Mechanism Underlying the Nucleobase-Distinguishing Ability of Benzopyridopyrimidine (BPP).

PubMed

Kochman, Michał A; Bil, Andrzej; Miller, R J Dwayne

2017-11-02

Benzopyridopyrimidine (BPP) is a fluorescent nucleobase analogue capable of forming base pairs with adenine (A) and guanine (G) at different sites. When incorporated into oligodeoxynucleotides, it is capable of differentiating between the two purine nucleobases by virtue of the fact that its fluorescence is largely quenched when it is base-paired to guanine, whereas base-pairing to adenine causes only a slight reduction of the fluorescence quantum yield. In the present article, the photophysics of BPP is investigated through computer simulations. BPP is found to be a good charge acceptor, as demonstrated by its positive and appreciably large electron affinity. The selective quenching process is attributed to charge transfer (CT) from the purine nucleobase, which is predicted to be efficient in the BPP-G base pair, but essentially inoperative in the BPP-A base pair. The CT process owes its high selectivity to a combination of two factors: the ionization potential of guanine is lower than that of adenine, and less obviously, the site occupied by guanine enables a greater stabilization of the CT state through electrostatic interactions than the one occupied by adenine. The case of BPP illustrates that molecular recognition via hydrogen bonding can enhance the selectivity of photoinduced CT processes.

Damage mechanism of hydroxyl radicals toward adenine—thymine base pair

NASA Astrophysics Data System (ADS)

Tan, Rong-Ri; Wang, Dong-Qi; Zhang, Feng-Shou

2014-02-01

The adenine—thymine base pair was studied in the presence of hydroxyl radicals in order to probe the hydrogen bond effect. The results show that the hydrogen bonds have little effect on the hydroxylation and dehydrogenation happened at the sites, which are not involved in a hydrogen bond, while at the sites involved in hydrogen bond formation in the base pair, the reaction becomes more difficult, both in view of the free energy barrier and the exothermicity. With a 6-311++G(d,p) level of description, both B3LYP and MP2 methods confirm that the C8 site of isolated adenine has the highest possibility to form covalent bond with the hydroxyl radicals, though with different energetics: B3LYP predicts a barrierless pathway, while MP2 finds a transition state with an energy of 106.1 kJ/mol. For the dehydrogenation reactions, B3LYP method predicts that the free energy barrier increases in the order of HN9 < HN61 < HN62 < H2 < H8.

Imidazopyridine/Pyrrole and hydroxybenzimidazole/pyrrole pairs for DNA minor groove recognition.

PubMed

Renneberg, Dorte; Dervan, Peter B

2003-05-14

The DNA binding properties of fused heterocycles imidazo[4,5-b]pyridine (Ip) and hydroxybenzimidazole (Hz) paired with pyrrole (Py) in eight-ring hairpin polyamides are reported. The recognition profile of Ip/Py and Hz/Py pairs were compared to the five-membered ring pairs Im/Py and Hp/Py on a DNA restriction fragment at four 6-base pair recognition sites which vary at a single position 5'-TGTNTA-3', where N = G, C, T, A. The Ip/Py pair distinguishes G.C from C.G, T.A, and A.T, and the Hz/Py pair distinguishes T.A from A.T, G.C, and C.G, affording a new set of heterocycle pairs to target the four Watson-Crick base pairs in the minor groove of DNA.

Understanding the differences between genome sequences of Escherichia coli B strains REL606 and BL21(DE3), and comparison of the closely related E. coli B and K-12 genomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Studier, F.W.; Daegelen, P.; Lenski, R. E.

2009-12-01

Each difference between the genome sequences of Escherichia coli B strains REL606 and BL21(DE3) can be interpreted in light of known laboratory manipulations plus a gene conversion between ribosomal RNA operons. Two treatments with 1-methyl-3-nitro-1-nitrosoguanidine in the REL606 lineage produced at least 93 single-base-pair mutations ({approx} 90% GC-to-AT transitions) and 3 single-base-pair GC deletions. Two UV treatments in the BL21(DE3) lineage produced only 4 single-base-pair mutations but 16 large deletions. P1 transductions from K-12 into the two B lineages produced 317 single-base-pair differences and 9 insertions or deletions, reflecting differences between B DNA in BL21(DE3) and integrated restriction fragments ofmore » K-12 DNA inherited by REL606. Two sites showed selective enrichment of spontaneous mutations. No unselected spontaneous single-base-pair mutations were evident. The genome sequences revealed that a progenitor of REL606 had been misidentified, explaining initially perplexing differences. Limited sequencing of other B strains defined characteristic properties of B and allowed assembly of the inferred genome of the ancestral B of Delbrueck and Luria. Comparison of the B and K-12 genomes shows that more than half of the 3793 proteins of their basic genomes are predicted to be identical, although {approx} 310 appear to be functional in either B or K-12 but not in both. The ancestral basic genome appears to have had {approx} 4039 coding sequences occupying {approx} 4.0 Mbp. Repeated horizontal transfer from diverged Escherichia coli genomes and homologous recombination may explain the observed variable distribution of single-base-pair differences. Fifteen sites are occupied by phage-related elements, but only six by comparable elements at the same site. More than 50 sites are occupied by IS elements in both B and K, 16 in common, and likely founding IS elements are identified. A signature of widespread cryptic phage P4-type mobile elements was identified. Complex deletions (dense clusters of small deletions and substitutions) apparently removed nonessential genes from {approx} 30 sites in the basic genomes.« less

Evidence of pervasive biologically functional secondary structures within the genomes of eukaryotic single-stranded DNA viruses.

PubMed

Muhire, Brejnev Muhizi; Golden, Michael; Murrell, Ben; Lefeuvre, Pierre; Lett, Jean-Michel; Gray, Alistair; Poon, Art Y F; Ngandu, Nobubelo Kwanele; Semegni, Yves; Tanov, Emil Pavlov; Monjane, Adérito Luis; Harkins, Gordon William; Varsani, Arvind; Shepherd, Dionne Natalie; Martin, Darren Patrick

2014-02-01

Single-stranded DNA (ssDNA) viruses have genomes that are potentially capable of forming complex secondary structures through Watson-Crick base pairing between their constituent nucleotides. A few of the structural elements formed by such base pairings are, in fact, known to have important functions during the replication of many ssDNA viruses. Unknown, however, are (i) whether numerous additional ssDNA virus genomic structural elements predicted to exist by computational DNA folding methods actually exist and (ii) whether those structures that do exist have any biological relevance. We therefore computationally inferred lists of the most evolutionarily conserved structures within a diverse selection of animal- and plant-infecting ssDNA viruses drawn from the families Circoviridae, Anelloviridae, Parvoviridae, Nanoviridae, and Geminiviridae and analyzed these for evidence of natural selection favoring the maintenance of these structures. While we find evidence that is consistent with purifying selection being stronger at nucleotide sites that are predicted to be base paired than at sites predicted to be unpaired, we also find strong associations between sites that are predicted to pair with one another and site pairs that are apparently coevolving in a complementary fashion. Collectively, these results indicate that natural selection actively preserves much of the pervasive secondary structure that is evident within eukaryote-infecting ssDNA virus genomes and, therefore, that much of this structure is biologically functional. Lastly, we provide examples of various highly conserved but completely uncharacterized structural elements that likely have important functions within some of the ssDNA virus genomes analyzed here.

Evidence of Pervasive Biologically Functional Secondary Structures within the Genomes of Eukaryotic Single-Stranded DNA Viruses

PubMed Central

Muhire, Brejnev Muhizi; Golden, Michael; Murrell, Ben; Lefeuvre, Pierre; Lett, Jean-Michel; Gray, Alistair; Poon, Art Y. F.; Ngandu, Nobubelo Kwanele; Semegni, Yves; Tanov, Emil Pavlov; Monjane, Adérito Luis; Harkins, Gordon William; Varsani, Arvind; Shepherd, Dionne Natalie

2014-01-01

Single-stranded DNA (ssDNA) viruses have genomes that are potentially capable of forming complex secondary structures through Watson-Crick base pairing between their constituent nucleotides. A few of the structural elements formed by such base pairings are, in fact, known to have important functions during the replication of many ssDNA viruses. Unknown, however, are (i) whether numerous additional ssDNA virus genomic structural elements predicted to exist by computational DNA folding methods actually exist and (ii) whether those structures that do exist have any biological relevance. We therefore computationally inferred lists of the most evolutionarily conserved structures within a diverse selection of animal- and plant-infecting ssDNA viruses drawn from the families Circoviridae, Anelloviridae, Parvoviridae, Nanoviridae, and Geminiviridae and analyzed these for evidence of natural selection favoring the maintenance of these structures. While we find evidence that is consistent with purifying selection being stronger at nucleotide sites that are predicted to be base paired than at sites predicted to be unpaired, we also find strong associations between sites that are predicted to pair with one another and site pairs that are apparently coevolving in a complementary fashion. Collectively, these results indicate that natural selection actively preserves much of the pervasive secondary structure that is evident within eukaryote-infecting ssDNA virus genomes and, therefore, that much of this structure is biologically functional. Lastly, we provide examples of various highly conserved but completely uncharacterized structural elements that likely have important functions within some of the ssDNA virus genomes analyzed here. PMID:24284329

Simplified biased random walk model for RecA-protein-mediated homology recognition offers rapid and accurate self-assembly of long linear arrays of binding sites

NASA Astrophysics Data System (ADS)

Kates-Harbeck, Julian; Tilloy, Antoine; Prentiss, Mara

2013-07-01

Inspired by RecA-protein-based homology recognition, we consider the pairing of two long linear arrays of binding sites. We propose a fully reversible, physically realizable biased random walk model for rapid and accurate self-assembly due to the spontaneous pairing of matching binding sites, where the statistics of the searched sample are included. In the model, there are two bound conformations, and the free energy for each conformation is a weakly nonlinear function of the number of contiguous matched bound sites.

How Mg2+ ion and water network affect the stability and structure of non-Watson-Crick base pairs in E. coli loop E of 5S rRNA: a molecular dynamics and reference interaction site model (RISM) study.

PubMed

Shanker, Sudhanshu; Bandyopadhyay, Pradipta

2017-08-01

The non-Watson-Crick (non-WC) base pairs of Escherichia coli loop E of 5S rRNA are stabilized by Mg 2+ ions through water-mediated interaction. It is important to know the synergic role of Mg 2+ and the water network surrounding Mg 2+ in stabilizing the non-WC base pairs of RNA. For this purpose, free energy change of the system is calculated using molecular dynamics (MD) simulation as Mg 2+ is pulled from RNA, which causes disturbance of the water network. It was found that Mg 2+ remains hexahydrated unless it is close to or far from RNA. In the pentahydrated form, Mg 2+ interacts directly with RNA. Water network has been identified by two complimentary methods; MD followed by a density-based clustering algorithm and three-dimensional-reference interaction site model. These two methods gave similar results. Identification of water network around Mg 2+ and non-WC base pairs gives a clue to the strong effect of water network on the stability of this RNA. Based on sequence analysis of all Eubacteria 5s rRNA, we propose that hexahydrated Mg 2+ is an integral part of this RNA and geometry of base pairs surrounding it adjust to accommodate the [Formula: see text]. Overall the findings from this work can help in understanding the basis of the complex structure and stability of RNA with non-WC base pairs.

A contact photo-cross-linking investigation of the active site of the 8-17 deoxyribozyme.

PubMed

Liu, Yong; Sen, Dipankar

2008-09-12

The small RNA-cleaving 8-17 deoxyribozyme (DNAzyme) has been the subject of extensive mechanistic and structural investigation, including a number of recent single-molecule studies of its global folding. Little detailed insight exists, however, into this DNAzyme's active site; for instance, the identity of specific nucleotides that are proximal to or in contact with the scissile site in the substrate. Here, we report a systematic replacement of a number of bases within the magnesium-folded DNAzyme-substrate complex with thio- and halogen-substituted base analogues, which were then photochemically activated to generate contact cross-links within the complex. Mapping of the cross-links revealed a striking pattern of DNAzyme-substrate cross-links but an absence of significant intra-DNAzyme cross-links. Notably, the two nucleotides directly flanking the scissile phosphodiester cross-linked strongly with functionally important elements within the DNAzyme, the thymine of a G.T wobble base pair, a WCGR bulge loop, and a terminal AGC loop. Mutation of the wobble base pair to a G-C pair led to a significant folding instability of the DNAzyme-substrate complex. The cross-linking patterns obtained were used to generate a model for the DNAzyme's active site that had the substrate's scissile phosphodiester sandwiched between the DNAzyme's wobble thymine and its AGC and WCGR loops.

Hydration sites of unpaired RNA bases: a statistical analysis of the PDB structures.

PubMed

Kirillova, Svetlana; Carugo, Oliviero

2011-10-19

Hydration is crucial for RNA structure and function. X-ray crystallography is the most commonly used method to determine RNA structures and hydration and, therefore, statistical surveys are based on crystallographic results, the number of which is quickly increasing. A statistical analysis of the water molecule distribution in high-resolution X-ray structures of unpaired RNA nucleotides showed that: different bases have the same penchant to be surrounded by water molecules; clusters of water molecules indicate possible hydration sites, which, in some cases, match those of the major and minor grooves of RNA and DNA double helices; complex hydrogen bond networks characterize the solvation of the nucleotides, resulting in a significant rigidity of the base and its surrounding water molecules. Interestingly, the hydration sites around unpaired RNA bases do not match, in general, the positions that are occupied by the second nucleotide when the base-pair is formed. The hydration sites around unpaired RNA bases were found. They do not replicate the atom positions of complementary bases in the Watson-Crick pairs.

Hydration sites of unpaired RNA bases: a statistical analysis of the PDB structures

PubMed Central

2011-01-01

Background Hydration is crucial for RNA structure and function. X-ray crystallography is the most commonly used method to determine RNA structures and hydration and, therefore, statistical surveys are based on crystallographic results, the number of which is quickly increasing. Results A statistical analysis of the water molecule distribution in high-resolution X-ray structures of unpaired RNA nucleotides showed that: different bases have the same penchant to be surrounded by water molecules; clusters of water molecules indicate possible hydration sites, which, in some cases, match those of the major and minor grooves of RNA and DNA double helices; complex hydrogen bond networks characterize the solvation of the nucleotides, resulting in a significant rigidity of the base and its surrounding water molecules. Interestingly, the hydration sites around unpaired RNA bases do not match, in general, the positions that are occupied by the second nucleotide when the base-pair is formed. Conclusions The hydration sites around unpaired RNA bases were found. They do not replicate the atom positions of complementary bases in the Watson-Crick pairs. PMID:22011380

Contacts between the factor TUF and RPG sequences.

PubMed

Vignais, M L; Huet, J; Buhler, J M; Sentenac, A

1990-08-25

The yeast TUF factor binds specifically to RPG-like sequences involved in multiple functions at enhancers, silencers, and telomeres. We have characterized the interaction of TUF with its optimal binding sequence, rpg-1 (1-ACACCCATACATTT-14), using a gel DNA-binding assay in combination with methylation protection and mutagenesis experiments. As many as 10 base pairs appear to be engaged in factor binding. Analysis of a collection of 30 different RPG mutants demonstrated the importance of 8 base pairs at position 2, 3, 4, 5, 6, 7, 10, and 12 and the critical role of the central GC pair at position 5. Methylation protection data on four different natural sites confirmed a close contact at positions 4, 5, 6, and 10 and suggested additional contacts at base pairs 8, 12, and 13. The derived consensus sequence was RCAAYCCRYNCAYY. A quantitative band shift analysis was used to determine the equilibrium dissociation constant for the complex of TUF and its optimal binding site rpg-1. The specific dissociation constant (K8) was found to be 1.3 x 10(-11) M. The comparison of the K8 value with the dissociation constant obtained for nonspecific DNA sites (Kn8 = 8.7 x 10(-6) M) shows the high binding selectivity of TUF for its specific RPG target.

Molecular flip–flops formed by overlapping Fis sites

PubMed Central

Hengen, Paul N.; Lyakhov, Ilya G.; Stewart, Lisa E.; Schneider, Thomas D.

2003-01-01

The DNA-binding protein Fis frequently uses pairs of sites 7 or 11 base pairs (bp) apart. Two overlapping Fis sites separated by 11 bp are found in the Escherichia coli origin of chromosomal replication. Only one of these sites is bound by Fis at a time, so the structure is a molecular flip–flop that could direct alternative firing of replication complexes in opposite directions. Alternatively, the flip–flop could represent part of an on–off switch for replication. Because they can be used to create precise switched states, molecular flip–flops could be used as the basis of a novel molecular computer. PMID:14602927

Molecular flip-flops formed by overlapping Fis sites.

PubMed

Hengen, Paul N; Lyakhov, Ilya G; Stewart, Lisa E; Schneider, Thomas D

2003-11-15

The DNA-binding protein Fis frequently uses pairs of sites 7 or 11 base pairs (bp) apart. Two overlapping Fis sites separated by 11 bp are found in the Escherichia coli origin of chromosomal replication. Only one of these sites is bound by Fis at a time, so the structure is a molecular flip-flop that could direct alternative firing of replication complexes in opposite directions. Alternatively, the flip-flop could represent part of an on-off switch for replication. Because they can be used to create precise switched states, molecular flip-flops could be used as the basis of a novel molecular computer.

A single Watson-Crick G x C base pair in water: aqueous hydrogen bonds in hydrophobic cavities.

PubMed

Sawada, Tomohisa; Fujita, Makoto

2010-05-26

Hydrogen bond (H-bond) formation in water has been a challenging task because water molecules are constant competitors. In biological systems, however, stable H-bonds are formed by shielding the H-bonding sites from the competing water molecules within hydrophobic pockets. Inspired by the nature's elaborated way, we found that even mononucleotides (G and C) can form the minimal G x C Watson-Crick pair in water by simply providing a synthetic cavity that efficiently shields the Watson-Crick H-bonding sites. The minimal Watson-Crick structure in water was elucidated by NMR study and firmly characterized by crystallographic analysis. The crystal structure also displays that, within the cavity, coencapsulated anions and solvents efficiently mediate the minimal G x C Watson-Crick pair formation. Furthermore, the competition experiments with the other nucleobases clearly revealed the evident selectivity for the G x C base pairing in water. These results show the fact that a H-bonded nucleobase pair was effectively induced and stabilized in the local environment of an artificial hydrophobic cavity.

Stacked-unstacked equilibrium at the nick site of DNA.

PubMed

Protozanova, Ekaterina; Yakovchuk, Peter; Frank-Kamenetskii, Maxim D

2004-09-17

Stability of duplex DNA with respect to separation of complementary strands is crucial for DNA executing its major functions in the cell and it also plays a central role in major biotechnology applications of DNA: DNA sequencing, polymerase chain reaction, and DNA microarrays. Two types of interaction are well known to contribute to DNA stability: stacking between adjacent base-pairs and pairing between complementary bases. However, their contribution into the duplex stability is yet to be determined. Now we fill this fundamental gap in our knowledge of the DNA double helix. We have prepared a series of 32, 300 bp-long DNA fragments with solitary nicks in the same position differing only in base-pairs flanking the nick. Electrophoretic mobility of these fragments in the gel has been studied. Assuming the equilibrium between stacked and unstacked conformations at the nick site, all 32 stacking free energy parameters have been obtained. Only ten of them are essential and they govern the stacking interactions between adjacent base-pairs in intact DNA double helix. A full set of DNA stacking parameters has been determined for the first time. From these data and from a well-known dependence of DNA melting temperature on G.C content, the contribution of base-pairing into duplex stability has been estimated. The obtained energy parameters of the DNA double helix are of paramount importance for understanding sequence-dependent DNA flexibility and for numerous biotechnology applications.

Homologous Chromosome Pairing in Drosophila melanogaster Proceeds through Multiple Independent Initiations

PubMed Central

Fung, Jennifer C.; Marshall, Wallace F.; Dernburg, Abby; Agard, David A.; Sedat, John W.

1998-01-01

The dynamics by which homologous chromosomes pair is currently unknown. Here, we use fluorescence in situ hybridization in combination with three-dimensional optical microscopy to show that homologous pairing of the somatic chromosome arm 2L in Drosophila occurs by independent initiation of pairing at discrete loci rather than by a processive zippering of sites along the length of chromosome. By evaluating the pairing frequencies of 11 loci on chromosome arm 2L over several timepoints during Drosophila embryonic development, we show that all 11 loci are paired very early in Drosophila development, within 13 h after egg deposition. To elucidate whether such pairing occurs by directed or undirected motion, we analyzed the pairing kinetics of histone loci during nuclear cycle 14. By measuring changes of nuclear length and correlating these changes with progression of time during cycle 14, we were able to express the pairing frequency and distance between homologous loci as a function of time. Comparing the experimentally determined dynamics of pairing to simulations based on previously proposed models of pairing motion, we show that the observed pairing kinetics are most consistent with a constrained random walk model and not consistent with a directed motion model. Thus, we conclude that simple random contacts through diffusion could suffice to allow pairing of homologous sites. PMID:9531544

Homologous chromosome pairing in Drosophila melanogaster proceeds through multiple independent initiations.

PubMed

Fung, J C; Marshall, W F; Dernburg, A; Agard, D A; Sedat, J W

1998-04-06

The dynamics by which homologous chromosomes pair is currently unknown. Here, we use fluorescence in situ hybridization in combination with three-dimensional optical microscopy to show that homologous pairing of the somatic chromosome arm 2L in Drosophila occurs by independent initiation of pairing at discrete loci rather than by a processive zippering of sites along the length of chromosome. By evaluating the pairing frequencies of 11 loci on chromosome arm 2L over several timepoints during Drosophila embryonic development, we show that all 11 loci are paired very early in Drosophila development, within 13 h after egg deposition. To elucidate whether such pairing occurs by directed or undirected motion, we analyzed the pairing kinetics of histone loci during nuclear cycle 14. By measuring changes of nuclear length and correlating these changes with progression of time during cycle 14, we were able to express the pairing frequency and distance between homologous loci as a function of time. Comparing the experimentally determined dynamics of pairing to simulations based on previously proposed models of pairing motion, we show that the observed pairing kinetics are most consistent with a constrained random walk model and not consistent with a directed motion model. Thus, we conclude that simple random contacts through diffusion could suffice to allow pairing of homologous sites.

Comparison of the conformation of an oligonucleotide containing a central G-T base pair with the non-mismatch sequence by proton NMR.

PubMed Central

Quignard, E; Fazakerley, G V; van der Marel, G; van Boom, J H; Guschlbauer, W

1987-01-01

We have recorded NOESY spectra of two non-selfcomplementary undecanucleotide duplexes. From the observed NOEs we do not detect any significant distortion of the helix when a G-C pair is replaced by a G-T pair and the normal interresidue connectivities can be followed through the mismatch site. We conclude that the 2D spectra of the non-exchangeable protons do not allow differentiation between a wobble or rare tautomer form for the mismatch. NOE measurements in H2O, however, clearly show that the mismatch adopts a wobble structure and give information on the hydration in the minor groove for the G-T base pair which is embedded between two A-T base pairs in the sequence. PMID:3033602

Structural landscape of base pairs containing post-transcriptional modifications in RNA

PubMed Central

Seelam, Preethi P.; Sharma, Purshotam

2017-01-01

Base pairs involving post-transcriptionally modified nucleobases are believed to play important roles in a wide variety of functional RNAs. Here we present our attempts toward understanding the structural and functional role of naturally occurring modified base pairs using a combination of X-ray crystal structure database analysis, sequence analysis, and advanced quantum chemical methods. Our bioinformatics analysis reveals that despite their presence in all major secondary structural elements, modified base pairs are most prevalent in tRNA crystal structures and most commonly involve guanine or uridine modifications. Further, analysis of tRNA sequences reveals additional examples of modified base pairs at structurally conserved tRNA regions and highlights the conservation patterns of these base pairs in three domains of life. Comparison of structures and binding energies of modified base pairs with their unmodified counterparts, using quantum chemical methods, allowed us to classify the base modifications in terms of the nature of their electronic structure effects on base-pairing. Analysis of specific structural contexts of modified base pairs in RNA crystal structures revealed several interesting scenarios, including those at the tRNA:rRNA interface, antibiotic-binding sites on the ribosome, and the three-way junctions within tRNA. These scenarios, when analyzed in the context of available experimental data, allowed us to correlate the occurrence and strength of modified base pairs with their specific functional roles. Overall, our study highlights the structural importance of modified base pairs in RNA and points toward the need for greater appreciation of the role of modified bases and their interactions, in the context of many biological processes involving RNA. PMID:28341704

Unique active site promotes error-free replication opposite an 8-oxo-guanine lesion by human DNA polymerase iota

PubMed Central

Kirouac, Kevin N.; Ling, Hong

2011-01-01

The 8-oxo-guanine (8-oxo-G) lesion is the most abundant and mutagenic oxidative DNA damage existing in the genome. Due to its dual coding nature, 8-oxo-G causes most DNA polymerases to misincorporate adenine. Human Y-family DNA polymerase iota (polι) preferentially incorporates the correct cytosine nucleotide opposite 8-oxo-G. This unique specificity may contribute to polι’s biological role in cellular protection against oxidative stress. However, the structural basis of this preferential cytosine incorporation is currently unknown. Here we present four crystal structures of polι in complex with DNA containing an 8-oxo-G lesion, paired with correct dCTP or incorrect dATP, dGTP, and dTTP nucleotides. An exceptionally narrow polι active site restricts the purine bases in a syn conformation, which prevents the dual coding properties of 8-oxo-G by inhibiting syn/anti conformational equilibrium. More importantly, the 8-oxo-G base in a syn conformation is not mutagenic in polι because its Hoogsteen edge does not form a stable base pair with dATP in the narrow active site. Instead, the syn 8-oxo-G template base forms the most stable replicating base pair with correct dCTP due to its small pyrimidine base size and enhanced hydrogen bonding with the Hoogsteen edge of 8-oxo-G. In combination with site directed mutagenesis, we show that Gln59 in the finger domain specifically interacts with the additional O8 atom of the lesion base, which influences nucleotide selection, enzymatic efficiency, and replication stalling at the lesion site. Our work provides the structural mechanism of high-fidelity 8-oxo-G replication by a human DNA polymerase. PMID:21300901

Crystallization and preliminary X-ray diffraction analysis of the Bacillus subtilis replication termination protein in complex with the 37-base-pair TerI-binding site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vivian, J. P.; Porter, C.; Wilce, J. A.

2006-11-01

A preparation of replication terminator protein (RTP) of B. subtilis and a 37-base-pair TerI sequence (comprising two binding sites for RTP) has been purified and crystallized. The replication terminator protein (RTP) of Bacillus subtilis binds to specific DNA sequences that halt the progression of the replisome in a polar manner. These terminator complexes flank a defined region of the chromosome into which they allow replication forks to enter but not exit. Forcing the fusion of replication forks in a specific zone is thought to allow the coordination of post-replicative processes. The functional terminator complex comprises two homodimers each of 29more » kDa bound to overlapping binding sites. A preparation of RTP and a 37-base-pair TerI sequence (comprising two binding sites for RTP) has been purified and crystallized. A data set to 3.9 Å resolution with 97.0% completeness and an R{sub sym} of 12% was collected from a single flash-cooled crystal using synchrotron radiation. The diffraction data are consistent with space group P622, with unit-cell parameters a = b = 118.8, c = 142.6 Å.« less

Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

PubMed

Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

2017-07-06

The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

The 5S rRNA loop E: chemical probing and phylogenetic data versus crystal structure.

PubMed

Leontis, N B; Westhof, E

1998-09-01

A significant fraction of the bases in a folded, structured RNA molecule participate in noncanonical base pairing interactions, often in the context of internal loops or multi-helix junction loops. The appearance of each new high-resolution RNA structure provides welcome data to guide efforts to understand and predict RNA 3D structure, especially when the RNA in question is a functionally conserved molecule. The recent publication of the crystal structure of the "Loop E" region of bacterial 5S ribosomal RNA is such an event [Correll CC, Freeborn B, Moore PB, Steitz TA, 1997, Cell 91:705-712]. In addition to providing more examples of already established noncanonical base pairs, such as purine-purine sheared pairings, trans-Hoogsteen UA, and GU wobble pairs, the structure provides the first high-resolution views of two new purine-purine pairings and a new GU pairing. The goal of the present analysis is to expand the capabilities of both chemical probing and phylogenetic analysis to predict with greater accuracy the structures of RNA molecules. First, in light of existing chemical probing data, we investigate what lessons could be learned regarding the interpretation of this widely used method of RNA structure probing. Then we analyze the 3D structure with reference to molecular phylogeny data (assuming conservation of function) to discover what alternative base pairings are geometrically compatible with the structure. The comparisons between previous modeling efforts and crystal structures show that the intricate involvements of ions and water molecules in the maintenance of non-Watson-Crick pairs render the process of correctly identifying the interacting sites in such pairs treacherous, except in cases of trans-Hoogsteen A/U or sheared A/G pairs for the adenine N1 site. The phylogenetic analysis identifies A/A, A/C, A/U and C/A, C/C, and C/U pairings isosteric with sheared A/G, as well as A/A and A/C pairings isosteric with both G/U and G/G bifurcated pairings. Thus, each non-Watson-Crick pair could be characterized by a phylogenetic signature of variations between isosteric-like pairings. In addition to the conservative changes, which form a dictionary of pairings isosterically compatible with those observed in the crystal structure, concerted changes involving several base pairs also occur. The latter covariations may indicate transitions between related but distinctive motifs within the loop E of 5S ribosomal RNA.

Simple physics-based analytical formulas for the potentials of mean force of the interaction of amino-acid side chains in water. V. Like-charged side chains.

PubMed

Makowski, Mariusz; Liwo, Adam; Sobolewski, Emil; Scheraga, Harold A

2011-05-19

A new model of side-chain-side-chain interactions for charged side-chains of amino acids, to be used in the UNRES force-field, has been developed, in which a side chain consists of a nonpolar and a charged site. The interaction energy between the nonpolar sites is composed of a Gay-Berne and a cavity term; the interaction energy between the charged sites consists of a Lennard-Jones term, a Coulombic term, a generalized-Born term, and a cavity term, while the interaction energy between the nonpolar and charged sites is composed of a Gay-Berne and a polarization term. We parametrized the energy function for the models of all six pairs of natural like-charged amino-acid side chains, namely propionate-propionate (for the aspartic acid-aspartic acid pair), butyrate-butyrate (for the glutamic acid-glutamic acid pair), propionate-butyrate (for the aspartic acid-glutamic acid pair), pentylamine cation-pentylamine cation (for the lysine-lysine pair), 1-butylguanidine cation-1-butylguanidine cation (for the arginine-arginine pair), and pentylamine cation-1-butylguanidine cation (for the lysine-arginine pair). By using umbrella-sampling molecular dynamics simulations in explicit TIP3P water, we determined the potentials of mean force of the above-mentioned pairs as functions of distance and orientation and fitted analytical expressions to them. The positions and depths of the contact minima and the positions and heights of the desolvation maxima, including their dependence on the orientation of the molecules were well represented by analytical expressions for all systems. The values of the parameters of all the energy components are physically reasonable, which justifies use of such potentials in coarse-grain protein-folding simulations. © 2011 American Chemical Society

Unusual target site disruption by the rare-cutting HNH restriction endonuclease PacI

PubMed Central

Shen, Betty; Heiter, Daniel F.; Chan, Siu-Hong; Wang, Hua; Xu, Shuang-Yong; Morgan, Richard D.; Wilson, Geoffrey G.; Stoddard, Barry L.

2010-01-01

The crystal structure of the rare-cutting HNH restriction endonuclease PacI in complex with its eight base pair target recognition sequence 5'-TTAATTAA-3' has been determined to 1.9 Å resolution. The enzyme forms an extended homodimer, with each subunit containing two zinc-bound motifs surrounding a ββα-metal catalytic site. The latter is unusual in that a tyrosine residue likely initiates strand-cleavage. PacI dramatically distorts its target sequence from Watson-Crick duplex DNA basepairing, with every base separated from its original partner. Two bases on each strand are unpaired, four are engaged in non-canonical A:A and T:T base pairs, and the remaining two bases are matched with new Watson-Crick partners. This represents a highly unusual DNA binding mechanism for a restriction endonuclease, and implies that initial recognition of the target site might involve significantly different contacts from those visualized in the DNA-bound cocrystal structures. PMID:20541511

The crystal structure of an oligo(U):pre-mRNA duplex from a trypanosome RNA editing substrate

PubMed Central

Mooers, Blaine H.M.; Singh, Amritanshu

2011-01-01

Guide RNAs bind antiparallel to their target pre-mRNAs to form editing substrates in reaction cycles that insert or delete uridylates (Us) in most mitochondrial transcripts of trypanosomes. The 5′ end of each guide RNA has an anchor sequence that binds to the pre-mRNA by base-pair complementarity. The template sequence in the middle of the guide RNA directs the editing reactions. The 3′ ends of most guide RNAs have ∼15 contiguous Us that bind to the purine-rich unedited pre-mRNA upstream of the editing site. The resulting U-helix is rich in G·U wobble base pairs. To gain insights into the structure of the U-helix, we crystallized 8 bp of the U-helix in one editing substrate for the A6 mRNA of Trypanosoma brucei. The fragment provides three samples of the 5′-AGA-3′/5′-UUU-3′ base-pair triple. The fusion of two identical U-helices head-to-head promoted crystallization. We obtained X-ray diffraction data with a resolution limit of 1.37 Å. The U-helix had low and high twist angles before and after each G·U wobble base pair; this variation was partly due to shearing of the wobble base pairs as revealed in comparisons with a crystal structure of a 16-nt RNA with all Watson–Crick base pairs. Both crystal structures had wider major grooves at the junction between the poly(U) and polypurine tracts. This junction mimics the junction between the template helix and the U-helix in RNA-editing substrates and may be a site of major groove invasion by RNA editing proteins. PMID:21878548

Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

PubMed

Hwang, Hanshin; Taylor, John-Stephen

2005-03-29

We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the Klenow fragment, and the lesser role of shape selection in insertion by pol eta due to its more open and less constrained active site.

[Association between obesity and DNA methylation among the 7-16 year-old twins].

PubMed

Li, C X; Gao, Y; Gao, W J; Yu, C Q; Lyu, J; Lyu, R R; Duan, J L; Sun, Y; Guo, X H; Wang, S F; Zhou, B; Wang, G; Cao, W H; Li, L M

2018-04-10

Objective: On whole-genome scale, we tried to explore the correlation between obesity-related traits and DNA methylation sites, based on discordant monozygotic twin pairs. Methods: A total of 90 pairs of 6-17 year-old twins were recruited in Chaoyang district, Yanqing district and Fangshan district in Beijing in 2016. Information on twins was gathered through a self-designed questionnaire and results: from physical examination, including height, weight and waist circumference of the subjects under study. DNA methylation detection was chosen on the Illumina Human Methylation EPIC BeadChip. R 3.3.1 language was used to read the DNA methylation signal under quality control on samples and probes. Ebayes function of empirical Bayes paired moderated t -test was used to identify the differential methylated CpG sites (DMCs). VarFit function of empirical Bayes paired moderated Levene test was used to identify the differentially variables CpG sits (DVCs) in obese and normal groups. Results According to the obesity discordance criteria, we collected 23 pairs of twins (age range 7 to 16 years), including 12 male pairs. A total of 817 471 qualified CpG loci were included in the genome-wide correlation analysis. According to the significance level of FDR set as <0.05, no positive sites would meet this standard. When DMC CpG site cg05684382, with the smallest P value (1.26E-06) as on chromosome 12, the DVC CpG site cg26188191 with the smallest P value (6.44E-06) appeared in CMIP gene on chromosome 16. Conclusions: In this study, we analyzed the genome-wide DNA methylation and its correlation with obesity traits. After multiple testing corrections, no positive sites were found to have associated with obesity. However, results from the correlation analysis demonstrated sites cg05684382 (chr: 12) and cg26188191 (chr: 16) might have played a role in the development of obesity. This study provides a methodologic reference for the studies on discordance twins related problems.

Theoretical study on the binding mechanism between N6-methyladenine and natural DNA bases.

PubMed

Song, Qi-Xia; Ding, Zhen-Dong; Liu, Jian-Hua; Li, Yan; Wang, Hai-Jun

2013-03-01

N6-methyladenine (m(6)A) is a rare base naturally occurring in DNA. It is different from the base adenine due to its N-CH(3). Therefore, the base not only pairs with thymine, but also with other DNA bases (cytosine, adenine and guanine). In this work, Møller-Plesset second-order (MP2) method has been used to investigate the binding mechanism between m(6)A and natural DNA bases in gas phase and in aqueous solution. The results show that N-CH(3) changed the way of N6-methyladenine binding to natural DNA bases. The binding style significantly influences the stability of base pairs. The trans-m(6)A:G and trans-m(6)A:C conformers are the most stable among all the base pairs. The existence of solvent can remarkably reduce the stability of the base pairs, and the DNA bases prefer pairing with trans-m(6)A to cis-m(6)A. Besides, the properties of these hydrogen bonds have been analyzed by atom in molecules (AIM) theory, natural bond orbital (NBO) analysis and Wiberg bond indexes (WBI). In addition, pairing with m(6)A decreases the binding energies compared to the normal Watson-Crick base pairs, it may explain the instability of the N6 site methylated DNA in theory.

Modified nucleotides reveal the indirect role of the central base pairs in stabilizing the lac repressor-operator complex.

PubMed Central

Zhang, X; Gottlieb, P A

1995-01-01

Guanine residues in the lac operator were replaced by 2-aminopurine or purine analogues, pairing the modified nucleotides with C. The observed equilibrium dissociation constants for lac repressor binding to substituted operators were measured in 10 mM Tris, 150 mM KCl, 0.1 mM EDTA, 0.1 mM DTE, pH 7.6 at 25 degrees C. These measurements revealed five positions that destabilized the complex when substituted with either analogue. Two positions, which are related by a 2-fold symmetry, are in the major groove of the operator thought to directly interact with the protein. Three sites were in the central region of the operator. A purine analogue at a sixth site perturbed the local DNA structure and destabilized the complex. Alkylation interference experiments of the 2-aminopurine substituted operators demonstrated that, of the five affected, two substitutions displayed altered phosphate interference patterns at the phosphate adjacent to the substituted base. For these operators, complex formation was measured in different concentrations of KCl to assess the contribution of counterion release to the bimolecular process. The results indicated that both complexes were similar to wild-type, although minor changes were observed. The Kobs of the complex was then measured when 2-aminopurine or purine analogues were paired with uracil nucleotide, a base pair that serves to stabilize the DNA. The introduction of the new base pairs revealed two effects on the bimolecular interaction. For those operator sites that are thought to perturb the interaction directly, the affinity of the complex was weakened to levels observed for the singly-substituted operators. In contrast, the nucleotides of 2-aminopurine paired with uracil positioned in the central region of the operator served to enhance the stability of the complex. The purine-uracil base pair substitution on the other hand had a significant destabilizing effect on the interaction. We propose that the central base pairs modulate binding of the complex by altering the intrinsic properties of the DNA. Two specific attributes are required to achieve the lowest free energy of interaction. The DNA must have two interstrand hydrogen bonds to stabilize the duplex and it must have properties associated with directional bending or unwinding. This analysis does not rule out contributions by direct interactions between the protein and the central region of the operator but underscores how indirect effects play a major role in complex formation in this system. Images PMID:7784203

Comparative reactivity of mismatched and unpaired bases in relation to their type and surroundings. Chemical cleavage of DNA mismatches in mutation detection analysis.

PubMed

Yakubovskaya, Marianna G; Belyakova, Anna A; Gasanova, Viktoria K; Belitsky, Gennady A; Dolinnaya, Nina G

2010-07-01

Systematic study of chemical reactivity of non-Watson-Crick base pairs depending on their type and microenvironment was performed on a model system that represents two sets of synthetic DNA duplexes with all types of mismatched and unmatched bases flanked by T.A or G.C pairs. Using comparative cleavage pattern analysis, we identified the main and additional target bases and performed quantitative study of the time course and efficacy of DNA modification caused by potassium permanganate or hydroxylamine. Potassium permanganate in combination with tetraethylammonium chloride was shown to induce DNA cleavage at all mismatched or bulged T residues, as well as at thymines of neighboring canonical pairs. Other mispaired (bulged) bases and thymine residues located on the second position from the mismatch site were not the targets for KMnO(4) attack. In contrast, hydroxylamine cleaved only heteroduplexes containing mismatched or unmatched C residues, and did not modify adjacent cytosines. However when G.C pairs flank bulged C residue, neighboring cytosines are also attacked by hydroxylamine due to defect migration. Chemical reactivity of target bases was shown to correlate strongly with the local disturbance of DNA double helix at mismatch or bulge site. With our model system, we were able to prove the absence of false-negative and false-positive results. Portion of heteroduplex reliably revealed in a mixture with corresponding homoduplex consists of 5% for bulge bases and "open" non-canonical pairs, and 10% for wobble base pairs giving minimal violations in DNA structure. This study provides a complete understanding of the principles of mutation detection methodology based on chemical cleavage of mismatches and clarifies the advantages and limitations of this approach in various biological and conformational studies of DNA. Copyright 2010 Elsevier Masson SAS. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Weina; Hellinga, Homme W.; Beese, Lorena S.

Even though high-fidelity polymerases copy DNA with remarkable accuracy, some base-pair mismatches are incorporated at low frequency, leading to spontaneous mutagenesis. Using high-resolution X-ray crystallographic analysis of a DNA polymerase that catalyzes replication in crystals, we observe that a C {center_dot} A mismatch can mimic the shape of cognate base pairs at the site of incorporation. This shape mimicry enables the mismatch to evade the error detection mechanisms of the polymerase, which would normally either prevent mismatch incorporation or promote its nucleolytic excision. Movement of a single proton on one of the mismatched bases alters the hydrogen-bonding pattern such thatmore » a base pair forms with an overall shape that is virtually indistinguishable from a canonical, Watson-Crick base pair in double-stranded DNA. These observations provide structural evidence for the rare tautomer hypothesis of spontaneous mutagenesis, a long-standing concept that has been difficult to demonstrate directly.« less

Raman spectroscopy of DNA-metal complexes. I. Interactions and conformational effects of the divalent cations: Mg, Ca, Sr, Ba, Mn, Co, Ni, Cu, Pd, and Cd.

PubMed

Duguid, J; Bloomfield, V A; Benevides, J; Thomas, G J

1993-11-01

Interactions of divalent metal cations (Mg2+, Ca2+, Ba2+, Sr2+, Mn2+, Co2+, Ni2+, Cu2+, Pd2+, and Cd2+) with DNA have been investigated by laser Raman spectroscopy. Both genomic calf-thymus DNA (> 23 kilobase pairs) and mononucleosomal fragments (160 base pairs) were employed as targets of metal interaction in solutions containing 5 weight-% DNA and metal:phosphate molar ratios of 0.6:1. Raman difference spectra reveal that transition metal cations (Mn2+, Co2+, Ni2+, Cu2+, Pd2+, and Cd2+) induce the greatest structural changes in B-DNA. The Raman (vibrational) band differences are extensive and indicate partial disordering of the B-form backbone, reduction in base stacking, reduction in base pairing, and specific metal interaction with acceptor sites on the purine (N7) and pyrimidine (N3) rings. Many of the observed spectral changes parallel those accompanying thermal denaturation of B-DNA and suggest that the metals link the bases of denatured DNA. While exocyclic carbonyls of dT, dG, and dC may stabilize metal ligation, correlation plots show that perturbations of the carbonyls are mainly a consequence of metal-induced denaturation of the double helix. Transition metal interactions with the DNA phosphates are weak in comparison to interactions with the bases, except in the case of Cu2+, which strongly perturbs both base and phosphate group vibrations. On the other hand, the Raman signature of B-DNA is largely unperturbed by Mg2+, Ca2+, Sr2+, and Ba2+, suggesting much weaker interactions of the alkaline earth metals with both base and phosphate sites. A notable exception is a moderate perturbation by alkaline earths of purine N7 sites in 160-base pair DNA, with Ca2+ causing the greatest effect. Correlation plots demonstrate a strong interrelationship between perturbations of Raman bands assigned to ring vibrations of the bases and those of bands assigned to exocyclic carbonyls and backbone phosphodiester groups. However, strong correlations do not occur between the Raman phosphodioxy band (centered near 1092 cm-1) and other Raman bands, suggesting that the former is not highly sensitive to the structural changes induced by divalent metal cations. The structural perturbations induced by divalent cations are much greater for > 23-kilobase pair DNA than for 160-base pair DNA, as evidenced by both the Raman difference spectra and the tendency toward the formation of insoluble aggregates. In the presence of transition metals, aggregation of high-molecular-weight DNA is evident at temperatures as low as 11 degrees C. A relationship between DNA melting and aggregation is proposed in which initial metal binding at major groove sites locally destabilizes the B-DNA double helix, causing displacement of the bases away from one another and exposing additional metal binding sites. Metal cation linkage of two displaced bases would allow separate DNA strands to crosslink. Aggregation is proposed to result from the formation of an extended network of these crosslinks.

Mojo Hand, a TALEN design tool for genome editing applications.

PubMed

Neff, Kevin L; Argue, David P; Ma, Alvin C; Lee, Han B; Clark, Karl J; Ekker, Stephen C

2013-01-16

Recent studies of transcription activator-like (TAL) effector domains fused to nucleases (TALENs) demonstrate enormous potential for genome editing. Effective design of TALENs requires a combination of selecting appropriate genetic features, finding pairs of binding sites based on a consensus sequence, and, in some cases, identifying endogenous restriction sites for downstream molecular genetic applications. We present the web-based program Mojo Hand for designing TAL and TALEN constructs for genome editing applications (http://www.talendesign.org). We describe the algorithm and its implementation. The features of Mojo Hand include (1) automatic download of genomic data from the National Center for Biotechnology Information, (2) analysis of any DNA sequence to reveal pairs of binding sites based on a user-defined template, (3) selection of restriction-enzyme recognition sites in the spacer between the TAL monomer binding sites including options for the selection of restriction enzyme suppliers, and (4) output files designed for subsequent TALEN construction using the Golden Gate assembly method. Mojo Hand enables the rapid identification of TAL binding sites for use in TALEN design. The assembly of TALEN constructs, is also simplified by using the TAL-site prediction program in conjunction with a spreadsheet management aid of reagent concentrations and TALEN formulation. Mojo Hand enables scientists to more rapidly deploy TALENs for genome editing applications.

