR) band pairs between the two sensors. The near-simultaneous earth observations were limited by the smaller swath size of ETM+ (183 km) compared to MODIS (2330 km). Two sets of continuous granules for Terra MODIS and Landsat 7 ETM+ were selected and mosaicked based on pixel geolocation information for noncloudy pixels over the African continent. The matching pixel pairs were resampled from a fine to a coarse pixel resolution, and the at-sensor spectral radiance values for a wide dynamic range of the sensors were compared and analyzed, covering various surface types. The following study focuses on radiometric stability analysis from the VNIR band-pairs of ETM+ and MODIS. The Libya-4 desert target was included in the path of this continuous orbit, which served as a verification point between the short-term and the long-term trending results from previous studies. MODTRAN at-sensor spectral radiance simulation is included for a representative desert surface type to evaluate the consistency of the results.

  5. Super-Resolution Person Re-Identification With Semi-Coupled Low-Rank Discriminant Dictionary Learning.

    PubMed

    Jing, Xiao-Yuan; Zhu, Xiaoke; Wu, Fei; Hu, Ruimin; You, Xinge; Wang, Yunhong; Feng, Hui; Yang, Jing-Yu

    2017-03-01

    Person re-identification has been widely studied due to its importance in surveillance and forensics applications. In practice, gallery images are high resolution (HR), while probe images are usually low resolution (LR) in the identification scenarios with large variation of illumination, weather, or quality of cameras. Person re-identification in this kind of scenarios, which we call super-resolution (SR) person re-identification, has not been well studied. In this paper, we propose a semi-coupled low-rank discriminant dictionary learning (SLD 2 L) approach for SR person re-identification task. With the HR and LR dictionary pair and mapping matrices learned from the features of HR and LR training images, SLD 2 L can convert the features of the LR probe images into HR features. To ensure that the converted features have favorable discriminative capability and the learned dictionaries can well characterize intrinsic feature spaces of the HR and LR images, we design a discriminant term and a low-rank regularization term for SLD 2 L. Moreover, considering that low resolution results in different degrees of loss for different types of visual appearance features, we propose a multi-view SLD 2 L (MVSLD 2 L) approach, which can learn the type-specific dictionary pair and mappings for each type of feature. Experimental results on multiple publicly available data sets demonstrate the effectiveness of our proposed approaches for the SR person re-identification task.

  6. Blocking Strategies for Performing Entity Resolution in a Distributed Computing Environment

    ERIC Educational Resources Information Center

    Wang, Pei

    2016-01-01

    Entity resolution (ER) is an O(n[superscript 2]) problem where n is the number of records to be processed. The pair-wise nature of ER makes it impractical to perform on large datasets without the use of a technique called blocking. In blocking the records are separated into groups (called blocks) in such a way the records most likely to match are…

  7. Process of constructing a lightweight x-ray flight mirror assembly

    NASA Astrophysics Data System (ADS)

    McClelland, Ryan S.; Biskach, Michael P.; Chan, Kai-Wing; Espina, Rebecca A.; Hohl, Bruce R.; Saha, Timo T.; Zhang, William W.

    2014-07-01

    Lightweight and high resolution optics are needed for future space-based x-ray telescopes to achieve advances in highenergy astrophysics. NASA's Next Generation X-ray Optics (NGXO) project has made significant progress towards building such optics, both in terms of maturing the technology for spaceflight readiness and improving the angular resolution. Technology Development Modules (TDMs) holding three pairs of mirrors have been regularly and repeatedly integrated and tested both for optical performance and mechanical strength. X-ray test results have been improved over the past year from 10.3 arc-seconds Half Power Diameter (HPD) to 8.3 arc-seconds HPD. A vibration test has been completed to NASA standard verification levels showing the optics can survive launch and pointing towards improvements in strengthening the modules through redundant bonds. A Finite Element Analysis (FEA) study was completed which shows the mirror distortion caused by bonding is insensitive to the number of bonds. Next generation TDMs, which will demonstrate a lightweight structure and mount additional pairs of mirrors, have been designed and fabricated. The light weight of the module structure is achieved through the use of E-60 Beryllium Oxide metal matrix composite material. As the angular resolution of the development modules has improved, gravity distortion during horizontal x-ray testing has become a limiting factor. To address this issue, a facility capable of testing in the vertical orientation has been designed and planned. Test boring at the construction site suggest standard caisson construction methods can be utilized to install a subterranean vertical vacuum pipe. This facility will also allow for the testing of kinematically mounted mirror segments, which greatly reduces the effect of bonding displacements. A development platform demonstrating the feasibility of kinematically mounting mirror segments has been designed, fabricated, and successfully tested.

  8. Cross-calibration of the Landsat-7 ETM+ and Landsat-5 TM with the ResourceSat-1 (IRS-P6) AWiFS and LISS-III sensors

    USGS Publications Warehouse

    Chander, G.; Scaramuzza, P.L.

    2006-01-01

    Increasingly, data from multiple sensors are used to gain a more complete understanding of land surface processes at a variety of scales. The Landsat suite of satellites has collected the longest continuous archive of multispectral data. The ResourceSat-1 Satellite (also called as IRS-P6) was launched into the polar sunsynchronous orbit on Oct 17, 2003. It carries three remote sensing sensors: the High Resolution Linear Imaging Self-Scanner (LISS-IV), Medium Resolution Linear Imaging Self-Scanner (LISS-III), and the Advanced Wide Field Sensor (AWiFS). These three sensors are used together to provide images with different resolution and coverage. To understand the absolute radiometric calibration accuracy of IRS-P6 AWiFS and LISS-III sensors, image pairs from these sensors were compared to the Landsat-5 TM and Landsat-7 ETM+ sensors. The approach involved the calibration of nearly simultaneous surface observations based on image statistics from areas observed simultaneously by the two sensors.

  9. Simultaneous piston position and tilt angle sensing for large vertical displacement micromirrors by frequency detection inductive sensing

    NASA Astrophysics Data System (ADS)

    Tseng, V. F.-G.; Xie, H.

    2015-11-01

    This paper presents a frequency detection based inductive eddy current sensing mechanism to simultaneously sense the piston position and tilt angle of the mirror plate of large vertical displacement micromirrors that exhibit piston scan ranges above 100 μm. This is accomplished by sensing the inductance change, and thus resonant frequency shift, of two microfabricated sensing coils packaged underneath the mirror plate. For demonstration purpose, the coils were paired with discrete circuit components to oscillate at 11.9 MHz and 12.5 MHz, respectively. The piston position and tilt angle of the mirror plate could be simultaneously monitored over a 500 μm piston scan range, achieving a maximum piston sensitivity of 4.15 kHz/μm with a piston sensing resolution of 96 nm and a maximum tilt angle sensitivity of 60.5 kHz/° with a tilt angle sensing resolution of 0.0013°. Analytical modeling of the coil inductance change via image theory was also conducted, showing that the sensor sensitivity and resolution could be improved by increasing the coil oscillation frequency and decreasing the coil size.

  10. Evaluation of variability in high-resolution protein structures by global distance scoring.

    PubMed

    Anzai, Risa; Asami, Yoshiki; Inoue, Waka; Ueno, Hina; Yamada, Koya; Okada, Tetsuji

    2018-01-01

    Systematic analysis of the statistical and dynamical properties of proteins is critical to understanding cellular events. Extraction of biologically relevant information from a set of high-resolution structures is important because it can provide mechanistic details behind the functional properties of protein families, enabling rational comparison between families. Most of the current structural comparisons are pairwise-based, which hampers the global analysis of increasing contents in the Protein Data Bank. Additionally, pairing of protein structures introduces uncertainty with respect to reproducibility because it frequently accompanies other settings for superimposition. This study introduces intramolecular distance scoring for the global analysis of proteins, for each of which at least several high-resolution structures are available. As a pilot study, we have tested 300 human proteins and showed that the method is comprehensively used to overview advances in each protein and protein family at the atomic level. This method, together with the interpretation of the model calculations, provide new criteria for understanding specific structural variation in a protein, enabling global comparison of the variability in proteins from different species.

  11. Direct Characterization of Ultrafast Energy-Time Entangled Photon Pairs.

    PubMed

    MacLean, Jean-Philippe W; Donohue, John M; Resch, Kevin J

    2018-02-02

    Energy-time entangled photons are critical in many quantum optical phenomena and have emerged as important elements in quantum information protocols. Entanglement in this degree of freedom often manifests itself on ultrafast time scales, making it very difficult to detect, whether one employs direct or interferometric techniques, as photon-counting detectors have insufficient time resolution. Here, we implement ultrafast photon counters based on nonlinear interactions and strong femtosecond laser pulses to probe energy-time entanglement in this important regime. Using this technique and single-photon spectrometers, we characterize all the spectral and temporal correlations of two entangled photons with femtosecond resolution. This enables the witnessing of energy-time entanglement using uncertainty relations and the direct observation of nonlocal dispersion cancellation on ultrafast time scales. These techniques are essential to understand and control the energy-time degree of freedom of light for ultrafast quantum optics.

  12. Bi-Directional Brillouin Optical Time Domain Analyzer System for Long Range Distributed Sensing.

    PubMed

    Guo, Nan; Wang, Liang; Wang, Jie; Jin, Chao; Tam, Hwa-Yaw; Zhang, A Ping; Lu, Chao

    2016-12-16

    We propose and experimentally demonstrate a novel scheme of bi-directional Brillouin time domain analyzer (BD-BOTDA) to extend the sensing range. By deploying two pump-probe pairs at two different wavelengths, the Brillouin frequency shift (BFS) distribution over each half of the whole fiber can be obtained with the simultaneous detection of Brillouin signals in both channels. Compared to the conventional unidirectional BOTDA system of the same sensing range, the proposed BD-BOTDA scheme enables distributed sensing with a performance level comparable to the conventional one with half of the sensing range and a spatial resolution of 2 m, while maintaining the Brillouin signal-to-noise ratio (SNR) and the BFS uncertainty. Based on this technique, we have achieved distributed temperature sensing with a measurement range of 81.9 km fiber at a spatial resolution of 2 m and BFS uncertainty of ~0.44 MHz without introducing any complicated components or schemes.

  13. Statistical Limits to Super Resolution

    NASA Astrophysics Data System (ADS)

    Lucy, L. B.

    1992-08-01

    The limits imposed by photon statistics on the degree to which Rayleigh's resolution limit for diffraction-limited images can be surpassed by applying image restoration techniques are investigated. An approximate statistical theory is given for the number of detected photons required in the image of an unresolved pair of equal point sources in order that its information content allows in principle resolution by restoration. This theory is confirmed by numerical restoration experiments on synthetic images, and quantitative limits are presented for restoration of diffraction-limited images formed by slit and circular apertures.

  14. Compton scatter tomography in TOF-PET

    NASA Astrophysics Data System (ADS)

    Hemmati, Hamidreza; Kamali-Asl, Alireza; Ay, Mohammadreza; Ghafarian, Pardis

    2017-10-01

    Scatter coincidences contain hidden information about the activity distribution on the positron emission tomography (PET) imaging system. However, in conventional reconstruction, the scattered data cause the blurring of images and thus are estimated and subtracted from detected coincidences. List mode format provides a new aspect to use time of flight (TOF) and energy information of each coincidence in the reconstruction process. In this study, a novel approach is proposed to reconstruct activity distribution using the scattered data in the PET system. For each single scattering coincidence, a scattering angle can be determined by the recorded energy of the detected photons, and then possible locations of scattering can be calculated based on the scattering angle. Geometry equations show that these sites lie on two arcs in 2D mode or the surface of a prolate spheroid in 3D mode, passing through the pair of detector elements. The proposed method uses a novel and flexible technique to estimate source origin locations from the possible scattering locations, using the TOF information. Evaluations were based on a Monte-Carlo simulation of uniform and non-uniform phantoms at different resolutions of time and detector energy. The results show that although the energy uncertainties deteriorate the image spatial resolution in the proposed method, the time resolution has more impact on image quality than the energy resolution. With progress of the TOF system, the reconstruction using the scattered data can be used in a complementary manner, or to improve image quality in the next generation of PET systems.

  15. Semiclassical propagator of the Wigner function.

    PubMed

    Dittrich, Thomas; Viviescas, Carlos; Sandoval, Luis

    2006-02-24

    Propagation of the Wigner function is studied on two levels of semiclassical propagation: one based on the Van Vleck propagator, the other on phase-space path integration. Leading quantum corrections to the classical Liouville propagator take the form of a time-dependent quantum spot. Its oscillatory structure depends on whether the underlying classical flow is elliptic or hyperbolic. It can be interpreted as the result of interference of a pair of classical trajectories, indicating how quantum coherences are to be propagated semiclassically in phase space. The phase-space path-integral approach allows for a finer resolution of the quantum spot in terms of Airy functions.

  16. Report on Pairing-based Cryptography.

    PubMed

    Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

    2015-01-01

    This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.

  17. Report on Pairing-based Cryptography

    PubMed Central

    Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

    2015-01-01

    This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST’s position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed. PMID:26958435

  18. Accomplishments of the MUSICA project to provide accurate, long-term, global and high-resolution observations of tropospheric {H2O,δD} pairs - a review

    NASA Astrophysics Data System (ADS)

    Schneider, Matthias; Wiegele, Andreas; Barthlott, Sabine; González, Yenny; Christner, Emanuel; Dyroff, Christoph; García, Omaira E.; Hase, Frank; Blumenstock, Thomas; Sepúlveda, Eliezer; Mengistu Tsidu, Gizaw; Takele Kenea, Samuel; Rodríguez, Sergio; Andrey, Javier

    2016-07-01

    In the lower/middle troposphere, {H2O,δD} pairs are good proxies for moisture pathways; however, their observation, in particular when using remote sensing techniques, is challenging. The project MUSICA (MUlti-platform remote Sensing of Isotopologues for investigating the Cycle of Atmospheric water) addresses this challenge by integrating the remote sensing with in situ measurement techniques. The aim is to retrieve calibrated tropospheric {H2O,δD} pairs from the middle infrared spectra measured from ground by FTIR (Fourier transform infrared) spectrometers of the NDACC (Network for the Detection of Atmospheric Composition Change) and the thermal nadir spectra measured by IASI (Infrared Atmospheric Sounding Interferometer) aboard the MetOp satellites. In this paper, we present the final MUSICA products, and discuss the characteristics and potential of the NDACC/FTIR and MetOp/IASI {H2O,δD} data pairs. First, we briefly resume the particularities of an {H2O,δD} pair retrieval. Second, we show that the remote sensing data of the final product version are absolutely calibrated with respect to H2O and δD in situ profile references measured in the subtropics, between 0 and 7 km. Third, we reveal that the {H2O,δD} pair distributions obtained from the different remote sensors are consistent and allow distinct lower/middle tropospheric moisture pathways to be identified in agreement with multi-year in situ references. Fourth, we document the possibilities of the NDACC/FTIR instruments for climatological studies (due to long-term monitoring) and of the MetOp/IASI sensors for observing diurnal signals on a quasi-global scale and with high horizontal resolution. Fifth, we discuss the risk of misinterpreting {H2O,δD} pair distributions due to incomplete processing of the remote sensing products.

  19. The effect of gas physics on the halo mass function

    NASA Astrophysics Data System (ADS)

    Stanek, R.; Rudd, D.; Evrard, A. E.

    2009-03-01

    Cosmological tests based on cluster counts require accurate calibration of the space density of massive haloes, but most calibrations to date have ignored complex gas physics associated with halo baryons. We explore the sensitivity of the halo mass function to baryon physics using two pairs of gas-dynamic simulations that are likely to bracket the true behaviour. Each pair consists of a baseline model involving only gravity and shock heating, and a refined physics model aimed at reproducing the observed scaling of the hot, intracluster gas phase. One pair consists of billion-particle resimulations of the original 500h-1Mpc Millennium Simulation of Springel et al., run with the smoothed particle hydrodynamics (SPH) code GADGET-2 and using a refined physics treatment approximated by pre-heating (PH) at high redshift. The other pair are high-resolution simulations from the adaptive-mesh refinement code ART, for which the refined treatment includes cooling, star formation and supernova feedback (CSF). We find that, although the mass functions of the gravity-only (GO) treatments are consistent with the recent calibration of Tinker et al. (2008), both pairs of simulations with refined baryon physics show significant deviations. Relative to the GO case, the masses of ~1014h-1Msolar haloes in the PH and CSF treatments are shifted by the averages of -15 +/- 1 and +16 +/- 2 per cent, respectively. These mass shifts cause ~30 per cent deviations in number density relative to the Tinker function, significantly larger than the 5 per cent statistical uncertainty of that calibration.

  20. An empirically derived three-dimensional Laplace resonance in the Gliese 876 planetary system

    NASA Astrophysics Data System (ADS)

    Nelson, Benjamin E.; Robertson, Paul M.; Payne, Matthew J.; Pritchard, Seth M.; Deck, Katherine M.; Ford, Eric B.; Wright, Jason T.; Isaacson, Howard T.

    2016-01-01

    We report constraints on the three-dimensional orbital architecture for all four planets known to orbit the nearby M dwarf Gliese 876 based solely on Doppler measurements and demanding long-term orbital stability. Our data set incorporates publicly available radial velocities taken with the ELODIE and CORALIE spectrographs, High Accuracy Radial velocity Planet Searcher (HARPS), and Keck HIgh Resolution Echelle Spectrometer (HIRES) as well as previously unpublished HIRES velocities. We first quantitatively assess the validity of the planets thought to orbit GJ 876 by computing the Bayes factors for a variety of different coplanar models using an importance sampling algorithm. We find that a four-planet model is preferred over a three-planet model. Next, we apply a Newtonian Markov chain Monte Carlo algorithm to perform a Bayesian analysis of the planet masses and orbits using an N-body model in three-dimensional space. Based on the radial velocities alone, we find that a 99 per cent credible interval provides upper limits on the mutual inclinations for the three resonant planets (Φcb < 6.20° for the {c} and {b} pair and Φbe < 28.5° for the {b} and {e} pair). Subsequent dynamical integrations of our posterior sample find that the GJ 876 planets must be roughly coplanar (Φcb < 2.60° and Φbe < 7.87°, suggesting that the amount of planet-planet scattering in the system has been low. We investigate the distribution of the respective resonant arguments of each planet pair and find that at least one argument for each planet pair and the Laplace argument librate. The libration amplitudes in our three-dimensional orbital model support the idea of the outer three planets having undergone significant past disc migration.

  1. Generation of Gigawatt Circularly Polarized Attosecond-Pulse Pairs

    NASA Astrophysics Data System (ADS)

    Hu, K.; Wu, H.-C.

    2017-12-01

    A novel scheme for generating a pair of gigawatt attosecond pulses by coherent Thomson scattering from relativistic electron sheets is proposed. With a circularly polarized relativistic laser pulse, the scattered x-ray signal can have a saddlelike temporal profile, where the lower electromagnetic frequencies are found mostly in the center region of this saddlelike profile. By filtering out the latter, we can obtain two few-attosecond pulses separated by a subfemtosecond interval, which is tunable by controlling the energy of the sheet electrons. Such a pulse pair can be useful for an attosecond pump probe at an unprecedented time resolution and for ultrafast chiral studies in molecules and materials.

  2. Comparison of 2015 Medicare relative value units for gender-specific procedures: Gynecologic and gynecologic-oncologic versus urologic CPT coding. Has time healed gender-worth?

    PubMed

    Benoit, M F; Ma, J F; Upperman, B A

    2017-02-01

    In 1992, Congress implemented a relative value unit (RVU) payment system to set reimbursement for all procedures covered by Medicare. In 1997, data supported that a significant gender bias existed in reimbursement for gynecologic compared to urologic procedures. The present study was performed to compare work and total RVU's for gender specific procedures effective January 2015 and to evaluate if time has healed the gender-based RVU worth. Using the 2015 CPT codes, we compared work and total RVU's for 50 pairs of gender specific procedures. We also evaluated 2015 procedure related provider compensation. The groups were matched so that the procedures were anatomically similar. We also compared 2015 to 1997 RVU and fee schedules. Evaluation of work RVU's for the paired procedures revealed that in 36 cases (72%), male vs female procedures had a higher wRVU and tRVU. For total fee/reimbursement, 42 (84%) male based procedures were compensated at a higher rate than the paired female procedures. On average, male specific surgeries were reimbursed at an amount that was 27.67% higher for male procedures than for female-specific surgeries. Female procedure based work RVU's have increased minimally from 1997 to 2015. Time and effort have trended towards resolution of some gender-related procedure worth discrepancies but there are still significant RVU and compensation differences that should be further reviewed and modified as surgical time and effort highly correlate. Copyright © 2016. Published by Elsevier Inc.

  3. Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics

    PubMed Central

    Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.

    2015-01-01

    Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

  4. Identification of squid species by melting temperature shifts on fluorescence melting curve analysis (FMCA) using single dual-labeled probe

    NASA Astrophysics Data System (ADS)

    Koh, Eunjung; Song, Ha Jeong; Kwon, Na Young; Kim, Gi Won; Lee, Kwang Ho; Jo, Soyeon; Park, Sujin; Park, Jihyun; Park, Eun Kyeong; Hwang, Seung Yong

    2017-06-01

    Real time PCR is a standard method for identification of species. One of limitations of the qPCR is that there would be false-positive result due to mismatched hybridization between target sequence and probe depending on the annealing temperature in the PCR condition. As an alternative, fluorescence melting curve analysis (FMCA) could be applied for species identification. FMCA is based on a dual-labeled probe. Even with subtle difference of target sequence, there are visible melting temperature (Tm) shift. One of FMCA applications is distinguishing organisms distributed and consumed globally as popular food ingredients. Their prices are set by species or country of origin. However, counterfeiting or distributing them without any verification procedure are becoming social problems and threatening food safety. Besides distinguishing them in naked eye is very difficult and almost impossible in any processed form. Therefore, it is necessary to identify species in molecular level. In this research three species of squids which have 1-2 base pair differences each are selected as samples since they have the same issue. We designed a probe which perfectly matches with one species and the others mismatches 2 and 1 base pair respectively and labeled with fluorophore and quencher. In an experiment with a single probe, we successfully distinguished them by Tm shift depending on the difference of base pair. By combining FMCA and qPCR chip, smaller-scale assay with higher sensitivity and resolution could be possible, andc furthermore, enabling results analysis with smart phone would realize point-of-care testing (POCT).

  5. Molecular epidemiology of Plum pox virus in Japan.

    PubMed

    Maejima, Kensaku; Himeno, Misako; Komatsu, Ken; Takinami, Yusuke; Hashimoto, Masayoshi; Takahashi, Shuichiro; Yamaji, Yasuyuki; Oshima, Kenro; Namba, Shigetou

    2011-05-01

    For a molecular epidemiological study based on complete genome sequences, 37 Plum pox virus (PPV) isolates were collected from the Kanto region in Japan. Pair-wise analyses revealed that all 37 Japanese isolates belong to the PPV-D strain, with low genetic diversity (less than 0.8%). In phylogenetic analysis of the PPV-D strain based on complete nucleotide sequences, the relationships of the PPV-D strain were reconstructed with high resolution: at the global level, the American, Canadian, and Japanese isolates formed their own distinct monophyletic clusters, suggesting that the routes of viral entry into these countries were independent; at the local level, the actual transmission histories of PPV were precisely reconstructed with high bootstrap support. This is the first description of the molecular epidemiology of PPV based on complete genome sequences.

  6. Efficient and accurate local approximations to coupled-electron pair approaches: An attempt to revive the pair natural orbital method

    NASA Astrophysics Data System (ADS)

    Neese, Frank; Wennmohs, Frank; Hansen, Andreas

    2009-03-01

    Coupled-electron pair approximations (CEPAs) and coupled-pair functionals (CPFs) have been popular in the 1970s and 1980s and have yielded excellent results for small molecules. Recently, interest in CEPA and CPF methods has been renewed. It has been shown that these methods lead to competitive thermochemical, kinetic, and structural predictions. They greatly surpass second order Møller-Plesset and popular density functional theory based approaches in accuracy and are intermediate in quality between CCSD and CCSD(T) in extended benchmark studies. In this work an efficient production level implementation of the closed shell CEPA and CPF methods is reported that can be applied to medium sized molecules in the range of 50-100 atoms and up to about 2000 basis functions. The internal space is spanned by localized internal orbitals. The external space is greatly compressed through the method of pair natural orbitals (PNOs) that was also introduced by the pioneers of the CEPA approaches. Our implementation also makes extended use of density fitting (or resolution of the identity) techniques in order to speed up the laborious integral transformations. The method is called local pair natural orbital CEPA (LPNO-CEPA) (LPNO-CPF). The implementation is centered around the concepts of electron pairs and matrix operations. Altogether three cutoff parameters are introduced that control the size of the significant pair list, the average number of PNOs per electron pair, and the number of contributing basis functions per PNO. With the conservatively chosen default values of these thresholds, the method recovers about 99.8% of the canonical correlation energy. This translates to absolute deviations from the canonical result of only a few kcal mol-1. Extended numerical test calculations demonstrate that LPNO-CEPA (LPNO-CPF) has essentially the same accuracy as parent CEPA (CPF) methods for thermochemistry, kinetics, weak interactions, and potential energy surfaces but is up to 500 times faster. The method performs best in conjunction with large and flexible basis sets. These results open the way for large-scale chemical applications.

  7. Efficient and accurate local approximations to coupled-electron pair approaches: An attempt to revive the pair natural orbital method.

    PubMed

    Neese, Frank; Wennmohs, Frank; Hansen, Andreas

    2009-03-21

    Coupled-electron pair approximations (CEPAs) and coupled-pair functionals (CPFs) have been popular in the 1970s and 1980s and have yielded excellent results for small molecules. Recently, interest in CEPA and CPF methods has been renewed. It has been shown that these methods lead to competitive thermochemical, kinetic, and structural predictions. They greatly surpass second order Moller-Plesset and popular density functional theory based approaches in accuracy and are intermediate in quality between CCSD and CCSD(T) in extended benchmark studies. In this work an efficient production level implementation of the closed shell CEPA and CPF methods is reported that can be applied to medium sized molecules in the range of 50-100 atoms and up to about 2000 basis functions. The internal space is spanned by localized internal orbitals. The external space is greatly compressed through the method of pair natural orbitals (PNOs) that was also introduced by the pioneers of the CEPA approaches. Our implementation also makes extended use of density fitting (or resolution of the identity) techniques in order to speed up the laborious integral transformations. The method is called local pair natural orbital CEPA (LPNO-CEPA) (LPNO-CPF). The implementation is centered around the concepts of electron pairs and matrix operations. Altogether three cutoff parameters are introduced that control the size of the significant pair list, the average number of PNOs per electron pair, and the number of contributing basis functions per PNO. With the conservatively chosen default values of these thresholds, the method recovers about 99.8% of the canonical correlation energy. This translates to absolute deviations from the canonical result of only a few kcal mol(-1). Extended numerical test calculations demonstrate that LPNO-CEPA (LPNO-CPF) has essentially the same accuracy as parent CEPA (CPF) methods for thermochemistry, kinetics, weak interactions, and potential energy surfaces but is up to 500 times faster. The method performs best in conjunction with large and flexible basis sets. These results open the way for large-scale chemical applications.

  8. iSeq: Web-Based RNA-seq Data Analysis and Visualization.

    PubMed

    Zhang, Chao; Fan, Caoqi; Gan, Jingbo; Zhu, Ping; Kong, Lei; Li, Cheng

    2018-01-01

    Transcriptome sequencing (RNA-seq) is becoming a standard experimental methodology for genome-wide characterization and quantification of transcripts at single base-pair resolution. However, downstream analysis of massive amount of sequencing data can be prohibitively technical for wet-lab researchers. A functionally integrated and user-friendly platform is required to meet this demand. Here, we present iSeq, an R-based Web server, for RNA-seq data analysis and visualization. iSeq is a streamlined Web-based R application under the Shiny framework, featuring a simple user interface and multiple data analysis modules. Users without programming and statistical skills can analyze their RNA-seq data and construct publication-level graphs through a standardized yet customizable analytical pipeline. iSeq is accessible via Web browsers on any operating system at http://iseq.cbi.pku.edu.cn .

  9. Mars Exploration Rover engineering cameras

    USGS Publications Warehouse

    Maki, J.N.; Bell, J.F.; Herkenhoff, K. E.; Squyres, S. W.; Kiely, A.; Klimesh, M.; Schwochert, M.; Litwin, T.; Willson, R.; Johnson, Aaron H.; Maimone, M.; Baumgartner, E.; Collins, A.; Wadsworth, M.; Elliot, S.T.; Dingizian, A.; Brown, D.; Hagerott, E.C.; Scherr, L.; Deen, R.; Alexander, D.; Lorre, J.

    2003-01-01

    NASA's Mars Exploration Rover (MER) Mission will place a total of 20 cameras (10 per rover) onto the surface of Mars in early 2004. Fourteen of the 20 cameras are designated as engineering cameras and will support the operation of the vehicles on the Martian surface. Images returned from the engineering cameras will also be of significant importance to the scientific community for investigative studies of rock and soil morphology. The Navigation cameras (Navcams, two per rover) are a mast-mounted stereo pair each with a 45?? square field of view (FOV) and an angular resolution of 0.82 milliradians per pixel (mrad/pixel). The Hazard Avoidance cameras (Hazcams, four per rover) are a body-mounted, front- and rear-facing set of stereo pairs, each with a 124?? square FOV and an angular resolution of 2.1 mrad/pixel. The Descent camera (one per rover), mounted to the lander, has a 45?? square FOV and will return images with spatial resolutions of ???4 m/pixel. All of the engineering cameras utilize broadband visible filters and 1024 x 1024 pixel detectors. Copyright 2003 by the American Geophysical Union.

  10. Micropreparative capillary gel electrophoresis of DNA: rapid expressed sequence tag library construction.

    PubMed

    Shi, Liang; Khandurina, Julia; Ronai, Zsolt; Li, Bi-Yu; Kwan, Wai King; Wang, Xun; Guttman, András

    2003-01-01

    A capillary gel electrophoresis based automated DNA fraction collection technique was developed to support a novel DNA fragment-pooling strategy for expressed sequence tag (EST) library construction. The cDNA population is first cleaved by BsaJ I and EcoR I restriction enzymes, and then subpooled by selective ligation with specific adapters followed by polymerase chain reaction (PCR) amplification and labeling. Combination of this cDNA fingerprinting method with high-resolution capillary gel electrophoresis separation and precise fractionation of individual cDNA transcript representatives avoids redundant fragment selection and concomitant repetitive sequencing of abundant transcripts. Using a computer-controlled capillary electrophoresis device the transcript representatives were separated by their size and fractions were automatically collected in every 30 s into 96-well plates. The high resolving power of the sieving matrix ensured sequencing grade separation of the DNA fragments (i.e., single-base resolution) and successful fraction collection. Performance and precision of the fraction collection procedure was validated by PCR amplification of the collected DNA fragments followed by capillary electrophoresis analysis for size and purity verification. The collected and PCR-amplified transcript representatives, ranging up to several hundred base pairs, were then sequenced to create an EST library.

  11. Custom Super-Resolution Microscope for the Structural Analysis of Nanostructures

    DTIC Science & Technology

    2018-05-29

    research community. As part of our validation of the new design approach, we performed two - color imaging of pairs of adjacent oligo probes hybridized...nanostructures and biological targets. Our microscope features a large field of view and custom optics that facilitate 3D imaging and enhanced contrast in...our imaging throughput by creating two microscopy platforms for high-throughput, super-resolution materials characterization, with the AO set-up being

  12. A High-Resolution Cluster of Oceanographic Instruments for Boundary Layer Measurements under Ice.

    DTIC Science & Technology

    1985-11-01

    arrangement for use with laser velocimetry. The EO components are mounted on an aluminum chassis, which is in turn placed in an underwater housing made...temperature/conductivity probe pair used * on the HRC cluster. It consists of a thermistor probe (FASTIP, Model FP07, Thermometrics , Inc.) and a dual...component. The orientation of all three DLT)V pairs is shown in Figure 1. 3.2 Temperature and Conductivity Probes The FASTIP thermistor by Thermometrics

  13. Characterisation and comparison of event generators for pair conversion: A crucial step for future low energy gamma telescope

    NASA Astrophysics Data System (ADS)

    Gros, P.; Bernard, D.

    2017-05-01

    Gamma ray astronomy suffers from a sensitivity gap between 0.1 and 100Mev. With high angular resolution for the electrons, it will also be possible to probe the linear polarisation of the photons. An accurate simulation is necessary to correctly design and compare these detectors. We establish baseline distributions of key kinematic variables as simulated by a 5D, exact down to threshold, and polarised event generator. We compare them to simulations with the low energy electromagnetic models available in Geant4 and in EGS5. We show that different generators give a different picture of the optimal angular resolution of pair telescopes. We also show that, of all the simulations we used, only the full 5D generator describes accurately the angular asymmetry in the case of polarised photons.

  14. The 3-amino-derivative of gamma-cyclodextrin as chiral selector of Dns-amino acids in electrokinetic chromatography.

    PubMed

    Giuffrida, A; Contino, A; Maccarrone, G; Messina, M; Cucinotta, V

    2009-04-24

    The enantioseparation of the enantiomeric pairs of 10 Dns derivatives of alpha-amino acids was successfully carried out by using for the first time the 3-amino derivative of the gamma-cyclodextrin. The effects of pH and selector concentration on the migration times and the resolutions of analytes were studied in detail. 3-Deoxy-3-amino-2(S),3(R)-gamma-cyclodextrin (GCD3AM) shows very good chiral recognition ability even at very low concentrations at all the three investigated values of pH, as shown by the very large values of selectivity and resolution towards several pairs of amino acids. The role played by the cavity, the substitution site and the protonation equilibria on the observed properties of chiral selectivity, on varying the specific amino acid involved, is discussed.

  15. Insight of endo-1,4-xylanase II from Trichoderma reesei: conserved water-mediated H-bond and ion pairs interactions.

    PubMed

    Vijayakumar, Balakrishnan; Velmurugan, Devadasan

    2013-12-01

    Endo-1,4-Xylanase II is an enzyme which degrades the linear polysaccharide beta-1,4-xylan into xylose. This enzyme shows highest enzyme activity around 55 °C, even without being stabilized by the disulphide bridges. A set of nine high resolution crystal structures of Xylanase II (1.11-1.80 Å) from Trichoderma reesei were selected and analyzed in order to identify the invariant water molecules, ion pairs and water-mediated ionic interactions. The crystal structure (PDB-id: 2DFB) solved at highest resolution (1.11 Å) was chosen as the reference and the remaining structures were treated as mobile molecules. These structures were then superimposed with the reference molecule to observe the invariant water molecules using 3-dimensional structural superposition server. A total of 37 water molecules were identified to be invariant molecules in all the crystal structures, of which 26 invariant molecules have hydrogen bond interactions with the back bone of residues and 21 invariant water molecules have interactions with side chain residues. The structural and functional roles of these water molecules and ion pairs have been discussed. The results show that the invariant water molecules and ion pairs may be involved in maintaining the structural architecture, dynamics and function of the Endo-1,4-Xylanase II.

  16. Massively parallel sensing of trace molecules and their isotopologues with broadband subharmonic mid-infrared frequency combs

    NASA Astrophysics Data System (ADS)

    Muraviev, A. V.; Smolski, V. O.; Loparo, Z. E.; Vodopyanov, K. L.

    2018-04-01

    Mid-infrared spectroscopy offers supreme sensitivity for the detection of trace gases, solids and liquids based on tell-tale vibrational bands specific to this spectral region. Here, we present a new platform for mid-infrared dual-comb Fourier-transform spectroscopy based on a pair of ultra-broadband subharmonic optical parametric oscillators pumped by two phase-locked thulium-fibre combs. Our system provides fast (7 ms for a single interferogram), moving-parts-free, simultaneous acquisition of 350,000 spectral data points, spaced by a 115 MHz intermodal interval over the 3.1-5.5 µm spectral range. Parallel detection of 22 trace molecular species in a gas mixture, including isotopologues containing isotopes such as 13C, 18O, 17O, 15N, 34S, 33S and deuterium, with part-per-billion sensitivity and sub-Doppler resolution is demonstrated. The technique also features absolute optical frequency referencing to an atomic clock, a high degree of mutual coherence between the two mid-infrared combs with a relative comb-tooth linewidth of 25 mHz, coherent averaging and feasibility for kilohertz-scale spectral resolution.

  17. The Optimization of Electrophoresis on a Glass Microfluidic Chip and its Application in Forensic Science.

    PubMed

    Han, Jun P; Sun, Jing; Wang, Le; Liu, Peng; Zhuang, Bin; Zhao, Lei; Liu, Yao; Li, Cai X

    2017-11-01

    Microfluidic chips offer significant speed, cost, and sensitivity advantages, but numerous parameters must be optimized to provide microchip electrophoresis detection. Experiments were conducted to study the factors, including sieving matrices (the concentration and type), surface modification, analysis temperature, and electric field strengths, which all impact the effectiveness of microchip electrophoresis detection of DNA samples. Our results showed that the best resolution for ssDNA was observed using 4.5% w/v (7 M urea) lab-fabricated LPA gel, dynamic wall coating of the microchannel, electrophoresis temperatures between 55 and 60°C, and electrical fields between 350 and 450 V/cm on the microchip-based capillary electrophoresis (μCE) system. One base-pair resolution could be achieved in the 19-cm-length microchannel. Furthermore, both 9947A standard genomic DNA and DNA extracted from blood spots were demonstrated to be successfully separated with well-resolved DNA peaks in 8 min. Therefore, the microchip electrophoresis system demonstrated good potential for rapid forensic DNA analysis. © 2017 American Academy of Forensic Sciences.

  18. Temporal and spatial scaling impacts on extreme precipitation

    NASA Astrophysics Data System (ADS)

    Eggert, B.; Berg, P.; Haerter, J. O.; Jacob, D.; Moseley, C.

    2015-01-01

    Both in the current climate and in the light of climate change, understanding of the causes and risk of precipitation extremes is essential for protection of human life and adequate design of infrastructure. Precipitation extreme events depend qualitatively on the temporal and spatial scales at which they are measured, in part due to the distinct types of rain formation processes that dominate extremes at different scales. To capture these differences, we first filter large datasets of high-resolution radar measurements over Germany (5 min temporally and 1 km spatially) using synoptic cloud observations, to distinguish convective and stratiform rain events. In a second step, for each precipitation type, the observed data are aggregated over a sequence of time intervals and spatial areas. The resulting matrix allows a detailed investigation of the resolutions at which convective or stratiform events are expected to contribute most to the extremes. We analyze where the statistics of the two types differ and discuss at which resolutions transitions occur between dominance of either of the two precipitation types. We characterize the scales at which the convective or stratiform events will dominate the statistics. For both types, we further develop a mapping between pairs of spatially and temporally aggregated statistics. The resulting curve is relevant when deciding on data resolutions where statistical information in space and time is balanced. Our study may hence also serve as a practical guide for modelers, and for planning the space-time layout of measurement campaigns. We also describe a mapping between different pairs of resolutions, possibly relevant when working with mismatched model and observational resolutions, such as in statistical bias correction.

  19. Daily monitoring of 30 m crop condition over complex agricultural landscapes

    NASA Astrophysics Data System (ADS)

    Sun, L.; Gao, F.; Xie, D.; Anderson, M. C.; Yang, Y.

    2017-12-01

    Crop progress provides information necessary for efficient irrigation, scheduling fertilization and harvesting operations at optimal times for achieving higher yields. In the United States, crop progress reports are released online weekly by US Department of Agriculture (USDA) - National Agricultural Statistics Service (NASS). However, the ground data collection is time consuming and subjective, and these reports are provided at either district (multiple counties) or state level. Remote sensing technologies have been widely used to map crop conditions, to extract crop phenology, and to predict crop yield. However, for current satellite-based sensors, it is difficult to acquire both high spatial resolution and frequent coverage. For example, Landsat satellites are capable to capture 30 m resolution images, while the long revisit cycles, cloud contamination further limited their use in detecting rapid surface changes. On the other hand, MODIS can provide daily observations, but with coarse spatial resolutions range from 250 to 1000 m. In recent years, multi-satellite data fusion technology such as the Spatial and Temporal Adaptive Reflectance Fusion Model (STARFM) has been used to combine the spatial resolution of Landsat with the temporal frequency of MODIS. It has been found that this synthetic dataset could provide more valuable information compared to the images acquired from only one single sensor. However, accuracy of STARFM depends on heterogeneity of landscape and available clear image pairs of MODIS and Landsat. In this study, a new fusion method was developed using the crop vegetation index (VI) timeseries extracted from "pure" MODIS pixels and Landsat overpass images to generate daily 30 m VI for crops. The fusion accuracy was validated by comparing to the original Landsat images. Results show that the relative error in non-rapid growing period is around 3-5% and in rapid growing period is around 6-8% . The accuracy is much better than that of STARFM which is 4-9% in non-rapid growing period and 10-16% in rapid growing period based on 13 image pairs. The predicted VI from this approach looks consistent and smooth in the SLC-off gap stripes of Landsat 7 ETM+ image. The new fusion results will be used to map crop phenology and to predict crop yield at field scale in the complex agricultural landscapes.

  20. Nucleic acid duplexes incorporating a dissociable covalent base pair

    NASA Technical Reports Server (NTRS)

    Gao, K.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    1999-01-01

    We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure.

  1. A Theoretical Study and Numerical Simulation of a Quasi-Distributed Sensor Based on the Low-Finesse Fabry-Perot Interferometer: Frequency-Division Multiplexing

    PubMed Central

    Guillen Bonilla, José Trinidad; Guillen Bonilla, Alex; Rodríguez Betancourtt, Verónica M.; Guillen Bonilla, Héctor; Casillas Zamora, Antonio

    2017-01-01

    The application of the sensor optical fibers in the areas of scientific instrumentation and industrial instrumentation is very attractive due to its numerous advantages. In the industry of civil engineering for example, quasi-distributed sensors made with optical fiber are used for reliable strain and temperature measurements. Here, a quasi-distributed sensor in the frequency domain is discussed. The sensor consists of a series of low-finesse Fabry-Perot interferometers where each Fabry-Perot interferometer acts as a local sensor. Fabry-Perot interferometers are formed by pairs of identical low reflective Bragg gratings imprinted in a single mode fiber. All interferometer sensors have different cavity length, provoking frequency-domain multiplexing. The optical signal represents the superposition of all interference patterns which can be decomposed using the Fourier transform. The frequency spectrum was analyzed and sensor’s properties were defined. Following that, a quasi-distributed sensor was numerically simulated. Our sensor simulation considers sensor properties, signal processing, noise system, and instrumentation. The numerical results show the behavior of resolution vs. signal-to-noise ratio. From our results, the Fabry-Perot sensor has high resolution and low resolution. Both resolutions are conceivable because the Fourier Domain Phase Analysis (FDPA) algorithm elaborates two evaluations of Bragg wavelength shift. PMID:28420083

  2. A Theoretical Study and Numerical Simulation of a Quasi-Distributed Sensor Based on the Low-Finesse Fabry-Perot Interferometer: Frequency-Division Multiplexing.

    PubMed

    Guillen Bonilla, José Trinidad; Guillen Bonilla, Alex; Rodríguez Betancourtt, Verónica M; Guillen Bonilla, Héctor; Casillas Zamora, Antonio

    2017-04-14

    The application of the sensor optical fibers in the areas of scientific instrumentation and industrial instrumentation is very attractive due to its numerous advantages. In the industry of civil engineering for example, quasi-distributed sensors made with optical fiber are used for reliable strain and temperature measurements. Here, a quasi-distributed sensor in the frequency domain is discussed. The sensor consists of a series of low-finesse Fabry-Perot interferometers where each Fabry-Perot interferometer acts as a local sensor. Fabry-Perot interferometers are formed by pairs of identical low reflective Bragg gratings imprinted in a single mode fiber. All interferometer sensors have different cavity length, provoking frequency-domain multiplexing. The optical signal represents the superposition of all interference patterns which can be decomposed using the Fourier transform. The frequency spectrum was analyzed and sensor's properties were defined. Following that, a quasi-distributed sensor was numerically simulated. Our sensor simulation considers sensor properties, signal processing, noise system, and instrumentation. The numerical results show the behavior of resolution vs. signal-to-noise ratio. From our results, the Fabry-Perot sensor has high resolution and low resolution. Both resolutions are conceivable because the Fourier Domain Phase Analysis (FDPA) algorithm elaborates two evaluations of Bragg wavelength shift.

  3. pyBSM: A Python package for modeling imaging systems

    NASA Astrophysics Data System (ADS)

    LeMaster, Daniel A.; Eismann, Michael T.

    2017-05-01

    There are components that are common to all electro-optical and infrared imaging system performance models. The purpose of the Python Based Sensor Model (pyBSM) is to provide open source access to these functions for other researchers to build upon. Specifically, pyBSM implements much of the capability found in the ERIM Image Based Sensor Model (IBSM) V2.0 along with some improvements. The paper also includes two use-case examples. First, performance of an airborne imaging system is modeled using the General Image Quality Equation (GIQE). The results are then decomposed into factors affecting noise and resolution. Second, pyBSM is paired with openCV to evaluate performance of an algorithm used to detect objects in an image.

  4. The Mast Cameras and Mars Descent Imager (MARDI) for the 2009 Mars Science Laboratory

    NASA Technical Reports Server (NTRS)

    Malin, M. C.; Bell, J. F.; Cameron, J.; Dietrich, W. E.; Edgett, K. S.; Hallet, B.; Herkenhoff, K. E.; Lemmon, M. T.; Parker, T. J.; Sullivan, R. J.

    2005-01-01

    Based on operational experience gained during the Mars Exploration Rover (MER) mission, we proposed and were selected to conduct two related imaging experiments: (1) an investigation of the geology and short-term atmospheric vertical wind profile local to the Mars Science Laboratory (MSL) landing site using descent imaging, and (2) a broadly-based scientific investigation of the MSL locale employing visible and very near infra-red imaging techniques from a pair of mast-mounted, high resolution cameras. Both instruments share a common electronics design, a design also employed for the MSL Mars Hand Lens Imager (MAHLI) [1]. The primary differences between the cameras are in the nature and number of mechanisms and specific optics tailored to each camera s requirements.

  5. Generalizations of the subject-independent feature set for music-induced emotion recognition.

    PubMed

    Lin, Yuan-Pin; Chen, Jyh-Horng; Duann, Jeng-Ren; Lin, Chin-Teng; Jung, Tzyy-Ping

    2011-01-01

    Electroencephalogram (EEG)-based emotion recognition has been an intensely growing field. Yet, how to achieve acceptable accuracy on a practical system with as fewer electrodes as possible is less concerned. This study evaluates a set of subject-independent features, based on differential power asymmetry of symmetric electrode pairs [1], with emphasis on its applicability to subject variability in music-induced emotion classification problem. Results of this study have evidently validated the feasibility of using subject-independent EEG features to classify four emotional states with acceptable accuracy in second-scale temporal resolution. These features could be generalized across subjects to detect emotion induced by music excerpts not limited to the music database that was used to derive the emotion-specific features.

  6. Measurement of the φ* η distribution of muon pairs with masses between 30 and 500 GeV in 10.4 fb -1 of pp¯ collisions

    DOE PAGES

    Abazov, Victor Mukhamedovich

    2015-04-06

    We present a measurement of the distribution of the variable φ* η for muon pairs with masses between 30 and 500 GeV, using the complete run II data set collected by the D0 detector at the Fermilab Tevatron proton-antiproton collider. This corresponds to an integrated luminosity of 10.4 fb –1 at √s = 1.96 TeV. The data are corrected for detector effects and presented in bins of dimuon rapidity and mass. The variable φ* η probes the same physical effects as the Z/γ* boson transverse momentum, but is less susceptible to the effects of experimental resolution and efficiency. These aremore » the first measurements at any collider of the φ* η distributions for dilepton masses away from the Z → ℓ +ℓ – boson mass peak. As a result, the data are compared to QCD predictions based on the resummation of multiple soft gluons.« less

  7. Collision-induced Absorption in the Infrared: A Data Base for Modelling Planetary and Stellar Atmospheres

    NASA Technical Reports Server (NTRS)

    Borysow, Aleksandra

    1998-01-01

    Accurate knowledge of certain collision-induced absorption continua of molecular pairs such as H2-H2, H2-He, H2-CH4, CO2-CO2, etc., is a prerequisite for most spectral analyses and modelling attempts of atmospheres of planets and cold stars. We collect and regularly update simple, state of the art computer programs for the calculation of the absorption coefficient of such molecular pairs over a broad range of temperatures and frequencies, for the various rotovibrational bands. The computational results are in agreement with the existing laboratory measurements of such absorption continua, recorded with a spectral resolution of a few wavenumbers, but reliable computational results may be expected even in the far wings, and at temperatures for which laboratory measurements do not exist. Detailed information is given concerning the systems thus studied, the temperature and frequency ranges considered, the rotovibrational bands thus modelled, and how one may obtain copies of the FORTRAN77 computer programs by e-mail.

  8. Superconductivity in an electron band just above the Fermi level: possible route to BCS-BEC superconductivity.

    PubMed

    Okazaki, K; Ito, Y; Ota, Y; Kotani, Y; Shimojima, T; Kiss, T; Watanabe, S; Chen, C-T; Niitaka, S; Hanaguri, T; Takagi, H; Chainani, A; Shin, S

    2014-02-28

    Conventional superconductivity follows Bardeen-Cooper-Schrieffer(BCS) theory of electrons-pairing in momentum-space, while superfluidity is the Bose-Einstein condensation(BEC) of atoms paired in real-space. These properties of solid metals and ultra-cold gases, respectively, are connected by the BCS-BEC crossover. Here we investigate the band dispersions in FeTe(0.6)Se(0.4)(Tc = 14.5 K ~ 1.2 meV) in an accessible range below and above the Fermi level(EF) using ultra-high resolution laser angle-resolved photoemission spectroscopy. We uncover an electron band lying just 0.7 meV (~8 K) above EF at the Γ-point, which shows a sharp superconducting coherence peak with gap formation below Tc. The estimated superconducting gap Δ and Fermi energy [Symbol: see text]F indicate composite superconductivity in an iron-based superconductor, consisting of strong-coupling BEC in the electron band and weak-coupling BCS-like superconductivity in the hole band. The study identifies the possible route to BCS-BEC superconductivity.

  9. Nanoscale Ultrasound-Switchable FRET-Based Liposomes for Near-Infrared Fluorescence Imaging in Optically Turbid Media.