Scanning ARM Cloud Radar Handbook

DOE Office of Scientific and Technical Information (OSTI.GOV)

Widener, K; Bharadwaj, N; Johnson, K

2012-06-18

The scanning ARM cloud radar (SACR) is a polarimetric Doppler radar consisting of three different radar designs based on operating frequency. These are designated as follows: (1) X-band SACR (X-SACR); (2) Ka-band SACR (Ka-SACR); and (3) W-band SACR (W-SACR). There are two SACRs on a single pedestal at each site where SACRs are deployed. The selection of the operating frequencies at each deployed site is predominantly determined by atmospheric attenuation at the site. Because RF attenuation increases with atmospheric water vapor content, ARM's Tropical Western Pacific (TWP) sites use the X-/Ka-band frequency pair. The Southern Great Plains (SGP) and Northmore » Slope of Alaska (NSA) sites field the Ka-/W-band frequency pair. One ARM Mobile Facility (AMF1) has a Ka/W-SACR and the other (AMF2) has a X/Ka-SACR.« less

Sequence dependency of canonical base pair opening in the DNA double helix

PubMed Central

Villa, Alessandra

2017-01-01

The flipping-out of a DNA base from the double helical structure is a key step of many cellular processes, such as DNA replication, modification and repair. Base pair opening is the first step of base flipping and the exact mechanism is still not well understood. We investigate sequence effects on base pair opening using extensive classical molecular dynamics simulations targeting the opening of 11 different canonical base pairs in two DNA sequences. Two popular biomolecular force fields are applied. To enhance sampling and calculate free energies, we bias the simulation along a simple distance coordinate using a newly developed adaptive sampling algorithm. The simulation is guided back and forth along the coordinate, allowing for multiple opening pathways. We compare the calculated free energies with those from an NMR study and check assumptions of the model used for interpreting the NMR data. Our results further show that the neighboring sequence is an important factor for the opening free energy, but also indicates that other sequence effects may play a role. All base pairs are observed to have a propensity for opening toward the major groove. The preferred opening base is cytosine for GC base pairs, while for AT there is sequence dependent competition between the two bases. For AT opening, we identify two non-canonical base pair interactions contributing to a local minimum in the free energy profile. For both AT and CG we observe long-lived interactions with water and with sodium ions at specific sites on the open base pair. PMID:28369121

Analysis of low flows and selected methods for estimating low-flow characteristics at partial-record and ungaged stream sites in western Washington

USGS Publications Warehouse

Curran, Christopher A.; Eng, Ken; Konrad, Christopher P.

2012-01-01

Regional low-flow regression models for estimating Q7,10 at ungaged stream sites are developed from the records of daily discharge at 65 continuous gaging stations (including 22 discontinued gaging stations) for the purpose of evaluating explanatory variables. By incorporating the base-flow recession time constant τ as an explanatory variable in the regression model, the root-mean square error for estimating Q7,10 at ungaged sites can be lowered to 72 percent (for known values of τ), which is 42 percent less than if only basin area and mean annual precipitation are used as explanatory variables. If partial-record sites are included in the regression data set, τ must be estimated from pairs of discharge measurements made during continuous periods of declining low flows. Eight measurement pairs are optimal for estimating τ at partial-record sites, and result in a lowering of the root-mean square error by 25 percent. A low-flow survey strategy that includes paired measurements at partial-record sites requires additional effort and planning beyond a standard strategy, but could be used to enhance regional estimates of τ and potentially reduce the error of regional regression models for estimating low-flow characteristics at ungaged sites.

The electrostatic characteristics of G·U wobble base pairs

PubMed Central

Xu, Darui; Landon, Theresa; Greenbaum, Nancy L.; Fenley, Marcia O.

2007-01-01

G·U wobble base pairs are the most common and highly conserved non-Watson–Crick base pairs in RNA. Previous surface maps imply uniformly negative electrostatic potential at the major groove of G·U wobble base pairs embedded in RNA helices, suitable for entrapment of cationic ligands. In this work, we have used a Poisson–Boltzmann approach to gain a more detailed and accurate characterization of the electrostatic profile. We found that the major groove edge of an isolated G·U wobble displays distinctly enhanced negativity compared with standard GC or AU base pairs; however, in the context of different helical motifs, the electrostatic pattern varies. G·U wobbles with distinct widening have similar major groove electrostatic potentials to their canonical counterparts, whereas those with minimal widening exhibit significantly enhanced electronegativity, ranging from 0.8 to 2.5 kT/e, depending upon structural features. We propose that the negativity at the major groove of G·U wobble base pairs is determined by the combined effect of the base atoms and the sugar-phosphate backbone, which is impacted by stacking pattern and groove width as a result of base sequence. These findings are significant in that they provide predictive power with respect to which G·U sites in RNA are most likely to bind cationic ligands. PMID:17526525

Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

PubMed

Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

2004-03-01

A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson-Crick base pair in SECIS element plays an important role in the selenocysteine expression by UGA codon.

Sequence specificity of mutagen-nucleic acid complexes in solution: intercalation and mutagen-base pair overlap geometries for proflavine binding to dC-dC-dG-dG and dG-dG-dC-dC self-complementary duplexes.

PubMed

Patel, D J; Canuel, L L

1977-07-01

The complex formed between the mutagen proflavine and the dC-dC-dG-dG and dG-dG-dC-dC self-complementary tetranucleotide duplexes has been monitored by proton high resolution nuclear magnetic resonance spectroscopy in 0.1 M phosphate solution at high nucleotide/drug ratios. The large upfield shifts (0.5 to 0.85 ppm) observed at all the proflavine ring nonexchangeable protons on complex formation are consistent with intercalation of the mutagen between base pairs of the tetranucleotide duplex. We have proposed an approximate overlap geometry between the proflavine ring and nearest neighbor base pairs at the intercalation site from a comparison between experimental shifts and those calculated for various stacking orientations. We have compared the binding of actinomycin D, propidium diiodide, and proflavine to self-complementary tetranucleotide sequences dC-dC-dG-dG and dG-dG-dC-dC by UV absorbance changes in the drug bands between 400 and 500 nm. Actinomycin D exhibits a pronounced specificity for sequences with dG-dC sites (dG-dG-dC-dC), while propidium diiodide and proflavine exhibit a specificity for sequences with dC-dG sites (dC-dC-dG-dG). Actinomycin D binds more strongly than propidium diiodide and proflavine to dC-dG-dC-dG (contains dC-dG and dG-dC binding sites), indicative of the additional stabilization from hydrogen bonding and hydrophobic interactions between the pentapeptide lactone rings of actinomycin D and the base pair edges and sugar-phosphate backbone of the tetranucleotide duplex.

Sequence specificity of mutagen-nucleic acid complexes in solution: Intercalation and mutagen-base pair overlap geometries for proflavine binding to dC-dC-dG-dG and dG-dG-dC-dC self-complementary duplexes

PubMed Central

Patel, Dinshaw J.; Canuel, Lita L.

1977-01-01

The complex formed between the mutagen proflavine and the dC-dC-dG-dG and dG-dG-dC-dC self-complementary tetranucleotide duplexes has been monitored by proton high resolution nuclear magnetic resonance spectroscopy in 0.1 M phosphate solution at high nucleotide/drug ratios. The large upfield shifts (0.5 to 0.85 ppm) observed at all the proflavine ring nonexchangeable protons on complex formation are consistent with intercalation of the mutagen between base pairs of the tetranucleotide duplex. We have proposed an approximate overlap geometry between the proflavine ring and nearest neighbor base pairs at the intercalation site from a comparison between experimental shifts and those calculated for various stacking orientations. We have compared the binding of actinomycin D, propidium diiodide, and proflavine to self-complementary tetranucleotide sequences dC-dC-dG-dG and dG-dG-dC-dC by UV absorbance changes in the drug bands between 400 and 500 nm. Actinomycin D exhibits a pronounced specificity for sequences with dG-dC sites (dG-dG-dC-dC), while propidium diiodide and proflavine exhibit a specificity for sequences with dC-dG sites (dC-dC-dG-dG). Actinomycin D binds more strongly than propidium diiodide and proflavine to dC-dG-dC-dG (contains dC-dG and dG-dC binding sites), indicative of the additional stabilization from hydrogen bonding and hydrophobic interactions between the pentapeptide lactone rings of actinomycin D and the base pair edges and sugar-phosphate backbone of the tetranucleotide duplex. PMID:268613

X-ray-structure of a cytidylyl-3',5'-adenosine-proflavine complex: a self-paired parallel-chain double helical dimer with an intercalated acridine dye.

PubMed Central

Westhof, E; Sundaralingam, M

1980-01-01

The non-self-complementary dinucleoside monophosphate cytidylyl-3',5'-adenosine (CpA) forms a base-paired parallel-chain dimer with an intercalated proflavine. The dimer complex possesses a right-handed helical twist. The dimer helix has an irregular girth with a neutral adenine-adenine (A-A) pair, hydrogen-bonded through the N6 and N7 sites (C1'...C1' separation of 10.97 A), and a triply hydrogen-bonded protonated cytosine-cytosine (C-C) pair with a proton shared between the base N3 sites (Cl'...Cl' separation of 9.59 A). The torsion angles of the sugar-phosphate backbone are within their most preferred ranges and the sugar puckering sequence (5' leads to 3') is C3'-endo, C2'-endo. There is also a second proflavine molecule sandwiched between CpA dimers on the 21-axis. Both proflavines are necessarily disordered, being on dyad axis, and this suggests possible insights into the dynamics of intercalation of planar drugs. This structure shows that intercalation of planar drugs in nucleic acids may not be restricted to antiparallel complementary Watson-Crick pairing regions and provides additional mechanisms for acridine mutagenesis. PMID:6929524

The structure of the L3 loop from the hepatitis delta virus ribozyme: a syn cytidine.

PubMed Central

Lynch, S R; Tinoco, I

1998-01-01

The structure of the L3 central hairpin loop isolated from the antigenomic sequence of the hepatitis delta virus ribozyme with the P2 and P3 stems from the ribozyme stacked on top of the loop has been determined by NMR spectroscopy. The 26 nt stem-loop structure contains nine base pairs and a 7 nt loop (5'-UCCUCGC-3'). This hairpin loop is critical for efficient catalysis in the intact ribozyme. The structure was determined using homonuclear and heteronuclear NMR techniques on non-labeled and15N-labeled RNA oligonucleotides. The overall root mean square deviation for the structure was 1.15 A (+/- 0.28 A) for the loop and the closing C.G base pair and 0.90 A (+/- 0.18 A) for the loop and the closing C.G base pair but without the lone purine in the loop, which is not well defined in the structure. The structure indicates a U.C base pair between the nucleotides on the 5'- and 3'-ends of the loop. This base pair is formed with a single hydrogen bond involving the cytosine exocyclic amino proton and the carbonyl O4 of the uracil. The most unexpected finding in the loop is a syn cytidine. While not unprecedented, syn pyrimidines are highly unusual. This one can be confidently established by intranucleotide distances between the ribose and the base determined by NMR spectroscopy. A similar study of the structure of this loop showed a somewhat different three-dimensional structure. A discussion of differences in the two structures, as well as possible sites of interaction with the cleavage site, will be presented. PMID:9461457

Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

PubMed Central

Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

2015-01-01

Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536

Silver (I) as DNA glue: Ag(+)-mediated guanine pairing revealed by removing Watson-Crick constraints.

PubMed

Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G

2015-05-14

Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

CryoEM structure of the spliceosome immediately after branching

PubMed Central

Galej, Wojciech P.; Wilkinson, Max E.; Fica, Sebastian M.; Oubridge, Chris; Newman, Andrew J.; Nagai, Kiyoshi

2016-01-01

Pre-mRNA splicing proceeds by two consecutive trans-esterification reactions via a lariat-intron intermediate. We present the 3.8Å cryoEM structure of the spliceosome immediately after lariat formation. The 5’-splice site is cleaved but remains close to the catalytic Mg2+ site in the U2/U6 snRNA triplex, and the 5’-phosphate of the intron nucleotide G(+1) is linked to the branch adenosine 2’OH. The 5’-exon is held between the Prp8 N-terminal and Linker domains, and base-pairs with U5 snRNA loop 1. Non-Watson-Crick interactions between the branch helix and 5’-splice site dock the branch adenosine into the active site, while intron nucleotides +3 to +6 base-pair with the U6 snRNA ACAGAGA sequence. Isy1 and the step one factors Yju2 and Cwc25 stabilise docking of the branch helix. The intron downstream of the branch site emerges between the Prp8 RT and Linker domains and extends towards Prp16 helicase, suggesting a plausible mechanism of remodelling before exon ligation. PMID:27459055

Homologous pairing and chromosome dynamics in meiosis and mitosis.

PubMed

McKee, Bruce D

2004-03-15

Pairing of homologous chromosomes is an essential feature of meiosis, acting to promote high levels of recombination and to ensure segregation of homologs. However, homologous pairing also occurs in somatic cells, most regularly in Dipterans such as Drosophila, but also to a lesser extent in other organisms, and it is not known how mitotic and meiotic pairing relate to each other. In this article, I summarize results of recent molecular studies of pairing in both mitosis and meiosis, focusing especially on studies using fluorescent in situ hybridization (FISH) and GFP-tagging of single loci, which have allowed investigators to assay the pairing status of chromosomes directly. These approaches have permitted the demonstration that pairing occurs throughout the cell cycle in mitotic cells in Drosophila, and that the transition from mitotic to meiotic pairing in spermatogenesis is accompanied by a dramatic increase in pairing frequency. Similar approaches in mammals, plants and fungi have established that with few exceptions, chromosomes enter meiosis unpaired and that chromosome movements involving the telomeric, and sometimes centromeric, regions often precede the onset of meiotic pairing. The possible roles of proteins involved in homologous recombination, synapsis and sister chromatid cohesion in homolog pairing are discussed with an emphasis on those for which mutant phenotypes have permitted an assessment of effects on homolog pairing. Finally, I consider the question of the distribution and identity of chromosomal pairing sites, using recent data to evaluate possible relationships between pairing sites and other chromosomal sites, such as centromeres, telomeres, promoters and heterochromatin. I cite evidence that may point to a relationship between matrix attachment sites and homologous pairing sites.

Structural Mechanism behind Distinct Efficiency of Oct4/Sox2 Proteins in Differentially Spaced DNA Complexes

PubMed Central

Yesudhas, Dhanusha; Anwar, Muhammad Ayaz; Panneerselvam, Suresh; Durai, Prasannavenkatesh; Shah, Masaud; Choi, Sangdun

2016-01-01

The octamer-binding transcription factor 4 (Oct4) and sex-determining region Y (SRY)-box 2 (Sox2) proteins induce various transcriptional regulators to maintain cellular pluripotency. Most Oct4/Sox2 complexes have either 0 base pairs (Oct4/Sox20bp) or 3 base pairs (Oct4/Sox23bp) separation between their DNA-binding sites. Results from previous biochemical studies have shown that the complexes separated by 0 base pairs are associated with a higher pluripotency rate than those separated by 3 base pairs. Here, we performed molecular dynamics (MD) simulations and calculations to determine the binding free energy and per-residue free energy for the Oct4/Sox20bp and Oct4/Sox23bp complexes to identify structural differences that contribute to differences in induction rate. Our MD simulation results showed substantial differences in Oct4/Sox2 domain movements, as well as secondary-structure changes in the Oct4 linker region, suggesting a potential reason underlying the distinct efficiencies of these complexes during reprogramming. Moreover, we identified key residues and hydrogen bonds that potentially facilitate protein-protein and protein-DNA interactions, in agreement with previous experimental findings. Consequently, our results confess that differential spacing of the Oct4/Sox2 DNA binding sites can determine the magnitude of transcription of the targeted genes during reprogramming. PMID:26790000

A rapid, generally applicable method to engineer zinc fingers illustrated by targeting the HIV-1 promoter.

PubMed

Isalan, M; Klug, A; Choo, Y

2001-07-01

DNA-binding domains with predetermined sequence specificity are engineered by selection of zinc finger modules using phage display, allowing the construction of customized transcription factors. Despite remarkable progress in this field, the available protein-engineering methods are deficient in many respects, thus hampering the applicability of the technique. Here we present a rapid and convenient method that can be used to design zinc finger proteins against a variety of DNA-binding sites. This is based on a pair of pre-made zinc finger phage-display libraries, which are used in parallel to select two DNA-binding domains each of which recognizes given 5 base pair sequences, and whose products are recombined to produce a single protein that recognizes a composite (9 base pair) site of predefined sequence. Engineering using this system can be completed in less than two weeks and yields proteins that bind sequence-specifically to DNA with Kd values in the nanomolar range. To illustrate the technique, we have selected seven different proteins to bind various regions of the human immunodeficiency virus 1 (HIV-1) promoter.

Shape Effect Undermined by Surface Reconstruction: Ethanol Dehydrogenation over Shape-Controlled SrTiO 3 Nanocrystals

DOE PAGES

Foo, Guo Shiou; Hood, Zachary D.; Wu, Zili

2017-12-05

For this research, to gain an in-depth understanding of the surface properties relevant for catalysis using ternary oxides, we report the acid–base pair reactivity of shape-controlled SrTiO 3 (STO) nanocrystals for the dehydrogenation of ethanol. Cubes, truncated cubes, dodecahedra, and etched cubes of STO with varying ratios of (001) and (110) crystal facets were synthesized using a hydrothermal method. Low-energy ion scattering (LEIS) analysis revealed that the (001) surface on cubes of STO is enriched with SrO due to surface reconstruction, resulting in a high ratio of strong base sites. Chemical treatment with dilute nitric acid to form etched cubesmore » of STO resulted in a surface enriched with Ti cations and strong acidity. Furthermore, the strength and distribution of surface acidic sites increase with the ratio of (110) facet from cubes to truncated cubes to dodecahedra for STO. Kinetic, isotopic, and spectroscopy methods show that the dehydrogenation of ethanol proceeds through the facile dissociation of the alcohol group, followed by the cleavage of the C α–H bond, which is the rate-determining step. Co-feeding of various probe molecules during catalysis, such as NH 3, 2,6-di-tert-butylpyridine, CO 2, and SO 2, reveals that a pair of Lewis acid site and basic surface oxygen atom is involved in the dehydrogenation reaction. The surface density of acid–base site pairs was measured using acetic acid as a probe molecule, allowing initial acetaldehyde formation turnover rates to be obtained. Comparison among various catalysts reveals no simple correlation between ethanol turnover rate and the percentage of either surface facet ((001) or (110)) of the STO nanocrystals. Instead, the reaction rate is found to increase with the strength of acid sites but reversely with the strength of base sites. The acid–base property is directly related to the surface composition as a result from different surface reconstruction behaviors of the shaped STO nanocrystals. Lastly, the finding in this work underscores the importance of characterizing the top surface compositions and sites properties when assessing the catalytic performance of shape-controlled complex oxides such as perovskites.« less

Shape Effect Undermined by Surface Reconstruction: Ethanol Dehydrogenation over Shape-Controlled SrTiO 3 Nanocrystals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Foo, Guo Shiou; Hood, Zachary D.; Wu, Zili

For this research, to gain an in-depth understanding of the surface properties relevant for catalysis using ternary oxides, we report the acid–base pair reactivity of shape-controlled SrTiO 3 (STO) nanocrystals for the dehydrogenation of ethanol. Cubes, truncated cubes, dodecahedra, and etched cubes of STO with varying ratios of (001) and (110) crystal facets were synthesized using a hydrothermal method. Low-energy ion scattering (LEIS) analysis revealed that the (001) surface on cubes of STO is enriched with SrO due to surface reconstruction, resulting in a high ratio of strong base sites. Chemical treatment with dilute nitric acid to form etched cubesmore » of STO resulted in a surface enriched with Ti cations and strong acidity. Furthermore, the strength and distribution of surface acidic sites increase with the ratio of (110) facet from cubes to truncated cubes to dodecahedra for STO. Kinetic, isotopic, and spectroscopy methods show that the dehydrogenation of ethanol proceeds through the facile dissociation of the alcohol group, followed by the cleavage of the C α–H bond, which is the rate-determining step. Co-feeding of various probe molecules during catalysis, such as NH 3, 2,6-di-tert-butylpyridine, CO 2, and SO 2, reveals that a pair of Lewis acid site and basic surface oxygen atom is involved in the dehydrogenation reaction. The surface density of acid–base site pairs was measured using acetic acid as a probe molecule, allowing initial acetaldehyde formation turnover rates to be obtained. Comparison among various catalysts reveals no simple correlation between ethanol turnover rate and the percentage of either surface facet ((001) or (110)) of the STO nanocrystals. Instead, the reaction rate is found to increase with the strength of acid sites but reversely with the strength of base sites. The acid–base property is directly related to the surface composition as a result from different surface reconstruction behaviors of the shaped STO nanocrystals. Lastly, the finding in this work underscores the importance of characterizing the top surface compositions and sites properties when assessing the catalytic performance of shape-controlled complex oxides such as perovskites.« less

Physical mapping of the 5S and 18S rDNA in ten species of Hypostomus Lacépède 1803 (Siluriformes: Loricariidae): evolutionary tendencies in the genus.

PubMed

Bueno, Vanessa; Venere, Paulo César; Thums Konerat, Jocicléia; Zawadzki, Cláudio Henrique; Vicari, Marcelo Ricardo; Margarido, Vladimir Pavan

2014-01-01

Hypostomus is a diverse group with unclear aspects regarding its biology, including the mechanisms that led to chromosome diversification within the group. Fluorescence in situ hybridization (FISH) with 5S and 18S rDNA probes was performed on ten Hypostomini species. Hypostomus faveolus, H. cochliodon, H. albopunctatus, H. aff. paulinus, and H. topavae had only one chromosome pair with 18S rDNA sites, while H. ancistroides, H. commersoni, H. hermanni, H. regani, and H. strigaticeps had multiple 18S rDNA sites. Regarding the 5S rDNA genes, H. ancistroides, H. regani, H. albopunctatus, H. aff. paulinus, and H. topavae had 5S rDNA sites on only one chromosome pair and H. faveolus, H. cochliodon, H. commersoni, H. hermanni, and H. strigaticeps had multiple 5S rDNA sites. Most species had 18S rDNA sites in the telomeric region of the chromosomes. All species but H. cochliodon had 5S rDNA in the centromeric/pericentromeric region of one metacentric pair. Obtained results are discussed based on existent phylogenies for the genus, with comments on possible dispersion mechanisms to justify the variability of the rDNA sites in Hypostomus.

Synthesis and binding properties of new selective ligands for the nucleobase opposite the AP site.

PubMed

Abe, Yukiko; Nakagawa, Osamu; Yamaguchi, Rie; Sasaki, Shigeki

2012-06-01

DNA is continuously damaged by endogenous and exogenous factors such as oxidative stress or DNA alkylating agents. These damaged nucleobases are removed by DNA N-glycosylase and form apurinic/apyrimidinic sites (AP sites) as intermediates in the base excision repair (BER) pathway. AP sites are also representative DNA damages formed by spontaneous hydrolysis. The AP sites block DNA polymerase and a mismatch nucleobase is inserted opposite the AP sites by polymerization to cause acute toxicities and mutations. Thus, AP site specific compounds have attracted much attention for therapeutic and diagnostic purposes. In this study, we have developed nucleobase-polyamine conjugates as the AP site binding ligand by expecting that the nucleobase part would play a role in the specific recognition of the nucleobase opposite the AP site by the Watson-Crick base pair formation and that the polyamine part should contribute to the access of the ligand to the AP site by a non-specific interaction to the DNA phosphate backbone. The nucleobase conjugated with 3,3'-diaminodipropylamine (A-ligand, G-ligand, C-ligand, T-ligand and U-ligand) showed a specific stabilization of the duplex containing the AP site depending on the complementary combination with the nucleobase opposite the AP site; that is A-ligand to T, G-ligand to C, C-ligand to G, T- and U-ligand to A. The thermodynamic binding parameters clearly indicated that the specific stabilization is due to specific binding of the ligands to the complementary AP site. These results have suggested that the complementary base pairs of the Watson-Crick type are formed at the AP site. Copyright © 2012 Elsevier Ltd. All rights reserved.

A simple and highly selective 2,2-diferrocenylpropane-based multi-channel ion pair receptor for Pb(2+) and HSO4(-).

PubMed

Wan, Qian; Zhuo, Ji-Bin; Wang, Xiao-Xue; Lin, Cai-Xia; Yuan, Yao-Feng

2015-03-28

A structurally simple, 2,2-diferrocenylpropane-based ion pair receptor 1 was synthesized and characterized by (1)H NMR, (13)C NMR, HRMS, elemental analyses, and single-crystal X-ray diffraction. The ion pair receptor 1 showed excellent selectivity and sensitivity towards Pb(2+) with multi-channel responses: a fluorescence enhancement (more than 42-fold), a notable color change from yellow to red, redox anodic shift (ΔE1/2 = 151 mV), while HSO4(-) promoted fluorescence enhancement when Pb(2+) or Zn(2+) was bonded to the cation binding-site. (1)H NMR titration and density functional theory were performed to reveal the sensing mechanism based on photo-induced electron transfer (PET).

Universal fingerprinting chip server.

PubMed

Casique-Almazán, Janet; Larios-Serrato, Violeta; Olguín-Ruíz, Gabriela Edith; Sánchez-Vallejo, Carlos Javier; Maldonado-Rodríguez, Rogelio; Méndez-Tenorio, Alfonso

2012-01-01

The Virtual Hybridization approach predicts the most probable hybridization sites across a target nucleic acid of known sequence, including both perfect and mismatched pairings. Potential hybridization sites, having a user-defined minimum number of bases that are paired with the oligonucleotide probe, are first identified. Then free energy values are evaluated for each potential hybridization site, and if it has a calculated free energy of equal or higher negative value than a user-defined free energy cut-off value, it is considered as a site of high probability of hybridization. The Universal Fingerprinting Chip Applications Server contains the software for visualizing predicted hybridization patterns, which yields a simulated hybridization fingerprint that can be compared with experimentally derived fingerprints or with a virtual fingerprint arising from a different sample. The database is available for free at http://bioinformatica.homelinux.org/UFCVH/

Solid frustrated-Lewis-pair catalysts constructed by regulations on surface defects of porous nanorods of CeO2

PubMed Central

Zhang, Sai; Huang, Zheng-Qing; Ma, Yuanyuan; Gao, Wei; Li, Jing; Cao, Fangxian; Li, Lin; Chang, Chun-Ran; Qu, Yongquan

2017-01-01

Identification on catalytic sites of heterogeneous catalysts at atomic level is important to understand catalytic mechanism. Surface engineering on defects of metal oxides can construct new active sites and regulate catalytic activity and selectivity. Here we outline the strategy by controlling surface defects of nanoceria to create the solid frustrated Lewis pair (FLP) metal oxide for efficient hydrogenation of alkenes and alkynes. Porous nanorods of ceria (PN-CeO2) with a high concentration of surface defects construct new Lewis acidic sites by two adjacent surface Ce3+. The neighbouring surface lattice oxygen as Lewis base and constructed Lewis acid create solid FLP site due to the rigid lattice of ceria, which can easily dissociate H–H bond with low activation energy of 0.17 eV. PMID:28516952

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ogle, James M.; Brodersen, Ditlev E.; Clemons, William M.

Crystal structures of the 30S ribosomal subunit in complex with messenger RNA and cognate transfer RNA in the A site, both in the presence and absence of the antibiotic paromomycin, have been solved at between 3.1 and 3.3 angstroms resolution. Cognate transfer RNA (tRNA) binding induces global domain movements of the 30S subunit and changes in the conformation of the universally conserved and essential bases A1492, A1493, and G530 of 16S RNA. These bases interact intimately with the minor groove of the first two base pairs between the codon and anticodon, thus sensing Watson-Crick base-pairing geometry and discriminating against near-cognatemore » tRNA. The third, or 'wobble,' position of the codon is free to accommodate certain noncanonical base pairs. By partially inducing these structural changes, paromomycin facilitates binding of near-cognate tRNAs.« less

A tale of two sequences: microRNA-target chimeric reads.

PubMed

Broughton, James P; Pasquinelli, Amy E

2016-04-04

In animals, a functional interaction between a microRNA (miRNA) and its target RNA requires only partial base pairing. The limited number of base pair interactions required for miRNA targeting provides miRNAs with broad regulatory potential and also makes target prediction challenging. Computational approaches to target prediction have focused on identifying miRNA target sites based on known sequence features that are important for canonical targeting and may miss non-canonical targets. Current state-of-the-art experimental approaches, such as CLIP-seq (cross-linking immunoprecipitation with sequencing), PAR-CLIP (photoactivatable-ribonucleoside-enhanced CLIP), and iCLIP (individual-nucleotide resolution CLIP), require inference of which miRNA is bound at each site. Recently, the development of methods to ligate miRNAs to their target RNAs during the preparation of sequencing libraries has provided a new tool for the identification of miRNA target sites. The chimeric, or hybrid, miRNA-target reads that are produced by these methods unambiguously identify the miRNA bound at a specific target site. The information provided by these chimeric reads has revealed extensive non-canonical interactions between miRNAs and their target mRNAs, and identified many novel interactions between miRNAs and noncoding RNAs.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xia, Shuangluo; Vashishtha, Ashwani; Bulkley, David

During DNA synthesis, base stacking and Watson-Crick (WC) hydrogen bonding increase the stability of nascent base pairs when they are in a ternary complex. To evaluate the contribution of base stacking to the incorporation efficiency of dNTPs when a DNA polymerase encounters an abasic site, we varied the penultimate base pairs (PBs) adjacent to the abasic site using all 16 possible combinations. We then determined pre-steady-state kinetic parameters with an RB69 DNA polymerase variant and solved nine structures of the corresponding ternary complexes. The efficiency of incorporation for incoming dNTPs opposite an abasic site varied between 2- and 210-fold dependingmore » on the identity of the PB. We propose that the A rule can be extended to encompass the fact that DNA polymerase can bypass dA/abasic sites more efficiently than other dN/abasic sites. Crystal structures of the ternary complexes show that the surface of the incoming base was stacked against the PB's interface and that the kinetic parameters for dNMP incorporation were consistent with specific features of base stacking, such as surface area and partial charge-charge interactions between the incoming base and the PB. Without a templating nucleotide residue, an incoming dNTP has no base with which it can hydrogen bond and cannot be desolvated, so that these surrounding water molecules become ordered and remain on the PB's surface in the ternary complex. When these water molecules are on top of a hydrophobic patch on the PB, they destabilize the ternary complex, and the incorporation efficiency of incoming dNTPs is reduced.« less

Structure of p73 DNA-binding domain tetramer modulates p73 transactivation

PubMed Central

Ethayathulla, Abdul S.; Tse, Pui-Wah; Monti, Paola; Nguyen, Sonha; Inga, Alberto; Fronza, Gilberto; Viadiu, Hector

2012-01-01

The transcription factor p73 triggers developmental pathways and overlaps stress-induced p53 transcriptional pathways. How p53-family response elements determine and regulate transcriptional specificity remains an unsolved problem. In this work, we have determined the first crystal structures of p73 DNA-binding domain tetramer bound to response elements with spacers of different length. The structure and function of the adaptable tetramer are determined by the distance between two half-sites. The structures with zero and one base-pair spacers show compact p73 DNA-binding domain tetramers with large tetramerization interfaces; a two base-pair spacer results in DNA unwinding and a smaller tetramerization interface, whereas a four base-pair spacer hinders tetramerization. Functionally, p73 is more sensitive to spacer length than p53, with one base-pair spacer reducing 90% of transactivation activity and longer spacers reducing transactivation to basal levels. Our results establish the quaternary structure of the p73 DNA-binding domain required as a scaffold to promote transactivation. PMID:22474346

Analyses of frameshifting at UUU-pyrimidine sites.

PubMed

Schwartz, R; Curran, J F

1997-05-15

Others have recently shown that the UUU phenylalanine codon is highly frameshift-prone in the 3'(rightward) direction at pyrimidine 3'contexts. Here, several approaches are used to analyze frameshifting at such sites. The four permutations of the UUU/C (phenylalanine) and CGG/U (arginine) codon pairs were examined because they vary greatly in their expected frameshifting tendencies. Furthermore, these synonymous sites allow direct tests of the idea that codon usage can control frameshifting. Frameshifting was measured for these dicodons embedded within each of two broader contexts: the Escherichia coli prfB (RF2 gene) programmed frameshift site and a 'normal' message site. The principal difference between these contexts is that the programmed frameshift contains a purine-rich sequence upstream of the slippery site that can base pair with the 3'end of 16 S rRNA (the anti-Shine-Dalgarno) to enhance frameshifting. In both contexts frameshift frequencies are highest if the slippery tRNAPhe is capable of stable base pairing in the shifted reading frame. This requirement is less stringent in the RF2 context, as if the Shine-Dalgarno interaction can help stabilize a quasi-stable rephased tRNA:message complex. It was previously shown that frameshifting in RF2 occurs more frequently if the codon 3'to the slippery site is read by a rare tRNA. Consistent with that earlier work, in the RF2 context frameshifting occurs substantially more frequently if the arginine codon is CGG, which is read by a rare tRNA. In contrast, in the 'normal' context frameshifting is only slightly greater at CGG than at CGU. It is suggested that the Shine-Dalgarno-like interaction elevates frameshifting specifically during the pause prior to translation of the second codon, which makes frameshifting exquisitely sensitive to the rate of translation of that codon. In both contexts frameshifting increases in a mutant strain that fails to modify tRNA base A37, which is 3'of the anticodon. Thus, those base modifications may limit frameshifting at UUU codons. Finally, statistical analyses show that UUU Ynn dicodons are extremely rare in E.coli genes that have highly biased codon usage.

Analyses of frameshifting at UUU-pyrimidine sites.

PubMed Central

Schwartz, R; Curran, J F

1997-01-01

Others have recently shown that the UUU phenylalanine codon is highly frameshift-prone in the 3'(rightward) direction at pyrimidine 3'contexts. Here, several approaches are used to analyze frameshifting at such sites. The four permutations of the UUU/C (phenylalanine) and CGG/U (arginine) codon pairs were examined because they vary greatly in their expected frameshifting tendencies. Furthermore, these synonymous sites allow direct tests of the idea that codon usage can control frameshifting. Frameshifting was measured for these dicodons embedded within each of two broader contexts: the Escherichia coli prfB (RF2 gene) programmed frameshift site and a 'normal' message site. The principal difference between these contexts is that the programmed frameshift contains a purine-rich sequence upstream of the slippery site that can base pair with the 3'end of 16 S rRNA (the anti-Shine-Dalgarno) to enhance frameshifting. In both contexts frameshift frequencies are highest if the slippery tRNAPhe is capable of stable base pairing in the shifted reading frame. This requirement is less stringent in the RF2 context, as if the Shine-Dalgarno interaction can help stabilize a quasi-stable rephased tRNA:message complex. It was previously shown that frameshifting in RF2 occurs more frequently if the codon 3'to the slippery site is read by a rare tRNA. Consistent with that earlier work, in the RF2 context frameshifting occurs substantially more frequently if the arginine codon is CGG, which is read by a rare tRNA. In contrast, in the 'normal' context frameshifting is only slightly greater at CGG than at CGU. It is suggested that the Shine-Dalgarno-like interaction elevates frameshifting specifically during the pause prior to translation of the second codon, which makes frameshifting exquisitely sensitive to the rate of translation of that codon. In both contexts frameshifting increases in a mutant strain that fails to modify tRNA base A37, which is 3'of the anticodon. Thus, those base modifications may limit frameshifting at UUU codons. Finally, statistical analyses show that UUU Ynn dicodons are extremely rare in E.coli genes that have highly biased codon usage. PMID:9115369

Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

PubMed

Yang, Haozhe; Mei, Hui; Seela, Frank

2015-07-06

Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds

PubMed Central

Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.

2008-01-01

We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765

The use of molecular dynamics simulations to evaluate the DNA sequence-selectivity of G-A cross-linking PBD-duocarmycin dimers.

PubMed

Jackson, Paul J M; Rahman, Khondaker M; Thurston, David E

2017-01-01

The pyrrolobenzodiazepine (PBD) and duocarmycin families are DNA-interactive agents that covalently bond to guanine (G) and adenine (A) bases, respectively, and that have been joined together to create synthetic dimers capable of cross-linking G-G, A-A, and G-A bases. Three G-A alkylating dimers have been reported in publications to date, with defined DNA-binding sites proposed for two of them. In this study we have used molecular dynamics simulations to elucidate preferred DNA-binding sites for the three published molecular types. For the PBD-CPI dimer UTA-6026 (1), our simulations correctly predicted its favoured binding site (i.e., 5'-C(G)AATTA-3') as identified by DNA cleavage studies. However, for the PBD-CI molecule ('Compound 11', 3), we were unable to reconcile the results of our simulations with the reported preferred cross-linking sequence (5'-ATTTTCC(G)-3'). We found that the molecule is too short to span the five base pairs between the A and G bases as claimed, but should target instead a sequence such as 5'-ATTTC(G)-3' with two less base pairs between the reacting G and A residues. Our simulation results for this hybrid dimer are also in accord with the very low interstrand cross-linking and in vitro cytotoxicity activities reported for it. Although a preferred cross-linking sequence was not reported for the third hybrid dimer ('27eS', 2), our simulations predict that it should span two base pairs between covalently reacting G and A bases (e.g., 5'-GTAT(A)-3'). Copyright © 2016. Published by Elsevier Ltd.

An evaluation of the genetic-matched pair study design using genome-wide SNP data from the European population.

PubMed

Lu, Timothy Tehua; Lao, Oscar; Nothnagel, Michael; Junge, Olaf; Freitag-Wolf, Sandra; Caliebe, Amke; Balascakova, Miroslava; Bertranpetit, Jaume; Bindoff, Laurence Albert; Comas, David; Holmlund, Gunilla; Kouvatsi, Anastasia; Macek, Milan; Mollet, Isabelle; Nielsen, Finn; Parson, Walther; Palo, Jukka; Ploski, Rafal; Sajantila, Antti; Tagliabracci, Adriano; Gether, Ulrik; Werge, Thomas; Rivadeneira, Fernando; Hofman, Albert; Uitterlinden, André Gerardus; Gieger, Christian; Wichmann, Heinz-Erich; Ruether, Andreas; Schreiber, Stefan; Becker, Christian; Nürnberg, Peter; Nelson, Matthew Roberts; Kayser, Manfred; Krawczak, Michael

2009-07-01

Genetic matching potentially provides a means to alleviate the effects of incomplete Mendelian randomization in population-based gene-disease association studies. We therefore evaluated the genetic-matched pair study design on the basis of genome-wide SNP data (309,790 markers; Affymetrix GeneChip Human Mapping 500K Array) from 2457 individuals, sampled at 23 different recruitment sites across Europe. Using pair-wise identity-by-state (IBS) as a matching criterion, we tried to derive a subset of markers that would allow identification of the best overall matching (BOM) partner for a given individual, based on the IBS status for the subset alone. However, our results suggest that, by following this approach, the prediction accuracy is only notably improved by the first 20 markers selected, and increases proportionally to the marker number thereafter. Furthermore, in a considerable proportion of cases (76.0%), the BOM of a given individual, based on the complete marker set, came from a different recruitment site than the individual itself. A second marker set, specifically selected for ancestry sensitivity using singular value decomposition, performed even more poorly and was no more capable of predicting the BOM than randomly chosen subsets. This leads us to conclude that, at least in Europe, the utility of the genetic-matched pair study design depends critically on the availability of comprehensive genotype information for both cases and controls.

Enhancing acronym/abbreviation knowledge bases with semantic information.

PubMed

Torii, Manabu; Liu, Hongfang

2007-10-11

In the biomedical domain, a terminology knowledge base that associates acronyms/abbreviations (denoted as SFs) with the definitions (denoted as LFs) is highly needed. For the construction such terminology knowledge base, we investigate the feasibility to build a system automatically assigning semantic categories to LFs extracted from text. Given a collection of pairs (SF,LF) derived from text, we i) assess the coverage of LFs and pairs (SF,LF) in the UMLS and justify the need of a semantic category assignment system; and ii) automatically derive name phrases annotated with semantic category and construct a system using machine learning. Utilizing ADAM, an existing collection of (SF,LF) pairs extracted from MEDLINE, our system achieved an f-measure of 87% when assigning eight UMLS-based semantic groups to LFs. The system has been incorporated into a web interface which integrates SF knowledge from multiple SF knowledge bases. Web site: http://gauss.dbb.georgetown.edu/liblab/SFThesurus.

Computational DNA hole spectroscopy: A new tool to predict mutation hotspots, critical base pairs, and disease ‘driver’ mutations

PubMed Central

Suárez, Martha Y.; Villagrán; Miller, John H.

2015-01-01

We report on a new technique, computational DNA hole spectroscopy, which creates spectra of electron hole probabilities vs. nucleotide position. A hole is a site of positive charge created when an electron is removed. Peaks in the hole spectrum depict sites where holes tend to localize and potentially trigger a base pair mismatch during replication. Our studies of mitochondrial DNA reveal a correlation between L-strand hole spectrum peaks and spikes in the human mutation spectrum. Importantly, we also find that hole peak positions that do not coincide with large variant frequencies often coincide with disease-implicated mutations and/or (for coding DNA) encoded conserved amino acids. This enables combining hole spectra with variant data to identify critical base pairs and potential disease ‘driver’ mutations. Such integration of DNA hole and variance spectra could ultimately prove invaluable for pinpointing critical regions of the vast non-protein-coding genome. An observed asymmetry in correlations, between the spectrum of human mtDNA variations and the L- and H-strand hole spectra, is attributed to asymmetric DNA replication processes that occur for the leading and lagging strands. PMID:26310834

Computational DNA hole spectroscopy: A new tool to predict mutation hotspots, critical base pairs, and disease 'driver' mutations.

PubMed

Villagrán, Martha Y Suárez; Miller, John H

2015-08-27

We report on a new technique, computational DNA hole spectroscopy, which creates spectra of electron hole probabilities vs. nucleotide position. A hole is a site of positive charge created when an electron is removed. Peaks in the hole spectrum depict sites where holes tend to localize and potentially trigger a base pair mismatch during replication. Our studies of mitochondrial DNA reveal a correlation between L-strand hole spectrum peaks and spikes in the human mutation spectrum. Importantly, we also find that hole peak positions that do not coincide with large variant frequencies often coincide with disease-implicated mutations and/or (for coding DNA) encoded conserved amino acids. This enables combining hole spectra with variant data to identify critical base pairs and potential disease 'driver' mutations. Such integration of DNA hole and variance spectra could ultimately prove invaluable for pinpointing critical regions of the vast non-protein-coding genome. An observed asymmetry in correlations, between the spectrum of human mtDNA variations and the L- and H-strand hole spectra, is attributed to asymmetric DNA replication processes that occur for the leading and lagging strands.

Genome Editing Tools in Plants

PubMed Central

Mohanta, Tapan Kumar; Bashir, Tufail; Hashem, Abeer; Bae, Hanhong

2017-01-01

Genome editing tools have the potential to change the genomic architecture of a genome at precise locations, with desired accuracy. These tools have been efficiently used for trait discovery and for the generation of plants with high crop yields and resistance to biotic and abiotic stresses. Due to complex genomic architecture, it is challenging to edit all of the genes/genomes using a particular genome editing tool. Therefore, to overcome this challenging task, several genome editing tools have been developed to facilitate efficient genome editing. Some of the major genome editing tools used to edit plant genomes are: Homologous recombination (HR), zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), pentatricopeptide repeat proteins (PPRs), the CRISPR/Cas9 system, RNA interference (RNAi), cisgenesis, and intragenesis. In addition, site-directed sequence editing and oligonucleotide-directed mutagenesis have the potential to edit the genome at the single-nucleotide level. Recently, adenine base editors (ABEs) have been developed to mutate A-T base pairs to G-C base pairs. ABEs use deoxyadeninedeaminase (TadA) with catalytically impaired Cas9 nickase to mutate A-T base pairs to G-C base pairs. PMID:29257124

Validation of an association rule mining-based method to infer associations between medications and problems.

PubMed

Wright, A; McCoy, A; Henkin, S; Flaherty, M; Sittig, D

2013-01-01

In a prior study, we developed methods for automatically identifying associations between medications and problems using association rule mining on a large clinical data warehouse and validated these methods at a single site which used a self-developed electronic health record. To demonstrate the generalizability of these methods by validating them at an external site. We received data on medications and problems for 263,597 patients from the University of Texas Health Science Center at Houston Faculty Practice, an ambulatory practice that uses the Allscripts Enterprise commercial electronic health record product. We then conducted association rule mining to identify associated pairs of medications and problems and characterized these associations with five measures of interestingness: support, confidence, chi-square, interest and conviction and compared the top-ranked pairs to a gold standard. 25,088 medication-problem pairs were identified that exceeded our confidence and support thresholds. An analysis of the top 500 pairs according to each measure of interestingness showed a high degree of accuracy for highly-ranked pairs. The same technique was successfully employed at the University of Texas and accuracy was comparable to our previous results. Top associations included many medications that are highly specific for a particular problem as well as a large number of common, accurate medication-problem pairs that reflect practice patterns.

Molecular dynamics of the frame-shifting pseudoknot from beet western yellows virus: the role of non-Watson-Crick base-pairing, ordered hydration, cation binding and base mutations on stability and unfolding.

PubMed

Csaszar, K; Spacková, N; Stefl, R; Sponer, J; Leontis, N B

2001-11-09

Molecular dynamics simulations of the frame-shifting pseudoknot from beet western yellows virus (BWYV, NDB file UR0004) were performed with explicit inclusion of solvent and counterions. In all, 33 ns of simulation were carried out, including 10 ns of the native structure with protonation of the crucial cytosine residue, C8(N3+). The native structure exhibited stable trajectories retaining all Watson-Crick and tertiary base-pairs, except for fluctuations or transient disruptions at specific sites. The most significant fluctuations involved the change or disruption of hydrogen-bonding between C8(N3+) and bases G12, A25, and C26, as well as disruption of the water bridges linking C8(N3+) with A25 and C26. To increase sampling of rare events, the native simulation was continued at 400 K. A partial, irreversible unfolding of the molecule was initiated by slippage of C8(N3+) relative to G12 and continued by sudden concerted changes in hydrogen-bonding involving A23, A24, and A25. These events were followed by a gradual loss of stacking interactions in loop 2. Of the Watson-Crick base-pairs, only the 5'-terminal pair of stem 1 dissociated at 400 K, while the trans sugar-edge/sugar-edge A20.G4 interaction remained surprisingly stable. Four additional room-temperature simulations were carried out to obtain insights into the structural and dynamic effects of selected mutations. In two of these, C8 was left unprotonated. Considerable local rearrangements occurred that were not observed in the crystal structure, thus confirming N3-protonation of C8 in the native molecule. We also investigated the effect of mutating C8(N3+) to U8, to correlate with experimental and phylogenetic studies, and of changing the G4 x C17 base-pair to A4 x U17 to weaken the trans sugar-edge interaction between positions 4 and 20 and to test models of unfolding. The simulations indicate that the C8 x G12 x C26 base-triple at the junction is the most labile region of the frame-shifting pseudoknot. They provide insights into the roles of the other non-Watson-Crick base-pairs in the early stages of unfolding of the pseudoknot, which must occur to allow readthrough of the message by the ribosome. The simulations revealed several critical, highly ordered hydration sites with close to 100 % occupancies and residency times of individual water molecules of up to 5 ns. Sodium cation coordination sites with occupancies above 50 % were also observed. Copyright 2001 Academic Press.

Imino proton exchange and base-pair kinetics in the AMP-RNA aptamer complex.

PubMed

Nonin, S; Jiang, F; Patel, D J

1997-05-02

We report on the dynamics of base-pair opening in the ATP-binding asymmetric internal loop and flanking base-pairs of the AMP-RNA aptamer complex by monitoring the exchange characteristics of the extremely well resolved imino protons in the NMR spectrum of the complex. The kinetics of imino proton exchange as a function of basic pH or added ammonia catalyst are used to measure the apparent base-pair dissociation constants and lifetimes of Watson-Crick and mismatched base-pairs, as well as the solvent accessibility of the unpaired imino protons in the complex. The exchange characteristics of the imino protons identify the existence of four additional hydrogen bonds stabilizing the conformation of the asymmetric ATP-binding internal loop that were not detected by NOEs and coupling constants alone, but are readily accommodated in the previously reported solution structure of the AMP-RNA aptamer complex published from our laboratory. The hydrogen exchange kinetics of the non-Watson-Crick pairs in the asymmetric internal loop of the AMP-RNA aptamer complex have been characterized and yield apparent dissociation constants (alphaKd) that range from 10(-2) to 10(-7). Surprisingly, three of these alphaKd values are amongst the lowest measured for all base-pairs in the AMP-RNA aptamer complex. Comparative studies of hydrogen exchange of the imino protons in the free RNA aptamer and the AMP-RNA aptamer complex establish that complexation stabilizes not only the bases within the ATP-binding asymmetric internal loop, but also the flanking stem base-pairs (two pairs on either side) of the binding site. We also outline some preliminary results related to the exchange properties of a sugar 2'-hydroxyl proton of a guanosine residue involved in a novel hydrogen bond that has been shown to contribute to the immobilization of the bound AMP by the RNA aptamer, and whose resonance is narrow and downfield shifted in the spectrum.

PolyU tail of rho-independent terminator of bacterial small RNAs is essential for Hfq action.

PubMed

Otaka, Hironori; Ishikawa, Hirokazu; Morita, Teppei; Aiba, Hiroji

2011-08-09

Major bacterial small RNAs (sRNAs) regulate the translation and stability of target mRNAs through base pairing with the help of the RNA chaperone Hfq. The Hfq-dependent sRNAs consist of three basic elements, mRNA base-pairing region, Hfq-binding site, and rho-independent terminator. Although the base-pairing region and the terminator are well documented in many sRNAs, the Hfq-binding site is less well-defined except that Hfq binds RNA with a preference for AU-rich sequences. Here, we performed mutational and biochemical studies to define the sRNA site required for Hfq action using SgrS as a model sRNA. We found that shortening terminator polyU tail eliminates the ability of SgrS to bind to Hfq and to silence ptsG mRNA. We also demonstrate that the SgrS terminator can be replaced with any foreign rho-independent terminators possessing a polyU tail longer than 8 without losing the ability to silence ptsG mRNA in an Hfq-dependent manner. Moreover, we found that shortening the terminator polyU tail of several other sRNAs also eliminates the ability to bind to Hfq and to regulate target mRNAs. We conclude that the polyU tail of sRNAs is essential for Hfq action in general. The data also indicate that the terminator polyU tail plays a role in Hfq-dependent stabilization of sRNAs.

PolyU tail of rho-independent terminator of bacterial small RNAs is essential for Hfq action

PubMed Central

Otaka, Hironori; Ishikawa, Hirokazu; Morita, Teppei; Aiba, Hiroji

2011-01-01

Major bacterial small RNAs (sRNAs) regulate the translation and stability of target mRNAs through base pairing with the help of the RNA chaperone Hfq. The Hfq-dependent sRNAs consist of three basic elements, mRNA base-pairing region, Hfq-binding site, and rho-independent terminator. Although the base-pairing region and the terminator are well documented in many sRNAs, the Hfq-binding site is less well-defined except that Hfq binds RNA with a preference for AU-rich sequences. Here, we performed mutational and biochemical studies to define the sRNA site required for Hfq action using SgrS as a model sRNA. We found that shortening terminator polyU tail eliminates the ability of SgrS to bind to Hfq and to silence ptsG mRNA. We also demonstrate that the SgrS terminator can be replaced with any foreign rho-independent terminators possessing a polyU tail longer than 8 without losing the ability to silence ptsG mRNA in an Hfq-dependent manner. Moreover, we found that shortening the terminator polyU tail of several other sRNAs also eliminates the ability to bind to Hfq and to regulate target mRNAs. We conclude that the polyU tail of sRNAs is essential for Hfq action in general. The data also indicate that the terminator polyU tail plays a role in Hfq-dependent stabilization of sRNAs. PMID:21788484

Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

PubMed

Xia, Shuangluo; Konigsberg, William H

2014-04-01

Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

Rapid departure of Roseate Terns (Sterna dougallii) following large-scale nest failure

USGS Publications Warehouse

Spendelow, Jeffrey A.; Eichenwald, Adam J.

2018-01-01

Nest failure of most pairs of Roseate Terns (Sterna dougallii) at Falkner Island, Connecticut, in 2002-2003 (due mainly to predation by Black-crowned Night-herons [Nycticorax nycticorax]) was followed by the rapid departure of many of the failed individuals in both years. Nine failed pairs (16.7%) stayed while 40 (74.1%) of 54 unsuccessful pairs left within 2 d following nest failure in 2002, and 7 pairs (21.9%) stayed while 25 (78.1%) of 32 unsuccessful pairs left within 2 d in 2003. Individuals that departed this colony site by the end of June likely had time to prospect and renest at another colony site in the same year, and individuals that successfully renested at another colony site could have shown reduced colony-site fidelity to Falkner Island in subsequent years.

Estimation of occupancy, breeding success, and predicted abundance of golden eagles (Aquila chrysaetos) in the Diablo Range, California, 2014

USGS Publications Warehouse

Wiens, J. David; Kolar, Patrick S.; Fuller, Mark R.; Hunt, W. Grainger; Hunt, Teresa

2015-01-01

We used a multistate occupancy sampling design to estimate occupancy, breeding success, and abundance of territorial pairs of golden eagles (Aquila chrysaetos) in the Diablo Range, California, in 2014. This method uses the spatial pattern of detections and non-detections over repeated visits to survey sites to estimate probabilities of occupancy and successful reproduction while accounting for imperfect detection of golden eagles and their young during surveys. The estimated probability of detecting territorial pairs of golden eagles and their young was less than 1 and varied with time of the breeding season, as did the probability of correctly classifying a pair’s breeding status. Imperfect detection and breeding classification led to a sizeable difference between the uncorrected, naïve estimate of the proportion of occupied sites where successful reproduction was observed (0.20) and the model-based estimate (0.30). The analysis further indicated a relatively high overall probability of landscape occupancy by pairs of golden eagles (0.67, standard error = 0.06), but that areas with the greatest occupancy and reproductive potential were patchily distributed. We documented a total of 138 territorial pairs of golden eagles during surveys completed in the 2014 breeding season, which represented about one-half of the 280 pairs we estimated to occur in the broader 5,169-square kilometer region sampled. The study results emphasize the importance of accounting for imperfect detection and spatial heterogeneity in studies of site occupancy, breeding success, and abundance of golden eagles.

Reduction of pain via platelet-rich plasma in split-thickness skin graft donor sites: a series of matched pairs

PubMed Central

Miller, John D.; Rankin, Timothy M.; Hua, Natalie T.; Ontiveros, Tina; Giovinco, Nicholas A.; Mills, Joseph L.; Armstrong, David G.

2015-01-01

In the past decade, autologous platelet-rich plasma (PRP) therapy has seen increasingly widespread integration into medical specialties. PRP application is known to accelerate wound epithelialization rates, and may also reduce postoperative wound site pain. Recently, we observed an increase in patient satisfaction following PRP gel (Angel, Cytomedix, Rockville, MD) application to split-thickness skin graft (STSG) donor sites. We assessed all patients known to our university-based hospital service who underwent multiple STSGs up to the year 2014, with at least one treated with topical PRP. Based on these criteria, five patients aged 48.4±17.6 (80% male) were identified who could serve as their own control, with mean time of 4.4±5.1 years between operations. In both therapies, initial dressing changes occurred on postoperative day (POD) 7, with donor site pain measured by Likert visual pain scale. Paired t-tests compared the size and thickness of harvested skin graft and patient pain level, and STSG thickness and surface area were comparable between control and PRP interventions (p>0.05 for all). Donor site pain was reduced from an average of 7.2 (±2.6) to 3 (±3.7), an average reduction in pain of 4.2 (standard error 1.1, p=0.0098) following PRP use. Based on these results, the authors suggest PRP as a beneficial adjunct for reducing donor site pain following STSG harvest. PMID:25623477

Nearly complete rRNA genes assembled from across the metazoan animals: effects of more taxa, a structure-based alignment, and paired-sites evolutionary models on phylogeny reconstruction.

PubMed

Mallatt, Jon; Craig, Catherine Waggoner; Yoder, Matthew J

2010-04-01

This study (1) uses nearly complete rRNA-gene sequences from across Metazoa (197 taxa) to reconstruct animal phylogeny; (2) presents a highly annotated, manual alignment of these sequences with special reference to rRNA features including paired sites (http://purl.oclc.org/NET/rRNA/Metazoan_alignment) and (3) tests, after eliminating as few disruptive, rogue sequences as possible, if a likelihood framework can recover the main metazoan clades. We found that systematic elimination of approximately 6% of the sequences, including the divergent or unstably placed sequences of cephalopods, arrowworm, symphylan and pauropod myriapods, and of myzostomid and nemertodermatid worms, led to a tree that supported Ecdysozoa, Lophotrochozoa, Protostomia, and Bilateria. Deuterostomia, however, was never recovered, because the rRNA of urochordates goes (nonsignificantly) near the base of the Bilateria. Counterintuitively, when we modeled the evolution of the paired sites, phylogenetic resolution was not increased over traditional tree-building models that assume all sites in rRNA evolve independently. The rRNA genes of non-bilaterians contain a higher % AT than do those of most bilaterians. The rRNA genes of Acoela and Myzostomida were found to be secondarily shortened, AT-enriched, and highly modified, throwing some doubt on the location of these worms at the base of Bilateria in the rRNA tree--especially myzostomids, which other evidence suggests are annelids instead. Other findings are marsupial-with-placental mammals, arrowworms in Ecdysozoa (well supported here but contradicted by morphology), and Placozoa as sister to Cnidaria. Finally, despite the difficulties, the rRNA-gene trees are in strong concordance with trees derived from multiple protein-coding genes in supporting the new animal phylogeny. (c) 2009 Elsevier Inc. All rights reserved.

Pair-bonded humans conform to sexual stereotypes in web-based advertisements for extra-marital partners.

PubMed

Kelley, Trish C; Hare, James F

2010-10-20

Partners advertisements provide advertisers with access to a large pool of prospective mates, and have proven useful in documenting sex differences in human mating preferences. We coded data from an Internet site (AshleyMadison.com) catering to advertisers engaged in existing pair-bonded relationships. While we predicted that pair-bonding may liberate advertisers from conforming to sexual stereotypes of male promiscuity and female choosiness, our results are uniformly consistent with those stereotypes. Our findings thus provide further evidence that human mating behavior is highly constrained by fundamental biological differences between males and females.

Control of box C/D snoRNP assembly by N6-methylation of adenine.

PubMed

Huang, Lin; Ashraf, Saira; Wang, Jia; Lilley, David Mj

2017-09-01

N 6 -methyladenine is the most widespread mRNA modification. A subset of human box C/D snoRNA species have target GAC sequences that lead to formation of N 6 -methyladenine at a key trans Hoogsteen-sugar A·G base pair, of which half are methylated in vivo The GAC target is conserved only in those that are methylated. Methylation prevents binding of the 15.5-kDa protein and the induced folding of the RNA Thus, the assembly of the box C/D snoRNP could in principle be regulated by RNA methylation at its critical first stage. Crystallography reveals that N 6 -methylation of adenine prevents the formation of trans Hoogsteen-sugar A·G base pairs, explaining why the box C/D RNA cannot adopt its kinked conformation. More generally, our data indicate that sheared A·G base pairs (but not Watson-Crick base pairs) are more susceptible to disruption by N 6 mA methylation and are therefore possible regulatory sites. The human signal recognition particle RNA and many related Alu retrotransposon RNA species are also methylated at N6 of an adenine that forms a sheared base pair with guanine and mediates a key tertiary interaction. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.

Guide-substrate base-pairing requirement for box H/ACA RNA-guided RNA pseudouridylation.

PubMed

De Zoysa, Meemanage D; Wu, Guowei; Katz, Raviv; Yu, Yi-Tao

2018-06-05

Box H/ACA RNAs are a group of small RNAs found in abundance in eukaryotes (as well as in archaea). Although their sequences differ, eukaryotic box H/ACA RNAs all share the same unique hairpin-hinge-hairpin-tail structure. Almost all of them function as guides that primarily direct pseudouridylation of rRNAs and spliceosomal snRNAs at specific sites. Although box H/ACA RNA-guided pseudouridylation has been extensively studied, the detailed rules governing this reaction, especially those concerning the guide RNA-substrate RNA base-pairing interactions that determine the specificity and efficiency of pseudouridylation, are still not exactly clear. This is particularly relevant given that the lengths of the guide sequences involved in base-pairing vary from one box H/ACA RNA to another. Here, we carry out a detailed investigation into guide-substrate base-pairing interactions, and identify the minimum number of base-pairs (8), required for RNA-guided pseudouridylation. In addition, we find that the pseudouridylation pocket, present in each hairpin of box H/ACA RNA, exhibits flexibility in fitting slightly different substrate sequences. Our results are consistent across three independent pseudouridylation pockets tested, suggesting that our findings are generally applicable to box H/ACA RNA-guided RNA pseudouridylation. Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Geomfinder: a multi-feature identifier of similar three-dimensional protein patterns: a ligand-independent approach.

PubMed

Núñez-Vivanco, Gabriel; Valdés-Jiménez, Alejandro; Besoaín, Felipe; Reyes-Parada, Miguel

2016-01-01

Since the structure of proteins is more conserved than the sequence, the identification of conserved three-dimensional (3D) patterns among a set of proteins, can be important for protein function prediction, protein clustering, drug discovery and the establishment of evolutionary relationships. Thus, several computational applications to identify, describe and compare 3D patterns (or motifs) have been developed. Often, these tools consider a 3D pattern as that described by the residues surrounding co-crystallized/docked ligands available from X-ray crystal structures or homology models. Nevertheless, many of the protein structures stored in public databases do not provide information about the location and characteristics of ligand binding sites and/or other important 3D patterns such as allosteric sites, enzyme-cofactor interaction motifs, etc. This makes necessary the development of new ligand-independent methods to search and compare 3D patterns in all available protein structures. Here we introduce Geomfinder, an intuitive, flexible, alignment-free and ligand-independent web server for detailed estimation of similarities between all pairs of 3D patterns detected in any two given protein structures. We used around 1100 protein structures to form pairs of proteins which were assessed with Geomfinder. In these analyses each protein was considered in only one pair (e.g. in a subset of 100 different proteins, 50 pairs of proteins can be defined). Thus: (a) Geomfinder detected identical pairs of 3D patterns in a series of monoamine oxidase-B structures, which corresponded to the effectively similar ligand binding sites at these proteins; (b) we identified structural similarities among pairs of protein structures which are targets of compounds such as acarbose, benzamidine, adenosine triphosphate and pyridoxal phosphate; these similar 3D patterns are not detected using sequence-based methods; (c) the detailed evaluation of three specific cases showed the versatility of Geomfinder, which was able to discriminate between similar and different 3D patterns related to binding sites of common substrates in a range of diverse proteins. Geomfinder allows detecting similar 3D patterns between any two pair of protein structures, regardless of the divergency among their amino acids sequences. Although the software is not intended for simultaneous multiple comparisons in a large number of proteins, it can be particularly useful in cases such as the structure-based design of multitarget drugs, where a detailed analysis of 3D patterns similarities between a few selected protein targets is essential.

Advancing viral RNA structure prediction: measuring the thermodynamics of pyrimidine-rich internal loops

PubMed Central

Phan, Andy; Mailey, Katherine; Saeki, Jessica; Gu, Xiaobo

2017-01-01

Accurate thermodynamic parameters improve RNA structure predictions and thus accelerate understanding of RNA function and the identification of RNA drug binding sites. Many viral RNA structures, such as internal ribosome entry sites, have internal loops and bulges that are potential drug target sites. Current models used to predict internal loops are biased toward small, symmetric purine loops, and thus poorly predict asymmetric, pyrimidine-rich loops with >6 nucleotides (nt) that occur frequently in viral RNA. This article presents new thermodynamic data for 40 pyrimidine loops, many of which can form UU or protonated CC base pairs. Uracil and protonated cytosine base pairs stabilize asymmetric internal loops. Accurate prediction rules are presented that account for all thermodynamic measurements of RNA asymmetric internal loops. New loop initiation terms for loops with >6 nt are presented that do not follow previous assumptions that increasing asymmetry destabilizes loops. Since the last 2004 update, 126 new loops with asymmetry or sizes greater than 2 × 2 have been measured. These new measurements significantly deepen and diversify the thermodynamic database for RNA. These results will help better predict internal loops that are larger, pyrimidine-rich, and occur within viral structures such as internal ribosome entry sites. PMID:28213527

Identifying N6-methyladenosine sites using multi-interval nucleotide pair position specificity and support vector machine

NASA Astrophysics Data System (ADS)

Xing, Pengwei; Su, Ran; Guo, Fei; Wei, Leyi

2017-04-01

N6-methyladenosine (m6A) refers to methylation of the adenosine nucleotide acid at the nitrogen-6 position. It plays an important role in a series of biological processes, such as splicing events, mRNA exporting, nascent mRNA synthesis, nuclear translocation and translation process. Numerous experiments have been done to successfully characterize m6A sites within sequences since high-resolution mapping of m6A sites was established. However, as the explosive growth of genomic sequences, using experimental methods to identify m6A sites are time-consuming and expensive. Thus, it is highly desirable to develop fast and accurate computational identification methods. In this study, we propose a sequence-based predictor called RAM-NPPS for identifying m6A sites within RNA sequences, in which we present a novel feature representation algorithm based on multi-interval nucleotide pair position specificity, and use support vector machine classifier to construct the prediction model. Comparison results show that our proposed method outperforms the state-of-the-art predictors on three benchmark datasets across the three species, indicating the effectiveness and robustness of our method. Moreover, an online webserver implementing the proposed predictor has been established at http://server.malab.cn/RAM-NPPS/. It is anticipated to be a useful prediction tool to assist biologists to reveal the mechanisms of m6A site functions.

Electron holes appear to trigger cancer-implicated mutations

NASA Astrophysics Data System (ADS)

Miller, John; Villagran, Martha

Malignant tumors are caused by mutations, which also affect their subsequent growth and evolution. We use a novel approach, computational DNA hole spectroscopy [M.Y. Suarez-Villagran & J.H. Miller, Sci. Rep. 5, 13571 (2015)], to compute spectra of enhanced hole probability based on actual sequence data. A hole is a mobile site of positive charge created when an electron is removed, for example by radiation or contact with a mutagenic agent. Peaks in the hole spectrum depict sites where holes tend to localize and potentially trigger a base pair mismatch during replication. Our studies of reveal a correlation between hole spectrum peaks and spikes in human mutation frequencies. Importantly, we also find that hole peak positions that do not coincide with large variant frequencies often coincide with cancer-implicated mutations and/or (for coding DNA) encoded conserved amino acids. This enables combining hole spectra with variant data to identify critical base pairs and potential cancer `driver' mutations. Such integration of DNA hole and variance spectra could also prove invaluable for pinpointing critical regions, and sites of driver mutations, in the vast non-protein-coding genome. Supported by the State of Texas through the Texas Ctr. for Superconductivity.

Characterization of the Trans Watson-Crick GU Base Pair Located in the Catalytic Core of the Antigenomic HDV Ribozyme

PubMed Central

Lévesque, Dominique; Reymond, Cédric; Perreault, Jean-Pierre

2012-01-01

The HDV ribozyme’s folding pathway is, by far, the most complex folding pathway elucidated to date for a small ribozyme. It includes 6 different steps that have been shown to occur before the chemical cleavage. It is likely that other steps remain to be discovered. One of the most critical of these unknown steps is the formation of the trans Watson-Crick GU base pair within loop III. The U23 and G28 nucleotides that form this base pair are perfectly conserved in all natural variants of the HDV ribozyme, and therefore are considered as being part of the signature of HDV-like ribozymes. Both the formation and the transformation of this base pair have been studied mainly by crystal structure and by molecular dynamic simulations. In order to obtain physical support for the formation of this base pair in solution, a set of experiments, including direct mutagenesis, the site-specific substitution of chemical groups, kinetic studies, chemical probing and magnesium-induced cleavage, were performed with the specific goal of characterizing this trans Watson-Crick GU base pair in an antigenomic HDV ribozyme. Both U23 and G28 can be substituted for nucleotides that likely preserve some of the H-bond interactions present before and after the cleavage step. The formation of the more stable trans Watson-Crick base pair is shown to be a post-cleavage event, while a possibly weaker trans Watson-Crick/Hoogsteen interaction seems to form before the cleavage step. The formation of this unusually stable post-cleavage base pair may act as a driving force on the chemical cleavage by favouring the formation of a more stable ground state of the product-ribozyme complex. To our knowledge, this represents the first demonstration of a potential stabilising role of a post-cleavage conformational switch event in a ribozyme-catalyzed reaction. PMID:22768274

Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

PubMed

Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P

2015-02-10

5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

Differential stabilities and sequence-dependent base pair opening dynamics of Watson–Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine

DOE PAGES

Szulik, Marta W.; Pallan, Pradeep S.; Nocek, Boguslaw; ...

2015-01-29

5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T 8X 9G 10-3' sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC didmore » not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A 5:T 8, whereas 5caC did not. At the oxidized base pair G 4:X 9, 5fC exhibited an increase in the imino proton exchange rate and the calculated k op. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C 3:G 10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G 4:X 9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N 4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. Furthermore, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.« less

Differential Stabilities and Sequence-Dependent Base Pair Opening Dynamics of Watson–Crick Base Pairs with 5-Hydroxymethylcytosine, 5-Formylcytosine, or 5-Carboxylcytosine

PubMed Central

2016-01-01

5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5′-CG-3′ sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5′-T8X9G10-3′ sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A5:T8, whereas 5caC did not. At the oxidized base pair G4:X9, 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C3:G10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G4:X9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes. PMID:25632825

An Algorithm for Finding Candidate Synaptic Sites in Computer Generated Networks of Neurons with Realistic Morphologies

PubMed Central

van Pelt, Jaap; Carnell, Andrew; de Ridder, Sander; Mansvelder, Huibert D.; van Ooyen, Arjen

2010-01-01

Neurons make synaptic connections at locations where axons and dendrites are sufficiently close in space. Typically the required proximity is based on the dimensions of dendritic spines and axonal boutons. Based on this principle one can search those locations in networks formed by reconstructed neurons or computer generated neurons. Candidate synapses are then located where axons and dendrites are within a given criterion distance from each other. Both experimentally reconstructed and model generated neurons are usually represented morphologically by piecewise-linear structures (line pieces or cylinders). Proximity tests are then performed on all pairs of line pieces from both axonal and dendritic branches. Applying just a test on the distance between line pieces may result in local clusters of synaptic sites when more than one pair of nearby line pieces from axonal and dendritic branches is sufficient close, and may introduce a dependency on the length scale of the individual line pieces. The present paper describes a new algorithm for defining locations of candidate synapses which is based on the crossing requirement of a line piece pair, while the length of the orthogonal distance between the line pieces is subjected to the distance criterion for testing 3D proximity. PMID:21160548

Solution structure of a GAAA tetraloop receptor RNA.

PubMed Central

Butcher, S E; Dieckmann, T; Feigon, J

1997-01-01

The GAAA tetraloop receptor is an 11-nucleotide RNA sequence that participates in the tertiary folding of a variety of large catalytic RNAs by providing a specific binding site for GAAA tetraloops. Here we report the solution structure of the isolated tetraloop receptor as solved by multidimensional, heteronuclear magnetic resonance spectroscopy. The internal loop of the tetraloop receptor has three adenosines stacked in a cross-strand or zipper-like fashion. This arrangement produces a high degree of base stacking within the asymmetric internal loop without extrahelical bases or kinking the helix. Additional interactions within the internal loop include a U. U mismatch pair and a G.U wobble pair. A comparison with the crystal structure of the receptor RNA bound to its tetraloop shows that a conformational change has to occur upon tetraloop binding, which is in good agreement with previous biochemical data. A model for an alternative binding site within the receptor is proposed based on the NMR structure, phylogenetic data and previous crystallographic structures of tetraloop interactions. PMID:9405377

Altered minor-groove hydrogen bonds in DNA block transcription elongation by T7 RNA polymerase.

PubMed

Tanasova, Marina; Goeldi, Silvan; Meyer, Fabian; Hanawalt, Philip C; Spivak, Graciela; Sturla, Shana J

2015-05-26

DNA transcription depends upon the highly efficient and selective function of RNA polymerases (RNAPs). Modifications in the template DNA can impact the progression of RNA synthesis, and a number of DNA adducts, as well as abasic sites, arrest or stall transcription. Nonetheless, data are needed to understand why certain modifications to the structure of DNA bases stall RNA polymerases while others are efficiently bypassed. In this study, we evaluate the impact that alterations in dNTP/rNTP base-pair geometry have on transcription. T7 RNA polymerase was used to study transcription over modified purines and pyrimidines with altered H-bonding capacities. The results suggest that introducing wobble base-pairs into the DNA:RNA heteroduplex interferes with transcriptional elongation and stalls RNA polymerase. However, transcriptional stalling is not observed if mismatched base-pairs do not H-bond. Together, these studies show that RNAP is able to discriminate mismatches resulting in wobble base-pairs, and suggest that, in cases of modifications with minor steric impact, DNA:RNA heteroduplex geometry could serve as a controlling factor for initiating transcription-coupled DNA repair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

SDM-Assist software to design site-directed mutagenesis primers introducing “silent” restriction sites

PubMed Central

2013-01-01

Background Over the past decades site-directed mutagenesis (SDM) has become an indispensable tool for biological structure-function studies. In principle, SDM uses modified primer pairs in a PCR reaction to introduce a mutation in a cDNA insert. DpnI digestion of the reaction mixture is used to eliminate template copies before amplification in E. coli; however, this process is inefficient resulting in un-mutated clones which can only be distinguished from mutant clones by sequencing. Results We have developed a program – ‘SDM-Assist’ which creates SDM primers adding a specific identifier: through additional silent mutations a restriction site is included or a previous one removed which allows for highly efficient identification of ‘mutated clones’ by a simple restriction digest. Conclusions The direct identification of SDM clones will save time and money for researchers. SDM-Assist also scores the primers based on factors such as Tm, GC content and secondary structure allowing for simplified selection of optimal primer pairs. PMID:23522286

Negatively supercoiled simian virus 40 DNA contains Z-DNA segments within transcriptional enhancer sequences

NASA Technical Reports Server (NTRS)

Nordheim, A.; Rich, A.

1983-01-01

Three 8-base pair (bp) segments of alternating purine-pyrimidine from the simian virus 40 enhancer region form Z-DNA on negative supercoiling; minichromosome DNase I-hypersensitive sites determined by others bracket these three segments. A survey of transcriptional enhancer sequences reveals a pattern of potential Z-DNA-forming regions which occur in pairs 50-80 bp apart. This may influence local chromatin structure and may be related to transcriptional activation.

Localisation in a Growth Model with Interaction

NASA Astrophysics Data System (ADS)

Costa, M.; Menshikov, M.; Shcherbakov, V.; Vachkovskaia, M.

2018-05-01

This paper concerns the long term behaviour of a growth model describing a random sequential allocation of particles on a finite cycle graph. The model can be regarded as a reinforced urn model with graph-based interaction. It is motivated by cooperative sequential adsorption, where adsorption rates at a site depend on the configuration of existing particles in the neighbourhood of that site. Our main result is that, with probability one, the growth process will eventually localise either at a single site, or at a pair of neighbouring sites.

Localisation in a Growth Model with Interaction

NASA Astrophysics Data System (ADS)

Costa, M.; Menshikov, M.; Shcherbakov, V.; Vachkovskaia, M.

2018-06-01

This paper concerns the long term behaviour of a growth model describing a random sequential allocation of particles on a finite cycle graph. The model can be regarded as a reinforced urn model with graph-based interaction. It is motivated by cooperative sequential adsorption, where adsorption rates at a site depend on the configuration of existing particles in the neighbourhood of that site. Our main result is that, with probability one, the growth process will eventually localise either at a single site, or at a pair of neighbouring sites.

The utility of twins in developmental cognitive neuroscience research: How twins strengthen the ABCD research design.

PubMed

Iacono, William G; Heath, Andrew C; Hewitt, John K; Neale, Michael C; Banich, Marie T; Luciana, Monica M; Madden, Pamela A; Barch, Deanna M; Bjork, James M

2018-08-01

The ABCD twin study will elucidate the genetic and environmental contributions to a wide range of mental and physical health outcomes in children, including substance use, brain and behavioral development, and their interrelationship. Comparisons within and between monozygotic and dizygotic twin pairs, further powered by multiple assessments, provide information about genetic and environmental contributions to developmental associations, and enable stronger tests of causal hypotheses, than do comparisons involving unrelated children. Thus a sub-study of 800 pairs of same-sex twins was embedded within the overall Adolescent Brain and Cognitive Development (ABCD) design. The ABCD Twin Hub comprises four leading centers for twin research in Minnesota, Colorado, Virginia, and Missouri. Each site is enrolling 200 twin pairs, as well as singletons. The twins are recruited from registries of all twin births in each State during 2006-2008. Singletons at each site are recruited following the same school-based procedures as the rest of the ABCD study. This paper describes the background and rationale for the ABCD twin study, the ascertainment of twin pairs and implementation strategy at each site, and the details of the proposed analytic strategies to quantify genetic and environmental influences and test hypotheses critical to the aims of the ABCD study. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gao, X.; Patel, D.J.

The authors report on two-dimensional proton NMR studies of echinomycin complexes with the self-complementary d(A1-C2-G3-Tr) and d(T1-C2-G3-A4) duplexes in aqueous solution. The exchangeable and nonexchangeable antibiotic and nucleic acid protons in the 1 echinomycin per tetranucleotide duplex complexes have been assigned from analyses of scalar coupling and distance connectivities in two-dimensional data sets records in H/sub 2/O and D/sub 2/O solution. An analysis of the intermolecular NOE patterns for both complexes combined with large upfield imino proton and large downfield phosphorus complexation chemical shift changes demonstrates that the two quinoxaline chromophores of echinomycin bisintercalate into the minor groove surrounding themore » dC-dG step of each tetranucleotide duplex. Further, the quinoxaline rings selectively stack between A1 and C2 bases in the d(ACGT) complex and between T1 and C2 bases in the d(TCGA) complex. The intermolecular NOE patterns and the base and sugar proton chemical shifts for residues C2 and G3 are virtually identical for the d(ACGT) and d(TCGA) complexes. A large set of intermolecular contacts established from nuclear Overhauser effects (NOEs) between antibiotic and nucleic acid protons in the echinomycin-tetranucleotide complexes in solution are consistent with corresponding contacts reported for echinomycin-oligonucleotide complexes in the crystalline state. The authors demonstrate that the G x G base pairs adopt Watson-Crick pairing in both d(ACGT) and d(TCGA) complexes in solution. By contrast, the A1 x T4 base pairs adopt Hoogsteen pairing for the echinomycin-d(A1-C2-G3-Tr) complex while the T1 x A4 base pairs adopt Watson-Crick pairing for the echinomycin-d(T1-C2-G3-A4) complex in aqueous solution. These results emphasize the role of sequence in discriminating between Watson-Crick and Hoogsteen pairs at base pairs flanking the echinomycin bisintercalation site in solution.« less

Cooperative activation of cardiac transcription through myocardin bridging of paired MEF2 sites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Anderson, Courtney M.; Hu, Jianxin; Thomas, Reuben

2017-03-28

Enhancers frequently contain multiple binding sites for the same transcription factor. These homotypic binding sites often exhibit synergy, whereby the transcriptional output from two or more binding sites is greater than the sum of the contributions of the individual binding sites alone. Although this phenomenon is frequently observed, the mechanistic basis for homotypic binding site synergy is poorly understood. Here in this paper, we identify a bona fide cardiac-specific Prkaa2 enhancer that is synergistically activated by homotypic MEF2 binding sites. We show that two MEF2 sites in the enhancer function cooperatively due to bridging of the MEF2C-bound sites by themore » SAP domain-containing co-activator protein myocardin, and we show that paired sites buffer the enhancer from integration site-dependent effects on transcription in vivo. Paired MEF2 sites are prevalent in cardiac enhancers, suggesting that this might be a common mechanism underlying synergy in the control of cardiac gene expression in vivo.« less

Genetic dissection of the consensus sequence for the class 2 and class 3 flagellar promoters

PubMed Central

Wozniak, Christopher E.; Hughes, Kelly T.

2008-01-01

Summary Computational searches for DNA binding sites often utilize consensus sequences. These search models make assumptions that the frequency of a base pair in an alignment relates to the base pair’s importance in binding and presume that base pairs contribute independently to the overall interaction with the DNA binding protein. These two assumptions have generally been found to be accurate for DNA binding sites. However, these assumptions are often not satisfied for promoters, which are involved in additional steps in transcription initiation after RNA polymerase has bound to the DNA. To test these assumptions for the flagellar regulatory hierarchy, class 2 and class 3 flagellar promoters were randomly mutagenized in Salmonella. Important positions were then saturated for mutagenesis and compared to scores calculated from the consensus sequence. Double mutants were constructed to determine how mutations combined for each promoter type. Mutations in the binding site for FlhD4C2, the activator of class 2 promoters, better satisfied the assumptions for the binding model than did mutations in the class 3 promoter, which is recognized by the σ28 transcription factor. These in vivo results indicate that the activator sites within flagellar promoters can be modeled using simple assumptions but that the DNA sequences recognized by the flagellar sigma factor require more complex models. PMID:18486950

Lewis Acid Pairs for the Activation of Biomass-derived Oxygenates in Aqueous Media

DOE Office of Scientific and Technical Information (OSTI.GOV)

Roman, Yuriy

2015-09-14

The objective of this project is to understand the mechanistic aspects behind the cooperative activation of oxygenates by catalytic pairs in aqueous media. Specifically, we will investigate how the reactivity of a solid Lewis acid can be modulated by pairing the active site with other catalytic sites at the molecular level, with the ultimate goal of enhancing activation of targeted functional groups. Although unusual catalytic properties have been attributed to the cooperative effects promoted by such catalytic pairs, virtually no studies exist detailing the use heterogeneous water-tolerant Lewis pairs. A main goal of this work is to devise rational pathwaysmore » for the synthesis of porous heterogeneous catalysts featuring isolated Lewis pairs that are active in the transformation of biomass-derived oxygenates in the presence of bulk water. Achieving this technical goal will require closely linking advanced synthesis techniques; detailed kinetic and mechanistic investigations; strict thermodynamic arguments; and comprehensive characterization studies of both materials and reaction intermediates. For the last performance period (2014-2015), two technical aims were pursued: 1) C-C coupling using Lewis acid and base pairs in Lewis acidic zeolites. Tin-, zirconium-, and hafnium containing zeolites (e.g., Sn-, Zr-, and Hf-Beta) are versatile solid Lewis acids that selectively activate carbonyl functional groups. In this aim, we demonstrate that these zeolites catalyze the cross-aldol condensation of aromatic aldehydes with acetone under mild reaction conditions with near quantitative yields. NMR studies with isotopically labeled molecules confirm that acid-base pairs in the Si-O-M framework ensemble promote soft enolization through α-proton abstraction. The Lewis acidic zeolites maintain activity in the presence of water and, unlike traditional base catalysts, in acidic solutions. 2) One-pot synthesis of MWW zeolite nanosheets for activation of bulky substrates. Through post-synthetic modifications, layered zeolite precursors can be transformed into 2-dimensional (2D), zeolites with open architectures. These novel hierarchical microporous/mesoporous materials with exposed active sites can facilitate the conversion of bulky substrates while maintaining higher stability than amorphous mesoporous materials. However, post-synthetic exfoliation techniques are energy intensive, multi-step and require highly alkaline conditions that result in low silica yields and a partially amorphous product. In this aim, we demonstrate an effective one-pot synthesis method to generate exfoliated single-unit-cell thick MWW nanosheets. The new material, named MIT-1, is synthesized using a rationally-designed OSDA and results in a material with high crystallinity, surface area, and acidity that does not require post-synthetic treatments other than calcination. A parametric study of Al, Na, and water content reveals that MIT-1 crystallizes over a wide synthetic window. Characterization data show that MIT-1 has high mesoporosity with an external surface area exceeding 500 m2g-1 and a high external acid site density of 21 x 10-5 mol g-1. Catalytic tests demonstrate that MIT-1 has three-fold higher catalytic activity for the Friedel-Crafts alkylation of benzene with benzyl alcohol as compared to that of other 3D MWW topology zeolites.« less

Identification of a TAAT-containing motif required for high level expression of the COL1A1 promoter in differentiated osteoblasts of transgenic mice

NASA Technical Reports Server (NTRS)

Dodig, M.; Kronenberg, M. S.; Bedalov, A.; Kream, B. E.; Gronowicz, G.; Clark, S. H.; Mack, K.; Liu, Y. H.; Maxon, R.; Pan, Z. Z.;

A two-dimensional 1H-NMR study of the dam methylase site: comparison between the hemimethylated GATC sequence, its unmethylated analogue and a hemimethylated CATG sequence. The sequence dependence of methylation upon base-pair lifetimes.

PubMed

Fazakerley, G V; Quignard, E; Teoule, R; Guy, A; Guschlbauer, W

1987-09-15

We report two-dimensional NOE (NOESY) spectra on the sequence d(GCGATCATGG).d(CCATGATCGC) which contains the unmethylated dam site. As expected the DNA adopts a B-form conformation but appears to be distorted at the TG step of the second strand. This distorsion, probably bending, is not seen on the opposite strand. When the first strand is methylated on adenine in the GATC or CATG sequence the NOESY spectra indicate little or no change in the conformation. However the single strand-duplex exchange is slowed down to the slow-exchange region on a proton NMR time scale. We have assigned the exchangeable imino and cytidine amino resonances of the three duplexes. From the imino linewidths as a function of temperature, we observe that the unmethylated and the hemimethylated Gm6ATC duplexes melt normally from the ends. However, this is not so for the hemimethylated Cm6ATG duplex which, apart from the terminal base pairs, melts cooperatively and at higher temperature. In spectra recorded in H2O a second duplex is observed, for the Gm6ATC sequence, which we have not been able to identify. It is however unlikely to be a hairpin structure. Ultraviolet-melting curves also indicate the presence of two transitions for this duplex. The effect of methylation upon base-pair lifetimes has been studied by comparing the above three duplexes. Little effect is observed upon methylation in the GATC sequence but a drastic increase in the lifetimes of all base pairs is observed upon methylation in the CATG sequence.

Support effects in catalysis studied by in-situ sum frequency generation vibrational spectroscopy and in-situ x-ray spectroscopies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kennedy, Griffin John

Here, kinetic measurements are paired with in-situ spectroscopic characterization tools to investigate colloidally based, supported Pt catalytic model systems in order to elucidate the mechanisms by which metal and support work in tandem to dictate activity and selectivity. The results demonstrate oxide support materials, while inactive in absence of Pt nanoparticles, possess unique active sites for the selective conversion of gas phase molecules when paired with an active metal catalyst.

Fragment-based identification of determinants of conformational and spectroscopic change at the ricin active site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Carra,J.; McHugh, C.; Mulligan, S.

2007-01-01

We found that amide ligands can bind weakly but specifically to the ricin active site, producing significant shifts in positions of the critical active site residues Arg180 and Tyr80. These results indicate that fragment-based drug discovery methods are capable of identifying minimal bonding determinants of active-site side-chain rearrangements and the mechanistic origins of spectroscopic shifts. Our results suggest that tryptophan fluorescence provides a sensitive probe for the geometric relationship of arginine-tryptophan pairs, which often have significant roles in protein function. Using the unusual characteristics of the RTA system, we measured the still controversial thermodynamic changes of site-specific urea binding tomore » a protein, results that are relevant to understanding the physical mechanisms of protein denaturation.« less

Sordaria, a model system to uncover links between meiotic pairing and recombination

PubMed Central

Zickler, Denise; Espagne, Eric

2017-01-01

The mycelial fungus Sordaria macrospora was first used as experimental system for meiotic recombination. This review shows that it provides also a powerful cytological system for dissecting chromosome dynamics in wild-type and mutant meioses. Fundamental cytogenetic findings include: (1) The identification of presynaptic alignment as a key step in pairing of homologous chromosomes. (2) The discovery that biochemical complexes that mediate recombination at the DNA level concomitantly mediate pairing of homologs. (3) This pairing process involves not only resolution but also avoidance of chromosomal entanglements and the resolution system includes dissolution of constraining DNA recombination interactions, achieved by a unique role of Mlh1. (4) Discovery that the central components of the synaptonemal complex directly mediate the re-localization of the recombination proteins from on-axis to in-between homologue axis positions. (5) Identification of putative STUbL protein Hei10 as a structure-based signal transduction molecule that coordinates progression and differentiation of recombinational interactions at multiple stages. (6) Discovery that a single interference process mediates both nucleation of the SC and designation of crossover sites, thereby ensuring even spacing of both features. (7) Discovery of local modulation of sister-chromatid cohesion at sites of crossover recombination. PMID:26877138

APOLLO: a quality assessment service for single and multiple protein models.

PubMed

Wang, Zheng; Eickholt, Jesse; Cheng, Jianlin

2011-06-15

We built a web server named APOLLO, which can evaluate the absolute global and local qualities of a single protein model using machine learning methods or the global and local qualities of a pool of models using a pair-wise comparison approach. Based on our evaluations on 107 CASP9 (Critical Assessment of Techniques for Protein Structure Prediction) targets, the predicted quality scores generated from our machine learning and pair-wise methods have an average per-target correlation of 0.671 and 0.917, respectively, with the true model quality scores. Based on our test on 92 CASP9 targets, our predicted absolute local qualities have an average difference of 2.60 Å with the actual distances to native structure. http://sysbio.rnet.missouri.edu/apollo/. Single and pair-wise global quality assessment software is also available at the site.

The effect of site-based preservice experiences on elementary science teaching self-efficacy beliefs

NASA Astrophysics Data System (ADS)

Wingfield, Mary E.

Current reform in science education has focused on the need for improvement of preservice teacher training (National Science Education Standards, 1996). As a situation specific construct (Bandura, 1977), self-efficacy studies have been conducted to investigate factors that impact preservice teachers' sense of confidence as it relates to their ability to become successful science teachers. This descriptive study identified factors in the site based experiences that affected preservice elementary teachers' self-efficacy as measured by the Science Teaching Efficacy Belief Instrument (STEBL-B) (Enochs and Riggs, 1990). The sample consisted of the entire population of undergraduate elementary preservice teachers in the site based teacher education program during the fall semester of 1997 at a large south central urban university. The 131 paired, pretest posttests of the entire STEBL-B and the two constructs were analyzed for significance in mean score gains. Results of the paired t test yielded a t value of 11.52 which was significant at p <.001. An analysis of covariance using the pretest as the covariate yielded an F value of 6.41 which was statistically significant at p <.001. These quantitative results were supported by interviews and by written comments on questionnaires that determined ratings for the extent of impact on self-efficacy from site based experiences. Results of this study indicate that the experiences of the site based program has a significant positive impact on the preservice teachers' self-efficacy. The implication for teacher educators is that this specific affective dimension can be significantly enhanced. The site based program can provide the four factors Bandura identified as sources of information used to determine self-efficacy. These include performance accomplishments through authentic teaching experiences, vicarious experiences through observation of the site based teachers, and verbal persuasion and physiological states from feedback given by the university coordinators. The majority of these preservice teachers started the semester with a negative attitude toward teaching science, but ended the semester with a positive view of themselves as effective science teachers in the future.

Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development

PubMed Central

Kazemian, Majid; Pham, Hannah; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh

2013-01-01

Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein–protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action. PMID:23847101

Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development.

PubMed

Kazemian, Majid; Pham, Hannah; Wolfe, Scot A; Brodsky, Michael H; Sinha, Saurabh

2013-09-01

Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein-protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action.

Advancing viral RNA structure prediction: measuring the thermodynamics of pyrimidine-rich internal loops.