    PubMed

    Zhang, Qimei; Morgan, Stephen P; Mather, Melissa L

    2017-09-01

    A new approach for fluorescence imaging in optically turbid media centered on the use of nanoscale ultrasound-switchable FRET-based liposome contrast agents is reported. Liposomes containing lipophilic carbocyanine dyes as FRET pairs with emission wavelengths located in the near-infrared window are prepared. The efficacy of FRET and self-quenching for liposomes with a range of fluorophore concentrations is first calculated from measurement of the liposome emission spectra. Exposure of the liposomes to ultrasound results in changes in the detected fluorescent signal, the nature of which depends on the fluorophores used, detection wavelength, and the fluorophore concentration. Line scanning of a tube containing the contrast agents with 1 mm inner diameter buried at a depth of 1 cm in a heavily scattering tissue phantom demonstrates an improvement in image spatial resolution by a factor of 6.3 as compared with images obtained in the absence of ultrasound. Improvements are also seen in image contrast with the highest obtained being 9% for a liposome system containing FRET pairs. Overall the results obtained provide evidence of the potential the nanoscale ultrasound-switchable FRET-based liposomes studied here have for in vivo fluorescence imaging. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Relative Error Evaluation to Typical Open Global dem Datasets in Shanxi Plateau of China

    NASA Astrophysics Data System (ADS)

    Zhao, S.; Zhang, S.; Cheng, W.

    2018-04-01

    Produced by radar data or stereo remote sensing image pairs, global DEM datasets are one of the most important types for DEM data. Relative error relates to surface quality created by DEM data, so it relates to geomorphology and hydrologic applications using DEM data. Taking Shanxi Plateau of China as the study area, this research evaluated the relative error to typical open global DEM datasets including Shuttle Radar Terrain Mission (SRTM) data with 1 arc second resolution (SRTM1), SRTM data with 3 arc second resolution (SRTM3), ASTER global DEM data in the second version (GDEM-v2) and ALOS world 3D-30m (AW3D) data. Through process and selection, more than 300,000 ICESat/GLA14 points were used as the GCP data, and the vertical error was computed and compared among four typical global DEM datasets. Then, more than 2,600,000 ICESat/GLA14 point pairs were acquired using the distance threshold between 100 m and 500 m. Meanwhile, the horizontal distance between every point pair was computed, so the relative error was achieved using slope values based on vertical error difference and the horizontal distance of the point pairs. Finally, false slope ratio (FSR) index was computed through analyzing the difference between DEM and ICESat/GLA14 values for every point pair. Both relative error and FSR index were categorically compared for the four DEM datasets under different slope classes. Research results show: Overall, AW3D has the lowest relative error values in mean error, mean absolute error, root mean square error and standard deviation error; then the SRTM1 data, its values are a little higher than AW3D data; the SRTM3 and GDEM-v2 data have the highest relative error values, and the values for the two datasets are similar. Considering different slope conditions, all the four DEM data have better performance in flat areas but worse performance in sloping regions; AW3D has the best performance in all the slope classes, a litter better than SRTM1; with slope increasing, the relative error for the SRTM3 data increases faster than other DEM datasets; so SRTM3 is better than GDEM-v2 in flat regions but worse in sloping regions. As to FSR value, AW3D has the lowest value, 4.37 %; then SRTM1 data, 5.80 %, similar to AW3D data; SRTM3 has higher value, about 8.27 %; GDEM-v2 data has the highest FSR value, about 12.15 %. FSR can represent the performance of correctly creating the earth surface based on DEM data. Hence, AW3D has the best performance, which is approximate to but a little better than SRTM1. The performance of SRTM3 and GDEM-v2 is similar, which is much worse than AW3D and SRTM1, and the performance of GDEM-v2 is the worst of all. Originated from the DEM dataset with 5m resolution, AW3D is regarded as the most precise global DEM datasets up to now, so it may exerts more effect in topographic analysis and geographic research. Through analysis and comparison of the relative error for the four open global DEM datasets, this research will provide reference in open global DEM datasets selection and applications in geosciences and other relevant fields.

  11. Development of a high resolution optical-fiber tilt sensor by F-P filter

    NASA Astrophysics Data System (ADS)

    Pan, Jianjun; Nan, Qiuming; Li, Shujie; Hao, Zhonghua

    2017-04-01

    A high-resolution tilt sensor is developed, which is composed of a pair of optical fiber collimators and a simple pendulum with an F-P filter. The tilt angle is measured by demodulating the shift of center wavelength of F-P filter, which is caused by incidence angle changing. The relationship between tilted angle and the center wavelength is deduced. Calibration experiment results also confirm the deduction, and show that it is easy to obtain a high resolution. Setting the initial angle to 6degree, the measurement range is ±3degree, its average sensitivity is 1104pm/degree, and its average resolution is as high as 0.0009degree.

  12. The nearest neighbor and next nearest neighbor effects on the thermodynamic and kinetic properties of RNA base pair

    NASA Astrophysics Data System (ADS)

    Wang, Yujie; Wang, Zhen; Wang, Yanli; Liu, Taigang; Zhang, Wenbing

    2018-01-01

    The thermodynamic and kinetic parameters of an RNA base pair with different nearest and next nearest neighbors were obtained through long-time molecular dynamics simulation of the opening-closing switch process of the base pair near its melting temperature. The results indicate that thermodynamic parameters of GC base pair are dependent on the nearest neighbor base pair, and the next nearest neighbor base pair has little effect, which validated the nearest-neighbor model. The closing and opening rates of the GC base pair also showed nearest neighbor dependences. At certain temperature, the closing and opening rates of the GC pair with nearest neighbor AU is larger than that with the nearest neighbor GC, and the next nearest neighbor plays little role. The free energy landscape of the GC base pair with the nearest neighbor GC is rougher than that with nearest neighbor AU.

  13. Estimation and modeling of forest attributes across large spatial scales using BiomeBGC, high-resolution imagery, LiDAR data, and inventory data

    NASA Astrophysics Data System (ADS)

    Golinkoff, Jordan Seth

    The accurate estimation of forest attributes at many different spatial scales is a critical problem. Forest landowners may be interested in estimating timber volume, forest biomass, and forest structure to determine their forest's condition and value. Counties and states may be interested to learn about their forests to develop sustainable management plans and policies related to forests, wildlife, and climate change. Countries and consortiums of countries need information about their forests to set global and national targets to deal with issues of climate change and deforestation as well as to set national targets and understand the state of their forest at a given point in time. This dissertation approaches these questions from two perspectives. The first perspective uses the process model Biome-BGC paired with inventory and remote sensing data to make inferences about a current forest state given known climate and site variables. Using a model of this type, future climate data can be used to make predictions about future forest states as well. An example of this work applied to a forest in northern California is presented. The second perspective of estimating forest attributes uses high resolution aerial imagery paired with light detection and ranging (LiDAR) remote sensing data to develop statistical estimates of forest structure. Two approaches within this perspective are presented: a pixel based approach and an object based approach. Both approaches can serve as the platform on which models (either empirical growth and yield models or process models) can be run to generate inferences about future forest state and current forest biogeochemical cycling.

  14. Multispectral image sharpening using a shift-invariant wavelet transform and adaptive processing of multiresolution edges

    USGS Publications Warehouse

    Lemeshewsky, G.P.; Rahman, Z.-U.; Schowengerdt, R.A.; Reichenbach, S.E.

    2002-01-01

    Enhanced false color images from mid-IR, near-IR (NIR), and visible bands of the Landsat thematic mapper (TM) are commonly used for visually interpreting land cover type. Described here is a technique for sharpening or fusion of NIR with higher resolution panchromatic (Pan) that uses a shift-invariant implementation of the discrete wavelet transform (SIDWT) and a reported pixel-based selection rule to combine coefficients. There can be contrast reversals (e.g., at soil-vegetation boundaries between NIR and visible band images) and consequently degraded sharpening and edge artifacts. To improve performance for these conditions, I used a local area-based correlation technique originally reported for comparing image-pyramid-derived edges for the adaptive processing of wavelet-derived edge data. Also, using the redundant data of the SIDWT improves edge data generation. There is additional improvement because sharpened subband imagery is used with the edge-correlation process. A reported technique for sharpening three-band spectral imagery used forward and inverse intensity, hue, and saturation transforms and wavelet-based sharpening of intensity. This technique had limitations with opposite contrast data, and in this study sharpening was applied to single-band multispectral-Pan image pairs. Sharpening used simulated 30-m NIR imagery produced by degrading the spatial resolution of a higher resolution reference. Performance, evaluated by comparison between sharpened and reference image, was improved when sharpened subband data were used with the edge correlation.

  15. [Structural and Dipole Structure Peculiarities of Hoogsteen Base Pairs Formed in Complementary Nucleobases according to ab initio Quantum Mechanics Studies].

    PubMed

    Petrenko, Y M

    2015-01-01

    Ab initio quantum mechanics studies for the detection of structure and dipole structure peculiarities of Hoogsteen base pairs relative to Watson-Crick base pairs, were performed during our work. These base pairs are formed as a result of complementary interactions. It was revealed, that adenine-thymine Hoogsteen base pair and adenine-thymine Watson-Crick base pairs can be formed depending on initial configuration. Cytosine-guanine Hoogsteen pairs are formed only when cytosine was originally protonated. Both types of Hoogsteen pairs have noticeable difference in the bond distances and angles. These differences appeared in purine as well as in pyrimidine parts of the pairs. Hoogsteen pairs have mostly shorter hydrogen bond lengths and significantly larger angles of hydrogen bonds and larger angles between the hydrogen bonds than Watson-Crick base pairs. Notable differences are also observed with respect to charge distribution and dipole moment. Quantitative data on these differences are shown in our work. It is also reported that the values of local parameters (according to Cambridge classification of the parameters which determine DNA properties) in Hoogsteen base pairs, are greatly different from Watson-Crick ones.

  16. Nucleic acid duplexes incorporating a dissociable covalent base pair

    PubMed Central

    Gao, Kui; Orgel, Leslie E.

    1999-01-01

    We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure. PMID:10611299

  17. X-ray microscopy using reflection targets based on SEM with tungsten filament

    NASA Astrophysics Data System (ADS)

    Liu, Junbiao; Ma, Yutian; Zhao, Weixia; Niu, Geng; Chu, Mingzhang; Yin, Bohua; Han, Li; Liu, Baodong

    2016-10-01

    X-ray MicroandNano imaging is developed based on the conventional x-ray tomography, it can not only provide nondestructive testing with higher resolution measurement, but also be used to examine the material or the structure with low atomic number and low density. The source with micro-focal spot size is one of the key components of x-ray MicroandNano imaging. The focused electron beam from SEM bombarding the metal target can generate x-ray with ultra-small size. It is convenient to set up x-ray microscopy based on SEM for laboratory use. This paper describes a new x-ray microscopy using reflection targets based on FEI Quanta600 SEM with tungsten filament. The flat panel detector is placed outside of the vacuum chamber with 300μm thickness Be-window to isolate vacuum from the air. A stage with 3 DOFs is added to adjust the positions of the target, the SEM's sample stage is used to move sample. And the shape of target is designed as cone with 60° half cone angle to get the maximum x-ray dosage. The attenuation coefficient of Bewindow for x-ray is about 25%. Finally, the line pair card is used to evaluate the resolution and the result shows that the resolution of the system can receive less than 750nm, when the acceleration voltage is 30keV, the beam current is 160nA, the SEM working distance is 5mm and the acquisition time of the detector is 60s.

  18. DNA base pair resolution measurements using resonance energy transfer efficiency in lanthanide doped nanoparticles.

    PubMed

    Delplanque, Aleksandra; Wawrzynczyk, Dominika; Jaworski, Pawel; Matczyszyn, Katarzyna; Pawlik, Krzysztof; Buckle, Malcolm; Nyk, Marcin; Nogues, Claude; Samoc, Marek

    2015-01-01

    Lanthanide-doped nanoparticles are of considerable interest for biodetection and bioimaging techniques thanks to their unique chemical and optical properties. As a sensitive luminescence material, they can be used as (bio) probes in Förster Resonance Energy Transfer (FRET) where trivalent lanthanide ions (La3+) act as energy donors. In this paper we present an efficient method to transfer ultrasmall (ca. 8 nm) NaYF4 nanoparticles dispersed in organic solvent to an aqueous solution via oxidation of the oleic acid ligand. Nanoparticles were then functionalized with single strand DNA oligomers (ssDNA) by inducing covalent bonds between surface carboxylic groups and a 5' amine modified-ssDNA. Hybridization with the 5' fluorophore (Cy5) modified complementary ssDNA strand demonstrated the specificity of binding and allowed the fine control over the distance between Eu3+ ions doped nanoparticle and the fluorophore by varying the number of the dsDNA base pairs. First, our results confirmed nonradiative resonance energy transfer and demonstrate the dependence of its efficiency on the distance between the donor (Eu3+) and the acceptor (Cy5) with sensitivity at a nanometre scale.

  19. Structure of a tetrameric galectin from Cinachyrella sp. (ball sponge)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Freymann, Douglas M., E-mail: freymann@northwestern.edu; Nakamura, Yuka; Focia, Pamela J.

    2012-09-01

    The structure of a tetrameric sponge galectin suggests a basis for glutamate receptor potentiation. The galectins are a family of proteins that bind with highest affinity to N-acetyllactosamine disaccharides, which are common constituents of asparagine-linked complex glycans. They play important and diverse physiological roles, particularly in the immune system, and are thought to be critical metastatic agents for many types of cancer cells, including gliomas. A recent bioactivity-based screen of marine sponge (Cinachyrella sp.) extract identified an ancestral member of the galectin family based on its unexpected ability to positively modulate mammalian ionotropic glutamate receptor function. To gain insight intomore » the mechanistic basis of this activity, the 2.1 Å resolution X-ray structure of one member of the family, galectin CchG-1, is reported. While the protomer exhibited structural similarity to mammalian prototype galectin, CchG-1 adopts a novel tetrameric arrangement in which a rigid toroidal-shaped ‘donut’ is stabilized in part by the packing of pairs of vicinal disulfide bonds. Twofold symmetry between binding-site pairs provides a basis for a model for interaction with ionotropic glutamate receptors.« less

  20. Sensitivity of drainage morphometry based hydrological response (GIUH) of a river basin to the spatial resolution of DEM data

    NASA Astrophysics Data System (ADS)

    Sahoo, Ramendra; Jain, Vikrant

    2018-02-01

    Drainage network pattern and its associated morphometric ratios are some of the important plan form attributes of a drainage basin. Extraction of these attributes for any basin is usually done by spatial analysis of the elevation data of that basin. These planform attributes are further used as input data for studying numerous process-response interactions inside the physical premise of the basin. One of the important uses of the morphometric ratios is its usage in the derivation of hydrologic response of a basin using GIUH concept. Hence, accuracy of the basin hydrological response to any storm event depends upon the accuracy with which, the morphometric ratios can be estimated. This in turn, is affected by the spatial resolution of the source data, i.e. the digital elevation model (DEM). We have estimated the sensitivity of the morphometric ratios and the GIUH derived hydrograph parameters, to the resolution of source data using a 30 meter and a 90 meter DEM. The analysis has been carried out for 50 drainage basins in a mountainous catchment. A simple and comprehensive algorithm has been developed for estimation of the morphometric indices from a stream network. We have calculated all the morphometric parameters and the hydrograph parameters for each of these basins extracted from two different DEMs, with different spatial resolutions. Paired t-test and Sign test were used for the comparison. Our results didn't show any statistically significant difference among any of the parameters calculated from the two source data. Along with the comparative study, a first-hand empirical analysis about the frequency distribution of the morphometric and hydrologic response parameters has also been communicated. Further, a comparison with other hydrological models suggests that plan form morphometry based GIUH model is more consistent with resolution variability in comparison to topographic based hydrological model.

  1. Determination of stellar ages from asteroseismology

    NASA Technical Reports Server (NTRS)

    Ulrich, R. K.

    1986-01-01

    This Letter shows that measurements of the stellar analog of the solar five minute oscillations can permit the determination of the radius and age of isolated stars. The key frequencies of oscillation correspond to pairs of modes differing by two in the degree of the spherical harmonic describing the angular dependence of the motion and by one in the overtone order of the modes. The frequency pairs are very nearly degenerate, and adequate frequency resolution will require a nearly unbroken time sequence extending over 15 days.

  2. Packet based serial link realized in FPGA dedicated for high resolution infrared image transmission

    NASA Astrophysics Data System (ADS)

    Bieszczad, Grzegorz

    2015-05-01

    In article the external digital interface specially designed for thermographic camera built in Military University of Technology is described. The aim of article is to illustrate challenges encountered during design process of thermal vision camera especially related to infrared data processing and transmission. Article explains main requirements for interface to transfer Infra-Red or Video digital data and describes the solution which we elaborated based on Low Voltage Differential Signaling (LVDS) physical layer and signaling scheme. Elaborated link for image transmission is built using FPGA integrated circuit with built-in high speed serial transceivers achieving up to 2500Gbps throughput. Image transmission is realized using proprietary packet protocol. Transmission protocol engine was described in VHDL language and tested in FPGA hardware. The link is able to transmit 1280x1024@60Hz 24bit video data using one signal pair. Link was tested to transmit thermal-vision camera picture to remote monitor. Construction of dedicated video link allows to reduce power consumption compared to solutions with ASIC based encoders and decoders realizing video links like DVI or packed based Display Port, with simultaneous reduction of wires needed to establish link to one pair. Article describes functions of modules integrated in FPGA design realizing several functions like: synchronization to video source, video stream packeting, interfacing transceiver module and dynamic clock generation for video standard conversion.

  3. Molecular recognition of DNA base pairs by the formamido/pyrrole and formamido/imidazole pairings in stacked polyamides.

    PubMed

    Buchmueller, Karen L; Staples, Andrew M; Uthe, Peter B; Howard, Cameron M; Pacheco, Kimberly A O; Cox, Kari K; Henry, James A; Bailey, Suzanna L; Horick, Sarah M; Nguyen, Binh; Wilson, W David; Lee, Moses

    2005-01-01

    Polyamides containing an N-terminal formamido (f) group bind to the minor groove of DNA as staggered, antiparallel dimers in a sequence-specific manner. The formamido group increases the affinity and binding site size, and it promotes the molecules to stack in a staggered fashion thereby pairing itself with either a pyrrole (Py) or an imidazole (Im). There has not been a systematic study on the DNA recognition properties of the f/Py and f/Im terminal pairings. These pairings were analyzed here in the context of f-ImPyPy, f-ImPyIm, f-PyPyPy and f-PyPyIm, which contain the central pairing modes, -ImPy- and -PyPy-. The specificity of these triamides towards symmetrical recognition sites allowed for the f/Py and f/Im terminal pairings to be directly compared by SPR, CD and DeltaT (M) experiments. The f/Py pairing, when placed next to the -ImPy- or -PyPy- central pairings, prefers A/T and T/A base pairs to G/C base pairs, suggesting that f/Py has similar DNA recognition specificity to Py/Py. With -ImPy- central pairings, f/Im prefers C/G base pairs (>10 times) to the other Watson-Crick base pairs; therefore, f/Im behaves like the Py/Im pair. However, the f/Im pairing is not selective for the C/G base pair when placed next to the -PyPy- central pairings.

  4. An overview of instrumentation for the Large Binocular Telescope

    NASA Astrophysics Data System (ADS)

    Wagner, R. Mark

    2012-09-01

    An overview of instrumentation for the Large Binocular Telescope (LBT) is presented. Optical instrumentation includes the Large Binocular Camera (LBC), a pair of wide-field (27' x 27') mosaic CCD imagers at the prime focus, and the Multi-Object Double Spectrograph (MODS), a pair of dual-beam blue-red optimized long-slit spectrographs mounted at the left and right direct F/15 Gregorian foci incorporating multiple slit masks for multi-object spectroscopy over a 6' field and spectral resolutions of up to 2000. Infrared instrumentation includes the LBT Near-IR Spectroscopic Utility with Camera and Integral Field Unit for Extragalactic Research (LUCI), a modular near-infrared (0.9-2.5 μm) imager and spectrograph pair mounted at the left and right front bent F/15 Gregorian foci and designed for seeing-limited (FOV: 4' × 4') imaging, long-slit spectroscopy, and multiobject spectroscopy utilizing cooled slit masks and diffraction limited (FOV: 0'.5 × 0'.5) imaging and long-slit spectroscopy. Strategic instruments under development that can utilize the full 23-m baseline of the LBT include an interferometric cryogenic beam combiner with near-infrared and thermal-infrared instruments for Fizeau imaging and nulling interferometry (LBTI) and an optical bench near-infrared beam combiner utilizing multi-conjugate adaptive optics for high angular resolution and sensitivity (LINC-NIRVANA). LBTI is currently undergoing commissioning on the LBT and utilizing the installed adaptive secondary mirrors in both single- sided and two-sided beam combination modes. In addition, a fiber-fed bench spectrograph (PEPSI) capable of ultra high resolution spectroscopy and spectropolarimetry (R = 40,000-300,000) will be available as a principal investigator instrument. Over the past four years the LBC pair, LUCI1, and MODS1 have been commissioned and are now scheduled for routine partner science observations. The delivery of both LUCI2 and MODS2 is anticipated before the end of 2012. The availability of all these instruments mounted simultaneously on the LBT permits unique science, flexible scheduling, and improved operational support.

  5. Design and evaluation of a THz time domain imaging system using standard optical design software.

    PubMed

    Brückner, Claudia; Pradarutti, Boris; Müller, Ralf; Riehemann, Stefan; Notni, Gunther; Tünnermann, Andreas

    2008-09-20

    A terahertz (THz) time domain imaging system is analyzed and optimized with standard optical design software (ZEMAX). Special requirements to the illumination optics and imaging optics are presented. In the optimized system, off-axis parabolic mirrors and lenses are combined. The system has a numerical aperture of 0.4 and is diffraction limited for field points up to 4 mm and wavelengths down to 750 microm. ZEONEX is used as the lens material. Higher aspherical coefficients are used for correction of spherical aberration and reduction of lens thickness. The lenses were manufactured by ultraprecision machining. For optimization of the system, ray tracing and wave-optical methods were combined. We show how the ZEMAX Gaussian beam analysis tool can be used to evaluate illumination optics. The resolution of the THz system was tested with a wire and a slit target, line gratings of different period, and a Siemens star. The behavior of the temporal line spread function can be modeled with the polychromatic coherent line spread function feature in ZEMAX. The spectral and temporal resolutions of the line gratings are compared with the respective modulation transfer function of ZEMAX. For maximum resolution, the system has to be diffraction limited down to the smallest wavelength of the spectrum of the THz pulse. Then, the resolution on time domain analysis of the pulse maximum can be estimated with the spectral resolution of the center of gravity wavelength. The system resolution near the optical axis on time domain analysis of the pulse maximum is 1 line pair/mm with an intensity contrast of 0.22. The Siemens star is used for estimation of the resolution of the whole system. An eight channel electro-optic sampling system was used for detection. The resolution on time domain analysis of the pulse maximum of all eight channels could be determined with the Siemens star to be 0.7 line pairs/mm.

  6. Unique Thermal Stability of Unnatural Hydrophobic Ds Bases in Double-Stranded DNAs.

    PubMed

    Kimoto, Michiko; Hirao, Ichiro

    2017-10-20

    Genetic alphabet expansion technology, the introduction of unnatural bases or base pairs into replicable DNA, has rapidly advanced as a new synthetic biology area. A hydrophobic unnatural base pair between 7-(2-thienyl)imidazo[4,5-b]pyridine (Ds) and 2-nitro-4-propynylpyrrole (Px) exhibited high fidelity as a third base pair in PCR. SELEX methods using the Ds-Px pair enabled high-affinity DNA aptamer generation, and introducing a few Ds bases into DNA aptamers extremely augmented their affinities and selectivities to target proteins. Here, to further scrutinize the functions of this highly hydrophobic Ds base, the thermal stabilities of double-stranded DNAs (dsDNA) containing a noncognate Ds-Ds or G-Ds pair were examined. The thermal stability of the Ds-Ds self-pair was as high as that of the natural G-C pair, and apart from the generally higher stability of the G-C pair than that of the A-T pair, most of the 5'-pyrimidine-Ds-purine-3' sequences, such as CDsA and TDsA, exhibited higher stability than the 5'-purine-Ds-pyrimidine-3' sequences, such as GDsC and ADsC, in dsDNAs. This trait enabled the GC-content-independent control of the thermal stability of the designed dsDNA fragments. The melting temperatures of dsDNA fragments containing the Ds-Ds pair can be predicted from the nearest-neighbor parameters including the Ds base. In addition, the noncognate G-Ds pair can efficiently distinguish its neighboring cognate natural base pairs from noncognate pairs. We demonstrated that real-time PCR using primers containing Ds accurately detected a single-nucleotide mismatch in target DNAs. These unique properties of the Ds base that affect the stabilities of the neighboring base pairs could impart new functions to DNA molecules and technologies.

  7. Utilization of Prosodic Information in Syntactic Ambiguity Resolution

    PubMed Central

    2010-01-01

    Two self paced listening experiments examined the role of prosodic phrasing in syntactic ambiguity resolution. In Experiment 1, the stimuli consisted of early closure sentences (e.g., “While the parents watched, the child sang a song.”) containing transitive-biased subordinate verbs paired with plausible direct objects or intransitive-biased subordinate verbs paired with implausible direct objects. Experiment 2 also contained early closure sentences with transitively and intransitive-biased subordinate verbs, but the subordinate verbs were always followed by plausible direct objects. In both experiments, there were two prosodic conditions. In the subject-biased prosodic condition, an intonational phrase boundary marked the clausal boundary following the subordinate verb. In the object-biased prosodic condition, the clause boundary was unmarked. The results indicate that lexical and prosodic cues interact at the subordinate verb and plausibility further affects processing at the ambiguous noun. Results are discussed with respect to models of the role of prosody in sentence comprehension. PMID:20033849

  8. Search for pair production of vector-like quarks in the b W b - W channel from proton–proton collisions at s = 13 TeV

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sirunyan, A. M.; Tumasyan, A.; Adam, W.

    A search is presented for the production of vector-like quark pairs, Tmore » $$\\overline{\\mathrm{T}}$$or Y$$\\overline{\\mathrm{Y}}$$, with electric charge of 2/3 (T) or -4/3 (Y), in proton-proton collisions at $$\\sqrt{s} =$$ 13 TeV. The data were collected by the CMS experiment at the LHC in 2016 and correspond to an integrated luminosity of 35.8 fb$$^{-1}$$. The T and Y quarks are assumed to decay exclusively to a W boson and a b quark. The search is based on events with a single isolated electron or muon, large missing transverse momentum, and at least four jets with large transverse momenta. In the search, a kinematic reconstruction of the final state observables is performed, which would permit a signal to be detected as a narrow mass peak ($$\\approx$$7% resolution). The observed number of events is consistent with the standard model prediction. Assuming strong pair production of the vector-like quarks and a 100% branching fraction to bW, a lower limit of 1295 GeV at 95% confidence level is set on the T and Y quark masses.« less

  9. Search for pair production of vector-like quarks in the b W b - W channel from proton–proton collisions at s = 13 TeV

    DOE PAGES

    Sirunyan, A. M.; Tumasyan, A.; Adam, W.; ...

    2018-02-03

    A search is presented for the production of vector-like quark pairs, Tmore » $$\\overline{\\mathrm{T}}$$or Y$$\\overline{\\mathrm{Y}}$$, with electric charge of 2/3 (T) or -4/3 (Y), in proton-proton collisions at $$\\sqrt{s} =$$ 13 TeV. The data were collected by the CMS experiment at the LHC in 2016 and correspond to an integrated luminosity of 35.8 fb$$^{-1}$$. The T and Y quarks are assumed to decay exclusively to a W boson and a b quark. The search is based on events with a single isolated electron or muon, large missing transverse momentum, and at least four jets with large transverse momenta. In the search, a kinematic reconstruction of the final state observables is performed, which would permit a signal to be detected as a narrow mass peak ($$\\approx$$7% resolution). The observed number of events is consistent with the standard model prediction. Assuming strong pair production of the vector-like quarks and a 100% branching fraction to bW, a lower limit of 1295 GeV at 95% confidence level is set on the T and Y quark masses.« less

  10. Hybrid region merging method for segmentation of high-resolution remote sensing images

    NASA Astrophysics Data System (ADS)

    Zhang, Xueliang; Xiao, Pengfeng; Feng, Xuezhi; Wang, Jiangeng; Wang, Zuo

    2014-12-01

    Image segmentation remains a challenging problem for object-based image analysis. In this paper, a hybrid region merging (HRM) method is proposed to segment high-resolution remote sensing images. HRM integrates the advantages of global-oriented and local-oriented region merging strategies into a unified framework. The globally most-similar pair of regions is used to determine the starting point of a growing region, which provides an elegant way to avoid the problem of starting point assignment and to enhance the optimization ability for local-oriented region merging. During the region growing procedure, the merging iterations are constrained within the local vicinity, so that the segmentation is accelerated and can reflect the local context, as compared with the global-oriented method. A set of high-resolution remote sensing images is used to test the effectiveness of the HRM method, and three region-based remote sensing image segmentation methods are adopted for comparison, including the hierarchical stepwise optimization (HSWO) method, the local-mutual best region merging (LMM) method, and the multiresolution segmentation (MRS) method embedded in eCognition Developer software. Both the supervised evaluation and visual assessment show that HRM performs better than HSWO and LMM by combining both their advantages. The segmentation results of HRM and MRS are visually comparable, but HRM can describe objects as single regions better than MRS, and the supervised and unsupervised evaluation results further prove the superiority of HRM.

  11. [The sibling status effects and the personality scales of the MMPI].

    PubMed

    Hama, H; Mine, H; Mine, H; Matsuyama, Y

    1987-06-01

    The purpose of this study is to find out if the personalities of siblings are similar or different. Subjects used were Doshisha University students and members of their families, provided those families had only two children. Altogether 29 pairs of boys and their younger brothers, 47 pairs of boys and their younger sisters, 44 pairs of girls and their younger brothers, and 51 pairs of girls and their younger sisters were given the MMPI individually. Sibling status effects were found in many of the MMPI scores according to the type of sibling dyads and birth order, especially for the sibling dyad of elder brother and younger sister. Personality relationships between the first and second child showed that there were significant correlations in many MMPI scales: L, K, Pd, Pa, Pt, Sc, Si, Conflict resolution, Manifest anxiety, Repression-Sensitization, and Hostility. Among the four types of sibling dyad, the pairs of girls and their younger brothers showed the highest correlation in their personality.

  12. Tilt-Pair Analysis of Images from a Range of Different Specimens in Single-Particle Electron Cryomicroscopy

    PubMed Central

    Henderson, Richard; Chen, Shaoxia; Chen, James Z.; Grigorieff, Nikolaus; Passmore, Lori A.; Ciccarelli, Luciano; Rubinstein, John L.; Crowther, R. Anthony; Stewart, Phoebe L.; Rosenthal, Peter B.

    2011-01-01

    The comparison of a pair of electron microscope images recorded at different specimen tilt angles provides a powerful approach for evaluating the quality of images, image-processing procedures, or three-dimensional structures. Here, we analyze tilt-pair images recorded from a range of specimens with different symmetries and molecular masses and show how the analysis can produce valuable information not easily obtained otherwise. We show that the accuracy of orientation determination of individual single particles depends on molecular mass, as expected theoretically since the information in each particle image increases with molecular mass. The angular uncertainty is less than 1° for particles of high molecular mass (∼ 50 MDa), several degrees for particles in the range 1–5 MDa, and tens of degrees for particles below 1 MDa. Orientational uncertainty may be the major contributor to the effective temperature factor (B-factor) describing contrast loss and therefore the maximum resolution of a structure determination. We also made two unexpected observations. Single particles that are known to be flexible showed a wider spread in orientation accuracy, and the orientations of the largest particles examined changed by several degrees during typical low-dose exposures. Smaller particles presumably also reorient during the exposure; hence, specimen movement is a second major factor that limits resolution. Tilt pairs thus enable assessment of orientation accuracy, map quality, specimen motion, and conformational heterogeneity. A convincing tilt-pair parameter plot, where 60% of the particles show a single cluster around the expected tilt axis and tilt angle, provides confidence in a structure determined using electron cryomicroscopy. PMID:21939668

  13. Nearly complete rRNA genes assembled from across the metazoan animals: effects of more taxa, a structure-based alignment, and paired-sites evolutionary models on phylogeny reconstruction.

    PubMed

    Mallatt, Jon; Craig, Catherine Waggoner; Yoder, Matthew J

    2010-04-01

    This study (1) uses nearly complete rRNA-gene sequences from across Metazoa (197 taxa) to reconstruct animal phylogeny; (2) presents a highly annotated, manual alignment of these sequences with special reference to rRNA features including paired sites (http://purl.oclc.org/NET/rRNA/Metazoan_alignment) and (3) tests, after eliminating as few disruptive, rogue sequences as possible, if a likelihood framework can recover the main metazoan clades. We found that systematic elimination of approximately 6% of the sequences, including the divergent or unstably placed sequences of cephalopods, arrowworm, symphylan and pauropod myriapods, and of myzostomid and nemertodermatid worms, led to a tree that supported Ecdysozoa, Lophotrochozoa, Protostomia, and Bilateria. Deuterostomia, however, was never recovered, because the rRNA of urochordates goes (nonsignificantly) near the base of the Bilateria. Counterintuitively, when we modeled the evolution of the paired sites, phylogenetic resolution was not increased over traditional tree-building models that assume all sites in rRNA evolve independently. The rRNA genes of non-bilaterians contain a higher % AT than do those of most bilaterians. The rRNA genes of Acoela and Myzostomida were found to be secondarily shortened, AT-enriched, and highly modified, throwing some doubt on the location of these worms at the base of Bilateria in the rRNA tree--especially myzostomids, which other evidence suggests are annelids instead. Other findings are marsupial-with-placental mammals, arrowworms in Ecdysozoa (well supported here but contradicted by morphology), and Placozoa as sister to Cnidaria. Finally, despite the difficulties, the rRNA-gene trees are in strong concordance with trees derived from multiple protein-coding genes in supporting the new animal phylogeny. (c) 2009 Elsevier Inc. All rights reserved.

  14. Video-based data acquisition system for use in eye blink classical conditioning procedures in sheep.

    PubMed

    Nation, Kelsey; Birge, Adam; Lunde, Emily; Cudd, Timothy; Goodlett, Charles; Washburn, Shannon

    2017-10-01

    Pavlovian eye blink conditioning (EBC) has been extensively studied in humans and laboratory animals, providing one of the best-understood models of learning in neuroscience. EBC has been especially useful in translational studies of cerebellar and hippocampal function. We recently reported a novel extension of EBC procedures for use in sheep, and now describe new advances in a digital video-based system. The system delivers paired presentations of conditioned stimuli (CSs; a tone) and unconditioned stimuli (USs; an air puff to the eye), or CS-alone "unpaired" trials. This system tracks the linear distance between the eyelids to identify blinks occurring as either unconditioned (URs) or conditioned (CRs) responses, to a resolution of 5 ms. A separate software application (Eye Blink Reviewer) is used to review and autoscore the trial CRs and URs, on the basis of a set of predetermined rules, permitting an operator to confirm (or rescore, if needed) the autoscore results, thereby providing quality control for accuracy of scoring. Learning curves may then be quantified in terms of the frequencies of CRs over sessions, both on trials with paired CS-US presentations and on CS-alone trials. The latency to CR onset, latency to CR peak, and occurrence of URs are also obtained. As we demonstrated in two example cases, this video-based system provides efficient automated means to conduct EBC in sheep and can facilitate fully powered studies with multigroup designs that involve paired and unpaired training. This can help extend new studies in sheep, a species well suited for translational studies of neurodevelopmental disorders resulting from gestational exposure to drugs, toxins, or intrauterine distress.

  15. Tracking quasi-stationary flow of weak fluorescent signals by adaptive multi-frame correlation.

    PubMed

    Ji, L; Danuser, G

    2005-12-01

    We have developed a novel cross-correlation technique to probe quasi-stationary flow of fluorescent signals in live cells at a spatial resolution that is close to single particle tracking. By correlating image blocks between pairs of consecutive frames and integrating their correlation scores over multiple frame pairs, uncertainty in identifying a globally significant maximum in the correlation score function has been greatly reduced as compared with conventional correlation-based tracking using the signal of only two consecutive frames. This approach proves robust and very effective in analysing images with a weak, noise-perturbed signal contrast where texture characteristics cannot be matched between only a pair of frames. It can also be applied to images that lack prominent features that could be utilized for particle tracking or feature-based template matching. Furthermore, owing to the integration of correlation scores over multiple frames, the method can handle signals with substantial frame-to-frame intensity variation where conventional correlation-based tracking fails. We tested the performance of the method by tracking polymer flow in actin and microtubule cytoskeleton structures labelled at various fluorophore densities providing imagery with a broad range of signal modulation and noise. In applications to fluorescent speckle microscopy (FSM), where the fluorophore density is sufficiently low to reveal patterns of discrete fluorescent marks referred to as speckles, we combined the multi-frame correlation approach proposed above with particle tracking. This hybrid approach allowed us to follow single speckles robustly in areas of high speckle density and fast flow, where previously published FSM analysis methods were unsuccessful. Thus, we can now probe cytoskeleton polymer dynamics in living cells at an entirely new level of complexity and with unprecedented detail.

  16. Optimization of dose and image quality in adult and pediatric computed tomography scans

    NASA Astrophysics Data System (ADS)

    Chang, Kwo-Ping; Hsu, Tzu-Kun; Lin, Wei-Ting; Hsu, Wen-Lin

    2017-11-01

    Exploration to maximize CT image and reduce radiation dose was conducted while controlling for multiple factors. The kVp, mAs, and iteration reconstruction (IR), affect the CT image quality and radiation dose absorbed. The optimal protocols (kVp, mAs, IR) are derived by figure of merit (FOM) based on CT image quality (CNR) and CT dose index (CTDIvol). CT image quality metrics such as CT number accuracy, SNR, low contrast materials' CNR and line pair resolution were also analyzed as auxiliary assessments. CT protocols were carried out with an ACR accreditation phantom and a five-year-old pediatric head phantom. The threshold values of the adult CT scan parameters, 100 kVp and 150 mAs, were determined from the CT number test and line pairs in ACR phantom module 1and module 4 respectively. The findings of this study suggest that the optimal scanning parameters for adults be set at 100 kVp and 150-250 mAs. However, for improved low- contrast resolution, 120 kVp and 150-250 mAs are optimal. Optimal settings for pediatric head CT scan were 80 kVp/50 mAs, for maxillary sinus and brain stem, while 80 kVp /300 mAs for temporal bone. SNR is not reliable as the independent image parameter nor the metric for determining optimal CT scan parameters. The iteration reconstruction (IR) approach is strongly recommended for both adult and pediatric CT scanning as it markedly improves image quality without affecting radiation dose.

  17. Crystal-Structure-Guided Design of Self-Assembling RNA Nanotriangles.

    PubMed

    Boerneke, Mark A; Dibrov, Sergey M; Hermann, Thomas

    2016-03-14

    RNA nanotechnology uses RNA structural motifs to build nanosized architectures that assemble through selective base-pair interactions. Herein, we report the crystal-structure-guided design of highly stable RNA nanotriangles that self-assemble cooperatively from short oligonucleotides. The crystal structure of an 81 nucleotide nanotriangle determined at 2.6 Å resolution reveals the so-far smallest circularly closed nanoobject made entirely of double-stranded RNA. The assembly of the nanotriangle architecture involved RNA corner motifs that were derived from ligand-responsive RNA switches, which offer the opportunity to control self-assembly and dissociation. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. OPTICAL PROCESSING OF INFORMATION: Multistage optoelectronic two-dimensional image switches

    NASA Astrophysics Data System (ADS)

    Fedorov, V. B.

    1994-06-01

    The implementation principles and the feasibility of construction of high-throughput multistage optoelectronic switches, capable of transmitting data in the form of two-dimensional images along interconnected pairs of optical channels, are considered. Different ways of realising compact switches are proposed. They are based on the use of polarisation-sensitive elements, arrays of modulators of the plane of polarisation of light, arrays of objectives, and free-space optics. Optical systems of such switches can theoretically ensure that the resolution and optical losses in two-dimensional image transmission are limited only by diffraction. Estimates are obtained of the main maximum-performance parameters of the proposed optoelectronic image switches.

  19. Observing Holliday junction branch migration one step at a time

    NASA Astrophysics Data System (ADS)

    Ha, Taekjip

    2004-03-01

    During genetic recombination, two homologous DNA molecules undergo strand exchange to form a four-way DNA (Holliday) junction and the recognition and processing of this species by branch migration and junction resolving enzymes determine the outcome. We have used single molecule fluorescence techniques to study two intrinsic structural dynamics of the Holliday junction, stacking conformer transitions and spontaneous branch migration. Our studies show that the dynamics of branch migration, resolved with one base pair resolution, is determined by the stability of conformers which in turn depends on the local DNA sequences. Therefore, the energy landscape of Holliday junction branch migation is not uniform, but is rugged.

  20. A high resolution electron microscopy investigation of curvature in carbon nanotubes

    NASA Astrophysics Data System (ADS)

    Weldon, D. N.; Blau, W. J.; Zandbergen, H. W.

    1995-07-01

    Evidence for heptagon inclusion in multi-walled carbon nanotubes was sought in arc-produced carbon deposits. Transmission electron microscopy revealed many curved nanotubes although their relative abundance was low. Close examination of the micrographs in the regions of expected heptagon inclusion shows that the curvature is accomplished by folding or fracture of the lattice planes. This observed phenomenon contradicts the theoretical modelling studies which predict stable structures with negative curvature accomplished by heptagon/pentagon pairs. A possible explanation for curvature in single-walled tubes is presented based on a molecular mechanics geometry optimisation study of spa inclusion in a graphite sheet.

  1. Molecular recognition of DNA base pairs by the formamido/pyrrole and formamido/imidazole pairings in stacked polyamides

    PubMed Central

    Buchmueller, Karen L.; Staples, Andrew M.; Uthe, Peter B.; Howard, Cameron M.; Pacheco, Kimberly A. O.; Cox, Kari K.; Henry, James A.; Bailey, Suzanna L.; Horick, Sarah M.; Nguyen, Binh; Wilson, W. David; Lee, Moses

    2005-01-01

    Polyamides containing an N-terminal formamido (f) group bind to the minor groove of DNA as staggered, antiparallel dimers in a sequence-specific manner. The formamido group increases the affinity and binding site size, and it promotes the molecules to stack in a staggered fashion thereby pairing itself with either a pyrrole (Py) or an imidazole (Im). There has not been a systematic study on the DNA recognition properties of the f/Py and f/Im terminal pairings. These pairings were analyzed here in the context of f-ImPyPy, f-ImPyIm, f-PyPyPy and f-PyPyIm, which contain the central pairing modes, –ImPy– and –PyPy–. The specificity of these triamides towards symmetrical recognition sites allowed for the f/Py and f/Im terminal pairings to be directly compared by SPR, CD and ΔTM experiments. The f/Py pairing, when placed next to the –ImPy– or –PyPy– central pairings, prefers A/T and T/A base pairs to G/C base pairs, suggesting that f/Py has similar DNA recognition specificity to Py/Py. With –ImPy– central pairings, f/Im prefers C/G base pairs (>10 times) to the other Watson–Crick base pairs; therefore, f/Im behaves like the Py/Im pair. However, the f/Im pairing is not selective for the C/G base pair when placed next to the –PyPy– central pairings. PMID:15703305

  2. Detecting phase-amplitude coupling with high frequency resolution using adaptive decompositions

    PubMed Central

    Pittman-Polletta, Benjamin; Hsieh, Wan-Hsin; Kaur, Satvinder; Lo, Men-Tzung; Hu, Kun

    2014-01-01

    Background Phase-amplitude coupling (PAC) – the dependence of the amplitude of one rhythm on the phase of another, lower-frequency rhythm – has recently been used to illuminate cross-frequency coordination in neurophysiological activity. An essential step in measuring PAC is decomposing data to obtain rhythmic components of interest. Current methods of PAC assessment employ narrowband Fourier-based filters, which assume that biological rhythms are stationary, harmonic oscillations. However, biological signals frequently contain irregular and nonstationary features, which may contaminate rhythms of interest and complicate comodulogram interpretation, especially when frequency resolution is limited by short data segments. New method To better account for nonstationarities while maintaining sharp frequency resolution in PAC measurement, even for short data segments, we introduce a new method of PAC assessment which utilizes adaptive and more generally broadband decomposition techniques – such as the empirical mode decomposition (EMD). To obtain high frequency resolution PAC measurements, our method distributes the PAC associated with pairs of broadband oscillations over frequency space according to the time-local frequencies of these oscillations. Comparison with existing methods We compare our novel adaptive approach to a narrowband comodulogram approach on a variety of simulated signals of short duration, studying systematically how different types of nonstationarities affect these methods, as well as on EEG data. Conclusions Our results show: (1) narrowband filtering can lead to poor PAC frequency resolution, and inaccuracy and false negatives in PAC assessment; (2) our adaptive approach attains better PAC frequency resolution and is more resistant to nonstationarities and artifacts than traditional comodulograms. PMID:24452055

  3. Base-Pairing Energies of Protonated Nucleoside Base Pairs of dCyd and m5dCyd: Implications for the Stability of DNA i-Motif Conformations

    NASA Astrophysics Data System (ADS)

    Yang, Bo; Rodgers, M. T.

    2015-08-01

    Hypermethylation of cytosine in expanded (CCG)n•(CGG)n trinucleotide repeats results in Fragile X syndrome, the most common cause of inherited mental retardation. The (CCG)n•(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of protonated base pairs of cytosine. Here we investigate the effects of 5-methylation and the sugar moiety on the base-pairing energies (BPEs) of protonated cytosine base pairs by examining protonated nucleoside base pairs of 2'-deoxycytidine (dCyd) and 5-methyl-2'-deoxycytidine (m5dCyd) using threshold collision-induced dissociation techniques. 5-Methylation of a single or both cytosine residues leads to very small change in the BPE. However, the accumulated effect may be dramatic in diseased state trinucleotide repeats where many methylated base pairs may be present. The BPEs of the protonated nucleoside base pairs examined here significantly exceed those of Watson-Crick dGuo•dCyd and neutral dCyd•dCyd base pairs, such that these base-pairing interactions provide the major forces responsible for stabilization of DNA i-motif conformations. Compared with isolated protonated nucleobase pairs of cytosine and 1-methylcytosine, the 2'-deoxyribose sugar produces an effect similar to the 1-methyl substituent, and leads to a slight decrease in the BPE. These results suggest that the base-pairing interactions may be slightly weaker in nucleic acids, but that the extended backbone is likely to exert a relatively small effect on the total BPE. The proton affinity (PA) of m5dCyd is also determined by competitive analysis of the primary dissociation pathways that occur in parallel for the protonated (m5dCyd)H+(dCyd) nucleoside base pair and the absolute PA of dCyd previously reported.

  4. An overview of instrumentation for the Large Binocular Telescope

    NASA Astrophysics Data System (ADS)

    Wagner, R. Mark

    2006-06-01

    An overview of instrumentation for the Large Binocular Telescope is presented. Optical instrumentation includes the Large Binocular Camera (LBC), a pair of wide-field (27' × 27') mosaic CCD imagers at the prime focus, and the Multi-Object Double Spectrograph (MODS), a pair of dual-beam blue-red optimized long-slit spectrographs mounted at the straight-through F/15 Gregorian focus incorporating multiple slit masks for multi-object spectroscopy over a 6' field and spectral resolutions of up to 8000. Infrared instrumentation includes the LBT Near-IR Spectroscopic Utility with Camera and Integral Field Unit for Extragalactic Research (LUCIFER), a modular near-infrared (0.9-2.5 μm) imager and spectrograph pair mounted at a bent interior focal station and designed for seeing-limited (FOV: 4' × 4') imaging, long-slit spectroscopy, and multi-object spectroscopy utilizing cooled slit masks and diffraction limited (FOV: 0'.5 × 0'.5) imaging and long-slit spectroscopy. Strategic instruments under development for the remaining two combined focal stations include an interferometric cryogenic beam combiner with near-infrared and thermal-infrared instruments for Fizeau imaging and nulling interferometry (LBTI) and an optical bench near-infrared beam combiner utilizing multi-conjugate adaptive optics for high angular resolution and sensitivity (LINC-NIRVANA). In addition, a fiber-fed bench spectrograph (PEPSI) capable of ultra high resolution spectroscopy and spectropolarimetry (R = 40,000-300,000) will be available as a principal investigator instrument. The availability of all these instruments mounted simultaneously on the LBT permits unique science, flexible scheduling, and improved operational support.

  5. An overview of instrumentation for the Large Binocular Telescope

    NASA Astrophysics Data System (ADS)

    Wagner, R. Mark

    2004-09-01

    An overview of instrumentation for the Large Binocular Telescope is presented. Optical instrumentation includes the Large Binocular Camera (LBC), a pair of wide-field (27'x 27') UB/VRI optimized mosaic CCD imagers at the prime focus, and the Multi-Object Double Spectrograph (MODS), a pair of dual-beam blue-red optimized long-slit spectrographs mounted at the straight-through F/15 Gregorian focus incorporating multiple slit masks for multi-object spectroscopy over a 6\\arcmin\\ field and spectral resolutions of up to 8000. Infrared instrumentation includes the LBT Near-IR Spectroscopic Utility with Camera and Integral Field Unit for Extragalactic Research (LUCIFER), a modular near-infrared (0.9-2.5 μm) imager and spectrograph pair mounted at a bent interior focal station and designed for seeing-limited (FOV: 4'x 4') imaging, long-slit spectroscopy, and multi-object spectroscopy utilizing cooled slit masks and diffraction limited (FOV: 0'.5 x 0'.5) imaging and long-slit spectroscopy. Strategic instruments under development for the remaining two combined focal stations include an interferometric cryogenic beam combiner with near-infrared and thermal-infrared instruments for Fizeau imaging and nulling interferometry (LBTI) and an optical bench beam combiner with visible and near-infrared imagers utilizing multi-conjugate adaptive optics for high angular resolution and sensitivity (LINC/NIRVANA). In addition, a fiber-fed bench spectrograph (PEPSI) capable of ultra high resolution spectroscopy and spectropolarimetry (R = 40,000-300,000) will be available as a principal investigator instrument. The availability of all these instruments mounted simultaneously on the LBT permits unique science, flexible scheduling, and improved operational support.