PubMed

Phan, Andy; Mailey, Katherine; Saeki, Jessica; Gu, Xiaobo; Schroeder, Susan J

2017-05-01

Accurate thermodynamic parameters improve RNA structure predictions and thus accelerate understanding of RNA function and the identification of RNA drug binding sites. Many viral RNA structures, such as internal ribosome entry sites, have internal loops and bulges that are potential drug target sites. Current models used to predict internal loops are biased toward small, symmetric purine loops, and thus poorly predict asymmetric, pyrimidine-rich loops with >6 nucleotides (nt) that occur frequently in viral RNA. This article presents new thermodynamic data for 40 pyrimidine loops, many of which can form UU or protonated CC base pairs. Uracil and protonated cytosine base pairs stabilize asymmetric internal loops. Accurate prediction rules are presented that account for all thermodynamic measurements of RNA asymmetric internal loops. New loop initiation terms for loops with >6 nt are presented that do not follow previous assumptions that increasing asymmetry destabilizes loops. Since the last 2004 update, 126 new loops with asymmetry or sizes greater than 2 × 2 have been measured. These new measurements significantly deepen and diversify the thermodynamic database for RNA. These results will help better predict internal loops that are larger, pyrimidine-rich, and occur within viral structures such as internal ribosome entry sites. © 2017 Phan et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Binding Sites Analyser (BiSA): Software for Genomic Binding Sites Archiving and Overlap Analysis

PubMed Central

Khushi, Matloob; Liddle, Christopher; Clarke, Christine L.; Graham, J. Dinny

2014-01-01

Genome-wide mapping of transcription factor binding and histone modification reveals complex patterns of interactions. Identifying overlaps in binding patterns by different factors is a major objective of genomic studies, but existing methods to archive large numbers of datasets in a personalised database lack sophistication and utility. Therefore we have developed transcription factor DNA binding site analyser software (BiSA), for archiving of binding regions and easy identification of overlap with or proximity to other regions of interest. Analysis results can be restricted by chromosome or base pair overlap between regions or maximum distance between binding peaks. BiSA is capable of reporting overlapping regions that share common base pairs; regions that are nearby; regions that are not overlapping; and average region sizes. BiSA can identify genes located near binding regions of interest, genomic features near a gene or locus of interest and statistical significance of overlapping regions can also be reported. Overlapping results can be visualized as Venn diagrams. A major strength of BiSA is that it is supported by a comprehensive database of publicly available transcription factor binding sites and histone modifications, which can be directly compared to user data. The documentation and source code are available on http://bisa.sourceforge.net PMID:24533055

Uptake, Outcomes, and Costs of Antenatal, Well-Baby, and Prevention of Mother-to-Child Transmission of HIV Services under Routine Care Conditions in Zambia

PubMed Central

Scott, Callie A.; Iyer, Hari S.; Lembela Bwalya, Deophine; Bweupe, Maximillian; Rosen, Sydney B.; Scott, Nancy; Larson, Bruce A.

2013-01-01

Background Zambia adopted Option A for prevention of mother-to-child transmission of HIV (PMTCT) in 2010 and announced a move to Option B+ in 2013. We evaluated the uptake, outcomes, and costs of antenatal, well-baby, and PMTCT services under routine care conditions in Zambia after the adoption of Option A. Methods We enrolled 99 HIV-infected/HIV-exposed (index) mother/baby pairs with a first antenatal visit in April-September 2011 at four study sites and 99 HIV-uninfected/HIV-unexposed (comparison) mother/baby pairs matched on site, gestational age, and calendar month at first visit. Data on patient outcomes and resources utilized from the first antenatal visit through six months postpartum were extracted from site registers. Costs in 2011 USD were estimated from the provider’s perspective. Results Index mothers presented for antenatal care at a mean 23.6 weeks gestation; 55% were considered to have initiated triple-drug antiretroviral therapy (ART) based on information recorded in site registers. Six months postpartum, 62% of index and 30% of comparison mother/baby pairs were retained in care; 67% of index babies retained had an unknown HIV status. Comparison and index mother/baby pairs utilized fewer resources than under fully guideline-concordant care; index babies utilized more well-baby resources than comparison babies. The average cost per comparison pair retained in care six months postpartum was $52 for antenatal and well-baby services. The average cost per index pair retained was $88 for antenatal, well-baby, and PMTCT services and increased to $185 when costs of triple-drug ART services were included. Conclusions HIV-infected mothers present to care late in pregnancy and many are lost to follow up by six months postpartum. HIV-exposed babies are more likely to remain in care and receive non-HIV, well-baby care than HIV-unexposed babies. Improving retention in care, guideline concordance, and moving to Option B+ will result in increased service delivery costs in the short term. PMID:24015245

Evidence for W=0 pairing in repulsive Hubbard square and hexagonal geometries

NASA Astrophysics Data System (ADS)

Perfetto, Enrico; Stefanucci, Gianluca; Callegari, Agnese; Cini, Michele

2004-08-01

Square and hexagonal lattices with purely repulsive on-site interactions on all sites and appropriate fillings show W=0 pairing, and the effective attractive interaction is due to a symmetry driven correlation effect; the W=0 pairs are two-body singlet eigenstates of the Hamiltonian with vanishing on-site repulsion. We can set up gedanken experiments with these bound pairs. Chains of CuO 4 units connected by weak links provide a test case which displays bound pair hopping and superconducting flux quantization (SFQ). Focusing on the low-energy sector, one obtains an accurate description in terms of an effective hard-core boson Hamiltonian which naturally describes itinerant pairs and SFQ in mesoscopic rings. For the numerical calculations, we take advantage of a recently proposed exact spin-disentangled diagonalization technique which can be generally applied to many-fermion problems and drastically reduces the size of the matrices to be handled. Remarkably, the very same pairing mechanism also works neatly with the wrapped honeycomb lattice, suitable for armchair carbon nanotubes; the binding energy of W=0 pairs depends strongly on the filling and decreases towards a small but non-zero value in the graphite limit.

Structure of the circumsporozoite protein gene in 18 strains of Plasmodium falciparum.

PubMed

Weber, J L; Hockmeyer, W T

1985-06-01

Using the cloned circumsporozoite (CS) protein gene of a Brazilian strain of Plasmodium falciparum as probe, we have analyzed the structure of the CS protein gene from 17 other Asian, African, Central and South American parasite strains by nucleic acid hybridization. Each strain appears to have one CS protein gene which hybridizes readily to the Brazilian strain probe. The 5' and 3' thirds of the genes are invariant in size in all 18 strains whereas the central third containing the 12 base pair tandem repeats varies in size over a range of about 100 base pairs. Several differences were found in the locations of Sau3A sites in the genes. The Sau3A sites are significant because each of the minority Asn-Val-Asp-Pro repeats in the cloned gene has a Sau3A site. DNA melting of hybrids revealed a high degree of homology between the sequences of the cloned gene and genes from an Asian strain and an African strain. A 14 base oligodeoxynucleotide with a sequence from the central repeat region hybridized to all strains tested. We conclude that the CS protein gene is highly conserved among strains of P. falciparum and that malaria vaccine development with the CS protein is unlikely to be complicated by strain variation.

pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

PubMed

Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

2009-11-23

Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

ETMB-RBF: discrimination of metal-binding sites in electron transporters based on RBF networks with PSSM profiles and significant amino acid pairs.

PubMed

Ou, Yu-Yen; Chen, Shu-An; Wu, Sheng-Cheng

2013-01-01

Cellular respiration is the process by which cells obtain energy from glucose and is a very important biological process in living cell. As cells do cellular respiration, they need a pathway to store and transport electrons, the electron transport chain. The function of the electron transport chain is to produce a trans-membrane proton electrochemical gradient as a result of oxidation-reduction reactions. In these oxidation-reduction reactions in electron transport chains, metal ions play very important role as electron donor and acceptor. For example, Fe ions are in complex I and complex II, and Cu ions are in complex IV. Therefore, to identify metal-binding sites in electron transporters is an important issue in helping biologists better understand the workings of the electron transport chain. We propose a method based on Position Specific Scoring Matrix (PSSM) profiles and significant amino acid pairs to identify metal-binding residues in electron transport proteins. We have selected a non-redundant set of 55 metal-binding electron transport proteins as our dataset. The proposed method can predict metal-binding sites in electron transport proteins with an average 10-fold cross-validation accuracy of 93.2% and 93.1% for metal-binding cysteine and histidine, respectively. Compared with the general metal-binding predictor from A. Passerini et al., the proposed method can improve over 9% of sensitivity, and 14% specificity on the independent dataset in identifying metal-binding cysteines. The proposed method can also improve almost 76% sensitivity with same specificity in metal-binding histidine, and MCC is also improved from 0.28 to 0.88. We have developed a novel approach based on PSSM profiles and significant amino acid pairs for identifying metal-binding sites from electron transport proteins. The proposed approach achieved a significant improvement with independent test set of metal-binding electron transport proteins.

ETMB-RBF: Discrimination of Metal-Binding Sites in Electron Transporters Based on RBF Networks with PSSM Profiles and Significant Amino Acid Pairs

PubMed Central

Ou, Yu-Yen; Chen, Shu-An; Wu, Sheng-Cheng

2013-01-01

Background Cellular respiration is the process by which cells obtain energy from glucose and is a very important biological process in living cell. As cells do cellular respiration, they need a pathway to store and transport electrons, the electron transport chain. The function of the electron transport chain is to produce a trans-membrane proton electrochemical gradient as a result of oxidation–reduction reactions. In these oxidation–reduction reactions in electron transport chains, metal ions play very important role as electron donor and acceptor. For example, Fe ions are in complex I and complex II, and Cu ions are in complex IV. Therefore, to identify metal-binding sites in electron transporters is an important issue in helping biologists better understand the workings of the electron transport chain. Methods We propose a method based on Position Specific Scoring Matrix (PSSM) profiles and significant amino acid pairs to identify metal-binding residues in electron transport proteins. Results We have selected a non-redundant set of 55 metal-binding electron transport proteins as our dataset. The proposed method can predict metal-binding sites in electron transport proteins with an average 10-fold cross-validation accuracy of 93.2% and 93.1% for metal-binding cysteine and histidine, respectively. Compared with the general metal-binding predictor from A. Passerini et al., the proposed method can improve over 9% of sensitivity, and 14% specificity on the independent dataset in identifying metal-binding cysteines. The proposed method can also improve almost 76% sensitivity with same specificity in metal-binding histidine, and MCC is also improved from 0.28 to 0.88. Conclusions We have developed a novel approach based on PSSM profiles and significant amino acid pairs for identifying metal-binding sites from electron transport proteins. The proposed approach achieved a significant improvement with independent test set of metal-binding electron transport proteins. PMID:23405059

Architecture of a Fur Binding Site: a Comparative Analysis

PubMed Central

Lavrrar, Jennifer L.; McIntosh, Mark A.

2003-01-01

Fur is an iron-binding transcriptional repressor that recognizes a 19-bp consensus site of the sequence 5′-GATAATGATAATCATTATC-3′. This site can be defined as three adjacent hexamers of the sequence 5′-GATAAT-3′, with the third being slightly imperfect (an F-F-F configuration), or as two hexamers in the forward orientation separated by one base pair from a third hexamer in the reverse orientation (an F-F-x-R configuration). Although Fur can bind synthetic DNA sequences containing the F-F-F arrangement, most natural binding sites are variations of the F-F-x-R arrangement. The studies presented here compared the ability of Fur to recognize synthetic DNA sequences containing two to four adjacent hexamers with binding to sequences containing variations of the F-F-x-R arrangement (including natural operator sequences from the entS and fepB promoter regions of Escherichia coli). Gel retardation assays showed that the F-F-x-R architecture was necessary for high-affinity Fur-DNA interactions and that contiguous hexamers were not recognized as effectively. In addition, the stoichiometry of Fur at each binding site was determined, showing that Fur interacted with its minimal 19-bp binding site as two overlapping dimers. These data confirm the proposed overlapping-dimer binding model, where the unit of interaction with a single Fur dimer is two inverted hexamers separated by a C:G base pair, with two overlapping units comprising the 19-bp consensus binding site required for the high-affinity interaction with two Fur dimers. PMID:12644489

A Bayesian mixture model for chromatin interaction data.

PubMed

Niu, Liang; Lin, Shili

2015-02-01

Chromatin interactions mediated by a particular protein are of interest for studying gene regulation, especially the regulation of genes that are associated with, or known to be causative of, a disease. A recent molecular technique, Chromatin interaction analysis by paired-end tag sequencing (ChIA-PET), that uses chromatin immunoprecipitation (ChIP) and high throughput paired-end sequencing, is able to detect such chromatin interactions genomewide. However, ChIA-PET may generate noise (i.e., pairings of DNA fragments by random chance) in addition to true signal (i.e., pairings of DNA fragments by interactions). In this paper, we propose MC_DIST based on a mixture modeling framework to identify true chromatin interactions from ChIA-PET count data (counts of DNA fragment pairs). The model is cast into a Bayesian framework to take into account the dependency among the data and the available information on protein binding sites and gene promoters to reduce false positives. A simulation study showed that MC_DIST outperforms the previously proposed hypergeometric model in terms of both power and type I error rate. A real data study showed that MC_DIST may identify potential chromatin interactions between protein binding sites and gene promoters that may be missed by the hypergeometric model. An R package implementing the MC_DIST model is available at http://www.stat.osu.edu/~statgen/SOFTWARE/MDM.

Interaction of small molecules with double-stranded RNA: spectroscopic, viscometric, and calorimetric study of hoechst and proflavine binding to PolyCG structures.

PubMed

Sinha, Rangana; Hossain, Maidul; Kumar, Gopinatha Suresh

2009-04-01

Design and synthesis of new small molecules binding to double-stranded RNA necessitate complete understanding of the molecular aspects of the binding of many existing molecules. Toward this goal, in this work we evaluated the biophysical aspects of the interaction of a DNA intercalator (proflavine) and a minor groove binder (hoechst 33258) with two polymorphic forms of polyCG, namely, the right-handed Watson-Crick base paired A-form and the left-handed Hoogsteen base paired H(L)-form, by absorption, fluorescence, and viscometry experiments. The energetics of the interaction of these molecules with the RNA structures has also been elucidated by isothermal titration calorimetry (ITC). Results suggest that proflavine strongly intercalates in both forms of polyCG, whereas hoechst shows mainly groove-binding modes. The binding of both drugs to both forms of RNA resulted in significant conformational change to the RNA structure with the bound molecules being placed in the chiral RNA helix. ITC profiles for both proflavine and hoechst show two binding sites. Binding of proflavine to both forms of RNA is endothermic and entropy driven in the first site and exothermic and enthalpy driven in the second site, whereas hoechst binding to both forms of RNA is exothermic and enthalpy driven in the first site and endothermic and entropy driven in the second site. This study suggests that the binding affinity characteristics and energetics of interaction of these DNA binding molecules with the RNA conformations are significantly different and may serve as data for future development of effective structure-selective RNA-based drugs.

Replication of a carcinogenic nitropyrene DNA lesion by human Y-family DNA polymerase

PubMed Central

Kirouac, Kevin N.; Basu, Ashis K.; Ling, Hong

2013-01-01

Nitrated polycyclic aromatic hydrocarbons are common environmental pollutants, of which many are mutagenic and carcinogenic. 1-Nitropyrene is the most abundant nitrated polycyclic aromatic hydrocarbon, which causes DNA damage and is carcinogenic in experimental animals. Error-prone translesion synthesis of 1-nitropyrene–derived DNA lesions generates mutations that likely play a role in the etiology of cancer. Here, we report two crystal structures of the human Y-family DNA polymerase iota complexed with the major 1-nitropyrene DNA lesion at the insertion stage, incorporating either dCTP or dATP nucleotide opposite the lesion. Polι maintains the adduct in its active site in two distinct conformations. dCTP forms a Watson–Crick base pair with the adducted guanine and excludes the pyrene ring from the helical DNA, which inhibits replication beyond the lesion. By contrast, the mismatched dATP stacks above the pyrene ring that is intercalated in the helix and achieves a productive conformation for misincorporation. The intra-helical bulky pyrene mimics a base pair in the active site and facilitates adenine misincorporation. By structure-based mutagenesis, we show that the restrictive active site of human polη prevents the intra-helical conformation and A-base misinsertions. This work provides one of the molecular mechanisms for G to T transversions, a signature mutation in human lung cancer. PMID:23268450

Determinant quantum Monte Carlo study of d -wave pairing in the plaquette Hubbard hamiltonian

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ying, T.; Mondaini, R.; Sun, X. D.

2014-08-13

We used the determinant Quantum Monte Carlo (DQMC) to determine the pairing and magnetic response for a Hubbard model built up from four-site clusters - a two-dimensional square lattice consisting of elemental 2x2 plaquettes with hopping t and on-site repulsion U coupled by an interplaquette hopping t' ≤ t. Superconductivity in this geometry has previously been studied by a variety of analytic and numeric methods, with differing conclusions concerning whether the pairing correlations and transition temperature are raised near half-filling by the inhomogeneous hopping or not. For U/t = 4, DQMC indicates an optimal t'/t ≈ 0.4 at which themore » pairing vertex is most attractive. We also found that optimal t'/t increases with U/t. We then contrast our results for this plaquette model with a Hamiltonian which instead involves a regular pattern of site energies whose large site energy limit is the three band CuO 2 model; we show that there the inhomogeneity rapidly, and monotonically, suppresses pairing.« less

Empirical evidence for acceleration-dependent amplification factors

USGS Publications Warehouse

Borcherdt, R.D.

2002-01-01

Site-specific amplification factors, Fa and Fv, used in current U.S. building codes decrease with increasing base acceleration level as implied by the Loma Prieta earthquake at 0.1g and extrapolated using numerical models and laboratory results. The Northridge earthquake recordings of 17 January 1994 and subsequent geotechnical data permit empirical estimates of amplification at base acceleration levels up to 0.5g. Distance measures and normalization procedures used to infer amplification ratios from soil-rock pairs in predetermined azimuth-distance bins significantly influence the dependence of amplification estimates on base acceleration. Factors inferred using a hypocentral distance norm do not show a statistically significant dependence on base acceleration. Factors inferred using norms implied by the attenuation functions of Abrahamson and Silva show a statistically significant decrease with increasing base acceleration. The decrease is statistically more significant for stiff clay and sandy soil (site class D) sites than for stiffer sites underlain by gravely soils and soft rock (site class C). The decrease in amplification with increasing base acceleration is more pronounced for the short-period amplification factor, Fa, than for the midperiod factor, Fv.

Visualizing excitations at buried heterojunctions in organic semiconductor blends.

PubMed

Jakowetz, Andreas C; Böhm, Marcus L; Sadhanala, Aditya; Huettner, Sven; Rao, Akshay; Friend, Richard H

2017-05-01

Interfaces play a crucial role in semiconductor devices, but in many device architectures they are nanostructured, disordered and buried away from the surface of the sample. Conventional optical, X-ray and photoelectron probes often fail to provide interface-specific information in such systems. Here we develop an all-optical time-resolved method to probe the local energetic landscape and electronic dynamics at such interfaces, based on the Stark effect caused by electron-hole pairs photo-generated across the interface. Using this method, we found that the electronically active sites at the polymer/fullerene interfaces in model bulk-heterojunction blends fall within the low-energy tail of the absorption spectrum. This suggests that these sites are highly ordered compared with the bulk of the polymer film, leading to large wavefunction delocalization and low site energies. We also detected a 100 fs migration of holes from higher- to lower-energy sites, consistent with these charges moving ballistically into more ordered polymer regions. This ultrafast charge motion may be key to separating electron-hole pairs into free charges against the Coulomb interaction.

Visualizing excitations at buried heterojunctions in organic semiconductor blends

NASA Astrophysics Data System (ADS)

Jakowetz, Andreas C.; Böhm, Marcus L.; Sadhanala, Aditya; Huettner, Sven; Rao, Akshay; Friend, Richard H.

2017-05-01

Interfaces play a crucial role in semiconductor devices, but in many device architectures they are nanostructured, disordered and buried away from the surface of the sample. Conventional optical, X-ray and photoelectron probes often fail to provide interface-specific information in such systems. Here we develop an all-optical time-resolved method to probe the local energetic landscape and electronic dynamics at such interfaces, based on the Stark effect caused by electron-hole pairs photo-generated across the interface. Using this method, we found that the electronically active sites at the polymer/fullerene interfaces in model bulk-heterojunction blends fall within the low-energy tail of the absorption spectrum. This suggests that these sites are highly ordered compared with the bulk of the polymer film, leading to large wavefunction delocalization and low site energies. We also detected a 100 fs migration of holes from higher- to lower-energy sites, consistent with these charges moving ballistically into more ordered polymer regions. This ultrafast charge motion may be key to separating electron-hole pairs into free charges against the Coulomb interaction.

Evolution of I-SceI Homing Endonucleases with Increased DNA Recognition Site Specificity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Joshi, Rakesh; Ho, Kwok Ki; Tenney, Kristen

2013-09-18

Elucidating how homing endonucleases undergo changes in recognition site specificity will facilitate efforts to engineer proteins for gene therapy applications. I-SceI is a monomeric homing endonuclease that recognizes and cleaves within an 18-bp target. It tolerates limited degeneracy in its target sequence, including substitution of a C:G{sub +4} base pair for the wild-type A:T{sub +4} base pair. Libraries encoding randomized amino acids at I-SceI residue positions that contact or are proximal to A:T{sub +4} were used in conjunction with a bacterial one-hybrid system to select I-SceI derivatives that bind to recognition sites containing either the A:T{sub +4} or the C:G{submore » +4} base pairs. As expected, isolates encoding wild-type residues at the randomized positions were selected using either target sequence. All I-SceI proteins isolated using the C:G{sub +4} recognition site included small side-chain substitutions at G100 and either contained (K86R/G100T, K86R/G100S and K86R/G100C) or lacked (G100A, G100T) a K86R substitution. Interestingly, the binding affinities of the selected variants for the wild-type A:T{sub +4} target are 4- to 11-fold lower than that of wild-type I-SceI, whereas those for the C:G{sub +4} target are similar. The increased specificity of the mutant proteins is also evident in binding experiments in vivo. These differences in binding affinities account for the observed -36-fold difference in target preference between the K86R/G100T and wild-type proteins in DNA cleavage assays. An X-ray crystal structure of the K86R/G100T mutant protein bound to a DNA duplex containing the C:G{sub +4} substitution suggests how sequence specificity of a homing enzyme can increase. This biochemical and structural analysis defines one pathway by which site specificity is augmented for a homing endonuclease.« less

Structure-affinity relationships for the binding of actinomycin D to DNA

NASA Astrophysics Data System (ADS)

Gallego, José; Ortiz, Angel R.; de Pascual-Teresa, Beatriz; Gago, Federico

1997-03-01

Molecular models of the complexes between actinomycin D and 14 different DNA hexamers were built based on the X-ray crystal structure of the actinomycin-d(GAAGCTTC)2 complex. The DNA sequences included the canonical GpC binding step flanked by different base pairs, nonclassical binding sites such as GpG and GpT, and sites containing 2,6-diamino- purine. A good correlation was found between the intermolecular interaction energies calculated for the refined complexes and the relative preferences of actinomycin binding to standard and modified DNA. A detailed energy decomposition into van der Waals and electrostatic components for the interactions between the DNA base pairs and either the chromophore or the peptidic part of the antibiotic was performed for each complex. The resulting energy matrix was then subjected to principal component analysis, which showed that actinomycin D discriminates among different DNA sequences by an interplay of hydrogen bonding and stacking interactions. The structure-affinity relationships for this important antitumor drug are thus rationalized and may be used to advantage in the design of novel sequence-specific DNA-binding agents.

Thermodynamic Signature of DNA Damage: Characterization of DNA with a 5-Hydroxy-2'-deoxycytidine•2'-Deoxyguanosine Base Pair

PubMed Central

Ganguly, Manjori; Szulik, Marta W.; Donahue, Patrick S.; Clancy, Kate; Stone, Michael P.; Gold, Barry

2012-01-01

Oxidation of DNA due to exposure to reactive oxygen species is a major source of DNA damage. One of the oxidation lesions formed, 5-hydroxy-2'-deoxycytidine, has been shown to miscode by some replicative DNA polymerases but not by error prone polymerases capable of translesion synthesis. The 5-hydroxy-2'-deoxycytidine lesion is repaired by DNA glycosylases that require the 5-hydroxycytidine base to be extrahelical so it can enter into the enzyme's active site where it is excised off the DNA backbone to afford an abasic site. The thermodynamic and NMR results presented herein, describe the effect of a 5-hydroxy-2'-deoxycytidine•2'-deoxyguanosine base pair on the stability of two different DNA duplexes. The results demonstrate that the lesion is highly destabilizing and that the energy barrier for the unstacking of 5-hydroxy-2'-deoxycytidine from the DNA duplex may be low. This could provide a thermodynamic mode of adduct identification by DNA glycosylases that require the lesion to be extrahelical. PMID:22332945

MicroRNA Targeting Specificity in Mammals: Determinants Beyond Seed Pairing

PubMed Central

Grimson, Andrew; Farh, Kyle Kai-How; Johnston, Wendy K.; Garrett-Engele, Philip; Lim, Lee P.; Bartel, David P.

2013-01-01

Summary Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are ~7-nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for co-expressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13–16, and positioning within the 3'UTR at least 15 nt from the stop codon and away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets. PMID:17612493

Structural determinants of an internal ribosome entry site that direct translational reading frame selection

PubMed Central

Ren, Qian; Au, Hilda H.T.; Wang, Qing S.; Lee, Seonghoon; Jan, Eric

2014-01-01

The dicistrovirus intergenic internal ribosome entry site (IGR IRES) directly recruits the ribosome and initiates translation using a non-AUG codon. A subset of IGR IRESs initiates translation in either of two overlapping open reading frames (ORFs), resulting in expression of the 0 frame viral structural polyprotein and an overlapping +1 frame ORFx. A U–G base pair adjacent to the anticodon-like pseudoknot of the IRES directs +1 frame translation. Here, we show that the U-G base pair is not absolutely required for +1 frame translation. Extensive mutagenesis demonstrates that 0 and +1 frame translation can be uncoupled. Ribonucleic acid (RNA) structural probing analyses reveal that the mutant IRESs adopt distinct conformations. Toeprinting analysis suggests that the reading frame is selected at a step downstream of ribosome assembly. We propose a model whereby the IRES adopts conformations to occlude the 0 frame aminoacyl-tRNA thereby allowing delivery of the +1 frame aminoacyl-tRNA to the A site to initiate translation of ORFx. This study provides a new paradigm for programmed recoding mechanisms that increase the coding capacity of a viral genome. PMID:25038250

A Bulky Rhodium Complex Bound to an Adenosine-Adenosine DNA Mismatch: General Architecture of the Metalloinsertion Binding Mode†

PubMed Central

Zeglis, Brian M.; Pierre, Valérie C.; Kaiser, Jens T.; Barton, Jacqueline K.

2009-01-01

Two crystal structures are determined for Δ-Rh(bpy)2(chrysi)3+ (chrysi = 5,6-chrysenequinone diimine) bound to the oligonucleotide duplex 5′-CGGAAATTACCG-3′ containing two adenosine-adenosine mismatches (italics) through metalloinsertion. Diffraction quality crystals with two different space groups (P3221 and P43212) were obtained under very similar crystallization conditions. In both structures, the bulky rhodium complex inserts into the two mismatched sites from the minor groove side, ejecting the mismatched bases into the major groove. The conformational changes are localized to the mismatched site; the metal complex replaces the mismatched base pair without an increase in base pair rise. The expansive metal complex is accommodated in the duplex by a slight opening in the phosphodiester backbone; all sugars retain a C2′-endo puckering, and flanking base pairs neither stretch nor shear. The structures differ, however, in that in one of the structures, an additional metal complex is bound by intercalation from the major groove at the central 5′-AT-3′ step. We conclude that this additional metal complex is intercalated into this central step because of crystal packing forces. The structures described here of Δ-Rh(bpy)2(chrysi)3+ bound to thermodynamically destabilized AA mismatches share critical features with binding by metalloinsertion in two other oligonucleotides containing different single base mismatches. These results underscore the generality of the metalloinsertion as a new mode of non-covalent binding by small molecules with a DNA duplex. PMID:19374348

Nine pairs of megastigmane enantiomers from the leaves of Eucommia ulmoides Oliver.

PubMed

Yan, Jiankun; Shi, Xuliu; Donkor, Paul Owusu; Zhu, Huajie; Gao, Xiumei; Ding, Liqin; Qiu, Feng

2017-10-01

Nine pairs of megastigmane enantiomers (1a/1b-9a/9b), comprising two new compounds (6S,9R)-blumenol C (7b), (6S,9S)-blumenol C (8b), two pairs of enantiomers (+)-(6R)-eucomegastigmane A (1a), (-)-(6S)-eucomegastigmane A (1b), (+)-(3S,4S)-eucomegastigmane B (5a), (-)-(3R,4R)-eucomegastigmane B (5b) isolated by chiral resolution firstly, and twelve known compounds, were isolated from the leaves of Eucommia ulmoides Oliver. Their structures were elucidated based on extensive spectroscopic analysis. Absolute configurations of the megastigmane enantiomers were assigned by comparing experimental ECD and OR with calculated ECD and OR. Docking-based virtual screening of all compounds showed that megastigmane enantiomers have weak intermolecular interactions with the binding site residues of angiotensin-converting enzyme (ACE) and angiotensin II type 1 receptor (AT 1 R).

Lead and selenite adsorption at water–goethite interfaces from first principles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leung, Kevin; Criscenti, Louise J.

Here, the complexation of toxic and/or radioactive ions on to mineral surfaces is an important topic in geochemistry. We apply periodic-boundary-conditions density functional theory (DFT) molecular dynamics simulations to examine the coordination of Pb(II),more » $${\\rm SeO}_3^{2-}$$ , and their contact ion pairs to goethite (1 0 1) and (2 1 0) surfaces. The multitude of Pb(II) adsorption sites and possibility of Pb(II)-induced FeOH deprotonation make this a complex problem. At surface sites where Pb(II) is coordinated to three FeO and/or FeOH groups, and with judicious choices of FeOH surface group protonation states, the predicted Fe–Pb distances are in good agreement with EXAFS measurements. Trajectories where Pb(II) is in part coordinated to only two surface Fe–O groups exhibit larger fluctuations in Pb–O distances. Pb(II)/$${\\rm SeO}_3^{2-}$$ contact ion pairs are at least metastable on goethite (2 1 0) surfaces if the $${\\rm SeO}_3^{2-}$$ has a monodentate Se–O–Fe bond. Our DFT-based molecular dynamics calculations are a prerequisite for calculations of finite temperature equilibrium binding constants of Pb(II) and Pb(II)/$${\\rm SeO}_3^{2-}$$ ion pairs to goethite adsorption sites.« less

Lead and selenite adsorption at water–goethite interfaces from first principles

DOE PAGES

Leung, Kevin; Criscenti, Louise J.

2017-08-04

Here, the complexation of toxic and/or radioactive ions on to mineral surfaces is an important topic in geochemistry. We apply periodic-boundary-conditions density functional theory (DFT) molecular dynamics simulations to examine the coordination of Pb(II),more » $${\\rm SeO}_3^{2-}$$ , and their contact ion pairs to goethite (1 0 1) and (2 1 0) surfaces. The multitude of Pb(II) adsorption sites and possibility of Pb(II)-induced FeOH deprotonation make this a complex problem. At surface sites where Pb(II) is coordinated to three FeO and/or FeOH groups, and with judicious choices of FeOH surface group protonation states, the predicted Fe–Pb distances are in good agreement with EXAFS measurements. Trajectories where Pb(II) is in part coordinated to only two surface Fe–O groups exhibit larger fluctuations in Pb–O distances. Pb(II)/$${\\rm SeO}_3^{2-}$$ contact ion pairs are at least metastable on goethite (2 1 0) surfaces if the $${\\rm SeO}_3^{2-}$$ has a monodentate Se–O–Fe bond. Our DFT-based molecular dynamics calculations are a prerequisite for calculations of finite temperature equilibrium binding constants of Pb(II) and Pb(II)/$${\\rm SeO}_3^{2-}$$ ion pairs to goethite adsorption sites.« less

Empirical Site Amplification Factors Incorporating Soil Nonlinearity in Taiwan

NASA Astrophysics Data System (ADS)

Kuo, C. H.; Chung, C. H.; Che-Min, L.; Huang, J. Y.; Wen, K. L.

2017-12-01

Characteristics of site amplifications caused by both crustal and subduction earthquakes are important in Taiwan. For example, seismic waves were amplified and led to significant building damages in the Taipei Basin by the 1986 Hualien offshore (subduction interface) and the 1999 Chi-Chi earthquakes (crustal), for which the epicentral distances were about 100 km. To understand local site amplifications in Taiwan, empirical site amplification factors for horizontal ground motions are studied using recently constructed strong motion and site databases for the free-field TSMIP stations in Taiwan. Records of large magnitude earthquakes of ML larger than six from 1994 to 2014 were selected for this study. Site amplification factors at site conditions with Vs30 of 120 m/s to 1500 m/s and base accelerations up to 0.7g were inferred from intensity ratios of station pairs within specific distances. The reference site condition is assumed as Vs30 of 760 m/s (B/C boundary). Preliminary results indicate: 1. Soil nonlinearity is more obviously at short periods (PGA, Sa0.3) than long periods (PGV, Sa1.0). 2. Soil nonlinearity is significant for stations belong to site classes of B, C, D, and E in Taiwan. 3. Effect of station-pair distance is seen at short periods (PGA and Sa0.3). 4. No significant different is found in site amplifications of crustal and subduction earthquakes. The result could be a reference for the Fa and Fv in Taiwan's building code.

Determinants of Base-Pair Substitution Patterns Revealed by Whole-Genome Sequencing of DNA Mismatch Repair Defective Escherichia coli.

PubMed

Foster, Patricia L; Niccum, Brittany A; Popodi, Ellen; Townes, Jesse P; Lee, Heewook; MohammedIsmail, Wazim; Tang, Haixu

2018-06-15

Mismatch repair (MMR) is a major contributor to replication fidelity, but its impact varies with sequence context and the nature of the mismatch. Mutation accumulation experiments followed by whole-genome sequencing of MMR-defective E. coli strains yielded ≈30,000 base-pair substitutions, revealing mutational patterns across the entire chromosome. The base-pair substitution spectrum was dominated by A:T > G:C transitions, which occurred predominantly at the center base of 5'N A C3'+5'G T N3' triplets. Surprisingly, growth on minimal medium or at low temperature attenuated these mutations. Mononucleotide runs were also hotspots for base-pair substitutions, and the rate at which these occurred increased with run length. Comparison with ≈2000 base-pair substitutions accumulated in MMR-proficient strains revealed that both kinds of hotspots appeared in the wild-type spectrum and so are likely to be sites of frequent replication errors. In MMR-defective strains transitions were strand biased, occurring twice as often when A and C rather than T and G were on the lagging-strand template. Loss of nucleotide diphosphate kinase increases the cellular concentration of dCTP, which resulted in increased rates of mutations due to misinsertion of C opposite A and T. In an mmr ndk double mutant strain, these mutations were more frequent when the template A and T were on the leading strand, suggesting that lagging-strand synthesis was more error-prone or less well corrected by proofreading than was leading strand synthesis. Copyright © 2018, Genetics.

Cytogenetic analysis in three Bryconamericus species (Characiformes, Characidae): first description of the 5S rDNA-bearing chromosome pairs in the genus

PubMed Central

2013-01-01

Background Nowadays, the genus Bryconamericus is placed in subfamily Stevardiinae within of Characidae, but not shows consistent evidence of monophyletism. The purpose of this work was to study the chromosomes of three species of Bryconamericus, aiming to add cytogenetic knowledge and contribute to the understanding of the chromosomal evolution of this genus. Results The chromosomes of three species of Bryconamericus were analyzed using cytogenetic techniques. The karyotype of Bryconamericus stramineus contained 6 metacentric (m) + 10 submetacentric (sm) + 16 subtelocentric (st) + 20 acrocentric (a), the fundamental number (FN) of 84, one silver impregnated (Ag-NOR) pair, one pair bearing the 18S ribosomal DNA sites, another pair bearing the 5S rDNA sites, and a few positive C-bands. Bryconamericus turiuba had a karyotype containing 8 m + 10sm + 14st + 20a (FN = 84), one chromosome pair Ag-NOR, two pairs bearing the 18S rDNA sites, two pairs bearing the 5S rDNA sites, and a few C-band regions. Bryconamericus cf. iheringii had a karyotype containing 10 m + 14sm + 18st + 10a (FN = 94), including one pair with a secondary constriction Ag-NOR positive. In this karyotype the fluorescent in situ hybridization (FISH) showed the 18S and 5S rDNA probe in adjacent position. Conclusions The results obtained in this work showed different characteristics in the organization of two multigene families, indicating that distinct evolutionary forces acting on the diversity of rDNA sequences in the genome of three Bryconamericus species. PMID:23547656

Unusual hydrogen bonding patterns in AF (aminofluorene) and AAF (acetylaminofluorene) modified DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Broyde, S.; Hingerty, B.E.; Shapiro, R.

1989-01-01

New structures are presented for AF and AAF modified DNAs that place the carcinogen in the minor groove of a B-DNA helix. These structures employ non-Watson-Crick base pairing schemes with syn guanine at the modification site. 32 refs., 9 figs.

A rhodium(III) complex for high-affinity DNA base-pair mismatch recognition

PubMed Central

Junicke, Henrik; Hart, Jonathan R.; Kisko, Jennifer; Glebov, Oleg; Kirsch, Ilan R.; Barton, Jacqueline K.

2003-01-01

A rhodium(III) complex, rac-[Rh(bpy)2phzi]3+ (bpy, 2,2′-bipyridine; phzi, benzo[a]phenazine-5,6-quinone diimine) has been designed as a sterically demanding intercalator targeted to destabilized mismatched sites in double-helical DNA. The complex is readily synthesized by condensation of the phenazine quinone with the corresponding diammine complex. Upon photoactivation, the complex promotes direct strand scission at single-base mismatch sites within the DNA duplex. As with the parent mismatch-specific reagent, [Rh(bpy)2(chrysi)]3+ [chrysene-5,6-quinone diimine (chrysi)], mismatch selectivity depends on the helix destabilization associated with mispairing. Unlike the parent chrysi complex, the phzi analogue binds and cleaves with high affinity and efficiency. The specific binding constants for CA, CC, and CT mismatches within a 31-mer oligonucleotide duplex are 0.3, 1, and 6 × 107 M−1, respectively; site-specific photocleavage is evident at nanomolar concentrations. Moreover, the specificity, defined as the ratio in binding affinities for mispaired vs. well paired sites, is maintained. The increase in affinity is attributed to greater stability in the mismatched site associated with stacking by the heterocyclic aromatic ligand. The high-affinity complex is also applied in the differential cleavage of DNA obtained from cell lines deficient in mismatch repair vs. those proficient in mismatch repair. Agreement is found between photocleavage by the mismatch-specific probes and deficiency in mismatch repair. This mismatch-specific targeting, therefore, offers a potential strategy for new chemotherapeutic design. PMID:12610209

In Situ Biotreatment of TBA with Recirculation/Oxygenation

PubMed Central

North, Katharine P.; Mackay, Douglas M.; Kayne, Julian S.; Petersen, Daniel; Rasa, Ehsan; Rastegarzadeh, Laleh; Holland, Reef B.; Scow, Kate M.

2012-01-01

The potential for in situ biodegradation of tert-butyl alcohol (TBA) by creation of aerobic conditions in the subsurface with recirculating well pairs was investigated in two field studies conducted at Vandenberg Air Force Base (VAFB). In the first experiment, a single recirculating well pair with bromide tracer and oxygen amendment successfully delivered oxygen to the subsurface for 42 days. TBA concentrations were reduced from approximately 500 μg/L to below the detection limit within the treatment zone and the treated water was detected in a monitoring transect several meters downgradient. In the second experiment, a site-calibrated model was used to design a double recirculating well pair with oxygen amendment, which successfully delivered oxygen to the subsurface for 291 days and also decreased TBA concentrations to below the detection limit. Methylibium petroleiphilum strain PM1, a known TBA-degrading bacterium, was detectable at the study site but addition of oxygen had little impact on the already low baseline population densities, suggesting that there was not enough carbon within the groundwater plume to support significant new growth in the PM1 population. Given favorable hydrogeologic and geochemical conditions, the use of recirculating well pairs to introduce dissolved oxygen into the subsurface is a viable method to stimulate in situ biodegradation of TBA or other aerobically-degradable aquifer contaminants. PMID:23358537

Sordaria, a model system to uncover links between meiotic pairing and recombination.

PubMed

Zickler, Denise; Espagne, Eric

2016-06-01

The mycelial fungus Sordaria macrospora was first used as experimental system for meiotic recombination. This review shows that it provides also a powerful cytological system for dissecting chromosome dynamics in wild-type and mutant meioses. Fundamental cytogenetic findings include: (1) the identification of presynaptic alignment as a key step in pairing of homologous chromosomes. (2) The discovery that biochemical complexes that mediate recombination at the DNA level concomitantly mediate pairing of homologs. (3) This pairing process involves not only resolution but also avoidance of chromosomal entanglements and the resolution system includes dissolution of constraining DNA recombination interactions, achieved by a unique role of Mlh1. (4) Discovery that the central components of the synaptonemal complex directly mediate the re-localization of the recombination proteins from on-axis to in-between homologue axis positions. (5) Identification of putative STUbL protein Hei10 as a structure-based signal transduction molecule that coordinates progression and differentiation of recombinational interactions at multiple stages. (6) Discovery that a single interference process mediates both nucleation of the SC and designation of crossover sites, thereby ensuring even spacing of both features. (7) Discovery of local modulation of sister-chromatid cohesion at sites of crossover recombination. Copyright © 2016 Elsevier Ltd. All rights reserved.

In Situ Biotreatment of TBA with Recirculation/Oxygenation.

PubMed

North, Katharine P; Mackay, Douglas M; Kayne, Julian S; Petersen, Daniel; Rasa, Ehsan; Rastegarzadeh, Laleh; Holland, Reef B; Scow, Kate M

2012-01-01

The potential for in situ biodegradation of tert-butyl alcohol (TBA) by creation of aerobic conditions in the subsurface with recirculating well pairs was investigated in two field studies conducted at Vandenberg Air Force Base (VAFB). In the first experiment, a single recirculating well pair with bromide tracer and oxygen amendment successfully delivered oxygen to the subsurface for 42 days. TBA concentrations were reduced from approximately 500 μg/L to below the detection limit within the treatment zone and the treated water was detected in a monitoring transect several meters downgradient. In the second experiment, a site-calibrated model was used to design a double recirculating well pair with oxygen amendment, which successfully delivered oxygen to the subsurface for 291 days and also decreased TBA concentrations to below the detection limit. Methylibium petroleiphilum strain PM1, a known TBA-degrading bacterium, was detectable at the study site but addition of oxygen had little impact on the already low baseline population densities, suggesting that there was not enough carbon within the groundwater plume to support significant new growth in the PM1 population. Given favorable hydrogeologic and geochemical conditions, the use of recirculating well pairs to introduce dissolved oxygen into the subsurface is a viable method to stimulate in situ biodegradation of TBA or other aerobically-degradable aquifer contaminants.

Cross-calibration of the Terra MODIS, Landsat 7 ETM+ and EO-1 ALI sensors using near-simultaneous surface observation over the Railroad Valley Playa, Nevada, test site

USGS Publications Warehouse

Chander, G.; Angal, A.; Choi, T.; Meyer, D.J.; Xiong, X.; Teillet, P.M.

2007-01-01

A cross-calibration methodology has been developed using coincident image pairs from the Terra Moderate Resolution Imaging Spectroradiometer (MODIS), the Landsat 7 (L7) Enhanced Thematic Mapper Plus (ETM+) and the Earth Observing EO-1 Advanced Land Imager (ALI) to verify the absolute radiometric calibration accuracy of these sensors with respect to each other. To quantify the effects due to different spectral responses, the Relative Spectral Responses (RSR) of these sensors were studied and compared by developing a set of "figures-of-merit." Seven cloud-free scenes collected over the Railroad Valley Playa, Nevada (RVPN), test site were used to conduct the cross-calibration study. This cross-calibration approach was based on image statistics from near-simultaneous observations made by different satellite sensors. Homogeneous regions of interest (ROI) were selected in the image pairs, and the mean target statistics were converted to absolute units of at-sensor reflectance. Using these reflectances, a set of cross-calibration equations were developed giving a relative gain and bias between the sensor pair.

Nucleotide sequence and transcriptional start site of the Methylobacterium organophilum XX methanol dehydrogenase structural gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Machlin, S.M.; Hanson, R.S.

The nucleotide sequence of a cloned 2.5-kilobase-pair SmaI fragment containing the methanol dehydrogenase (MDH) structural gene from Methylobacterium organophilum XX was determined. A single open reading frame with a coding capacity of 626 amino acids (molecular weight, 66,000) was identified on one stand, and N-terminal sequencing of purified MDH revealed that 27 of these residues constituted a putative signal peptide. Primer extension mapping of in vivo transcripts indicated that the start of mRNA synthesis was 160 to 170 base pairs upstream of the ATG codon. Northern (RNA) blot analysis further demonstrated that the transcript was 2.1 kilobase pairs in lengthmore » and therefore appeared to encode only MDH.« less

Observation of sediment resuspension in Old Tampa Bay, Florida

USGS Publications Warehouse

Schoellhamer, David H.; ,

1990-01-01

Equipment and methodology have been developed to monitor sediment resuspension at two sites in Old Tampa Bay. Velocities are measured with electromagnetic current meters and suspended solids and turbidity are monitored with optical backscatterance sensors. In late November 1989, a vertical array of instrument pairs was deployed from a permanent platform at a deep-water site, and a submersible instrument package with a single pair of instruments was deployed at a shallow-water site. Wind waves caused resuspension at the shallow-water site, but not at the deeper platform site, and spring tidal currents did not cause resuspension at either site.

Structural basis of DNA folding and recognition in an AMP-DNA aptamer complex: distinct architectures but common recognition motifs for DNA and RNA aptamers complexed to AMP.

PubMed

Lin, C H; Patel, D J

1997-11-01

Structural studies by nuclear magnetic resonance (NMR) of RNA and DNA aptamer complexes identified through in vitro selection and amplification have provided a wealth of information on RNA and DNA tertiary structure and molecular recognition in solution. The RNA and DNA aptamers that target ATP (and AMP) with micromolar affinity exhibit distinct binding site sequences and secondary structures. We report below on the tertiary structure of the AMP-DNA aptamer complex in solution and compare it with the previously reported tertiary structure of the AMP-RNA aptamer complex in solution. The solution structure of the AMP-DNA aptamer complex shows, surprisingly, that two AMP molecules are intercalated at adjacent sites within a rectangular widened minor groove. Complex formation involves adaptive binding where the asymmetric internal bubble of the free DNA aptamer zippers up through formation of a continuous six-base mismatch segment which includes a pair of adjacent three-base platforms. The AMP molecules pair through their Watson-Crick edges with the minor groove edges of guanine residues. These recognition G.A mismatches are flanked by sheared G.A and reversed Hoogsteen G.G mismatch pairs. The AMP-DNA aptamer and AMP-RNA aptamer complexes have distinct tertiary structures and binding stoichiometries. Nevertheless, both complexes have similar structural features and recognition alignments in their binding pockets. Specifically, AMP targets both DNA and RNA aptamers by intercalating between purine bases and through identical G.A mismatch formation. The recognition G.A mismatch stacks with a reversed Hoogsteen G.G mismatch in one direction and with an adenine base in the other direction in both complexes. It is striking that DNA and RNA aptamers selected independently from libraries of 10(14) molecules in each case utilize identical mismatch alignments for molecular recognition with micromolar affinity within binding-site pockets containing common structural elements.