  6. An overview of instrumentation for the Large Binocular Telescope

    NASA Astrophysics Data System (ADS)

    Wagner, R. Mark

    2008-07-01

    An overview of instrumentation for the Large Binocular Telescope is presented. Optical instrumentation includes the Large Binocular Camera (LBC), a pair of wide-field (27' × 27') mosaic CCD imagers at the prime focus, and the Multi-Object Double Spectrograph (MODS), a pair of dual-beam blue-red optimized long-slit spectrographs mounted at the straight-through F/15 Gregorian focus incorporating multiple slit masks for multi-object spectroscopy over a 6 field and spectral resolutions of up to 8000. Infrared instrumentation includes the LBT Near-IR Spectroscopic Utility with Camera and Integral Field Unit for Extragalactic Research (LUCIFER), a modular near-infrared (0.9-2.5 μm) imager and spectrograph pair mounted at a bent interior focal station and designed for seeing-limited (FOV: 4' × 4') imaging, long-slit spectroscopy, and multi-object spectroscopy utilizing cooled slit masks and diffraction limited (FOV: 0.5' × 0.5') imaging and long-slit spectroscopy. Strategic instruments under development for the remaining two combined focal stations include an interferometric cryogenic beam combiner with near-infrared and thermal-infrared instruments for Fizeau imaging and nulling interferometry (LBTI) and an optical bench near-infrared beam combiner utilizing multi-conjugate adaptive optics for high angular resolution and sensitivity (LINC-NIRVANA). In addition, a fiber-fed bench spectrograph (PEPSI) capable of ultra high resolution spectroscopy and spectropolarimetry (R = 40,000-300,000) will be available as a principal investigator instrument. The availability of all these instruments mounted simultaneously on the LBT permits unique science, flexible scheduling, and improved operational support.

  7. Light-Sharing Interface for dMiCE Detectors using Sub-Surface Laser Engraving.

    PubMed

    Hunter, William C J; Miyaoka, Robert S; MacDonald, Lawrence; McDougald, Wendy; Lewellen, Thomas K

    2013-10-01

    We have previously reported on dMiCE, a method of resolving depth or interaction (DOI) in a pair of discrete crystals by encoding light sharing properties as a function of depth in the interface of this crystal-element pair. A challenge for this method is the cost and repeatability of interface treatment for a crystal pair. In this work, we report our preliminary results on using sub-surface laser engraving (SSLE) as a means of forming this depth-dependent interface in a dMiCE detector. A surplus first-generation SSLE system was used to create a partially reflective layer 100-microns thick at the boundary between two halves of a 1.4-by-2.9-by-20 mmˆ3 LYSO crystal. The boundary of these paired crystal elements was positioned between two 3-mm wide Geiger-Müller avalanche photodiodes from Hamamatsu. The responses of these two photodetectors were acquired for an ensemble of 511-keV photons collimated to interact at a fixed depth in just one crystal element. Interaction position was then varied to measure detector response as a function of depth, which was then used to maximum-likelihood positions events. Despite use of sub-optimal SSLE processing we found an average DOI resolution of 3.4 mm for front-sided readout and 3.9 mm for back-sided readout. We expect DOI resolution can be improved significantly by optimizing the SSLE process and pattern.

  8. Light-Sharing Interface for dMiCE Detectors using Sub-Surface Laser Engraving

    PubMed Central

    Hunter, William C.J.; Miyaoka, Robert S.; MacDonald, Lawrence; McDougald, Wendy; Lewellen, Thomas K.

    2014-01-01

    We have previously reported on dMiCE, a method of resolving depth or interaction (DOI) in a pair of discrete crystals by encoding light sharing properties as a function of depth in the interface of this crystal-element pair. A challenge for this method is the cost and repeatability of interface treatment for a crystal pair. In this work, we report our preliminary results on using sub-surface laser engraving (SSLE) as a means of forming this depth-dependent interface in a dMiCE detector. A surplus first-generation SSLE system was used to create a partially reflective layer 100-microns thick at the boundary between two halves of a 1.4-by-2.9-by-20 mmˆ3 LYSO crystal. The boundary of these paired crystal elements was positioned between two 3-mm wide Geiger-Müller avalanche photodiodes from Hamamatsu. The responses of these two photodetectors were acquired for an ensemble of 511-keV photons collimated to interact at a fixed depth in just one crystal element. Interaction position was then varied to measure detector response as a function of depth, which was then used to maximum-likelihood positions events. Despite use of sub-optimal SSLE processing we found an average DOI resolution of 3.4 mm for front-sided readout and 3.9 mm for back-sided readout. We expect DOI resolution can be improved significantly by optimizing the SSLE process and pattern. PMID:25506194

  9. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

    PubMed

    Takezawa, Yusuke; Shionoya, Mitsuhiko

    2012-12-18

    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional DNA molecules such as artificial DNAzymes and DNA machines. In addition, the metallo-base pairing system is a powerful tool for the construction of homogeneous and heterogeneous metal arrays, which can lead to DNA-based nanomaterials such as electronic wires and magnetic devices. Recently researchers have investigated these systems as enzyme replacements, which may offer an additional contribution to chemical biology and synthetic biology through the expansion of the genetic alphabet.

  10. Mapping biological to clinical phenotypes during the development (21 days) and resolution (21 days) of experimental gingivitis.

    PubMed

    Scott, Ann E; Milward, Mike; Linden, Gerard J; Matthews, John B; Carlile, Monica J; Lundy, Fionnuala T; Naeeni, Mojgan A; Lorraine Martin, S; Walker, Brian; Kinane, Denis; Brock, Gareth R; Chapple, Iain L C

    2012-02-01

    To characterize and map temporal changes in the biological and clinical phenotype during a 21-day experimental gingivitis study. Experimental gingivitis was induced over 21 days in healthy human volunteers (n = 56), after which normal brushing was resumed (resolution phase). Gingival and plaque indices were assessed. Gingival crevicular fluid was collected from four paired test and contra-lateral control sites in each volunteer during induction (Days 0, 7, 14 and 21) and resolution (Days 28 and 42) of experimental gingivitis. Fluid volumes were measured and a single analyte was quantified from each site-specific, 30s sample. Data were evaluated by analysis of repeated measurements and paired sample tests. Clinical indices and gingival crevicular fluid volumes at test sites increased from Day 0, peaking at Day 21 (test/control differences all p < 0.0001) and decreased back to control levels by Day 28. Levels of four inflammatory markers showed similar patterns, with significant differences between test and control apparent at Day 7 (substance P, cathepsin G, interleukin-1β, elastase: all p < 0.03) and peaking at Day 21 (all p < 0.002). Levels of α-1-antitrypsin showed no pattern. Levels of substance P, cathepsin G, interleukin-1β and neutrophil elastase act as objective biomarkers of gingival inflammation induction and resolution that typically precede phenotypical changes. © 2011 John Wiley & Sons A/S.

  11. Theoretical determination of one-electron redox potentials for DNA bases, base pairs, and stacks.

    PubMed

    Paukku, Y; Hill, G

    2011-05-12

    Electron affinities, ionization potentials, and redox potentials for DNA bases, base pairs, and N-methylated derivatives are computed at the DFT/M06-2X/6-31++G(d,p) level of theory. Redox properties of a guanine-guanine stack model are explored as well. Reduction and oxidation potentials are in good agreement with the experimental ones. Electron affinities of base pairs were found to be negative. Methylation of canonical bases affects the ionization potentials the most. Base pair formation and base stacking lower ionization potentials by 0.3 eV. Pairing of guanine with the 5-methylcytosine does not seem to influence the redox properties of this base pair much.

  12. The Reference Elevation Model of Antarctica (REMA): A High Resolution, Time-Stamped Digital Elevation Model for the Antarctic Ice Sheet

    NASA Astrophysics Data System (ADS)

    Howat, I.; Noh, M. J.; Porter, C. C.; Smith, B. E.; Morin, P. J.

    2017-12-01

    We are creating the Reference Elevation Model of Antarctica (REMA), a continuous, high resolution (2-8 m), high precision (accuracy better than 1 m) reference surface for a wide range of glaciological and geodetic applications. REMA will be constructed from stereo-photogrammetric Digital Surface Models (DSM) extracted from pairs of submeter resolution DigitalGlobe satellite imagery and vertically registred to precise elevations from near-coincident airborne LiDAR, ground-based GPS surveys and Cryosat-2 radar altimetry. Both a seamless mosaic and individual, time-stamped DSM strips, collected primarily between 2012 and 2016, will be distributed to enable change measurement. These data will be used for mapping bed topography from ice thickness, measuring ice thickness changes, constraining ice flow and geodynamic models, mapping glacial geomorphology, terrain corrections and filtering of remote sensing observations, and many other science tasks. Is will also be critical for mapping ice traverse routes, landing sites and other field logistics planning. REMA will also provide a critical elevation benchmark for future satellite altimetry missions including ICESat-2. Here we report on REMA production progress, initial accuracy assessment and data availability.

  13. Optimisation of chromatographic resolution using objective functions including both time and spectral information.

    PubMed

    Torres-Lapasió, J R; Pous-Torres, S; Ortiz-Bolsico, C; García-Alvarez-Coque, M C

    2015-01-16

    The optimisation of the resolution in high-performance liquid chromatography is traditionally performed attending only to the time information. However, even in the optimal conditions, some peak pairs may remain unresolved. Such incomplete resolution can be still accomplished by deconvolution, which can be carried out with more guarantees of success by including spectral information. In this work, two-way chromatographic objective functions (COFs) that incorporate both time and spectral information were tested, based on the peak purity (analyte peak fraction free of overlapping) and the multivariate selectivity (figure of merit derived from the net analyte signal) concepts. These COFs are sensitive to situations where the components that coelute in a mixture show some spectral differences. Therefore, they are useful to find out experimental conditions where the spectrochromatograms can be recovered by deconvolution. Two-way multivariate selectivity yielded the best performance and was applied to the separation using diode-array detection of a mixture of 25 phenolic compounds, which remained unresolved in the chromatographic order using linear and multi-linear gradients of acetonitrile-water. Peak deconvolution was carried out using the combination of orthogonal projection approach and alternating least squares. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Derivation of planetary topography using multi-image shape-from-shading

    USGS Publications Warehouse

    Lohse, V.; Heipke, C.; Kirk, R.L.

    2006-01-01

    In many cases, the derivation of high-resolution digital terrain models (DTMs) from planetary surfaces using conventional digital image matching is a problem. The matching methods need at least one stereo pair of images with sufficient texture. However, many space missions provide only a few stereo images and planetary surfaces often possess insufficient texture. This paper describes a method for the generation of high-resolution DTMs from planetary surfaces, which has the potential to overcome the described problem. The suggested method, developed by our group, is based on shape-from-shading using an arbitrary number of digital optical images, and is termed "multi-image shape-from-shading" (MI-SFS). The paper contains an explanation of the theory of MI-SFS, followed by a presentation of current results, which were obtained using images from NASA's lunar mission Clementine, and constitute the first practical application with our method using extraterrestrial imagery. The lunar surface is reconstructed under the assumption of different kinds of reflectance models (e.g. Lommel-Seeliger and Lambert). The represented results show that the derivation of a high-resolution DTM of real digital planetary images by means of MI-SFS is feasible. ?? 2006 Elsevier Ltd. All rights reserved.

  15. Urban Modelling Performance of Next Generation SAR Missions

    NASA Astrophysics Data System (ADS)

    Sefercik, U. G.; Yastikli, N.; Atalay, C.

    2017-09-01

    In synthetic aperture radar (SAR) technology, urban mapping and modelling have become possible with revolutionary missions TerraSAR-X (TSX) and Cosmo-SkyMed (CSK) since 2007. These satellites offer 1m spatial resolution in high-resolution spotlight imaging mode and capable for high quality digital surface model (DSM) acquisition for urban areas utilizing interferometric SAR (InSAR) technology. With the advantage of independent generation from seasonal weather conditions, TSX and CSK DSMs are much in demand by scientific users. The performance of SAR DSMs is influenced by the distortions such as layover, foreshortening, shadow and double-bounce depend up on imaging geometry. In this study, the potential of DSMs derived from convenient 1m high-resolution spotlight (HS) InSAR pairs of CSK and TSX is validated by model-to-model absolute and relative accuracy estimations in an urban area. For the verification, an airborne laser scanning (ALS) DSM of the study area was used as the reference model. Results demonstrated that TSX and CSK urban DSMs are compatible in open, built-up and forest land forms with the absolute accuracy of 8-10 m. The relative accuracies based on the coherence of neighbouring pixels are superior to absolute accuracies both for CSK and TSX.

  16. Downscaling remotely sensed imagery using area-to-point cokriging and multiple-point geostatistical simulation

    NASA Astrophysics Data System (ADS)

    Tang, Yunwei; Atkinson, Peter M.; Zhang, Jingxiong

    2015-03-01

    A cross-scale data integration method was developed and tested based on the theory of geostatistics and multiple-point geostatistics (MPG). The goal was to downscale remotely sensed images while retaining spatial structure by integrating images at different spatial resolutions. During the process of downscaling, a rich spatial correlation model in the form of a training image was incorporated to facilitate reproduction of similar local patterns in the simulated images. Area-to-point cokriging (ATPCK) was used as locally varying mean (LVM) (i.e., soft data) to deal with the change of support problem (COSP) for cross-scale integration, which MPG cannot achieve alone. Several pairs of spectral bands of remotely sensed images were tested for integration within different cross-scale case studies. The experiment shows that MPG can restore the spatial structure of the image at a fine spatial resolution given the training image and conditioning data. The super-resolution image can be predicted using the proposed method, which cannot be realised using most data integration methods. The results show that ATPCK-MPG approach can achieve greater accuracy than methods which do not account for the change of support issue.

  17. High Resolution Spectroscopy and Dynamics: from Jet Cooled Radicals to Gas-Liquid Interfaces

    NASA Astrophysics Data System (ADS)

    Sharp-Williams, E.; Roberts, M. A.; Roscioli, J. R.; Gisler, A. W.; Ziemkiewicz, M.; Nesbitt, D. J.; Dong, F.; Perkins, B. G., Jr.

    2010-06-01

    This talk will attempt to reflect recent work in our group involving two quite different but complementary applications of high resolution molecular spectroscopy for detailed study of intramolecular as well as intermolecular dynamics in small molecules. The first is based on direct infrared absorption spectroscopy in a 100 KHz slit supersonic discharge, which provides a remarkably versatile and yet highly sensitive probe for study of important chemical transients such as open shell combustion species and molecular ions under jet cooled (10-20K), sub-Doppler conditions. For this talk will focus on gas phase spectroscopic results for a series of unsaturated hydrocarbon radical species (ethynyl, vinyl, and phenyl) reputed to be critical intermediates in soot formation. Secondly, we will discuss recent applications of high resolution IR and velocity map imaging spectroscopy toward quantum state resolved collision dynamics of jet cooled molecules from gas-room temperature ionic liquid (RTIL) and gas-self assembled monolayer (SAM) interfaces. Time permitting, we will also present new results on hyperthermal scattering of jet cooled NO radical from liquid Ga, which offer a novel window into non-adiabatic energy transfer and electron-hole pair dynamics at the gas-molten metal interface.

  18. Could This Be the Mars Soviet 3 Lander?

    NASA Image and Video Library

    2013-04-11

    This set of images shows what might be hardware from the Soviet Union 1971 Mars 3 lander, seen in a pair of images from the High Resolution Imaging Science Experiment HiRISE camera on NASA Mars Reconnaissance Orbiter.

  19. Hidden in Plain Sight: Subtle Effects of the 8-Oxoguanine Lesion on the Structure, Dynamics, and Thermodynamics of a 15-Base-Pair Oligodeoxynucleotide Duplex†

    PubMed Central

    Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.

    2011-01-01

    The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242

  20. Molecular specificity in photoacoustic microscopy by time-resolved transient absorption.

    PubMed

    Shelton, Ryan L; Mattison, Scott P; Applegate, Brian E

    2014-06-01

    We have recently harnessed transient absorption, a resonant two-photon process, for ultrahigh resolution photoacoustic microscopy, achieving nearly an order of magnitude improvement in axial resolution. The axial resolution is optically constrained due to the two-photon process unlike traditional photoacoustic microscopy where the axial resolution is inversely proportional to the frequency bandwidth of the detector. As a resonant process, the arrival time of the two photons need not be instantaneous. Systematically recording the signal as a function of the delay between two pulses will result in the measurement of an exponential decay whose time constant is related to the molecular dynamics. This time constant, analogous to the fluorescence lifetime, but encompassing nonradiative decay as well, can be used to differentiate between molecular systems with overlapping absorption spectra. This is frequently the situation for closely related yet distinct molecules such as redox pairs. In order to enable the measure of the exponential decay, we have reconfigured our transient absorption ultrasonic microscopy (TAUM) system to incorporate two laser sources with precisely controlled pulse trains. The system was tested by measuring Rhodamine 6G, an efficient laser dye where the molecular dynamics are dominated by the fluorescence pathway. As expected, the measured exponential time constant or ground state recovery time, 3.3±0.7  ns, was similar to the well-known fluorescence lifetime, 4.11±0.05  ns. Oxy- and deoxy-hemoglobin are the quintessential pair whose relative concentration is related to the local blood oxygen saturation. We have measured the ground state recovery times of these two species in fully oxygenated and deoxygenated bovine whole blood to be 3.7±0.8  ns and 7.9±1.0  ns, respectively. Hence, even very closely related pairs of molecules may be differentiated with this technique.

  1. Development of capacitive multiplexing circuit for SiPM-based time-of-flight (TOF) PET detector

    NASA Astrophysics Data System (ADS)

    Choe, Hyeok-Jun; Choi, Yong; Hu, Wei; Yan, Jianhua; Jung, Jin Ho

    2017-04-01

    There has been great interest in developing a time-of-flight (TOF) PET to improve the signal-to-noise ratio of PET image relative to that of non-TOF PET. Silicon photomultiplier (SiPM) arrays have attracted attention for use as a fast TOF PET photosensor. Since numerous SiPM arrays are needed to construct a modern human PET, a multiplexing method providing both good timing performance and high channel reduction capability is required to develop a SiPM-based TOF PET. The purpose of this study was to develop a capacitive multiplexing circuit for the SiPM-based TOF PET. The proposed multiplexing circuit was evaluated by measuring the coincidence resolving time (CRT) and the energy resolution as a function of the overvoltage using three different capacitor values of 15, 30, and 51 pF. A flood histogram was also obtained and quantitatively assessed. Experiments were performed using a 4× 4 array of 3× 3 mm2 SiPMs. Regarding the capacitor values, the multiplexing circuit using a smaller capacitor value showed the best timing performance. On the other hand, the energy resolution and flood histogram quality of the multiplexing circuit deteriorated as the capacitor value became smaller. The proposed circuit was able to achieve a CRT of 260+/- 4 ps FWHM and an energy resolution of 17.1 % with a pair of 2× 2× 20 mm3 LYSO crystals using a capacitor value of 30 pF at an overvoltage of 3.0 V. It was also possible to clearly resolve a 6× 6 array of LYSO crystals in the flood histogram using the multiplexing circuit. The experiment results indicate that the proposed capacitive multiplexing circuit is useful to obtain an excellent timing performance and a crystal-resolving capability in the flood histogram with a minimal degradation of the energy resolution, as well as to reduce the number of the readout channels of the SiPM-based TOF PET detector.

  2. Paired β-sheet structure of an Aβ(1-40) amyloid fibril revealed by electron microscopy

    PubMed Central

    Sachse, Carsten; Fändrich, Marcus; Grigorieff, Nikolaus

    2008-01-01

    Alzheimer's disease is a neurodegenerative disorder that is characterized by the cerebral deposition of amyloid fibrils formed by Aβ peptide. Despite their prevalence in Alzheimer's and other neurodegenerative diseases, important details of the structure of amyloid fibrils remain unknown. Here, we present a three-dimensional structure of a mature amyloid fibril formed by Aβ(1-40) peptide, determined by electron cryomicroscopy at ≈8-Å resolution. The fibril consists of two protofilaments, each containing ≈5-nm-long regions of β-sheet structure. A local twofold symmetry within each region suggests that pairs of β-sheets are formed from equivalent parts of two Aβ(1-40) peptides contained in each protofilament. The pairing occurs via tightly packed interfaces, reminiscent of recently reported steric zipper structures. However, unlike these previous structures, the β-sheet pairing is observed within an amyloid fibril and includes significantly longer amino acid sequences. PMID:18483195

  3. Structural landscape of base pairs containing post-transcriptional modifications in RNA

    PubMed Central

    Seelam, Preethi P.; Sharma, Purshotam

    2017-01-01

    Base pairs involving post-transcriptionally modified nucleobases are believed to play important roles in a wide variety of functional RNAs. Here we present our attempts toward understanding the structural and functional role of naturally occurring modified base pairs using a combination of X-ray crystal structure database analysis, sequence analysis, and advanced quantum chemical methods. Our bioinformatics analysis reveals that despite their presence in all major secondary structural elements, modified base pairs are most prevalent in tRNA crystal structures and most commonly involve guanine or uridine modifications. Further, analysis of tRNA sequences reveals additional examples of modified base pairs at structurally conserved tRNA regions and highlights the conservation patterns of these base pairs in three domains of life. Comparison of structures and binding energies of modified base pairs with their unmodified counterparts, using quantum chemical methods, allowed us to classify the base modifications in terms of the nature of their electronic structure effects on base-pairing. Analysis of specific structural contexts of modified base pairs in RNA crystal structures revealed several interesting scenarios, including those at the tRNA:rRNA interface, antibiotic-binding sites on the ribosome, and the three-way junctions within tRNA. These scenarios, when analyzed in the context of available experimental data, allowed us to correlate the occurrence and strength of modified base pairs with their specific functional roles. Overall, our study highlights the structural importance of modified base pairs in RNA and points toward the need for greater appreciation of the role of modified bases and their interactions, in the context of many biological processes involving RNA. PMID:28341704

  4. Reconstruction of 7T-Like Images From 3T MRI

    PubMed Central

    Bahrami, Khosro; Shi, Feng; Zong, Xiaopeng; Shin, Hae Won; An, Hongyu

    2016-01-01

    In the recent MRI scanning, ultra-high-field (7T) MR imaging provides higher resolution and better tissue contrast compared to routine 3T MRI, which may help in more accurate and early brain diseases diagnosis. However, currently, 7T MRI scanners are more expensive and less available at clinical and research centers. These motivate us to propose a method for the reconstruction of images close to the quality of 7T MRI, called 7T-like images, from 3T MRI, to improve the quality in terms of resolution and contrast. By doing so, the post-processing tasks, such as tissue segmentation, can be done more accurately and brain tissues details can be seen with higher resolution and contrast. To do this, we have acquired a unique dataset which includes paired 3T and 7T images scanned from same subjects, and then propose a hierarchical reconstruction based on group sparsity in a novel multi-level Canonical Correlation Analysis (CCA) space, to improve the quality of 3T MR image to be 7T-like MRI. First, overlapping patches are extracted from the input 3T MR image. Then, by extracting the most similar patches from all the aligned 3T and 7T images in the training set, the paired 3T and 7T dictionaries are constructed for each patch. It is worth noting that, for the training, we use pairs of 3T and 7T MR images from each training subject. Then, we propose multi-level CCA to map the paired 3T and 7T patch sets to a common space to increase their correlations. In such space, each input 3T MRI patch is sparsely represented by the 3T dictionary and then the obtained sparse coefficients are used together with the corresponding 7T dictionary to reconstruct the 7T-like patch. Also, to have the structural consistency between adjacent patches, the group sparsity is employed. This reconstruction is performed with changing patch sizes in a hierarchical framework. Experiments have been done using 13 subjects with both 3T and 7T MR images. The results show that our method outperforms previous methods and is able to recover better structural details. Also, to place our proposed method in a medical application context, we evaluated the influence of post-processing methods such as brain tissue segmentation on the reconstructed 7T-like MR images. Results show that our 7T-like images lead to higher accuracy in segmentation of white matter (WM), gray matter (GM), cerebrospinal fluid (CSF), and skull, compared to segmentation of 3T MR images. PMID:27046894

  5. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

    PubMed

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

    2004-03-01

    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson-Crick base pair in SECIS element plays an important role in the selenocysteine expression by UGA codon.

  6. Introducing a model of pairing based on base pair specific interactions between identical DNA sequences

    NASA Astrophysics Data System (ADS)

    (O' Lee, Dominic J.

    2018-02-01

    At present, there have been suggested two types of physical mechanism that may facilitate preferential pairing between DNA molecules, with identical or similar base pair texts, without separation of base pairs. One mechanism solely relies on base pair specific patterns of helix distortion being the same on the two molecules, discussed extensively in the past. The other mechanism proposes that there are preferential interactions between base pairs of the same composition. We introduce a model, built on this second mechanism, where both thermal stretching and twisting fluctuations are included, as well as the base pair specific helix distortions. Firstly, we consider an approximation for weak pairing interactions, or short molecules. This yields a dependence of the energy on the square root of the molecular length, which could explain recent experimental data. However, analysis suggests that this approximation is no longer valid at large DNA lengths. In a second approximation, for long molecules, we define two adaptation lengths for twisting and stretching, over which the pairing interaction can limit the accumulation of helix disorder. When the pairing interaction is sufficiently strong, both adaptation lengths are finite; however, as we reduce pairing strength, the stretching adaptation length remains finite but the torsional one becomes infinite. This second state persists to arbitrarily weak values of the pairing strength; suggesting that, if the molecules are long enough, the pairing energy scales as length. To probe differences between the two pairing mechanisms, we also construct a model of similar form. However, now, pairing between identical sequences solely relies on the intrinsic helix distortion patterns. Between the two models, we see interesting qualitative differences. We discuss our findings, and suggest new work to distinguish between the two mechanisms.

  7. Advances in organic polymer-based monolithic column technology for high-resolution liquid chromatography-mass spectrometry profiling of antibodies, intact proteins, oligonucleotides, and peptides.

    PubMed

    Eeltink, Sebastiaan; Wouters, Sam; Dores-Sousa, José Luís; Svec, Frantisek

    2017-05-19

    This review focuses on the preparation of organic polymer-based monolithic stationary phases and their application in the separation of biomolecules, including antibodies, intact proteins and protein isoforms, oligonucleotides, and protein digests. Column and material properties, and the optimization of the macropore structure towards kinetic performance are also discussed. State-of-the-art liquid chromatography-mass spectrometry biomolecule separations are reviewed and practical aspects such as ion-pairing agent selection and carryover are presented. Finally, advances in comprehensive two-dimensional LC separations using monolithic columns, in particular ion-exchange×reversed-phase and reversed-phase×reversed-phase LC separations conducted at high and low pH, are shown. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. LookSeq: a browser-based viewer for deep sequencing data.

    PubMed

    Manske, Heinrich Magnus; Kwiatkowski, Dominic P

    2009-11-01

    Sequencing a genome to great depth can be highly informative about heterogeneity within an individual or a population. Here we address the problem of how to visualize the multiple layers of information contained in deep sequencing data. We propose an interactive AJAX-based web viewer for browsing large data sets of aligned sequence reads. By enabling seamless browsing and fast zooming, the LookSeq program assists the user to assimilate information at different levels of resolution, from an overview of a genomic region to fine details such as heterogeneity within the sample. A specific problem, particularly if the sample is heterogeneous, is how to depict information about structural variation. LookSeq provides a simple graphical representation of paired sequence reads that is more revealing about potential insertions and deletions than are conventional methods.

  9. High-speed digitization readout of silicon photomultipliers for time of flight positron emission tomography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ronzhin, A.; Los, S.; Martens, M.

    2011-02-01

    We report on work to develop a system with about 100 picoseconds (ps) time resolution for time of flight positron emission tomography [TOF-PET]. The chosen photo detectors for the study were Silicon Photomultipliers (SiPM's). This study was based on extensive experience in studying timing properties of SiPM's. The readout of these devices used the commercial high speed digitizer DRS4. We applied different algorithms to get the best time resolution of 155 ps Guassian (sigma) for a LYSO crystal coupled to a SiPM. We consider the work as a first step in building a prototype TOF-PET module. The field of positron-emission-tomographymore » (PET) has been rapidly developing. But there are significant limitations in how well current PET scanners can reconstruct images, related to how fast data can be acquired, how much volume they can image, and the spatial and temporal resolution of the generated photons. Typical modern scanners now include multiple rings of detectors, which can image a large volume of the patient. In this type of scanner, one can treat each ring as a separate detector and require coincidences only within the ring, or treat the entire region viewed by the scanner as a single 3 dimensional volume. This 3d technique has significantly better sensitivity since more photon pair trajectories are accepted. However, the scattering of photons within the volume of the patient, and the effect of random coincidences limits the technique. The advent of sub-nanosecond timing resolution detectors means that there is potentially much better rejection of scattered photon events and random coincidence events in the 3D technique. In addition, if the timing is good enough, then the origin of photons pairs can be determined better, resulting in improved spatial resolution - so called 'Time-of-Flight' PET, or TOF-PET. Currently a lot of activity has occurred in applications of SiPMs for TOF-PET. This is due to the devices very good time resolution, low profile, lack of high voltage needed, and their non-sensitivity to magnetic fields. While investigations into this technique have begun elsewhere, we feel that the extensive SiPM characterization and data acquisition expertise of Fermilab, and the historical in-depth research of PET imaging at University of Chicago will combine to make significant strides in this field. We also benefit by a working relationship with the SiPM producer STMicroelectronics (STM).« less

  10. The Effect of Shadow Area on Sgm Algorithm and Disparity Map Refinement from High Resolution Satellite Stereo Images

    NASA Astrophysics Data System (ADS)

    Tatar, N.; Saadatseresht, M.; Arefi, H.

    2017-09-01

    Semi Global Matching (SGM) algorithm is known as a high performance and reliable stereo matching algorithm in photogrammetry community. However, there are some challenges using this algorithm especially for high resolution satellite stereo images over urban areas and images with shadow areas. As it can be seen, unfortunately the SGM algorithm computes highly noisy disparity values for shadow areas around the tall neighborhood buildings due to mismatching in these lower entropy areas. In this paper, a new method is developed to refine the disparity map in shadow areas. The method is based on the integration of potential of panchromatic and multispectral image data to detect shadow areas in object level. In addition, a RANSAC plane fitting and morphological filtering are employed to refine the disparity map. The results on a stereo pair of GeoEye-1 captured over Qom city in Iran, shows a significant increase in the rate of matched pixels compared to standard SGM algorithm.

  11. Near-atomic resolution visualization of human transcription promoter opening

    PubMed Central

    He, Yuan; Yan, Chunli; Fang, Jie; Inouye, Carla; Tjian, Robert; Ivanov, Ivaylo; Nogales, Eva

    2016-01-01

    In eukaryotic transcription initiation, a large multi-subunit pre-initiation complex (PIC) that assembles at the core promoter is required for the opening of the duplex DNA and identification of the start site for transcription by RNA polymerase II. Here we use cryo-electron microscropy (cryo-EM) to determine near-atomic resolution structures of the human PIC in a closed state (engaged with duplex DNA), an open state (engaged with a transcription bubble), and an initially transcribing complex (containing six base pairs of DNA–RNA hybrid). Our studies provide structures for previously uncharacterized components of the PIC, such as TFIIE and TFIIH, and segments of TFIIA, TFIIB and TFIIF. Comparison of the different structures reveals the sequential conformational changes that accompany the transition from each state to the next throughout the transcription initiation process. This analysis illustrates the key role of TFIIB in transcription bubble stabilization and provides strong structural support for a translocase activity of XPB. PMID:27193682

  12. Species identification in meat products: A new screening method based on high resolution melting analysis of cyt b gene.

    PubMed

    Lopez-Oceja, A; Nuñez, C; Baeta, M; Gamarra, D; de Pancorbo, M M

    2017-12-15

    Meat adulteration by substitution with lower value products and/or mislabeling involves economic, health, quality and socio-religious issues. Therefore, identification and traceability of meat species has become an important subject to detect possible fraudulent practices. In the present study the development of a high resolution melt (HRM) screening method for the identification of eight common meat species is reported. Samples from Bos taurus, Ovis aries, Sus scrofa domestica, Equus caballus, Oryctolagus cuniculus, Gallus gallus domesticus, Meleagris gallopavo and Coturnix coturnix were analyzed through the amplification of a 148 bp fragment from the cyt b gene with a universal primer pair in HRM analyses. Melting profiles from each species, as well as from several DNA mixtures of these species and blind samples, allowed a successful species differentiation. The results demonstrated that the HRM method here proposed is a fast, reliable, and low-cost screening technique. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Bi-Directional Brillouin Optical Time Domain Analyzer System for Long Range Distributed Sensing

    PubMed Central

    Guo, Nan; Wang, Liang; Wang, Jie; Jin, Chao; Tam, Hwa-Yaw; Zhang, A. Ping; Lu, Chao

    2016-01-01

    We propose and experimentally demonstrate a novel scheme of bi-directional Brillouin time domain analyzer (BD-BOTDA) to extend the sensing range. By deploying two pump-probe pairs at two different wavelengths, the Brillouin frequency shift (BFS) distribution over each half of the whole fiber can be obtained with the simultaneous detection of Brillouin signals in both channels. Compared to the conventional unidirectional BOTDA system of the same sensing range, the proposed BD-BOTDA scheme enables distributed sensing with a performance level comparable to the conventional one with half of the sensing range and a spatial resolution of 2 m, while maintaining the Brillouin signal-to-noise ratio (SNR) and the BFS uncertainty. Based on this technique, we have achieved distributed temperature sensing with a measurement range of 81.9 km fiber at a spatial resolution of 2 m and BFS uncertainty of ~0.44 MHz without introducing any complicated components or schemes. PMID:27999250

  14. Electrochemical and spectroscopic study on the interaction between isoprenaline and DNA using multivariate curve resolution-alternating least squares.

    PubMed

    Ni, Yongnian; Wei, Min; Kokot, Serge

    2011-11-01

    Interaction of isoprenaline (ISO) with calf-thymus DNA was studied by spectroscopic and electrochemical methods. The behavior of ISO was investigated at a glassy carbon electrode (GCE) by cyclic voltammetry (CV) and differential pulse stripping voltammetry (DPSV); ISO was oxidized and an irreversible oxidation peak was observed. The binding constant K and the stoichiometric coefficient m of ISO with DNA were evaluated. Also, with the addition of DNA, hyperchromicity of the UV-vis absorption spectra of ISO was noted, while the fluorescence intensity decreased significantly. Multivariate curve resolution-alternating least squares (MCR-ALS) chemometrics method was applied to resolve the combined spectroscopic data matrix, which was obtained by the UV-vis and fluorescence methods. Pure spectra of ISO, DNA and ISO-DNA complex, and their concentration profiles were then successfully obtained. The results indicated that the ISO molecule intercalated into the base-pairs of DNA, and the complex of ISO-DNA was formed. Copyright © 2011 Elsevier B.V. All rights reserved.

  15. pKa shifting in double-stranded RNA is highly dependent upon nearest neighbors and bulge positioning.

    PubMed

    Wilcox, Jennifer L; Bevilacqua, Philip C

    2013-10-22

    Shifting of pKa's in RNA is important for many biological processes; however, the driving forces responsible for shifting are not well understood. Herein, we determine how structural environments surrounding protonated bases affect pKa shifting in double-stranded RNA (dsRNA). Using (31)P NMR, we determined the pKa of the adenine in an A(+)·C base pair in various sequence and structural environments. We found a significant dependence of pKa on the base pairing strength of nearest neighbors and the location of a nearby bulge. Increasing nearest neighbor base pairing strength shifted the pKa of the adenine in an A(+)·C base pair higher by an additional 1.6 pKa units, from 6.5 to 8.1, which is well above neutrality. The addition of a bulge two base pairs away from a protonated A(+)·C base pair shifted the pKa by only ~0.5 units less than a perfectly base paired hairpin; however, positioning the bulge just one base pair away from the A(+)·C base pair prohibited formation of the protonated base pair as well as several flanking base pairs. Comparison of data collected at 25 °C and 100 mM KCl to biological temperature and Mg(2+) concentration revealed only slight pKa changes, suggesting that similar sequence contexts in biological systems have the potential to be protonated at biological pH. We present a general model to aid in the determination of the roles protonated bases may play in various dsRNA-mediated processes including ADAR editing, miRNA processing, programmed ribosomal frameshifting, and general acid-base catalysis in ribozymes.

  16. Limb Spicules from the Ground and from Space

    NASA Astrophysics Data System (ADS)

    Pasachoff, Jay M.; Jacobson, William A.; Sterling, Alphonse C.

    2009-11-01

    We amassed statistics for quiet-sun chromosphere spicules at the limb using ground-based observations from the Swedish 1-m Solar Telescope on La Palma and simultaneously from NASA’s Transition Region and Coronal Explorer (TRACE) spacecraft. The observations were obtained in July 2006. With the 0.2 arcsecond resolution obtained after maximizing the ground-based resolution with the Multi-Object Multi-Frame Blind Deconvolution (MOMFBD) program, we obtained specific statistics for sizes and motions of over two dozen individual spicules, based on movies compiled at 50-second cadence for the series of five wavelengths observed in a very narrow band at Hα, on-band and at ± 0.035 nm and ± 0.070 nm (10 s at each wavelength) using the SOUP filter, and had simultaneous observations in the 160 nm EUV continuum from TRACE. The MOMFBD restoration also automatically aligned the images, facilitating the making of Dopplergrams at each off-band pair. We studied 40 Hα spicules, and 14 EUV spicules that overlapped Hα spicules; we found that their dynamical and morphological properties fit into the framework of several previous studies. From a preliminary comparison with spicule theories, our observations are consistent with a reconnection mechanism for spicule generation, and with UV spicules being a sheath region surrounding the Hα spicules.

  17. Full-Frame Reference for Test Photo of Moon

    NASA Image and Video Library

    2005-09-10

    This pair of views shows how little of the full image frame was taken up by the Moon in test images taken Sept. 8, 2005, by the High Resolution Imaging Science Experiment HiRISE camera on NASA Mars Reconnaissance Orbiter.

  18. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs

    PubMed Central

    2017-01-01

    Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package. PMID:29107980

  19. Block Adjustment and Image Matching of WORLDVIEW-3 Stereo Pairs and Accuracy Evaluation

    NASA Astrophysics Data System (ADS)

    Zuo, C.; Xiao, X.; Hou, Q.; Li, B.

    2018-05-01

    WorldView-3, as a high-resolution commercial earth observation satellite, which is launched by Digital Global, provides panchromatic imagery of 0.31 m resolution. The positioning accuracy is less than 3.5 meter CE90 without ground control, which can use for large scale topographic mapping. This paper presented the block adjustment for WorldView-3 based on RPC model and achieved the accuracy of 1 : 2000 scale topographic mapping with few control points. On the base of stereo orientation result, this paper applied two kinds of image matching algorithm for DSM extraction: LQM and SGM. Finally, this paper compared the accuracy of the point cloud generated by the two image matching methods with the reference data which was acquired by an airborne laser scanner. The results showed that the RPC adjustment model of WorldView-3 image with small number of GCPs could satisfy the requirement of Chinese Surveying and Mapping regulations for 1 : 2000 scale topographic maps. And the point cloud result obtained through WorldView-3 stereo image matching had higher elevation accuracy, the RMS error of elevation for bare ground area is 0.45 m, while for buildings the accuracy can almost reach 1 meter.

  20. Globally optimal tumor segmentation in PET-CT images: a graph-based co-segmentation method.

    PubMed

    Han, Dongfeng; Bayouth, John; Song, Qi; Taurani, Aakant; Sonka, Milan; Buatti, John; Wu, Xiaodong

    2011-01-01

    Tumor segmentation in PET and CT images is notoriously challenging due to the low spatial resolution in PET and low contrast in CT images. In this paper, we have proposed a general framework to use both PET and CT images simultaneously for tumor segmentation. Our method utilizes the strength of each imaging modality: the superior contrast of PET and the superior spatial resolution of CT. We formulate this problem as a Markov Random Field (MRF) based segmentation of the image pair with a regularized term that penalizes the segmentation difference between PET and CT. Our method simulates the clinical practice of delineating tumor simultaneously using both PET and CT, and is able to concurrently segment tumor from both modalities, achieving globally optimal solutions in low-order polynomial time by a single maximum flow computation. The method was evaluated on clinically relevant tumor segmentation problems. The results showed that our method can effectively make use of both PET and CT image information, yielding segmentation accuracy of 0.85 in Dice similarity coefficient and the average median hausdorff distance (HD) of 6.4 mm, which is 10% (resp., 16%) improvement compared to the graph cuts method solely using the PET (resp., CT) images.

  1. From trees to forest: relational complexity network and workload of air traffic controllers.

    PubMed

    Zhang, Jingyu; Yang, Jiazhong; Wu, Changxu

    2015-01-01

    In this paper, we propose a relational complexity (RC) network framework based on RC metric and network theory to model controllers' workload in conflict detection and resolution. We suggest that, at the sector level, air traffic showing a centralised network pattern can provide cognitive benefits in visual search and resolution decision which will in turn result in lower workload. We found that the network centralisation index can account for more variance in predicting perceived workload and task completion time in both a static conflict detection task (Study 1) and a dynamic one (Study 2) in addition to other aircraft-level and pair-level factors. This finding suggests that linear combination of aircraft-level or dyad-level information may not be adequate and the global-pattern-based index is necessary. Theoretical and practical implications of using this framework to improve future workload modelling and management are discussed. We propose a RC network framework to model the workload of air traffic controllers. The effect of network centralisation was examined in both a static conflict detection task and a dynamic one. Network centralisation was predictive of perceived workload and task completion time over and above other control variables.

  2. DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

    PubMed

    Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

    2012-10-11

    Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

  3. Point Cloud and Digital Surface Model Generation from High Resolution Multiple View Stereo Satellite Imagery

    NASA Astrophysics Data System (ADS)

    Gong, K.; Fritsch, D.

    2018-05-01

    Nowadays, multiple-view stereo satellite imagery has become a valuable data source for digital surface model generation and 3D reconstruction. In 2016, a well-organized multiple view stereo publicly benchmark for commercial satellite imagery has been released by the John Hopkins University Applied Physics Laboratory, USA. This benchmark motivates us to explore the method that can generate accurate digital surface models from a large number of high resolution satellite images. In this paper, we propose a pipeline for processing the benchmark data to digital surface models. As a pre-procedure, we filter all the possible image pairs according to the incidence angle and capture date. With the selected image pairs, the relative bias-compensated model is applied for relative orientation. After the epipolar image pairs' generation, dense image matching and triangulation, the 3D point clouds and DSMs are acquired. The DSMs are aligned to a quasi-ground plane by the relative bias-compensated model. We apply the median filter to generate the fused point cloud and DSM. By comparing with the reference LiDAR DSM, the accuracy, the completeness and the robustness are evaluated. The results show, that the point cloud reconstructs the surface with small structures and the fused DSM generated by our pipeline is accurate and robust.

  4. Development of Genic and Genomic SSR Markers of Robusta Coffee (Coffea canephora Pierre Ex A. Froehner)

    PubMed Central

    Hendre, Prasad S.; Aggarwal, Ramesh K.

    2014-01-01

    Coffee breeding and improvement efforts can be greatly facilitated by availability of a large repository of simple sequence repeats (SSRs) based microsatellite markers, which provides efficiency and high-resolution in genetic analyses. This study was aimed to improve SSR availability in coffee by developing new genic−/genomic-SSR markers using in-silico bioinformatics and streptavidin-biotin based enrichment approach, respectively. The expressed sequence tag (EST) based genic microsatellite markers (EST-SSRs) were developed using the publicly available dataset of 13,175 unigene ESTs, which showed a distribution of 1 SSR/3.4 kb of coffee transcriptome. Genomic SSRs, on the other hand, were developed from an SSR-enriched small-insert partial genomic library of robusta coffee. In total, 69 new SSRs (44 EST-SSRs and 25 genomic SSRs) were developed and validated as suitable genetic markers. Diversity analysis of selected coffee genotypes revealed these to be highly informative in terms of allelic diversity and PIC values, and eighteen of these markers (∼27%) could be mapped on a robusta linkage map. Notably, the markers described here also revealed a very high cross-species transferability. In addition to the validated markers, we have also designed primer pairs for 270 putative EST-SSRs, which are expected to provide another ca. 200 useful genetic markers considering the high success rate (88%) of marker conversion of similar pairs tested/validated in this study. PMID:25461752

  5. Long-stem shaped multifunctional molecular beacon for highly sensitive nucleic acids determination via intramolecular and intermolecular interactions based strand displacement amplification.

    PubMed

    Xu, Jianguo; Zheng, Tingting; Le, Jingqing; Jia, Lee

    2017-11-20

    Occurrence and application of oligonucleotide probes have promoted great progress in the biochemical analysis field due to their unique biological and chemical properties. In this work, a long-stem shaped multifunctional molecular beacon (LS-MMB) that is responsive to a cancer-related gene, p53, is well-prepared. By designing the probe with long-paired bases at its two ends and short-paired bases between the middle region and the 3' end, the LS-MMB is intelligently endowed with the ability to recognize the target analyte, serve as the polymerization primer/template, and signal the hybridization event synchronously, which is distinctly advantageous over the traditional molecular beacons (MBs). Moreover, it is excitingly found that the LS-MMB can be employed to exert intramolecular and intermolecular interactions for strand displacement amplification (SDA) without the involvement of any assistant probes; this therapy results in a really easy and rapid sensing system that provides an extremely low background noise and high target output signal. In this case, an excellent sensitivity and specificity to detect target gene down to picomolar level and resolution to even one nucleotide variation are achieved, respectively. In addition, the application potential for real genomic DNA analysis is realized. We envision that the probe of LS-MMB can act as a universal platform for biosensing and biomedical research.

  6. A close-pair binary in a distant triple supermassive black hole system.

    PubMed

    Deane, R P; Paragi, Z; Jarvis, M J; Coriat, M; Bernardi, G; Fender, R P; Frey, S; Heywood, I; Klöckner, H-R; Grainge, K; Rumsey, C

    2014-07-03

    Galaxies are believed to evolve through merging, which should lead to some hosting multiple supermassive black holes. There are four known triple black hole systems, with the closest black hole pair being 2.4 kiloparsecs apart (the third component in this system is at 3 kiloparsecs), which is far from the gravitational sphere of influence (about 100 parsecs for a black hole with mass one billion times that of the Sun). Previous searches for compact black hole systems concluded that they were rare, with the tightest binary system having a separation of 7 parsecs (ref. 10). Here we report observations of a triple black hole system at redshift z = 0.39, with the closest pair separated by about 140 parsecs and significantly more distant from Earth than any other known binary of comparable orbital separation. The effect of the tight pair is to introduce a rotationally symmetric helical modulation on the structure of the large-scale radio jets, which provides a useful way to search for other tight pairs without needing extremely high resolution observations. As we found this tight pair after searching only six galaxies, we conclude that tight pairs are more common than hitherto believed, which is an important observational constraint for low-frequency gravitational wave experiments.

  7. The pulse-pair algorithm as a robust estimator of turbulent weather spectral parameters using airborne pulse Doppler radar

    NASA Technical Reports Server (NTRS)

    Baxa, Ernest G., Jr.; Lee, Jonggil

    1991-01-01

    The pulse pair method for spectrum parameter estimation is commonly used in pulse Doppler weather radar signal processing since it is economical to implement and can be shown to be a maximum likelihood estimator. With the use of airborne weather radar for windshear detection, the turbulent weather and strong ground clutter return spectrum differs from that assumed in its derivation, so the performance robustness of the pulse pair technique must be understood. Here, the effect of radar system pulse to pulse phase jitter and signal spectrum skew on the pulse pair algorithm performance is discussed. Phase jitter effect may be significant when the weather return signal to clutter ratio is very low and clutter rejection filtering is attempted. The analysis can be used to develop design specifications for airborne radar system phase stability. It is also shown that the weather return spectrum skew can cause a significant bias in the pulse pair mean windspeed estimates, and that the poly pulse pair algorithm can reduce this bias. It is suggested that use of a spectrum mode estimator may be more appropriate in characterizing the windspeed within a radar range resolution cell for detection of hazardous windspeed gradients.

  8. Qualification test of a MPPC-based PET module for future MRI-PET scanners

    NASA Astrophysics Data System (ADS)

    Kurei, Y.; Kataoka, J.; Kato, T.; Fujita, T.; Funamoto, H.; Tsujikawa, T.; Yamamoto, S.

    2014-11-01

    We have developed a high-resolution, compact Positron Emission Tomography (PET) module for future use in MRI-PET scanners. The module consists of large-area, 4×4 ch MPPC arrays (Hamamatsu S11827-3344MG) optically coupled with Ce:LYSO scintillators fabricated into 12×12 matrices of 1×1 mm2 pixels. At this stage, a pair of module and coincidence circuits was assembled into an experimental prototype gantry arranged in a ring of 90 mm in diameter to form the MPPC-based PET system. The PET detector ring was then positioned around the RF coil of the 4.7 T MRI system. We took an image of a point 22Na source under fast spin echo (FSE) and gradient echo (GE), in order to measure interference between the MPPC-based PET and the MRI. We only found a slight degradation in the spatial resolution of the PET image from 1.63 to 1.70 mm (FWHM; x-direction), or 1.48-1.55 mm (FWHM; y-direction) when operating with the MRI, while the signal-to-noise ratio (SNR) of the MRI image was only degraded by 5%. These results encouraged us to develop a more advanced version of the MRI-PET gantry with eight MPPC-based PET modules, whose detailed design and first qualification test are also presented in this paper.

  9. ICLUS v1.3 Population Projections

    EPA Pesticide Factsheets

    Climate and land-use change are major components of global environmental change with feedbacks between these components. The consequences of these interactions show that land use may exacerbate or alleviate climate change effects. Based on these findings it is important to use land-use scenarios that are consistent with the specific assumptions underlying climate-change scenarios. The Integrated Climate and Land-Use Scenarios (ICLUS) project developed land-use outputs that are based on a downscaled version of the Intergovernmental Panel on Climate Change (IPCC) Special Report on Emissions Scenarios (SRES) social, economic, and demographic storylines. ICLUS outputs are derived from a pair of models. A demographic model generates county-level population estimates that are distributed by a spatial allocation model (SERGoM v3) as housing density across the landscape. Land-use outputs were developed for the four main SRES storylines and a baseline (base case). The model is run for the conterminous USA and output is available for each scenario by decade to 2100. In addition to housing density at a 1 hectare spatial resolution, this project also generated estimates of impervious surface at a resolution of 1 square kilometer. This shapefile holds population data for all counties of the conterminous USA for all decades (2010-2100) and SRES population growth scenarios (A1, A2, B1, B2), as well as a 'base case' (BC) scenario, for use in the Integrated Climate and Land Use

  10. Comparison of Interferometric Time-Series Analysis Techniques with Implications for Future Mission Design

    NASA Astrophysics Data System (ADS)

    Werner, C. L.; Wegmuller, U.; Strozzi, T.; Wiesmann, A.