Sympatric occurrence of four cytotypes and one extra chromosome in Bryconamericus ecai (Characidae): 18S rDNA polymorphism and heterochromatin composition.

PubMed

dos Santos, Angélica Rossotti; Rubert, Marceléia; Giuliano-Caetano, Lucia; Dias, Ana Lúcia

2012-02-01

In the present study, specimens of Bryconamericus ecai collected from the Forquetinha River/RS, were cytogenetically analyzed, disclosing a wide karyotypic diversity in this species. All individuals had 2n = 50, with different karyotypic formulae, resulting in four cytotypes and one B macrochromosome observed in cytotype III. Heterochromatin was distributed in the pericentromeric region of most chromosomes on the four cytotypes and also on a chromosome pair with interstitial markings in cytotype IV. Staining with CMA(3) and DAPI fluorochromes revealed a C-band region rich in AT base pairs in cytotypes I, II and III, and a pair with GC-rich heterochromatin in cytotypes II and III. Cytotype IV presented CMA(3) and DAPI positive heterochromatin. Silver nitrate impregnation, in situ hybridization, and fluorochrome staining showed a multiple system of AgNORs, 18S rDNA and CMA(3) sites in cytotypes I, III and IV, with both inter-and intraindividual variability in the number and location of these sites. Cytotype II had only one pair of NORs coincident with the 18S rDNA and CMA(3) sites, indicating a simple system. The chromosomal polymorphism observed among the specimens of B. ecai added to the literature data show that chromosomal rearrangements, especially pericentric inversions, play an important role in the karyotypic evolution of this group of fish. It can also be implied that more than one species of Bryconamericus is probably occurring, living in sympatry in the Forquetinha River/RS. © 2012 The Authors.

Ub-ISAP: a streamlined UNIX pipeline for mining unique viral vector integration sites from next generation sequencing data.

PubMed

Kamboj, Atul; Hallwirth, Claus V; Alexander, Ian E; McCowage, Geoffrey B; Kramer, Belinda

2017-06-17

The analysis of viral vector genomic integration sites is an important component in assessing the safety and efficiency of patient treatment using gene therapy. Alongside this clinical application, integration site identification is a key step in the genetic mapping of viral elements in mutagenesis screens that aim to elucidate gene function. We have developed a UNIX-based vector integration site analysis pipeline (Ub-ISAP) that utilises a UNIX-based workflow for automated integration site identification and annotation of both single and paired-end sequencing reads. Reads that contain viral sequences of interest are selected and aligned to the host genome, and unique integration sites are then classified as transcription start site-proximal, intragenic or intergenic. Ub-ISAP provides a reliable and efficient pipeline to generate large datasets for assessing the safety and efficiency of integrating vectors in clinical settings, with broader applications in cancer research. Ub-ISAP is available as an open source software package at https://sourceforge.net/projects/ub-isap/ .

HIM-8 binds to the X chromosome pairing center and mediates chromosome-specific meiotic synapsis.

PubMed

Phillips, Carolyn M; Wong, Chihunt; Bhalla, Needhi; Carlton, Peter M; Weiser, Pinky; Meneely, Philip M; Dernburg, Abby F

2005-12-16

The him-8 gene is essential for proper meiotic segregation of the X chromosomes in C. elegans. Here we show that loss of him-8 function causes profound X chromosome-specific defects in homolog pairing and synapsis. him-8 encodes a C2H2 zinc-finger protein that is expressed during meiosis and concentrates at a site on the X chromosome known as the meiotic pairing center (PC). A role for HIM-8 in PC function is supported by genetic interactions between PC lesions and him-8 mutations. HIM-8 bound chromosome sites associate with the nuclear envelope (NE) throughout meiotic prophase. Surprisingly, a point mutation in him-8 that retains both chromosome binding and NE localization fails to stabilize pairing or promote synapsis. These observations indicate that stabilization of homolog pairing is an active process in which the tethering of chromosome sites to the NE may be necessary but is not sufficient.

Kinetic selection vs. free energy of DNA base pairing in control of polymerase fidelity.

PubMed

Oertell, Keriann; Harcourt, Emily M; Mohsen, Michael G; Petruska, John; Kool, Eric T; Goodman, Myron F

2016-04-19

What is the free energy source enabling high-fidelity DNA polymerases (pols) to favor incorporation of correct over incorrect base pairs by 10(3)- to 10(4)-fold, corresponding to free energy differences of ΔΔGinc∼ 5.5-7 kcal/mol? Standard ΔΔG° values (∼0.3 kcal/mol) calculated from melting temperature measurements comparing matched vs. mismatched base pairs at duplex DNA termini are far too low to explain pol accuracy. Earlier analyses suggested that pol active-site steric constraints can amplify DNA free energy differences at the transition state (kinetic selection). A recent paper [Olson et al. (2013)J Am Chem Soc135:1205-1208] used Vent pol to catalyze incorporations in the presence of inorganic pyrophosphate intended to equilibrate forward (polymerization) and backward (pyrophosphorolysis) reactions. A steady-state leveling off of incorporation profiles at long reaction times was interpreted as reaching equilibrium between polymerization and pyrophosphorolysis, yielding apparent ΔG° = -RTlnKeq, indicating ΔΔG° of 3.5-7 kcal/mol, sufficient to account for pol accuracy without need of kinetic selection. Here we perform experiments to measure and account for pyrophosphorolysis explicitly. We show that forward and reverse reactions attain steady states far from equilibrium for wrong incorporations such as G opposite T. Therefore,[Formula: see text]values obtained from such steady-state evaluations ofKeqare not dependent on DNA properties alone, but depend largely on constraints imposed on right and wrong substrates in the polymerase active site.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Szulik, Marta W.; Pallan, Pradeep S.; Nocek, Boguslaw

5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T 8X 9G 10-3' sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC didmore » not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A 5:T 8, whereas 5caC did not. At the oxidized base pair G 4:X 9, 5fC exhibited an increase in the imino proton exchange rate and the calculated k op. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C 3:G 10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G 4:X 9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N 4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. Furthermore, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.« less

Characterization of a tandemly repeated DNA sequence family originally derived by retroposition of tRNA(Glu) in the newt.

PubMed

Nagahashi, S; Endoh, H; Suzuki, Y; Okada, N

1991-11-20

A previous report from this laboratory showed that in vitro transcription of total genomic DNA of the newt Cynopus pyrrhogaster resulted in a discrete sized 8 S RNA, which represented highly repetitive and transcribable sequences with a glutamic acid tRNA-like structure in the newt genome. We isolated four independent clones from a newt genomic library and determined the complete sequences of three 2000 to 2400 base-pair PstI fragments spanning the 8 S RNA gene. The glutamic acid tRNA-related segment in the 8 S RNA gene contains the CCA sequence expected as the 3' terminus of a tRNA molecule. Further, the 11 nucleotides located 13 nucleotides upstream from one of the two transcription initiation sites of the 8 S RNA were found to be repeated in the region upstream from the termination site, suggesting that the original unit, which is shorter than the 8 S RNA, was retrotransposed via cDNA intermediates from the PolIII transcript. In the upstream region of the 8 S RNA gene, a 360 nucleotide unit containing the glutamic acid tRNA-related segment was found to be duplicated (clones NE1 and NE10) or triplicated (clone NE3). Except for the difference in the number of the 360 nucleotide unit, the three sequences of the 2000 to 2400 base-pair PstI fragment were essentially the same with only a few mutations and minor deletions. Inverse polymerase chain reaction and sequence determination of the products, together with a Southern hybridization experiment, demonstrated that the family consists of a tandemly repeated unit of 3300, 3700 or 4100 base-pairs. Thus during evolution, this family in the newt was created by retroposition via cDNA intermediates, followed by duplication or triplication of the 360 nucleotide unit and multiplication of the 3300 to 4100 base-pair region at the DNA level.

Neurons in cat V1 show significant clustering by degree of tuning

PubMed Central

Ziskind, Avi J.; Emondi, Al A.; Kurgansky, Andrei V.; Rebrik, Sergei P.

2015-01-01

Neighboring neurons in cat primary visual cortex (V1) have similar preferred orientation, direction, and spatial frequency. How diverse is their degree of tuning for these properties? To address this, we used single-tetrode recordings to simultaneously isolate multiple cells at single recording sites and record their responses to flashed and drifting gratings of multiple orientations, spatial frequencies, and, for drifting gratings, directions. Orientation tuning width, spatial frequency tuning width, and direction selectivity index (DSI) all showed significant clustering: pairs of neurons recorded at a single site were significantly more similar in each of these properties than pairs of neurons from different recording sites. The strength of the clustering was generally modest. The percent decrease in the median difference between pairs from the same site, relative to pairs from different sites, was as follows: for different measures of orientation tuning width, 29–35% (drifting gratings) or 15–25% (flashed gratings); for DSI, 24%; and for spatial frequency tuning width measured in octaves, 8% (drifting gratings). The clusterings of all of these measures were much weaker than for preferred orientation (68% decrease) but comparable to that seen for preferred spatial frequency in response to drifting gratings (26%). For the above properties, little difference in clustering was seen between simple and complex cells. In studies of spatial frequency tuning to flashed gratings, strong clustering was seen among simple-cell pairs for tuning width (70% decrease) and preferred frequency (71% decrease), whereas no clustering was seen for simple-complex or complex-complex cell pairs. PMID:25652921

Models and methods to characterize site amplification from a pair of records

USGS Publications Warehouse

Safak, E.

1997-01-01

The paper presents a tutorial review of the models and methods that are used to characterize site amplification from the pairs of rock- and soil-site records, and introduces some new techniques with better theoretical foundations. The models and methods discussed include spectral and cross-spectral ratios, spectral ratios for downhole records, response spectral ratios, constant amplification factors, parametric models, physical models, and time-varying filters. An extensive analytical and numerical error analysis of spectral and cross-spectral ratios shows that probabilistically cross-spectral ratios give more reliable estimates of site amplification. Spectral ratios should not be used to determine site amplification from downhole-surface recording pairs because of the feedback in the downhole sensor. Response spectral ratios are appropriate for low frequencies, but overestimate the amplification at high frequencies. The best method to be used depends on how much precision is required in the estimates.

Hole pairing and ground state properties of high-Tc superconductivity within the t-t'-J-V model

NASA Astrophysics Data System (ADS)

Roy, Krishanu; Pal, Papiya; Nath, Subhadip; Ghosh, Nanda Kumar

2018-04-01

The t-t'-J-V model, one of the realistic models for studying high-Tc cuprates, has been investigated to explore the hole pairing and other ground state properties using exact diagonalization (ED) technique with 2 holes in a small 8-site cluster. The role of next-nearest-neighbor (NNN) hopping and nearest-neighbor (NN) Coulomb repulsion has been considered. It appears that qualitative behavior of the ground state energies of an 8-site and 16- or 18-site cluster is similar. Results show that a small short-ranged antiferromagnetic (AF) correlation exists in the 2 hole case which is favored by large V/t. A superconducting phase emerges at 0 ≤ V/t ≤ 4J. Hole-hole correlation calculation also suggests that the two holes of the pair are either at |i - j| = 1 or √2. Negative t'/t suppresses the possibility of pairing of holes. Though s-wave pairing susceptibility is dominant, pairing correlation length calculation indicates that the long range pairing, which is suitable for superconductivity, is in the d-wave channel. Both s- and d-wave pairing susceptibility gets suppressed by V/t while d-(s-) wave susceptibility gets favored (suppressed) by t'/t. The charge gap shows a gapped behavior while a spin-gapless region exists at small V/t for finite t'/t.

Comparative chromosomal localization of 45S and 5S rDNAs and implications for genome evolution in Cucumis.

PubMed

Zhang, Zhen-Tao; Yang, Shu-Qiong; Li, Zi-Ang; Zhang, Yun-Xia; Wang, Yun-Zhu; Cheng, Chun-Yan; Li, Ji; Chen, Jin-Feng; Lou, Qun-Feng

2016-07-01

Ribosomal DNAs are useful cytogenetic markers for chromosome analysis. Studies investigating site numbers and distributions of rDNAs have provided important information for elucidating genome organization and chromosomal relationships of many species by fluorescence in situ hybridization. But relevant studies are scarce for species of the genus Cucumis, especially in wild species. In the present study, FISH was conducted to investigate the organization of 45S and 5S rDNA among 20 Cucumis accessions, including cultivars and wild accessions. Our results showed that the number of 45S rDNA sites varied from one to five pairs in different accessions, and most of these sites are located at the terminal regions of chromosomes. Interestingly, up to five pairs of 45S rDNA sites were observed in C. sativus var. sativus, the species which has the lowest chromosome number, i.e., 2n = 14. Only one pair of 5S rDNA sites was detected in all accessions, except for C. heptadactylus, C. sp, and C. spp that had two pairs of 5S rDNA sites. The distributions of 5S rDNA sites showed more variation than 45S rDNA sites. The phylogenetic analysis in this study showed that 45S and 5S rDNA have contrasting evolutionary patterns. We find that 5S rDNA has a polyploidization-related tendency towards the terminal location from an interstitial location but maintains a conserved site number, whereas the 45S rDNA showed a trend of increasing site number but a relatively conserved location.

Structure/cleavage-based insights into helical perturbations at bulge sites within T. thermophilus Argonaute silencing complexes

PubMed Central

Sheng, Gang; Gogakos, Tasos; Wang, Jiuyu; Zhao, Hongtu; Serganov, Artem; Juranek, Stefan

2017-01-01

Abstract We have undertaken a systematic structural study of Thermus thermophilus Argonaute (TtAgo) ternary complexes containing single-base bulges positioned either within the seed segment of the guide or target strands and at the cleavage site. Our studies establish that single-base bulges 7T8, 5A6 and 4A5 on the guide strand are stacked-into the duplex, with conformational changes localized to the bulge site, thereby having minimal impact on the cleavage site. By contrast, single-base bulges 6’U7’ and 6’A7’ on the target strand are looped-out of the duplex, with the resulting conformational transitions shifting the cleavable phosphate by one step. We observe a stable alignment for the looped-out 6’N7’ bulge base, which stacks on the unpaired first base of the guide strand, with the looped-out alignment facilitated by weakened Watson–Crick and reversed non-canonical flanking pairs. These structural studies are complemented by cleavage assays that independently monitor the impact of bulges on TtAgo-mediated cleavage reaction. PMID:28911094

Adjacent DNA sequences modulate Sox9 transcriptional activation at paired Sox sites in three chondrocyte-specific enhancer elements

PubMed Central

Bridgewater, Laura C.; Walker, Marlan D.; Miller, Gwen C.; Ellison, Trevor A.; Holsinger, L. Daniel; Potter, Jennifer L.; Jackson, Todd L.; Chen, Reuben K.; Winkel, Vicki L.; Zhang, Zhaoping; McKinney, Sandra; de Crombrugghe, Benoit

2003-01-01

Expression of the type XI collagen gene Col11a2 is directed to cartilage by at least three chondrocyte-specific enhancer elements, two in the 5′ region and one in the first intron of the gene. The three enhancers each contain two heptameric sites with homology to the Sox protein-binding consensus sequence. The two sites are separated by 3 or 4 bp and arranged in opposite orientation to each other. Targeted mutational analyses of these three enhancers showed that in the intronic enhancer, as in the other two enhancers, both Sox sites in a pair are essential for enhancer activity. The transcription factor Sox9 binds as a dimer at the paired sites, and the introduction of insertion mutations between the sites demonstrated that physical interactions between the adjacently bound proteins are essential for enhancer activity. Additional mutational analyses demonstrated that although Sox9 binding at the paired Sox sites is necessary for enhancer activity, it alone is not sufficient. Adjacent DNA sequences in each enhancer are also required, and mutation of those sequences can eliminate enhancer activity without preventing Sox9 binding. The data suggest a new model in which adjacently bound proteins affect the DNA bend angle produced by Sox9, which in turn determines whether an active transcriptional enhancer complex is assembled. PMID:12595563

Increasing the structural coverage of tuberculosis drug targets.

PubMed

Baugh, Loren; Phan, Isabelle; Begley, Darren W; Clifton, Matthew C; Armour, Brianna; Dranow, David M; Taylor, Brandy M; Muruthi, Marvin M; Abendroth, Jan; Fairman, James W; Fox, David; Dieterich, Shellie H; Staker, Bart L; Gardberg, Anna S; Choi, Ryan; Hewitt, Stephen N; Napuli, Alberto J; Myers, Janette; Barrett, Lynn K; Zhang, Yang; Ferrell, Micah; Mundt, Elizabeth; Thompkins, Katie; Tran, Ngoc; Lyons-Abbott, Sally; Abramov, Ariel; Sekar, Aarthi; Serbzhinskiy, Dmitri; Lorimer, Don; Buchko, Garry W; Stacy, Robin; Stewart, Lance J; Edwards, Thomas E; Van Voorhis, Wesley C; Myler, Peter J

2015-03-01

High-resolution three-dimensional structures of essential Mycobacterium tuberculosis (Mtb) proteins provide templates for TB drug design, but are available for only a small fraction of the Mtb proteome. Here we evaluate an intra-genus "homolog-rescue" strategy to increase the structural information available for TB drug discovery by using mycobacterial homologs with conserved active sites. Of 179 potential TB drug targets selected for x-ray structure determination, only 16 yielded a crystal structure. By adding 1675 homologs from nine other mycobacterial species to the pipeline, structures representing an additional 52 otherwise intractable targets were solved. To determine whether these homolog structures would be useful surrogates in TB drug design, we compared the active sites of 106 pairs of Mtb and non-TB mycobacterial (NTM) enzyme homologs with experimentally determined structures, using three metrics of active site similarity, including superposition of continuous pharmacophoric property distributions. Pair-wise structural comparisons revealed that 19/22 pairs with >55% overall sequence identity had active site Cα RMSD <1 Å, >85% side chain identity, and ≥80% PSAPF (similarity based on pharmacophoric properties) indicating highly conserved active site shape and chemistry. Applying these results to the 52 NTM structures described above, 41 shared >55% sequence identity with the Mtb target, thus increasing the effective structural coverage of the 179 Mtb targets over three-fold (from 9% to 32%). The utility of these structures in TB drug design can be tested by designing inhibitors using the homolog structure and assaying the cognate Mtb enzyme; a promising test case, Mtb cytidylate kinase, is described. The homolog-rescue strategy evaluated here for TB is also generalizable to drug targets for other diseases. Copyright © 2014 Elsevier Ltd. All rights reserved.

Increasing the structural coverage of tuberculosis drug targets

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baugh, Loren; Phan, Isabelle; Begley, Darren W.

High-resolution three-dimensional structures of essential Mycobacterium tuberculosis (Mtb) proteins provide templates for TB drug design, but are available for only a small fraction of the Mtb proteome. Here we evaluate an intra-genus “homolog-rescue” strategy to increase the structural information available for TB drug discovery by using mycobacterial homologs with conserved active sites. We found that of 179 potential TB drug targets selected for x-ray structure determination, only 16 yielded a crystal structure. By adding 1675 homologs from nine other mycobacterial species to the pipeline, structures representing an additional 52 otherwise intractable targets were solved. To determine whether these homolog structuresmore » would be useful surrogates in TB drug design, we compared the active sites of 106 pairs of Mtb and non-TB mycobacterial (NTM) enzyme homologs with experimentally determined structures, using three metrics of active site similarity, including superposition of continuous pharmacophoric property distributions. Pair-wise structural comparisons revealed that 19/22 pairs with >55% overall sequence identity had active site Cα RMSD <1 Å, >85% side chain identity, and ≥80% PS APF (similarity based on pharmacophoric properties) indicating highly conserved active site shape and chemistry. Applying these results to the 52 NTM structures described above, 41 shared >55% sequence identity with the Mtb target, thus increasing the effective structural coverage of the 179 Mtb targets over three-fold (from 9% to 32%). The utility of these structures in TB drug design can be tested by designing inhibitors using the homolog structure and assaying the cognate Mtb enzyme; a promising test case, Mtb cytidylate kinase, is described. The homolog-rescue strategy evaluated here for TB is also generalizable to drug targets for other diseases.« less

Increasing the structural coverage of tuberculosis drug targets

DOE PAGES

Baugh, Loren; Phan, Isabelle; Begley, Darren W.; ...

2014-12-19

High-resolution three-dimensional structures of essential Mycobacterium tuberculosis (Mtb) proteins provide templates for TB drug design, but are available for only a small fraction of the Mtb proteome. Here we evaluate an intra-genus “homolog-rescue” strategy to increase the structural information available for TB drug discovery by using mycobacterial homologs with conserved active sites. We found that of 179 potential TB drug targets selected for x-ray structure determination, only 16 yielded a crystal structure. By adding 1675 homologs from nine other mycobacterial species to the pipeline, structures representing an additional 52 otherwise intractable targets were solved. To determine whether these homolog structuresmore » would be useful surrogates in TB drug design, we compared the active sites of 106 pairs of Mtb and non-TB mycobacterial (NTM) enzyme homologs with experimentally determined structures, using three metrics of active site similarity, including superposition of continuous pharmacophoric property distributions. Pair-wise structural comparisons revealed that 19/22 pairs with >55% overall sequence identity had active site Cα RMSD <1 Å, >85% side chain identity, and ≥80% PS APF (similarity based on pharmacophoric properties) indicating highly conserved active site shape and chemistry. Applying these results to the 52 NTM structures described above, 41 shared >55% sequence identity with the Mtb target, thus increasing the effective structural coverage of the 179 Mtb targets over three-fold (from 9% to 32%). The utility of these structures in TB drug design can be tested by designing inhibitors using the homolog structure and assaying the cognate Mtb enzyme; a promising test case, Mtb cytidylate kinase, is described. The homolog-rescue strategy evaluated here for TB is also generalizable to drug targets for other diseases.« less

Increasing the Structural Coverage of Tuberculosis Drug Targets

PubMed Central

Baugh, Loren; Phan, Isabelle; Begley, Darren W.; Clifton, Matthew C.; Armour, Brianna; Dranow, David M.; Taylor, Brandy M.; Muruthi, Marvin M.; Abendroth, Jan; Fairman, James W.; Fox, David; Dieterich, Shellie H.; Staker, Bart L.; Gardberg, Anna S.; Choi, Ryan; Hewitt, Stephen N.; Napuli, Alberto J.; Myers, Janette; Barrett, Lynn K.; Zhang, Yang; Ferrell, Micah; Mundt, Elizabeth; Thompkins, Katie; Tran, Ngoc; Lyons-Abbott, Sally; Abramov, Ariel; Sekar, Aarthi; Serbzhinskiy, Dmitri; Lorimer, Don; Buchko, Garry W.; Stacy, Robin; Stewart, Lance J.; Edwards, Thomas E.; Van Voorhis, Wesley C.; Myler, Peter J.

2015-01-01

High-resolution three-dimensional structures of essential Mycobacterium tuberculosis (Mtb) proteins provide templates for TB drug design, but are available for only a small fraction of the Mtb proteome. Here we evaluate an intra-genus “homolog-rescue” strategy to increase the structural information available for TB drug discovery by using mycobacterial homologs with conserved active sites. Of 179 potential TB drug targets selected for x-ray structure determination, only 16 yielded a crystal structure. By adding 1675 homologs from nine other mycobacterial species to the pipeline, structures representing an additional 52 otherwise intractable targets were solved. To determine whether these homolog structures would be useful surrogates in TB drug design, we compared the active sites of 106 pairs of Mtb and non-TB mycobacterial (NTM) enzyme homologs with experimentally determined structures, using three metrics of active site similarity, including superposition of continuous pharmacophoric property distributions. Pair-wise structural comparisons revealed that 19/22 pairs with >55% overall sequence identity had active site Cα RMSD <1Å, >85% side chain identity, and ≥80% PSAPF (similarity based on pharmacophoric properties) indicating highly conserved active site shape and chemistry. Applying these results to the 52 NTM structures described above, 41 shared >55% sequence identity with the Mtb target, thus increasing the effective structural coverage of the 179 Mtb targets over three-fold (from 9% to 32%). The utility of these structures in TB drug design can be tested by designing inhibitors using the homolog structure and assaying the cognate Mtb enzyme; a promising test case, Mtb cytidylate kinase, is described. The homolog-rescue strategy evaluated here for TB is also generalizable to drug targets for other diseases. PMID:25613812

MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

PubMed

Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

2016-01-01

Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic strands to increase the success rate. It is a standalone web-based pipeline, which is fully configured within a virtual machine and thus can be readily used without any configuration. We have experimentally validated primer pairs designed by our pipeline and shown a very high success rate of primer pairs: out of 66 BSP primer pairs, 63 were successfully validated without any further optimization step and using the same qPCR conditions. The MSP-HTPrimer pipeline is freely available from http://sourceforge.net/p/msp-htprimer.

Energetic basis for selective recognition of T*G mismatched base pairs in DNA by imidazole-rich polyamides.

PubMed

Lacy, Eilyn R; Nguyen, Binh; Le, Minh; Cox, Kari K; OHare, Caroline; Hartley, John A; Lee, Moses; Wilson, W David

2004-01-01

To complement available structure and binding results and to develop a detailed understanding of the basis for selective molecular recognition of T.G mismatches in DNA by imidazole containing polyamides, a full thermodynamic profile for formation of the T.G-polyamide complex has been determined. The amide-linked heterocycles f-ImImIm and f-PyImIm (where f is formamido group, Im is imidazole and Py is pyrrole) were studied by using biosensor-surface plasmon resonance (SPR) and isothermal titration calorimetry (ITC) with a T.G mismatch containing DNA hairpin duplex and a similar DNA with only Watson-Crick base pairs. Large negative binding enthalpies for all of the polyamide-DNA complexes indicate that the interactions are enthalpically driven. SPR results show slower complex formation and stronger binding of f-ImImIm to the T.G than to the match site. The thermodynamic analysis indicates that the enhanced binding to the T.G site is the result of better entropic contributions. Negative heat capacity changes for the complex are correlated with calculated solvent accessible surface area changes and indicate hydrophobic contributions to complex formation. DNase I footprinting analysis in a long DNA sequence provided supporting evidence that f-ImImIm binds selectively to T.G mismatch sites.

Energetic basis for selective recognition of T·G mismatched base pairs in DNA by imidazole-rich polyamides

PubMed Central

Lacy, Eilyn R.; Nguyen, Binh; Le, Minh; Cox, Kari K.; O'Hare, Caroline; Hartley, John A.; Lee, Moses; Wilson, W. David

2004-01-01

To complement available structure and binding results and to develop a detailed understanding of the basis for selective molecular recognition of T·G mismatches in DNA by imidazole containing polyamides, a full thermodynamic profile for formation of the T·G–polyamide complex has been determined. The amide-linked heterocycles f-ImImIm and f-PyImIm (where f is formamido group, Im is imidazole and Py is pyrrole) were studied by using biosensor-surface plasmon resonance (SPR) and isothermal titration calorimetry (ITC) with a T·G mismatch containing DNA hairpin duplex and a similar DNA with only Watson–Crick base pairs. Large negative binding enthalpies for all of the polyamide–DNA complexes indicate that the interactions are enthalpically driven. SPR results show slower complex formation and stronger binding of f-ImImIm to the T·G than to the match site. The thermodynamic analysis indicates that the enhanced binding to the T·G site is the result of better entropic contributions. Negative heat capacity changes for the complex are correlated with calculated solvent accessible surface area changes and indicate hydrophobic contributions to complex formation. DNase I footprinting analysis in a long DNA sequence provided supporting evidence that f-ImImIm binds selectively to T·G mismatch sites. PMID:15064359

Optical sensing system based on wireless paired emitter detector diode device and ionogels for lab-on-a-disc water quality analysis.

PubMed

Czugala, Monika; Gorkin, Robert; Phelan, Thomas; Gaughran, Jennifer; Curto, Vincenzo Fabio; Ducrée, Jens; Diamond, Dermot; Benito-Lopez, Fernando

2012-12-07

This work describes the first use of a wireless paired emitter detector diode device (PEDD) as an optical sensor for water quality monitoring in a lab-on-a-disc device. The microfluidic platform, based on an ionogel sensing area combined with a low-cost optical sensor, is applied for quantitative pH and qualitative turbidity monitoring of water samples at point-of-need. The autonomous capabilities of the PEDD system, combined with the portability and wireless communication of the full device, provide the flexibility needed for on-site water testing. Water samples from local fresh and brackish sources were successfully analysed using the device, showing very good correlation with standard bench-top systems.

The Structural Basis for Recognition of the PreQ0 Metabolite by an Unusually Small Riboswitch Aptamer Domain*S⃞♦

PubMed Central

Spitale, Robert C.; Torelli, Andrew T.; Krucinska, Jolanta; Bandarian, Vahe; Wedekind, Joseph E.

2009-01-01

Riboswitches are RNA elements that control gene expression through metabolite binding. The preQ1 riboswitch exhibits the smallest known ligand-binding domain and is of interest for its economical organization and high affinity interactions with guanine-derived metabolites required to confer tRNA wobbling. Here we present the crystal structure of a preQ1 aptamer domain in complex with its precursor metabolite preQ0. The structure is highly compact with a core that features a stem capped by a well organized decaloop. The metabolite is recognized within a deep pocket via Watson-Crick pairing with C15. Additional hydrogen bonds are made to invariant bases U6 and A29. The ligand-bound state confers continuous helical stacking throughout the core fold, thus providing a platform to promote Watson-Crick base pairing between C9 of the decaloop and the first base of the ribosome-binding site, G33. The structure offers insight into the mode of ribosome-binding site sequestration by a minimal RNA fold stabilized by metabolite binding and has implications for understanding the molecular basis by which bacterial genes are regulated. PMID:19261617

Evidence That Intergenic Spacer Repeats of Drosophila Melanogaster Rrna Genes Function as X-Y Pairing Sites in Male Meiosis, and a General Model for Achiasmatic Pairing

PubMed Central

McKee, B. D.; Habera, L.; Vrana, J. A.

1992-01-01

In Drosophila melanogaster males, X-Y meiotic chromosome pairing is mediated by the nucleolus organizers (NOs) which are located in the X heterochromatin (Xh) and near the Y centromere. Deficiencies for Xh disrupt X-Y meiotic pairing and cause high frequencies of X-Y nondisjunction. Insertion of cloned rRNA genes on an Xh(-) chromosome partially restores normal X-Y pairing and disjunction. To map the sequences within an inserted, X-linked rRNA gene responsible for stimulating X-Y pairing, partial deletions were generated by P element-mediated destabilization of the insert. Complete deletions of the rRNA transcription unit did not interfere with the ability to stimulate X-Y pairing as long as most of the intergenic spacer (IGS) remained. Within groups of deletions that lacked the entire transcription unit and differed only in length of residual IGS material, pairing ability was proportional to the dose of 240-bp intergenic spacer repeats. Deletions of the complete rRNA transcription unit or of the 28S sequences alone blocked nucleolus formation, as determined by binding of an antinucleolar antibody, yet did not interfere with pairing ability, suggesting that X-Y pairing may not be mechanistically related to nucleolus formation. A model for achiasmatic pairing in Drosophila males based upon the combined action of topoisomerase I and a strand transferase is proposed. PMID:1330825

NMR studies on the structure and dynamics of lac operator DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, S.C.

Nuclear Magnetic Resonance spectroscopy was used to elucidate the relationships between structure, dynamics and function of the gene regulatory sequence corresponding to the lactose operon operator of Escherichia coli. The length of the DNA fragments examined varied from 13 to 36 base pair, containing all or part of the operator sequence. These DNA fragments are either derived genetically or synthesized chemically. Resonances of the imino protons were assigned by one dimensional inter-base pair nuclear Overhauser enhancement (NOE) measurements. Imino proton exchange rates were measured by saturation recovery methods. Results from the kinetic measurements show an interesting dynamic heterogeneity with amore » maximum opening rate centered about a GTG/CAC sequence which correlates with the biological function of the operator DNA. This particular three base pair sequence occurs frequently and often symmetrically in prokaryotic nd eukaryotic DNA sites where one anticipates specific protein interaction for gene regulation. The observed sequence dependent imino proton exchange rate may be a reflection of variation of the local structure of regulatory DNA. The results also indicate that the observed imino proton exchange rates are length dependent.« less

Pyrvinium pamoate changes alternative splicing of the serotonin receptor 2C by influencing its RNA structure

PubMed Central

Shen, Manli; Bellaousov, Stanislav; Hiller, Michael; de La Grange, Pierre; Creamer, Trevor P.; Malina, Orit; Sperling, Ruth; Mathews, David H.; Stoilov, Peter; Stamm, Stefan

2013-01-01

The serotonin receptor 2C plays a central role in mood and appetite control. It undergoes pre-mRNA editing as well as alternative splicing. The RNA editing suggests that the pre-mRNA forms a stable secondary structure in vivo. To identify substances that promote alternative exons inclusion, we set up a high-throughput screen and identified pyrvinium pamoate as a drug-promoting exon inclusion without editing. Circular dichroism spectroscopy indicates that pyrvinium pamoate binds directly to the pre-mRNA and changes its structure. SHAPE (selective 2′-hydroxyl acylation analysed by primer extension) assays show that part of the regulated 5′-splice site forms intramolecular base pairs that are removed by this structural change, which likely allows splice site recognition and exon inclusion. Genome-wide analyses show that pyrvinium pamoate regulates >300 alternative exons that form secondary structures enriched in A–U base pairs. Our data demonstrate that alternative splicing of structured pre-mRNAs can be regulated by small molecules that directly bind to the RNA, which is reminiscent to an RNA riboswitch. PMID:23393189

DNA sequence alignment by microhomology sampling during homologous recombination

PubMed Central

Qi, Zhi; Redding, Sy; Lee, Ja Yil; Gibb, Bryan; Kwon, YoungHo; Niu, Hengyao; Gaines, William A.; Sung, Patrick

2015-01-01

Summary Homologous recombination (HR) mediates the exchange of genetic information between sister or homologous chromatids. During HR, members of the RecA/Rad51 family of recombinases must somehow search through vast quantities of DNA sequence to align and pair ssDNA with a homologous dsDNA template. Here we use single-molecule imaging to visualize Rad51 as it aligns and pairs homologous DNA sequences in real-time. We show that Rad51 uses a length-based recognition mechanism while interrogating dsDNA, enabling robust kinetic selection of 8-nucleotide (nt) tracts of microhomology, which kinetically confines the search to sites with a high probability of being a homologous target. Successful pairing with a 9th nucleotide coincides with an additional reduction in binding free energy and subsequent strand exchange occurs in precise 3-nt steps, reflecting the base triplet organization of the presynaptic complex. These findings provide crucial new insights into the physical and evolutionary underpinnings of DNA recombination. PMID:25684365

Detecting cooperative sequences in the binding of RNA Polymerase-II

NASA Astrophysics Data System (ADS)

Glass, Kimberly; Rozenberg, Julian; Girvan, Michelle; Losert, Wolfgang; Ott, Ed; Vinson, Charles

2008-03-01

Regulation of the expression level of genes is a key biological process controlled largely by the 1000 base pair (bp) sequence preceding each gene (the promoter region). Within that region transcription factor binding sites (TFBS), 5-10 bp long sequences, act individually or cooperate together in the recruitment of, and therefore subsequent gene transcription by, RNA Polymerase-II (RNAP). We have measured the binding of RNAP to promoters on a genome-wide basis using Chromatin Immunoprecipitation (ChIP-on-Chip) microarray assays. Using all 8-base pair long sequences as a test set, we have identified the DNA sequences that are enriched in promoters with high RNAP binding values. We are able to demonstrate that virtually all sequences enriched in such promoters contain a CpG dinucleotide, indicating that TFBS that contain the CpG dinucleotide are involved in RNAP binding to promoters. Further analysis shows that the presence of pairs of CpG containing sequences cooperate to enhance the binding of RNAP to the promoter.

Chemical restrictions of roots in Ultisol subsoils lessened by long-term management

NASA Technical Reports Server (NTRS)

Hardy, D. H.; Raper, C. D. Jr; Miner, G. S.; Raper CD, J. r. (Principal Investigator)

1990-01-01

Exchangeable Al in subsoils of Ultisols in the southeastern USA can restrict rooting depth. Downward movement of basic cations (Ca, Mg, and K), applied as lime and fertilizer, may diminish that restriction over time. Materials from the argillic horizon were collected from three paired sites, having managed (long-term cropping) and nonmanaged topsoils (Typic Paleudults and Hapludults). One managed site was cropped continuously for 15 yr while the others were cultivated for more than 30 yr. Concentrations of extractable cations and other nutrients from the paired sites were compared to determine the magnitude of change due to management. The ability of the subsoils to support plant growth was evaluated in a missing-nutrient greenhouse experiment with sorghum [Sorghum bicolor (L.) Moench]. Subsoils of managed sites had greater effective cation-exchange capacity (CEC) and base saturation than those of non-managed sites. While availabilities of Ca, Mg, and K in subsoils of nonmanaged sites were inadequate to support maximal plant growth, they were adequate in subsoils of managed sites. Compared with nonmanaged sites, KCl-exchangeable Al in subsoils of managed sites was 23% lower at the 15-yr location and 65 and 100% lower at the two other locations. In the absence of lime, sorghum growth was almost totally inhibited on nonmanaged subsoils amended with optimum nutrients. On the managed subsoils, where 100, 65, and 23% of the nonmanaged exchangeable Al had been neutralized by topsoil fertilization and liming, growth reductions under the same conditions were 0, 50, and 100%, respectively. Thus, relatively long-term management had improved these Ultisol subsoils for root growth and development.

Reversible geminate recombination of hydrogen-bonded water molecule pair

NASA Astrophysics Data System (ADS)

Markovitch, Omer; Agmon, Noam

2008-08-01

The (history independent) autocorrelation function for a hydrogen-bonded water molecule pair, calculated from classical molecular dynamics trajectories of liquid water, exhibits a t-3/2 asymptotic tail. Its whole time dependence agrees quantitatively with the solution for reversible diffusion-influenced geminate recombination derived by Agmon and Weiss [J. Chem. Phys. 91, 6937 (1989)]. Agreement with diffusion theory is independent of the precise definition of the bound state. Given the water self-diffusion constant, this theory enables us to determine the dissociation and bimolecular recombination rate parameters for a water dimer. (The theory is indispensable for obtaining the bimolecular rate coefficient.) Interestingly, the activation energies obtained from the temperature dependence of these rate coefficients are similar, rather than differing by the hydrogen-bond (HB) strength. This suggests that recombination requires displacing another water molecule, which meanwhile occupied the binding site. Because these activation energies are about twice the HB strength, cleavage of two HBs may be required to allow pair separation. The autocorrelation function without the HB angular restriction yields a recombination rate coefficient that is larger than that for rebinding to all four tetrahedral water sites (with angular restrictions), suggesting the additional participation of interstitial sites. Following dissociation, the probability of the pair to be unbound but within the reaction sphere rises more slowly than expected, possibly because binding to the interstitial sites delays pair separation. An extended diffusion model, which includes an additional binding site, can account for this behavior.

Ecosystem carbon loss with woody plant invasion of grasslands.

PubMed

Jackson, Robert B; Banner, Jay L; Jobbágy, Esteban G; Pockman, William T; Wall, Diana H

2002-08-08

The invasion of woody vegetation into deserts, grasslands and savannas is generally thought to lead to an increase in the amount of carbon stored in those ecosystems. For this reason, shrub and forest expansion (for example, into grasslands) is also suggested to be a substantial, if uncertain, component of the terrestrial carbon sink. Here we investigate woody plant invasion along a precipitation gradient (200 to 1,100 mm yr(-1)) by comparing carbon and nitrogen budgets and soil delta(13)C profiles between six pairs of adjacent grasslands, in which one of each pair was invaded by woody species 30 to 100 years ago. We found a clear negative relationship between precipitation and changes in soil organic carbon and nitrogen content when grasslands were invaded by woody vegetation, with drier sites gaining, and wetter sites losing, soil organic carbon. Losses of soil organic carbon at the wetter sites were substantial enough to offset increases in plant biomass carbon, suggesting that current land-based assessments may overestimate carbon sinks. Assessments relying on carbon stored from woody plant invasions to balance emissions may therefore be incorrect.

A reference skeletal dosimetry model for an adult male radionuclide therapy patient based on three-dimensional imaging and paired-image radiation transport

NASA Astrophysics Data System (ADS)

Shah, Amish P.

The need for improved patient-specificity of skeletal dose estimates is widely recognized in radionuclide therapy. Current clinical models for marrow dose are based on skeletal mass estimates from a variety of sources and linear chord-length distributions that do not account for particle escape into cortical bone. To predict marrow dose, these clinical models use a scheme that requires separate calculations of cumulated activity and radionuclide S values. Selection of an appropriate S value is generally limited to one of only three sources, all of which use as input the trabecular microstructure of an individual measured 25 years ago, and the tissue mass derived from different individuals measured 75 years ago. Our study proposed a new modeling approach to marrow dosimetry---the Paired Image Radiation Transport (PIRT) model---that properly accounts for both the trabecular microstructure and the cortical macrostructure of each skeletal site in a reference male radionuclide patient. The PIRT model, as applied within EGSnrc, requires two sets of input geometry: (1) an infinite voxel array of segmented microimages of the spongiosa acquired via microCT; and (2) a segmented ex-vivo CT image of the bone site macrostructure defining both the spongiosa (marrow, endosteum, and trabeculae) and the cortical bone cortex. Our study also proposed revising reference skeletal dosimetry models for the adult male cancer patient. Skeletal site-specific radionuclide S values were obtained for a 66-year-old male reference patient. The derivation for total skeletal S values were unique in that the necessary skeletal mass and electron dosimetry calculations were formulated from the same source bone site over the entire skeleton. We conclude that paired-image radiation-transport techniques provide an adoptable method by which the intricate, anisotropic trabecular microstructure of the skeletal site; and the physical size and shape of the bone can be handled together, for improved compilation of reference radionuclide S values. We also conclude that this comprehensive model for the adult male cancer patient should be implemented for use in patient-specific calculations for radionuclide dosimetry of the skeleton.

Genomic sequencing and in vivo footprinting of an expression-specific DNase I-hypersensitive site of avian vitellogenin II promoter reveal a demethylation of a mCpG and a change in specific interactions of proteins with DNA.

PubMed Central

Saluz, H P; Feavers, I M; Jiricny, J; Jost, J P

1988-01-01

Genomic sequencing was used to study the in vivo methylation pattern of two CpG sites in the promoter region of the avian vitellogenin gene. The CpG at position +10 was fully methylated in DNA isolated from tissues that do not express the gene but was unmethylated in the liver of mature hens and estradiol-treated roosters. In the latter tissue, this site became demethylated and DNase I hypersensitive after estradiol treatment. A second CpG (position -52) was unmethylated in all tissues examined. In vivo genomic footprinting with dimethyl sulfate revealed different patterns of DNA protection in silent and expressed genes. In rooster liver cells, at least 10 base pairs of DNA, including the methylated CpG, were protected by protein(s). Gel-shift assays indicated that a protein factor, present in rooster liver nuclear extract, bound at this site only when it was methylated. In hen liver cells, the same unmethylated CpG lies within a protected region of approximately equal to 20 base pairs. In vitro DNase I protection and gel-shift assays indicate that this sequence is bound by a protein, which binds both double- and single-stranded DNA. For the latter substrate, this factor was shown to bind solely the noncoding (i.e., mRNA-like) strand. Images PMID:3413118

A fully synthetic human Fab antibody library based on fixed VH/VL framework pairings with favorable biophysical properties

PubMed Central

Tiller, Thomas; Schuster, Ingrid; Deppe, Dorothée; Siegers, Katja; Strohner, Ralf; Herrmann, Tanja; Berenguer, Marion; Poujol, Dominique; Stehle, Jennifer; Stark, Yvonne; Heßling, Martin; Daubert, Daniela; Felderer, Karin; Kaden, Stefan; Kölln, Johanna; Enzelberger, Markus; Urlinger, Stefanie

2013-01-01

This report describes the design, generation and testing of Ylanthia, a fully synthetic human Fab antibody library with 1.3E+11 clones. Ylanthia comprises 36 fixed immunoglobulin (Ig) variable heavy (VH)/variable light (VL) chain pairs, which cover a broad range of canonical complementarity-determining region (CDR) structures. The variable Ig heavy and Ig light (VH/VL) chain pairs were selected for biophysical characteristics favorable to manufacturing and development. The selection process included multiple parameters, e.g., assessment of protein expression yield, thermal stability and aggregation propensity in fragment antigen binding (Fab) and IgG1 formats, and relative Fab display rate on phage. The framework regions are fixed and the diversified CDRs were designed based on a systematic analysis of a large set of rearranged human antibody sequences. Care was taken to minimize the occurrence of potential posttranslational modification sites within the CDRs. Phage selection was performed against various antigens and unique antibodies with excellent biophysical properties were isolated. Our results confirm that quality can be built into an antibody library by prudent selection of unmodified, fully human VH/VL pairs as scaffolds. PMID:23571156

Single-fluorophore monitoring of DNA hybridization for investigating the effect of secondary structure on the nucleation step.

PubMed

Jo, Joon-Jung; Kim, Min-Ji; Son, Jung-Tae; Kim, Jandi; Shin, Jong-Shik

2009-07-17

Nucleic acid hybridization is one of the essential biological processes involved in storage and transmission of genetic information. Here we quantitatively determined the effect of secondary structure on the hybridization activation energy using structurally defined oligonucleotides. It turned out that activation energy is linearly proportional to the length of a single-stranded region flanking a nucleation site, generating a 0.18 kcal/mol energy barrier per nucleotide. Based on this result, we propose that the presence of single-stranded segments available for non-productive base pairing with a nucleation counterpart extends the searching process for nucleation sites to find a perfect match. This result may provide insights into rational selection of a target mRNA site for siRNA and antisense gene silencing.

Reduction in Predator Defense in the Presence of Neighbors in a Colonial Fish

PubMed Central

Schädelin, Franziska C.; Fischer, Stefan; Wagner, Richard H.

2012-01-01

Predation pressure has long been considered a leading explanation of colonies, where close neighbors may reduce predation via dilution, alarming or group predator attacks. Attacking predators may be costly in terms of energy and survival, leading to the question of how neighbors contribute to predator deterrence in relationship to each other. Two hypotheses explaining the relative efforts made by neighbors are byproduct-mutualism, which occurs when breeders inadvertently attack predators by defending their nests, and reciprocity, which occurs when breeders deliberately exchange predator defense efforts with neighbors. Most studies investigating group nest defense have been performed with birds. However, colonial fish may constitute a more practical model system for an experimental approach because of the greater ability of researchers to manipulate their environment. We investigated in the colonial fish, Neolamprologus caudopunctatus, whether prospecting pairs preferred to breed near conspecifics or solitarily, and how breeders invested in anti-predator defense in relation to neighbors. In a simple choice test, prospecting pairs selected breeding sites close to neighbors versus a solitary site. Predators were then sequentially presented to the newly established test pairs, the previously established stimulus pairs or in between the two pairs. Test pairs attacked the predator eight times more frequently when they were presented on their non-neighbor side compared to between the two breeding sites, where stimulus pairs maintained high attack rates. Thus, by joining an established pair, test pairs were able to reduce their anti-predator efforts near neighbors, at no apparent cost to the stimulus pairs. These findings are unlikely to be explained by reciprocity or byproduct-mutualism. Our results instead suggest a commensal relationship in which new pairs exploit the high anti-predator efforts of established pairs, which invest similarly with or without neighbors. Further studies are needed to determine the scope of commensalism as an anti-predator strategy in colonial animals. PMID:22615741

Mapping of rDNA on the chromosomes of Eleusine species by fluorescence in situ hybridization.

PubMed

Bisht, M S; Mukai, Y

2000-12-01

Mapping of rDNA sites on the chromosomes of four diploid and two tetraploid species of Eleusine has provided valuable information on genome relationship between the species. Presence of 18S-5.8S-26S rDNA on the largest pair of the chromosomes, location of 5S rDNA at four sites on two pairs of chromosomes and presence of 18S-5.8S-26S and 5S rDNA at same location on one pair of chromosomes have clearly differentiated E. multiflora from rest of the species of Eleusine. The two tetraploid species, E. coracana and E. africana have the same number of 18S-5.8S-26S and 5S rDNA sites and located at similar position on the chromosomes. Diploid species, E. indica, E. floccifolia and E. tristachya have the same 18S-5.8S-26S sites and location on the chromosomes which also resembled with the two pairs of 18S-5.8S-26S rDNA locations in tetraploid species, E. coracana and E. africana. The 5S rDNA sites on chromosomes of E. indica and E. floccifolia were also comparable to the 5S rDNA sites of E. africana and E. coracana. The similarity of the rDNA sites and their location on chromosomes in the three diploid and two polyploid species also supports the view that genome donors to tetraploid species may be from these diploid species.

Multiheteromacrocycles that Complex Metal Ions. Sixth Progress Report, 1 May 1979-30 April 1980

DOE R&D Accomplishments Database

Cram, D. J.

1980-01-15

Objective is to design synthesize, and evaluate cyclic and polycyclic host organic compounds for their abilities to complex and lipophilize guest metal ions, their complexes, and their clusters. Host organic compounds consist of strategically placed solvating, coordinating, and ion-pairing sites tied together by covalent bonds through hydrocarbon units around cavities shaped to be occupied by guest metal ions or by metal ions plus their ligands. Specificity in complexation is sought by matching the following properties of host and guest: cavity and metal ion sizes; geometric arrangements of binding sites; number of binding sites; character of binding sites; and valences. During this period, hemispherands based on an aryloxy or cyclic urea unit, spherands based on aryloxyl units only, and their complexes with alkali metals and alkaline earths were investigated. An attempt to separate {sup 6}Li and {sup 7}Li by gel permeation chromatography of lithiospherium chloride failed. (DLC)

Evidence for conformational capture mechanism for damage recognition by NER protein XPC/Rad4.

NASA Astrophysics Data System (ADS)

Chakraborty, Sagnik; Steinbach, Peter J.; Paul, Debamita; Min, Jung-Hyun; Ansari, Anjum

Altered flexibility of damaged DNA sites is considered to play an important role in damage recognition by DNA repair proteins. Characterizing lesion-induced DNA dynamics has remained a challenge. We have combined ps-resolved fluorescence lifetime measurements with cytosine analog FRET pair uniquely sensitive to local unwinding/twisting to analyze DNA conformational distributions. This innovative approach maps out with unprecedented sensitivity the alternative conformations accessible to a series of DNA constructs containing 3-base-pair mismatch, suitable model lesions for the DNA repair protein xeroderma pigmentosum C (XPC) complex. XPC initiates eukaryotic nucleotide excision repair by recognizing various DNA lesions primarily through DNA deformability. Structural studies show that Rad4 (yeast ortholog of XPC) unwinds DNA at the lesion site and flips out two nucleotide pairs. Our results elucidate a broad range of conformations accessible to mismatched DNA even in the absence of the protein. Notably, the most severely distorted conformations share remarkable resemblance to the deformed conformation seen in the crystal structure of the Rad4-bound ``recognition'' complex supporting for the first time a possible ``conformational capture'' mechanism for damage recognition by XPC/Rad4. NSF Univ of Illinois-Chicago.

Hfq restructures RNA-IN and RNA-OUT and facilitates antisense pairing in the Tn10/IS10 system

PubMed Central

Ross, Joseph A.; Ellis, Michael J.; Hossain, Shahan; Haniford, David B.

2013-01-01

Hfq functions in post-transcriptional gene regulation in a wide range of bacteria, usually by promoting base-pairing of mRNAs and trans-encoded sRNAs that share partial sequence complementarity. It is less clear if Hfq is required for pairing of cis-encoded RNAs (i.e., antisense RNAs) with their target mRNAs. In the current work, we have characterized the interactions between Escherichia coli Hfq and the components of the Tn10/IS10 antisense system, RNA-IN and RNA-OUT. We show that Hfq interacts with RNA-OUT through its proximal RNA-binding surface, as is typical for Hfq and trans-encoded sRNAs. In contrast, RNA-IN binds both proximal and distal RNA-binding surfaces in Hfq with a higher affinity for the latter, as is typical for mRNA interactions in canonical sRNA-mRNA pairs. Importantly, an amino acid substitution in Hfq that interferes with RNA binding to the proximal site negatively impacts RNA-IN:OUT pairing in vitro and suppresses the ability of Hfq to negatively regulate IS10 transposition in vivo. We also show that Hfq binding to RNA-IN and RNA-OUT alters secondary structure elements in both of these RNAs and speculate that this could be important in how Hfq facilitates RNA-IN:OUT pairing. Based on the results presented here, we suggest that Hfq could be involved in regulating RNA pairing in other antisense systems, including systems encoded by other transposable elements. PMID:23510801

Wobble pairs of the HDV ribozyme play specific roles in stabilization of active site dynamics.

PubMed

Sripathi, Kamali N; Banáš, Pavel; Réblová, Kamila; Šponer, Jiří; Otyepka, Michal; Walter, Nils G

2015-02-28

The hepatitis delta virus (HDV) is the only known human pathogen whose genome contains a catalytic RNA motif (ribozyme). The overall architecture of the HDV ribozyme is that of a double-nested pseudoknot, with two GU pairs flanking the active site. Although extensive studies have shown that mutation of either wobble results in decreased catalytic activity, little work has focused on linking these mutations to specific structural effects on catalytic fitness. Here we use molecular dynamics simulations based on an activated structure to probe the active site dynamics as a result of wobble pair mutations. In both wild-type and mutant ribozymes, the in-line fitness of the active site (as a measure of catalytic proficiency) strongly depends on the presence of a C75(N3H3+)N1(O5') hydrogen bond, which positions C75 as the general acid for the reaction. Our mutational analyses show that each GU wobble supports catalytically fit conformations in distinct ways; the reverse G25U20 wobble promotes high in-line fitness, high occupancy of the C75(N3H3+)G1(O5') general-acid hydrogen bond and stabilization of the G1U37 wobble, while the G1U37 wobble acts more locally by stabilizing high in-line fitness and the C75(N3H3+)G1(O5') hydrogen bond. We also find that stable type I A-minor and P1.1 hydrogen bonding above and below the active site, respectively, prevent local structural disorder from spreading and disrupting global conformation. Taken together, our results define specific, often redundant architectural roles for several structural motifs of the HDV ribozyme active site, expanding the known roles of these motifs within all HDV-like ribozymes and other structured RNAs.

Wobble Pairs of the HDV Ribozyme Play Specific Roles in Stabilization of Active Site Dynamics

PubMed Central

Sripathi, Kamali N.; Banáš, Pavel; Reblova, Kamila; Šponer, Jiři; Otyepka, Michal

2015-01-01

The hepatitis delta virus (HDV) is the only known human pathogen whose genome contains a catalytic RNA motif (ribozyme). The overall architecture of the HDV ribozyme is that of a double-nested pseudoknot, with two GU pairs flanking the active site. Although extensive studies have shown that mutation of either wobble results in decreased catalytic activity, little work has focused on linking these mutations to specific structural effects on catalytic fitness. Here we use molecular dynamics simulations based on an activated structure to probe the active site dynamics as a result of wobble pair mutations. In both wild-type and mutant ribozymes, the in-line fitness of the active site (as a measure of catalytic proficiency) strongly depends on the presence of a C75(N3H3+)N1(O5′) hydrogen bond, which positions C75 as the general acid for the reaction. Our mutational analyses show that each GU wobble supports catalytically fit conformations in distinct ways; the reverse G25U20 wobble promotes high in-line fitness, high occupancy of the C75(N3H3+)G1(O5′) general-acid hydrogen bond and stabilization of the G1U37 wobble, while the G1U37 wobble acts more locally by stabilizing high in-line fitness and the C75(N3H3+)G1(O5′) hydrogen bond. We also find that stable type I A-minor and P1.1 hydrogen bonding above and below the active site, respectively, prevent local structural disorder from spreading and disrupting global conformation. Taken together, our results define specific, often redundant architectural roles for several structural motifs of the HDV ribozyme active site, expanding the known roles of these motifs within all HDV-like ribozymes and other structured RNAs. PMID:25631765

Active Site Detection by Spatial Conformity and Electrostatic Analysis—Unravelling a Proteolytic Function in Shrimp Alkaline Phosphatase

PubMed Central

Chakraborty, Sandeep; Minda, Renu; Salaye, Lipika; Bhattacharjee, Swapan K.; Rao, Basuthkar J.

2011-01-01

Computational methods are increasingly gaining importance as an aid in identifying active sites. Mostly these methods tend to have structural information that supplement sequence conservation based analyses. Development of tools that compute electrostatic potentials has further improved our ability to better characterize the active site residues in proteins. We have described a computational methodology for detecting active sites based on structural and electrostatic conformity - C ata L ytic A ctive S ite P rediction (CLASP). In our pipelined model, physical 3D signature of any particular enzymatic function as defined by its active sites is used to obtain spatially congruent matches. While previous work has revealed that catalytic residues have large pKa deviations from standard values, we show that for a given enzymatic activity, electrostatic potential difference (PD) between analogous residue pairs in an active site taken from different proteins of the same family are similar. False positives in spatially congruent matches are further pruned by PD analysis where cognate pairs with large deviations are rejected. We first present the results of active site prediction by CLASP for two enzymatic activities - β-lactamases and serine proteases, two of the most extensively investigated enzymes. The results of CLASP analysis on motifs extracted from Catalytic Site Atlas (CSA) are also presented in order to demonstrate its ability to accurately classify any protein, putative or otherwise, with known structure. The source code and database is made available at www.sanchak.com/clasp/. Subsequently, we probed alkaline phosphatases (AP), one of the well known promiscuous enzymes, for additional activities. Such a search has led us to predict a hitherto unknown function of shrimp alkaline phosphatase (SAP), where the protein acts as a protease. Finally, we present experimental evidence of the prediction by CLASP by showing that SAP indeed has protease activity in vitro. PMID:22174814

Convergent transmission of RNAi guide-target mismatch information across Argonaute internal allosteric network.

PubMed

Joseph, Thomas T; Osman, Roman

2012-01-01

In RNA interference, a guide strand derived from a short dsRNA such as a microRNA (miRNA) is loaded into Argonaute, the central protein in the RNA Induced Silencing Complex (RISC) that silences messenger RNAs on a sequence-specific basis. The positions of any mismatched base pairs in an miRNA determine which Argonaute subtype is used. Subsequently, the Argonaute-guide complex binds and silences complementary target mRNAs; certain Argonautes cleave the target. Mismatches between guide strand and the target mRNA decrease cleavage efficiency. Thus, loading and silencing both require that signals about the presence of a mismatched base pair are communicated from the mismatch site to effector sites. These effector sites include the active site, to prevent target cleavage; the binding groove, to modify nucleic acid binding affinity; and surface allosteric sites, to control recruitment of additional proteins to form the RISC. To examine how such signals may be propagated, we analyzed the network of internal allosteric pathways in Argonaute exhibited through correlations of residue-residue interactions. The emerging network can be described as a set of pathways emanating from the core of the protein near the active site, distributed into the bulk of the protein, and converging upon a distributed cluster of surface residues. Nucleotides in the guide strand "seed region" have a stronger relationship with the protein than other nucleotides, concordant with their importance in sequence selectivity. Finally, any of several seed region guide-target mismatches cause certain Argonaute residues to have modified correlations with the rest of the protein. This arises from the aggregation of relatively small interaction correlation changes distributed across a large subset of residues. These residues are in effector sites: the active site, binding groove, and surface, implying that direct functional consequences of guide-target mismatches are mediated through the cumulative effects of a large number of internal allosteric pathways.

Convergent Transmission of RNAi Guide-Target Mismatch Information across Argonaute Internal Allosteric Network

PubMed Central

Joseph, Thomas T.; Osman, Roman

2012-01-01

In RNA interference, a guide strand derived from a short dsRNA such as a microRNA (miRNA) is loaded into Argonaute, the central protein in the RNA Induced Silencing Complex (RISC) that silences messenger RNAs on a sequence-specific basis. The positions of any mismatched base pairs in an miRNA determine which Argonaute subtype is used. Subsequently, the Argonaute-guide complex binds and silences complementary target mRNAs; certain Argonautes cleave the target. Mismatches between guide strand and the target mRNA decrease cleavage efficiency. Thus, loading and silencing both require that signals about the presence of a mismatched base pair are communicated from the mismatch site to effector sites. These effector sites include the active site, to prevent target cleavage; the binding groove, to modify nucleic acid binding affinity; and surface allosteric sites, to control recruitment of additional proteins to form the RISC. To examine how such signals may be propagated, we analyzed the network of internal allosteric pathways in Argonaute exhibited through correlations of residue-residue interactions. The emerging network can be described as a set of pathways emanating from the core of the protein near the active site, distributed into the bulk of the protein, and converging upon a distributed cluster of surface residues. Nucleotides in the guide strand “seed region” have a stronger relationship with the protein than other nucleotides, concordant with their importance in sequence selectivity. Finally, any of several seed region guide-target mismatches cause certain Argonaute residues to have modified correlations with the rest of the protein. This arises from the aggregation of relatively small interaction correlation changes distributed across a large subset of residues. These residues are in effector sites: the active site, binding groove, and surface, implying that direct functional consequences of guide-target mismatches are mediated through the cumulative effects of a large number of internal allosteric pathways. PMID:23028290

Past, present and future of kidney paired donation transplantation in India

PubMed Central

Kute, Vivek B; Patel, Himanshu V; Shah, Pankaj R; Modi, Pranjal R; Shah, Veena R; Rizvi, Sayyed J; Pal, Bipin C; Modi, Manisha P; Shah, Priya S; Varyani, Umesh T; Wakhare, Pavan S; Shinde, Saiprasad G; Ghodela, Vijay A; Patel, Minaxi H; Trivedi, Varsha B; Trivedi, Hargovind L

2017-01-01

One third of healthy willing living kidney donors are rejected due to ABO blood group incompatibility and donor specific antibody. This increases pre-transplant dialysis duration leading to increased morbidity and mortality on the kidney transplantation waiting list. Over the last decade kidney paired donation is most rapidly increased source of living kidney donors. In a kidney transplantation program dominated by living donor kidney transplantation, kidney paired donation is a legal and valid alternative strategy to increase living donor kidney transplantation. This is more useful in countries with limited resources where ABO incompatible kidney transplantation or desensitization protocol is not feasible because of costs/infectious complications and deceased donor kidney transplantation is in initial stages. The matching allocation, ABO blood type imbalance, reciprocity, simultaneity, geography were the limitation for the expansion of kidney paired donation. Here we describe different successful ways to increase living donor kidney transplantation through kidney paired donation. Compatible pairs, domino chain, combination of kidney paired donation with desensitization or ABO incompatible transplantation, international kidney paired donation, non-simultaneous, extended, altruistic donor chain and list exchange are different ways to expand the donor pool. In absence of national kidney paired donation program, a dedicated kidney paired donation team will increase access to living donor kidney transplantation in individual centres with team work. Use of social networking sites to expand donor pool, HLA based national kidney paired donation program will increase quality and quantity of kidney paired donation transplantation. Transplant centres should remove the barriers to a broader implementation of multicentre, national kidney paired donation program to further optimize potential of kidney paired donation to increase transplantation of O group and sensitized patients. This review assists in the development of similar programs in other developing countries. PMID:28507916

Past, present and future of kidney paired donation transplantation in India.

PubMed

Kute, Vivek B; Patel, Himanshu V; Shah, Pankaj R; Modi, Pranjal R; Shah, Veena R; Rizvi, Sayyed J; Pal, Bipin C; Modi, Manisha P; Shah, Priya S; Varyani, Umesh T; Wakhare, Pavan S; Shinde, Saiprasad G; Ghodela, Vijay A; Patel, Minaxi H; Trivedi, Varsha B; Trivedi, Hargovind L

2017-04-24

One third of healthy willing living kidney donors are rejected due to ABO blood group incompatibility and donor specific antibody. This increases pre-transplant dialysis duration leading to increased morbidity and mortality on the kidney transplantation waiting list. Over the last decade kidney paired donation is most rapidly increased source of living kidney donors. In a kidney transplantation program dominated by living donor kidney transplantation, kidney paired donation is a legal and valid alternative strategy to increase living donor kidney transplantation. This is more useful in countries with limited resources where ABO incompatible kidney transplantation or desensitization protocol is not feasible because of costs/infectious complications and deceased donor kidney transplantation is in initial stages. The matching allocation, ABO blood type imbalance, reciprocity, simultaneity, geography were the limitation for the expansion of kidney paired donation. Here we describe different successful ways to increase living donor kidney transplantation through kidney paired donation. Compatible pairs, domino chain, combination of kidney paired donation with desensitization or ABO incompatible transplantation, international kidney paired donation, non-simultaneous, extended, altruistic donor chain and list exchange are different ways to expand the donor pool. In absence of national kidney paired donation program, a dedicated kidney paired donation team will increase access to living donor kidney transplantation in individual centres with team work. Use of social networking sites to expand donor pool, HLA based national kidney paired donation program will increase quality and quantity of kidney paired donation transplantation. Transplant centres should remove the barriers to a broader implementation of multicentre, national kidney paired donation program to further optimize potential of kidney paired donation to increase transplantation of O group and sensitized patients. This review assists in the development of similar programs in other developing countries.

Nucleic acid constructs containing orthogonal site selective recombinases (OSSRs)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gilmore, Joshua M.; Anderson, J. Christopher; Dueber, John E.

The present invention provides for a recombinant nucleic acid comprising a nucleotide sequence comprising a plurality of constructs, wherein each construct independently comprises a nucleotide sequence of interest flanked by a pair of recombinase recognition sequences. Each pair of recombinase recognition sequences is recognized by a distinct recombinase. Optionally, each construct can, independently, further comprise one or more genes encoding a recombinase capable of recognizing the pair of recombinase recognition sequences of the construct. The recombinase can be an orthogonal (non-cross reacting), site-selective recombinase (OSSR).

DNA lability induced by nimustine and ramustine in rat glioma cells.

PubMed Central

Mineura, K; Fushimi, S; Itoh, Y; Kowada, M

1988-01-01

The DNA labile sites induced by two nitrosoureas, nimustine (ACNU) and ramustine (MCNU) synthesised in Japan, have been examined in highly reiterated DNA sequences of rat glioma cells. Reiterated fragments of 167 and 203 base pairs (bp), obtained after Hind III and Hae III restriction endonuclease digestion of rat glioma cells DNA, were used as target DNA sequences to determine the labile sites. In vitro reaction with ACNU and MCNU resulted in scission products corresponding to the locations of guanine. Subsequent piperidine hydrolysis produced more frequent breaks of the phosphodiester bonds at guanine positions, thus forming alkali-labile sites. Images PMID:3236017

ATP hydrolysis in Eg5 kinesin involves a catalytic two-water mechanism.

PubMed

Parke, Courtney L; Wojcik, Edward J; Kim, Sunyoung; Worthylake, David K

2010-02-19

Motor proteins couple steps in ATP binding and hydrolysis to conformational switching both in and remote from the active site. In our kinesin.AMPPPNP crystal structure, closure of the active site results in structural transformations appropriate for microtubule binding and organizes an orthosteric two-water cluster. We conclude that a proton is shared between the lytic water, positioned for gamma-phosphate attack, and a second water that serves as a general base. To our knowledge, this is the first experimental detection of the catalytic base for any ATPase. Deprotonation of the second water by switch residues likely triggers subsequent large scale structural rearrangements. Therefore, the catalytic base is responsible for initiating nucleophilic attack of ATP and for relaying the positive charge over long distances to initiate mechanotransduction. Coordination of switch movements via sequential proton transfer along paired water clusters may be universal for nucleotide triphosphatases with conserved active sites, such as myosins and G-proteins.

The Impact of Afforestation on the Carbon Stocks of Mineral Soils Across the Republic of Ireland.

NASA Astrophysics Data System (ADS)

Wellock, M.; Laperle, C.; Kiely, G.; Reidy, B.; Duffy, C.; Tobin, B.

2009-04-01

At the beginning of the twentieth century forests accounted for only 1% of the total Irish land cover (Pilcher & Mac an tSaoir, 1995). However, due to the efforts of successive governments there has been rapid afforestation since the 1960s resulting in a 10.0% forest land cover as of 2007 (The Department of Agriculture, Fisheries, and Food, 2007). A large proportion of this afforestation took place after the mid-1980s and was fueled by government grant incentive schemes targeted at private landowners (Renou & Farrell 2005). Consequently, 54% of forests are less than 20 years old (Byrne, 2006). This specific land use change provides an opportunity for Ireland to meet international obligations set forth by the United Nations Framework Convention on Climate Change (UNFCCC, 1992). These obligations include the limitation of greenhouse gas emissions to 13% above 1990 levels. In order to promote accountability for these commitments, the UNFCCC treaty and the Kyoto Protocol (Kyoto Protocol, 1997) mandate signatories to publish greenhouse gas (GHG) emissions inventories for both greenhouse gas sources and removals by sinks. Article 3.3 of the Kyoto Protocol allows changes in C stocks due to afforestation, reforestation, and deforestation since 1990 to be used to offset inventory emissions. Therefore, due to the rapid rate of afforestation and its increased carbon sequestration since 1990, Ireland has the potential to significantly offset GHG emissions. There is little known as to the impacts of afforestation on the carbon stocks in soils over time, and even less known about the impact on Irish soils. The FORESTC project aims to analyse this impact by undertaking a nationwide study using a method similar to that of the paired plot method in Davis and Condron, 2002. The study will examine 42 forest sites across Ireland selected randomly from the National Forest Inventory (National Forest Inventory, 2007). These 42 sites will be grouped based on the forest type which includes conifer, broadleaf, and mixed (broadleaf and conifer) and soil type: brown earth, podzol, brown podzolic, gley and brown earth. The paired plot method involves selecting a second site that represents the same soil type and physical characteristics as the forest site. The only difference between the two sites should be the current land-use of the pair site, which should represent the pre-afforestation land-use of the forest site. Each forest site and its pair site will be sampled in the top 30 cm of soil for bulk density and organic carbon %, while litter and F/H layer samples will be taken and analysed for carbon. This data should provide an analysis of the carbon stocks of the soil and litter of both the forest site and its pair site allowing for comparison and thus the impact of afforestation on carbon stocks. References. Byrne, K.A., & Milne, R. (2006). Carbon stocks and sequestration in plantation forests in the Republic of Ireland. Forestry, 79, no. 4: 361. Davis, M.R., & Condron, L.M. (2002). Impact of grassland afforestation on soil carbon in New Zealand: a review of paired-site studies. Australian Journal of Soil Research, 40, no. 4: 675-690. Kyoto Protocol. 1997 Kyoto Protocol to the United Nations Framework Convention on Climate Change. FCCC/CP/1997/7/Add.1, Decision 1/CP.3, Annex 7. UN. National Forest Inventory: NFI Methodology. (2007). Forest Service, The Department of Agriculture, Fisheries, and Food, Wexford, Ireland. Pilcher, J.R. & Mac an tSaoir, S. (1995). Wood, Trees and Forests in Ireland. (Royal Irish Academy, Dublin. Renou, F. & Farrell, E.P. (2005). Reclaiming peatlands for forestry: the Irish experience. In: Stanturf, J.A. and Madsen, P.A. (eds.). Restoration of boreal and temperate forests. CRC Press, Boca Raton. p.541-557. UNFCCC. 1992 United Nations Framework Convention on Climate Change. Palais des Nations, Geneva. http://www.unfccc.de/index.html

Unique Dynamic Properties of DNA Duplexes Containing Interstrand Crosslinks†

PubMed Central

Friedman, Joshua I.; Jiang, Yu Lin; Miller, Paul S.; Stivers, James T.

2010-01-01

Bifunctional DNA alkylating agents form a diverse assortment of covalent DNA interstrand crosslinked (ICL) structures that are potent cytotoxins. Since it is implausible that cells could possess distinct DNA repair systems for each individual ICL, it is believed that common structural and dynamic features of ICL damage are recognized, rather than specific structural characteristics of each cross-linking agent. Investigation of the structural and dynamic properties of ICLs that might be important for recognition has been complicated by heterogeneous incorporation of these lesions into DNA. To address this problem we have synthesized and characterized several homogenous ICL-DNAs containing site–specific staggered N4-cytosine-ethyl-N4-cytosine crosslinks. Staggered crosslinks were introduced in two ways: in a manner that preserves the overall structure of B-form duplex DNA, and in a manner that highly distorts the DNA structure, with the goal of understanding how structural and dynamic properties of diverse ICL duplexes might flag these sites for repair. Measurements of base pair opening dynamics in the B-form ICL duplex by 1H NMR linewidth or imino proton solvent exchange showed that the guanine base opposite to the crosslinked cytosine opened at least an order of magnitude more slowly than when in a control matched normal duplex. To a lesser degree, the B-form ICL also induced a decrease in base pair opening dynamics that extended from the site of the crosslink to adjacent base pairs. In contrast, the non-B-form ICL showed extensive conformational dynamics at the site of the cross link, which extended over the entire DNA sequence. Since DNA duplexes containing the B-form and non-B-form ICL crosslinks have both been shown to be incised when incubated in mammalian whole cell extracts, while a matched normal duplex is not, we conclude that intrinsic DNA dynamics is not a requirement for specific damage incision of these ICLs. Instead, we propose a general model where destabilized ICL-duplexes serve to energetically facilitate binding of DNA repair factors that must induce bubbles or other distortions in the duplex. However, the essential requirement for incision is an immobile Y-junction where the repair factors are stably bound at the site of the ICL, and the two DNA strands are unpaired. PMID:21174443

Duplex Interrogation by a Direct DNA Repair Protein in Search of Base Damage

PubMed Central

Yi, Chengqi; Chen, Baoen; Qi, Bo; Zhang, Wen; Jia, Guifang; Zhang, Liang; Li, Charles J.; Dinner, Aaron R.; Yang, Cai-Guang; He, Chuan

2012-01-01

ALKBH2 is a direct DNA repair dioxygenase guarding mammalian genome against N1-methyladenine, N3-methylcytosine, and 1,N6-ethenoadenine damage. A prerequisite for repair is to identify these lesions in the genome. Here we present crystal structures of ALKBH2 bound to different duplex DNAs. Together with computational and biochemical analyses, our results suggest that DNA interrogation by ALKBH2 displays two novel features: i) ALKBH2 probes base-pair stability and detects base pairs with reduced stability; ii) ALKBH2 does not have nor need a “damage-checking site”, which is critical for preventing spurious base-cleavage for several glycosylases. The demethylation mechanism of ALKBH2 insures that only cognate lesions are oxidized and reversed to normal bases, and that a flipped, non-substrate base remains intact in the active site. Overall, the combination of duplex interrogation and oxidation chemistry allows ALKBH2 to detect and process diverse lesions efficiently and correctly. PMID:22659876

Pairing tendencies in a two-orbital Hubbard model in one dimension

DOE Office of Scientific and Technical Information (OSTI.GOV)

Patel, Niravkumar D.; Nocera, Adriana; Alvarez, Gonzalo

The recent discovery of superconductivity under high pressure in the ladder compound BaFe2S3 has opened a new field of research in iron-based superconductors with focus on quasi-one-dimensional geometries. In this publication, using the density matrix renormalization group technique, we study a two-orbital Hubbard model defined in one-dimensional chains. Our main result is the presence of hole binding tendencies at intermediate Hubbard U repulsion and robust Hund coupling JH / U = 0.25. Binding does not occur either in weak coupling or at very strong coupling. The pair-pair correlations that are dominant near half-filling, or of similar strength as the chargemore » and spin correlation channels, involve hole-pair operators that are spin singlets, use nearest-neighbor sites, and employ different orbitals for each hole. As a result, the Hund coupling strength, presence of robust magnetic moments, and antiferromagnetic correlations among them are important for the binding tendencies found here.« less

A curved RNA helix incorporating an internal loop with G·A and A·A non-Watson–Crick base pairing

PubMed Central

Baeyens, Katrien J.; De Bondt, Hendrik L.; Pardi, Arthur; Holbrook, Stephen R.

1996-01-01

The crystal structure of the RNA dodecamer 5′-GGCC(GAAA)GGCC-3′ has been determined from x-ray diffraction data to 2.3-Å resolution. In the crystal, these oligomers form double helices around twofold symmetry axes. Four consecutive non-Watson–Crick base pairs make up an internal loop in the middle of the duplex, including sheared G·A pairs and novel asymmetric A·A pairs. This internal loop sequence produces a significant curvature and narrowing of the double helix. The helix is curved by 34° from end to end and the diameter is narrowed by 24% in the internal loop. A Mn2+ ion is bound directly to the N7 of the first guanine in the Watson–Crick region following the internal loop and the phosphate of the preceding residue. This Mn2+ location corresponds to a metal binding site observed in the hammerhead catalytic RNA. PMID:8917508

Increments to chiral recognition facilitating enantiomer separations of chiral acids, bases, and ampholytes using Cinchona-based zwitterion exchanger chiral stationary phases.

PubMed

Wernisch, Stefanie; Pell, Reinhard; Lindner, Wolfgang

2012-07-01

The intramolecular distances of anion and cation exchanger sites of zwitterionic chiral stationary phases represent potential tuning sites for enantiomer selectivity. In this contribution, we investigate the influence of alkanesulfonic acid chain length and flexibility on enantiomer separations of chiral acids, bases, and amphoteric molecules for six Cinchona alkaloid-based chiral stationary phases in comparison with structurally related anion and cation exchangers. Employing polar-organic elution conditions, we observed an intramolecular counterion effect for acidic analytes which led to reduced retention times but did not impair enantiomer selectivities. Retention of amphoteric analytes is based on simultaneous double ion pairing of their charged functional groups with the acidic and basic sites of the zwitterionic selectors. A chiral center in the vicinity of the strong cation exchanger site is vital for chiral separations of bases. Sterically demanding side chains are beneficial for separations of free amino acids. Enantioseparations of free (un-derivatized) peptides were particularly successful in stationary phases with straight-chain alkanesulfonic acid sites, pointing to a beneficial influence of more flexible moieties. In addition, we observed pseudo-enantiomeric behavior of quinine and quinidine-derived chiral stationary phases facilitating reversal of elution orders for all analytes. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Physical signals for protein-DNA recognition

NASA Astrophysics Data System (ADS)

Cao, Xiao-Qin; Zeng, Jia; Yan, Hong

2009-09-01

This paper discovers consensus physical signals around eukaryotic splice sites, transcription start sites, and replication origin start and end sites on a genome-wide scale based on their DNA flexibility profiles calculated by three different flexibility models. These salient physical signals are localized highly rigid and flexible DNAs, which may play important roles in protein-DNA recognition by the sliding search mechanism. The found physical signals lead us to a detailed hypothetical view of the search process in which a DNA-binding protein first finds a genomic region close to the target site from an arbitrary starting location by three-dimensional (3D) hopping and intersegment transfer mechanisms for long distances, and subsequently uses the one-dimensional (1D) sliding mechanism facilitated by the localized highly rigid DNAs to accurately locate the target flexible binding site within 30 bp (base pair) short distances. Guided by these physical signals, DNA-binding proteins rapidly search the entire genome to recognize a specific target site from the 3D to 1D pathway. Our findings also show that current promoter prediction programs (PPPs) based on DNA physical properties may suffer from lots of false positives because other functional sites such as splice sites and replication origins have similar physical signals as promoters do.

Design and methods for a community-based intervention to reduce sugar-sweetened beverage consumption among youth: H2GO! study.

PubMed

Wang, Monica L; Lemon, Stephenie C; Clausen, Kristian; Whyte, Julie; Rosal, Milagros C

2016-11-09

Reducing sugar-sweetened beverage (SSB) intake is an important dietary target among underserved children at high risk for obesity and associated morbidities. Community-based approaches to reduce SSB intake are needed. The use of narrative-based approaches (presenting messages within the context of a story) can facilitate connection with target health messages and empower children as behavior change agents within their families. The H 2 GO! program is a community-based behavioral intervention that integrates narrative-based strategies to reduce SSB consumption and promote water intake among school-age youth and parents. Guided by the Social Cognitive Theory and the Social Ecological Model, the H 2 GO! intervention consists of 6 weekly sessions that target beverage knowledge, attitudes, and behaviors through youth-produced messages and narratives to reduce SSB intake and encourage water intake and parent-child activities. To reach underserved youth and families, we identified Boys & Girls Clubs (B&GC) (youth-based community centers that serve an ethnically diverse and predominantly low socioeconomic status population) as a community partner and study setting. Participants (children ages 9-12 years and their parents) will be recruited from B&GC sites in Massachusetts, USA. Intervention efficacy will be assessed through a site-randomized trial (N = 2 youth-based community sites, pair-matched for size and racial/ethnic composition) with 54 parent-child pairs (N = 108) enrolled per site (N = 216 total). The comparison site will carry on with usual practice. Child and parental SSB and water consumption (primary outcomes) and parent and child beverage knowledge and attitudes (secondary outcomes) will be measured via self-report surveys. Additional outcomes include children's anthropometric data, additional dietary behaviors, and physical activity. Measures will be collected at baseline, 2 and 6 months follow-up. With an estimated 20 % dropout rate, the study will have 80 % power to detect a group difference of 3.9 servings of SSBs per week. Community-based approaches hold potential for decreasing SSB consumption among youth and families, particularly among underserved populations who are at greater obesity risk. This article describes the design and methods of a community-based behavioral intervention designed to reduce SSB consumption among youth and parents/caregivers. ClinicalTrials.gov NCT02890056 . Date of Registration: August 31, 2016.

Biennial Guidance Test Symposium (14th) held in Holloman Air Force Base, New Mexico on 3-5 October 1989. Volume 1

DTIC Science & Technology

1989-10-30

assembled pair is tumble lapped. Tumble lapping is a process in which Mechanically, the 1.5-inch diameter rotors a a weighted lapping element and slurry of...parameter met AGTF requirements at that site. Weighting factors were than assigned to each parameter as an indication of importance of the parameter to...AGTF. The weighted score was determined by multiplying the score by the weighting factor. The weighted scores were then totaled for each site to

Structural Basis of Transcriptional Regulation of the Proline Utilization Regulon by Multifunctional PutA

PubMed Central

Zhou, Yuzhen; Larson, John D.; Bottoms, Christopher A.; Arturo, Emilia C.; Henzl, Michael T.; Jenkins, Jermaine L.; Nix, Jay C.; Becker, Donald F.; Tanner, John J.

2009-01-01

Summary The multifunctional Escherichia coli PutA flavoprotein functions as both a membrane-associated proline catabolic enzyme and transcriptional repressor of the proline utilization genes putA and putP. To better understand the mechanism of transcriptional regulation by PutA, we have mapped the put regulatory region, determined a crystal structure of the PutA ribbon-helix-helix domain (PutA52) complexed with DNA and examined the thermodynamics of DNA binding to PutA52. Five operator sites, each containing the sequence motif 5′-GTTGCA-3′, were identified using gel-shift analysis. Three of the sites are shown to be critical for repression of putA, whereas the two other sites are important for repression of putP. The 2.25 Å resolution crystal structure of PutA52 bound to one of the operators (operator 2, 21-bp) shows that the protein contacts a 9-bp fragment, corresponding to the GTTGCA consensus motif plus three flanking base pairs. Since the operator sequences differ in flanking bases, the structure implies that PutA may have different affinities for the five operators. This hypothesis was explored using isothermal titration calorimetry. The binding of PutA52 to operator 2 is exothermic with an enthalpy of −1.8 kcal/mol and a dissociation constant of 210 nM. Substitution of the flanking bases of operator 4 into operator 2 results in an unfavorable enthalpy of 0.2 kcal/mol and 15-fold lower affinity, which shows that base pairs outside of the consensus motif impact binding. The structural and thermodynamic data suggest that hydrogen bonds between Lys9 and bases adjacent to the GTTGCA motif contribute to transcriptional regulation by fine-tuning the affinity of PutA for put control operators. PMID:18586269

Reproductive Ecology Of The Florida Scrub-Jay (Aphelocoma Coerulescens) On John F. Kennedy Space Center/Merritt Island National Wildlife Refuge: A Long-Term Study

NASA Technical Reports Server (NTRS)

Carter, Geoffry M.; Breininger, David R.; Larson, Vicky L.; Oddy, Donna M.; Smith, Rebecca B.; Stolen, Eric D.

2005-01-01

From 1988 to 2002 we studied the breeding ecology of Florida Scrub-Jays (Aphelocoma coerulescens) on John F. Kennedy Space Center/Merritt Island National Wildlife Refuge. We examined phenology, clutch size, hatching failure rates, fledgling production, nest success, predation rates, sources egg and nestling mortality, and the effects of helpers on these measures. Nesting phenology was similar among sites. Mean clutch size at Titan was significantly larger than at HC or T4. Pairs with helpers did not produce larger clutches than pairs without helpers. Fledgling production at T4 was significantly greater than at HC and similar to Titan. Pairs with helpers at HC produced significantly more fledglings than pairs without helpers; helpers did not influence fledgling production at the other sites. Nest success at HC and Titan was low, 19% and 32% respectively. Nest success at T4 was 48% and was significantly greater than at HC. Average predation rates at all sites increased with season progression. Predation rates at all sight rose sharply by early June. The main cause of nest failure at all sites was predation, 93%.

Influence of asymmetric attenuation of single and paired dendritic inputs on summation of synaptic potentials and initiation of action potentials.

PubMed

Fortier, Pierre A; Bray, Chelsea

2013-04-16

Previous studies revealed mechanisms of dendritic inputs leading to action potential initiation at the axon initial segment and backpropagation into the dendritic tree. This interest has recently expanded toward the communication between different parts of the dendritic tree which could preprocess information before reaching the soma. This study tested for effects of asymmetric voltage attenuation between different sites in the dendritic tree on summation of synaptic inputs and action potential initiation using the NEURON simulation environment. Passive responses due to the electrical equivalent circuit of the three-dimensional neuron architecture with leak channels were examined first, followed by the responses after adding voltage-gated channels and finally synaptic noise. Asymmetric attenuation of voltage, which is a function of asymmetric input resistance, was seen between all pairs of dendritic sites but the transfer voltages (voltage recorded at the opposite site from stimulation among a pair of dendritic sites) were equal and also summed linearly with local voltage responses during simultaneous stimulation of both sites. In neurons with voltage-gated channels, we reproduced the observations where a brief stimulus to the proximal ascending dendritic branch of a pyramidal cell triggers a local action potential but a long stimulus triggers a somal action potential. Combined stimulation of a pair of sites in this proximal dendrite did not alter this pattern. The attraction of the action potential onset toward the soma with a long stimulus in the absence of noise was due to the higher density of voltage-gated sodium channels at the axon initial segment. This attraction was, however, negligible at the most remote distal dendritic sites and was replaced by an effect due to high input resistance. Action potential onset occurred at the dendritic site of higher input resistance among a pair of remote dendritic sites, irrespective of which of these two sites received the synaptic input. Exploration of the parameter space showed how the gradient of voltage-gated channel densities and input resistances along a dendrite could draw the action potential onset away from the stimulation site. The attraction of action potential onset toward the higher density of voltage-gated channels in the soma during stimulation of the proximal dendrite was, however, reduced after the addition of synaptic noise. Copyright © 2012 IBRO. Published by Elsevier Ltd. All rights reserved.

Integrating knowledge-based multi-criteria evaluation techniques with GIS for landfill site selection: A case study using AHP

NASA Astrophysics Data System (ADS)

Fagbohun, B. J.; Aladejana, O. O.

2016-09-01

A major challenge in most growing urban areas of developing countries, without a pre-existing land use plan is the sustainable and efficient management of solid wastes. Siting a landfill is a complicated task because of several environmental regulations. This challenge gives birth to the need to develop efficient strategies for the selection of proper waste disposal sites in accordance with all existing environmental regulations. This paper presents a knowledge-based multi-criteria decision analysis using GIS for the selection of suitable landfill site in Ado-Ekiti, Nigeria. In order to identify suitable sites for landfill, seven factors - land use/cover, geology, river, soil, slope, lineament and roads - were taken into consideration. Each factor was classified and ranked based on prior knowledge about the area and existing guidelines. Weights for each factor were determined through pair-wise comparison using Saaty's 9 point scale and AHP. The integration of factors according to their weights using weighted index overlay analysis revealed that 39.23 km2 within the area was suitable to site a landfill. The resulting suitable area was classified as high suitability covering 6.47 km2 (16.49%), moderate suitability 25.48 km2 (64.95%) and low suitability 7.28 km2 (18.56%) based on their overall weights.

Pair and triplet approximation of a spatial lattice population model with multiscale dispersal using Markov chains for estimating spatial autocorrelation.

PubMed

Hiebeler, David E; Millett, Nicholas E

2011-06-21

We investigate a spatial lattice model of a population employing dispersal to nearest and second-nearest neighbors, as well as long-distance dispersal across the landscape. The model is studied via stochastic spatial simulations, ordinary pair approximation, and triplet approximation. The latter method, which uses the probabilities of state configurations of contiguous blocks of three sites as its state variables, is demonstrated to be greatly superior to pair approximations for estimating spatial correlation information at various scales. Correlations between pairs of sites separated by arbitrary distances are estimated by constructing spatial Markov processes using the information from both approximations. These correlations demonstrate why pair approximation misses basic qualitative features of the model, such as decreasing population density as a large proportion of offspring are dropped on second-nearest neighbors, and why triplet approximation is able to include them. Analytical and numerical results show that, excluding long-distance dispersal, the initial growth rate of an invading population is maximized and the equilibrium population density is also roughly maximized when the population spreads its offspring evenly over nearest and second-nearest neighboring sites. Copyright © 2011 Elsevier Ltd. All rights reserved.

Nest-site selection, reproductive ecology and shifts within core-use areas of Black-necked Cranes at the northern limit of the Tibetan Plateau

PubMed Central

An, Bei; Shu, Meilin

2017-01-01

We investigated population dynamics, breeding pairs, breeding habitat selection, nest density, distance between neighboring nests, nest survival, reproductive success, and recruitment rate for Black-necked Cranes (BNC, Grus nigricollis) during 2013–2015 in Yanchiwan National Nature Reserve (YCW), Gansu, China. Numbers of BNC and breeding pairs remained relatively stable at around 140 individuals and 40 pairs. Recruitment rates ranged from 15.7% to 25.8%. The average nest distance was 718.66 ± 430.50 m (2013), 1064.51 ± 323.99 m (2014) and 534.99 ± 195.45 m (2015). Average nest survival rate, hatching success, and breeding success of all 29 nests were 65.56 ± 5.09%, 57.04 ± 6.12% and 32.78% ± 2.55. Water depth, water body area, and distance to land were positively related to nest survival, while disturbance level showed a negative relationship. However, nest site selection of BNC was determined by habitat type, disturbance and water depth. BNC often foraged in mudflats and freshwater marsh but seldom foraged in saline-alkali wet meadows due to food density and quantity in April, the month when BNC choose nest sites. Conservation strategies based on habitats should consider ecological factors that may not be well predicted by nest site selection. Shifts within core-use areas from satellite tracking of BNC demonstrated that maintaining populations demands that conservation areas are large enough to permit breeding BNC changes in space use. Our results are important for conservation management and provide quantitative reproductive data for this species. PMID:28168110

Nest-site selection, reproductive ecology and shifts within core-use areas of Black-necked Cranes at the northern limit of the Tibetan Plateau.

PubMed

Zhang, Lixun; An, Bei; Shu, Meilin; Yang, Xiaojun

2017-01-01

We investigated population dynamics, breeding pairs, breeding habitat selection, nest density, distance between neighboring nests, nest survival, reproductive success, and recruitment rate for Black-necked Cranes (BNC, Grus nigricollis ) during 2013-2015 in Yanchiwan National Nature Reserve (YCW), Gansu, China. Numbers of BNC and breeding pairs remained relatively stable at around 140 individuals and 40 pairs. Recruitment rates ranged from 15.7% to 25.8%. The average nest distance was 718.66 ± 430.50 m (2013), 1064.51 ± 323.99 m (2014) and 534.99 ± 195.45 m (2015). Average nest survival rate, hatching success, and breeding success of all 29 nests were 65.56 ± 5.09%, 57.04 ± 6.12% and 32.78% ± 2.55. Water depth, water body area, and distance to land were positively related to nest survival, while disturbance level showed a negative relationship. However, nest site selection of BNC was determined by habitat type, disturbance and water depth. BNC often foraged in mudflats and freshwater marsh but seldom foraged in saline-alkali wet meadows due to food density and quantity in April, the month when BNC choose nest sites. Conservation strategies based on habitats should consider ecological factors that may not be well predicted by nest site selection. Shifts within core-use areas from satellite tracking of BNC demonstrated that maintaining populations demands that conservation areas are large enough to permit breeding BNC changes in space use. Our results are important for conservation management and provide quantitative reproductive data for this species.