    2006-12-01

    Principle contributors to the noise in differential SAR interferograms are temporal phase stability of the surface, geometry relating to baseline and surface slope, and propagation path delay variations due to tropospheric water vapor and the ionosphere. Time series analysis of multiple interferograms generated from a stack of SAR SLC images seeks to determine the deformation history of the surface while reducing errors. Only those scatterers within a resolution element that are stable and coherent for each interferometric pair contribute to the desired deformation signal. Interferograms with baselines exceeding 1/3 the critical baseline have substantial geometrical decorrelation for distributed targets. Short baseline pairs with multiple reference scenes can be combined using least-squares estimation to obtain a global deformation solution. Alternately point-like persistent scatterers can be identified in scenes that do not exhibit geometrical decorrelation associated with large baselines. In this approach interferograms are formed from a stack of SAR complex images using a single reference scene. Stable distributed scatter pixels are excluded however due to the presence of large baselines. We apply both point- based and short-baseline methodologies and compare results for a stack of fine-beam Radarsat data acquired in 2002-2004 over a rapidly subsiding oil field near Lost Hills, CA. We also investigate the density of point-like scatters with respect to image resolution. The primary difficulty encountered when applying time series methods is phase unwrapping errors due to spatial and temporal gaps. Phase unwrapping requires sufficient spatial and temporal sampling. Increasing the SAR range bandwidth increases the range resolution as well as increasing the critical interferometric baseline that defines the required satellite orbital tube diameter. Sufficient spatial sampling also permits unwrapping because of the reduced phase/pixel gradient. Short time intervals further reduce the differential phase due to deformation when the deformation is continuous. Lower frequency systems (L- vs. C-Band) substantially improve the ability to unwrap the phase correctly by directly reducing both interferometric phase amplitude and temporal decorrelation.

  11. Four pi-recoil proportional counter used as neutron spectrometer

    NASA Technical Reports Server (NTRS)

    Bennett, E. F.

    1968-01-01

    Study considers problems encountered in using 4 pi-recoil counters for neutron spectra measurement. Emphasis is placed on calibration, shape discrimination, variation of W, the average energy loss per ion pair, and the effects of differentiation on the intrinsic counter resolution.

  12. An overview of instrumentation for the Large Binocular Telescope

    NASA Astrophysics Data System (ADS)

    Wagner, R. Mark

    2010-07-01

    An overview of instrumentation for the Large Binocular Telescope is presented. Optical instrumentation includes the Large Binocular Camera (LBC), a pair of wide-field (27 × 27) mosaic CCD imagers at the prime focus, and the Multi-Object Double Spectrograph (MODS), a pair of dual-beam blue-red optimized long-slit spectrographs mounted at the straight-through F/15 Gregorian focus incorporating multiple slit masks for multi-object spectroscopy over a 6 field and spectral resolutions of up to 8000. Infrared instrumentation includes the LBT Near-IR Spectroscopic Utility with Camera and Integral Field Unit for Extragalactic Research (LUCIFER), a modular near-infrared (0.9-2.5 μm) imager and spectrograph pair mounted at a bent interior focal station and designed for seeing-limited (FOV: 4 × 4) imaging, long-slit spectroscopy, and multi-object spectroscopy utilizing cooled slit masks and diffraction limited (FOV: 0.5 × 0.5) imaging and long-slit spectroscopy. Strategic instruments under development for the remaining two combined focal stations include an interferometric cryogenic beam combiner with near-infrared and thermal-infrared instruments for Fizeau imaging and nulling interferometry (LBTI) and an optical bench near-infrared beam combiner utilizing multi-conjugate adaptive optics for high angular resolution and sensitivity (LINC-NIRVANA). In addition, a fiber-fed bench spectrograph (PEPSI) capable of ultra high resolution spectroscopy and spectropolarimetry (R = 40,000-300,000) will be available as a principal investigator instrument. The availability of all these instruments mounted simultaneously on the LBT permits unique science, flexible scheduling, and improved operational support. Over the past two years the LBC and the first LUCIFER instrument have been brought into routine scientific operation and MODS1 commissioning is set to begin in the fall of 2010.

  13. Confocal microscopy refines generic concept of a problematic taxon: rediagnosis of the genus Neoprothrix and remarks on female anatomy of eriophyoids (Acari: Eriophyoidea).

    PubMed

    Chetverikov, Philipp E; Desnitskiy, Alexey G; Navia, Denise

    2015-02-16

    Due to the higher resolution, confocal microscopy (CLSM) can be applied to refine the origin of tiny structures of the autofluorescent exoskeletons of microarthropods (mites in particular) which are hard to visualize using traditional differential interference contract light microscopy (DIC LM) and phase contrast light microscopy (PC LM). Three-dimensional (3D) reconstructions of the prodorsal shield topography of eriophyoid mites using Neoprothrix hibiscus Reis and Navia as a model, suggest that the structures originally treated as paired setae vi are two internal rod-like apodemes. Based on this, the genus Neoprothrix is excluded from the subfamily Prothricinae Amrine and transferred to the subfamily Sierraphytoptinae Keifer. Observations on partially cleared specimens of N. hibiscus showed that remnants of the central nervous system, paired glands and developing oocytes can be visualized using DIC LM and CLSM methods. New high quality microscope images are provided of recently described "flower-shaped" structures and two main components of yolk inclusions of the mature eggs inside the oviduct.

  14. The Impact of Deviation from Michaelis-Menten Saturation on Mathematical Model Stability Properties

    NASA Technical Reports Server (NTRS)

    Blackwell, Charles; Kliss, Mark (Technical Monitor)

    1998-01-01

    Based on purely abstract ecological theory, it has been argued that a system composed of two or more consumers competing for the same resource cannot persist. By analysis on a Monod format mathematical model, Hubble and others demonstrated that this assertion is true for all but very special cases of such competing organisms which are determined by an index formed by a grouping of. the parameters which characterize the biological processes of the competing organisms. In the laboratory, using a bioreactor, Hansen and Hubble obtained confirmatory results for several cases of two competing species, and they characterized it as "qualitative confirmation" of the assertion. This result is amazing, since the analysis required the exact equality of the hey index, and it seems certain that no pair of organism species could have exactly equal values. It is quite plausible, however, that pairs of organism species could have approximately equal indices, and the question of how different they could be and still have coexistence of the two (or more) presents itself. In this paper, the pursuit of this question and a compatible resolution is presented.

  15. Fiducial and differential cross sections of Higgs boson production measured in the four-lepton decay channel in pp collisions at √{ s} = 8 TeV with the ATLAS detector

    NASA Astrophysics Data System (ADS)

    Aad, G.; Abbott, B.; Abdallah, J.; Abdel Khalek, S.; Abdinov, O.; Aben, R.; Abi, B.; Abolins, M.; Abouzeid, O. S.; Abramowicz, H.; Abreu, H.; Abreu, R.; Abulaiti, Y.; Acharya, B. S.; Adamczyk, L.; Adams, D. L.; Adelman, J.; Adomeit, S.; Adye, T.; Agatonovic-Jovin, T.; Aguilar-Saavedra, J. A.; Agustoni, M.; Ahlen, S. P.; Ahmadov, F.; Aielli, G.; Akerstedt, H.; Åkesson, T. P. A.; Akimoto, G.; Akimov, A. V.; Alberghi, G. L.; Albert, J.; Albrand, S.; Alconada Verzini, M. J.; Aleksa, M.; Aleksandrov, I. N.; Alexa, C.; Alexander, G.; Alexandre, G.; Alexopoulos, T.; Alhroob, M.; Alimonti, G.; Alio, L.; Alison, J.; Allbrooke, B. M. M.; Allison, L. J.; Allport, P. P.; Aloisio, A.; Alonso, A.; Alonso, F.; Alpigiani, C.; Altheimer, A.; Alvarez Gonzalez, B.; Alviggi, M. G.; Amako, K.; Amaral Coutinho, Y.; Amelung, C.; Amidei, D.; Amor Dos Santos, S. P.; Amorim, A.; Amoroso, S.; Amram, N.; Amundsen, G.; Anastopoulos, C.; Ancu, L. S.; Andari, N.; Andeen, T.; Anders, C. F.; Anders, G.; Anderson, K. J.; Andreazza, A.; Andrei, V.; Anduaga, X. S.; Angelidakis, S.; Angelozzi, I.; Anger, P.; Angerami, A.; Anghinolfi, F.; Anisenkov, A. V.; Anjos, N.; Annovi, A.; Antonaki, A.; Antonelli, M.; Antonov, A.; Antos, J.; Anulli, F.; Aoki, M.; Aperio Bella, L.; Apolle, R.; Arabidze, G.; Aracena, I.; Arai, Y.; Araque, J. P.; Arce, A. T. H.; Arguin, J.-F.; Argyropoulos, S.; Arik, M.; Armbruster, A. J.; Arnaez, O.; Arnal, V.; Arnold, H.; Arratia, M.; Arslan, O.; Artamonov, A.; Artoni, G.; Asai, S.; Asbah, N.; Ashkenazi, A.; Åsman, B.; Asquith, L.; Assamagan, K.; Astalos, R.; Atkinson, M.; Atlay, N. B.; Auerbach, B.; Augsten, K.; Aurousseau, M.; Avolio, G.; Azuelos, G.; Azuma, Y.; Baak, M. A.; Baas, A. E.; Bacci, C.; Bachacou, H.; Bachas, K.; Backes, M.; Backhaus, M.; Backus Mayes, J.; Badescu, E.; Bagiacchi, P.; Bagnaia, P.; Bai, Y.; Bain, T.; Baines, J. T.; Baker, O. K.; Balek, P.; Balli, F.; Banas, E.; Banerjee, Sw.; Bannoura, A. A. E.; Bansal, V.; Bansil, H. S.; Barak, L.; Baranov, S. P.; Barberio, E. L.; Barberis, D.; Barbero, M.; Barillari, T.; Barisonzi, M.; Barklow, T.; Barlow, N.; Barnett, B. M.; Barnett, R. M.; Barnovska, Z.; Baroncelli, A.; Barone, G.; Barr, A. J.; Barreiro, F.; Barreiro Guimarães da Costa, J.; Bartoldus, R.; Barton, A. E.; Bartos, P.; Bartsch, V.; Bassalat, A.; Basye, A.; Bates, R. L.; Batley, J. R.; Battaglia, M.; Battistin, M.; Bauer, F.; Bawa, H. S.; Beattie, M. D.; Beau, T.; Beauchemin, P. H.; Beccherle, R.; Bechtle, P.; Beck, H. P.; Becker, K.; Becker, S.; Beckingham, M.; Becot, C.; Beddall, A. J.; Beddall, A.; Bedikian, S.; Bednyakov, V. A.; Bee, C. P.; Beemster, L. J.; Beermann, T. A.; Begel, M.; Behr, K.; Belanger-Champagne, C.; Bell, P. J.; Bell, W. H.; Bella, G.; Bellagamba, L.; Bellerive, A.; Bellomo, M.; Belotskiy, K.; Beltramello, O.; Benary, O.; Benchekroun, D.; Bendtz, K.; Benekos, N.; Benhammou, Y.; Benhar Noccioli, E.; Benitez Garcia, J. A.; Benjamin, D. P.; Bensinger, J. R.; Benslama, K.; Bentvelsen, S.; Berge, D.; Bergeaas Kuutmann, E.; Berger, N.; Berghaus, F.; Beringer, J.; Bernard, C.; Bernat, P.; Bernius, C.; Bernlochner, F. U.; Berry, T.; Berta, P.; Bertella, C.; Bertoli, G.; Bertolucci, F.; Bertsche, C.; Bertsche, D.; Besana, M. I.; Besjes, G. J.; Bessidskaia, O.; Bessner, M.; Besson, N.; Betancourt, C.; Bethke, S.; Bhimji, W.; Bianchi, R. M.; Bianchini, L.; Bianco, M.; Biebel, O.; Bieniek, S. P.; Bierwagen, K.; Biesiada, J.; Biglietti, M.; Bilbao de Mendizabal, J.; Bilokon, H.; Bindi, M.; Binet, S.; Bingul, A.; Bini, C.; Black, C. W.; Black, J. E.; Black, K. M.; Blackburn, D.; Blair, R. E.; Blanchard, J.-B.; Blazek, T.; Bloch, I.; Blocker, C.; Blum, W.; Blumenschein, U.; Bobbink, G. J.; Bobrovnikov, V. S.; Bocchetta, S. S.; Bocci, A.; Bock, C.; Boddy, C. R.; Boehler, M.; Boek, T. T.; Bogaerts, J. A.; Bogdanchikov, A. G.; Bogouch, A.; Bohm, C.; Bohm, J.; Boisvert, V.; Bold, T.; Boldea, V.; Boldyrev, A. S.; Bomben, M.; Bona, M.; Boonekamp, M.; Borisov, A.; Borissov, G.; Borri, M.; Borroni, S.; Bortfeldt, J.; Bortolotto, V.; Bos, K.; Boscherini, D.; Bosman, M.; Boterenbrood, H.; Boudreau, J.; Bouffard, J.; Bouhova-Thacker, E. V.; Boumediene, D.; Bourdarios, C.; Bousson, N.; Boutouil, S.; Boveia, A.; Boyd, J.; Boyko, I. R.; Bozic, I.; Bracinik, J.; Brandt, A.; Brandt, G.; Brandt, O.; Bratzler, U.; Brau, B.; Brau, J. E.; Braun, H. M.; Brazzale, S. F.; Brelier, B.; Brendlinger, K.; Brennan, A. J.; Brenner, R.; Bressler, S.; Bristow, K.; Bristow, T. M.; Britton, D.; Brochu, F. M.; Brock, I.; Brock, R.; Bromberg, C.; Bronner, J.; Brooijmans, G.; Brooks, T.; Brooks, W. K.; Brosamer, J.; Brost, E.; Brown, J.; Bruckman de Renstrom, P. A.; Bruncko, D.; Bruneliere, R.; Brunet, S.; Bruni, A.; Bruni, G.; Bruschi, M.; Bryngemark, L.; Buanes, T.; Buat, Q.; Bucci, F.; Buchholz, P.; Buckingham, R. M.; Buckley, A. G.; Buda, S. I.; Budagov, I. A.; Buehrer, F.; Bugge, L.; Bugge, M. K.; Bulekov, O.; Bundock, A. C.; Burckhart, H.; Burdin, S.; Burghgrave, B.; Burke, S.; Burmeister, I.; Busato, E.; Büscher, D.; Büscher, V.; Bussey, P.; Buszello, C. P.; Butler, B.; Butler, J. M.; Butt, A. I.; Buttar, C. M.; Butterworth, J. M.; Butti, P.; Buttinger, W.; Buzatu, A.; Byszewski, M.; Cabrera Urbán, S.; Caforio, D.; Cakir, O.; Calafiura, P.; Calandri, A.; Calderini, G.; Calfayan, P.; Calkins, R.; Caloba, L. P.; Calvet, D.; Calvet, S.; Camacho Toro, R.; Camarda, S.; Cameron, D.; Caminada, L. M.; Caminal Armadans, R.; Campana, S.; Campanelli, M.; Campoverde, A.; Canale, V.; Canepa, A.; Cano Bret, M.; Cantero, J.; Cantrill, R.; Cao, T.; Capeans Garrido, M. D. M.; Caprini, I.; Caprini, M.; Capua, M.; Caputo, R.; Cardarelli, R.; Carli, T.; Carlino, G.; Carminati, L.; Caron, S.; Carquin, E.; Carrillo-Montoya, G. D.; Carter, J. R.; Carvalho, J.; Casadei, D.; Casado, M. P.; Casolino, M.; Castaneda-Miranda, E.; Castelli, A.; Castillo Gimenez, V.; Castro, N. F.; Catastini, P.; Catinaccio, A.; Catmore, J. R.; Cattai, A.; Cattani, G.; Caudron, J.; Cavaliere, V.; Cavalli, D.; Cavalli-Sforza, M.; Cavasinni, V.; Ceradini, F.; Cerio, B. C.; Cerny, K.; Cerqueira, A. S.; Cerri, A.; Cerrito, L.; Cerutti, F.; Cerv, M.; Cervelli, A.; Cetin, S. A.; Chafaq, A.; Chakraborty, D.; Chalupkova, I.; Chang, P.; Chapleau, B.; Chapman, J. D.; Charfeddine, D.; Charlton, D. G.; Chau, C. C.; Chavez Barajas, C. A.; Cheatham, S.; Chegwidden, A.; Chekanov, S.; Chekulaev, S. V.; Chelkov, G. A.; Chelstowska, M. A.; Chen, C.; Chen, H.; Chen, K.; Chen, L.; Chen, S.; Chen, X.; Chen, Y.; Chen, Y.; Cheng, H. C.; Cheng, Y.; Cheplakov, A.; Cherkaoui El Moursli, R.; Chernyatin, V.; Cheu, E.; Chevalier, L.; Chiarella, V.; Chiefari, G.; Childers, J. T.; Chilingarov, A.; Chiodini, G.; Chisholm, A. S.; Chislett, R. T.; Chitan, A.; Chizhov, M. V.; Chouridou, S.; Chow, B. K. B.; Chromek-Burckhart, D.; Chu, M. L.; Chudoba, J.; Chwastowski, J. J.; Chytka, L.; Ciapetti, G.; Ciftci, A. K.; Ciftci, R.; Cinca, D.; Cindro, V.; Ciocio, A.; Cirkovic, P.; Citron, Z. H.; Citterio, M.; Ciubancan, M.; Clark, A.; Clark, P. J.; Clarke, R. N.; Cleland, W.; Clemens, J. C.; Clement, C.; Coadou, Y.; Cobal, M.; Coccaro, A.; Cochran, J.; Coffey, L.; Cogan, J. G.; Coggeshall, J.; Cole, B.; Cole, S.; Colijn, A. P.; Collot, J.; Colombo, T.; Colon, G.; Compostella, G.; Conde Muiño, P.; Coniavitis, E.; Conidi, M. C.; Connell, S. H.; Connelly, I. A.; Consonni, S. M.; Consorti, V.; Constantinescu, S.; Conta, C.; Conti, G.; Conventi, F.; Cooke, M.; Cooper, B. D.; Cooper-Sarkar, A. M.; Cooper-Smith, N. J.; Copic, K.; Cornelissen, T.; Corradi, M.; Corriveau, F.; Corso-Radu, A.; Cortes-Gonzalez, A.; Cortiana, G.; Costa, G.; Costa, M. J.; Costanzo, D.; Côté, D.; Cottin, G.; Cowan, G.; Cox, B. E.; Cranmer, K.; Cree, G.; Crépé-Renaudin, S.; Crescioli, F.; Cribbs, W. A.; Crispin Ortuzar, M.; Cristinziani, M.; Croft, V.; Crosetti, G.; Cuciuc, C.-M.; Cuhadar Donszelmann, T.; Cummings, J.; Curatolo, M.; Cuthbert, C.; Czirr, H.; Czodrowski, P.; Czyczula, Z.; D'Auria, S.; D'Onofrio, M.; da Cunha Sargedas de Sousa, M. J.; da Via, C.; Dabrowski, W.; Dafinca, A.; Dai, T.; Dale, O.; Dallaire, F.; Dallapiccola, C.; Dam, M.; Daniells, A. C.; Dano Hoffmann, M.; Dao, V.; Darbo, G.; Darmora, S.; Dassoulas, J. A.; Dattagupta, A.; Davey, W.; David, C.; Davidek, T.; Davies, E.; Davies, M.; Davignon, O.; Davison, A. R.; Davison, P.; Davygora, Y.; Dawe, E.; Dawson, I.; Daya-Ishmukhametova, R. K.; de, K.; de Asmundis, R.; de Castro, S.; de Cecco, S.; de Groot, N.; de Jong, P.; de la Torre, H.; de Lorenzi, F.; de Nooij, L.; de Pedis, D.; de Salvo, A.; de Sanctis, U.; de Santo, A.; de Vivie de Regie, J. B.; Dearnaley, W. J.; Debbe, R.; Debenedetti, C.; Dechenaux, B.; Dedovich, D. V.; Deigaard, I.; Del Peso, J.; Del Prete, T.; Deliot, F.; Delitzsch, C. M.; Deliyergiyev, M.; Dell'Acqua, A.; Dell'Asta, L.; Dell'Orso, M.; Della Pietra, M.; Della Volpe, D.; Delmastro, M.; Delsart, P. A.; Deluca, C.; Demers, S.; Demichev, M.; Demilly, A.; Denisov, S. P.; Derendarz, D.; Derkaoui, J. E.; Derue, F.; Dervan, P.; Desch, K.; Deterre, C.; Deviveiros, P. O.; Dewhurst, A.; Dhaliwal, S.; di Ciaccio, A.; di Ciaccio, L.; di Domenico, A.; di Donato, C.; di Girolamo, A.; di Girolamo, B.; di Mattia, A.; di Micco, B.; di Nardo, R.; di Simone, A.; di Sipio, R.; di Valentino, D.; Dias, F. A.; Diaz, M. A.; Diehl, E. B.; Dietrich, J.; Dietzsch, T. A.; Diglio, S.; Dimitrievska, A.; Dingfelder, J.; Dionisi, C.; Dita, P.; Dita, S.; Dittus, F.; Djama, F.; Djobava, T.; Djuvsland, J. I.; Do Vale, M. A. B.; Do Valle Wemans, A.; Dobos, D.; Doglioni, C.; Doherty, T.; Dohmae, T.; Dolejsi, J.; Dolezal, Z.; Dolgoshein, B. A.; Donadelli, M.; Donati, S.; Dondero, P.; Donini, J.; Dopke, J.; Doria, A.; Dova, M. T.; Doyle, A. T.; Dris, M.; Dubbert, J.; Dube, S.; Dubreuil, E.; Duchovni, E.; Duckeck, G.; Ducu, O. A.; Duda, D.; Dudarev, A.; Dudziak, F.; Duflot, L.; Duguid, L.; Dührssen, M.; Dunford, M.; Duran Yildiz, H.; Düren, M.; Durglishvili, A.; Dwuznik, M.; Dyndal, M.; Ebke, J.; Edson, W.; Edwards, N. C.; Ehrenfeld, W.; Eifert, T.; Eigen, G.; Einsweiler, K.; Ekelof, T.; El Kacimi, M.; Ellert, M.; Elles, S.; Ellinghaus, F.; Ellis, N.; Elmsheuser, J.; Elsing, M.; Emeliyanov, D.; Enari, Y.; Endner, O. C.; Endo, M.; Engelmann, R.; Erdmann, J.; Ereditato, A.; Eriksson, D.; Ernis, G.; Ernst, J.; Ernst, M.; Ernwein, J.; Errede, D.; Errede, S.; Ertel, E.; Escalier, M.; Esch, H.; Escobar, C.; Esposito, B.; Etienvre, A. I.; Etzion, E.; Evans, H.; Ezhilov, A.; Fabbri, L.; Facini, G.; Fakhrutdinov, R. M.; Falciano, S.; Falla, R. J.; Faltova, J.; Fang, Y.; Fanti, M.; Farbin, A.; Farilla, A.; Farooque, T.; Farrell, S.; Farrington, S. M.; Farthouat, P.; Fassi, F.; Fassnacht, P.; Fassouliotis, D.; Favareto, A.; Fayard, L.; Federic, P.; Fedin, O. L.; Fedorko, W.; Fehling-Kaschek, M.; Feigl, S.; Feligioni, L.; Feng, C.; Feng, E. J.; Feng, H.; Fenyuk, A. B.; Fernandez Perez, S.; Ferrag, S.; Ferrando, J.; Ferrari, A.; Ferrari, P.; Ferrari, R.; Ferreira de Lima, D. E.; Ferrer, A.; Ferrere, D.; Ferretti, C.; Ferretto Parodi, A.; Fiascaris, M.; Fiedler, F.; Filipčič, A.; Filipuzzi, M.; Filthaut, F.; Fincke-Keeler, M.; Finelli, K. D.; Fiolhais, M. C. N.; Fiorini, L.; Firan, A.; Fischer, A.; Fischer, J.; Fisher, W. C.; Fitzgerald, E. A.; Flechl, M.; Fleck, I.; Fleischmann, P.; Fleischmann, S.; Fletcher, G. T.; Fletcher, G.; Flick, T.; Floderus, A.; Flores Castillo, L. R.; Florez Bustos, A. C.; Flowerdew, M. J.; Formica, A.; Forti, A.; Fortin, D.; Fournier, D.; Fox, H.; Fracchia, S.; Francavilla, P.; Franchini, M.; Franchino, S.; Francis, D.; Franconi, L.; Franklin, M.; Franz, S.; Fraternali, M.; French, S. T.; Friedrich, C.; Friedrich, F.; Froidevaux, D.; Frost, J. A.; Fukunaga, C.; Fullana Torregrosa, E.; Fulsom, B. G.; Fuster, J.; Gabaldon, C.; Gabizon, O.; Gabrielli, A.; Gabrielli, A.; Gadatsch, S.; Gadomski, S.; Gagliardi, G.; Gagnon, P.; Galea, C.; Galhardo, B.; Gallas, E. J.; Gallo, V.; Gallop, B. J.; Gallus, P.; Galster, G.; Gan, K. K.; Gao, J.; Gao, Y. S.; Garay Walls, F. M.; Garberson, F.; García, C.; García Navarro, J. E.; Garcia-Sciveres, M.; Gardner, R. W.; Garelli, N.; Garonne, V.; Gatti, C.; Gaudio, G.; Gaur, B.; Gauthier, L.; Gauzzi, P.; Gavrilenko, I. L.; Gay, C.; Gaycken, G.; Gazis, E. N.; Ge, P.; Gecse, Z.; Gee, C. N. P.; Geerts, D. A. A.; Geich-Gimbel, Ch.; Gellerstedt, K.; Gemme, C.; Gemmell, A.; Genest, M. H.; Gentile, S.; George, M.; George, S.; Gerbaudo, D.; Gershon, A.; Ghazlane, H.; Ghodbane, N.; Giacobbe, B.; Giagu, S.; Giangiobbe, V.; Giannetti, P.; Gianotti, F.; Gibbard, B.; Gibson, S. M.; Gilchriese, M.; Gillam, T. P. S.; Gillberg, D.; Gilles, G.; Gingrich, D. M.; Giokaris, N.; Giordani, M. P.; Giordano, R.; Giorgi, F. M.; Giorgi, F. M.; Giraud, P. F.; Giugni, D.; Giuliani, C.; Giulini, M.; Gjelsten, B. K.; Gkaitatzis, S.; Gkialas, I.; Gladilin, L. K.; Glasman, C.; Glatzer, J.; Glaysher, P. C. F.; Glazov, A.; Glonti, G. L.; Goblirsch-Kolb, M.; Goddard, J. R.; Godlewski, J.; Goeringer, C.; Goldfarb, S.; Golling, T.; Golubkov, D.; Gomes, A.; Gomez Fajardo, L. S.; Gonçalo, R.; Goncalves Pinto Firmino da Costa, J.; Gonella, L.; González de La Hoz, S.; Gonzalez Parra, G.; Gonzalez-Sevilla, S.; Goossens, L.; Gorbounov, P. A.; Gordon, H. A.; Gorelov, I.; Gorini, B.; Gorini, E.; Gorišek, A.; Gornicki, E.; Goshaw, A. T.; Gössling, C.; Gostkin, M. I.; Gouighri, M.; Goujdami, D.; Goulette, M. P.; Goussiou, A. G.; Goy, C.; Gozpinar, S.; Grabas, H. M. X.; Graber, L.; Grabowska-Bold, I.; Grafström, P.; Grahn, K.-J.; Gramling, J.; Gramstad, E.; Grancagnolo, S.; Grassi, V.; Gratchev, V.; Gray, H. M.; Graziani, E.; Grebenyuk, O. G.; Greenwood, Z. D.; Gregersen, K.; Gregor, I. M.; Grenier, P.; Griffiths, J.; Grillo, A. A.; Grimm, K.; Grinstein, S.; Gris, Ph.; Grishkevich, Y. V.; Grivaz, J.-F.; Grohs, J. P.; Grohsjean, A.; Gross, E.; Grosse-Knetter, J.; Grossi, G. C.; Groth-Jensen, J.; Grout, Z. J.; Guan, L.; Guenther, J.; Guescini, F.; Guest, D.; Gueta, O.; Guicheney, C.; Guido, E.; Guillemin, T.; Guindon, S.; Gul, U.; Gumpert, C.; Guo, J.; Gupta, S.; Gutierrez, P.; Gutierrez Ortiz, N. G.; Gutschow, C.; Guttman, N.; Guyot, C.; Gwenlan, C.; Gwilliam, C. B.; Haas, A.; Haber, C.; Hadavand, H. K.; Haddad, N.; Haefner, P.; Hageböck, S.; Hajduk, Z.; Hakobyan, H.; Haleem, M.; Hall, D.; Halladjian, G.; Hamacher, K.; Hamal, P.; Hamano, K.; Hamer, M.; Hamilton, A.; Hamilton, S.; Hamity, G. N.; Hamnett, P. G.; Han, L.; Hanagaki, K.; Hanawa, K.; Hance, M.; Hanke, P.; Hanna, R.; Hansen, J. B.; Hansen, J. D.; Hansen, P. H.; Hara, K.; Hard, A. S.; Harenberg, T.; Hariri, F.; Harkusha, S.; Harper, D.; Harrington, R. D.; Harris, O. M.; Harrison, P. F.; Hartjes, F.; Hasegawa, M.; Hasegawa, S.; Hasegawa, Y.; Hasib, A.; Hassani, S.; Haug, S.; Hauschild, M.; Hauser, R.; Havranek, M.; Hawkes, C. M.; Hawkings, R. J.; Hawkins, A. D.; Hayashi, T.; Hayden, D.; Hays, C. P.; Hayward, H. S.; Haywood, S. J.; Head, S. J.; Heck, T.; Hedberg, V.; Heelan, L.; Heim, S.; Heim, T.; Heinemann, B.; Heinrich, L.; Hejbal, J.; Helary, L.; Heller, C.; Heller, M.; Hellman, S.; Hellmich, D.; Helsens, C.; Henderson, J.; Henderson, R. C. W.; Heng, Y.; Hengler, C.; Henrichs, A.; Henriques Correia, A. M.; Henrot-Versille, S.; Herbert, G. H.; Hernández Jiménez, Y.; Herrberg-Schubert, R.; Herten, G.; Hertenberger, R.; Hervas, L.; Hesketh, G. G.; Hessey, N. P.; Hickling, R.; Higón-Rodriguez, E.; Hill, E.; Hill, J. C.; Hiller, K. H.; Hillert, S.; Hillier, S. J.; Hinchliffe, I.; Hines, E.; Hirose, M.; Hirschbuehl, D.; Hobbs, J.; Hod, N.; Hodgkinson, M. C.; Hodgson, P.; Hoecker, A.; Hoeferkamp, M. R.; Hoenig, F.; Hoffman, J.; Hoffmann, D.; Hohlfeld, M.; Holmes, T. R.; Hong, T. M.; Hooft van Huysduynen, L.; Hopkins, W. H.; Horii, Y.; Hostachy, J.-Y.; Hou, S.; Hoummada, A.; Howard, J.; Howarth, J.; Hrabovsky, M.; Hristova, I.; Hrivnac, J.; Hryn'ova, T.; Hsu, C.; Hsu, P. J.; Hsu, S.-C.; Hu, D.; Hu, X.; Huang, Y.; Hubacek, Z.; Hubaut, F.; Huegging, F.; Huffman, T. B.; Hughes, E. W.; Hughes, G.; Huhtinen, M.; Hülsing, T. A.; Hurwitz, M.; Huseynov, N.; Huston, J.; Huth, J.; Iacobucci, G.; Iakovidis, G.; Ibragimov, I.; Iconomidou-Fayard, L.; Ideal, E.; Idrissi, Z.; Iengo, P.; Igonkina, O.; Iizawa, T.; Ikegami, Y.; Ikematsu, K.; Ikeno, M.; Ilchenko, Y.; Iliadis, D.; Ilic, N.; Inamaru, Y.; Ince, T.; Ioannou, P.; Iodice, M.; Iordanidou, K.; Ippolito, V.; Irles Quiles, A.; Isaksson, C.; Ishino, M.; Ishitsuka, M.; Ishmukhametov, R.; Issever, C.; Istin, S.; Iturbe Ponce, J. M.; Iuppa, R.; Ivarsson, J.; Iwanski, W.; Iwasaki, H.; Izen, J. M.; Izzo, V.; Jackson, B.; Jackson, M.; Jackson, P.; Jaekel, M. R.; Jain, V.; Jakobs, K.; Jakobsen, S.; Jakoubek, T.; Jakubek, J.; Jamin, D. O.; Jana, D. K.; Jansen, E.; Jansen, H.; Janssen, J.; Janus, M.; Jarlskog, G.; Javadov, N.; Javůrek, T.; Jeanty, L.; Jejelava, J.; Jeng, G.-Y.; Jennens, D.; Jenni, P.; Jentzsch, J.; Jeske, C.; Jézéquel, S.; Ji, H.; Jia, J.; Jiang, Y.; Jimenez Belenguer, M.; Jin, S.; Jinaru, A.; Jinnouchi, O.; Joergensen, M. D.; Johansson, K. E.; Johansson, P.; Johns, K. A.; Jon-And, K.; Jones, G.; Jones, R. W. L.; Jones, T. J.; Jongmanns, J.; Jorge, P. M.; Joshi, K. D.; Jovicevic, J.; Ju, X.; Jung, C. A.; Jungst, R. M.; Jussel, P.; Juste Rozas, A.; Kaci, M.; Kaczmarska, A.; Kado, M.; Kagan, H.; Kagan, M.; Kajomovitz, E.; Kalderon, C. W.; Kama, S.; Kamenshchikov, A.; Kanaya, N.; Kaneda, M.; Kaneti, S.; Kantserov, V. A.; Kanzaki, J.; Kaplan, B.; Kapliy, A.; Kar, D.; Karakostas, K.; Karastathis, N.; Kareem, M. J.; Karnevskiy, M.; Karpov, S. N.; Karpova, Z. M.; Karthik, K.; Kartvelishvili, V.; Karyukhin, A. N.; Kashif, L.; Kasieczka, G.; Kass, R. D.; Kastanas, A.; Kataoka, Y.; Katre, A.; Katzy, J.; Kaushik, V.; Kawagoe, K.; Kawamoto, T.; Kawamura, G.; Kazama, S.; Kazanin, V. F.; Kazarinov, M. Y.; Keeler, R.; Kehoe, R.; Keil, M.; Keller, J. S.; Kempster, J. J.; Keoshkerian, H.; Kepka, O.; Kerševan, B. P.; Kersten, S.; Kessoku, K.; Keung, J.; Khalil-Zada, F.; Khandanyan, H.; Khanov, A.; Khodinov, A.; Khomich, A.; Khoo, T. J.; Khoriauli, G.; Khoroshilov, A.; Khovanskiy, V.; Khramov, E.; Khubua, J.; Kim, H. Y.; Kim, H.; Kim, S. H.; Kimura, N.; Kind, O.; King, B. T.; King, M.; King, R. S. B.; King, S. B.; Kirk, J.; Kiryunin, A. E.; Kishimoto, T.; Kisielewska, D.; Kiss, F.; Kittelmann, T.; Kiuchi, K.; Kladiva, E.; Klein, M.; Klein, U.; Kleinknecht, K.; Klimek, P.; Klimentov, A.; Klingenberg, R.; Klinger, J. A.; Klioutchnikova, T.; Klok, P. F.; Kluge, E.-E.; Kluit, P.; Kluth, S.; Kneringer, E.; Knoops, E. B. F. G.; Knue, A.; Kobayashi, D.; Kobayashi, T.; Kobel, M.; Kocian, M.; Kodys, P.; Koevesarki, P.; Koffas, T.; Koffeman, E.; Kogan, L. A.; Kohlmann, S.; Kohout, Z.; Kohriki, T.; Koi, T.; Kolanoski, H.; Koletsou, I.; Koll, J.; Komar, A. A.; Komori, Y.; Kondo, T.; Kondrashova, N.; Köneke, K.; König, A. C.; König, S.; Kono, T.; Konoplich, R.; Konstantinidis, N.; Kopeliansky, R.; Koperny, S.; Köpke, L.; Kopp, A. K.; Korcyl, K.; Kordas, K.; Korn, A.; Korol, A. A.; Korolkov, I.; Korolkova, E. V.; Korotkov, V. A.; Kortner, O.; Kortner, S.; Kostyukhin, V. V.; Kotov, V. M.; Kotwal, A.; Kourkoumelis, C.; Kouskoura, V.; Koutsman, A.; Kowalewski, R.; Kowalski, T. Z.; Kozanecki, W.; Kozhin, A. S.; Kral, V.; Kramarenko, V. A.; Kramberger, G.; Krasnopevtsev, D.; Krasznahorkay, A.; Kraus, J. K.; Kravchenko, A.; Kreiss, S.; Kretz, M.; Kretzschmar, J.; Kreutzfeldt, K.; Krieger, P.; Kroeninger, K.; Kroha, H.; Kroll, J.; Kroseberg, J.; Krstic, J.; Kruchonak, U.; Krüger, H.; Kruker, T.; Krumnack, N.; Krumshteyn, Z. V.; Kruse, A.; Kruse, M. C.; Kruskal, M.; Kubota, T.; Kucuk, H.; Kuday, S.; Kuehn, S.; Kugel, A.; Kuhl, A.; Kuhl, T.; Kukhtin, V.; Kulchitsky, Y.; Kuleshov, S.; Kuna, M.; Kunkle, J.; Kupco, A.; Kurashige, H.; Kurochkin, Y. A.; Kurumida, R.; Kus, V.; Kuwertz, E. S.; Kuze, M.; Kvita, J.; La Rosa, A.; La Rotonda, L.; Lacasta, C.; Lacava, F.; Lacey, J.; Lacker, H.; Lacour, D.; Lacuesta, V. R.; Ladygin, E.; Lafaye, R.; Laforge, B.; Lagouri, T.; Lai, S.; Laier, H.; Lambourne, L.; Lammers, S.; Lampen, C. L.; Lampl, W.; Lançon, E.; Landgraf, U.; Landon, M. P. J.; Lang, V. S.; Lankford, A. J.; Lanni, F.; Lantzsch, K.; Laplace, S.; Lapoire, C.; Laporte, J. F.; Lari, T.; Lasagni Manghi, F.; Lassnig, M.; Laurelli, P.; Lavrijsen, W.; Law, A. T.; Laycock, P.; Le Dortz, O.; Le Guirriec, E.; Le Menedeu, E.; Lecompte, T.; Ledroit-Guillon, F.; Lee, C. A.; Lee, H.; Lee, J. S. H.; Lee, S. C.; Lee, L.; Lefebvre, G.; Lefebvre, M.; Legger, F.; Leggett, C.; Lehan, A.; Lehmacher, M.; Lehmann Miotto, G.; Lei, X.; Leight, W. A.; Leisos, A.; Leister, A. G.; Leite, M. A. L.; Leitner, R.; Lellouch, D.; Lemmer, B.; Leney, K. J. C.; Lenz, T.; Lenzen, G.; Lenzi, B.; Leone, R.; Leone, S.; Leonidopoulos, C.; Leontsinis, S.; Leroy, C.; Lester, C. G.; Lester, C. M.; Levchenko, M.; Levêque, J.; Levin, D.; Levinson, L. J.; Levy, M.; Lewis, A.; Lewis, G. H.; Leyko, A. M.; Leyton, M.; Li, B.; Li, B.; Li, H.; Li, H. L.; Li, L.; Li, L.; Li, S.; Li, Y.; Liang, Z.; Liao, H.; Liberti, B.; Lichard, P.; Lie, K.; Liebal, J.; Liebig, W.; Limbach, C.; Limosani, A.; Lin, S. C.; Lin, T. H.; Linde, F.; Lindquist, B. E.; Linnemann, J. T.; Lipeles, E.; Lipniacka, A.; Lisovyi, M.; Liss, T. M.; Lissauer, D.; Lister, A.; Litke, A. M.; Liu, B.; Liu, D.; Liu, J. B.; Liu, K.; Liu, L.; Liu, M.; Liu, M.; Liu, Y.; Livan, M.; Livermore, S. S. A.; Lleres, A.; Llorente Merino, J.; Lloyd, S. L.; Lo Sterzo, F.; Lobodzinska, E.; Loch, P.; Lockman, W. S.; Loddenkoetter, T.; Loebinger, F. K.; Loevschall-Jensen, A. E.; Loginov, A.; Lohse, T.; Lohwasser, K.; Lokajicek, M.; Lombardo, V. P.; Long, B. A.; Long, J. D.; Long, R. E.; Lopes, L.; Lopez Mateos, D.; Lopez Paredes, B.; Lopez Paz, I.; Lorenz, J.; Lorenzo Martinez, N.; Losada, M.; Loscutoff, P.; Lou, X.; Lounis, A.; Love, J.; Love, P. A.; Lowe, A. J.; Lu, F.; Lu, N.; Lubatti, H. J.; Luci, C.; Lucotte, A.; Luehring, F.; Lukas, W.; Luminari, L.; Lundberg, O.; Lund-Jensen, B.; Lungwitz, M.; Lynn, D.; Lysak, R.; Lytken, E.; Ma, H.; Ma, L. L.; Maccarrone, G.; Macchiolo, A.; Machado Miguens, J.; Macina, D.; Madaffari, D.; Madar, R.; Maddocks, H. J.; Mader, W. F.; Madsen, A.; Maeno, M.; Maeno, T.; Maevskiy, A.; Magradze, E.; Mahboubi, K.; Mahlstedt, J.; Mahmoud, S.; Maiani, C.; Maidantchik, C.; Maier, A. A.; Maio, A.; Majewski, S.; Makida, Y.; Makovec, N.; Mal, P.; Malaescu, B.; Malecki, Pa.; Maleev, V. P.; Malek, F.; Mallik, U.; Malon, D.; Malone, C.; Maltezos, S.; Malyshev, V. M.; Malyukov, S.; Mamuzic, J.; Mancini, G.; Mandelli, B.; Mandelli, L.; Mandić, I.; Mandrysch, R.; Maneira, J.; Manfredini, A.; Manhaes de Andrade Filho, L.; Manjarres Ramos, J. A.; Mann, A.; Manning, P. M.; Manousakis-Katsikakis, A.; Mansoulie, B.; Mantifel, R.; Mapelli, L.; March, L.; Marchand, J. F.; Marchiori, G.; Marcisovsky, M.; Marino, C. P.; Marjanovic, M.; Marques, C. N.; Marroquim, F.; Marsden, S. P.; Marshall, Z.; Marti, L. F.; Marti-Garcia, S.; Martin, B.; Martin, B.; Martin, T. A.; Martin, V. J.; Martin Dit Latour, B.; Martinez, H.; Martinez, M.; Martin-Haugh, S.; Martyniuk, A. C.; Marx, M.; Marzano, F.; Marzin, A.; Masetti, L.; Mashimo, T.; Mashinistov, R.; Masik, J.; Maslennikov, A. L.; Massa, I.; Massa, L.; Massol, N.; Mastrandrea, P.; Mastroberardino, A.; Masubuchi, T.; Mättig, P.; Mattmann, J.; Maurer, J.; Maxfield, S. J.; Maximov, D. A.; Mazini, R.; Mazzaferro, L.; Mc Goldrick, G.; Mc Kee, S. P.; McCarn, A.; McCarthy, R. L.; McCarthy, T. G.; McCubbin, N. A.; McFarlane, K. W.; McFayden, J. A.; McHedlidze, G.; McMahon, S. J.; McPherson, R. A.; Mechnich, J.; Medinnis, M.; Meehan, S.; Mehlhase, S.; Mehta, A.; Meier, K.; Meineck, C.; Meirose, B.; Melachrinos, C.; Mellado Garcia, B. R.; Meloni, F.; Mengarelli, A.; Menke, S.; Meoni, E.; Mercurio, K. M.; Mergelmeyer, S.; Meric, N.; Mermod, P.; Merola, L.; Meroni, C.; Merritt, F. S.; Merritt, H.; Messina, A.; Metcalfe, J.; Mete, A. S.; Meyer, C.; Meyer, C.; Meyer, J.-P.; Meyer, J.; Middleton, R. P.; Migas, S.; Mijović, L.; Mikenberg, G.; Mikestikova, M.; Mikuž, M.; Milic, A.; Miller, D. W.; Mills, C.; Milov, A.; Milstead, D. A.; Milstein, D.; Minaenko, A. A.; Minami, Y.; Minashvili, I. A.; Mincer, A. I.; Mindur, B.; Mineev, M.; Ming, Y.; Mir, L. M.; Mirabelli, G.; Mitani, T.; Mitrevski, J.; Mitsou, V. A.; Mitsui, S.; Miucci, A.; Miyagawa, P. S.; Mjörnmark, J. U.; Moa, T.; Mochizuki, K.; Mohapatra, S.; Mohr, W.; Molander, S.; Moles-Valls, R.; Mönig, K.; Monini, C.; Monk, J.; Monnier, E.; Montejo Berlingen, J.; Monticelli, F.; Monzani, S.; Moore, R. W.; Morange, N.; Moreno, D.; Moreno Llácer, M.; Morettini, P.; Morgenstern, M.; Morii, M.; Moritz, S.; Morley, A. K.; Mornacchi, G.; Morris, J. D.; Morvaj, L.; Moser, H. G.; Mosidze, M.; Moss, J.; Motohashi, K.; Mount, R.; Mountricha, E.; Mouraviev, S. V.; Moyse, E. J. W.; Muanza, S.; Mudd, R. D.; Mueller, F.; Mueller, J.; Mueller, K.; Mueller, T.; Mueller, T.; Muenstermann, D.; Munwes, Y.; Murillo Quijada, J. A.; Murray, W. J.; Musheghyan, H.; Musto, E.; Myagkov, A. G.; Myska, M.; Nackenhorst, O.; Nadal, J.; Nagai, K.; Nagai, R.; Nagai, Y.; Nagano, K.; Nagarkar, A.; Nagasaka, Y.; Nagel, M.; Nairz, A. M.; Nakahama, Y.; Nakamura, K.; Nakamura, T.; Nakano, I.; Namasivayam, H.; Nanava, G.; Narayan, R.; Nattermann, T.; Naumann, T.; Navarro, G.; Nayyar, R.; Neal, H. A.; Nechaeva, P. Yu.; Neep, T. J.; Nef, P. D.; Negri, A.; Negri, G.; Negrini, M.; Nektarijevic, S.; Nellist, C.; Nelson, A.; Nelson, T. K.; Nemecek, S.; Nemethy, P.; Nepomuceno, A. A.; Nessi, M.; Neubauer, M. S.; Neumann, M.; Neves, R. M.; Nevski, P.; Newman, P. R.; Nguyen, D. H.; Nickerson, R. B.; Nicolaidou, R.; Nicquevert, B.; Nielsen, J.; Nikiforou, N.; Nikiforov, A.; Nikolaenko, V.; Nikolic-Audit, I.; Nikolics, K.; Nikolopoulos, K.; Nilsson, P.; Ninomiya, Y.; Nisati, A.; Nisius, R.; Nobe, T.; Nodulman, L.; Nomachi, M.; Nomidis, I.; Norberg, S.; Nordberg, M.; Novgorodova, O.; Nowak, S.; Nozaki, M.; Nozka, L.; Ntekas, K.; Nunes Hanninger, G.; Nunnemann, T.; Nurse, E.; Nuti, F.; O'Brien, B. J.; O'Grady, F.; O'Neil, D. C.; O'Shea, V.; Oakham, F. G.; Oberlack, H.; Obermann, T.; Ocariz, J.; Ochi, A.; Ochoa, M. I.; Oda, S.; Odaka, S.; Ogren, H.; Oh, A.; Oh, S. H.; Ohm, C. C.; Ohman, H.; Okamura, W.; Okawa, H.; Okumura, Y.; Okuyama, T.; Olariu, A.; Olchevski, A. G.; Olivares Pino, S. A.; Oliveira Damazio, D.; Oliver Garcia, E.; Olszewski, A.; Olszowska, J.; Onofre, A.; Onyisi, P. U. E.; Oram, C. J.; Oreglia, M. J.; Oren, Y.; Orestano, D.; Orlando, N.; Oropeza Barrera, C.; Orr, R. S.; Osculati, B.; Ospanov, R.; Otero Y Garzon, G.; Otono, H.; Ouchrif, M.; Ouellette, E. A.; Ould-Saada, F.; Ouraou, A.; Oussoren, K. P.; Ouyang, Q.; Ovcharova, A.; Owen, M.; Ozcan, V. E.; Ozturk, N.; Pachal, K.; Pacheco Pages, A.; Padilla Aranda, C.; Pagáčová, M.; Pagan Griso, S.; Paganis, E.; Pahl, C.; Paige, F.; Pais, P.; Pajchel, K.; Palacino, G.; Palestini, S.; Palka, M.; Pallin, D.; Palma, A.; Palmer, J. D.; Pan, Y. B.; Panagiotopoulou, E.; Panduro Vazquez, J. G.; Pani, P.; Panikashvili, N.; Panitkin, S.; Pantea, D.; Paolozzi, L.; Papadopoulou, Th. D.; Papageorgiou, K.; Paramonov, A.; Paredes Hernandez, D.; Parker, M. A.; Parodi, F.; Parsons, J. A.; Parzefall, U.; Pasqualucci, E.; Passaggio, S.; Passeri, A.; Pastore, F.; Pastore, Fr.; Pásztor, G.; Pataraia, S.; Patel, N. D.; Pater, J. R.; Patricelli, S.; Pauly, T.; Pearce, J.; Pedersen, L. E.; Pedersen, M.; Pedraza Lopez, S.; Pedro, R.; Peleganchuk, S. V.; Pelikan, D.; Peng, H.; Penning, B.; Penwell, J.; Perepelitsa, D. V.; Perez Codina, E.; Pérez García-Estañ, M. T.; Perez Reale, V.; Perini, L.; Pernegger, H.; Perrella, S.; Perrino, R.; Peschke, R.; Peshekhonov, V. D.; Peters, K.; Peters, R. F. Y.; Petersen, B. A.; Petersen, T. C.; Petit, E.; Petridis, A.; Petridou, C.; Petrolo, E.; Petrucci, F.; Pettersson, N. E.; Pezoa, R.; Phillips, P. W.; Piacquadio, G.; Pianori, E.; Picazio, A.; Piccaro, E.; Piccinini, M.; Piegaia, R.; Pignotti, D. T.; Pilcher, J. E.; Pilkington, A. D.; Pina, J.; Pinamonti, M.; Pinder, A.; Pinfold, J. L.; Pingel, A.; Pinto, B.; Pires, S.; Pitt, M.; Pizio, C.; Plazak, L.; Pleier, M.-A.; Pleskot, V.; Plotnikova, E.; Plucinski, P.; Pluth, D.; Poddar, S.; Podlyski, F.; Poettgen, R.; Poggioli, L.; Pohl, D.; Pohl, M.; Polesello, G.; Policicchio, A.; Polifka, R.; Polini, A.; Pollard, C. S.; Polychronakos, V.; Pommès, K.; Pontecorvo, L.; Pope, B. G.; Popeneciu, G. A.; Popovic, D. S.; Poppleton, A.; Portell Bueso, X.; Pospisil, S.; Potamianos, K.; Potrap, I. N.; Potter, C. J.; Potter, C. T.; Poulard, G.; Poveda, J.; Pozdnyakov, V.; Pralavorio, P.; Pranko, A.; Prasad, S.; Pravahan, R.; Prell, S.; Price, D.; Price, J.; Price, L. E.; Prieur, D.; Primavera, M.; Proissl, M.; Prokofiev, K.; Prokoshin, F.; Protopapadaki, E.; Protopopescu, S.; Proudfoot, J.; Przybycien, M.; Przysiezniak, H.; Ptacek, E.; Puddu, D.; Pueschel, E.; Puldon, D.; Purohit, M.; Puzo, P.; Qian, J.; Qin, G.; Qin, Y.; Quadt, A.; Quarrie, D. R.; Quayle, W. B.; Queitsch-Maitland, M.; Quilty, D.; Qureshi, A.; Radeka, V.; Radescu, V.; Radhakrishnan, S. K.; Radloff, P.; Rados, P.; Ragusa, F.; Rahal, G.; Rajagopalan, S.; Rammensee, M.; Randle-Conde, A. S.; Rangel-Smith, C.; Rao, K.; Rauscher, F.; Rave, T. C.; Ravenscroft, T.; Raymond, M.; Read, A. L.; Readioff, N. P.; Rebuzzi, D. M.; Redelbach, A.; Redlinger, G.; Reece, R.; Reeves, K.; Rehnisch, L.; Reisin, H.; Relich, M.; Rembser, C.; Ren, H.; Ren, Z. L.; Renaud, A.; Rescigno, M.; Resconi, S.; Rezanova, O. L.; Reznicek, P.; Rezvani, R.; Richter, R.; Ridel, M.; Rieck, P.; Rieger, J.; Rijssenbeek, M.; Rimoldi, A.; Rinaldi, L.; Ritsch, E.; Riu, I.; Rizatdinova, F.; Rizvi, E.; Robertson, S. H.; Robichaud-Veronneau, A.; Robinson, D.; Robinson, J. E. M.; Robson, A.; Roda, C.; Rodrigues, L.; Roe, S.; Røhne, O.; Rolli, S.; Romaniouk, A.; Romano, M.; Romero Adam, E.; Rompotis, N.; Ronzani, M.; Roos, L.; Ros, E.; Rosati, S.; Rosbach, K.; Rose, M.; Rose, P.; Rosendahl, P. L.; Rosenthal, O.; Rossetti, V.; Rossi, E.; Rossi, L. P.; Rosten, R.; Rotaru, M.; Roth, I.; Rothberg, J.; Rousseau, D.; Royon, C. R.; Rozanov, A.; Rozen, Y.; Ruan, X.; Rubbo, F.; Rubinskiy, I.; Rud, V. I.; Rudolph, C.; Rudolph, M. S.; Rühr, F.; Ruiz-Martinez, A.; Rurikova, Z.; Rusakovich, N. A.; Ruschke, A.; Rutherfoord, J. P.; Ruthmann, N.; Ryabov, Y. F.; Rybar, M.; Rybkin, G.; Ryder, N. C.; Saavedra, A. F.; Sabato, G.; Sacerdoti, S.; Saddique, A.; Sadeh, I.; Sadrozinski, H. F.-W.; Sadykov, R.; Safai Tehrani, F.; Sakamoto, H.; Sakurai, Y.; Salamanna, G.; Salamon, A.; Saleem, M.; Salek, D.; Sales de Bruin, P. H.; Salihagic, D.; Salnikov, A.; Salt, J.; Salvatore, D.; Salvatore, F.; Salvucci, A.; Salzburger, A.; Sampsonidis, D.; Sanchez, A.; Sánchez, J.; Sanchez Martinez, V.; Sandaker, H.; Sandbach, R. L.; Sander, H. G.; Sanders, M. P.; Sandhoff, M.; Sandoval, T.; Sandoval, C.; Sandstroem, R.; Sankey, D. P. C.; Sansoni, A.; Santoni, C.; Santonico, R.; Santos, H.; Santoyo Castillo, I.; Sapp, K.; Sapronov, A.; Saraiva, J. G.; Sarrazin, B.; Sartisohn, G.; Sasaki, O.; Sasaki, Y.; Sauvage, G.; Sauvan, E.; Savard, P.; Savu, D. O.; Sawyer, C.; Sawyer, L.; Saxon, D. H.; Saxon, J.; Sbarra, C.; Sbrizzi, A.; Scanlon, T.; Scannicchio, D. A.; Scarcella, M.; Scarfone, V.; Schaarschmidt, J.; Schacht, P.; Schaefer, D.; Schaefer, R.; Schaepe, S.; Schaetzel, S.; Schäfer, U.; Schaffer, A. C.; Schaile, D.; Schamberger, R. D.; Scharf, V.; Schegelsky, V. A.; Scheirich, D.; Schernau, M.; Scherzer, M. I.; Schiavi, C.; Schieck, J.; Schillo, C.; Schioppa, M.; Schlenker, S.; Schmidt, E.; Schmieden, K.; Schmitt, C.; Schmitt, S.; Schneider, B.; Schnellbach, Y. J.; Schnoor, U.; Schoeffel, L.; Schoening, A.; Schoenrock, B. D.; Schorlemmer, A. L. S.; Schott, M.; Schouten, D.; Schovancova, J.; Schramm, S.; Schreyer, M.; Schroeder, C.; Schuh, N.; Schultens, M. J.; Schultz-Coulon, H.-C.; Schulz, H.; Schumacher, M.; Schumm, B. A.; Schune, Ph.; Schwanenberger, C.; Schwartzman, A.; Schwarz, T. A.; Schwegler, Ph.; Schwemling, Ph.; Schwienhorst, R.; Schwindling, J.; Schwindt, T.; Schwoerer, M.; Sciacca, F. G.; Scifo, E.; Sciolla, G.; Scott, W. G.; Scuri, F.; Scutti, F.; Searcy, J.; Sedov, G.; Sedykh, E.; Seidel, S. C.; Seiden, A.; Seifert, F.; Seixas, J. M.; Sekhniaidze, G.; Sekula, S. J.; Selbach, K. E.; Seliverstov, D. M.; Sellers, G.; Semprini-Cesari, N.; Serfon, C.; Serin, L.; Serkin, L.; Serre, T.; Seuster, R.; Severini, H.; Sfiligoj, T.; Sforza, F.; Sfyrla, A.; Shabalina, E.; Shamim, M.; Shan, L. Y.; Shang, R.; Shank, J. T.; Shapiro, M.; Shatalov, P. B.; Shaw, K.; Shehu, C. Y.; Sherwood, P.; Shi, L.; Shimizu, S.; Shimmin, C. O.; Shimojima, M.; Shiyakova, M.; Shmeleva, A.; Shochet, M. J.; Short, D.; Shrestha, S.; Shulga, E.; Shupe, M. A.; Shushkevich, S.; Sicho, P.; Sidiropoulou, O.; Sidorov, D.; Sidoti, A.; Siegert, F.; Sijacki, Dj.; Silva, J.; Silver, Y.; Silverstein, D.; Silverstein, S. B.; Simak, V.; Simard, O.; Simic, Lj.; Simion, S.; Simioni, E.; Simmons, B.; Simoniello, R.; Simonyan, M.; Sinervo, P.; Sinev, N. B.; Sipica, V.; Siragusa, G.; Sircar, A.; Sisakyan, A. N.; Sivoklokov, S. Yu.; Sjölin, J.; Sjursen, T. B.; Skottowe, H. P.; Skovpen, K. Yu.; Skubic, P.; Slater, M.; Slavicek, T.; Slawinska, M.; Sliwa, K.; Smakhtin, V.; Smart, B. H.; Smestad, L.; Smirnov, S. Yu.; Smirnov, Y.; Smirnova, L. N.; Smirnova, O.; Smith, K. M.; Smizanska, M.; Smolek, K.; Snesarev, A. A.; Snidero, G.; Snyder, S.; Sobie, R.; Socher, F.; Soffer, A.; Soh, D. A.; Solans, C. A.; Solar, M.; Solc, J.; Soldatov, E. Yu.; Soldevila, U.; Solodkov, A. A.; Soloshenko, A.; Solovyanov, O. V.; Solovyev, V.; Sommer, P.; Song, H. Y.; Soni, N.; Sood, A.; Sopczak, A.; Sopko, B.; Sopko, V.; Sorin, V.; Sosebee, M.; Soualah, R.; Soueid, P.; Soukharev, A. M.; South, D.; Spagnolo, S.; Spanò, F.; Spearman, W. R.; Spettel, F.; Spighi, R.; Spigo, G.; Spiller, L. A.; Spousta, M.; Spreitzer, T.; Spurlock, B.; St. Denis, R. D.; Staerz, S.; Stahlman, J.; Stamen, R.; Stamm, S.; Stanecka, E.; Stanek, R. W.; Stanescu, C.; Stanescu-Bellu, M.; Stanitzki, M. M.; Stapnes, S.; Starchenko, E. A.; Stark, J.; Staroba, P.; Starovoitov, P.; Staszewski, R.; Stavina, P.; Steinberg, P.; Stelzer, B.; Stelzer, H. J.; Stelzer-Chilton, O.; Stenzel, H.; Stern, S.; Stewart, G. A.; Stillings, J. A.; Stockton, M. C.; Stoebe, M.; Stoicea, G.; Stolte, P.; Stonjek, S.; Stradling, A. R.; Straessner, A.; Stramaglia, M. E.; Strandberg, J.; Strandberg, S.; Strandlie, A.; Strauss, E.; Strauss, M.; Strizenec, P.; Ströhmer, R.; Strom, D. M.; Stroynowski, R.; Strubig, A.; Stucci, S. A.; Stugu, B.; Styles, N. A.; Su, D.; Su, J.; Subramaniam, R.; Succurro, A.; Sugaya, Y.; Suhr, C.; Suk, M.; Sulin, V. V.; Sultansoy, S.; Sumida, T.; Sun, S.; Sun, X.; Sundermann, J. E.; Suruliz, K.; Susinno, G.; Sutton, M. R.; Suzuki, Y.; Svatos, M.; Swedish, S.; Swiatlowski, M.; Sykora, I.; Sykora, T.; Ta, D.; Taccini, C.; Tackmann, K.; Taenzer, J.; Taffard, A.; Tafirout, R.; Taiblum, N.; Takai, H.; Takashima, R.; Takeda, H.; Takeshita, T.; Takubo, Y.; Talby, M.; Talyshev, A. A.; Tam, J. Y. C.; Tan, K. G.; Tanaka, J.; Tanaka, R.; Tanaka, S.; Tanaka, S.; Tanasijczuk, A. J.; Tannenwald, B. B.; Tannoury, N.; Tapprogge, S.; Tarem, S.; Tarrade, F.; Tartarelli, G. F.; Tas, P.; Tasevsky, M.; Tashiro, T.; Tassi, E.; Tavares Delgado, A.; Tayalati, Y.; Taylor, F. E.; Taylor, G. N.; Taylor, W.; Teischinger, F. A.; Teixeira Dias Castanheira, M.; Teixeira-Dias, P.; Temming, K. K.; Ten Kate, H.; Teng, P. K.; Teoh, J. J.; Terada, S.; Terashi, K.; Terron, J.; Terzo, S.; Testa, M.; Teuscher, R. J.; Therhaag, J.; Theveneaux-Pelzer, T.; Thomas, J. P.; Thomas-Wilsker, J.; Thompson, E. N.; Thompson, P. D.; Thompson, P. D.; Thompson, R. J.; Thompson, A. S.; Thomsen, L. A.; Thomson, E.; Thomson, M.; Thong, W. M.; Thun, R. P.; Tian, F.; Tibbetts, M. J.; Tikhomirov, V. O.; Tikhonov, Yu. A.; Timoshenko, S.; Tiouchichine, E.; Tipton, P.; Tisserant, S.; Todorov, T.; Todorova-Nova, S.; Toggerson, B.; Tojo, J.; Tokár, S.; Tokushuku, K.; Tollefson, K.; Tolley, E.; Tomlinson, L.; Tomoto, M.; Tompkins, L.; Toms, K.; Topilin, N. D.; Torrence, E.; Torres, H.; Torró Pastor, E.; Toth, J.; Touchard, F.; Tovey, D. R.; Tran, H. L.; Trefzger, T.; Tremblet, L.; Tricoli, A.; Trigger, I. M.; Trincaz-Duvoid, S.; Tripiana, M. F.; Trischuk, W.; Trocmé, B.; Troncon, C.; Trottier-McDonald, M.; Trovatelli, M.; True, P.; Trzebinski, M.; Trzupek, A.; Tsarouchas, C.; Tseng, J. C.-L.; Tsiareshka, P. V.; Tsionou, D.; Tsipolitis, G.; Tsirintanis, N.; Tsiskaridze, S.; Tsiskaridze, V.; Tskhadadze, E. G.; Tsukerman, I. I.; Tsulaia, V.; Tsuno, S.; Tsybychev, D.; Tudorache, A.; Tudorache, V.; Tuna, A. N.; Tupputi, S. A.; Turchikhin, S.; Turecek, D.; Turk Cakir, I.; Turra, R.; Turvey, A. J.; Tuts, P. M.; Tykhonov, A.; Tylmad, M.; Tyndel, M.; Uchida, K.; Ueda, I.; Ueno, R.; Ughetto, M.; Ugland, M.; Uhlenbrock, M.; Ukegawa, F.; Unal, G.; Undrus, A.; Unel, G.; Ungaro, F. C.; Unno, Y.; Unverdorben, C.; Urbaniec, D.; Urquijo, P.; Usai, G.; Usanova, A.; Vacavant, L.; Vacek, V.; Vachon, B.; Valencic, N.; Valentinetti, S.; Valero, A.; Valery, L.; Valkar, S.; Valladolid Gallego, E.; Vallecorsa, S.; Valls Ferrer, J. A.; van den Wollenberg, W.; van der Deijl, P. C.; van der Geer, R.; van der Graaf, H.; van der Leeuw, R.; van der Ster, D.; van Eldik, N.; van Gemmeren, P.; van Nieuwkoop, J.; van Vulpen, I.; van Woerden, M. C.; Vanadia, M.; Vandelli, W.; Vanguri, R.; Vaniachine, A.; Vankov, P.; Vannucci, F.; Vardanyan, G.; Vari, R.; Varnes, E. W.; Varol, T.; Varouchas, D.; Vartapetian, A.; Varvell, K. E.; Vazeille, F.; Vazquez Schroeder, T.; Veatch, J.; Veloso, F.; Veneziano, S.; Ventura, A.; Ventura, D.; Venturi, M.; Venturi, N.; Venturini, A.; Vercesi, V.; Verducci, M.; Verkerke, W.; Vermeulen, J. C.; Vest, A.; Vetterli, M. C.; Viazlo, O.; Vichou, I.; Vickey, T.; Vickey Boeriu, O. E.; Viehhauser, G. H. A.; Viel, S.; Vigne, R.; Villa, M.; Villaplana Perez, M.; Vilucchi, E.; Vincter, M. G.; Vinogradov, V. B.; Virzi, J.; Vivarelli, I.; Vives Vaque, F.; Vlachos, S.; Vladoiu, D.; Vlasak, M.; Vogel, A.; Vogel, M.; Vokac, P.; Volpi, G.; Volpi, M.; von der Schmitt, H.; von Radziewski, H.; von Toerne, E.; Vorobel, V.; Vorobev, K.; Vos, M.; Voss, R.; Vossebeld, J. H.; Vranjes, N.; Vranjes Milosavljevic, M.; Vrba, V.; Vreeswijk, M.; Vu Anh, T.; Vuillermet, R.; Vukotic, I.; Vykydal, Z.; Wagner, P.; Wagner, W.; Wahlberg, H.; Wahrmund, S.; Wakabayashi, J.; Walder, J.; Walker, R.; Walkowiak, W.; Wall, R.; Waller, P.; Walsh, B.; Wang, C.; Wang, C.; Wang, F.; Wang, H.; Wang, H.; Wang, J.; Wang, J.; Wang, K.; Wang, R.; Wang, S. M.; Wang, T.; Wang, X.; Wanotayaroj, C.; Warburton, A.; Ward, C. P.; Wardrope, D. R.; Warsinsky, M.; Washbrook, A.; Wasicki, C.; Watkins, P. M.; Watson, A. T.; Watson, I. J.; Watson, M. F.; Watts, G.; Watts, S.; Waugh, B. M.; Webb, S.; Weber, M. S.; Weber, S. W.; Webster, J. S.; Weidberg, A. R.; Weigell, P.; Weinert, B.; Weingarten, J.; Weiser, C.; Weits, H.; Wells, P. S.; Wenaus, T.; Wendland, D.; Weng, Z.; Wengler, T.; Wenig, S.; Wermes, N.; Werner, M.; Werner, P.; Wessels, M.; Wetter, J.; Whalen, K.; White, A.; White, M. J.; White, R.; White, S.; Whiteson, D.; Wicke, D.; Wickens, F. J.; Wiedenmann, W.; Wielers, M.; Wienemann, P.; Wiglesworth, C.; Wiik-Fuchs, L. A. M.; Wijeratne, P. A.; Wildauer, A.; Wildt, M. A.; Wilkens, H. G.; Will, J. Z.; Williams, H. H.; Williams, S.; Willis, C.; Willocq, S.; Wilson, A.; Wilson, J. A.; Wingerter-Seez, I.; Winklmeier, F.; Winter, B. T.; Wittgen, M.; Wittig, T.; Wittkowski, J.; Wollstadt, S. J.; Wolter, M. W.; Wolters, H.; Wosiek, B. K.; Wotschack, J.; Woudstra, M. J.; Wozniak, K. W.; Wright, M.; Wu, M.; Wu, S. L.; Wu, X.; Wu, Y.; Wulf, E.; Wyatt, T. R.; Wynne, B. M.; Xella, S.; Xiao, M.; Xu, D.; Xu, L.; Yabsley, B.; Yacoob, S.; Yakabe, R.; Yamada, M.; Yamaguchi, H.; Yamaguchi, Y.; Yamamoto, A.; Yamamoto, K.; Yamamoto, S.; Yamamura, T.; Yamanaka, T.; Yamauchi, K.; Yamazaki, Y.; Yan, Z.; Yang, H.; Yang, H.; Yang, U. K.; Yang, Y.; Yanush, S.; Yao, L.; Yao, W.-M.; Yasu, Y.; Yatsenko, E.; Yau Wong, K. H.; Ye, J.; Ye, S.; Yeletskikh, I.; Yen, A. L.; Yildirim, E.; Yilmaz, M.; Yoosoofmiya, R.; Yorita, K.; Yoshida, R.; Yoshihara, K.; Young, C.; Young, C. J. S.; Youssef, S.; Yu, D. R.; Yu, J.; Yu, J. M.; Yu, J.; Yuan, L.; Yurkewicz, A.; Yusuff, I.; Zabinski, B.; Zaidan, R.; Zaitsev, A. M.; Zaman, A.; Zambito, S.; Zanello, L.; Zanzi, D.; Zeitnitz, C.; Zeman, M.; Zemla, A.; Zengel, K.; Zenin, O.; Ženiš, T.; Zerwas, D.; Zevi Della Porta, G.; Zhang, D.; Zhang, F.; Zhang, H.; Zhang, J.; Zhang, L.; Zhang, X.; Zhang, Z.; Zhao, Z.; Zhemchugov, A.; Zhong, J.; Zhou, B.; Zhou, L.; Zhou, N.; Zhu, C. G.; Zhu, H.; Zhu, J.; Zhu, Y.; Zhuang, X.; Zhukov, K.; Zibell, A.; Zieminska, D.; Zimine, N. I.; Zimmermann, C.; Zimmermann, R.; Zimmermann, S.; Zimmermann, S.; Zinonos, Z.; Ziolkowski, M.; Zobernig, G.; Zoccoli, A.; Zur Nedden, M.; Zurzolo, G.; Zutshi, V.; Zwalinski, L.; Atlas Collaboration

    2014-11-01

    Measurements of fiducial and differential cross sections of Higgs boson production in the H → ZZ* → 4 ℓ decay channel are presented. The cross sections are determined within a fiducial phase space and corrected for detection efficiency and resolution effects. They are based on 20.3 fb-1 of pp collision data, produced at √{ s} = 8 TeV centre-of-mass energy at the LHC and recorded by the ATLAS detector. The differential measurements are performed in bins of transverse momentum and rapidity of the four-lepton system, the invariant mass of the subleading lepton pair and the decay angle of the leading lepton pair with respect to the beam line in the four-lepton rest frame, as well as the number of jets and the transverse momentum of the leading jet. The measured cross sections are compared to selected theoretical calculations of the Standard Model expectations. No significant deviation from any of the tested predictions is found.

  16. A unique chromatin complex occupies young α-satellite arrays of human centromeres

    PubMed Central

    Henikoff, Jorja G.; Thakur, Jitendra; Kasinathan, Sivakanthan; Henikoff, Steven

    2015-01-01

    The intractability of homogeneous α-satellite arrays has impeded understanding of human centromeres. Artificial centromeres are produced from higher-order repeats (HORs) present at centromere edges, although the exact sequences and chromatin conformations of centromere cores remain unknown. We use high-resolution chromatin immunoprecipitation (ChIP) of centromere components followed by clustering of sequence data as an unbiased approach to identify functional centromere sequences. We find that specific dimeric α-satellite units shared by multiple individuals dominate functional human centromeres. We identify two recently homogenized α-satellite dimers that are occupied by precisely positioned CENP-A (cenH3) nucleosomes with two ~100–base pair (bp) DNA wraps in tandem separated by a CENP-B/CENP-C–containing linker, whereas pericentromeric HORs show diffuse positioning. Precise positioning is largely maintained, whereas abundance decreases exponentially with divergence, which suggests that young α-satellite dimers with paired ~100-bp particles mediate evolution of functional human centromeres. Our unbiased strategy for identifying functional centromeric sequences should be generally applicable to tandem repeat arrays that dominate the centromeres of most eukaryotes. PMID:25927077

  17. Transient radical pairs studied by time-resolved EPR.

    PubMed

    Bittl, Robert; Weber, Stefan

    2005-02-25

    Photogenerated short-lived radical pairs (RP) are common in biological photoprocesses such as photosynthesis and enzymatic DNA repair. They can be favorably probed by time-resolved electron paramagnetic resonance (EPR) methods with adequate time resolution. Two EPR techniques have proven to be particularly useful to extract information on the working states of photoinduced biological processes that is only difficult or sometimes even impossible to obtain by other types of spectroscopy. Firstly, transient EPR yields crucial information on the chemical nature and the geometry of the individual RP halves in a doublet-spin pair generated by a short laser pulse. This time-resolved method is applicable in all magnetic field/microwave frequency regimes that are used for continuous-wave EPR, and is nowadays routinely utilized with a time resolution reaching about 10 ns. Secondly, a pulsed EPR method named out-of-phase electron spin echo envelope modulation (OOP-ESEEM) is increasingly becoming popular. By this pulsed technique, the mutual spin-spin interaction between the RP halves in a doublet-spin pair manifests itself as an echo modulation detected as a function of the microwave-pulse spacing of a two-pulse echo sequence subsequent to a laser pulse. From the dipolar coupling, the distance between the radicals is readily derived. Since the spin-spin interaction parameters are typically not observable by transient EPR, the two techniques complement each other favorably. Both EPR methods have recently been applied to a variety of light-induced RPs in photobiology. This review summarizes the results obtained from such studies in the fields of plant and bacterial photosynthesis and DNA repair mediated by the enzyme DNA photolyase.

  18. Optimization of the nanotwin-induced zigzag surface of copper by electromigration

    NASA Astrophysics Data System (ADS)

    Chen, Hsin-Ping; Huang, Chun-Wei; Wang, Chun-Wen; Wu, Wen-Wei; Liao, Chien-Neng; Chen, Lih-Juann; Tu, King-Ning

    2016-01-01

    By adding nanotwins to Cu, the surface electromigration (EM) slows down. The atomic mobility of the surface step-edges is retarded by the triple points where a twin meets a free surface to form a zigzag-type surface. We observed that EM can alter the zigzag surface structure to optimize the reduction of EM, according to Le Chatelier's principle. Statistically, the optimal alternation is to change an arbitrary (111)/(hkl) zigzag pair to a pair having a very low index (hkl) plane, especially the (200) plane. Using in situ ultrahigh vacuum and high-resolution transmission electron microscopy, we examined the effects of different zigzag surfaces on the rate of EM. The calculated rate of surface EM can be decreased by a factor of ten.By adding nanotwins to Cu, the surface electromigration (EM) slows down. The atomic mobility of the surface step-edges is retarded by the triple points where a twin meets a free surface to form a zigzag-type surface. We observed that EM can alter the zigzag surface structure to optimize the reduction of EM, according to Le Chatelier's principle. Statistically, the optimal alternation is to change an arbitrary (111)/(hkl) zigzag pair to a pair having a very low index (hkl) plane, especially the (200) plane. Using in situ ultrahigh vacuum and high-resolution transmission electron microscopy, we examined the effects of different zigzag surfaces on the rate of EM. The calculated rate of surface EM can be decreased by a factor of ten. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr05418d

  19. Rotational-translational fourier imaging system

    NASA Technical Reports Server (NTRS)

    Campbell, Jonathan W. (Inventor)

    2004-01-01

    This invention has the ability to create Fourier-based images with only two grid pairs. The two grid pairs are manipulated in a manner that allows (1) a first grid pair to provide multiple real components of the Fourier-based image and (2) a second grid pair to provide multiple imaginary components of the Fourier-based image. The novelty of this invention resides in the use of only two grid pairs to provide the same imaging information that has been traditionally collected with multiple grid pairs.

  20. Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

    PubMed

    Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-03-14

    We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

  1. Image inpainting and super-resolution using non-local recursive deep convolutional network with skip connections

    NASA Astrophysics Data System (ADS)

    Liu, Miaofeng

    2017-07-01

    In recent years, deep convolutional neural networks come into use in image inpainting and super-resolution in many fields. Distinct to most of the former methods requiring to know beforehand the local information for corrupted pixels, we propose a 20-depth fully convolutional network to learn an end-to-end mapping a dataset of damaged/ground truth subimage pairs realizing non-local blind inpainting and super-resolution. As there often exist image with huge corruptions or inpainting on a low-resolution image that the existing approaches unable to perform well, we also share parameters in local area of layers to achieve spatial recursion and enlarge the receptive field. To avoid the difficulty of training this deep neural network, skip-connections between symmetric convolutional layers are designed. Experimental results shows that the proposed method outperforms state-of-the-art methods for diverse corrupting and low-resolution conditions, it works excellently when realizing super-resolution and image inpainting simultaneously

  2. Modification of the ρ meson detected by low-mass electron-positron pairs in central Pbsbnd Au collisions at 158A GeV/c

    NASA Astrophysics Data System (ADS)

    Adamová, D.; Agakichiev, G.; Antończyk, D.; Appelshäuser, H.; Belaga, V.; Bielcikova, J.; Braun-Munzinger, P.; Busch, O.; Cherlin, A.; Damjanović, S.; Dietel, T.; Dietrich, L.; Drees, A.; Dubitzky, W.; Esumi, S. I.; Filimonov, K.; Fomenko, K.; Fraenkel, Z.; Garabatos, C.; Glässel, P.; Holeczek, J.; Kushpil, V.; Maas, A.; Marín, A.; Milošević, J.; Milov, A.; Miśkowiec, D.; Panebrattsev, Yu.; Petchenova, O.; Petráček, V.; Pfeiffer, A.; Rak, J.; Ravinovich, I.; Rehak, P.; Sako, H.; Schmitz, W.; Sedykh, S.; Shimansky, S.; Stachel, J.; Šumbera, M.; Tilsner, H.; Tserruya, I.; Wessels, J. P.; Wienold, T.; Wurm, J. P.; Xie, W.; Yurevich, S.; Yurevich, V.; Ceres Collaboration

    2008-09-01

    We present a measurement of e+e- pair production in central Pbsbnd Au collisions at 158 A GeV / c. As reported earlier, a significant excess of the e+e- pair yield over the expectation from hadron decays is observed. The improved mass resolution of the present data set, recorded with the upgraded CERES experiment at the CERN-SPS, allows for a comparison of the data with different theoretical approaches. The data clearly favor a substantial in-medium broadening of the ρ spectral function over a density-dependent shift of the ρ pole mass. The in-medium broadening model implies that baryon induced interactions are the key mechanism to the observed modifications of the ρ meson at SPS energy.

  3. Modification of the ρ meson detected by low-mass electron positron pairs in central PbAu collisions at 158A GeV/c

    NASA Astrophysics Data System (ADS)

    Ceres Collaboration; Adamová, D.; Agakichiev, G.; Antończyk, D.; Appelshäuser, H.; Belaga, V.; Bielcikova, J.; Braun-Munzinger, P.; Busch, O.; Cherlin, A.; Damjanović, S.; Dietel, T.; Dietrich, L.; Drees, A.; Dubitzky, W.; Esumi, S. I.; Filimonov, K.; Fomenko, K.; Fraenkel, Z.; Garabatos, C.; Glässel, P.; Holeczek, J.; Kushpil, V.; Maas, A.; Marín, A.; Milošević, J.; Milov, A.; Miśkowiec, D.; Panebrattsev, Yu.; Petchenova, O.; Petráček, V.; Pfeiffer, A.; Rak, J.; Ravinovich, I.; Rehak, P.; Sako, H.; Schmitz, W.; Sedykh, S.; Shimansky, S.; Stachel, J.; Šumbera, M.; Tilsner, H.; Tserruya, I.; Wessels, J. P.; Wienold, T.; Wurm, J. P.; Xie, W.; Yurevich, S.; Yurevich, V.

    2008-09-01

    We present a measurement of ee pair production in central PbAu collisions at 158A GeV/c. As reported earlier, a significant excess of the ee pair yield over the expectation from hadron decays is observed. The improved mass resolution of the present data set, recorded with the upgraded CERES experiment at the CERN-SPS, allows for a comparison of the data with different theoretical approaches. The data clearly favor a substantial in-medium broadening of the ρ spectral function over a density-dependent shift of the ρ pole mass. The in-medium broadening model implies that baryon induced interactions are the key mechanism to the observed modifications of the ρ meson at SPS energy.

  4. [Imaging anatomy of the cranial nerves using 3.0 Tesla MRI: a practical review for clinicians].

    PubMed

    Chávez-Barba, Oscar; Martínez-Martínez, Lidieth; Cazares-Arellano, José Luis; Martínez-López, Manuel; Roldan-Valadez, Ernesto

    2011-01-01

    Magnetic resonance (MR) imaging is the method of choice to evaluate the cranial nerves (CN). These nerves constitute a group of structures that have acquired during their phylogenetic development a high degree of specialization. There are 12 pairs of CN to which we use their specific name or number. The olfactory (I) and optic (II) pairs are not real nerves but tracts from the encephalon. The spinal nerve (XI) derives from superior cervical segment of the spine. The other 9 pairs of CN are related with the brain stem. Although the skull base foramina can be seen on computed tomography, the nerves themselves can only be visualized in detail on MR. That means, in order to see the different segments of nerves I to XII, the right sequences must be used. It is important to provide detailed clinical information to the radiologist so that a tailored MR study can be performed. In this review, the basic imaging anatomy of the 12 CN is discussed and illustrated briefly with an emphasis on more advanced extra-axial anatomy, illustrated with high-resolution MR images. Clinicians looking for complete anatomic descriptions and/or MR illustrations are advised to consult specialized textbooks considering it is not possible to describe all of the anatomy in one article. This manuscript is intended to be a practical review for clinicians.

  5. Gamma-Ray Imaging for Explosives Detection

    NASA Technical Reports Server (NTRS)

    deNolfo, G. A.; Hunter, S. D.; Barbier, L. M.; Link, J. T.; Son, S.; Floyd, S. R.; Guardala, N.; Skopec, M.; Stark, B.

    2008-01-01

    We describe a gamma-ray imaging camera (GIC) for active interrogation of explosives being developed by NASA/GSFC and NSWCICarderock. The GIC is based on the Three-dimensional Track Imager (3-DTI) technology developed at GSFC for gamma-ray astrophysics. The 3-DTI, a large volume time-projection chamber, provides accurate, approx.0.4 mm resolution, 3-D tracking of charged particles. The incident direction of gamma rays, E, > 6 MeV, are reconstructed from the momenta and energies of the electron-positron pair resulting from interactions in the 3-DTI volume. The optimization of the 3-DTI technology for this specific application and the performance of the GIC from laboratory tests is presented.

  6. Analysis and Design of a Fiber-optic Probe for DNA Sensors Final Report CRADA No. TSB-1147-95

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Molau, Nicole; Vail, Curtis

    In 1995, a challenge in the field of genetics dealt with the acquisition of efficient DNA sequencing techniques for reading the 3 billion base-pairs that comprised the human genome. AccuPhotonics, Inc. proposed to develop and manufacture a state-of-the-art near-field scanning optical microscopy (NSOM) fiber-optic probe that was expected to increase probe efficiency by two orders of magnitude over the existing state-of-the-art and to improve resolution to 10Å. The detailed design calculation and optimization of electrical properties of the fiber-optic probe tip geometry would be performed at LLNL, using existing finite-difference time-domain (FDTD) electromagnetic (EM) codes.

  7. Images for the base of the Pacific lithospheric plate beneath Wellington, New Zealand, from 500 kg dynamite shots recorded on a 100 km-long, 1000 seismometer array

    NASA Astrophysics Data System (ADS)

    Stern, T. A.; Henrys, S. A.; Sato, H.; Okaya, D. A.

    2012-12-01

    Seismic P and S-wave reflections are recorded from a west-dipping horizon at depth of 105 km beneath Wellington, New Zealand. From the depth and dip of this horizon we interpret this horizon to be the bottom of the subducting Pacific plate. In May 2011 the Seismic Array on Hikurangi margin Experiment (SAHKE) recorded reflections on a ~100 km-long high-resolution seismic line across the lower North Island of New Zealand. The main goal of this experiment was to provide a detailed image of the west dipping subducted Pacific plate beneath the Wellington city region. The seismic line had ~1000 seismographs spaced between 50-100 m apart and the 500 kg shots were in 50 m-deep, drill holes. An exceptionally high-resolution image for the top of the subducting Pacific Plate at a depth of 20-25 km beneath the Wellington region is seen. In addition, on most of the shots are a pair of 10-14 Hz reflections between 27 and 29 s two-way-travel-time (twtt) at zero offset. The quality of this reflection pair varies from shot to shot. When converted to depth and ray-traced the best solution for these deep events is a west-dipping ( ~ 15 degrees) horizon at a depth of about 105 km. This is consistent with the dip of the upper surface of the plate beneath Wellington, and therefore we argue that the deep (~105 km) reflector is the base of the Pacific plate. On two of the shots another pair 5-8 Hz reflections can also be seen between 47 and 52 s, and the move-out of these events is consistent with them being S-wave reflections from the same 105 km deep, west-dipping, boundary for a Vp/Vs ~ 1.74. Both the P-and S-wave reflections occur in pairs of twtt-thickness of 2 and 5 s, respectively and appear to define a ~ 6-8 km thick channel at the base of the plate if the Vp/Vs ratio~ 5/2 or 2.5. Such a high value of Vp/Vs is consistent with the channel containing fluids or partial melt of an unknown percent. Although we can't rule out the double reflections in both P and S as being multiples, this seems unlikely as multiples are not seen any where else in the shot gathers. Thus the lithosphere-asthenosphere boundary (LAB), at least in this setting, appears to be a sharp boundary, less than 10 km thick. As the top of the subduction zone is 20-25 km deep beneath our profile, the total thickness of the plate beneath Wellington is about 80 km. This is consistent with the thickness of old oceanic plates measured elsewhere with passive seismic methods.

  8. Efficient Implementation of the Pairing on Mobilephones Using BREW

    NASA Astrophysics Data System (ADS)

    Yoshitomi, Motoi; Takagi, Tsuyoshi; Kiyomoto, Shinsaku; Tanaka, Toshiaki

    Pairing based cryptosystems can accomplish novel security applications such as ID-based cryptosystems, which have not been constructed efficiently without the pairing. The processing speed of the pairing based cryptosystems is relatively slow compared with the other conventional public key cryptosystems. However, several efficient algorithms for computing the pairing have been proposed, namely Duursma-Lee algorithm and its variant ηT pairing. In this paper, we present an efficient implementation of the pairing over some mobilephones. Moreover, we compare the processing speed of the pairing with that of the other standard public key cryptosystems, i. e. RSA cryptosystem and elliptic curve cryptosystem. Indeed the processing speed of our implementation in ARM9 processors on BREW achieves under 100 milliseconds using the supersingular curve over F397. In addition, the pairing is more efficient than the other public key cryptosystems, and the pairing can be achieved enough also on BREW mobilephones. It has become efficient enough to implement security applications, such as short signature, ID-based cryptosystems or broadcast encryption, using the pairing on BREW mobilephones.

  9. Probing the Spatio-Temporal Characteristics of Temporal Aliasing Errors and their Impact on Satellite Gravity Retrievals

    NASA Astrophysics Data System (ADS)

    Wiese, D. N.; McCullough, C. M.

    2017-12-01

    Studies have shown that both single pair low-low satellite-to-satellite tracking (LL-SST) and dual-pair LL-SST hypothetical future satellite gravimetry missions utilizing improved onboard measurement systems relative to the Gravity Recovery and Climate Experiment (GRACE) will be limited by temporal aliasing errors; that is, the error introduced through deficiencies in models of high frequency mass variations required for the data processing. Here, we probe the spatio-temporal characteristics of temporal aliasing errors to understand their impact on satellite gravity retrievals using high fidelity numerical simulations. We find that while aliasing errors are dominant at long wavelengths and multi-day timescales, improving knowledge of high frequency mass variations at these resolutions translates into only modest improvements (i.e. spatial resolution/accuracy) in the ability to measure temporal gravity variations at monthly timescales. This result highlights the reliance on accurate models of high frequency mass variations for gravity processing, and the difficult nature of reducing temporal aliasing errors and their impact on satellite gravity retrievals.

  10. Dual mode scanner-tracker

    NASA Astrophysics Data System (ADS)

    Mongeon, R. J.

    1984-11-01

    The beam of a laser radar is moved over the field of view by means of a pair of scanner/trackers arranged in cascade along the laser beam. One of the scanner/trackers operates at high speed, with high resolution and a wide field and is located in the demagnified portion of the laser beam. The two scanner/trackers complement each other to achieve high speed, high resolution scanning as well as tracking of moving targets. A beam steering telescope for an airborne laser radar which incorporates the novel dual mode scanner/tracker is also shown. The other scanner/tracker operates at low speed with low resolution and a wide field and is located in the magnified portion of the laser beam.

  11. Simultaneous quantification of amino acids and Amadori products in foods through ion-pairing liquid chromatography-high-resolution mass spectrometry.

    PubMed

    Troise, Antonio Dario; Fiore, Alberto; Roviello, Giovanni; Monti, Simona Maria; Fogliano, Vincenzo

    2015-01-01

    The formation of the Amadori products (APs) is the first key step of Maillard reaction. Only few papers have dealt with simultaneous quantitation of amino acids and corresponding APs (1-amino-1-deoxy-2-ketose). Chromatographic separation of APs is affected by several drawbacks mainly related to their poor retention in conventional reversed phase separation. In this paper, a method for the simultaneous quantification of amino acids and their respective APs was developed combining high-resolution mass spectrometry with ion-pairing liquid chromatography. The limit of detection was 0.1 ng/mL for tryptophan, valine and arginine, while the limit of quantification ranged from 2 to 5 ng/mL according to the specific sensitivity of each analyte. The relative standard deviation % was lower than 10 % and the coefficient of correlation was higher than 0.99 for each calibration curve. The method was applied to milk, milk-based products, raw and processed tomato. Among the analyzed products, the most abundant amino acid was glutamic acid (16,646.89 ± 1,385.40 µg/g) and the most abundant AP was fructosyl-arginine in tomato puree (774.82 ± 10.01 µg/g). The easiness of sample preparation coupled to the analytical performances of the proposed method introduced the possibility to use the pattern of free amino acids and corresponding APs in the evaluation of the quality of raw food as well as the extent of thermal treatments in different food products.

  12. An ensemble of SVM classifiers based on gene pairs.

    PubMed

    Tong, Muchenxuan; Liu, Kun-Hong; Xu, Chungui; Ju, Wenbin

    2013-07-01

    In this paper, a genetic algorithm (GA) based ensemble support vector machine (SVM) classifier built on gene pairs (GA-ESP) is proposed. The SVMs (base classifiers of the ensemble system) are trained on different informative gene pairs. These gene pairs are selected by the top scoring pair (TSP) criterion. Each of these pairs projects the original microarray expression onto a 2-D space. Extensive permutation of gene pairs may reveal more useful information and potentially lead to an ensemble classifier with satisfactory accuracy and interpretability. GA is further applied to select an optimized combination of base classifiers. The effectiveness of the GA-ESP classifier is evaluated on both binary-class and multi-class datasets. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Envisaging quantum transport phenomenon in a muddled base pair of DNA

    NASA Astrophysics Data System (ADS)

    Vohra, Rajan; Sawhney, Ravinder Singh

    2018-05-01

    The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.

  14. Higher order structural effects stabilizing the reverse Watson–Crick Guanine-Cytosine base pair in functional RNAs

    PubMed Central

    Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi

    2014-01-01

    The G:C reverse Watson–Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. PMID:24121683

  15. An integrated hyperspectral and SAR satellite constellation for environment monitoring

    NASA Astrophysics Data System (ADS)

    Wang, Jinnian; Ren, Fuhu; Xie, Chou; An, Jun; Tong, Zhanbo

    2017-09-01

    A fully-integrated, Hyperspectral optical and SAR (Synthetic Aperture Radar) constellation of small earth observation satellites will be deployed over multiple launches from last December to next five years. The Constellation is expected to comprise a minimum of 16 satellites (8 SAR and 8 optical ) flying in two orbital planes, with each plane consisting of four satellite pairs, equally-spaced around the orbit plane. Each pair of satellites will consist of a hyperspectral/mutispectral optical satellite and a high-resolution SAR satellite (X-band) flying in tandem. The constellation is expected to offer a number of innovative capabilities for environment monitoring. As a pre-launch experiment, two hyperspectral earth observation minisatellites, Spark 01 and 02 were launched as secondary payloads together with Tansat in December 2016 on a CZ-2D rocket. The satellites feature a wide-range hyperspectral imager. The ground resolution is 50 m, covering spectral range from visible to near infrared (420 nm - 1000 nm) and a swath width of 100km. The imager has an average spectral resolution of 5 nm with 148 channels, and a single satellite could obtain hyperspectral imagery with 2.5 million km2 per day, for global coverage every 16 days. This paper describes the potential applications of constellation image in environment monitoring.

  16. Bifacial Base-Pairing Behaviors of 5-Hydroxyuracil DNA Bases through Hydrogen Bonding and Metal Coordination.

    PubMed

    Takezawa, Yusuke; Nishiyama, Kotaro; Mashima, Tsukasa; Katahira, Masato; Shionoya, Mitsuhiko

    2015-10-12

    A novel bifacial ligand-bearing nucleobase, 5-hydroxyuracil (U(OH) ), which forms both a hydrogen-bonded base pair (U(OH) -A) and a metal-mediated base pair (U(OH) -M-U(OH) ) has been developed. The U(OH) -M-U(OH) base pairs were quantitatively formed in the presence of lanthanide ions such as Gd(III) when U(OH) -U(OH) pairs were consecutively incorporated into DNA duplexes. This result established metal-assisted duplex stabilization as well as DNA-templated assembly of lanthanide ions. Notably, a duplex possessing U(OH) -A base pairs was destabilized by addition of Gd(III) ions. This observation suggests that the hybridization behaviors of the U(OH) -containing DNA strands are altered by metal complexation. Thus, the U(OH) nucleobase with a bifacial base-pairing property holds great promise as a component for metal-responsive DNA materials. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Molecular switching behavior in isosteric DNA base pairs.

    PubMed

    Jissy, A K; Konar, Sukanya; Datta, Ayan

    2013-04-15

    The structures and proton-coupled behavior of adenine-thymine (A-T) and a modified base pair containing a thymine isostere, adenine-difluorotoluene (A-F), are studied in different solvents by dispersion-corrected density functional theory. The stability of the canonical Watson-Crick base pair and the mismatched pair in various solvents with low and high dielectric constants is analyzed. It is demonstrated that A-F base pairing is favored in solvents with low dielectric constant. The stabilization and conformational changes induced by protonation are also analyzed for the natural as well as the mismatched base pair. DNA sequences capable of changing their sequence conformation on protonation are used in the construction of pH-based molecular switches. An acidic medium has a profound influence in stabilizing the isostere base pair. Such a large gain in stability on protonation leads to an interesting pH-controlled molecular switch, which can be incorporated in a natural DNA tract. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Joint estimation of 2D-DOA and frequency based on space-time matrix and conformal array.

    PubMed

    Wan, Liang-Tian; Liu, Lu-Tao; Si, Wei-Jian; Tian, Zuo-Xi

    2013-01-01

    Each element in the conformal array has a different pattern, which leads to the performance deterioration of the conventional high resolution direction-of-arrival (DOA) algorithms. In this paper, a joint frequency and two-dimension DOA (2D-DOA) estimation algorithm for conformal array are proposed. The delay correlation function is used to suppress noise. Both spatial and time sampling are utilized to construct the spatial-time matrix. The frequency and 2D-DOA estimation are accomplished based on parallel factor (PARAFAC) analysis without spectral peak searching and parameter pairing. The proposed algorithm needs only four guiding elements with precise positions to estimate frequency and 2D-DOA. Other instrumental elements can be arranged flexibly on the surface of the carrier. Simulation results demonstrate the effectiveness of the proposed algorithm.

  19. Registration-based interpolation applied to cardiac MRI

    NASA Astrophysics Data System (ADS)

    Ólafsdóttir, Hildur; Pedersen, Henrik; Hansen, Michael S.; Lyksborg, Mark; Hansen, Mads Fogtmann; Darkner, Sune; Larsen, Rasmus

    2010-03-01

    Various approaches have been proposed for segmentation of cardiac MRI. An accurate segmentation of the myocardium and ventricles is essential to determine parameters of interest for the function of the heart, such as the ejection fraction. One problem with MRI is the poor resolution in one dimension. A 3D registration algorithm will typically use a trilinear interpolation of intensities to determine the intensity of a deformed template image. Due to the poor resolution across slices, such linear approximation is highly inaccurate since the assumption of smooth underlying intensities is violated. Registration-based interpolation is based on 2D registrations between adjacent slices and is independent of segmentations. Hence, rather than assuming smoothness in intensity, the assumption is that the anatomy is consistent across slices. The basis for the proposed approach is the set of 2D registrations between each pair of slices, both ways. The intensity of a new slice is then weighted by (i) the deformation functions and (ii) the intensities in the warped images. Unlike the approach by Penney et al. 2004, this approach takes into account deformation both ways, which gives more robustness where correspondence between slices is poor. We demonstrate the approach on a toy example and on a set of cardiac CINE MRI. Qualitative inspection reveals that the proposed approach provides a more convincing transition between slices than images obtained by linear interpolation. A quantitative validation reveals significantly lower reconstruction errors than both linear and registration-based interpolation based on one-way registrations.

  20. Photochemical grid model performance with varying horizontal grid resolution and sub-grid plume treatment for the Martins Creek near-field SO2 study

    NASA Astrophysics Data System (ADS)

    Baker, Kirk R.; Hawkins, Andy; Kelly, James T.

    2014-12-01

    Near source modeling is needed to assess primary and secondary pollutant impacts from single sources and single source complexes. Source-receptor relationships need to be resolved from tens of meters to tens of kilometers. Dispersion models are typically applied for near-source primary pollutant impacts but lack complex photochemistry. Photochemical models provide a realistic chemical environment but are typically applied using grid cell sizes that may be larger than the distance between sources and receptors. It is important to understand the impacts of grid resolution and sub-grid plume treatments on photochemical modeling of near-source primary pollution gradients. Here, the CAMx photochemical grid model is applied using multiple grid resolutions and sub-grid plume treatment for SO2 and compared with a receptor mesonet largely impacted by nearby sources approximately 3-17 km away in a complex terrain environment. Measurements are compared with model estimates of SO2 at 4- and 1-km resolution, both with and without sub-grid plume treatment and inclusion of finer two-way grid nests. Annual average estimated SO2 mixing ratios are highest nearest the sources and decrease as distance from the sources increase. In general, CAMx estimates of SO2 do not compare well with the near-source observations when paired in space and time. Given the proximity of these sources and receptors, accuracy in wind vector estimation is critical for applications that pair pollutant predictions and observations in time and space. In typical permit applications, predictions and observations are not paired in time and space and the entire distributions of each are directly compared. Using this approach, model estimates using 1-km grid resolution best match the distribution of observations and are most comparable to similar studies that used dispersion and Lagrangian modeling systems. Model-estimated SO2 increases as grid cell size decreases from 4 km to 250 m. However, it is notable that the 1-km model estimates using 1-km meteorological model input are higher than the 1-km model simulation that used interpolated 4-km meteorology. The inclusion of sub-grid plume treatment did not improve model skill in predicting SO2 in time and space and generally acts to keep emitted mass aloft.