The effects of local bond relaxations on the electronic and photocatalysis performances of nonmetal doped 3R-MoS2 based photocatalyst: density functional theory

NASA Astrophysics Data System (ADS)

Chen, Dajin; Lu, Song; Li, Huanhuan; Li, Can; Li, Lei; Gong, Yinyan; Niu, Lengyuan; Liu, Xinjuan; Wang, Tao

2017-03-01

To investigate the effects of local bond relaxations on the electronic and photocatalysis performances of MoS2 photocatalyst, the thermodynamic, electronic and optical performances of nonmetal doped 3R-MoS2 have been calculated using density functional theory. Results shown that the positive or negative charges of impurity ions are decided by the Pauling electronegativity differences between Mo (or S) and nonmetal atoms, the H, B, Si, Cl, Br and I ions priority to occupy the interstitial site and the other ones tend to occupy the substitutional site. The localized electrons around NM ions are caused by the relaxed Mo-NM and S1-NM bonds, which can effectively affect the electronic and photocatalytic performances of specimens. The optical performances have been altered by the slightest changes of band gap and the newly formed impurity levels; the active sites have been also changed based on the different distributions of the highest occupied molecular orbital and the lowest unoccupied molecular orbital. In brief, the B, N, F, Si, P, Cl, As, Se, Te and Br ions contribute to the separation of photogenerated e-/h+ pairs and enhance the photocatalysis efficiency, but the H, C, O, and I ions will become the recombination centers of photogenerated e-/h+ pairs and should be avoided adding into 3R-MoS2.

Proximity to AGCT sequences dictates MMR-independent versus MMR-dependent mechanisms for AID-induced mutation via UNG2

PubMed Central

Thientosapol, Eddy Sanchai; Sharbeen, George; Lau, K.K. Edwin; Bosnjak, Daniel; Durack, Timothy; Stevanovski, Igor; Weninger, Wolfgang

2017-01-01

Abstract AID deaminates C to U in either strand of Ig genes, exclusively producing C:G/G:C to T:A/A:T transition mutations if U is left unrepaired. Error-prone processing by UNG2 or mismatch repair diversifies mutation, predominantly at C:G or A:T base pairs, respectively. Here, we show that transversions at C:G base pairs occur by two distinct processing pathways that are dictated by sequence context. Within and near AGCT mutation hotspots, transversion mutation at C:G was driven by UNG2 without requirement for mismatch repair. Deaminations in AGCT were refractive both to processing by UNG2 and to high-fidelity base excision repair (BER) downstream of UNG2, regardless of mismatch repair activity. We propose that AGCT sequences resist faithful BER because they bind BER-inhibitory protein(s) and/or because hemi-deaminated AGCT motifs innately form a BER-resistant DNA structure. Distal to AGCT sequences, transversions at G were largely co-dependent on UNG2 and mismatch repair. We propose that AGCT-distal transversions are produced when apyrimidinic sites are exposed in mismatch excision patches, because completion of mismatch repair would require bypass of these sites. PMID:28039326

Application of geographical information system in disposal site selection for hazardous wastes.

PubMed

Rezaeimahmoudi, Mehdi; Esmaeli, Abdolreza; Gharegozlu, Alireza; Shabanian, Hassan; Rokni, Ladan

2014-01-01

The aim of this study was to provide a scientific method based on Geographical Information System (GIS) regarding all sustainable development measures to locate a proper landfill for disposal of hazardous wastes, especially industrial (radioactive) wastes. Seven effective factors for determining hazardous waste landfill were applied in Qom Province, central Iran. These criteria included water, slope, population centers, roads, fault, protected areas and geology. The Analysis Hierarchical Process (AHP) model based on pair comparison was used. First, the weight of each factor was determined by experts; afterwards each layer of maps entered to ARC GIS and with special weight multiplied together, finally the best suitable site was introduced. The most suitable sites for burial were in northwest and west of Qom Province and eventually five zones were introduced as the sample sites. GIs and AHP model is introduced as the technical, useful and accelerator tool for disposal site selection. Furthermore it is determined that geological factor is the most effective layer for site selection. It is suggested that geological conditions should be considered primarily then other factors are taken into consideration.

Single-Molecule Mechanical (Un)folding of RNA Hairpins: Effects of Single A-U to A∙C Pair Substitutions and Single Proton Binding and Implications for mRNA Structure-Induced -1 Ribosomal Frameshifting.

PubMed

Yang, Lixia; Zhong, Zhensheng; Tong, Cailing; Jia, Huan; Liu, Yiran; Chen, Gang

2018-06-08

A wobble A∙C pair can be protonated at near physiological pH to form a more stable wobble A+∙C pair. Here, we constructed an RNA hairpin (rHP) and three mutants with one A-U base pair substituted with an A∙C mismatch on the top (near the loop, U22C), middle (U25C) and bottom (U29C) positions of the stem, respectively. Our results on single-molecule mechanical (un)folding using optical tweezers reveal the destabilization effect of A-U to A∙C pair substitution, and protonation-dependent enhancement of mechanical stability facilitated through an increased folding rate, or decreased unfolding rate, or both. Our data show that protonation may occur rapidly upon the formation of apparent mechanical folding transition state. Furthermore, we measured the bulk -1 ribosomal frameshifting efficiencies of the hairpins by a cell-free translation assay. For the mRNA hairpins studied, -1 frameshifting efficiency correlates with mechanical unfolding force at equilibrium and folding rate at around 15 pN. U29C has a frameshifting efficiency similar to that of rHP (~2%). Accordingly, the bottom 2-4 base pairs of U29C may not form under a stretching force at pH 7.3, which is consistent with the fact that the bottom base pairs of the hairpins may be disrupted by ribosome at the slippery site. U22C and U25C have a similar frameshifting efficiency (~1%), indicating that both unfolding and folding rates of an mRNA hairpin in a crowded environment may affect frameshifting. Our data indicate that mechanical (un)folding of RNA hairpins may mimic how mRNAs unfold and fold in the presence of translating ribosomes.

Modeling the evolution of regulatory elements by simultaneous detection and alignment with phylogenetic pair HMMs.

PubMed

Majoros, William H; Ohler, Uwe

2010-12-16

The computational detection of regulatory elements in DNA is a difficult but important problem impacting our progress in understanding the complex nature of eukaryotic gene regulation. Attempts to utilize cross-species conservation for this task have been hampered both by evolutionary changes of functional sites and poor performance of general-purpose alignment programs when applied to non-coding sequence. We describe a new and flexible framework for modeling binding site evolution in multiple related genomes, based on phylogenetic pair hidden Markov models which explicitly model the gain and loss of binding sites along a phylogeny. We demonstrate the value of this framework for both the alignment of regulatory regions and the inference of precise binding-site locations within those regions. As the underlying formalism is a stochastic, generative model, it can also be used to simulate the evolution of regulatory elements. Our implementation is scalable in terms of numbers of species and sequence lengths and can produce alignments and binding-site predictions with accuracy rivaling or exceeding current systems that specialize in only alignment or only binding-site prediction. We demonstrate the validity and power of various model components on extensive simulations of realistic sequence data and apply a specific model to study Drosophila enhancers in as many as ten related genomes and in the presence of gain and loss of binding sites. Different models and modeling assumptions can be easily specified, thus providing an invaluable tool for the exploration of biological hypotheses that can drive improvements in our understanding of the mechanisms and evolution of gene regulation.

A Bridging Water Anchors the Tethered 5-(3-Aminopropyl)-2′-deoxyuridine Amine in the DNA Major Groove Proximate to the N+2 C·G Base Pair: Implications for Formation of Interstrand 5′-GNC-3′ Cross-Links by Nitrogen Mustards‡

PubMed Central

Wang, Feng; Li, Feng; Ganguly, Manjori; Marky, Luis A.; Gold, Barry; Egli, Martin; Stone, Michael P.

2009-01-01

Site-specific insertion of 5-(3-aminopropyl)-2′-deoxyuridine (Z3dU) and 7-deaza-dG into the Dickerson-Drew dodecamers 5′-d(C1G2C3G4A5A6T7T8C9Z10C11G12)-3′ · 5′-d(C13G14C15G16A17A18T19T20-C21Z22C23G24)-3′ (named DDDZ10) and 5′-d(C1G2C3G4A5A6T7X8C9Z10C11G12)-3′ · 5′-d(C13G14C15G16A17A18-T19X20C21Z22C23G24)-3′ (named DDD2+Z10)(X = Z3dU; Z = 7-deaza-dG) suggests a mechanism underlying the formation of interstrand N+2 DNA cross-links by nitrogen mustards, e.g., melphalan and mechlorethamine. Analysis of the DDD2+Z10 duplex reveals that the tethered cations at base pairs A5 · X20 and X8 · A17 extend within the major groove in the 3′-direction, toward conserved Mg2+ binding sites located adjacent to N+2 base pairs C3 · Z22 and Z10 · C15. Bridging waters located between the tethered amines and either Z10 or Z22 O6 stabilize the tethered cations and allow interactions with the N + 2 base pairs without DNA bending. Incorporation of 7-deaza-dG into the DDD2+Z10 duplex weakens but does not eliminate electrostatic interactions between tethered amines and Z10 O6 and Z22 O6. The results suggest a mechanism by which tethered N7-dG aziridinium ions, the active species involved in formation of interstrand 5′-GNC-3′ cross-links by nitrogen mustards, modify the electrostatics of the major groove and position the aziridinium ions proximate to the major groove edge of the N+2 C · G base pair, facilitating interstrand cross-linking. PMID:18549246

Electronic and optical properties of Cu2XSnS4 (X = Be, Mg, Ca, Mn, Fe, and Ni) and the impact of native defect pairs

NASA Astrophysics Data System (ADS)

Chen, Rongzhen; Persson, Clas

2017-05-01

Reducing or controlling cation disorder in Cu2ZnSnS4 is a major challenge, mainly due to low formation energies of the anti-site pair ( CuZn - + ZnCu +) and the compensated Cu vacancy ( VCu - + ZnCu +). We study the electronic and optical properties of Cu2XSnS4 (CXTS, with X = Be, Mg, Ca, Mn, Fe, and Ni) and the impact of defect pairs, by employing the first-principles method within the density functional theory. The calculations indicate that these compounds can be grown in either the kesterite or stannite tetragonal phase, except Cu2CaSnS4 which seems to be unstable also in its trigonal phase. In the tetragonal phase, all six compounds have rather similar electronic band structures, suitable band-gap energies Eg for photovoltaic applications, as well as good absorption coefficients α(ω). However, the formation of the defect pairs ( C u X + X Cu) and ( V Cu + X Cu) is an issue for these compounds, especially considering the anti-site pair which has formation energy in the order of ˜0.3 eV. The ( C u X + X Cu) pair narrows the energy gap by typically ΔEg ≈ 0.1-0.3 eV, but for Cu2NiSnS4, the complex yields localized in-gap states. Due to the low formation energy of ( C u X + X Cu), we conclude that it is difficult to avoid disordering from the high concentration of anti-site pairs. The defect concentration in Cu2BeSnS4 is however expected to be significantly lower (as much as ˜104 times at typical device operating temperature) compared to the other compounds, which is partly explained by larger relaxation effects in Cu2BeSnS4 as the two anti-site atoms have different sizes. The disadvantage is that the stronger relaxation has a stronger impact on the band-gap narrowing. Therefore, instead of trying to reduce the anti-site pairs, we suggest that one shall try to compensate ( C u X + X Cu) with ( V Cu + X Cu) or other defects in order to stabilize the gap energy.

Mechanism for verification of mismatched and homoduplex DNAs by nucleotides-bound MutS analyzed by molecular dynamics simulations.

PubMed

Ishida, Hisashi; Matsumoto, Atsushi

2016-09-01

In order to understand how MutS recognizes mismatched DNA and induces the reaction of DNA repair using ATP, the dynamics of the complexes of MutS (bound to the ADP and ATP nucleotides, or not) and DNA (with mismatched and matched base-pairs) were investigated using molecular dynamics simulations. As for DNA, the structure of the base-pairs of the homoduplex DNA which interacted with the DNA recognition site of MutS was intermittently disturbed, indicating that the homoduplex DNA was unstable. As for MutS, the disordered loops in the ATPase domains, which are considered to be necessary for the induction of DNA repair, were close to (away from) the nucleotide-binding sites in the ATPase domains when the nucleotides were (not) bound to MutS. This indicates that the ATPase domains changed their structural stability upon ATP binding using the disordered loop. Conformational analysis by principal component analysis showed that the nucleotide binding changed modes which have structurally solid ATPase domains and the large bending motion of the DNA from higher to lower frequencies. In the MutS-mismatched DNA complex bound to two nucleotides, the bending motion of the DNA at low frequency modes may play a role in triggering the formation of the sliding clamp for the following DNA-repair reaction step. Moreover, MM-PBSA/GBSA showed that the MutS-homoduplex DNA complex bound to two nucleotides was unstable because of the unfavorable interactions between MutS and DNA. This would trigger the ATP hydrolysis or separation of MutS and DNA to continue searching for mismatch base-pairs. Proteins 2016; 84:1287-1303. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Mate fidelity and breeding site tenacity in a monogamous sandpiper, the black turnstone

USGS Publications Warehouse

Handel, Colleen M.; Gill, Robert E.

2000-01-01

We examined the relationship between mate fidelity and breeding site tenacity during a 5-year study of the black turnstone, Arenaria melanocephala, a socially monogamous sandpiper breeding in subarctic Alaska. We tested the predictions of several hypotheses regarding the incidence of divorce and the benefits of fidelity to mate and breeding site. Interannual return rates to the breeding grounds (88% for males, 79% for females) were among the highest yet recorded for any scolopacid sandpiper, and 88% of returning birds nested on their previous year's territory. The annual divorce rate was only 11%, and mate fidelity was significantly linked to fidelity to territory but independent of sex and year. Males arrived in spring significantly earlier than their mates and interannual fidelity was influenced by the relative timing of arrival of pair members. Reunited pairs had significantly higher fledging success than new pairs formed after death or divorce. The incidence of divorce was unrelated to reproductive success the previous year, although birds nested significantly further away after failure than after a successful nesting attempt. Sightings of marked individuals suggested that members of pairs do not winter together, and breeding site tenacity provides a mechanism through which pair members can reunite. We reject the 'incompatibility' hypothesis for divorce in turnstones, and our data contradict predictions of the 'better option' hypothesis. Alternatively, we propose the 'bet-hedging' hypothesis to explain the occurrence of divorce, which transpires when an individual pairs with a new mate to avoid the cost of waiting for a previous mate to return. Such costs can include remaining unmated, if the former mate has died, or experiencing lower reproductive success because of delayed breeding.

Intracistronic complementation in the simian virus 40 A gene.

PubMed Central

Tornow, J; Cole, C N

1983-01-01

A set of eight simian virus 40 mutants was constructed with lesions in the A gene, which encodes the large tumor (T) antigen. These mutants have small deletions (3-20 base pairs) at either 0.497, 0.288, or 0.243 map units. Mutants having both in-phase and frameshift mutations at each site were isolated. Neither plaque formation nor replication of the mutant DNAs could be detected after transfection of monkey kidney cells. Another nonviable mutant, dlA2459, had a 14-base-pair deletion at 0.193 map unit and was positive for viral DNA replication. Each of the eight mutants were tested for ability to form plaques after cotransfection with dlA2459 DNA. The four mutants that had in-phase deletions were able to complement dlA2459. The other four, which had frameshift deletions, did not. No plaques were formed after cotransfection of cells with any other pair of group A mutants. This suggests that the defect in dlA2459 defines a distinct functional domain of simian virus 40 T antigen. Images PMID:6312452

Estimating Genomic Distance from DNA Sequence Location in Cell Nuclei by a Random Walk Model

NASA Astrophysics Data System (ADS)

van den Engh, Ger; Sachs, Rainer; Trask, Barbara J.

1992-09-01

The folding of chromatin in interphase cell nuclei was studied by fluorescent in situ hybridization with pairs of unique DNA sequence probes. The sites of DNA sequences separated by 100 to 2000 kilobase pairs (kbp) are distributed in interphase chromatin according to a random walk model. This model provides the basis for calculating the spacing of sequences along the linear DNA molecule from interphase distance measurements. An interphase mapping strategy based on this model was tested with 13 probes from a 4-megabase pair (Mbp) region of chromosome 4 containing the Huntington disease locus. The results confirmed the locations of the probes and showed that the remaining gap in the published maps of this region is negligible in size. Interphase distance measurements should facilitate construction of chromosome maps with an average marker density of one per 100 kbp, approximately ten times greater than that achieved by hybridization to metaphase chromosomes.

Genome-wide identification and characterization of Notch transcription complex-binding sequence paired sites in leukemia cells

PubMed Central

Severson, Eric; Arnett, Kelly L.; Wang, Hongfang; Zang, Chongzhi; Taing, Len; Liu, Hudan; Pear, Warren S.; Liu, X. Shirley; Blacklow, Stephen C.; Aster, Jon C.

2018-01-01

Notch transcription complexes (NTCs) drive target gene expression by binding to two distinct types of genomic response elements, NTC monomer-binding sites and sequence-paired sites (SPSs) that bind NTC dimers. SPSs are conserved and are linked to the Notch-responsiveness of a few genes, but their overall contribution to Notch-dependent gene regulation is unknown. To address this issue, we determined the DNA sequence requirements for NTC dimerization using a fluorescence resonance energy transfer (FRET) assay, and applied insights from these in vitro studies to Notch-“addicted” leukemia cells. We find that SPSs contribute to the regulation of approximately a third of direct Notch target genes. While originally described in promoters, SPSs are present mainly in long-range enhancers, including an enhancer containing a newly described SPS that regulates HES5. Our work provides a general method for identifying sequence-paired sites in genome-wide data sets and highlights the widespread role of NTC dimerization in Notch-transformed leukemia cells. PMID:28465412

Quantitative Metabolome Analysis Based on Chromatographic Peak Reconstruction in Chemical Isotope Labeling Liquid Chromatography Mass Spectrometry.

PubMed

Huan, Tao; Li, Liang

2015-07-21

Generating precise and accurate quantitative information on metabolomic changes in comparative samples is important for metabolomics research where technical variations in the metabolomic data should be minimized in order to reveal biological changes. We report a method and software program, IsoMS-Quant, for extracting quantitative information from a metabolomic data set generated by chemical isotope labeling (CIL) liquid chromatography mass spectrometry (LC-MS). Unlike previous work of relying on mass spectral peak ratio of the highest intensity peak pair to measure relative quantity difference of a differentially labeled metabolite, this new program reconstructs the chromatographic peaks of the light- and heavy-labeled metabolite pair and then calculates the ratio of their peak areas to represent the relative concentration difference in two comparative samples. Using chromatographic peaks to perform relative quantification is shown to be more precise and accurate. IsoMS-Quant is integrated with IsoMS for picking peak pairs and Zero-fill for retrieving missing peak pairs in the initial peak pairs table generated by IsoMS to form a complete tool for processing CIL LC-MS data. This program can be freely downloaded from the www.MyCompoundID.org web site for noncommercial use.

Prediction of citrullination sites by incorporating k-spaced amino acid pairs into Chou's general pseudo amino acid composition.

PubMed

Ju, Zhe; Wang, Shi-Yun

2018-04-22

As one of the most important and common protein post-translational modifications, citrullination plays a key role in regulating various biological processes and is associated with several human diseases. The accurate identification of citrullination sites is crucial for elucidating the underlying molecular mechanisms of citrullination and designing drugs for related human diseases. In this study, a novel bioinformatics tool named CKSAAP_CitrSite is developed for the prediction of citrullination sites. With the assistance of support vector machine algorithm, the highlight of CKSAAP_CitrSite is to adopt the composition of k-spaced amino acid pairs surrounding a query site as input. As illustrated by 10-fold cross-validation, CKSAAP_CitrSite achieves a satisfactory performance with a Sensitivity of 77.59%, a Specificity of 95.26%, an Accuracy of 89.37% and a Matthew's correlation coefficient of 0.7566, which is much better than those of the existing prediction method. Feature analysis shows that the N-terminal space containing pairs may play an important role in the prediction of citrullination sites, and the arginines close to N-terminus tend to be citrullinated. The conclusions derived from this study could offer useful information for elucidating the molecular mechanisms of citrullination and related experimental validations. A user-friendly web-server for CKSAAP_CitrSite is available at 123.206.31.171/CKSAAP_CitrSite/. Copyright © 2017. Published by Elsevier B.V.

Working the kinks out of nucleosomal DNA

PubMed Central

Olson, Wilma K.; Zhurkin, Victor B.

2011-01-01

Condensation of DNA in the nucleosome takes advantage of its double-helical architecture. The DNA deforms at sites where the base pairs face the histone octamer. The largest so-called kink-and-slide deformations occur in the vicinity of arginines that penetrate the minor groove. Nucleosome structures formed from the 601 positioning sequence differ subtly from those incorporating an AT-rich human α-satellite DNA. Restraints imposed by the histone arginines on the displacement of base pairs can modulate the sequence-dependent deformability of DNA and potentially contribute to the unique features of the different nucleosomes. Steric barriers mimicking constraints found in the nucleosome induce the simulated large-scale rearrangement of canonical B-DNA to kink-and-slide states. The pathway to these states shows non-harmonic behavior consistent with bending profiles inferred from AFM measurements. PMID:21482100

Correlation of RNA secondary structure and attenuation of Sabin vaccine strains of poliovirus in tissue culture.

PubMed

Macadam, A J; Ferguson, G; Burlison, J; Stone, D; Skuce, R; Almond, J W; Minor, P D

1992-08-01

Part of the 5' noncoding regions of all three Sabin vaccine strains of poliovirus contains determinants of attenuation that are shown here to influence the ability of these strains to grow at elevated temperatures in BGM cells. The predicted RNA secondary structure of this region (nt 464-542 in P3/Sabin) suggests that both phenotypes are due to perturbation of base-paired stems. Ts phenotypes of site-directed mutants with defined changes in this region correlated well with predicted secondary structure stabilities. Reversal of base-pair orientation had little effect whereas stem disruption led to marked increases in temperature sensitivity. Phenotypic revertants of such viruses displayed mutations on either side of the stem. Mutations destabilizing stems led to intermediate phenotypes. These results provided evidence for the biological significance of the predicted RNA secondary structure.

Sequence-dependent effects in drug-DNA interaction: the crystal structure of Hoechst 33258 bound to the d(CGCAAATTTGCG)2 duplex.

PubMed Central

Spink, N; Brown, D G; Skelly, J V; Neidle, S

1994-01-01

The bis-benzimidazole drug Hoechst 33258 has been co-crystallized with the dodecanucleotide sequence d(CGCAAATTTGCG)2. The structure has been solved by molecular replacement and refined to an R factor of 18.5% for 2125 reflections collected on a Xentronics area detector. The drug is bound in the minor groove, at the five base-pair site 5'-ATTTG and is in a unique orientation. This is displaced by one base pair in the 5' direction compared to previously-determined structures of this drug with the sequence d(CGCGAATTCGCG)2. Reasons for this difference in behaviour are discussed in terms of several sequence-dependent structural features of the DNA, with particular reference to differences in propeller twist and minor-groove width. Images PMID:7515488

Precise assignment of the heavy-strand promoter of mouse mitochondrial DNA: cognate start sites are not required for transcriptional initiation.

PubMed Central

Chang, D D; Clayton, D A

1986-01-01

Transcription of the heavy strand of mouse mitochondrial DNA starts from two closely spaced, distinct sites located in the displacement loop region of the genome. We report here an analysis of regulatory sequences required for faithful transcription from these two sites. Data obtained from in vitro assays demonstrated that a 51-base-pair region, encompassing nucleotides -40 to +11 of the downstream start site, contains sufficient information for accurate transcription from both start sites. Deletion of the 3' flanking sequences, including one or both start sites to -17, resulted in the initiation of transcription by the mitochondrial RNA polymerase from alternative sites within vector DNA sequences. This feature places the mouse heavy-strand promoter uniquely among other known mitochondrial promoters, all of which absolutely require cognate start sites for transcription. Comparison of the heavy-strand promoter with those of other vertebrate mitochondrial DNAs revealed a remarkably high rate of sequence divergence among species. Images PMID:3785226

Coupled bipolarons and optical phonons as a model for high-Tc superconductors

NASA Technical Reports Server (NTRS)

Kasperczyk, J.

1991-01-01

The coherence length of the new high-temperature superconductors reaches a small value which is comparable to the dimensions of the unit cell of the compound. This means that a pair consists of two holes occupying the same site or two adjacent sites. Such a situation is described by a model of the local-pairs (bipolarons). The origin of local-pairs may come not only from strong enough electron or hole-phonon interaction but also from other interactions. Independent of the specific nature of such local-pairs, they can undergo a Bose-like condensation to the superconducting state at a critical temperature which is usually much lower than the temperature of the pair formation. An interplay of ferroelectric and superconducting properties is considered within the model of hole-like local-pairs interacting with optical phonons. Therefore, researchers extend the usual local-pair Hamiltonian by including a direct interaction between the local-pairs and the optical phonons. These optical phonons are known to play an important role in the ferroelectric transition and they transform into an additional pseudo-acoustic branch at the ferroelectric critical temperature. (This is associated with nonzero electric polarization due to the existence of two separate lattices composed of negative and positive ions, respectively.)

“Gate-keeper” Residues and Active-Site Rearrangements in DNA Polymerase μ Help Discriminate Non-cognate Nucleotides

PubMed Central

Li, Yunlang; Schlick, Tamar

2013-01-01

Incorporating the cognate instead of non-cognate substrates is crucial for DNA polymerase function. Here we analyze molecular dynamics simulations of DNA polymerase μ (pol μ) bound to different non-cognate incoming nucleotides including A:dCTP, A:dGTP, A(syn):dGTP, A:dATP, A(syn):dATP, T:dCTP, and T:dGTP to study the structure-function relationships involved with aberrant base pairs in the conformational pathway; while a pol μ complex with the A:dTTP base pair is available, no solved non-cognate structures are available. We observe distinct differences of the non-cognate systems compared to the cognate system. Specifically, the motions of active-site residue His329 and Asp330 distort the active site, and Trp436, Gln440, Glu443 and Arg444 tend to tighten the nucleotide-binding pocket when non-cognate nucleotides are bound; the latter effect may further lead to an altered electrostatic potential within the active site. That most of these “gate-keeper” residues are located farther apart from the upstream primer in pol μ, compared to other X family members, also suggests an interesting relation to pol μ's ability to incorporate nucleotides when the upstream primer is not paired. By examining the correlated motions within pol μ complexes, we also observe different patterns of correlations between non-cognate systems and the cognate system, especially decreased interactions between the incoming nucleotides and the nucleotide-binding pocket. Altered correlated motions in non-cognate systems agree with our recently proposed hybrid conformational selection/induced-fit models. Taken together, our studies propose the following order for difficulty of non-cognate system insertions by pol μ: T:dGTP

Pathway Ranking for In-place Sediment Management (CU1209). Site 2 Report - Pearl Harbor

DTIC Science & Technology

2006-04-01

type resistance cell. The probe is configured with two pairs of stainless steel electrodes, the outer pair through which a known current is imposed...the “bioinhibited” (no oxygen control) deployment at BPA . Vertical axis is dissolved oxygen concentration, and horizontal axis is sample record at 6...99 Table 5-7. BFSD results from site BPA . Numbers in the Flux Rate Confidence column indicate the

Using Mahalanobis Distance Scores for Matched Pairing of Schools in a Randomized Controlled Trial Study of Leadership and Assistance for Science Education Reform (LASER)

ERIC Educational Resources Information Center

Zoblotsky, Todd; Ransford-Kaldon, Carolyn; Morrison, Donald M.

2011-01-01

The present paper describes the recruitment and site selection process that has been underway since January 2011, with particular emphasis on the use of Mahalanobis distance score to determine matched pairs of sites prior to randomization to treatment and control groups. Through a systematic winnowing process, the authors found that they could…

DIMA 3.0: Domain Interaction Map.

PubMed

Luo, Qibin; Pagel, Philipp; Vilne, Baiba; Frishman, Dmitrij

2011-01-01

Domain Interaction MAp (DIMA, available at http://webclu.bio.wzw.tum.de/dima) is a database of predicted and known interactions between protein domains. It integrates 5807 structurally known interactions imported from the iPfam and 3did databases and 46,900 domain interactions predicted by four computational methods: domain phylogenetic profiling, domain pair exclusion algorithm correlated mutations and domain interaction prediction in a discriminative way. Additionally predictions are filtered to exclude those domain pairs that are reported as non-interacting by the Negatome database. The DIMA Web site allows to calculate domain interaction networks either for a domain of interest or for entire organisms, and to explore them interactively using the Flash-based Cytoscape Web software.

Somatic Incompatibility in Diakaryotic-monokaryotic and Dikaryotic Pairings of Echinodontium tinctorium

Treesearch

A. Dan Wilson

1991-01-01

Somatic incompatibility in dikaryotic-monokaryotic (di-mon) and dikaryotic pairings of Echinodontium tinctorium was investigated in vitro on 4.5% malt agar. Antagonistic reactions of varying intensity occurred in all pairings between 12 allopatric dikaryons from Idaho and Arizona, between 14 sib-composed dikaryons from two Idaho sites, and in over...

Comparing the Scoring of Human Decomposition from Digital Images to Scoring Using On-site Observations.

PubMed

Dabbs, Gretchen R; Bytheway, Joan A; Connor, Melissa

2017-09-01

When in forensic casework or empirical research in-person assessment of human decomposition is not possible, the sensible substitution is color photographic images. To date, no research has confirmed the utility of color photographic images as a proxy for in situ observation of the level of decomposition. Sixteen observers scored photographs of 13 human cadavers in varying decomposition stages (PMI 2-186 days) using the Total Body Score system (total n = 929 observations). The on-site TBS was compared with recorded observations from digital color images using a paired samples t-test. The average difference between on-site and photographic observations was -0.20 (t = -1.679, df = 928, p = 0.094). Individually, only two observers, both students with <1 year of experience, demonstrated TBS statistically significantly different than the on-site value, suggesting that with experience, observations of human decomposition based on digital images can be substituted for assessments based on observation of the corpse in situ, when necessary. © 2017 American Academy of Forensic Sciences.

Fine-scale genetic structure and social organization in female white-tailed deer.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Comer, Christopher E.; Kilgo, John C.; D'Angelo, Gino J.

Abstract: Social behavior of white-tailed deer (Odocoileus virginianus) can have important management implications. The formation of matrilineal social groups among female deer has been documented and management strategies have been proposed based on this well-developed social structure. Using radiocollared (n = 17) and hunter or vehicle-killed (n = 21) does, we examined spatial and genetic structure in white-tailed deer on a 7,000-ha portion of the Savannah River Site in the upper Coastal Plain of South Carolina, USA. We used 14 microsatellite DNA loci to calculate pairwise relatedness among individual deer and to assign doe pairs to putative relationship categories. Linearmore » distance and genetic relatedness were weakly correlated (r = –0.08, P = 0.058). Relationship categories differed in mean spatial distance, but only 60% of first-degree-related doe pairs (full sibling or mother–offspring pairs) and 38% of second-degree-related doe pairs (half sibling, grandmother–granddaughter pairs) were members of the same social group based on spatial association. Heavy hunting pressure in this population has created a young age structure among does, where the average age is <2.5 years, and <4% of does are >4.5 years old. This—combined with potentially elevated dispersal among young does—could limit the formation of persistent, cohesive social groups. Our results question the universal applicability of recently proposed models of spatial and genetic structuring in white-tailed deer, particularly in areas with differing harvest histories.« less

A novel, non-functional, COL1A1 polymorphism is not associated with lumbar disk disease in young male Greek subjects unlike that of the Sp1 site

PubMed Central

Bei, Thalia; Tilkeridis, Constantinos; Garantziotis, Stavros; Boikos, Sosipatros A.; Kazakos, Konstantinos; Simopoulos, Constantinos; Stratakis, Constantine A.

2011-01-01

OBJECTIVE We recently reported the association of the Sp1 site polymorphism of the COL1A1 gene with lumbar disk disease (LDD). In the present study we searched for a different polymorphism of the COL1A1 gene (which is usually not in linkage disequilibrium with the Sp1 site) in subjects with LDD. DESIGN Blood was collected from 24 Greek army recruits, aged 29±7.6 years, with LDD, and 66 healthy men, aged 26±4.38 years, matched for body mass index (BMI) and age, with normal BMD and with no history of trauma or fractures, who served as controls. DNA was extracted and the COL1A1 gene was sequenced. Of the control subjects, 12 were army recruits and 54 were selected from the general population. RESULTS The four base-pair insertion polymorphism in the COL1A1 gene analyzed by polymerase chain reaction amplification of DNA produces two different fragments (alleles A1 and A2): 14 patients (58.3%) were homozygous for A2A2, versus 35 controls (53%), while 3 patients (12.5%) were A1A1, and 8 of the control subjects (12%) had this genotype. There were no statistically significant differences in the presence of the two alleles of this polymorphism between patients with LDD and control subjects. CONCLUSIONS A four base-pair insertion polymorphism of the COL1A1 gene is not associated with the presence of LDD in young males, unlike the Sp1 site polymorphism of the same gene. These data reinforce the association between LDD and the functional polymorphisms of the Sp1 site by showing that other polymorphic sites of the of the COL1A1 gene in the same population of patients are not linked to the disease. PMID:18694864

Insights into finding a mismatch through the structure of a mispaired DNA bound by a rhodium intercalator

PubMed Central

Pierre, Valérie C.; Kaiser, Jens T.; Barton, Jacqueline K.

2007-01-01

We report the 1.1-Å resolution crystal structure of a bulky rhodium complex bound to two different DNA sites, mismatched and matched in the oligonucleotide 5′-(dCGGAAATTCCCG)2-3′. At the AC mismatch site, the structure reveals ligand insertion from the minor groove with ejection of both mismatched bases and elucidates how destabilized mispairs in DNA may be recognized. This unique binding mode contrasts with major groove intercalation, observed at a matched site, where doubling of the base pair rise accommodates stacking of the intercalator. Mass spectral analysis reveals different photocleavage products associated with the two binding modes in the crystal, with only products characteristic of mismatch binding in solution. This structure, illustrating two clearly distinct binding modes for a molecule with DNA, provides a rationale for the interrogation and detection of mismatches. PMID:17194756

Extensive dispersal of Roanoke logperch (Percina rex) inferred from genetic marker data

USGS Publications Warehouse

Roberts, James H.; Angermeier, Paul; Hallerman, Eric M.

2016-01-01

The dispersal ecology of most stream fishes is poorly characterised, complicating conservation efforts for these species. We used microsatellite DNA marker data to characterise dispersal patterns and effective population size (Ne) for a population of Roanoke logperchPercina rex, an endangered darter (Percidae). Juveniles and candidate parents were sampled for 2 years at sites throughout the Roanoke River watershed. Dispersal was inferred via genetic assignment tests (ATs), pedigree reconstruction (PR) and estimation of lifetime dispersal distance under a genetic isolation-by-distance model. Estimates of Ne varied from 105 to 1218 individuals, depending on the estimation method. Based on PR, polygamy was frequent in parents of both sexes, with individuals spawning with an average of 2.4 mates. The sample contained 61 half-sibling pairs, but only one parent–offspring pair and no full-sib pairs, which limited our ability to discriminate natal dispersal of juveniles from breeding dispersal of their parents between spawning events. Nonetheless, all methods indicated extensive dispersal. The AT indicated unrestricted dispersal among sites ≤15 km apart, while siblings inferred by the PR were captured an average of 14 km and up to 55 km apart. Model-based estimates of median lifetime dispersal distance (6–24 km, depending on assumptions) bracketed AT and PR estimates, indicating that widely dispersed individuals do, on average, contribute to gene flow. Extensive dispersal of P. rex suggests that darters and other small benthic stream fishes may be unexpectedly mobile. Monitoring and management activities for such populations should encompass entire watersheds to fully capture population dynamics.

AT base pair anions versus (9-methyl-A)(1-methyl-T) base pair anions.

PubMed

Radisic, Dunja; Bowen, Kit H; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej

2005-05-04

The anionic base pairs of adenine and thymine, (AT)(-), and 9-methyladenine and 1-methylthymine, (MAMT)(-), have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)(-) found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)(-) was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)(-) and a resulting (MAMT)(-) configuration that was either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)(-) occurred at a completely different electron binding energy than had (AT)(-). Moreover, the VDE value of (MAMT)(-) was in agreement with that predicted by theory. The configuration of (MAMT)(-) and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced DNA alterations, BFPT in the WC/HS configurations of (AT)(-) is not feasible.

Proflavine sensitivity of RNA processing in isolated nuclei.

PubMed Central

Yannarell, A; Niemann, M; Schumm, D E; Webb, T E

1977-01-01

The intercalating agent proflavine inhibits the processing and subsequent release of preformed messenger RNA and ribosomal RNA from isolated liver nuclei to surrogate cytoplasm. The direct effect of proflavine on these processes, as monitored in a reconstituted cell-free system, supports the theory that base-paired segments (i.e. hairpin loops) in the precursor RNA's are involved as recognition sites in nuclear RNA processing. PMID:866181

Defect chemistry and characterization of Hg sub 1x Cd sub x Te

NASA Technical Reports Server (NTRS)

Vydyanath, H. R.

1982-01-01

Single crystal samples of undoped and doped Hg sub 1-x Cd sub x Te were annealed at varying temperatures and partial pressures of Hg. Hall effect and mobility measurements were carried out on these samples after quenching to room temperature. Based on the variation of the carrier concentration and the carrier mobility as a function of the partial pressure of Hg temperature, and dopant concentration, defect models were established for the doped and the undoped crystals. These models indicate that the native acceptor defects in both Hg0.8Cd0.2Te and Hg0.6Cd0.4Te doubly ionized and the native donor defects are negligible in concentration, implying that p to n conversion in these alloys occurs due only to residual donors. Incorporation mechanism of copper, indium, iodine, and phosphorus were investigated. A large concentration of indium is found to be paired with the native acceptor defects. Results on crystals doped with phosphorus indicate that phosphorus behaves amphoterically, acting as a donor on Hg lattice sites and as an acceptor intersitially on Te lattice sites. A majority of the phosphorus is found to be present as neutral species formed from the pairing reaction between phosphorus on Hg lattice sites and phosphorus in interstitial sites. Equilibrium constants for the intrinsic excitation reaction, as well as for the incorporation of the different dopants and the native acceptor defects were established.

DNA and Protein Requirements for Substrate Conformational Changes Necessary for Human Flap Endonuclease-1-catalyzed Reaction*

PubMed Central

Algasaier, Sana I.; Exell, Jack C.; Bennet, Ian A.; Thompson, Mark J.; Gotham, Victoria J. B.; Shaw, Steven J.; Craggs, Timothy D.; Finger, L. David; Grasby, Jane A.

2016-01-01

Human flap endonuclease-1 (hFEN1) catalyzes the essential removal of single-stranded flaps arising at DNA junctions during replication and repair processes. hFEN1 biological function must be precisely controlled, and consequently, the protein relies on a combination of protein and substrate conformational changes as a prerequisite for reaction. These include substrate bending at the duplex-duplex junction and transfer of unpaired reacting duplex end into the active site. When present, 5′-flaps are thought to thread under the helical cap, limiting reaction to flaps with free 5′-termini in vivo. Here we monitored DNA bending by FRET and DNA unpairing using 2-aminopurine exciton pair CD to determine the DNA and protein requirements for these substrate conformational changes. Binding of DNA to hFEN1 in a bent conformation occurred independently of 5′-flap accommodation and did not require active site metal ions or the presence of conserved active site residues. More stringent requirements exist for transfer of the substrate to the active site. Placement of the scissile phosphate diester in the active site required the presence of divalent metal ions, a free 5′-flap (if present), a Watson-Crick base pair at the terminus of the reacting duplex, and the intact secondary structure of the enzyme helical cap. Optimal positioning of the scissile phosphate additionally required active site conserved residues Tyr40, Asp181, and Arg100 and a reacting duplex 5′-phosphate. These studies suggest a FEN1 reaction mechanism where junctions are bound and 5′-flaps are threaded (when present), and finally the substrate is transferred onto active site metals initiating cleavage. PMID:26884332

DNA cleavage site selection by Type III restriction enzymes provides evidence for head-on protein collisions following 1D bidirectional motion

PubMed Central

Schwarz, Friedrich W.; van Aelst, Kara; Tóth, Júlia; Seidel, Ralf; Szczelkun, Mark D.

2011-01-01

DNA cleavage by the Type III Restriction–Modification enzymes requires communication in 1D between two distant indirectly-repeated recognitions sites, yet results in non-specific dsDNA cleavage close to only one of the two sites. To test a recently proposed ATP-triggered DNA sliding model, we addressed why one site is selected over another during cleavage. We examined the relative cleavage of a pair of identical sites on DNA substrates with different distances to a free or protein blocked end, and on a DNA substrate using different relative concentrations of protein. Under these conditions a bias can be induced in the cleavage of one site over the other. Monte-Carlo simulations based on the sliding model reproduce the experimentally observed behaviour. This suggests that cleavage site selection simply reflects the dynamics of the preceding stochastic enzyme events that are consistent with bidirectional motion in 1D and DNA cleavage following head-on protein collision. PMID:21724613

Biphasic responses in multi-site phosphorylation systems.

PubMed

Suwanmajo, Thapanar; Krishnan, J

2013-12-06

Multi-site phosphorylation systems are repeatedly encountered in cellular biology and multi-site modification is a basic building block of post-translational modification. In this paper, we demonstrate how distributive multi-site modification mechanisms by a single kinase/phosphatase pair can lead to biphasic/partial biphasic dose-response characteristics for the maximally phosphorylated substrate at steady state. We use simulations and analysis to uncover a hidden competing effect which is responsible for this and analyse how it may be accentuated. We build on this to analyse different variants of multi-site phosphorylation mechanisms showing that some mechanisms are intrinsically not capable of displaying this behaviour. This provides both a consolidated understanding of how and under what conditions biphasic responses are obtained in multi-site phosphorylation and a basis for discriminating between different mechanisms based on this. We also demonstrate how this behaviour may be combined with other behaviour such as threshold and bistable responses, demonstrating the capacity of multi-site phosphorylation systems to act as complex molecular signal processors.

Influence of prior residents on settlement preferences in the anemonefish, Premnas biaculeatus

NASA Astrophysics Data System (ADS)

Dixson, Danielle L.; Jones, Geoffrey P.

2018-06-01

Settlement preferences play a critical role in the successful transition from pelagic larvae to benthic juveniles for many coral reef organisms. Reef fish larvae are capable of recognizing and behaviorally responding to a variety of sensory cues when assessing settlement site locations. The presence of resident conspecifics for site attached coral reef fishes could indicate a quality location, but may result in negative interactions through aggression from already-established individuals. For anemonefishes, where space on a sea anemone is limited and breeding is restricted to one adult pair, settlement preferences may depend on the number and sex of the occupants. Here we undertook both aquarium-based olfactory trials and a field experiment to determine the role resident anemonefish individuals have on sea anemone site selection in the spine cheek anemonefish, Premnas biaculeatus. We show larvae are able to identify the occupant saturation state and sex of the resident occupants based on chemical cues alone, with larvae preferring the chemical cues produced by a single male to a single female, the single fish to an empty sea anemone, and an empty sea anemone to a sea anemone containing an adult pair. These behavioral preferences were reflected in the settlement preferences of larvae when assessed in the natural environment. We hypothesize that the ability of resident fish to evict incoming larvae combined with the selective pressure on larvae to locate an ideal habitat has resulted in the larval ability to accurately identify habitat where settlement and future breeding opportunities are most likely achieved.

Probing the hammerhead ribozyme structure with ribonucleases.

PubMed Central

Hodgson, R A; Shirley, N J; Symons, R H

1994-01-01

Susceptibility to RNase digestion has been used to probe the conformation of the hammerhead ribozyme structure prepared from chemically synthesised RNAs. Less than about 1.5% of the total sample was digested to obtain a profile of RNase digestion sites. The observed digestion profiles confirmed the predicted base-paired secondary structure for the hammerhead. Digestion profiles of both cis and trans hammerhead structures were nearly identical which indicated that the structural interactions leading to self-cleavage were similar for both systems. Furthermore, the presence or absence of Mg2+ did not affect the RNase digestion profiles, thus indicating that Mg2+ did not modify the hammerhead structure significantly to induce self-cleavage. The base-paired stems I and II in the hammerhead structure were stable whereas stem III, which was susceptible to digestion, appeared to be an unstable region. The single strand domains separating the stems were susceptible to digestion with the exception of sites adjacent to guanosines; GL2.1 in the stem II loop and G12 in the conserved GAAAC sequence, which separates stems II and III. The absence of digestion at GL2.1 in the stem II hairpin loop of the hammerhead complex was maintained in uncomplexed ribozyme and in short oligonucleotides containing only the stem II hairpin region. In contrast, the G12 site became susceptible when the ribozyme was not complexed with its substrate. Overall the results are consistent with the role of Mg2+ in the hammerhead self-cleavage reaction being catalytic and not structural. Images PMID:8202361

Comparison of breeding bird and vegetation communities in primary and secondary forests of Great Smoky Mountains National Park

USGS Publications Warehouse

Simons, Theodore R.; Shriner, Susan A.; Farnsworth, George L.

2006-01-01

We compared breeding bird communities and vegetation characteristics at paired point locations in primary (undisturbed) and mature secondary forest (70-100 years old) sites in Great Smoky Mountains National Park, USA to understand how sites logged prior to creation of the park compare to undisturbed sites following 70 years of protection from human disturbance. We found that bird and vegetation communities are currently similar, but retain some differences in species composition. Rank abundance curves for primary and secondary forest bird communities showed very similar patterns of species dominance. Species composition was also similar on the two sites which shared 24 of the 25 most frequently recorded species. Nonetheless, comparisons of density estimates derived from distance sampling showed three bird species were more abundant on primary forest sites and that one bird species was significantly more abundant on secondary forest sites. Notably, comparisons based on raw counts (unadjusted for potential differences in detectability) produced somewhat different results. Analyses of vegetation samples for the paired sites also showed relative similarity, but with some differences between primary and secondary forests. Primary forest sites had more large trees (trees greater than 50 cm diameter at breast height) and late successional species. Primary forest sites had a denser tall shrub layer while secondary forest sites had a denser canopy layer. Nonetheless, tree species richness, basal area of live trees and number of standing snags did not differ between primary and secondary forest sites. Results indicate that breeding bird communities on sites within the park that were logged commercially 70 years ago are currently quite similar to bird communities on sites with no history of human disturbance. Similarities between the bird communities on previously disturbed and undisturbed sites in Great Smoky Mountains National Park may exceed those on more fragmented landscapes because large patches of primary forest, adjacent to commercially logged sites, remained in the park when it was established in 1935. These patches of primary forest may have served as source areas for commercially logged sites.