  1. 1,8-Naphthyridine-2,7-diamine: a potential universal reader of Watson-Crick base pairs for DNA sequencing by electron tunneling.

    PubMed

    Liang, Feng; Lindsay, Stuart; Zhang, Peiming

    2012-11-21

    With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.

  2. 1,8-Naphthyridine-2,7-diamine: A Potential Universal Reader of the Watson-Crick Base Pairs for DNA Sequencing by Electron Tunneling

    PubMed Central

    Liang, Feng; Lindsay, Stuart; Zhang, Peiming

    2013-01-01

    With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read the DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A:T and G:C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs. PMID:23038027

  3. Multiplexed single-molecule force spectroscopy using a centrifuge.

    PubMed

    Yang, Darren; Ward, Andrew; Halvorsen, Ken; Wong, Wesley P

    2016-03-17

    We present a miniature centrifuge force microscope (CFM) that repurposes a benchtop centrifuge for high-throughput single-molecule experiments with high-resolution particle tracking, a large force range, temperature control and simple push-button operation. Incorporating DNA nanoswitches to enable repeated interrogation by force of single molecular pairs, we demonstrate increased throughput, reliability and the ability to characterize population heterogeneity. We perform spatiotemporally multiplexed experiments to collect 1,863 bond rupture statistics from 538 traceable molecular pairs in a single experiment, and show that 2 populations of DNA zippers can be distinguished using per-molecule statistics to reduce noise.

  4. Multiplexed single-molecule force spectroscopy using a centrifuge

    PubMed Central

    Yang, Darren; Ward, Andrew; Halvorsen, Ken; Wong, Wesley P.

    2016-01-01

    We present a miniature centrifuge force microscope (CFM) that repurposes a benchtop centrifuge for high-throughput single-molecule experiments with high-resolution particle tracking, a large force range, temperature control and simple push-button operation. Incorporating DNA nanoswitches to enable repeated interrogation by force of single molecular pairs, we demonstrate increased throughput, reliability and the ability to characterize population heterogeneity. We perform spatiotemporally multiplexed experiments to collect 1,863 bond rupture statistics from 538 traceable molecular pairs in a single experiment, and show that 2 populations of DNA zippers can be distinguished using per-molecule statistics to reduce noise. PMID:26984516

  5. Speckle Interferometry at SOAR in 2016 and 2017

    NASA Astrophysics Data System (ADS)

    Tokovinin, Andrei; Mason, Brian D.; Hartkopf, William I.; Mendez, Rene A.; Horch, Elliott P.

    2018-06-01

    The results of speckle interferometric observations at the 4.1 m Southern Astrophysical Research Telescope in 2016 and 2017 are given, totaling 2483 measurements of 1570 resolved pairs and 609 non-resolutions. We describe briefly recent changes in the instrument and observing method and quantify the accuracy of the pixel scale and position angle calibration. Comments are given on 44 pairs resolved here for the first time. The orbital motion of the newly resolved subsystem BU 83 Aa,Ab roughly agrees with its 36-year astrometric orbit proposed by J. Dommanget. Most Tycho binaries examined here turned out to be spurious.

  6. A Guide to Fluorescent Protein FRET Pairs

    PubMed Central

    Bajar, Bryce T.; Wang, Emily S.; Zhang, Shu; Lin, Michael Z.; Chu, Jun

    2016-01-01

    Förster or fluorescence resonance energy transfer (FRET) technology and genetically encoded FRET biosensors provide a powerful tool for visualizing signaling molecules in live cells with high spatiotemporal resolution. Fluorescent proteins (FPs) are most commonly used as both donor and acceptor fluorophores in FRET biosensors, especially since FPs are genetically encodable and live-cell compatible. In this review, we will provide an overview of methods to measure FRET changes in biological contexts, discuss the palette of FP FRET pairs developed and their relative strengths and weaknesses, and note important factors to consider when using FPs for FRET studies. PMID:27649177

  7. An experimental investigation of preorgasmic reconditioning and postorgasmic deconditioning.

    PubMed Central

    Kantorowitz, D A

    1978-01-01

    The effects of pre- and postorgasmic presentation of moderately erotic cues were assessed in an analogue study. Eight heterosexual male volunteers (18 to 23 years) participated in three assessment (baseline, termination-of-treatment, and two- to three-month followup) and eight masturbatory conditioning sessions. Three slides of nude females of initially equal erotic value were paired respectively with the plateau, refractory, and resolution phases of the subjects' sexual cycles. Over treatment, stimuli paired with the plateau phase increased significantly in penile tumescence indices of eroticism; conversely, stimuli paired with the refractory phase decreased significantly. The conditioned effects on tumescence were largely extinguished at followup. While treatment did not alter short-term subjective indices of eroticism, stimuli presented during the refractory phase were rated significantly less erotic than the other stimuli at followup. The findings suggest that the "pairing" model of orgasmic conditioning is insufficient to account for previously reported clinical findings. A broader conceptualization of the mechanisms of orgasmic conditioning, and implications for treatment are discussed. PMID:649527

  8. Perfluorinated acids as ion-pairing agents in the determination of monoamine transmitters and some prominent metabolites in rat brain by high-performance liquid chromatography with amperometric detection.

    PubMed

    Patthy, M; Gyenge, R

    1988-09-30

    The behaviour of trifluoroacetate and heptafluorobutyrate as pairing ions for the reversed-phase ion-pair separation of monoamine transmitters and related metabolites was studied. The performance of systems with the perfluorinated acids was compared with that of systems containing sodium octyl sulphonate and was found to be better in terms of peak resolution combined with total analysis time, day-to-day reproducibility and the time required for attaining initial chromatographic equilibrium. Rat brain samples were deproteinized in the acidified mobile phase, injected directly on to a high-performance liquid chromatographic column and quantitated using an amperometric detector. Sample run times were 6-8 min, at a relatively low flow-rate. The detection limits achieved are fairly uncommon with conventional bore columns. The two perfluorinated acids studied differ in the dominant mechanisms of ion-pair formation and show selectivity differences as a result.

  9. Recombination Proteins Mediate Meiotic Spatial Chromosome Organization and Pairing

    PubMed Central

    Storlazzi, Aurora; Gargano, Silvana; Ruprich-Robert, Gwenael; Falque, Matthieu; David, Michelle; Kleckner, Nancy; Zickler, Denise

    2010-01-01

    SUMMARY Meiotic chromosome pairing involves not only recognition of homology but also juxtaposition of entire chromosomes in a topologically regular way. Analysis of filamentous fungus Sordaria macrospora reveals that recombination proteins Mer3, Msh4 and Mlh1 play direct roles in all of these aspects, in advance of their known roles in recombination. Absence of Mer3 helicase results in interwoven chromosomes, thereby revealing the existence of features that specifically ensure “entanglement avoidance”. Entanglements that remain at zygotene, i.e. “interlockings”, require Mlh1 for resolution, likely to eliminate constraining recombinational connections. Patterns of Mer3 and Msh4 foci along aligned chromosomes show that the double-strand breaks mediating homologous alignment have spatially separated ends, one localized to each partner axis, and that pairing involves interference among developing interhomolog interactions. We propose that Mer3, Msh4 and Mlh1 execute all of these roles during pairing by modulating the state of nascent double-strand break/partner DNA contacts within axis-associated recombination complexes. PMID:20371348

  10. An experimental investigation of preorgasmic reconditioning and postorgasmic deconditioning.

    PubMed

    Kantorowitz, D A

    1978-01-01

    The effects of pre- and postorgasmic presentation of moderately erotic cues were assessed in an analogue study. Eight heterosexual male volunteers (18 to 23 years) participated in three assessment (baseline, termination-of-treatment, and two- to three-month followup) and eight masturbatory conditioning sessions. Three slides of nude females of initially equal erotic value were paired respectively with the plateau, refractory, and resolution phases of the subjects' sexual cycles. Over treatment, stimuli paired with the plateau phase increased significantly in penile tumescence indices of eroticism; conversely, stimuli paired with the refractory phase decreased significantly. The conditioned effects on tumescence were largely extinguished at followup. While treatment did not alter short-term subjective indices of eroticism, stimuli presented during the refractory phase were rated significantly less erotic than the other stimuli at followup. The findings suggest that the "pairing" model of orgasmic conditioning is insufficient to account for previously reported clinical findings. A broader conceptualization of the mechanisms of orgasmic conditioning, and implications for treatment are discussed.

  11. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

    PubMed

    Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

    2013-06-17

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. RESOLFT nanoscopy with photoswitchable organic fluorophores

    NASA Astrophysics Data System (ADS)

    Kwon, Jiwoong; Hwang, Jihee; Park, Jaewan; Han, Gi Rim; Han, Kyu Young; Kim, Seong Keun

    2015-12-01

    Far-field optical nanoscopy has been widely used to image small objects with sub-diffraction-limit spatial resolution. Particularly, reversible saturable optical fluorescence transition (RESOLFT) nanoscopy with photoswitchable fluorescent proteins is a powerful method for super-resolution imaging of living cells with low light intensity. Here we demonstrate for the first time the implementation of RESOLFT nanoscopy for a biological system using organic fluorophores, which are smaller in size and easier to be chemically modified. With a covalently-linked dye pair of Cy3 and Alexa647 to label subcellular structures in fixed cells and by optimizing the imaging buffer and optical parameters, our RESOLFT nanoscopy achieved a spatial resolution of ~74 nm in the focal plane. This method provides a powerful alternative for low light intensity RESOLFT nanoscopy, which enables biological imaging with small organic probes at nanoscale resolution.

  13. Velocity gap mode of capillary electrophoresis developed for high-resolution chiral separations.

    PubMed

    Li, Xue; Li, Youxin; Zhao, Lumeng; Shen, Jianguo; Zhang, Yong; Bao, James J

    2014-10-01

    A new CE method based on velocity gap (VG) theory has been developed for high-resolution chiral separations. In VG, two consecutive electric fields are adopted to drive analytes passing through two capillaries, which are linked together through a joint. The joint is immersed inside another buffer vial which has conductivity communication with the buffer inside the capillary. By adjusting the field strengths onto the two capillaries, it is possible to observe different velocities of an analyte when it passes through those two capillaries and there would be a net velocity change (NVC) for the same analyte. Different analytes may have different NVC which may be specifically meaningful for enantioseparations because enantiomers are usually hard to resolve. By taking advantage of this NVC, it is possible to enhance the resolution of a chiral separation if a proper voltage program is applied. The feasibility of using NVC to enhance chiral separation was demonstrated in the separations of three pairs of enantiomers: terbutaline, chlorpheniramine, and promethazine. All separations started with partial separation in a conventional CE and were significantly improved under the same experimental conditions. The results indicated that VG has the potential to be used to improve the resolving power of CE in chiral separations. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Applications of High-Q Microresonators in Cavity Optomechanics and Nonlinear Photonics

    NASA Astrophysics Data System (ADS)

    Jiang, Wei C.

    Optical microresonators confining light to small volumes are indispensable for a great variety of studies and applications. This thesis is devoted to a study of cavity optomechanical and nonlinear optical phenomena in high-Q microresonators with different materials and structures. Based on that, it proposes and demonstrates several novel schemes and device platforms that exhibit great potential for various applications ranging from frequency metrology and quantum photonics, to information processing and sensing. The thesis starts with a demonstration of a high-frequency (above 1 GHz) regenerative optomechanical oscillator based on a 2-mum-radius high-Q silicon microdisk resonator in the silicon-on-insulator platform with an ultra-low threshold pump power at room temperature and atmosphere. It then continues to explore the cavity optomechanics in single-crystal lithium niobate. A compact lithium niobate microdisk optomechanical resonator with high optical and mechanical qualities, large optomechanical coupling, and high mechanical frequency is achieved, enabling the demonstration of regenerative oscillation in the ambience. Meanwhile, I propose and investigate a novel approach for single molecule detection that utilizes the optical spring effect in a high-Q coherent optomechanical oscillator to dramatically enhance the sensing resolution by orders of magnitude compared with conventional resonator-based approaches. In particular, a high-Q silica microsphere is employed to experimentally demonstrate the detection of single Bovine Serum Albumin proteins with a molecular weight of 66 kDalton at a signal-to-noise ratio of 16.8. On the other hand, the thesis focuses on the theoretical and experimental investigation of the generation of high-purity bright photon pairs in a silicon microdisk based on the cavity enhanced four-wave mixing. The device is able to produce multiple photon pairs at different wavelengths in the telecom band with a high spectral brightness of 6.24 x 107 pairs/s/mW 2/GHz and photon-pair correlation with a coincidence-to-accidental ratio of 1386+/-278 while pumped with a continuous-wave laser. Finally, an intriguing approach is proposed for dispersion dynamic tuning and micro-engineering, by taking advantage of the optical forces in nano-optomechanical structures. The proposed approach exhibits great potential for broad applications in dispersion-sensitive processes, which not only offer a new root towards versatile tunable nonlinear photonics, but may also open up a great avenue towards a new regime of nonlinear dynamics coupling between nonlinear optical and optomechanical effects.

  15. Direct and Inverse Kinematics of a Novel Tip-Tilt-Piston Parallel Manipulator

    NASA Technical Reports Server (NTRS)

    Tahmasebi, Farhad

    2004-01-01

    Closed-form direct and inverse kinematics of a new three degree-of-freedom (DOF) parallel manipulator with inextensible limbs and base-mounted actuators are presented. The manipulator has higher resolution and precision than the existing three DOF mechanisms with extensible limbs. Since all of the manipulator actuators are base-mounted; higher payload capacity, smaller actuator sizes, and lower power dissipation can be obtained. The manipulator is suitable for alignment applications where only tip, tilt, and piston motions are significant. The direct kinematics of the manipulator is reduced to solving an eighth-degree polynomial in the square of tangent of half-angle between one of the limbs and the base plane. Hence, there are at most 16 assembly configurations for the manipulator. In addition, it is shown that the 16 solutions are eight pairs of reflected configurations with respect to the base plane. Numerical examples for the direct and inverse kinematics of the manipulator are also presented.

  16. Kinematics of a New High Precision Three Degree-of-Freedom Parallel Manipulator

    NASA Technical Reports Server (NTRS)

    Tahmasebi, Farhad

    2005-01-01

    Closed-form direct and inverse kinematics of a new three degree-of-freedom (DOF) parallel manipulator with inextensible limbs and base-mounted actuators are presented. The manipulator has higher resolution and precision than the existing three DOF mechanisms with extensible limbs. Since all of the manipulator actuators are base-mounted; higher payload capacity, smaller actuator sizes, and lower power dissipation can be obtained. The manipulator is suitable for alignment applications where only tip, tilt, and piston motions are significant. The direct kinematics of the manipulator is reduced to solving an eighth-degree polynomial in the square of tangent of half-angle between one of the limbs and the base plane. Hence, there are at most sixteen assembly configurations for the manipulator. In addition, it is shown that the sixteen solutions are eight pairs of reflected configurations with respect to the base plane. Numerical examples for the direct and inverse kinematics of the manipulator are also presented.

  17. FPGA-based Trigger System for the Fermilab SeaQuest Experimentz

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shiu, Shiuan-Hal; Wu, Jinyuan; McClellan, Randall Evan

    The SeaQuest experiment (Fermilab E906) detects pairs of energetic μ + and μ -produced in 120 GeV/c proton–nucleon interactions in a high rate environment. The trigger system we used consists of several arrays of scintillator hodoscopes and a set of field-programmable gate array (FPGA) based VMEbus modules. Signals from up to 96 channels of hodoscope are digitized by each FPGA with a 1-ns resolution using the time-to-digital convertor (TDC) firmware. The delay of the TDC output can be adjusted channel-by-channel in 1-ns step and then re-aligned with the beam RF clock. The hit pattern on the hodoscope planes is thenmore » examined against pre-determined trigger matrices to identify candidate muon tracks. Finally, information on the candidate tracks is sent to the 2nd-level FPGA-based track correlator to find candidate di-muon events. The design and implementation of the FPGA-based trigger system for SeaQuest experiment are presented.« less

  18. FPGA-based trigger system for the Fermilab SeaQuest experimentz

    NASA Astrophysics Data System (ADS)

    Shiu, Shiuan-Hal; Wu, Jinyuan; McClellan, Randall Evan; Chang, Ting-Hua; Chang, Wen-Chen; Chen, Yen-Chu; Gilman, Ron; Nakano, Kenichi; Peng, Jen-Chieh; Wang, Su-Yin

    2015-12-01

    The SeaQuest experiment (Fermilab E906) detects pairs of energetic μ+ and μ- produced in 120 GeV/c proton-nucleon interactions in a high rate environment. The trigger system consists of several arrays of scintillator hodoscopes and a set of field-programmable gate array (FPGA) based VMEbus modules. Signals from up to 96 channels of hodoscope are digitized by each FPGA with a 1-ns resolution using the time-to-digital convertor (TDC) firmware. The delay of the TDC output can be adjusted channel-by-channel in 1-ns step and then re-aligned with the beam RF clock. The hit pattern on the hodoscope planes is then examined against pre-determined trigger matrices to identify candidate muon tracks. Information on the candidate tracks is sent to the 2nd-level FPGA-based track correlator to find candidate di-muon events. The design and implementation of the FPGA-based trigger system for SeaQuest experiment are presented.

  19. FPGA-based Trigger System for the Fermilab SeaQuest Experimentz

    DOE PAGES

    Shiu, Shiuan-Hal; Wu, Jinyuan; McClellan, Randall Evan; ...

    2015-09-10

    The SeaQuest experiment (Fermilab E906) detects pairs of energetic μ + and μ -produced in 120 GeV/c proton–nucleon interactions in a high rate environment. The trigger system we used consists of several arrays of scintillator hodoscopes and a set of field-programmable gate array (FPGA) based VMEbus modules. Signals from up to 96 channels of hodoscope are digitized by each FPGA with a 1-ns resolution using the time-to-digital convertor (TDC) firmware. The delay of the TDC output can be adjusted channel-by-channel in 1-ns step and then re-aligned with the beam RF clock. The hit pattern on the hodoscope planes is thenmore » examined against pre-determined trigger matrices to identify candidate muon tracks. Finally, information on the candidate tracks is sent to the 2nd-level FPGA-based track correlator to find candidate di-muon events. The design and implementation of the FPGA-based trigger system for SeaQuest experiment are presented.« less

  20. Rigorous accuracy assessment for 3D reconstruction using time-series Dual Fluoroscopy (DF) image pairs

    NASA Astrophysics Data System (ADS)

    Al-Durgham, Kaleel; Lichti, Derek D.; Kuntze, Gregor; Ronsky, Janet

    2017-06-01

    High-speed biplanar videoradiography, or clinically referred to as dual fluoroscopy (DF), imaging systems are being used increasingly for skeletal kinematics analysis. Typically, a DF system comprises two X-ray sources, two image intensifiers and two high-speed video cameras. The combination of these elements provides time-series image pairs of articulating bones of a joint, which permits the measurement of bony rotation and translation in 3D at high temporal resolution (e.g., 120-250 Hz). Assessment of the accuracy of 3D measurements derived from DF imaging has been the subject of recent research efforts by several groups, however with methodological limitations. This paper presents a novel and simple accuracy assessment procedure based on using precise photogrammetric tools. We address the fundamental photogrammetry principles for the accuracy evaluation of an imaging system. Bundle adjustment with selfcalibration is used for the estimation of the system parameters. The bundle adjustment calibration uses an appropriate sensor model and applies free-network constraints and relative orientation stability constraints for a precise estimation of the system parameters. A photogrammetric intersection of time-series image pairs is used for the 3D reconstruction of a rotating planar object. A point-based registration method is used to combine the 3D coordinates from the intersection and independently surveyed coordinates. The final DF accuracy measure is reported as the distance between 3D coordinates from image intersection and the independently surveyed coordinates. The accuracy assessment procedure is designed to evaluate the accuracy over the full DF image format and a wide range of object rotation. Experiment of reconstruction of a rotating planar object reported an average positional error of 0.44 +/- 0.2 mm in the derived 3D coordinates (minimum 0.05 and maximum 1.2 mm).

  1. Biophysics of Magnetic Orientation: Radical Pairs, Biogenic Magnetite, or both?

    NASA Astrophysics Data System (ADS)

    Kirschvink, Joe

    2011-03-01

    Two major biophysical mechanisms for magnetoreception in terrestrial animals, one based on biogenic magnetite and another on radical-pair biochemical reactions, have been the subject of experiment and debate for the past 30 years. The magnetite hypothesis has stood the test of time: biogenic magnetite is synthesized biochemically in Bacteria, Protists, and numerous Animal phyla, as well as in some plants. Chains of single-domain crystals have been detected by clean-lab based SQUID magnetometry in animal tissues in all major phyla, followed by high-resolution TEM in selected model organisms, as well as by electrophysiological studies demonstrating the role of the ophthalmic branch of the trigeminal nerve in the magnetoreceptive process. Pulse-remagnetization - configured to uniquely flip the polarity of single-domain ferromagnets - has dramatic effects on the behavior of many birds, honeybees, mole rats, turtles, and bats, to cite a growing list. Magnetite-containing cells in the vicinity of these neurons in fish are now the subject of intense study by our consortium. The existence of a specialized class of magnetite-containing magnetoreceptor cells in animal tissues is no longer controversial. In contrast, less success has been achieved in gaining experimental support across a range of taxa for the radical-pair hypothesis. Although this mechanism was proposed to explain an early observation that birds would not respond to complete inversion of the magnetic vector, many organisms (even some birds) do indeed respond to the field polarity. We also note that few, if any, of these critical experiments have been done using fully double-blind methods. This is joint work with: M. M. Walker (University of Auckland, New Zealand) and M. Winklhofer (LMU Munich, Germany).

  2. Comparison of clinical knowledge bases for summarization of electronic health records.

    PubMed

    McCoy, Allison B; Sittig, Dean F; Wright, Adam

    2013-01-01

    Automated summarization tools that create condition-specific displays may improve clinician efficiency. These tools require new kinds of knowledge that is difficult to obtain. We compared five problem-medication pair knowledge bases generated using four previously described knowledge base development approaches. The number of pairs in the resulting mapped knowledge bases varied widely due to differing mapping techniques from the source terminologies, ranging from 2,873 to 63,977,738 pairs. The number of overlapping pairs across knowledge bases was low, with one knowledge base having half of the pairs overlapping with another knowledge base, and most having less than a third overlapping. Further research is necessary to better evaluate the knowledge bases independently in additional settings, and to identify methods to integrate the knowledge bases.

  3. Correlation Functions Quantify Super-Resolution Images and Estimate Apparent Clustering Due to Over-Counting

    PubMed Central

    Veatch, Sarah L.; Machta, Benjamin B.; Shelby, Sarah A.; Chiang, Ethan N.; Holowka, David A.; Baird, Barbara A.

    2012-01-01

    We present an analytical method using correlation functions to quantify clustering in super-resolution fluorescence localization images and electron microscopy images of static surfaces in two dimensions. We use this method to quantify how over-counting of labeled molecules contributes to apparent self-clustering and to calculate the effective lateral resolution of an image. This treatment applies to distributions of proteins and lipids in cell membranes, where there is significant interest in using electron microscopy and super-resolution fluorescence localization techniques to probe membrane heterogeneity. When images are quantified using pair auto-correlation functions, the magnitude of apparent clustering arising from over-counting varies inversely with the surface density of labeled molecules and does not depend on the number of times an average molecule is counted. In contrast, we demonstrate that over-counting does not give rise to apparent co-clustering in double label experiments when pair cross-correlation functions are measured. We apply our analytical method to quantify the distribution of the IgE receptor (FcεRI) on the plasma membranes of chemically fixed RBL-2H3 mast cells from images acquired using stochastic optical reconstruction microscopy (STORM/dSTORM) and scanning electron microscopy (SEM). We find that apparent clustering of FcεRI-bound IgE is dominated by over-counting labels on individual complexes when IgE is directly conjugated to organic fluorophores. We verify this observation by measuring pair cross-correlation functions between two distinguishably labeled pools of IgE-FcεRI on the cell surface using both imaging methods. After correcting for over-counting, we observe weak but significant self-clustering of IgE-FcεRI in fluorescence localization measurements, and no residual self-clustering as detected with SEM. We also apply this method to quantify IgE-FcεRI redistribution after deliberate clustering by crosslinking with two distinct trivalent ligands of defined architectures, and we evaluate contributions from both over-counting of labels and redistribution of proteins. PMID:22384026

  4. Development and Applications of a New, High-Resolution, Operational MISR Aerosol Product

    NASA Astrophysics Data System (ADS)

    Garay, M. J.; Diner, D. J.; Kalashnikova, O.

    2014-12-01

    Since early 2000, the Multi-angle Imaging SpectroRadiometer (MISR) instrument on NASA's Terra satellite has been providing aerosol optical depth (AOD) and particle property retrievals at 17.6 km spatial resolution. Capitalizing on the capabilities provided by multi-angle viewing, the operational MISR algorithm performs well, with about 75% of MISR AOD retrievals falling within 0.05 or 20% × AOD of the paired validation data from the ground-based Aerosol Robotic Network (AERONET), and is able to distinguish aerosol particles by size and sphericity, over both land and water. These attributes enable a variety of applications, including aerosol transport model validation and global air quality assessment. Motivated by the adverse impacts of aerosols on human health at the local level, and taking advantage of computational speed advances that have occurred since the launch of Terra, we have implemented an operational MISR aerosol product with 4.4 km spatial resolution that maintains, and sometimes improves upon, the quality of the 17.6 km resolution product. We will describe the performance of this product relative to the heritage 17.6 km product, the global AERONET validation network, and high spatial density AERONET-DRAGON sites. Other changes that simplify product content, and make working with the data much easier for users, will also be discussed. Examples of how the new product demonstrates finer spatial variability of aerosol fields than previously retrieved, and ways this new dataset can be used for studies of local aerosol effects, will be shown.

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Okutsu, N.; Shimamura, K.; Shimizu, E.

    To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH{sub 2} group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH{sub 2} group of G-Cmore » base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes.« less

  6. Epigenetic discrimination of identical twins from blood under the forensic scenario.

    PubMed

    Vidaki, Athina; Díez López, Celia; Carnero-Montoro, Elena; Ralf, Arwin; Ward, Kirsten; Spector, Timothy; Bell, Jordana T; Kayser, Manfred

    2017-11-01

    Monozygotic (MZ) twins share the same STR profile, demonstrating a practical problem in forensic casework. DNA methylation has provided a suitable resource for MZ twin differentiation; however, studies addressing the forensic feasibility are lacking. Here, we investigated epigenetic MZ twin differentiation from blood under the forensic scenario comprising i) the discovery of candidate markers in reference-type blood DNA via genome-wide analysis, ii) the technical validation of candidate markers in reference-type blood DNA using a suitable targeted method, and iii) the analysis of the validated markers in trace-type DNA. Genome-wide methylation analysis in blood DNA from 10 MZ twin pairs resulted in 19-111 twin-differentially methylated sites (tDMSs) per pair with >0.3 twin-to-twin differences. Considering all top three candidate tDMSs across all pairs in the technical validation based on methylation-specific qPCR, 67.85% generated >0.1 twin-to-twin differences. Of the validated tDMSs, 68.4% showed >0.1 twin-to-twin differences with qPCR in trace-type DNA across 8 pairs. Using an updated marker selection strategy, 8 additional candidate tDMSs were obtained for an example MZ pair, of which 7 showed >0.1 twin-to-twin differences in both reference- and trace-type DNA. Lastly, we introduce a high-resolution melting curve analysis of the entire fragment that can complement the proposed approach. Overall, our study demonstrates the general feasibility of epigenetic twin differentiation in the forensic context and highlights that the number of informative tDMSs in the final trace DNA analysis is crucial, as some candidate markers identified in reference DNA were shown not informative in the trace DNA due to various, including technical, reasons. Future studies will need to address the optimal number of epigenetic markers required for reliable identification of MZ twin individuals including statistical considerations. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. LAN attack detection using Discrete Event Systems.

    PubMed

    Hubballi, Neminath; Biswas, Santosh; Roopa, S; Ratti, Ritesh; Nandi, Sukumar

    2011-01-01

    Address Resolution Protocol (ARP) is used for determining the link layer or Medium Access Control (MAC) address of a network host, given its Internet Layer (IP) or Network Layer address. ARP is a stateless protocol and any IP-MAC pairing sent by a host is accepted without verification. This weakness in the ARP may be exploited by malicious hosts in a Local Area Network (LAN) by spoofing IP-MAC pairs. Several schemes have been proposed in the literature to circumvent these attacks; however, these techniques either make IP-MAC pairing static, modify the existing ARP, patch operating systems of all the hosts etc. In this paper we propose a Discrete Event System (DES) approach for Intrusion Detection System (IDS) for LAN specific attacks which do not require any extra constraint like static IP-MAC, changing the ARP etc. A DES model is built for the LAN under both a normal and compromised (i.e., spoofed request/response) situation based on the sequences of ARP related packets. Sequences of ARP events in normal and spoofed scenarios are similar thereby rendering the same DES models for both the cases. To create different ARP events under normal and spoofed conditions the proposed technique uses active ARP probing. However, this probing adds extra ARP traffic in the LAN. Following that a DES detector is built to determine from observed ARP related events, whether the LAN is operating under a normal or compromised situation. The scheme also minimizes extra ARP traffic by probing the source IP-MAC pair of only those ARP packets which are yet to be determined as genuine/spoofed by the detector. Also, spoofed IP-MAC pairs determined by the detector are stored in tables to detect other LAN attacks triggered by spoofing namely, man-in-the-middle (MiTM), denial of service etc. The scheme is successfully validated in a test bed. Copyright © 2010 ISA. Published by Elsevier Ltd. All rights reserved.

  8. A Multi-object Exoplanet Detecting Technique

    NASA Astrophysics Data System (ADS)

    Zhang, K.

    2011-05-01

    Exoplanet exploration is not only a meaningful astronomical action, but also has a close relation with the extra-terrestrial life. High resolution echelle spectrograph is the key instrument for measuring stellar radial velocity (RV). But with higher precision, better environmental stability and higher cost are required. An improved technique of RV means invented by David J. Erskine in 1997, External Dispersed Interferometry (EDI), can increase the RV measuring precision by combining the moderate resolution spectrograph with a fixed-delay Michelson interferometer. LAMOST with large aperture and large field of view is equipped with 16 multi-object low resolution fiber spectrographs. And these spectrographs are capable to work in medium resolution mode (R=5{K}˜10{K}). LAMOST will be one of the most powerful exoplanet detecting systems over the world by introducing EDI technique. The EDI technique is a new technique for developing astronomical instrumentation in China. The operating theory of EDI was generally verified by a feasibility experiment done in 2009. And then a multi-object exoplanet survey system based on LAMOST spectrograph was proposed. According to this project, three important tasks have been done as follows: Firstly, a simulation of EDI operating theory contains the stellar spectrum model, interferometer transmission model, spectrograph mediation model and RV solution model. In order to meet the practical situation, two detecting modes, temporal and spatial phase-stepping methods, are separately simulated. The interference spectrum is analyzed with Fourier transform algorithm and a higher resolution conventional spectrum is resolved. Secondly, an EDI prototype is composed of a multi-object interferometer prototype and the LAMOST spectrograph. Some ideas are used in the design to reduce the effect of central obscuration, for example, modular structure and external/internal adjusting frames. Another feasibility experiment was done at Xinglong Station in 2010. A related spectrum reduction program and the instrumental stability were tested by obtaining some multi-object interference spectrum. Thirdly, studying the parameter optimization of fixed-delay Michelson interferometer is helpful to increase its inner thermal stability and reduce the external environmental requirement. Referring to Wide-angle Michelson Interferometer successfully used in Upper Atmospheric Wind field, a glass pair selecting scheme is given. By choosing a suitable glass pair of interference arms, the RV error can be stable as several hundred m\\cdots^{-1}\\cdot{dg}C^{-1}. Therefore, this work is helpful to deeply study EDI technique and speed up the development of multi-object exoplanet survey system. LAMOST will make a greater contribution to astronomy when the combination between its spectrographs and EDI technique comes true.

  9. Ten-Meter Scale Topography and Roughness of Mars Exploration Rovers Landing Sites and Martian Polar Regions

    NASA Technical Reports Server (NTRS)

    Ivanov, Anton B.

    2003-01-01

    The Mars Orbiter Camera (MOC) has been operating on board of the Mars Global Surveyor (MGS) spacecraft since 1998. It consists of three cameras - Red and Blue Wide Angle cameras (FOV=140 deg.) and Narrow Angle camera (FOV=0.44 deg.). The Wide Angle camera allows surface resolution down to 230 m/pixel and the Narrow Angle camera - down to 1.5 m/pixel. This work is a continuation of the project, which we have reported previously. Since then we have refined and improved our stereo correlation algorithm and have processed many more stereo pairs. We will discuss results of our stereo pair analysis located in the Mars Exploration rovers (MER) landing sites and address feasibility of recovering topography from stereo pairs (especially in the polar regions), taken during MGS 'Relay-16' mode.

  10. Validating silicon polytrodes with paired juxtacellular recordings: method and dataset

    PubMed Central

    Lopes, Gonçalo; Frazão, João; Nogueira, Joana; Lacerda, Pedro; Baião, Pedro; Aarts, Arno; Andrei, Alexandru; Musa, Silke; Fortunato, Elvira; Barquinha, Pedro; Kampff, Adam R.

    2016-01-01

    Cross-validating new methods for recording neural activity is necessary to accurately interpret and compare the signals they measure. Here we describe a procedure for precisely aligning two probes for in vivo “paired-recordings” such that the spiking activity of a single neuron is monitored with both a dense extracellular silicon polytrode and a juxtacellular micropipette. Our new method allows for efficient, reliable, and automated guidance of both probes to the same neural structure with micrometer resolution. We also describe a new dataset of paired-recordings, which is available online. We propose that our novel targeting system, and ever expanding cross-validation dataset, will be vital to the development of new algorithms for automatically detecting/sorting single-units, characterizing new electrode materials/designs, and resolving nagging questions regarding the origin and nature of extracellular neural signals. PMID:27306671

  11. Structural studies on Pax-8 Prd domain/DNA complex.

    PubMed

    Campagnolo, M; Pesaresi, A; Zelezetsky, I; Geremia, S; Randaccio, L; Bisca, A; Tell, G

    2007-04-01

    Pax-8 is a member of the Pax family of transcription factors and is essential in the development of thyroid follicular cells. Pax-8 has two DNA-binding domains: the paired domain and the homeo domain. In this study, a preliminary X-ray diffraction analysis of the mammalian Pax-8 paired domain in complex with the C-site of the thyroglobulin promoter was achieved. The Pax-8 paired domain was crystallized by the hanging-drop vapor-diffusion method in complex with both a blunt-ended 26 bp DNA fragment and with a sticky-ended 24 bp DNA fragment with two additional overhanging bases. Crystallization experiments make clear that the growth of transparent crystals with large dimensions and regular shape is particularly influenced by ionic strength. The crystals of Pax-8 complex with blunt-ended and sticky-ended DNA, diffracted synchrotron radiation to 6.0 and 8.0 A resolution and belongs both to the C centered monoclinic system with cell dimensions: a = 89.88 A, b = 80.05 A, c = 67.73 A, and beta = 124.3 degrees and a = 256.56, b = 69.07, c = 99.32 A, and beta = 98.1 degrees , respectively. Fluorescence experiments suggest that the crystalline disorder, deduced by the poor diffraction, can be attributed to the low homogeneity of the protein-DNA sample. The theoretical comparative model of the Pax-8 paired domain complexed with the C-site of the thyroglobulin promoter shows the probable presence of some specific protein-DNA interactions already observed in other Pax proteins and the important role of the cysteine residues of PAI subdomain in the redox control of the DNA recognition.

  12. PBOOST: a GPU-based tool for parallel permutation tests in genome-wide association studies.

    PubMed

    Yang, Guangyuan; Jiang, Wei; Yang, Qiang; Yu, Weichuan

    2015-05-01

    The importance of testing associations allowing for interactions has been demonstrated by Marchini et al. (2005). A fast method detecting associations allowing for interactions has been proposed by Wan et al. (2010a). The method is based on likelihood ratio test with the assumption that the statistic follows the χ(2) distribution. Many single nucleotide polymorphism (SNP) pairs with significant associations allowing for interactions have been detected using their method. However, the assumption of χ(2) test requires the expected values in each cell of the contingency table to be at least five. This assumption is violated in some identified SNP pairs. In this case, likelihood ratio test may not be applicable any more. Permutation test is an ideal approach to checking the P-values calculated in likelihood ratio test because of its non-parametric nature. The P-values of SNP pairs having significant associations with disease are always extremely small. Thus, we need a huge number of permutations to achieve correspondingly high resolution for the P-values. In order to investigate whether the P-values from likelihood ratio tests are reliable, a fast permutation tool to accomplish large number of permutations is desirable. We developed a permutation tool named PBOOST. It is based on GPU with highly reliable P-value estimation. By using simulation data, we found that the P-values from likelihood ratio tests will have relative error of >100% when 50% cells in the contingency table have expected count less than five or when there is zero expected count in any of the contingency table cells. In terms of speed, PBOOST completed 10(7) permutations for a single SNP pair from the Wellcome Trust Case Control Consortium (WTCCC) genome data (Wellcome Trust Case Control Consortium, 2007) within 1 min on a single Nvidia Tesla M2090 device, while it took 60 min in a single CPU Intel Xeon E5-2650 to finish the same task. More importantly, when simultaneously testing 256 SNP pairs for 10(7) permutations, our tool took only 5 min, while the CPU program took 10 h. By permuting on a GPU cluster consisting of 40 nodes, we completed 10(12) permutations for all 280 SNP pairs reported with P-values smaller than 1.6 × 10⁻¹² in the WTCCC datasets in 1 week. The source code and sample data are available at http://bioinformatics.ust.hk/PBOOST.zip. gyang@ust.hk; eeyu@ust.hk Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  13. Multi-epoch observations with high spatial resolution of multiple T Tauri systems

    NASA Astrophysics Data System (ADS)

    Csépány, Gergely; van den Ancker, Mario; Ábrahám, Péter; Köhler, Rainer; Brandner, Wolfgang; Hormuth, Felix; Hiss, Hector

    2017-07-01

    Context. In multiple pre-main-sequence systems the lifetime of circumstellar discs appears to be shorter than around single stars, and the actual dissipation process may depend on the binary parameters of the systems. Aims: We report high spatial resolution observations of multiple T Tauri systems at optical and infrared wavelengths. We determine whether the components are gravitationally bound and orbital motion is visible, derive orbital parameters, and investigate possible correlations between the binary parameters and disc states. Methods: We selected 18 T Tau multiple systems (16 binary and two triple systems, yielding 16 + 2 × 2 = 20 binary pairs) in the Taurus-Auriga star-forming region from a previous survey, with spectral types from K1 to M5 and separations from 0.22″ (31 AU) to 5.8″ (814 AU). We analysed data acquired in 2006-07 at Calar Alto using the AstraLux lucky imaging system, along with data from SPHERE and NACO at the VLT, and from the literature. Results: We found ten pairs to orbit each other, five pairs that may show orbital motion, and five likely common proper motion pairs. We found no obvious correlation between the stellar parameters and binary configuration. The 10 μm infra-red excess varies between 0.1 and 7.2 mag (similar to the distribution in single stars, where it is between 1.7 and 9.1), implying that the presence of the binary star does not greatly influence the emission from the inner disc. Conclusions: We have detected orbital motion in young T Tauri systems over a timescale of ≈ 20 yr. Further observations with even longer temporal baseline will provide crucial information on the dynamics of these young stellar systems.

  14. Radiometric cross-calibration of the Terra MODIS and Landsat 7 ETM+ using an invariant desert site

    USGS Publications Warehouse

    Choi, T.; Angal, A.; Chander, G.; Xiong, X.

    2008-01-01

    A methodology for long-term radiometric cross-calibration between the Terra Moderate Resolution Imaging Spectroradiometer (MODIS) and Landsat 7 (L7) Enhanced Thematic Mapper Plus (ETM+) sensors was developed. The approach involves calibration of near-simultaneous surface observations between 2000 and 2007. Fifty-seven cloud-free image pairs were carefully selected over the Libyan desert for this study. The Libyan desert site (+28.55??, +23.39??), located in northern Africa, is a high reflectance site with high spatial, spectral, and temporal uniformity. Because the test site covers about 12 kmx13 km, accurate geometric preprocessing is required to match the footprint size between the two sensors to avoid uncertainties due to residual image misregistration. MODIS Level IB radiometrically corrected products were reprojected to the corresponding ETM+ image's Universal Transverse Mercator (UTM) grid projection. The 30 m pixels from the ETM+ images were aggregated to match the MODIS spatial resolution (250 m in Bands 1 and 2, or 500 m in Bands 3 to 7). The image data from both sensors were converted to absolute units of at-sensor radiance and top-ofatmosphere (TOA) reflectance for the spectrally matching band pairs. For each band pair, a set of fitted coefficients (slope and offset) is provided to quantify the relationships between the testing sensors. This work focuses on long-term stability and correlation of the Terra MODIS and L7 ETM+ sensors using absolute calibration results over the entire mission of the two sensors. Possible uncertainties are also discussed such as spectral differences in matching band pairs, solar zenith angle change during a collection, and differences in solar irradiance models.

  15. Recognition of Watson-Crick base pairs: constraints and limits due to geometric selection and tautomerism

    PubMed Central

    Yusupov, Marat; Yusupova, Gulnara

    2014-01-01

    The natural bases of nucleic acids have a strong preference for one tautomer form, guaranteeing fidelity in their hydrogen bonding potential. However, base pairs observed in recent crystal structures of polymerases and ribosomes are best explained by an alternative base tautomer, leading to the formation of base pairs with Watson-Crick-like geometries. These observations set limits to geometric selection in molecular recognition of complementary Watson-Crick pairs for fidelity in replication and translation processes. PMID:24765524

  16. A Three-Dimensional View of Titan's Surface Features from Cassini RADAR Stereogrammetry

    NASA Astrophysics Data System (ADS)

    Kirk, R. L.; Howington-Kraus, E.; Redding, B. L.; Becker, T. L.; Lee, E. M.; Stiles, B. W.; Hensley, S.; Hayes, A.; Lopes, R. M.; Lorenz, R. D.; Mitchell, K. L.; Radebaugh, J.; Paganelli, F.; Soderblom, L. A.; Stofan, E. R.; Wood, C. A.; Wall, S. D.; Cassini RADAR Team

    2008-12-01

    As of the end of its four-year Prime Mission, Cassini has obtained 300-1500 m resolution synthetic aperture radar images of the surface of Titan during 19 flybys. The elongated image swaths overlap extensively, and ~2% of the surface has now been imaged two or more times. The majority of image pairs have different viewing directions, and thus contain stereo parallax that encodes information about Titan's surface relief over distances of ~1 km and greater. As we have previously reported, the first step toward extracting quantitative topographic information was the development of rigorous "sensor models" that allowed the stereo systems previously used at the USGS and JPL to map Venus with Magellan images to be used for Titan mapping. The second major step toward extensive topomapping of Titan has been the reprocessing of the RADAR images based on an improved model of the satellite's rotation. Whereas the original images (except for a few pairs obtained at similar orbital phase, some of which we have mapped previously) were offset by as much as 30 km, the new versions align much better. The remaining misalignments, typically <1 km, can be removed by a least-squares adjustment of the spacecraft trajectories before mapping, which also ensures that the stereo digital topographic models (DTMs) are made consistent with altimetry and SAR topography profiles. The useful stereo coverage now available includes a much larger portion of Titan's north polar lake country than we previously presented, a continuous traverse of high resolution data from the lakes to mid-southern latitudes, and widely distributed smaller areas. A remaining challenge is that many pairs of images are illuminated from opposite sides or from near-perpendicular directions, which can make image matching more difficult. We find that the high-contrast polarizing display of the stereo workstation at USGS provides a much clearer view of these unfavorably illuminated pairs than (for example) anaglyphs, and lets us supplement automatic image matching with interactive measurements where the former fails. We are collecting DTMs of all usable image pairs and will present the most interesting results. Examples of geologic questions that may be addressed are: What is the relation between Ganesa and surrounding features? Is it a dome or shield? Can the height of Titan's dunes be measured, and what is the relief of the bright "islands" that appear to divert the dunes? How high are the mountains of Xanadu and what gradients drive the channels between them? What are the relative and absolute height relations between seas and lakes of different types, and what does this tell us about the "hydro(carbono)logic" cycle of precipitation, evaporation, and surface and subsurface fluid flow?

  17. An overview and the current status of instrumentation at the Large Binocular Telescope Observatory

    NASA Astrophysics Data System (ADS)

    Wagner, R. Mark; Edwards, Michelle L.; Kuhn, Olga; Thompson, David; Veillet, Christian

    2014-07-01

    An overview of instrumentation for the Large Binocular Telescope (LBT) is presented. Optical instrumentation includes the Large Binocular Camera (LBC), a pair of wide-field (24' × 24') mosaic CCD imagers at the prime focus, and the Multi-Object Double Spectrograph (MODS), a pair of dual-beam blue-red optimized long-slit spectrographs mounted at the left and right direct F/15 Gregorian foci incorporating multiple slit masks for multi-object spectroscopy over a 6' field and spectral resolutions of up to 2000. Infrared instrumentation includes the LBT Near-IR Spectrometer (LUCI), a modular near-infrared (0.9-2.5 μm) imager and spectrograph pair mounted at the left and right front-bent F/15 Gregorian foci and designed for seeing-limited (FOV: 4' × 4') imaging, long-slit spectroscopy, and multi-object spectroscopy utilizing cooled slit masks and diffraction limited (FOV: 0'.5 x 0'.5) imaging and long-slit spectroscopy. Strategic instruments under development that can utilize the full 23 m baseline of the LBT include an interferometric cryogenic beam combiner with near-infrared and thermal-infrared instruments for Fizeau imaging and nulling interferometry (LBTI) and an optical bench near- infrared beam combiner utilizing multi-conjugate adaptive optics for high angular resolution and sensitivity (LINC-NIRVANA). LBTI is currently undergoing commissioning and performing science observations on the LBT utilizing the installed adaptive secondary mirrors in both single-sided and two-sided beam combination modes. In addition, a fiber-fed bench spectrograph (PEPSI) capable of ultra high resolution spectroscopy and spectropolarimetry (R = 40,000-300,000) will be available as a principal investigator instrument. Installation and testing of the bench spectrograph will begin in July 2014. Over the past four years the LBC pair, LUCI1, and MODS1 have been commissioned and are now scheduled for routine partner science observations. Both LUCI2 and MODS2 passed their laboratory acceptance milestones in the summer of 2013 and have been installed on the LBT. LUCI2 is currently being commissioned and the data analysis is well underway. Diffraction-limited commissioning of its adaptive optics modes will begin in the 2014B semester. MODS2 commissioning began in May 2014 and will completed in the 2014B semester as well. Binocular testing and commissioning of both the LUCI and MODS pairs will begin in 2014B with the goal that this capability could be offered sometime in 2015. The availability of all these instruments mounted simultaneously on the LBT permits unique science, flexible scheduling, and improved operational support.

  18. KIC 4150611: a rare multi-eclipsing quintuple with a hybrid pulsator

    NASA Astrophysics Data System (ADS)

    Hełminiak, K. G.; Ukita, N.; Kambe, E.; Kozłowski, S. K.; Pawłaszek, R.; Maehara, H.; Baranec, C.; Konacki, M.

    2017-06-01

    Aims: We aim to analyse KIC 4150611 (HD 181469) - an interesting, bright quintuple system that includes a hybrid δ Sct/γ Dor pulsator. Four periods of eclipses - 94.2, 8.65, 1.52 and 1.43 d - have been observed by the Kepler satellite, and three point sources (A, B, and C) are seen in high angular resolution images. Methods: From spectroscopic observations made with the HIDES spectrograph attached to the 1.88-m telescope of the Okayama Astrophysical Observatory (OAO), we have calculated for the first time radial velocities (RVs) of the component B - a pair of G-type stars - and combined them with Kepler photometry in order to obtain absolute physical parameters of this pair. We also managed to directly measure RVs of the pulsator, for the first time. Additionally, we modelled the light curves of the 1.52 and 1.43-day pairs, and measured their eclipse timing variations (ETVs). We also performed relative astrometry and photometry of three sources seen on the images taken with the NIRC2 camera of the Keck II telescope. Finally, we compared our results with theoretical isochrones. Results: The brightest component Aa is the hybrid pulsator, transited every 94.2 days by a pair of K/M-type stars (Ab1+Ab2), which themselves form a 1.52-day eclipsing binary. The components Ba and Bb are late G-type stars, forming another eclipsing pair with a 8.65 day period. Their masses and radii are MBa = 0.894 ± 0.010 M⊙, RBa = 0.802 ± 0.044 R⊙ for the primary, and MBb = 0.888 ± 0.010 M⊙, RBb = 0.856 ± 0.038 R⊙ for the secondary. The remaining period of 1.43 days is possibly related to a faint third star C, which itself is most likely a background object. The system's properties are well-represented by a 35 Myr isochrone, basing on which the masses of the pulsator and the 1.52-day pair are MAa = 1.64(6) M⊙, and MAb,tot = 0.90(13) M⊙, respectively. There are also suggestions of additional bodies in the system.

  19. A fast and fully automatic registration approach based on point features for multi-source remote-sensing images

    NASA Astrophysics Data System (ADS)

    Yu, Le; Zhang, Dengrong; Holden, Eun-Jung

    2008-07-01

    Automatic registration of multi-source remote-sensing images is a difficult task as it must deal with the varying illuminations and resolutions of the images, different perspectives and the local deformations within the images. This paper proposes a fully automatic and fast non-rigid image registration technique that addresses those issues. The proposed technique performs a pre-registration process that coarsely aligns the input image to the reference image by automatically detecting their matching points by using the scale invariant feature transform (SIFT) method and an affine transformation model. Once the coarse registration is completed, it performs a fine-scale registration process based on a piecewise linear transformation technique using feature points that are detected by the Harris corner detector. The registration process firstly finds in succession, tie point pairs between the input and the reference image by detecting Harris corners and applying a cross-matching strategy based on a wavelet pyramid for a fast search speed. Tie point pairs with large errors are pruned by an error-checking step. The input image is then rectified by using triangulated irregular networks (TINs) to deal with irregular local deformations caused by the fluctuation of the terrain. For each triangular facet of the TIN, affine transformations are estimated and applied for rectification. Experiments with Quickbird, SPOT5, SPOT4, TM remote-sensing images of the Hangzhou area in China demonstrate the efficiency and the accuracy of the proposed technique for multi-source remote-sensing image registration.

  20. A mechanical mechanism for translocation of ring-shaped helicases on DNA and its demonstration in a macroscopic simulation system

    NASA Astrophysics Data System (ADS)

    Chou, Y. C.

    2018-04-01

    The asymmetry in the two-layered ring structure of helicases and the random thermal fluctuations of the helicase and DNA molecules are considered as the bases for the generation of the force required for translocation of the ring-shaped helicase on DNA. The helicase comprises a channel at its center with two unequal ends, through which strands of DNA can pass. The random collisions between the portion of the DNA strand in the central channel and the wall of the channel generate an impulsive force toward the small end. This impulsive force is the starting point for the helicase to translocate along the DNA with the small end in front. Such a physical mechanism may serve as a complementary for the chemomechanical mechanism of the translocation of helicase on DNA. When the helicase arrives at the junction of ssDNA and dsDNA (a fork), the collision between the helicase and the closest base pair may produce a sufficient impulsive force to break the weak hydrogen bond of the base pair. Thus, the helicase may advance and repeat the process of unwinding the dsDNA strand. This mechanism was tested in a macroscopic simulation system where the helicase was simulated using a truncated-cone structure and DNA was simulated with bead chains. Many features of translocation and unwinding such as translocation on ssDNA and dsDNA, unwinding of dsDNA, rewinding, strand switching, and Holliday junction resolution were reproduced.

  1. Detection and Characterization of Leishmania (Leishmania) and Leishmania (Viannia) by SYBR Green-Based Real-Time PCR and High Resolution Melt Analysis Targeting Kinetoplast Minicircle DNA

    PubMed Central

    Ceccarelli, Marcello; Galluzzi, Luca; Migliazzo, Antonella; Magnani, Mauro

    2014-01-01

    Leishmaniasis is a neglected disease with a broad clinical spectrum which includes asymptomatic infection. A thorough diagnosis, able to distinguish and quantify Leishmania parasites in a clinical sample, constitutes a key step in choosing an appropriate therapy, making an accurate prognosis and performing epidemiological studies. Several molecular techniques have been shown to be effective in the diagnosis of leishmaniasis. In particular, a number of PCR methods have been developed on various target DNA sequences including kinetoplast minicircle constant regions. The first aim of this study was to develop a SYBR green-based qPCR assay for Leishmania (Leishmania) infantum detection and quantification, using kinetoplast minicircle constant region as target. To this end, two assays were compared: the first used previously published primer pairs (qPCR1), whereas the second used a nested primer pairs generating a shorter PCR product (qPCR2). The second aim of this study was to evaluate the possibility to discriminate among subgenera Leishmania (Leishmania) and Leishmania (Viannia) using the qPCR2 assay followed by melting or High Resolution Melt (HRM) analysis. Both assays used in this study showed good sensitivity and specificity, and a good correlation with standard IFAT methods in 62 canine clinical samples. However, the qPCR2 assay allowed to discriminate between Leishmania (Leishmania) and Leishmania (Viannia) subgenera through melting or HRM analysis. In addition to developing assays, we investigated the number and genetic variability of kinetoplast minicircles in the Leishmania (L.) infantum WHO international reference strain (MHOM/TN/80/IPT1), highlighting the presence of minicircle subclasses and sequence heterogeneity. Specifically, the kinetoplast minicircle number per cell was estimated to be 26,566±1,192, while the subclass of minicircles amplifiable by qPCR2 was estimated to be 1,263±115. This heterogeneity, also observed in canine clinical samples, must be taken into account in quantitative PCR-based applications; however, it might also be used to differentiate between Leishmania subgenera. PMID:24551178

  2. A Chromosome 7 Pericentric Inversion Defined at Single-Nucleotide Resolution Using Diagnostic Whole Genome Sequencing in a Patient with Hand-Foot-Genital Syndrome.

    PubMed

    Watson, Christopher M; Crinnion, Laura A; Harrison, Sally M; Lascelles, Carolina; Antanaviciute, Agne; Carr, Ian M; Bonthron, David T; Sheridan, Eamonn

    2016-01-01

    Next generation sequencing methodologies are facilitating the rapid characterisation of novel structural variants at nucleotide resolution. These approaches are particularly applicable to variants initially identified using alternative molecular methods. We report a child born with bilateral postaxial syndactyly of the feet and bilateral fifth finger clinodactyly. This was presumed to be an autosomal recessive syndrome, due to the family history of consanguinity. Karyotype analysis revealed a homozygous pericentric inversion of chromosome 7 (46,XX,inv(7)(p15q21)x2) which was confirmed to be heterozygous in both unaffected parents. Since the resolution of the karyotype was insufficient to identify any putatively causative gene, we undertook medium-coverage whole genome sequencing using paired-end reads, in order to elucidate the molecular breakpoints. In a two-step analysis, we first narrowed down the region by identifying discordant read-pairs, and then determined the precise molecular breakpoint by analysing the mapping locations of "soft-clipped" breakpoint-spanning reads. PCR and Sanger sequencing confirmed the identified breakpoints, both of which were located in intergenic regions. Significantly, the 7p15 breakpoint was located 523 kb upstream of HOXA13, the locus for hand-foot-genital syndrome. By inference from studies of HOXA locus control in the mouse, we suggest that the inversion has delocalised a HOXA13 enhancer to produce the phenotype observed in our patient. This study demonstrates how modern genetic diagnostic approach can characterise structural variants at nucleotide resolution and provide potential insights into functional regulation.

  3. Sparse maps—A systematic infrastructure for reduced-scaling electronic structure methods. II. Linear scaling domain based pair natural orbital coupled cluster theory

    NASA Astrophysics Data System (ADS)

    Riplinger, Christoph; Pinski, Peter; Becker, Ute; Valeev, Edward F.; Neese, Frank

    2016-01-01

    Domain based local pair natural orbital coupled cluster theory with single-, double-, and perturbative triple excitations (DLPNO-CCSD(T)) is a highly efficient local correlation method. It is known to be accurate and robust and can be used in a black box fashion in order to obtain coupled cluster quality total energies for large molecules with several hundred atoms. While previous implementations showed near linear scaling up to a few hundred atoms, several nonlinear scaling steps limited the applicability of the method for very large systems. In this work, these limitations are overcome and a linear scaling DLPNO-CCSD(T) method for closed shell systems is reported. The new implementation is based on the concept of sparse maps that was introduced in Part I of this series [P. Pinski, C. Riplinger, E. F. Valeev, and F. Neese, J. Chem. Phys. 143, 034108 (2015)]. Using the sparse map infrastructure, all essential computational steps (integral transformation and storage, initial guess, pair natural orbital construction, amplitude iterations, triples correction) are achieved in a linear scaling fashion. In addition, a number of additional algorithmic improvements are reported that lead to significant speedups of the method. The new, linear-scaling DLPNO-CCSD(T) implementation typically is 7 times faster than the previous implementation and consumes 4 times less disk space for large three-dimensional systems. For linear systems, the performance gains and memory savings are substantially larger. Calculations with more than 20 000 basis functions and 1000 atoms are reported in this work. In all cases, the time required for the coupled cluster step is comparable to or lower than for the preceding Hartree-Fock calculation, even if this is carried out with the efficient resolution-of-the-identity and chain-of-spheres approximations. The new implementation even reduces the error in absolute correlation energies by about a factor of two, compared to the already accurate previous implementation.

  4. Nanofibre optic force transducers with sub-piconewton resolution via near-field plasmon–dielectric interactions

    PubMed Central

    Huang, Qian; Lee, Joon; Arce, Fernando Teran; Yoon, Ilsun; Angsantikul, Pavimol; Liu, Justin; Shi, Yuesong; Villanueva, Josh; Thamphiwatana, Soracha; Ma, Xuanyi; Zhang, Liangfang; Chen, Shaochen; Lal, Ratnesh; Sirbuly, Donald J.

    2018-01-01

    Ultrasensitive nanomechanical instruments, including the atomic force microscope (AFM)1–4 and optical and magnetic tweezers5–8, have helped shed new light on the complex mechanical environments of biological processes. However, it is difficult to scale down the size of these instruments due to their feedback mechanisms9, which, if overcome, would enable high-density nanomechanical probing inside materials. A variety of molecular force probes including mechanophores10, quantum dots11, fluorescent pairs12,13 and molecular rotors14–16 have been designed to measure intracellular stresses; however, fluorescence-based techniques can have short operating times due to photo-instability and it is still challenging to quantify the forces with high spatial and mechanical resolution. Here, we develop a compact nanofibre optic force transducer (NOFT) that utilizes strong near-field plasmon–dielectric interactions to measure local forces with a sensitivity of <200 fN. The NOFT system is tested by monitoring bacterial motion and heart-cell beating as well as detecting infrasound power in solution. PMID:29576804

  5. Wide-field microscopy using microcamera arrays

    NASA Astrophysics Data System (ADS)

    Marks, Daniel L.; Youn, Seo Ho; Son, Hui S.; Kim, Jungsang; Brady, David J.

    2013-02-01

    A microcamera is a relay lens paired with image sensors. Microcameras are grouped into arrays to relay overlapping views of a single large surface to the sensors to form a continuous synthetic image. The imaged surface may be curved or irregular as each camera may independently be dynamically focused to a different depth. Microcamera arrays are akin to microprocessors in supercomputers in that both join individual processors by an optoelectronic routing fabric to increase capacity and performance. A microcamera may image ten or more megapixels and grouped into an array of several hundred, as has already been demonstrated by the DARPA AWARE Wide-Field program with multiscale gigapixel photography. We adapt gigapixel microcamera array architectures to wide-field microscopy of irregularly shaped surfaces to greatly increase area imaging over 1000 square millimeters at resolutions of 3 microns or better in a single snapshot. The system includes a novel relay design, a sensor electronics package, and a FPGA-based networking fabric. Biomedical applications of this include screening for skin lesions, wide-field and resolution-agile microsurgical imaging, and microscopic cytometry of millions of cells performed in situ.

  6. Characterization of the geometry and topology of DNA pictured as a discrete collection of atoms

    PubMed Central

    Olson, Wilma K.

    2014-01-01

    The structural and physical properties of DNA are closely related to its geometry and topology. The classical mathematical treatment of DNA geometry and topology in terms of ideal smooth space curves was not designed to characterize the spatial arrangements of atoms found in high-resolution and simulated double-helical structures. We present here new and rigorous numerical methods for the rapid and accurate assessment of the geometry and topology of double-helical DNA structures in terms of the constituent atoms. These methods are well designed for large DNA datasets obtained in detailed numerical simulations or determined experimentally at high-resolution. We illustrate the usefulness of our methodology by applying it to the analysis of three canonical double-helical DNA chains, a 65-bp minicircle obtained in recent molecular dynamics simulations, and a crystallographic array of protein-bound DNA duplexes. Although we focus on fully base-paired DNA structures, our methods can be extended to treat the geometry and topology of melted DNA structures as well as to characterize the folding of arbitrary molecules such as RNA and cyclic peptides. PMID:24791158

  7. A new look at lunar soil collected from the sea of tranquility during the Apollo 11 mission.

    PubMed

    Kiely, Carol; Greenberg, Gary; Kiely, Christopher J

    2011-02-01

    Complementary state-of-the-art optical, scanning electron, and X-ray microscopy techniques have been used to study the morphology of Apollo 11 lunar soil particles (10084-47). The combination of innovative lighting geometries with image processing of a through focal series of images has allowed us to obtain a unique collection of high-resolution light micrographs of these fascinating particles. Scanning electron microscopy (SEM) stereo-pair imaging has been exploited to illustrate some of the unique morphological properties of lunar regolith. In addition, for the first time, X-ray micrographs with submicron resolution have been taken of individual particles using X-ray ultramicroscopy (XuM). This SEM-based technique lends itself readily to the imaging of pores, cracks, and inclusions and allows the internal structure of an entire particle to be viewed. Rotational SEM and XuM movies have also been constructed from a series of images collected at sequential angles through 360°. These offer a new and insightful view of these complex particles providing size, shape, and spatial information on many of their internal features.

  8. Dual Energy Method for Breast Imaging: A Simulation Study.

    PubMed

    Koukou, V; Martini, N; Michail, C; Sotiropoulou, P; Fountzoula, C; Kalyvas, N; Kandarakis, I; Nikiforidis, G; Fountos, G

    2015-01-01

    Dual energy methods can suppress the contrast between adipose and glandular tissues in the breast and therefore enhance the visibility of calcifications. In this study, a dual energy method based on analytical modeling was developed for the detection of minimum microcalcification thickness. To this aim, a modified radiographic X-ray unit was considered, in order to overcome the limited kVp range of mammographic units used in previous DE studies, combined with a high resolution CMOS sensor (pixel size of 22.5 μm) for improved resolution. Various filter materials were examined based on their K-absorption edge. Hydroxyapatite (HAp) was used to simulate microcalcifications. The contrast to noise ratio (CNR tc ) of the subtracted images was calculated for both monoenergetic and polyenergetic X-ray beams. The optimum monoenergetic pair was 23/58 keV for the low and high energy, respectively, resulting in a minimum detectable microcalcification thickness of 100 μm. In the polyenergetic X-ray study, the optimal spectral combination was 40/70 kVp filtered with 100 μm cadmium and 1000 μm copper, respectively. In this case, the minimum detectable microcalcification thickness was 150 μm. The proposed dual energy method provides improved microcalcification detectability in breast imaging with mean glandular dose values within acceptable levels.

  9. Dual Energy Method for Breast Imaging: A Simulation Study

    PubMed Central

    2015-01-01

    Dual energy methods can suppress the contrast between adipose and glandular tissues in the breast and therefore enhance the visibility of calcifications. In this study, a dual energy method based on analytical modeling was developed for the detection of minimum microcalcification thickness. To this aim, a modified radiographic X-ray unit was considered, in order to overcome the limited kVp range of mammographic units used in previous DE studies, combined with a high resolution CMOS sensor (pixel size of 22.5 μm) for improved resolution. Various filter materials were examined based on their K-absorption edge. Hydroxyapatite (HAp) was used to simulate microcalcifications. The contrast to noise ratio (CNRtc) of the subtracted images was calculated for both monoenergetic and polyenergetic X-ray beams. The optimum monoenergetic pair was 23/58 keV for the low and high energy, respectively, resulting in a minimum detectable microcalcification thickness of 100 μm. In the polyenergetic X-ray study, the optimal spectral combination was 40/70 kVp filtered with 100 μm cadmium and 1000 μm copper, respectively. In this case, the minimum detectable microcalcification thickness was 150 μm. The proposed dual energy method provides improved microcalcification detectability in breast imaging with mean glandular dose values within acceptable levels. PMID:26246848

  10. Structure based alignment and clustering of proteins (STRALCP)

    DOEpatents

    Zemla, Adam T.; Zhou, Carol E.; Smith, Jason R.; Lam, Marisa W.

    2013-06-18

    Disclosed are computational methods of clustering a set of protein structures based on local and pair-wise global similarity values. Pair-wise local and global similarity values are generated based on pair-wise structural alignments for each protein in the set of protein structures. Initially, the protein structures are clustered based on pair-wise local similarity values. The protein structures are then clustered based on pair-wise global similarity values. For each given cluster both a representative structure and spans of conserved residues are identified. The representative protein structure is used to assign newly-solved protein structures to a group. The spans are used to characterize conservation and assign a "structural footprint" to the cluster.

  11. Sequence dependency of canonical base pair opening in the DNA double helix

    PubMed Central

    Villa, Alessandra

    2017-01-01

    The flipping-out of a DNA base from the double helical structure is a key step of many cellular processes, such as DNA replication, modification and repair. Base pair opening is the first step of base flipping and the exact mechanism is still not well understood. We investigate sequence effects on base pair opening using extensive classical molecular dynamics simulations targeting the opening of 11 different canonical base pairs in two DNA sequences. Two popular biomolecular force fields are applied. To enhance sampling and calculate free energies, we bias the simulation along a simple distance coordinate using a newly developed adaptive sampling algorithm. The simulation is guided back and forth along the coordinate, allowing for multiple opening pathways. We compare the calculated free energies with those from an NMR study and check assumptions of the model used for interpreting the NMR data. Our results further show that the neighboring sequence is an important factor for the opening free energy, but also indicates that other sequence effects may play a role. All base pairs are observed to have a propensity for opening toward the major groove. The preferred opening base is cytosine for GC base pairs, while for AT there is sequence dependent competition between the two bases. For AT opening, we identify two non-canonical base pair interactions contributing to a local minimum in the free energy profile. For both AT and CG we observe long-lived interactions with water and with sodium ions at specific sites on the open base pair. PMID:28369121

  12. Similarity in genetic alterations between paired well-differentiated and dedifferentiated components of dedifferentiated liposarcoma.

    PubMed

    Horvai, Andrew E; DeVries, Sandy; Roy, Ritu; O'Donnell, Richard J; Waldman, Frederic

    2009-11-01

    Liposarcoma represents a unique model insofar as some well-differentiated liposarcomas progress to non-lipogenic, so-called 'dedifferentiated,' forms. The well-differentiated and dedifferentiated family of liposarcomas demonstrates amplification of the chromosome subregion 12q13-q15 with resultant amplification of the MDM2 and CDK4 genes. However, the specific genetic changes that distinguish between well-differentiated and dedifferentiated liposarcomas are less well understood. To study the genetic changes in dedifferentiated liposarcomas, paired well-differentiated and dedifferentiated components of 29 tumors were analyzed separately by array-based comparative genomic hybridization. A bacterial artificial chromosome array at approximately 1-Mb resolution was used. The genetic changes were compared with clinical presentation, grade of the dedifferentiated component and overexpression of MDM2 and CDK4. Most tumors (n=21, 72%) were retroperitoneal, with both components present at initial diagnosis (n=25, 86%). Eight tumors (28%) were classified as low-grade dedifferentiation. In four cases (14%), a well-differentiated liposarcoma preceded the presentation of the dedifferentiated tumor by 1-5 years. 12q13-q15 was amplified in all tumors. Using unsupervised hierarchical clustering of copy-number changes, all but two tumors showed close similarities between well-differentiated and dedifferentiated components, and segregated as pairs. Dedifferentiated components had more total amplifications (P=0.008) and a trend for gain at 19q13.2, but no genetic changes were significant in distinguishing between the two components. High-level amplifications of 1p21-32 (n=7, 24%), 1q21-23 (n=9, 31%), 6q23-24 (n=6, 21%) and 12q24 (n=3, 10%) were common, but none significantly correlated with differentiation. Presentation and grade correlated with the frequency of changes at a number of genetic loci (P<0.001), whereas CDK4 immunostaining showed negative correlation with 12q13.13 amplification. The genotypic similarity, at the limit of the array's resolution, between components implies that most genetic changes precede phenotypic 'progression,' early in tumorigenesis. The relationship between genetic changes and presentation or grade may reflect differences in factors that control genomic instability or the background genotype of the tumor.

  13. High Speed Computational Ghost Imaging via Spatial Sweeping

    NASA Astrophysics Data System (ADS)

    Wang, Yuwang; Liu, Yang; Suo, Jinli; Situ, Guohai; Qiao, Chang; Dai, Qionghai

    2017-03-01

    Computational ghost imaging (CGI) achieves single-pixel imaging by using a Spatial Light Modulator (SLM) to generate structured illuminations for spatially resolved information encoding. The imaging speed of CGI is limited by the modulation frequency of available SLMs, and sets back its practical applications. This paper proposes to bypass this limitation by trading off SLM’s redundant spatial resolution for multiplication of the modulation frequency. Specifically, a pair of galvanic mirrors sweeping across the high resolution SLM multiply the modulation frequency within the spatial resolution gap between SLM and the final reconstruction. A proof-of-principle setup with two middle end galvanic mirrors achieves ghost imaging as fast as 42 Hz at 80 × 80-pixel resolution, 5 times faster than state-of-the-arts, and holds potential for one magnitude further multiplication by hardware upgrading. Our approach brings a significant improvement in the imaging speed of ghost imaging and pushes ghost imaging towards practical applications.

  14. Achieving high-efficiency emission depletion nanoscopy by employing cross relaxation in upconversion nanoparticles.

    PubMed

    Zhan, Qiuqiang; Liu, Haichun; Wang, Baoju; Wu, Qiusheng; Pu, Rui; Zhou, Chao; Huang, Bingru; Peng, Xingyun; Ågren, Hans; He, Sailing

    2017-10-20

    Stimulated emission depletion microscopy provides a powerful sub-diffraction imaging modality for life science studies. Conventionally, stimulated emission depletion requires a relatively high light intensity to obtain an adequate depletion efficiency through only light-matter interaction. Here we show efficient emission depletion for a class of lanthanide-doped upconversion nanoparticles with the assistance of interionic cross relaxation, which significantly lowers the laser intensity requirements of optical depletion. We demonstrate two-color super-resolution imaging using upconversion nanoparticles (resolution ~ 66 nm) with a single pair of excitation/depletion beams. In addition, we show super-resolution imaging of immunostained cytoskeleton structures of fixed cells (resolution ~ 82 nm) using upconversion nanoparticles. These achievements provide a new perspective for the development of photoswitchable luminescent probes and will broaden the applications of lanthanide-doped nanoparticles for sub-diffraction microscopic imaging.

  15. Note: Tandem Kirkpatrick-Baez microscope with sixteen channels for high-resolution laser-plasma diagnostics

    NASA Astrophysics Data System (ADS)

    Yi, Shengzhen; Zhang, Zhe; Huang, Qiushi; Zhang, Zhong; Wang, Zhanshan; Wei, Lai; Liu, Dongxiao; Cao, Leifeng; Gu, Yuqiu

    2018-03-01

    Multi-channel Kirkpatrick-Baez (KB) microscopes, which have better resolution and collection efficiency than pinhole cameras, have been widely used in laser inertial confinement fusion to diagnose time evolution of the target implosion. In this study, a tandem multi-channel KB microscope was developed to have sixteen imaging channels with the precise control of spatial resolution and image intervals. This precise control was created using a coarse assembly of mirror pairs with high-accuracy optical prisms, followed by precise adjustment in real-time x-ray imaging experiments. The multilayers coated on the KB mirrors were designed to have substantially the same reflectivity to obtain a uniform brightness of different images for laser-plasma temperature analysis. The study provides a practicable method to achieve the optimum performance of the microscope for future high-resolution applications in inertial confinement fusion experiments.

  16. Theoretical study on the binding mechanism between N6-methyladenine and natural DNA bases.

    PubMed

    Song, Qi-Xia; Ding, Zhen-Dong; Liu, Jian-Hua; Li, Yan; Wang, Hai-Jun

    2013-03-01

    N6-methyladenine (m(6)A) is a rare base naturally occurring in DNA. It is different from the base adenine due to its N-CH(3). Therefore, the base not only pairs with thymine, but also with other DNA bases (cytosine, adenine and guanine). In this work, Møller-Plesset second-order (MP2) method has been used to investigate the binding mechanism between m(6)A and natural DNA bases in gas phase and in aqueous solution. The results show that N-CH(3) changed the way of N6-methyladenine binding to natural DNA bases. The binding style significantly influences the stability of base pairs. The trans-m(6)A:G and trans-m(6)A:C conformers are the most stable among all the base pairs. The existence of solvent can remarkably reduce the stability of the base pairs, and the DNA bases prefer pairing with trans-m(6)A to cis-m(6)A. Besides, the properties of these hydrogen bonds have been analyzed by atom in molecules (AIM) theory, natural bond orbital (NBO) analysis and Wiberg bond indexes (WBI). In addition, pairing with m(6)A decreases the binding energies compared to the normal Watson-Crick base pairs, it may explain the instability of the N6 site methylated DNA in theory.

  17. Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs.

    PubMed

    McCoy, A B; Wright, A; Krousel-Wood, M; Thomas, E J; McCoy, J A; Sittig, D F

    2015-01-01

    Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes.

  18. Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs

    PubMed Central

    Wright, A.; Krousel-Wood, M.; Thomas, E. J.; McCoy, J. A.; Sittig, D. F.

    2015-01-01

    Summary Background Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. Objective We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. Methods We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. Results The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. Conclusions We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes. PMID:26171079

  19. A Transportable Gravity Gradiometer Based on Atom Interferometry

    NASA Technical Reports Server (NTRS)

    Yu, Nan; Thompson, Robert J.; Kellogg, James R.; Aveline, David C.; Maleki, Lute; Kohel, James M.

    2010-01-01

    A transportable atom interferometer-based gravity gradiometer has been developed at JPL to carry out measurements of Earth's gravity field at ever finer spatial resolutions, and to facilitate high-resolution monitoring of temporal variations in the gravity field from ground- and flight-based platforms. Existing satellite-based gravity missions such as CHAMP and GRACE measure the gravity field via precise monitoring of the motion of the satellites; i.e. the satellites themselves function as test masses. JPL's quantum gravity gradiometer employs a quantum phase measurement technique, similar to that employed in atomic clocks, made possible by recent advances in laser cooling and manipulation of atoms. This measurement technique is based on atomwave interferometry, and individual laser-cooled atoms are used as drag-free test masses. The quantum gravity gradiometer employs two identical atom interferometers as precision accelerometers to measure the difference in gravitational acceleration between two points (Figure 1). By using the same lasers for the manipulation of atoms in both interferometers, the accelerometers have a common reference frame and non-inertial accelerations are effectively rejected as common mode noise in the differential measurement of the gravity gradient. As a result, the dual atom interferometer-based gravity gradiometer allows gravity measurements on a moving platform, while achieving the same long-term stability of the best atomic clocks. In the laboratory-based prototype (Figure 2), the cesium atoms used in each atom interferometer are initially collected and cooled in two separate magneto-optic traps (MOTs). Each MOT, consisting of three orthogonal pairs of counter-propagating laser beams centered on a quadrupole magnetic field, collects up to 10(exp 9) atoms. These atoms are then launched vertically as in an atom fountain by switching off the magnetic field and introducing a slight frequency shift between pairs of lasers to create a moving rest frame for the trapped atoms. While still in this moving-frame molasses, the laser frequencies are further detuned from the atomic resonance (while maintaining this relative frequency shift) to cool the atom cloud's temperature to 2 K or below, corresponding to an rms velocity of less than 2 cm/s. After launch, the cold atoms undergo further state and velocity selection to prepare for atom interferometry. The atom interferometers are then realized using laser-induced stimulated Raman transitions to perform the necessary manipulations of each atom, and the resulting interferometer phase is measured using laser-induced fluorescence for state-normalized detection. More than 20 laser beams with independent controls of frequency, phase, and intensity are required for this measurement sequence. This instrument can facilitate the study of Earth's gravitational field from surface and air vehicles, as well as from space by allowing gravity mapping from a low-cost, single spacecraft mission. In addition, the operation of atom interferometer-based instruments in space offers greater sensitivity than is possible in terrestrial instruments due to the much longer interrogation times available in the microgravity environment. A space-based quantum gravity gradiometer has the potential to achieve sensitivities similar to the GRACE mission at long spatial wavelengths, and will also have resolution similar to GOCE for measurement at shorter length scales.

  20. MIXI: Mobile Intelligent X-Ray Inspection System

    NASA Astrophysics Data System (ADS)

    Arodzero, Anatoli; Boucher, Salime; Kutsaev, Sergey V.; Ziskin, Vitaliy

    2017-07-01

    A novel, low-dose Mobile Intelligent X-ray Inspection (MIXI) concept is being developed at RadiaBeam Technologies. The MIXI concept relies on a linac-based, adaptive, ramped energy source of short X-ray packets of pulses, a new type of fast X-ray detector, rapid processing of detector signals for intelligent control of the linac, and advanced radiography image processing. The key parameters for this system include: better than 3 mm line pair resolution; penetration greater than 320 mm of steel equivalent; scan speed with 100% image sampling rate of up to 15 km/h; and material discrimination over a range of thicknesses up to 200 mm of steel equivalent. Its minimal radiation dose, size and weight allow MIXI to be placed on a lightweight truck chassis.

  1. Independent transmission of sign language interpreter in DVB: assessment of image compression

    NASA Astrophysics Data System (ADS)

    Zatloukal, Petr; Bernas, Martin; Dvořák, LukáÅ.¡

    2015-02-01

    Sign language on television provides information to deaf that they cannot get from the audio content. If we consider the transmission of the sign language interpreter over an independent data stream, the aim is to ensure sufficient intelligibility and subjective image quality of the interpreter with minimum bit rate. The work deals with the ROI-based video compression of Czech sign language interpreter implemented to the x264 open source library. The results of this approach are verified in subjective tests with the deaf. They examine the intelligibility of sign language expressions containing minimal pairs for different levels of compression and various resolution of image with interpreter and evaluate the subjective quality of the final image for a good viewing experience.

  2. Implementation of a multichannel soft x-ray diagnostic for electron temperature measurements in TJ-II high-density plasmas

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Baiao, D.; Varandas, C.; Medina, F.

    2012-10-15

    Based on the multi-foil technique, a multichannel soft x-ray diagnostic for electron temperature measurements has been recently implemented in the TJ-II stellarator. The diagnostic system is composed by four photodiodes arrays with beryllium filters of different thickness. An in-vacuum amplifier board is coupled to each array, aiming at preventing induced noise currents. The Thomson scattering and the vacuum ultraviolet survey diagnostics are used for assessing plasma profiles and composition, being the analysis carried out with the radiation code IONEQ. The electron temperature is determined through the different signal-pair ratios with temporal and spatial resolution. The design and preliminary results frommore » the diagnostic are presented.« less

  3. Correction of amplitude-phase distortion for polarimetric active radar calibrator

    NASA Astrophysics Data System (ADS)

    Lin, Jianzhi; Li, Weixing; Zhang, Yue; Chen, Zengping

    2015-01-01

    The polarimetric active radar calibrator (PARC) is extensively used as an external test target for system distortion compensation and polarimetric calibration for the high-resolution polarimetric radar. However, the signal undergoes distortion in the PARC, affecting the effectiveness of the compensation and the calibration. The system distortion compensation resulting from the distortion of the amplitude and phase in the PARC was analyzed based on the "method of paired echoes." Then the correction method was proposed, which separated the ideal signals from the distorted signals. Experiments were carried on real radar data, and the experimental results were in good agreement with the theoretical analysis. After the correction, the PARC can be better used as an external test target for the system distortion compensation.

  4. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

    PubMed

    Kondo, Jiro; Westhof, Eric

    2011-10-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  5. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes

    PubMed Central

    Kondo, Jiro; Westhof, Eric

    2011-01-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

  6. The analysis of GEOS-3 altimeter data in the Tasman and Coral seas

    NASA Technical Reports Server (NTRS)

    Mather, R. S.

    1977-01-01

    A technique was developed for preprocessing GEOS-3 altimetry data to establish a model of the regional sea surface. The algorithms developed models for a 35,000,000 sq km area with an internal precision of + or - 1 m. There were discrepancies between the sea surface model so obtained and GEM6 based geoid profiles with wavelengths of approximately 2500 km and amplitudes of up to 5 m in this region. The amplitudes were smaller when compared with GEM10-based geoid determinations. However, the comparison of 14 pairs of overlapping passes in the region indicated altimeter resolution of the + or - 25 cm level if the wavelength corresponding to the Nyquist frequency were 30 km. The spectral analysis of such comparisons indicated the existence of significant signal strength in the discrepancies after least squares fitting, with wavelengths in excess of 200 km.

  7. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xia, Shuangluo; Konigsberg, William H.; Wang, Jimin

    Results obtained using 2,4-difluorotoluene nucleobase (dF) as a nonpolar thymine isostere by Kool and colleagues challenged the Watson-Crick dogma that hydrogen bonds between complementary bases are an absolute requirement for accurate DNA replication. Here, we report crystal structure of an RB69 DNA polymerase L561A/S565G/Y567A triple mutant ternary complex with a templating dF opposite dTTP at 1.8 {angstrom}-resolution. In this structure, direct hydrogen bonds were observed between: (i) dF and the incoming dTTP, (ii) dF and residue G568 of the polymerase, and (iii) dF and ordered water molecules surrounding the nascent base pair. Therefore, this structure provides evidence that a templatingmore » dF can form novel hydrogen bonds with the incoming dTTP and with the enzyme that differ from those formed with a templating dT.« less

  8. Urban Change Detection of Pingtan City based on Bi-temporal Remote Sensing Images

    NASA Astrophysics Data System (ADS)

    Degang, JIANG; Jinyan, XU; Yikang, GAO

    2017-02-01

    In this paper, a pair of SPOT 5-6 images with the resolution of 0.5m is selected. An object-oriented classification method is used to the two images and five classes of ground features were identified as man-made objects, farmland, forest, waterbody and unutilized land. An auxiliary ASTER GDEM was used to improve the classification accuracy. And the change detection based on the classification results was performed. Accuracy assessment was carried out finally. Consequently, satisfactory results were obtained. The results show that great changes of the Pingtan city have been detected as the expansion of the city area and the intensity increase of man-made buildings, roads and other infrastructures with the establishment of Pingtan comprehensive experimental zone. Wide range of open sea area along the island coast zones has been reclaimed for port and CBDs construction.

  9. A multiplexable TALE-based binary expression system for in vivo cellular interaction studies.

    PubMed

    Toegel, Markus; Azzam, Ghows; Lee, Eunice Y; Knapp, David J H F; Tan, Ying; Fa, Ming; Fulga, Tudor A

    2017-11-21

    Binary expression systems have revolutionised genetic research by enabling delivery of loss-of-function and gain-of-function transgenes with precise spatial-temporal resolution in vivo. However, at present, each existing platform relies on a defined exogenous transcription activator capable of binding a unique recognition sequence. Consequently, none of these technologies alone can be used to simultaneously target different tissues or cell types in the same organism. Here, we report a modular system based on programmable transcription activator-like effector (TALE) proteins, which enables parallel expression of multiple transgenes in spatially distinct tissues in vivo. Using endogenous enhancers coupled to TALE drivers, we demonstrate multiplexed orthogonal activation of several transgenes carrying cognate variable activating sequences (VAS) in distinct neighbouring cell types of the Drosophila central nervous system. Since the number of combinatorial TALE-VAS pairs is virtually unlimited, this platform provides an experimental framework for highly complex genetic manipulation studies in vivo.

  10. Insights into finding a mismatch through the structure of a mispaired DNA bound by a rhodium intercalator

    PubMed Central

    Pierre, Valérie C.; Kaiser, Jens T.; Barton, Jacqueline K.

    2007-01-01

    We report the 1.1-Å resolution crystal structure of a bulky rhodium complex bound to two different DNA sites, mismatched and matched in the oligonucleotide 5′-(dCGGAAATTCCCG)2-3′. At the AC mismatch site, the structure reveals ligand insertion from the minor groove with ejection of both mismatched bases and elucidates how destabilized mispairs in DNA may be recognized. This unique binding mode contrasts with major groove intercalation, observed at a matched site, where doubling of the base pair rise accommodates stacking of the intercalator. Mass spectral analysis reveals different photocleavage products associated with the two binding modes in the crystal, with only products characteristic of mismatch binding in solution. This structure, illustrating two clearly distinct binding modes for a molecule with DNA, provides a rationale for the interrogation and detection of mismatches. PMID:17194756

  11. Characterization of chiral amino acids from different milk origins using ultra-performance liquid chromatography coupled to ion-mobility mass spectrometry

    NASA Astrophysics Data System (ADS)

    Tian, He; Zheng, Nan; Li, Songli; Zhang, Yangdong; Zhao, Shengguo; Wen, Fang; Wang, Jiaqi

    2017-04-01

    Milk contains free amino acids (AAs) that play essential roles in maintaining the growth and health of infants, and D-AA isomers are increasingly being recognized as important signalling molecules. However, there are no studies of the different characteristics of chiral AA (C-AA) from different milk origins. Here, UPLC coupled to ion-mobility high-resolution MS (IM-HRMS) was employed to characterize 18 pairs of C-AAs in human, cow, yak, buffalo, goat, and camel milk. The results proved that milk origins can be differentiated based on the D- to L- AA ratio-based projection scores by principal component analysis. The present study gives a deeper understanding of the D- to L- AA ratio underlying the biological functions of different animal milks, and provide a new strategy for the study of AA metabolic pathways.

  12. Impact of positional difference on the measurement of breast density using MRI.

    PubMed

    Chen, Jeon-Hor; Chan, Siwa; Tang, Yi-Ting; Hon, Jia Shen; Tseng, Po-Chuan; Cheriyan, Angela T; Shah, Nikita Rakesh; Yeh, Dah-Cherng; Lee, San-Kan; Chen, Wen-Pin; McLaren, Christine E; Su, Min-Ying

    2015-05-01

    This study investigated the impact of arms/hands and body position on the measurement of breast density using MRI. Noncontrast-enhanced T1-weighted images were acquired from 32 healthy women. Each subject received four MR scans using different experimental settings, including a high resolution hands-up, a low resolution hands-up, a high resolution hands-down, and finally, another high resolution hands-up after repositioning. The breast segmentation was performed using a fully automatic chest template-based method. The breast volume (BV), fibroglandular tissue volume (FV), and percent density (PD) measured from the four MR scan settings were analyzed. A high correlation of BV, FV, and PD between any pair of the four MR scans was noted (r > 0.98 for all). Using the generalized estimating equation method, a statistically significant difference in mean BV among four settings was noted (left breast, score test p = 0.0056; right breast, score test p = 0.0016), adjusted for age and body mass index. Despite differences in BV, there were no statistically significant differences in the mean PDs among the four settings (p > 0.10 for left and right breasts). Using Bland-Altman plots, the smallest mean difference/bias and standard deviations for BV, FV, and PD were noted when comparing hands-up high vs low resolution when the breast positions were exactly the same. The authors' study showed that BV, FV, and PD measurements from MRI of different positions were highly correlated. BV may vary with positions but the measured PD did not differ significantly between positions. The study suggested that the percent density analyzed from MRI studies acquired using different arms/hands and body positions from multiple centers can be combined for analysis.

  13. Collimator optimization in myocardial perfusion SPECT using the ideal observer and realistic background variability for lesion detection and joint detection and localization tasks

    NASA Astrophysics Data System (ADS)

    Ghaly, Michael; Du, Yong; Links, Jonathan M.; Frey, Eric C.

    2016-03-01

    In SPECT imaging, collimators are a major factor limiting image quality and largely determine the noise and resolution of SPECT images. In this paper, we seek the collimator with the optimal tradeoff between image noise and resolution with respect to performance on two tasks related to myocardial perfusion SPECT: perfusion defect detection and joint detection and localization. We used the Ideal Observer (IO) operating on realistic background-known-statistically (BKS) and signal-known-exactly (SKE) data. The areas under the receiver operating characteristic (ROC) and localization ROC (LROC) curves (AUCd, AUCd+l), respectively, were used as the figures of merit for both tasks. We used a previously developed population of 54 phantoms based on the eXtended Cardiac Torso Phantom (XCAT) that included variations in gender, body size, heart size and subcutaneous adipose tissue level. For each phantom, organ uptakes were varied randomly based on distributions observed in patient data. We simulated perfusion defects at six different locations with extents and severities of 10% and 25%, respectively, which represented challenging but clinically relevant defects. The extent and severity are, respectively, the perfusion defect’s fraction of the myocardial volume and reduction of uptake relative to the normal myocardium. Projection data were generated using an analytical projector that modeled attenuation, scatter, and collimator-detector response effects, a 9% energy resolution at 140 keV, and a 4 mm full-width at half maximum (FWHM) intrinsic spatial resolution. We investigated a family of eight parallel-hole collimators that spanned a large range of sensitivity-resolution tradeoffs. For each collimator and defect location, the IO test statistics were computed using a Markov Chain Monte Carlo (MCMC) method for an ensemble of 540 pairs of defect-present and -absent images that included the aforementioned anatomical and uptake variability. Sets of test statistics were computed for both tasks and analyzed using ROC and LROC analysis methodologies. The results of this study suggest that collimators with somewhat poorer resolution and higher sensitivity than those of a typical low-energy high-resolution (LEHR) collimator were optimal for both defect detection and joint detection and localization tasks in myocardial perfusion SPECT for the range of defect sizes investigated. This study also indicates that optimizing instrumentation for a detection task may provide near-optimal performance on the more challenging detection-localization task.

  14. SIMBIO-SYS for BepiColombo: status and issues.

    NASA Astrophysics Data System (ADS)

    Flamini, E.; Capaccioni, F.; Cremonese, G.; Palumbo, P.; Formaro, R.; Mugnuolo, R.; Debei, S.; Ficai Veltroni, I.; Dami, M.; Tommasi, L.; SIMBIO-SYS Team

    The SIMBIO-SYS (Spectrometer and Imaging for MPO BepiColombo Integrated Observatory SYStem) is a complex instrument suite part of the scientific payload of the Mercury Planetary Orbiter for the BepiColombo mission, the last of the cornerstone missions of the European Space Agency (ESA) Horizon+ science program. The BepiColombo mission is compose by two scientific satellites on, Mercury Magnetic Orbiter-MMO, realized by the Japanese Space Agency JAXA, devoted to the study of the planet environment and the other, the Mercury Planetary Orbiter realized by ESA, devoted to the detailed study of the Hermean surface and interior. The SIMBIOSYS instrument will provide all the science imaging capability of the Bepicolombo MPO spacecraft. It consists of three channels: the STereo imaging Channel (STC), with broad spectral band in the 400-950 nm range and medium spatial resolution (up to 50 m/px), that will provide Digital Terrain Model of the entire surface of the planet with an accuracy better than 80 m; the High Resolution Imaging Channel HRIC), with broad spectral bands in the 400-900 nm range and high spatial resolution (up to 5 m/px), that will provide high resolution images of about 20% of the surface, and the Visible and near-Infrared Hyperspectral Imaging channel (VIHI), with high spectral resolution (up to 6 nm) in the 400-2000 nm range and spatial resolution up to 100 m/px, it will provide the global covergae at 400 m/px with the spectral information. SIMBIO-SYS will provide unprecedented high-resolution images, the Digital Terrain Model of the entire surface, and the surface composition in wide spectral range, at resolutions and coverage higher than the MESSENGER mission with a full co-alignememt of the three channels. The main scientific objectives can be summarized as follows: Definition of the impact flux in the inner Solar System: based on the impact crater population records Understanding of the accretional model of an end member of the Solar System: based on the type and distribution of mineral species Reconstruction of the surface geology and stratigraphic history: based on the combination of stereo and high- resolution imaging along with compositional information coming from the spectrometer Relative surface age by impact craters population density and distribution: based on the global imaging including the high-resolution mode Surface degradation processes and global resurfacing: derived from the erosional status of the impact crater and ejecta Identification of volcanic landforms and style: using the morphological and compositional information Crustal dynamics and mechanical properties of the lithosphere: based on the identification and classification of tectonic structures from visible images and detailed DTM Surface composition and crustal differentiation: based on the identification and distribution of mineral species as seen by the NIR hyperspectral imager Soil maturity and alteration processes: based on the measure of the spectral slope derived by the hyperspectral imager and the colour capabilities of the stereo camera Determination of moment of inertia of the planet: the high-resolution imaging channel as landmark pairs of surface features that can be observed on the periside as support for the libration experiment Surface-Atmosphere interaction processes and origin of the exosphere: knowledge of the surface composition is also crucial to unambiguously identify the source minerals for each of the constituents of the Mercury.s exosphere The instrument has been realized by Selex-ES under the contract and management of the Italian Space Agency (ASI) that have signed an MoU with CNES for the development of VIHI Proximity Electronics, the Main Electronics, and the instrument final calibration . All the realization and calibration has been carried on under the scientific supervision of the SIMBIO-SYS science team SIMBIOSYS has been delivered to ESA on April 2015 for the final integration on the BepiColombo MPO spacecraft.

  15. Closing loop base pairs in RNA loop-loop complexes: structural behavior, interaction energy and solvation analysis through molecular dynamics simulations.

    PubMed

    Golebiowski, Jérôme; Antonczak, Serge; Fernandez-Carmona, Juan; Condom, Roger; Cabrol-Bass, Daniel

    2004-12-01

    Nanosecond molecular dynamics using the Ewald summation method have been performed to elucidate the structural and energetic role of the closing base pair in loop-loop RNA duplexes neutralized by Mg2+ counterions in aqueous phases. Mismatches GA, CU and Watson-Crick GC base pairs have been considered for closing the loop of an RNA in complementary interaction with HIV-1 TAR. The simulations reveal that the mismatch GA base, mediated by a water molecule, leads to a complex that presents the best compromise between flexibility and energetic contributions. The mismatch CU base pair, in spite of the presence of an inserted water molecule, is too short to achieve a tight interaction at the closing-loop junction and seems to force TAR to reorganize upon binding. An energetic analysis has allowed us to quantify the strength of the interactions of the closing and the loop-loop pairs throughout the simulations. Although the water-mediated GA closing base pair presents an interaction energy similar to that found on fully geometry-optimized structure, the water-mediated CU closing base pair energy interaction reaches less than half the optimal value.

  16. The mosaics of Mars: As seen by the Viking Lander cameras

    NASA Technical Reports Server (NTRS)

    Levinthal, E. C.; Jones, K. L.

    1980-01-01

    The mosaics and derivative products produced from many individual high resolution images acquired by the Viking Lander Camera Systems are described: A morning and afternoon mosaic for both cameras at the Lander 1 Chryse Planitia site, and a morning, noon, and afternoon camera pair at Utopia Planitia, the Lander 11 site. The derived products include special geometric projections of the mosaic data sets, polar stereographic (donut), stereoscopic, and orthographic. Contour maps and vertical profiles of the topography were overlaid on the mosaics from which they were derived. Sets of stereo pairs were extracted and enlarged from stereoscopic projections of the mosaics.

  17. Molecular mechanisms of ribosomal protein gene coregulation

    PubMed Central

    Reja, Rohit; Vinayachandran, Vinesh; Ghosh, Sujana; Pugh, B. Franklin

    2015-01-01

    The 137 ribosomal protein genes (RPGs) of Saccharomyces provide a model for gene coregulation. We examined the positional and functional organization of their regulators (Rap1 [repressor activator protein 1], Fhl1, Ifh1, Sfp1, and Hmo1), the transcription machinery (TFIIB, TFIID, and RNA polymerase II), and chromatin at near-base-pair resolution using ChIP-exo, as RPGs are coordinately reprogrammed. Where Hmo1 is enriched, Fhl1, Ifh1, Sfp1, and Hmo1 cross-linked broadly to promoter DNA in an RPG-specific manner and demarcated by general minor groove widening. Importantly, Hmo1 extended 20–50 base pairs (bp) downstream from Fhl1. Upon RPG repression, Fhl1 remained in place. Hmo1 dissociated, which was coupled to an upstream shift of the +1 nucleosome, as reflected by the Hmo1 extension and core promoter region. Fhl1 and Hmo1 may create two regulatable and positionally distinct barriers, against which chromatin remodelers position the +1 nucleosome into either an activating or a repressive state. Consistent with in vitro studies, we found that specific TFIID subunits, in addition to cross-linking at the core promoter, made precise cross-links at Rap1 sites, which we interpret to reflect native Rap1–TFIID interactions. Our findings suggest how sequence-specific DNA binding regulates nucleosome positioning and transcription complex assembly >300 bp away and how coregulation coevolved with coding sequences. PMID:26385964

  18. Two-dimensional IR spectroscopy of the anti-HIV agent KP1212 reveals protonated and neutral tautomers that influence pH-dependent mutagenicity.

    PubMed

    Peng, Chunte Sam; Fedeles, Bogdan I; Singh, Vipender; Li, Deyu; Amariuta, Tiffany; Essigmann, John M; Tokmakoff, Andrei

    2015-03-17

    Antiviral drugs designed to accelerate viral mutation rates can drive a viral population to extinction in a process called lethal mutagenesis. One such molecule is 5,6-dihydro-5-aza-2'-deoxycytidine (KP1212), a selective mutagen that induces A-to-G and G-to-A mutations in the genome of replicating HIV. The mutagenic property of KP1212 was hypothesized to originate from its amino-imino tautomerism, which would explain its ability to base pair with either G or A. To test the multiple tautomer hypothesis, we used 2D IR spectroscopy, which offers subpicosecond time resolution and structural sensitivity to distinguish among rapidly interconverting tautomers. We identified several KP1212 tautomers and found that >60% of neutral KP1212 is present in the enol-imino form. The abundant proportion of this traditionally rare tautomer offers a compelling structure-based mechanism for pairing with adenine. Additionally, the pKa of KP1212 was measured to be 7.0, meaning a substantial population of KP1212 is protonated at physiological pH. Furthermore, the mutagenicity of KP1212 was found to increase dramatically at pH <7, suggesting a significant biological role for the protonated KP1212 molecules. Overall, our data reveal that the bimodal mutagenic properties of KP1212 result from its unique shape shifting ability that utilizes both tautomerization and protonation.

  19. Identifying N6-methyladenosine sites using multi-interval nucleotide pair position specificity and support vector machine

    NASA Astrophysics Data System (ADS)

    Xing, Pengwei; Su, Ran; Guo, Fei; Wei, Leyi

    2017-04-01

    N6-methyladenosine (m6A) refers to methylation of the adenosine nucleotide acid at the nitrogen-6 position. It plays an important role in a series of biological processes, such as splicing events, mRNA exporting, nascent mRNA synthesis, nuclear translocation and translation process. Numerous experiments have been done to successfully characterize m6A sites within sequences since high-resolution mapping of m6A sites was established. However, as the explosive growth of genomic sequences, using experimental methods to identify m6A sites are time-consuming and expensive. Thus, it is highly desirable to develop fast and accurate computational identification methods. In this study, we propose a sequence-based predictor called RAM-NPPS for identifying m6A sites within RNA sequences, in which we present a novel feature representation algorithm based on multi-interval nucleotide pair position specificity, and use support vector machine classifier to construct the prediction model. Comparison results show that our proposed method outperforms the state-of-the-art predictors on three benchmark datasets across the three species, indicating the effectiveness and robustness of our method. Moreover, an online webserver implementing the proposed predictor has been established at http://server.malab.cn/RAM-NPPS/. It is anticipated to be a useful prediction tool to assist biologists to reveal the mechanisms of m6A site functions.

  20. Amino acid ionic liquids as chiral ligands in ligand-exchange chiral separations.

    PubMed

    Liu, Qian; Wu, Kangkang; Tang, Fei; Yao, Lihua; Yang, Fei; Nie, Zhou; Yao, Shouzhuo

    2009-09-28

    Recently, amino acid ionic liquids (AAILs) have attracted much research interest. In this paper, we present the first application of AAILs in chiral separation based on the chiral ligand exchange principle. By using 1-alkyl-3-methylimidazolium L-proline (L-Pro) as a chiral ligand coordinated with copper(II), four pairs of underivatized amino acid enantiomers-dl-phenylalanine (dl-Phe), dl-histidine (dl-His), dl-tryptophane (dl-Trp), and dl-tyrosine (dl-Tyr)-were successfully separated in two major chiral separation techniques, HPLC and capillary electrophoresis (CE), with higher enantioselectivity than conventionally used amino acid ligands (resolution (R(s))=3.26-10.81 for HPLC; R(s)=1.34-4.27 for CE). Interestingly, increasing the alkyl chain length of the AAIL cation remarkably enhanced the enantioselectivity. It was inferred that the alkylmethylimidazolium cations and L-Pro form ion pairs on the surface of the stationary phase or on the inner surface of the capillary. The ternary copper complexes with L-Pro are consequently attached to the support surface, thus inducing an ion-exchange type of retention for the dl-enantiomers. Therefore, the AAIL cation plays an essential role in the separation. This work demonstrates that AAILs are good alternatives to conventional amino acid ligands for ligand-exchange-based chiral separation. It also reveals the tremendous application potential of this new type of task-specific ILs.

  1. On the use of electrical and optical strain gauges paired to magnetostrictive patch actuators

    NASA Astrophysics Data System (ADS)

    Braghin, Francesco; Cinquemani, Simone; Cazzulani, Gabriele; Comolli, Lorenzo

    2014-04-01

    Giant Magnetostrictive Actuators (GMA) can be profitably used in application of vibration control on smart structures. In this field, the use of inertial actuators based on magnetostrictive materials has been consolidate. Such devices turn out to be very effective in applications of vibration control, since they can be easily paired with sensors able to ensure the feedback signal necessary to perform the control action. Unlike most widespread applications, this paper studies the use of patch magnetostrictive actuators. They are made of a sheet of magnetostrictive material, rigidly constrained to the structure, and wrapped in a solenoid whose purpose is to change the intensity of the magnetic field within the material itself. The challenge in the use of such devices resides in the impossibility of having co-located sensors. This limit may be exceeded by using strain gauge sensors to measure the deformation of the structure at the actuator. This work analyzes experimentally the opportunity of introducing, inside a composite material structure, both the conventional electric strain gauges and the less conventional optical sensors based on Bragg's gratings. The performance of both solutions are analyzed with particular reference to the signal to noise ratio, the resolution of the sensors, the sensitivity to variations of the electric and magnetic fields and the temperature change associated with the operation of the actuator.

  2. GOME Total Ozone and Calibration Error Derived Usign Version 8 TOMS Algorithm

    NASA Technical Reports Server (NTRS)

    Gleason, J.; Wellemeyer, C.; Qin, W.; Ahn, C.; Gopalan, A.; Bhartia, P.

    2003-01-01

    The Global Ozone Monitoring Experiment (GOME) is a hyper-spectral satellite instrument measuring the ultraviolet backscatter at relatively high spectral resolution. GOME radiances have been slit averaged to emulate measurements of the Total Ozone Mapping Spectrometer (TOMS) made at discrete wavelengths and processed using the new TOMS Version 8 Ozone Algorithm. Compared to Differential Optical Absorption Spectroscopy (DOAS) techniques based on local structure in the Huggins Bands, the TOMS uses differential absorption between a pair of wavelengths including the local stiucture as well as the background continuum. This makes the TOMS Algorithm more sensitive to ozone, but it also makes the algorithm more sensitive to instrument calibration errors. While calibration adjustments are not needed for the fitting techniques like the DOAS employed in GOME algorithms, some adjustment is necessary when applying the TOMS Algorithm to GOME. Using spectral discrimination at near ultraviolet wavelength channels unabsorbed by ozone, the GOME wavelength dependent calibration drift is estimated and then checked using pair justification. In addition, the day one calibration offset is estimated based on the residuals of the Version 8 TOMS Algorithm. The estimated drift in the 2b detector of GOME is small through the first four years and then increases rapidly to +5% in normalized radiance at 331 nm relative to 385 nm by mid 2000. The lb detector appears to be quite well behaved throughout this time period.

  3. Electrophysiological correlates of implicit valenced self-processing in high vs. low self-esteem individuals.

    PubMed

    Grundy, John G; Benarroch, Miriam F F; Lebarr, A Nicole; Shedden, Judith M

    2015-01-01

    We provide the first high-temporal resolution account of the self-esteem implicit association test (IAT; Greenwald & Farnham, 2000) to highlight important similarities and differences between the cognitive processes corresponding to implicit valenced self-processing in high vs. low self-esteem individuals. We divided individuals into high and low self-esteem groups based on the Rosenberg self-esteem scale (Rosenberg, 1965) and administered the self-esteem IAT while recording electroencephalographic data. We show that the P2 captured group (high vs. low self-esteem) differences, the N250 and the late parietal positivity (LPP) captured differences corresponding to category pairing (self/positive vs. self/negative pairing), and the N1, P2, and P300-400 components captured interactions between self-esteem groups and whether the self was paired with positive or negative categories in the IAT. Overall, both high and low self-esteem groups were sensitive to the distinction between positive and negative information in relation to the self (me/negative generally displayed larger event-related potential amplitudes than me/positive), but for high self-esteem individuals, this difference was generally larger, earlier, and most pronounced over left-hemisphere electrodes. These electrophysiological differences may reflect differences in attentional resources devoted to teasing apart these two oppositely valenced associations. High self-esteem individuals appear to devote more automatic (early) attentional resources to strengthen the distinction between positively or negatively valenced information in relation to the self.

  4. Fast Radio Bursts and Radio Transients from Black Hole Batteries

    NASA Astrophysics Data System (ADS)

    Mingarelli, Chiara M. F.; Levin, Janna; Lazio, T. Joseph W.

    2015-12-01

    Most black holes (BHs) will absorb a neutron star (NS) companion fully intact without tidal disruption, suggesting the pair will remain dark to telescopes. Even without tidal disruption, electromagnetic (EM) luminosity is generated from the battery phase of the binary when the BH interacts with the NS magnetic field. Originally, the luminosity was expected to be in high-energy X-rays or gamma-rays, however, we conjecture that some of the battery power is emitted in the radio bandwidth. While the luminosity and timescale are suggestive of fast radio bursts (FRBs; millisecond-scale radio transients) NS-BH coalescence rates are too low to make these a primary FRB source. Instead, we propose that the transients form a FRB sub-population, distinguishable by a double peak with a precursor. The rapid ramp-up in luminosity manifests as a precursor to the burst which is 20%-80% as luminous given 0.5 ms timing resolution. The main burst arises from the peak luminosity before the merger. The post-merger burst follows from the NS magnetic field migration to the BH, causing a shock. NS-BH pairs are especially desirable for ground-based gravitational wave (GW) observatories since the pair might not otherwise be detected, with EM counterparts greatly augmenting the scientific leverage beyond the GW signal. The EM signal’s ability to break degeneracies in the parameters encoded in the GW and probe the NS magnetic field strength is quite valuable, yielding insights into open problems in NS magnetic field decay.

  5. Changes in liver stiffness measurement using acoustic radiation force impulse elastography after antiviral therapy in patients with chronic hepatitis C.

    PubMed

    Chen, Sheng-Hung; Lai, Hsueh-Chou; Chiang, I-Ping; Su, Wen-Pang; Lin, Chia-Hsin; Kao, Jung-Ta; Chuang, Po-Heng; Hsu, Wei-Fan; Wang, Hung-Wei; Chen, Hung-Yao; Huang, Guan-Tarn; Peng, Cheng-Yuan

    2018-01-01

    To compare on-treatment and off-treatment parameters acquired using acoustic radiation force impulse elastography, the Fibrosis-4 (FIB-4) index, and aspartate aminotransferase-to-platelet ratio index (APRI) in patients with chronic hepatitis C (CHC). Patients received therapies based on pegylated interferon or direct-acting antiviral agents. The changes in paired patient parameters, including liver stiffness (LS) values, the FIB-4 index, and APRI, from baseline to sustained virologic response (SVR) visit (24 weeks after the end of treatment) were compared. Multiple regression models were used to identify significant factors that explained the correlations with LS, FIB-4, and APRI values and SVR. A total of 256 patients were included, of which 219 (85.5%) achieved SVR. The paired LS values declined significantly from baseline to SVR visit in all groups and subgroups except the nonresponder subgroup (n = 10). Body mass index (P = 0.0062) and baseline LS (P < 0.0001) were identified as independent factors that explained the LS declines. Likewise, the baseline FIB-4 (P < 0.0001) and APRI (P < 0.0001) values independently explained the declines in the FIB-4 index and APRI, respectively. Moreover, interleukin-28B polymorphisms, baseline LS, and rapid virologic response were identified as independent correlates with SVR. Paired LS measurements in patients treated for CHC exhibited significant declines comparable to those in FIB-4 and APRI values. These declines may have correlated with the resolution of necroinflammation. Baseline LS values predicted SVR.

  6. Unveiling aerosol-cloud interactions - Part 1: Cloud contamination in satellite products enhances the aerosol indirect forcing estimate

    NASA Astrophysics Data System (ADS)

    Christensen, Matthew W.; Neubauer, David; Poulsen, Caroline A.; Thomas, Gareth E.; McGarragh, Gregory R.; Povey, Adam C.; Proud, Simon R.; Grainger, Roy G.

    2017-11-01

    Increased concentrations of aerosol can enhance the albedo of warm low-level cloud. Accurately quantifying this relationship from space is challenging due in part to contamination of aerosol statistics near clouds. Aerosol retrievals near clouds can be influenced by stray cloud particles in areas assumed to be cloud-free, particle swelling by humidification, shadows and enhanced scattering into the aerosol field from (3-D radiative transfer) clouds. To screen for this contamination we have developed a new cloud-aerosol pairing algorithm (CAPA) to link cloud observations to the nearest aerosol retrieval within the satellite image. The distance between each aerosol retrieval and nearest cloud is also computed in CAPA. Results from two independent satellite imagers, the Advanced Along-Track Scanning Radiometer (AATSR) and Moderate Resolution Imaging Spectroradiometer (MODIS), show a marked reduction in the strength of the intrinsic aerosol indirect radiative forcing when selecting aerosol pairs that are located farther away from the clouds (-0.28±0.26 W m-2) compared to those including pairs that are within 15 km of the nearest cloud (-0.49±0.18 W m-2). The larger aerosol optical depths in closer proximity to cloud artificially enhance the relationship between aerosol-loading, cloud albedo, and cloud fraction. These results suggest that previous satellite-based radiative forcing estimates represented in key climate reports may be exaggerated due to the inclusion of retrieval artefacts in the aerosol located near clouds.

  7. [Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

    PubMed

    Brovarets', O O

    2013-01-01

    At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

  8. A Survey of Aspartate Phenylalanine and Glutamate Phenylalanine Interactions in the Protein Data Bank: Searching for Anion Pairs

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Philip, Vivek M; Harris, Jason B; Adams, Rachel M

    Protein structures are stabilized using noncovalent interactions. In addition to the traditional noncovalent interactions, newer types of interactions are thought to be present in proteins. One such interaction, an anion pair, in which the positively charged edge of an aromatic ring interacts with an anion, forming a favorable anion quadrupole interaction, has been previously proposed [Jackson, M. R., et al. (2007) J. Phys. Chem. B111, 8242 8249]. To study the role of anion interactions in stabilizing protein structure, we analyzed pairwise interactions between phenylalanine (Phe) and the anionic amino acids, aspartate (Asp) and glutamate (Glu). Particular emphasis was focused onmore » identification of Phe Asp or Glu pairs separated by less than 7 in the high-resolution, nonredundant Protein Data Bank. Simplifying Phe to benzene and Asp or Glu to formate molecules facilitated in silico analysis of the pairs. Kitaura Morokuma energy calculations were performed on roughly 19000 benzene formate pairs and the resulting energies analyzed as a function of distance and angle. Edgewise interactions typically produced strongly stabilizing interaction energies (2 to 7.3 kcal/mol), while interactions involving the ring face resulted in weakly stabilizing to repulsive interaction energies. The strongest, most stabilizing interactions were identified as preferentially occurring in buried residues. Anion pairs are found throughout protein structures, in helices as well as strands. Numerous pairs also had nearby cation interactions as well as potential stacking. While more than 1000 structures did not contain an anion pair, the 3134 remaining structures contained approximately 2.6 anion pairs per protein, suggesting it is a reasonably common motif that could contribute to the overall structural stability of a protein.« less

  9. A Survey of Aspartate-Phenylalanine and Glutamate-Phenylalanine Interactions in the Protein Data Bank: Searching for Anion-pi Pairs

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Philip, Vivek M; Harris, Jason B; Adams, Rachel M

    Protein structures are stabilized using noncovalent interactions. In addition to the traditional noncovalent interactions, newer types of interactions are thought to be present in proteins. One such interaction, an anion-{pi} pair, in which the positively charged edge of an aromatic ring interacts with an anion, forming a favorable anion-quadrupole interaction, has been previously proposed [Jackson, M. R., et al. (2007) J. Phys. Chem. B111, 8242-8249]. To study the role of anion-{pi} interactions in stabilizing protein structure, we analyzed pairwise interactions between phenylalanine (Phe) and the anionic amino acids, aspartate (Asp) and glutamate (Glu). Particular emphasis was focused on identification ofmore » Phe-Asp or -Glu pairs separated by less than 7 {angstrom} in the high-resolution, nonredundant Protein Data Bank. Simplifying Phe to benzene and Asp or Glu to formate molecules facilitated in silico analysis of the pairs. Kitaura-Morokuma energy calculations were performed on roughly 19000 benzene-formate pairs and the resulting energies analyzed as a function of distance and angle. Edgewise interactions typically produced strongly stabilizing interaction energies (-2 to -7.3 kcal/mol), while interactions involving the ring face resulted in weakly stabilizing to repulsive interaction energies. The strongest, most stabilizing interactions were identified as preferentially occurring in buried residues. Anion-{pi} pairs are found throughout protein structures, in helices as well as {beta} strands. Numerous pairs also had nearby cation-{pi} interactions as well as potential {pi}-{pi} stacking. While more than 1000 structures did not contain an anion-{pi} pair, the 3134 remaining structures contained approximately 2.6 anion-{pi} pairs per protein, suggesting it is a reasonably common motif that could contribute to the overall structural stability of a protein.« less

  10. A survey of aspartate-phenylalanine and glutamate-phenylalanine interactions in the protein data bank: searching for anion-π pairs.

    PubMed

    Philip, Vivek; Harris, Jason; Adams, Rachel; Nguyen, Don; Spiers, Jeremy; Baudry, Jerome; Howell, Elizabeth E; Hinde, Robert J

    2011-04-12

    Protein structures are stabilized using noncovalent interactions. In addition to the traditional noncovalent interactions, newer types of interactions are thought to be present in proteins. One such interaction, an anion-π pair, in which the positively charged edge of an aromatic ring interacts with an anion, forming a favorable anion-quadrupole interaction, has been previously proposed [Jackson, M. R., et al. (2007) J. Phys. Chem. B111, 8242-8249]. To study the role of anion-π interactions in stabilizing protein structure, we analyzed pairwise interactions between phenylalanine (Phe) and the anionic amino acids, aspartate (Asp) and glutamate (Glu). Particular emphasis was focused on identification of Phe-Asp or -Glu pairs separated by less than 7 Å in the high-resolution, nonredundant Protein Data Bank. Simplifying Phe to benzene and Asp or Glu to formate molecules facilitated in silico analysis of the pairs. Kitaura-Morokuma energy calculations were performed on roughly 19000 benzene-formate pairs and the resulting energies analyzed as a function of distance and angle. Edgewise interactions typically produced strongly stabilizing interaction energies (-2 to -7.3 kcal/mol), while interactions involving the ring face resulted in weakly stabilizing to repulsive interaction energies. The strongest, most stabilizing interactions were identified as preferentially occurring in buried residues. Anion-π pairs are found throughout protein structures, in helices as well as β strands. Numerous pairs also had nearby cation-π interactions as well as potential π-π stacking. While more than 1000 structures did not contain an anion-π pair, the 3134 remaining structures contained approximately 2.6 anion-π pairs per protein, suggesting it is a reasonably common motif that could contribute to the overall structural stability of a protein.

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Leszczynski, Jerzy; Sponer, Judit; Sponer, Jiri

    Recent experimental studies on the Watson Crick type base pairing of triazine and aminopyrimidine derivatives suggest that acid/base properties of the constituent bases might be related to the duplex stabilities measured in solution. Herein we use high-level quantum chemical calculations and molecular dynamics simulations to evaluate the base pairing and stacking interactions of seven selected base pairs, which are common in that they are stabilized by two NH O hydrogen bonds separated by one NH N hydrogen bond. We show that neither the base pairing nor the base stacking interaction energies correlate with the reported pKa data of the basesmore » and the melting points of the duplexes. This suggests that the experimentally observed correlation between the melting point data of the duplexes and the pKa values of the constituent bases is not rooted in the intrinsic base pairing and stacking properties. The physical chemistry origin of the observed experimental correlation thus remains unexplained and requires further investigations. In addition, since our calculations are carried out with extrapolation to the complete basis set of atomic orbitals and with inclusion of higher electron correlation effects, they provide reference data for stacking and base pairing energies of non-natural bases.« less

  12. Thermal transport in topological-insulator-based superconducting hybrid structures with mixed singlet and triplet pairing states.

    PubMed

    Li, Hai; Zhao, Yuan Yuan

    2017-11-22

    In the framework of the Bogoliubov-de Gennes equation, we investigate the thermal transport properties in topological-insulator-based superconducting hybrid structures with mixed spin-singlet and spin-triplet pairing states, and emphasize the different manifestations of the spin-singlet and spin-triplet pairing states in the thermal transport signatures. It is revealed that the temperature-dependent differential thermal conductance strongly depends on the components of the pairing state, and the negative differential thermal conductance only occurs in the spin-singlet pairing state dominated regime. It is also found that the thermal conductance is profoundly sensitive to the components of the pairing state. In the spin-singlet pairing state controlled regime, the thermal conductance obviously oscillates with the phase difference and junction length. With increasing the proportion of the spin-triplet pairing state, the oscillating characteristic of the thermal conductance fades out distinctly. These results suggest an alternative route for distinguishing the components of pairing states in topological-insulator-based superconducting hybrid structures.

  13. An emperor penguin population estimate: the first global, synoptic survey of a species from space.

    PubMed

    Fretwell, Peter T; Larue, Michelle A; Morin, Paul; Kooyman, Gerald L; Wienecke, Barbara; Ratcliffe, Norman; Fox, Adrian J; Fleming, Andrew H; Porter, Claire; Trathan, Phil N

    2012-01-01

    Our aim was to estimate the population of emperor penguins (Aptenodytes fosteri) using a single synoptic survey. We examined the whole continental coastline of Antarctica using a combination of medium resolution and Very High Resolution (VHR) satellite imagery to identify emperor penguin colony locations. Where colonies were identified, VHR imagery was obtained in the 2009 breeding season. The remotely-sensed images were then analysed using a supervised classification method to separate penguins from snow, shadow and guano. Actual counts of penguins from eleven ground truthing sites were used to convert these classified areas into numbers of penguins using a robust regression algorithm.We found four new colonies and confirmed the location of three previously suspected sites giving a total number of emperor penguin breeding colonies of 46. We estimated the breeding population of emperor penguins at each colony during 2009 and provide a population estimate of ~238,000 breeding pairs (compared with the last previously published count of 135,000-175,000 pairs). Based on published values of the relationship between breeders and non-breeders, this translates to a total population of ~595,000 adult birds.There is a growing consensus in the literature that global and regional emperor penguin populations will be affected by changing climate, a driver thought to be critical to their future survival. However, a complete understanding is severely limited by the lack of detailed knowledge about much of their ecology, and importantly a poor understanding of their total breeding population. To address the second of these issues, our work now provides a comprehensive estimate of the total breeding population that can be used in future population models and will provide a baseline for long-term research.

  14. An Emperor Penguin Population Estimate: The First Global, Synoptic Survey of a Species from Space

    PubMed Central

    Fretwell, Peter T.; LaRue, Michelle A.; Morin, Paul; Kooyman, Gerald L.; Wienecke, Barbara; Ratcliffe, Norman; Fox, Adrian J.; Fleming, Andrew H.; Porter, Claire; Trathan, Phil N.

    2012-01-01

    Our aim was to estimate the population of emperor penguins (Aptenodytes fosteri) using a single synoptic survey. We examined the whole continental coastline of Antarctica using a combination of medium resolution and Very High Resolution (VHR) satellite imagery to identify emperor penguin colony locations. Where colonies were identified, VHR imagery was obtained in the 2009 breeding season. The remotely-sensed images were then analysed using a supervised classification method to separate penguins from snow, shadow and guano. Actual counts of penguins from eleven ground truthing sites were used to convert these classified areas into numbers of penguins using a robust regression algorithm. We found four new colonies and confirmed the location of three previously suspected sites giving a total number of emperor penguin breeding colonies of 46. We estimated the breeding population of emperor penguins at each colony during 2009 and provide a population estimate of ∼238,000 breeding pairs (compared with the last previously published count of 135,000–175,000 pairs). Based on published values of the relationship between breeders and non-breeders, this translates to a total population of ∼595,000 adult birds. There is a growing consensus in the literature that global and regional emperor penguin populations will be affected by changing climate, a driver thought to be critical to their future survival. However, a complete understanding is severely limited by the lack of detailed knowledge about much of their ecology, and importantly a poor understanding of their total breeding population. To address the second of these issues, our work now provides a comprehensive estimate of the total breeding population that can be used in future population models and will provide a baseline for long-term research. PMID:22514609

  15. Segmentation of arterial vessel wall motion to sub-pixel resolution using M-mode ultrasound.

    PubMed

    Fancourt, Craig; Azer, Karim; Ramcharan, Sharmilee L; Bunzel, Michelle; Cambell, Barry R; Sachs, Jeffrey R; Walker, Matthew

    2008-01-01

    We describe a method for segmenting arterial vessel wall motion to sub-pixel resolution, using the returns from M-mode ultrasound. The technique involves measuring the spatial offset between all pairs of scans from their cross-correlation, converting the spatial offsets to relative wall motion through a global optimization, and finally translating from relative to absolute wall motion by interpolation over the M-mode image. The resulting detailed wall distension waveform has the potential to enhance existing vascular biomarkers, such as strain and compliance, as well as enable new ones.

  16. Arcsec source location measurements in gamma-ray astronomy from a lunar observatory

    NASA Astrophysics Data System (ADS)

    Koch, D. G.; Hughes, B. E.

    1990-03-01

    The physical processes typically used in the detection of high energy gamma-rays do not permit good angular resolution, which makes difficult the unambiguous association of discrete gamma-ray sources with objects emitting at other wavelengths. This problem can be overcome by placing gamma-ray detectors on the moon and using the horizon as an occulting edge to achieve arcsec resolution. For the purpose of discussion, this concept is examined for gamma rays above about 20 MeV for which pair production dominates the detection process and locally-generated nuclear gamma rays do not contribute to the background.

  17. Long working distance objective lenses for single atom trapping and imaging

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pritchard, J. D., E-mail: jonathan.pritchard@strath.ac.uk; Department of Physics, University of Strathclyde, 107 Rottenrow East, Glasgow G4 0NG; Isaacs, J. A.

    We present a pair of optimized objective lenses with long working distances of 117 mm and 65 mm, respectively, that offer diffraction limited performance for both Cs and Rb wavelengths when imaging through standard vacuum windows. The designs utilise standard catalog lens elements to provide a simple and cost-effective solution. Objective 1 provides NA = 0.175 offering 3 μm resolution whilst objective 2 is optimized for high collection efficiency with NA = 0.29 and 1.8 μm resolution. This flexible design can be further extended for use at shorter wavelengths by simply re-optimising the lens separations.

  18. Evaluation of chromatographic columns packed with semi- and fully porous particles for benzimidazoles separation.

    PubMed

    Gonzalo-Lumbreras, Raquel; Sanz-Landaluze, Jon; Cámara, Carmen

    2015-07-01

    The behavior of 15 benzimidazoles, including their main metabolites, using several C18 columns with standard or narrow-bore diameters and different particle size and type were evaluated. These commercial columns were selected because their differences could affect separation of benzimidazoles, and so they can be used as alternative columns. A simple screening method for the analysis of benzimidazole residues and their main metabolites was developed. First, the separation of benzimidazoles was optimized using a Kinetex C18 column; later, analytical performances of other columns using the above optimized conditions were compared and then individually re-optimized. Critical pairs resolution, analysis run time, column type and characteristics, and selectivity were considered for chromatographic columns comparison. Kinetex XB was selected because it provides the shortest analysis time and the best resolution of critical pairs. Using this column, the separation conditions were re-optimized using a factorial design. Separations obtained with the different columns tested can be applied to the analysis of specific benzimidazoles residues or other applications. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. A Concept for a High-Energy Gamma-ray Polarimeter

    NASA Technical Reports Server (NTRS)

    Bloser, P. F.; Hunter, S. D.; Depaola, G. O.; Longo, F.

    2003-01-01

    We present a concept for an imaging gamma-ray polarimeter operating from approx. 50 MeV to approx. 1 GeV. Such an instrument would be valuable for the study of high-energy pulsars, active galactic nuclei, supernova remnants, and gamma-ray bursts. The concept makes use of pixelized gas micro-well detectors, under development at Goddard Space Flight Center, to record the electron-positron tracks from pair-production events in a large gas volume. Pixelized micro-well detectors have the potential to form large-volume 3-D track imagers with approx. 100 micron (rms) position resolution at moderate cost. The combination of high spatial resolution and a continuous low-density gas medium permits many thousands of measurements per radiation length, allowing the particle tracks to be imaged accurately before multiple scattering masks their original directions. The polarization of the incoming radiation may then be determined from the azimuthal distribution of the electron-positron pairs. We have performed Geant4 simulations of these processes to estimate the polarization sensitivity as a function of instrument parameters and event selection criteria.

  20. Evaluation of a Pair-Wise Conflict Detection and Resolution Algorithm in a Multiple Aircraft Scenario

    NASA Technical Reports Server (NTRS)

    Carreno, Victor A.

    2002-01-01

    The KB3D algorithm is a pairwise conflict detection and resolution (CD&R) algorithm. It detects and generates trajectory vectoring for an aircraft which has been predicted to be in an airspace minima violation within a given look-ahead time. It has been proven, using mechanized theorem proving techniques, that for a pair of aircraft, KB3D produces at least one vectoring solution and that all solutions produced are correct. Although solutions produced by the algorithm are mathematically correct, they might not be physically executable by an aircraft or might not solve multiple aircraft conflicts. This paper describes a simple solution selection method which assesses all solutions generated by KB3D and determines the solution to be executed. The solution selection method and KB3D are evaluated using a simulation in which N aircraft fly in a free-flight environment and each aircraft in the simulation uses KB3D to maintain separation. Specifically, the solution selection method filters KB3D solutions which are procedurally undesirable or physically not executable and uses a predetermined criteria for selection.

  1. Genetic and DNA sequence analysis of the kanamycin resistance transposon Tn903.

    PubMed Central

    Grindley, N D; Joyce, C M

    1980-01-01

    The kanamycin resistance transposon Tn903 consists of a unique region of about 1000 base pairs bounded by a pair of 1050-base-pair inverted repeat sequences. Each repeat contains two Pvu II endonuclease cleavage sites separated by 520 base pairs. We have constructed derivatives of Tn903 in which this 520-base-pair fragment is deleted from one or both repeats. Those derivatives that lack both 520-base-pair fragments cannot transpose, whereas those that lack just one remain transposition proficient. One such transposable derivative, Tn903 delta I, has been selected for further study. We have determined the sequence of the intact inverted repeat. The 18 base pairs at each end are identical and inverted relative to one another, a structure characteristic of insertion sequences. Additional experiments indicate that a single inverted repeat from Tn903 can, in fact, transpose; we propose that this element be called IS903. To correlate the DNA sequence with genetic activities, we have created mutations by inserting a 10-base-pair DNA fragment at several sites within the intact repeat of Tn903 delta 1, and we have examined the effect of such insertions on transposability. The results suggest that IS903 encodes a 307-amino-acid polypeptide (a "transposase") that is absolutely required for transposition of IS903 or Tn903. Images PMID:6261245

  2. Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

    PubMed

    Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

    2018-03-26

    DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Patterns of call communication between group-housed zebra finches change during the breeding cycle.

    PubMed

    Gill, Lisa F; Goymann, Wolfgang; Ter Maat, Andries; Gahr, Manfred

    2015-10-06

    Vocal signals such as calls play a crucial role for survival and successful reproduction, especially in group-living animals. However, call interactions and call dynamics within groups remain largely unexplored because their relation to relevant contexts or life-history stages could not be studied with individual-level resolution. Using on-bird microphone transmitters, we recorded the vocalisations of individual zebra finches (Taeniopygia guttata) behaving freely in social groups, while females and males previously unknown to each other passed through different stages of the breeding cycle. As birds formed pairs and shifted their reproductive status, their call repertoire composition changed. The recordings revealed that calls occurred non-randomly in fine-tuned vocal interactions and decreased within groups while pair-specific patterns emerged. Call-type combinations of vocal interactions changed within pairs and were associated with successful egg-laying, highlighting a potential fitness relevance of calling dynamics in communication systems.

  4. Validating silicon polytrodes with paired juxtacellular recordings: method and dataset.

    PubMed

    Neto, Joana P; Lopes, Gonçalo; Frazão, João; Nogueira, Joana; Lacerda, Pedro; Baião, Pedro; Aarts, Arno; Andrei, Alexandru; Musa, Silke; Fortunato, Elvira; Barquinha, Pedro; Kampff, Adam R

    2016-08-01

    Cross-validating new methods for recording neural activity is necessary to accurately interpret and compare the signals they measure. Here we describe a procedure for precisely aligning two probes for in vivo "paired-recordings" such that the spiking activity of a single neuron is monitored with both a dense extracellular silicon polytrode and a juxtacellular micropipette. Our new method allows for efficient, reliable, and automated guidance of both probes to the same neural structure with micrometer resolution. We also describe a new dataset of paired-recordings, which is available online. We propose that our novel targeting system, and ever expanding cross-validation dataset, will be vital to the development of new algorithms for automatically detecting/sorting single-units, characterizing new electrode materials/designs, and resolving nagging questions regarding the origin and nature of extracellular neural signals. Copyright © 2016 the American Physiological Society.

  5. Water pair potential of near spectroscopic accuracy. II. Vibration-rotation-tunneling levels of the water dimer

    NASA Astrophysics Data System (ADS)

    Groenenboom, G. C.; Wormer, P. E. S.; van der Avoird, A.; Mas, E. M.; Bukowski, R.; Szalewicz, K.

    2000-10-01

    Nearly exact six-dimensional quantum calculations of the vibration-rotation-tunneling (VRT) levels of the water dimer for values of the rotational quantum numbers J and K ⩽2 show that the SAPT-5s water pair potential presented in the preceding paper (paper I) gives a good representation of the experimental high-resolution far-infrared spectrum of the water dimer. After analyzing the sensitivity of the transition frequencies with respect to the linear parameters in the potential we could further improve this potential by using only one of the experimentally determined tunneling splittings of the ground state in (H2O)2. The accuracy of the resulting water pair potential, SAPT-5st, is established by comparison with the spectroscopic data of both (H2O)2 and (D2O)2: ground and excited state tunneling splittings and rotational constants, as well as the frequencies of the intermolecular vibrations.

  6. Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

    PubMed

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-08

    The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

  7. Comparable Stability of Hoogsteen and Watson–Crick Base Pairs in Ionic Liquid Choline Dihydrogen Phosphate

    PubMed Central

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-01

    The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194

  8. m1A and m1G Potently Disrupt A-RNA Structure Due to the Intrinsic Instability of Hoogsteen Base Pairs

    PubMed Central

    Zhou, Huiqing; Kimsey, Isaac J.; Nikolova, Evgenia N.; Sathyamoorthy, Bharathwaj; Grazioli, Gianmarc; McSally, James; Bai, Tianyu; Wunderlich, Christoph H.; Kreutz, Christoph; Andricioaei, Ioan; Al-Hashimi, Hashim M.

    2016-01-01

    The B-DNA double helix can dynamically accommodate G–C and A–T base pairs in either Watson-Crick or Hoogsteen configurations. Here, we show that G–C+ and A–U Hoogsteen base pairs are strongly disfavored in A-RNA. As a result, N1-methyl adenosine and N1-methyl guanosine, which occur in DNA as a form of alkylation damage, and in RNA as a posttranscriptional modification, have dramatically different consequences. They create G–C+ and A–U Hoogsteen base pairs in duplex DNA that maintain the structural integrity of the double helix, but block base pairing all together and induce local duplex melting in RNA, providing a mechanism for potently disrupting RNA structure through posttranscriptional modifications. The markedly different propensities to form Hoogsteen base pairs in B-DNA and A-RNA may help meet the opposing requirements of maintaining genome stability on one hand, and dynamically modulating the structure of the epitranscriptome on the other. PMID:27478929

  9. Structural Basis of Transcriptional Regulation of the Proline Utilization Regulon by Multifunctional PutA

    PubMed Central

    Zhou, Yuzhen; Larson, John D.; Bottoms, Christopher A.; Arturo, Emilia C.; Henzl, Michael T.; Jenkins, Jermaine L.; Nix, Jay C.; Becker, Donald F.; Tanner, John J.

    2009-01-01

    Summary The multifunctional Escherichia coli PutA flavoprotein functions as both a membrane-associated proline catabolic enzyme and transcriptional repressor of the proline utilization genes putA and putP. To better understand the mechanism of transcriptional regulation by PutA, we have mapped the put regulatory region, determined a crystal structure of the PutA ribbon-helix-helix domain (PutA52) complexed with DNA and examined the thermodynamics of DNA binding to PutA52. Five operator sites, each containing the sequence motif 5′-GTTGCA-3′, were identified using gel-shift analysis. Three of the sites are shown to be critical for repression of putA, whereas the two other sites are important for repression of putP. The 2.25 Å resolution crystal structure of PutA52 bound to one of the operators (operator 2, 21-bp) shows that the protein contacts a 9-bp fragment, corresponding to the GTTGCA consensus motif plus three flanking base pairs. Since the operator sequences differ in flanking bases, the structure implies that PutA may have different affinities for the five operators. This hypothesis was explored using isothermal titration calorimetry. The binding of PutA52 to operator 2 is exothermic with an enthalpy of −1.8 kcal/mol and a dissociation constant of 210 nM. Substitution of the flanking bases of operator 4 into operator 2 results in an unfavorable enthalpy of 0.2 kcal/mol and 15-fold lower affinity, which shows that base pairs outside of the consensus motif impact binding. The structural and thermodynamic data suggest that hydrogen bonds between Lys9 and bases adjacent to the GTTGCA motif contribute to transcriptional regulation by fine-tuning the affinity of PutA for put control operators. PMID:18586269

  10. Temperature-induced Lifshitz transition in WTe 2

    DOE PAGES

    Wu, Yun; Jo, Na Hyun; Ochi, Masayuki; ...

    2015-10-12

    In this study, we use ultrahigh resolution, tunable, vacuum ultraviolet laser-based, angle-resolved photoemission spectroscopy (ARPES), temperature- and field-dependent resistivity, and thermoelectric power (TEP) measurements to study the electronic properties of WTe 2, a compound that manifests exceptionally large, temperature-dependent magnetoresistance. The Fermi surface consists of two pairs of electron and two pairs of hole pockets along the X–Γ–X direction. Using detailed ARPES temperature scans, we find a rare example of a temperature-induced Lifshitz transition at T≃160 K, associated with the complete disappearance of the hole pockets. Our electronic structure calculations show a clear and substantial shift of the chemical potentialmore » μ(T) due to the semimetal nature of this material driven by modest changes in temperature. This change of Fermi surface topology is also corroborated by the temperature dependence of the TEP that shows a change of slope at T≈175 K and a breakdown of Kohler’s rule in the 70–140 K range. Our results and the mechanisms driving the Lifshitz transition and transport anomalies are relevant to other systems, such as pnictides, 3D Dirac semimetals, and Weyl semimetals.« less

  11. Fast Pb-glass neutron-to-light converter for ICF (Inertial Confinement Fusion) target burn history measurements

    NASA Astrophysics Data System (ADS)

    Lerche, R. A.; Cable, M. D.; Phillion, D. W.

    1990-09-01

    We are developing a streak camera based instrument to diagnose the fusion reaction rate (burn history) within laser-driven ICF targets filled with D-T fuel. Recently, we attempted measurements using the 16.7 MeV gamma ray emitted in the T(d,gamma)He(5) fusion reaction. Pb glass which has a large cross section for pair production acts as a gamma-ray-to-light converter. Gamma rays interact within the glass to form electron-positron pairs that produce large amounts (1000 photons/gamma ray) of prompt (less than 10 ps) Cerenkov light as they slow down. In our experimental instrument, an f/10 Cassegrain telescope optically couples light produced within the converter to a streak camera having 20-ps resolution. Experiments using high-yield (10(exp 13) D-T neutrons), direct-drive targets at Nova produced good signals with widths of 200 ps. Time-of-flight measurements show the signals to be induced by neutrons rather than gamma rays. The Pb glass appears to act as a fast neutron-to-light converter. We continue to study the interactions process and the possibility of using the 16.7 MeV gamma rays for burn time measurements.

  12. New application of superconductors: High sensitivity cryogenic light detectors

    NASA Astrophysics Data System (ADS)

    Cardani, L.; Bellini, F.; Casali, N.; Castellano, M. G.; Colantoni, I.; Coppolecchia, A.; Cosmelli, C.; Cruciani, A.; D'Addabbo, A.; Di Domizio, S.; Martinez, M.; Tomei, C.; Vignati, M.

    2017-02-01

    In this paper we describe the current status of the CALDER project, which is developing ultra-sensitive light detectors based on superconductors for cryogenic applications. When we apply an AC current to a superconductor, the Cooper pairs oscillate and acquire kinetic inductance, that can be measured by inserting the superconductor in a LC circuit with high merit factor. Interactions in the superconductor can break the Cooper pairs, causing sizable variations in the kinetic inductance and, thus, in the response of the LC circuit. The continuous monitoring of the amplitude and frequency modulation allows to reconstruct the incident energy with excellent sensitivity. This concept is at the basis of Kinetic Inductance Detectors (KIDs) that are characterized by natural aptitude to multiplexed read-out (several sensors can be tuned to different resonant frequencies and coupled to the same line), resolution of few eV, stable behavior over a wide temperature range, and ease in fabrication. We present the results obtained by the CALDER collaboration with 2×2 cm2 substrates sampled by 1 or 4 Aluminum KIDs. We show that the performances of the first prototypes are already competitive with those of other commonly used light detectors, and we discuss the strategies for a further improvement.

  13. Inertial collapse of bubble pairs near a solid surface

    NASA Astrophysics Data System (ADS)

    Alahyari Beig, Shahaboddin; Johnsen, Eric

    2017-11-01

    Cavitation occurs in a variety of applications ranging from naval structures to biomedical ultrasound. One important consequence is structural damage to neighboring surfaces following repeated inertial collapse of vapor bubbles. Although the mechanical loading produced by the collapse of a single bubble has been widely investigated, less is known about the detailed dynamics of the collapse of multiple bubbles. In such a problem, the bubble-bubble interactions typically affect the dynamics, e.g., by increasing the non-sphericity of the bubbles and amplifying/hindering the collapse intensity depending on the flow parameters. Here, we quantify the effects of bubble-bubble interactions on the bubble dynamics, as well as the pressures/temperatures produced by the collapse of a pair of gas bubbles near a rigid surface. We perform high-resolution simulations of this problem by solving the three-dimensional compressible Navier-Stokes equations for gas/liquid flows. The results are used to investigate the non-spherical bubble dynamics and characterize the pressure and temperature fields based on the relevant parameters entering the problem: stand-off distance, geometrical configuration (angle, relative size, distance), collapse strength. This research was supported in part by ONR Grant N00014-12-1-0751 and NSF Grant CBET 1253157.

  14. Structural Basis of Ligand Binding by a C-di-GMP Riboswitch

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Smith, K.; Lipchock, S; Ames, T

    2009-01-01

    The second messenger signaling molecule bis-(3{prime}-5{prime})-cyclic dimeric guanosine monophosphate (c-di-GMP) regulates many processes in bacteria, including motility, pathogenesis and biofilm formation. c-di-GMP-binding riboswitches are important downstream targets in this signaling pathway. Here we report the crystal structure, at 2.7 {angstrom} resolution, of a c-di-GMP riboswitch aptamer from Vibrio cholerae bound to c-di-GMP, showing that the ligand binds within a three-helix junction that involves base-pairing and extensive base-stacking. The symmetric c-di-GMP is recognized asymmetrically with respect to both the bases and the backbone. A mutant aptamer was engineered that preferentially binds the candidate signaling molecule c-di-AMP over c-di-GMP. Kinetic and structuralmore » data suggest that genetic regulation by the c-di-GMP riboswitch is kinetically controlled and that gene expression is modulated through the stabilization of a previously unidentified P1 helix, illustrating a direct mechanism for c-di-GMP signaling.« less

  15. Phenotypic variability in monozygotic twins with neurofibromatosis 2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Baser, M.E.; Ragge, N.K.; Riccardi, V.M.

    Mutations in the neurofibromatosis 2 (NF2) tumor suppressor gene on chromosome 22q12 cause a clinically variable autosomal dominant syndrome characterized by bilateral vestibular schwannomas (VSs), other nervous system tumors, and early onset lenticular cataracts. We studied three pairs of monozygotic (MZ) twins with NF2, all with bilateral VSs, to separate genetic from nongenetic causes of clinical variability. The evaluation included gadolinium-enhanced high-resolution magnetic resonance imaging of the head and spine, neuro-ophthalmic examination with slit lamp, physical examination, and zygosity testing with microsatellite markers. Each MZ pair was concordant for general phenotypic subtype (mild or severe) and often for the affectedmore » organ systems. However, the MZ pairs were discordant for some features of disease presentation or progression. For example, all three pairs were discordant for presence or type of associated cranial tumors. We hypothesize that phenotypic differences between NF2 MZ twins are at least partly due to stochastic processes, such as the loss of the second NF2 allele or alleles of other genes. 42 refs., 1 tab.« less

  16. Proteomic patterns for classification of ovarian cancer and CTCL serum samples utilizing peak pairs indicative of post-translational modifications.

    PubMed

    Liu, Chenwei; Shea, Nancy; Rucker, Sally; Harvey, Linda; Russo, Paul; Saul, Richard; Lopez, Mary F; Mikulskis, Alvydas; Kuzdzal, Scott; Golenko, Eva; Fishman, David; Vonderheid, Eric; Booher, Susan; Cowen, Edward W; Hwang, Sam T; Whiteley, Gordon R

    2007-11-01

    Proteomic patterns as a potential diagnostic technology has been well established for several cancer conditions and other diseases. The use of machine learning techniques such as decision trees, neural networks, genetic algorithms, and other methods has been the basis for pattern determination. Cancer is known to involve signaling pathways that are regulated through PTM of proteins. These modifications are also detectable with high confidence using high-resolution MS. We generated data using a prOTOF mass spectrometer on two sets of patient samples: ovarian cancer and cutaneous t-cell lymphoma (CTCL) with matched normal samples for each disease. Using the knowledge of mass shifts caused by common modifications, we built models using peak pairs and compared this to a conventional technique using individual peaks. The results for each disease showed that a small number of peak pairs gave classification equal to or better than the conventional technique that used multiple individual peaks. This simple peak picking technique could be used to guide identification of important peak pairs involved in the disease process.

  17. Stellar dynamics in E+E pairs of galaxies. 1: NGC 741/742, 1587/88 and 2672/73. The data

    NASA Astrophysics Data System (ADS)

    Bonfanti, P.; Rampazzo, R.; Combes, F.; Prugniel, P.; Sulentic, J. W.

    1995-05-01

    We present a kinematic study ofthree E+E galaxy pairs, NGC, 741/642, 1587/1588 (CPG 99) and 2672/2673 (CPG 175) All three pairs show a similar morpological distortion (i.e. the off-centering of inner versus outer isphototes; Davoust & Prungniel 1988) which is ascribed to the ongoing interaction. The data was obtained at the CFHT equipped with the Herzberg Spectrograph at a resolution of 0.88 A px-1 NGC741 and 2673 show significant rotation along the apparent minor axis. Both components of CPG 99 rotate very fast (with no evidence for rotation along the mirror axis of either component). None of the galaxies show abnormally high central velocity dispersion. We report some of the first clear detections of well defined velocity dispersions curves for interacting pairs. They show a systematic decrease with distance from the center, as expected for normal ellipticals. They do not show obvious heating in the outer parts as was previously reported. NGC 741 and 2672 show, respectively, possible U and inverse U-shaped structure in their velocity profiles.

  18. Seismic imaging of the southern California plate-boundary around the South-Central Transverse Ranges using double-difference tomography

    NASA Astrophysics Data System (ADS)

    Share, P. E.; Ben-Zion, Y.; Thurber, C. H.; Zhang, H.; Guo, H.

    2017-12-01

    We derive P and S seismic velocities within and around the South-Central Transverse Ranges section of the San Andreas Fault (SAF), using a new double-difference tomography algorithm incorporating both event-pair and station-pair differential times. The event-pair data can determine high-resolution relative earthquake locations and resolve fine-scale structure in seismogenic zones, whereas station-pair data allow for better absolute locations and higher resolution of structure near the surface where stations are most dense. The tomographic results are based on arrival times of P and S waves generated by 17,753 M>1 local events from 1/1/2010 to 6/30/2015 recorded by 259 stations within a 222 km x 164 km region. The resulting P and S velocity models include low velocities along major fault segments and across-fault velocity contrasts. For example, at depths <7 km, low velocity anomalies delineate the SAF from Cajon Pass to Coachella Valley, with the exception around San Gorgonio Pass (SGP) where a relatively fast rock body cuts across the fault. Extensive faulting and Pelona schist manifest as low velocities throughout the San Bernardino Basin (SBB). High velocity granites abut the SBB to the SW and NE, forming prominent velocity contrasts across the northern San Jacinto Fault Zone (SJFZ) and the SAF, respectively. At depths of 9-11 km, the models also show a velocity contrast with an areal extent of >50 km parallel to the SAF around Coachella Valley but offset to the NE by 13 km. This is interpreted to mark a dipping section of the SAF that separates granites at depth in the SW from gneisses and schists in the NE. Analysis of fault zone head waves propagating along these sections of the SAF and SJFZ show that major bimaterial interfaces are associated with the observed velocity contrasts. Additional features within the models include elongated low velocity anomalies extending from the SJFZ trifurcation area, which itself has associated low velocity at great depth (>14 km), to the Elsinore Fault in the SW. Moreover, a deep (>13 km) velocity contrast appears beneath the SBB with an east-west strike oblique to both the northern SJFZ and SAF traces. The latter is potentially related to the ancestral Banning Fault, which dips to the north, separating low velocity Pelona schist in the north from high velocity granites in the south.

  19. Use of Visible Satellite Imagery to Determine Velocity in Tidal Rivers

    NASA Astrophysics Data System (ADS)

    Mied, R. P.; Donato, T. F.; Chen, W.

    2006-05-01

    In the open ocean and on the continental shelf, current velocities have traditionally been calculated remotely using the Maximum Correlation Coefficient (MCC) technique to track features between sequential sea surface temperature image scenes. These images are obtained from NOAA polar orbiters having an effective ground pixel size of 1.47 km. In contrast to this relatively large distance, spatial scales over which current velocities can vary in rivers and estuaries are hundreds of meters; associated temporal scales vary from tens of minutes to hours. Traditional in-situ measurements can be instructive in determining some aspects of the flow, but truly synoptic overviews are possible only with remote sensing, provided high-resolution imagery is available. With the advent of a constellation of moderate- to high-resolution imaging systems (e.g., Landsat, ASTER, SPOT, Quickbird, Ikonos, and Orbview-3) it is now available to extend current estimations to these areas. For instance, Landsat-7 and ASTER produce imagery with spatial resolutions on the order of 30 m or less and within 30 min of each other. This is sufficient to spatially resolve a wide variety of surface features, and to maintain feature integrity over time for tracking purposes. We apply this approach to a portion of the tidal Potomac River by using pairs of co-registered, sequential, multi-spectral Landsat-7 and ASTER images. The final data used in the analysis set contain three spectral bands (green, red, and near-infrared), and have a ground pixel spacing (GSD) of 30m. The time step between each Landsat-7 and ASTER pair is approximately 29 minutes. Two image sets are used in the present study, one occurring on 5 October 2001 and the other on 2 April 2003. We show current maps derived from both image pairs an discuss the results in the light of model and

  20. Theoretical evaluation of accuracy in position and size of brain activity obtained by near-infrared topography

    NASA Astrophysics Data System (ADS)

    Kawaguchi, Hiroshi; Hayashi, Toshiyuki; Kato, Toshinori; Okada, Eiji

    2004-06-01

    Near-infrared (NIR) topography can obtain a topographical distribution of the activated region in the brain cortex. Near-infrared light is strongly scattered in the head, and the volume of tissue sampled by a source-detector pair on the head surface is broadly distributed in the brain. This scattering effect results in poor resolution and contrast in the topographic image of the brain activity. In this study, a one-dimensional distribution of absorption change in a head model is calculated by mapping and reconstruction methods to evaluate the effect of the image reconstruction algorithm and the interval of measurement points for topographic imaging on the accuracy of the topographic image. The light propagation in the head model is predicted by Monte Carlo simulation to obtain the spatial sensitivity profile for a source-detector pair. The measurement points are one-dimensionally arranged on the surface of the model, and the distance between adjacent measurement points is varied from 4 mm to 28 mm. Small intervals of the measurement points improve the topographic image calculated by both the mapping and reconstruction methods. In the conventional mapping method, the limit of the spatial resolution depends upon the interval of the measurement points and spatial sensitivity profile for source-detector pairs. The reconstruction method has advantages over the mapping method which improve the results of one-dimensional analysis when the interval of measurement points is less than 12 mm. The effect of overlapping of spatial sensitivity profiles indicates that the reconstruction method may be effective to improve the spatial resolution of a two-dimensional reconstruction of topographic image obtained with larger interval of measurement points. Near-infrared topography with the reconstruction method potentially obtains an accurate distribution of absorption change in the brain even if the size of absorption change is less than 10 mm.

Top