Base-unpaired regions in supercoiled replicative form DNA of coliphage M13

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dasgupta, S.; Allison, D.P.; Snyder, C.E.

Superhelical covalently closed circular replicative form DNA (RF I) of coliphage M13 appears as a relaxed molecule that has a base-unpaired region in the form of a bubble (100 to 200 base pairs long) seen in electron micrographs when spread in the presence of formaldehyde and formamide or after pretreatment with glyoxal. S1 endonuclease, specific for single-stranded DNA, converts superhelical M13 RF I DNA, but not nonsuperhelical M13 RF I to a significant extent, into unit-length linear molecules by sequential nicking of two strands. The locations of S1 nuclease-susceptible sites and glyoxal-fixed base-unpaired regions were both related to the fivemore » A-T-rich regions in M13 RF DNA. While S1 nuclease does not show preference for any of these sites, glyoxal-fixed bubbles occur predominantly at the major A-T-rich region in M13 RF DNA.« less

Responses of a Federally Endangered Songbird to Understory Thinning in Oak-Juniper Woodlands

NASA Astrophysics Data System (ADS)

Long, Ashley M.; Marshall, Mike E.; Morrison, Michael L.; Hays, K. Brian; Farrell, Shannon L.

2017-04-01

Wildlife conservation and management on military lands must be accomplished in the context of military readiness, which often includes ground-based training that is perceived to conflict with wildlife needs and environmental regulations. From 2008‒2012, we examined territory density, pairing success, and fledging success of the federally endangered golden-cheeked warbler ( Setophaga chrysoparia; hereafter warbler) in relation to removal of small-diameter trees from the understory of mature oak-juniper ( Quercus-Juniperus) woodland at the 87,890 ha Fort Hood Military Reservation in central Texas. Understory thinning created troop maneuver lanes, but left canopy vegetation intact. Warbler density, pairing success, and fledging success were similar across thinned and control sites. We found that warbler pairing and fledging success were best predicted by Ecological site (hereafter Ecosite), an indicator of hardwood tree species composition. Warbler pairing and fledging success were about 1.5 and 1.6 times higher, respectively, for territories dominated by the Low Stony Hill Ecosite than territories dominated by the Redlands Ecosite. Our results indicate that understory thinning for military training purposes did not have a negative effect on warblers at Fort Hood in the manner tested, and suggest that removal of smaller trees from the understory in a way that replicates historic conditions may elicit neutral responses from this forest-dependent songbird. Quantifying wildlife responses to military activities provides the Department of Defense and US Fish and Wildlife Service with data to guide conservation of threatened and endangered species on Department of Defense facilities while maintaining the military mission, and supports wildlife management efforts on other public and private lands.

Structural and Kinetic Analysis of Nucleoside Triphosphate Incorporation Opposite an Abasic Site by Human Translesion DNA Polymerase η

DOE Office of Scientific and Technical Information (OSTI.GOV)

Patra, Amritaj; Zhang, Qianqian; Lei, Li

2015-02-09

The most prevalent lesion in DNA is an abasic site resulting from glycolytic cleavage of a base. In a number of cellular studies, abasic sites preferentially code for dATP insertion (the “A rule”). In some cases frameshifts are also common. X-ray structures with abasic sites in oligonucleotides have been reported for several microbial and human DNA polymerases (pols), e.g. Dpo4, RB69, KlenTaq, yeast pol ι, human (h) pol ι, and human pol β. We reported previously that hpol η is a major pol involved in abasic site bypass (Choi, J.-Y., Lim, S., Kim, E. J., Jo, A., and Guengerich, F.more » P. (2010 J. Mol. Biol. 404, 34–44). hpol η inserted all four dNTPs in steady-state and pre-steady-state assays, preferentially inserting A and G. In LC-MS analysis of primer-template pairs, A and G were inserted but little C or T was inserted. Frameshifts were observed when an appropriate pyrimidine was positioned 5' to the abasic site in the template. In x-ray structures of hpol η with a non-hydrolyzable analog of dATP or dGTP opposite an abasic site, H-bonding was observed between the phosphate 5' to the abasic site and water H-bonded to N1 and N6 of A and N1 and O6 of G nucleoside triphosphate analogs, offering an explanation for what appears to be a “purine rule.” A structure was also obtained for an A inserted and bonded in the primer opposite the abasic site, but it did not pair with a 5' T in the template. Finally, we conclude that hpol η, a major copying enzyme with abasic sites, follows a purine rule, which can also lead to frameshifts. The phenomenon can be explained with H-bonds.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kirouac, Kevin N.; Ling, Hong; UWO)

Human DNA polymerase iota (pol iota) is a unique member of Y-family polymerases, which preferentially misincorporates nucleotides opposite thymines (T) and halts replication at T bases. The structural basis of the high error rates remains elusive. We present three crystal structures of pol complexed with DNA containing a thymine base, paired with correct or incorrect incoming nucleotides. A narrowed active site supports a pyrimidine to pyrimidine mismatch and excludes Watson-Crick base pairing by pol. The template thymine remains in an anti conformation irrespective of incoming nucleotides. Incoming ddATP adopts a syn conformation with reduced base stacking, whereas incorrect dGTP andmore » dTTP maintain anti conformations with normal base stacking. Further stabilization of dGTP by H-bonding with Gln59 of the finger domain explains the preferential T to G mismatch. A template 'U-turn' is stabilized by pol and the methyl group of the thymine template, revealing the structural basis of T stalling. Our structural and domain-swapping experiments indicate that the finger domain is responsible for pol's high error rates on pyrimidines and determines the incorporation specificity.« less

Absolute Radiometric Calibration of Narrow-Swath Imaging Sensors with Reference to Non-Coincident Wide-Swath Sensors

NASA Technical Reports Server (NTRS)

McCorkel, Joel; Thome, Kurtis; Lockwood, Ronald

2012-01-01

An inter-calibration method is developed to provide absolute radiometric calibration of narrow-swath imaging sensors with reference to non-coincident wide-swath sensors. The method predicts at-sensor radiance using non-coincident imagery from the reference sensor and knowledge of spectral reflectance of the test site. The imagery of the reference sensor is restricted to acquisitions that provide similar view and solar illumination geometry to reduce uncertainties due to directional reflectance effects. Spectral reflectance of the test site is found with a simple iterative radiative transfer method using radiance values of a well-understood wide-swath sensor and spectral shape information based on historical ground-based measurements. At-sensor radiance is calculated for the narrow-swath sensor using this spectral reflectance and atmospheric parameters that are also based on historical in situ measurements. Results of the inter-calibration method show agreement on the 2 5 percent level in most spectral regions with the vicarious calibration technique relying on coincident ground-based measurements referred to as the reflectance-based approach. While the variability of the inter-calibration method based on non-coincident image pairs is significantly larger, results are consistent with techniques relying on in situ measurements. The method is also insensitive to spectral differences between the sensors by transferring to surface spectral reflectance prior to prediction of at-sensor radiance. The utility of this inter-calibration method is made clear by its flexibility to utilize image pairings with acquisition dates differing in excess of 30 days allowing frequent absolute calibration comparisons between wide- and narrow-swath sensors.

ATLAS WORLD-cloud and networking in PanDA

NASA Astrophysics Data System (ADS)

Barreiro Megino, F.; De, K.; Di Girolamo, A.; Maeno, T.; Walker, R.; ATLAS Collaboration

2017-10-01

The ATLAS computing model was originally designed as static clouds (usually national or geographical groupings of sites) around the Tier 1 centres, which confined tasks and most of the data traffic. Since those early days, the sites’ network bandwidth has increased at 0(1000) and the difference in functionalities between Tier 1s and Tier 2s has reduced. After years of manual, intermediate solutions, we have now ramped up to full usage of World-cloud, the latest step in the PanDA Workload Management System to increase resource utilization on the ATLAS Grid, for all workflows (MC production, data (re)processing, etc.). We have based the development on two new site concepts. Nuclei sites are the Tier 1s and large Tier 2s, where tasks will be assigned and the output aggregated, and satellites are the sites that will execute the jobs and send the output to their nucleus. PanDA dynamically pairs nuclei and satellite sites for each task based on the input data availability, capability matching, site load and network connectivity. This contribution will introduce the conceptual changes for World-cloud, the development necessary in PanDA, an insight into the network model and the first half-year of operational experience.

A wideband wireless neural stimulation platform for high-density microelectrode arrays.

PubMed

Myers, Frank B; Simpson, Jim A; Ghovanloo, Maysam

2006-01-01

We describe a system that allows researchers to control an implantable neural microstimulator from a PC via a USB 2.0 interface and a novel dual-carrier wireless link, which provides separate data and power transmission. Our wireless stimulator, Interestim-2B (IS-2B), is a modular device capable of generating controlled-current stimulation pulse trains across 32 sites per module with support for a variety of stimulation schemes (biphasic/monophasic, bipolar/monopolar). We have developed software to generate multi-site stimulation commands for the IS-2B based on streaming data from artificial sensory devices such as cameras and microphones. For PC interfacing, we have developed a USB 2.0 microcontroller-based interface. Data is transmitted using frequency-shift keying (FSK) at 6/12 MHz to achieve a data rate of 3 Mb/s via a pair of rectangular coils. Power is generated using a class-E power amplifier operating at 1 MHz and transmitted via a separate pair of spiral planar coils which are oriented perpendicular to the data coils to minimize cross-coupling. We have successfully demonstrated the operation of the system by applying it as a visual prosthesis. Pulse-frequency modulated stimuli are generated in real-time based on a grayscale image from a webcam. These pulses are projected onto an 11x11 LED matrix that represents a 2D microelectrode array.

The CGTCA sequence motif is essential for biological activity of the vasoactive intestinal peptide gene cAMP-regulated enhancer.

PubMed Central

Fink, J S; Verhave, M; Kasper, S; Tsukada, T; Mandel, G; Goodman, R H

1988-01-01

cAMP-regulated transcription of the human vasoactive intestinal peptide gene is dependent upon a 17-base-pair DNA element located 70 base pairs upstream from the transcriptional initiation site. This element is similar to sequences in other genes known to be regulated by cAMP and to sequences in several viral enhancers. We have demonstrated that the vasoactive intestinal peptide regulatory element is an enhancer that depends upon the integrity of two CGTCA sequence motifs for biological activity. Mutations in either of the CGTCA motifs diminish the ability of the element to respond to cAMP. Enhancers containing the CGTCA motif from the somatostatin and adenovirus genes compete for binding of nuclear proteins from C6 glioma and PC12 cells to the vasoactive intestinal peptide enhancer, suggesting that CGTCA-containing enhancers interact with similar transacting factors. Images PMID:2842787

Identification and correction of systematic error in high-throughput sequence data

PubMed Central

2011-01-01

Background A feature common to all DNA sequencing technologies is the presence of base-call errors in the sequenced reads. The implications of such errors are application specific, ranging from minor informatics nuisances to major problems affecting biological inferences. Recently developed "next-gen" sequencing technologies have greatly reduced the cost of sequencing, but have been shown to be more error prone than previous technologies. Both position specific (depending on the location in the read) and sequence specific (depending on the sequence in the read) errors have been identified in Illumina and Life Technology sequencing platforms. We describe a new type of systematic error that manifests as statistically unlikely accumulations of errors at specific genome (or transcriptome) locations. Results We characterize and describe systematic errors using overlapping paired reads from high-coverage data. We show that such errors occur in approximately 1 in 1000 base pairs, and that they are highly replicable across experiments. We identify motifs that are frequent at systematic error sites, and describe a classifier that distinguishes heterozygous sites from systematic error. Our classifier is designed to accommodate data from experiments in which the allele frequencies at heterozygous sites are not necessarily 0.5 (such as in the case of RNA-Seq), and can be used with single-end datasets. Conclusions Systematic errors can easily be mistaken for heterozygous sites in individuals, or for SNPs in population analyses. Systematic errors are particularly problematic in low coverage experiments, or in estimates of allele-specific expression from RNA-Seq data. Our characterization of systematic error has allowed us to develop a program, called SysCall, for identifying and correcting such errors. We conclude that correction of systematic errors is important to consider in the design and interpretation of high-throughput sequencing experiments. PMID:22099972

Hole pairing and thermodynamic properties of the two dimensional frustrated t-J model

NASA Astrophysics Data System (ADS)

Roy, K.; Pal, P.; Nath, S.; Ghosh, N. K.

2018-04-01

The frustrated t-J model is investigated by using the exact-diagonalization (ED) method on an 8-site cluster. The effect on next-nearest-neighbor (NNN) exchange interaction J' (frustration) on the hole pairing and the thermodynamic properties of the system is considered. Two holes initially remain unbound at smaller value of J'/t, but tend to bind at larger value. The maximum possibility of pair formation has been observed to be at NNN sites. Entropy calculation shows that the system goes to more disordered state with J'. The specific heat curves show a single peak structure. A decrease in effective exchange energy is observed due to the frustration.

A mass spectrometry-based multiplex SNP genotyping by utilizing allele-specific ligation and strand displacement amplification.

PubMed

Park, Jung Hun; Jang, Hyowon; Jung, Yun Kyung; Jung, Ye Lim; Shin, Inkyung; Cho, Dae-Yeon; Park, Hyun Gyu

2017-05-15

We herein describe a new mass spectrometry-based method for multiplex SNP genotyping by utilizing allele-specific ligation and strand displacement amplification (SDA) reaction. In this method, allele-specific ligation is first performed to discriminate base sequence variations at the SNP site within the PCR-amplified target DNA. The primary ligation probe is extended by a universal primer annealing site while the secondary ligation probe has base sequences as an overhang with a nicking enzyme recognition site and complementary mass marker sequence. The ligation probe pairs are ligated by DNA ligase only at specific allele in the target DNA and the resulting ligated product serves as a template to promote the SDA reaction using a universal primer. This process isothermally amplifies short DNA fragments, called mass markers, to be analyzed by mass spectrometry. By varying the sizes of the mass markers, we successfully demonstrated the multiplex SNP genotyping capability of this method by reliably identifying several BRCA mutations in a multiplex manner with mass spectrometry. Copyright © 2016 Elsevier B.V. All rights reserved.

Origins of coevolution between residues distant in protein 3D structures

PubMed Central

Ovchinnikov, Sergey; Kamisetty, Hetunandan; Baker, David

2017-01-01

Residue pairs that directly coevolve in protein families are generally close in protein 3D structures. Here we study the exceptions to this general trend—directly coevolving residue pairs that are distant in protein structures—to determine the origins of evolutionary pressure on spatially distant residues and to understand the sources of error in contact-based structure prediction. Over a set of 4,000 protein families, we find that 25% of directly coevolving residue pairs are separated by more than 5 Å in protein structures and 3% by more than 15 Å. The majority (91%) of directly coevolving residue pairs in the 5–15 Å range are found to be in contact in at least one homologous structure—these exceptions arise from structural variation in the family in the region containing the residues. Thirty-five percent of the exceptions greater than 15 Å are at homo-oligomeric interfaces, 19% arise from family structural variation, and 27% are in repeat proteins likely reflecting alignment errors. Of the remaining long-range exceptions (<1% of the total number of coupled pairs), many can be attributed to close interactions in an oligomeric state. Overall, the results suggest that directly coevolving residue pairs not in repeat proteins are spatially proximal in at least one biologically relevant protein conformation within the family; we find little evidence for direct coupling between residues at spatially separated allosteric and functional sites or for increased direct coupling between residue pairs on putative allosteric pathways connecting them. PMID:28784799

Statistical Assessment of a Paired-site Approach for Verification of Carbon and Nitrogen Sequestration on CRP Land

NASA Astrophysics Data System (ADS)

Kucharik, C.; Roth, J.

2002-12-01

The threat of global climate change has provoked policy-makers to consider plausible strategies to slow the accumulation of greenhouse gases, especially carbon dioxide, in the atmosphere. One such idea involves the sequestration of atmospheric carbon (C) in degraded agricultural soils as part of the Conservation Reserve Program (CRP). While the potential for significant C sequestration in CRP grassland ecosystems has been demonstrated, the paired-site sampling approach traditionally used to quantify soil C changes has not been evaluated with robust statistical analysis. In this study, 14 paired CRP (> 8 years old) and cropland sites in Dane County, Wisconsin (WI) were used to assess whether a paired-site sampling design could detect statistically significant differences (ANOVA) in mean soil organic C and total nitrogen (N) storage. We compared surface (0 to 10 cm) bulk density, and sampled soils (0 to 5, 5 to 10, and 10 to 25 cm) for textural differences and chemical analysis of organic matter (OM), soil organic C (SOC), total N, and pH. The CRP contributed to lowering soil bulk density by 13% (p < 0.0001) and increased SOC and OM storage (kg m-2) by 13 to 17% in the 0 to 5 cm layer (p = 0.1). We tested the statistical power associated with ANOVA for measured soil properties, and calculated minimum detectable differences (MDD). We concluded that 40 to 65 paired sites and soil sampling in 5 cm increments near the surface were needed to achieve an 80% confidence level (α = 0.05; β = 0.20) in soil C and N sequestration rates. Because soil C and total N storage was highly variable among these sites (CVs > 20%), only a 23 to 29% change in existing total organic C and N pools could be reliably detected. While C and N sequestration (247 kg C ha{-1 } yr-1 and 17 kg N ha-1 yr-1) may be occurring and confined to the surface 5 cm as part of the WI CRP, our sampling design did not statistically support the desired 80% confidence level. We conclude that usage of statistical power analysis is essential to insure a high level of confidence in soil C and N sequestration rates that are quantified using paired plots.

Basic cytogenetics and physical mapping of ribosomal genes in four Astyanax species (Characiformes, Characidae) collected in Middle Paraná River, Iguassu National Park: considerations on taxonomy and systematics of the genus

PubMed Central

Paiz, Leonardo Marcel; Baumgärtner, Lucas; da Graça, Weferson Júnio; Margarido, Vladimir Pavan

2015-01-01

Abstract Karyotypes and chromosomal characteristics of both minor and major rDNAs in four fish species known popularly as “lambaris”, namely Astyanax abramis (Jenyns, 1842), Astyanax asuncionensis Géry, 1972, Astyanax correntinus (Holmberg, 1891) and Astyanax sp. collected from downstream of the Iguassu Falls (Middle Paraná River basin), preservation area of the Iguassu National Park, were analyzed by conventional and molecular protocols. Astyanax abramis had diploid chromosome number 2n=50 (4m+30sm+8st+8a) and single AgNORs (pair 22), Astyanax asuncionensis had 2n=50 (8m+24sm+6st+12a) and single AgNORs (pair 20), Astyanax sp. had 2n=50 (4m+26sm+8st+12a) and single AgNORs (pair 25), and Astyanax correntinus had 2n=36 (12m+16sm+2st+6a) and multiple AgNORs (pairs 12, 15, 16, 17). FISH with 18S rDNA showed a single site for Astyanax abramis, Astyanax asuncionensis and Astyanax sp. and multiple for Astyanax correntinus (14 sites). FISH with 5S rDNA showed single 5S-bearing loci chromosome pair only for Astyanax asuncionensis and multiple for Astyanax abramis (four sites), Astyanax correntinus (five sites) and Astyanax sp. (four sites). Distinct distribution patterns of heterochromatin were observed for karyotypes of all species, with the exception of the first acrocentric chromosome pair characterized by centromeric, interstitial-proximal and telomeric blocks of heterochromatin on the long arm, which may represent homeology between karyotypes of Astyanax abramis and Astyanax asuncionensis. Our study showed species-specific characteristics which can serve in diagnosis and differentiation between Astyanax abramis and Astyanax asuncionensis, considered cryptic species, as well as strengthening the occurrence of a species of Astyanax not yet described taxonomically. In addition, the data obtained from first cytogenetic studies in Astyanax correntinus suggest a high similarity with Astyanax schubarti Britski, 1964, suggesting that these species may belong to the same morphological group and that can be phylogenetically related. PMID:25893074

SLIDER: a generic metaheuristic for the discovery of correlated motifs in protein-protein interaction networks.

PubMed

Boyen, Peter; Van Dyck, Dries; Neven, Frank; van Ham, Roeland C H J; van Dijk, Aalt D J

2011-01-01

Correlated motif mining (cmm) is the problem of finding overrepresented pairs of patterns, called motifs, in sequences of interacting proteins. Algorithmic solutions for cmm thereby provide a computational method for predicting binding sites for protein interaction. In this paper, we adopt a motif-driven approach where the support of candidate motif pairs is evaluated in the network. We experimentally establish the superiority of the Chi-square-based support measure over other support measures. Furthermore, we obtain that cmm is an np-hard problem for a large class of support measures (including Chi-square) and reformulate the search for correlated motifs as a combinatorial optimization problem. We then present the generic metaheuristic slider which uses steepest ascent with a neighborhood function based on sliding motifs and employs the Chi-square-based support measure. We show that slider outperforms existing motif-driven cmm methods and scales to large protein-protein interaction networks. The slider-implementation and the data used in the experiments are available on http://bioinformatics.uhasselt.be.

Hydrolysis of N3-methyl-2'-deoxycytidine: model compound for reactivity of protonated cytosine residues in DNA.

PubMed

Sowers, L C; Sedwick, W D; Shaw, B R

1989-11-01

Protonation of cytosine residues at physiological pH may occur in DNA as a consequence of both alkylation and aberrant base-pair formation. When cytosine derivatives are protonated, they undergo hydrolysis reactions at elevated rates and can either deaminate to form the corresponding uracil derivatives or depyrimidinate generating abasic sites. The kinetic parameters for reaction of protonated cytosine are derived by studying the hydrolysis of N3-methyl-2'-deoxycytidine (m3dC), a cytosine analogue which is predominantly protonated at physiological pH. Both deamination and depyrimidimation reaction rates are shown to be linearly dependent upon the fraction of protonated molecules. We present here thermodynamic parameters which allow determination of hydrolysis rates of m3dC as functions of pH and temperature. Protonation of cytosine residues in DNA, as induced by aberrant base-pair formation or base modification, may accelerate the rate of both deamination and depyrimidation up to several thousand-fold under physiological conditions.

Quantitation of base substitutions in eukaryotic 5S rRNA: selection for the maintenance of RNA secondary structure.

PubMed

Curtiss, W C; Vournakis, J N

1984-01-01

Eukaryotic 5S rRNA sequences from 34 diverse species were compared by the following method: (1) The sequences were aligned; (2) the positions of substitutions were located by comparison of all possible pairs of sequences; (3) the substitution sites were mapped to an assumed general base pairing model; and (4) the R-Y model of base stacking was used to study stacking pattern relationships in the structure. An analysis of the sequence and structure variability in each region of the molecule is presented. It was found that the degree of base substitution varies over a wide range, from absolute conservation to occurrence of over 90% of the possible observable substitutions. The substitutions are located primarily in stem regions of the 5S rRNA secondary structure. More than 88% of the substitutions in helical regions maintain base pairing. The disruptive substitutions are primarily located at the edges of helical regions, resulting in shortening of the helical regions and lengthening of the adjacent nonpaired regions. Base stacking patterns determined by the R-Y model are mapped onto the general secondary structure. Intrastrand and interstrand stacking could stabilize alternative coaxial structures and limit the conformational flexibility of nonpaired regions. Two short contiguous regions are 100% conserved in all species. This may reflect evolutionary constraints imposed at the DNA level by the requirement for binding of a 5S gene transcription initiation factor during gene expression.

Long-term leisure time physical activity and properties of bone: a twin study.

PubMed

Ma, Hongqiang; Leskinen, Tuija; Alen, Markku; Cheng, Sulin; Sipilä, Sarianna; Heinonen, Ari; Kaprio, Jaakko; Suominen, Harri; Kujala, Urho M

2009-08-01

Effects of physical activity on bone properties, when controlled for genetic effects, are not fully understood. We aimed to study the association between long-term leisure time physical activity (LTPA) and bone properties using twin pairs known to be discordant for leisure time physical activity for at least 30 yr. Volumetric BMD and geometric properties were measured at the tibia shaft and distal end using pQCT in 16 middle-aged (50-74 yr) same-sex twin pairs (seven monozygotic [MZ] and nine dizygotic [DZ] pairs) selected from a population-based cohort. Paired differences between active and inactive co-twins were studied. Active members of MZ twin pairs had larger cortical bone cross-sectional area (intrapair difference: 8%, p = 0.006), thicker cortex (12%, p = 0.003), and greater moment of inertia (I(max), 20%, p = 0.024) at the tibia shaft than their inactive co-twins. At the distal tibia, trabecular BMD (12%, p = 0.050) and compressive strength index (18%, p = 0.038) were also higher in physically active MZ pair members than their inactive co-twins. The trends were similar, but less consistently so, in DZ pairs as in MZ pairs. Our genetically controlled study design shows that LTPA during adulthood strengthens bones in a site-specific manner, that is, the long bone shaft has a thicker cortex, and thus higher bending strength, whereas the distal bone has higher trabecular density and compressive strength. These results suggest that LTPA has a potential causal role in decreasing the long-term risk of osteoporosis and thus preventing osteoporotic fractures.

Systematic and simulation-free coarse graining of homopolymer melts: a relative-entropy-based study.

PubMed

Yang, Delian; Wang, Qiang

2015-09-28

We applied the systematic and simulation-free strategy proposed in our previous work (D. Yang and Q. Wang, J. Chem. Phys., 2015, 142, 054905) to the relative-entropy-based (RE-based) coarse graining of homopolymer melts. RE-based coarse graining provides a quantitative measure of the coarse-graining performance and can be used to select the appropriate analytic functional forms of the pair potentials between coarse-grained (CG) segments, which are more convenient to use than the tabulated (numerical) CG potentials obtained from structure-based coarse graining. In our general coarse-graining strategy for homopolymer melts using the RE framework proposed here, the bonding and non-bonded CG potentials are coupled and need to be solved simultaneously. Taking the hard-core Gaussian thread model (K. S. Schweizer and J. G. Curro, Chem. Phys., 1990, 149, 105) as the original system, we performed RE-based coarse graining using the polymer reference interaction site model theory under the assumption that the intrachain segment pair correlation functions of CG systems are the same as those in the original system, which de-couples the bonding and non-bonded CG potentials and simplifies our calculations (that is, we only calculated the latter). We compared the performance of various analytic functional forms of non-bonded CG pair potential and closures for CG systems in RE-based coarse graining, as well as the structural and thermodynamic properties of original and CG systems at various coarse-graining levels. Our results obtained from RE-based coarse graining are also compared with those from structure-based coarse graining.

Nesting habitat and productivity of Swainson's Hawks in southeastern Arizona

USGS Publications Warehouse

Nishida, Catherine; Boal, Clint W.; DeStefano, Stephen; Hobbs, Royden J.

2013-01-01

We studied Swainson's Hawks (Buteo swainsoni) in southeastern Arizona to assess the status of the local breeding population. Nest success (≥1 young fledged) was 44.4% in 1999 with an average of 1.43 ± 0.09 (SE) young produced per successful pair. Productivity was similar in 2000, with 58.2% nesting success and 1.83 ± 0.09 fledglings per successful pair. Mesquite (Prosopis velutina) and cottonwood (Populus fremontii) accounted for >50% of 167 nest trees. Nest trees were taller than surrounding trees and random trees, and overall there was more vegetative cover at nest sites than random sites. This apparent requirement for cover around nest sites could be important for management of the species in Arizona. However, any need for cover at nest sites must be balanced with the need for open areas for foraging. Density of nesting Swainson's Hawks was higher in agriculture than in grasslands and desert scrub. Breeding pairs had similar success in agricultural and nonagricultural areas, but the effect of rapid and widespread land-use change on breeding distribution and productivity continues to be a concern throughout the range of the species.

First-principles study of the solid solution of hydrogen in lanthanum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schoellhammer, Gunther; Herzig, Peter; Wolf, Walter

2011-09-01

Results from first-principles investigations of the energetical, structural, electronic, and vibrational properties of model structures probing the metal-rich region of the lanthanum-hydrogen system, i.e., the region of the solid solution of hydrogen in lanthanum, are presented. We have studied the site preference and the ordering tendency of hydrogen atoms interstitially bonded in close-packed lanthanum. Spatially separated hydrogen atoms have turned out to exhibit an energetical preference for the occupation of octahedral interstitial sites at low temperature. Indications for a reversal of the site preference in favor of the occupation of tetrahedral interstitial sites at elevated temperature have been found. Linearmore » arrangements consisting of pairs of octahedrally and/or tetrahedrally coordinated hydrogen atoms collinearly bonded to a central lanthanum atom have turned out to be energetically favorable structure elements. Further stabilization is achieved if such hydrogen pairs are in turn linked together so that extended chains of La-H bonds are formed. Pair formation and chain linking counteract the energetical preference for octahedral coordination observed for separated hydrogen atoms.« less

Regional pressure and temperature variations across the injured human brain: comparisons between paired intraparenchymal and ventricular measurements.

PubMed

Childs, Charmaine; Shen, Liang

2015-06-23

Intraparenchymal, multimodality sensors are commonly used in the management of patients with severe traumatic brain injury (TBI). The 'gold standard', based on accuracy, reliability and cost for intracranial pressure (ICP) monitoring is within the cerebral ventricle (external strain gauge). There are no standards yet for intracerebral temperature monitoring and little is known of temperature differences between brain tissue and ventricle. The aim of the study therefore was to determine pressure and temperature differences at intraparenchymal and ventricular sites during five days of continuous neuromonitoring. Patients with severe TBI requiring emergency surgery. patients who required ICP monitoring were eligible for recruitment. Two intracerebral probe types were used: a) intraventricular, dual parameter sensor (measuring pressure, temperature) with inbuilt catheter for CSF drainage: b) multiparameter intraparenchymal sensor measuring pressure, temperature and oxygen partial pressure. All sensors were inserted during surgery and under aseptic conditions. Seventeen patients, 12 undergoing neurosurgery (decompressive craniectomy n = 8, craniotomy n = 4) aged 21-78 years were studied. Agreement of measures for 9540 brain tissue-ventricular temperature 'pairs' and 10,291 brain tissue-ventricular pressure 'pairs' were determined using mixed model to compare mean temperature and pressure for longitudinal data. There was no significant overall difference for mean temperature (p = 0.92) or mean pressure readings (p = 0.379) between tissue and ventricular sites. With 95.8 % of paired temperature readings within 2SD (-0.4 to 0.4 °C) differences in temperature between brain tissue and ventricle were clinically insignificant. For pressure, 93.5 % of readings pairs fell within the 2SD range (-9.4756 to 7.8112 mmHg). However, for individual patients, agreement for mean tissue-ventricular pressure differences was poor on occasions. There is good overall agreement between paired temperature measurements obtained from deep white matter and brain ventricle in patients with and without early neurosurgery. For paired ICP measurements, 93.5 % of readings were within 2SD of mean difference. Whilst the majority of paired readings were comparable (within 10 mmHg) clinically relevant tissue-ventricular dissociations were noted. Further work is required to unravel the events responsible for short intervals of pressure dissociation before tissue pressure readings can be definitively accepted as a reliable surrogate for ventricular pressure.

Species composition of developing Central Appalachian hardwood stands following clearcutting

Treesearch

Lance A. Vickers; Thomas Fox

2015-01-01

This study examined the species composition of 47 paired stands on submesic sites on the Appalachian Plateau of West Virginia. Paired stands consisted of a mature stand adjacent to a young clearcut that was

Locating pairs of comparable study areas...new system developed

Treesearch

Raymond D. Ratliff; Jack N. Reppert

1966-01-01

A new system developed for locating pairs of comparable areas consists of three steps: (a) characterizing each of two areas according to 18 site factors and soil properties, (b) rating each pair of characteristics for comparability, and (c) rating the two areas for comparability by using the individual ratings as the basis. Two areas scoring 85 or more points out of a...

Site-specific incorporation of redox active amino acids into proteins

DOEpatents

Alfonta, Lital [San Diego, CA; Schultz, Peter G [La Jolla, CA; Zhang, Zhiwen [Austin, TX

2011-08-30

Compositions and methods of producing components of protein biosynthetic machinery that include orthogonal tRNAs, orthogonal aminoacyl-tRNA synthetases, and orthogonal pairs of tRNAs/synthetases, which incorporate redox active amino acids into proteins are provided. Methods for identifying these orthogonal pairs are also provided along with methods of producing proteins with redox active amino acids using these orthogonal pairs.

Site-specific incorporation of redox active amino acids into proteins

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alfonta, Lital; Schultz, Peter G.; Zhang, Zhiwen

Compositions and methods of producing components of protein biosynthetic machinery that include orthogonal tRNAs, orthogonal aminoacyl-tRNA synthetases, and orthogonal pairs of tRNAs/synthetases, which incorporate redox active amino acids into proteins are provided. Methods for identifying these orthogonal pairs are also provided along with methods of producing proteins with redox active amino acids using these orthogonal pairs.

Site specific incorporation of keto amino acids into proteins

DOEpatents

Schultz, Peter G [La Jolla, CA; Wang, Lei [San Diego, CA

2011-03-22

Compositions and methods of producing components of protein biosynthetic machinery that include orthogonal tRNAs, orthogonal aminoacyl-tRNA synthetases, and orthogonal pairs of tRNAs/synthetases, which incorporate keto amino acids into proteins are provided. Methods for identifying these orthogonal pairs are also provided along with methods of producing proteins with keto amino acids using these orthogonal pairs.

Site-specific incorporation of redox active amino acids into proteins

DOEpatents

Alfonta, Lital [San Diego, CA; Schultz, Peter G [La Jolla, CA; Zhang, Zhiwen [San Diego, CA

2012-02-14

Compositions and methods of producing components of protein biosynthetic machinery that include orthogonal tRNAs, orthogonal aminoacyl-tRNA synthetases, and orthogonal pairs of tRNAs/synthetases, which incorporate redox active amino acids into proteins are provided. Methods for identifying these orthogonal pairs are also provided along with methods of producing proteins with redox active amino acids using these orthogonal pairs.

Site specific incorporation of keto amino acids into proteins

DOEpatents

Schultz, Peter G [La Jolla, CA; Wang, Lei [San Diego, CA

2008-10-07

Compositions and methods of producing components of protein biosynthetic machinery that include orthogonal tRNAs, orthogonal aminoacyl-tRNA synthetases, and orthogonal pairs of tRNAs/synthetases, which incorporate keto amino acids into proteins are provided. Methods for identifying these orthogonal pairs are also provided along with methods of producing proteins with keto amino acids using these orthogonal pairs.

Site-specific incorporation of redox active amino acids into proteins

DOEpatents

Alfonta; Lital , Schultz; Peter G. , Zhang; Zhiwen

2010-10-12

Compositions and methods of producing components of protein biosynthetic machinery that include orthogonal tRNAs, orthogonal aminoacyl-tRNA synthetases, and orthogonal pairs of tRNAs/synthetases, which incorporate redox active amino acids into proteins are provided. Methods for identifying these orthogonal pairs are also provided along with methods of producing proteins with redox active amino acids using these orthogonal pairs.

Site specific incorporation of keto amino acids into proteins

DOEpatents

Schultz, Peter G [La Jolla, CA; Wang, Lei [San Diego, CA

2011-12-06

Compositions and methods of producing components of protein biosynthetic machinery that include orthogonal tRNAs, orthogonal aminoacyl-tRNA synthetases, and orthogonal pairs of tRNAs/synthetases, which incorporate keto amino acids into proteins are provided. Methods for identifying these orthogonal pairs are also provided along with methods of producing proteins with keto amino acids using these orthogonal pairs.

Site-specific incorporation of redox active amino acids into proteins

DOEpatents

Alfonta, Lital [San Diego, CA; Schultz, Peter G [La Jolla, CA; Zhang, Zhiwen [San Diego, CA

2009-02-24

Compositions and methods of producing components of protein biosynthetic machinery that include orthogonal tRNAs, orthogonal aminoacyl-tRNA synthetases, and orthogonal pairs of tRNAs/synthetases, which incorporate redox active amino acids into proteins are provided. Methods for identifying these orthogonal pairs are also provided along with methods of producing proteins with redox active amino acids using these orthogonal pairs.

Site specific incorporation of keto amino acids into proteins

DOEpatents

Schultz, Peter G [La Jolla, CA; Wang, Lei [San Diego, CA

2012-02-14

Compositions and methods of producing components of protein biosynthetic machinery that include orthogonal tRNAs, orthogonal aminoacyl-tRNA synthetases, and orthogonal pairs of tRNAs/synthetases, which incorporate keto amino acids into proteins are provided. Methods for identifying these orthogonal pairs are also provided along with methods of producing proteins with keto amino acids using these orthogonal pairs.

Simple Physics-Based Analytical Formulas for the Potentials of Mean Force of the Interaction of Amino Acid Side Chains in Water. VII. Charged-Hydrophobic/Polar and Polar-Hydrophobic/Polar Side Chains.

PubMed

Makowski, Mariusz; Liwo, Adam; Scheraga, Harold A

2017-01-19

The physics-based potentials of side-chain-side-chain interactions corresponding to pairs composed of charged and polar, polar and polar, charged and hydrophobic, and hydrophobic and hydrophobic side chains have been determined. A total of 144 four-dimensional potentials of mean force (PMFs) of all possible pairs of molecules modeling these pairs were determined by umbrella-sampling molecular dynamics simulations in explicit water as functions of distance and orientation, and the analytical expressions were then fitted to the PMFs. Depending on the type of interacting sites, the analytical approximation to the PMF is a sum of terms corresponding to van der Waals interactions and cavity-creation involving the nonpolar sections of the side chains and van der Waals, cavity-creation, and electrostatic (charge-dipole or dipole-dipole) interaction energies and polarization energies involving the charged or polar sections of the side chains. The model used in this work reproduces all features of the interacting pairs. The UNited RESidue force field with the new side-chain-side-chain interaction potentials was preliminarily tested with the N-terminal part of the B-domain of staphylococcal protein A (PDBL 1BDD ; a three-α-helix bundle) and UPF0291 protein YnzC from Bacillus subtilis (PDB: 2HEP ; an α-helical hairpin).

Molecular dynamics simulation of the opposite-base preference and interactions in the active site of formamidopyrimidine-DNA glycosylase.

PubMed

Popov, Alexander V; Endutkin, Anton V; Vorobjev, Yuri N; Zharkov, Dmitry O

2017-05-08

Formamidopyrimidine-DNA glycosylase (Fpg) removes abundant pre-mutagenic 8-oxoguanine (oxoG) bases from DNA through nucleophilic attack of its N-terminal proline at C1' of the damaged nucleotide. Since oxoG efficiently pairs with both C and A, Fpg must excise oxoG from pairs with C but not with A, otherwise a mutation occurs. The crystal structures of several Fpg-DNA complexes have been solved, yet no structure with A opposite the lesion is available. Here we use molecular dynamic simulation to model interactions in the pre-catalytic complex of Lactococcus lactis Fpg with DNA containing oxoG opposite C or A, the latter in either syn or anti conformation. The catalytic dyad, Pro1-Glu2, was modeled in all four possible protonation states. Only one transition was observed in the experimental reaction rate pH dependence plots, and Glu2 kept the same set of interactions regardless of its protonation state, suggesting that it does not limit the reaction rate. The adenine base opposite oxoG was highly distorting for the adjacent nucleotides: in the more stable syn models it formed non-canonical bonds with out-of-register nucleotides in both the damaged and the complementary strand, whereas in the anti models the adenine either formed non-canonical bonds or was expelled into the major groove. The side chains of Arg109 and Phe111 that Fpg inserts into DNA to maintain its kinked conformation tended to withdraw from their positions if A was opposite to the lesion. The region showing the largest differences in the dynamics between oxoG:C and oxoG:A substrates was unexpectedly remote from the active site, located near the linker joining the two domains of Fpg. This region was also highly conserved among 124 analyzed Fpg sequences. Three sites trapping water molecules through multiple bonds were identified on the protein-DNA interface, apparently helping to maintain enzyme-induced DNA distortion and participating in oxoG recognition. Overall, the discrimination against A opposite to the lesion seems to be due to incorrect DNA distortion around the lesion-containing base pair and, possibly, to gross movement of protein domains connected by the linker.

A Bridging Water Anchors the Tethered 5-(3-Aminopropyl)-2′-deoxyuridine Amine in the DNA Major Groove Proximate to the N+2 C·G Base Pair: Implications for Formation of Interstrand 5′-GNC-3′ Cross-Links by Nitrogen Mustards

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Feng; Li, Feng; Ganguly, Manjori

2008-11-14

Site-specific insertion of t-(3-aminopropyl)-2'-deoxyuridine (Z3dU) and 7-deaza-dG into the Dickerson-Drew dodecamers 5'-d(C{sup 1}G{sup 2}C{sup 3}G{sup 4}A{sup 5}A{sup 6}T{sup 7}T{sup 8}C{sup 9}{und Z}{sup 10}C{sup 11}G{sup 12})-3'{center_dot}5'-d (C{sup 13}G{sup 14}C{sup 15}G{sup 16}A{sup 17}A{sup 18}T{sup 19}T{sup 20}C{sup 21}{und Z}{sup 22}C{sup 23}G{sup 24})-3' (named DDD{sup Z10}) and 5'-d(C{sup 1}G{sup 2}C{sup 3}G{sup 4}A{sup 5}A{sup 6}T{sup 7}{und X}{sup 20}C{sup 21}{und Z}{sup 22}C{sup 23}G{sup 24})-3' (named DDD{sup 2+Z10}) (X = 73dU; Z = 7-deaza-dG) suggests a mechanism underlying the formation of interstrand N+2 DNA cross-links by nitrogen mustards, e.g., melphalan and mechlorethamine. Analysis of the DDD{sup 2+Z10} duplex reveals that the tethered cations at base pairs A{supmore » 5}{center_dot}X{sup 20} and X{sup 8}{center_dot}A{sup 17} extend within the major groove in the 3'-direction, toward conserved Mg{sup 2+} binding sites located adjacent to N+2 base pairs C{sup 3}{center_dot}Z{sup 22} and Z{sup 10}{center_dot}C{sup 15}. Bridging waters located between the tethered amines and either Z{sup 10} or Z{sup 22} O{sup 6} stabilize the tethered cations and allow interactions with the N + 2 base pairs without DNA bending. Incorporation of 7-deaza-dG into the DDD{sup 2+Z10} duplex weakens but does not eliminate electrostatic interactions between tethered amines and Z{sup 10} O{sup 6} and Z{sup 22} O{sup 6}. The results suggest a mechanism by which tethered N7-dG aziridinium ions, the active species involved in formation of interstrand 5'-GNC-3' cross-links by nitrogen mustards, modify the electrostatics of the major groove and position the aziridinium ions proximate to the major groove edge of the N+2 C{center_dot}G base pair, facilitating interstrand cross-linking.« less

Nitrogen vacancy, self-interstitial diffusion, and Frenkel-pair formation/dissociation in B 1 TiN studied by ab initio and classical molecular dynamics with optimized potentials

NASA Astrophysics Data System (ADS)

Sangiovanni, D. G.; Alling, B.; Steneteg, P.; Hultman, L.; Abrikosov, I. A.

2015-02-01

We use ab initio and classical molecular dynamics (AIMD and CMD) based on the modified embedded-atom method (MEAM) potential to simulate diffusion of N vacancy and N self-interstitial point defects in B 1 TiN. TiN MEAM parameters are optimized to obtain CMD nitrogen point-defect jump rates in agreement with AIMD predictions, as well as an excellent description of Ti Nx(˜0.7

Seismic reflection study of Flathead Lake, Montana

USGS Publications Warehouse

Wold, Richard J.

1982-01-01

A seismic reflection survey of Flathead Lake, Montana, was carried out in 1970 to study the geologic structure underlying the lake. Approximately 200 km of track lines were surveyed resulting in about 140 km of useable data (Fig. 1). A one cu. in. air gun was used as the energy source. Navigation was by a series of theodolite sitings of the boat from pairs of shore-based control points. 

Alteration of intersubunit acid–base pair interactions at the quasi-threefold axis of symmetry of Cucumber mosaic virus disrupts aphid vector transmission

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bricault, Christine A.; Perry, Keith L., E-mail: KLP3@cornell.edu

2013-06-05

In the atomic model of Cucumber mosaic virus (CMV), six amino acid residues form stabilizing salt bridges between subunits of the asymmetric unit at the quasi-threefold axis of symmetry. To evaluate the effects of these positions on virion stability and aphid vector transmissibility, six charged amino acid residues were individually mutated to alanine. All of the six engineered viruses were viable and exhibited near wild type levels of virion stability in the presence of urea. Aphid vector transmissibility was nearly or completely eliminated in the case of four of the mutants; two mutants demonstrated intermediate aphid transmissibility. For the majoritymore » of the engineered mutants, second-site mutations were observed following aphid transmission and/or mechanical passaging, and one restored transmission rates to that of the wild type. CMV capsids tolerate disruption of acid–base pairing interactions at the quasi-threefold axis of symmetry, but these interactions are essential for maintaining aphid vector transmissibility. - Highlights: ► Amino acids between structural subunits of Cucumber mosaic virus affect vector transmission. ► Mutant structural stability was retained, while aphid vector transmissibility was disrupted. ► Spontaneous, second-site mutations restored aphid vector transmissibility.« less

Influence of 6s{sup 2} lone pair electrons of Bi{sup 3+} on its preferential site occupancy in fluorapatite, NaCa{sub 3}Bi(PO{sub 4}){sub 3}F – An insight from Eu{sup 3+} luminescent probe

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lakshminarasimhan, N., E-mail: nlnsimha@gmail.com; Varadaraju, U.V.

2014-12-15

Graphical abstract: Eu{sup 3+} structural probe – difference in Eu{sup 3+} PL emission in (a) NaCa{sub 3}Bi{sub 0.95}Eu{sub 0.05}(PO{sub 4}){sub 3}F and (b) NaCa{sub 3}La{sub 0.95}Eu{sub 0.05}(PO{sub 4}){sub 3}F suggests Bi{sup 3+} with preferential site occupancy at M(II) site directing Eu{sup 3+} to M(I) site. - Highlights: • Eu{sup 3+} luminescent probe used for establishing the role of 6s{sup 2} lone pair electrons of Bi{sup 3+} in fluorapatite. • Difference in Eu{sup 3+} PL emission spectral features in NaCa{sub 3}Bi{sub 0.95}Eu{sub 0.05}(PO{sub 4}){sub 3}F and NaCa{sub 3}La{sub 0.95}Eu{sub 0.05}(PO{sub 4}){sub 3}F. • Preferential site occupancy of Bi{sup 3+} in M(II)more » site directs Eu{sup 3+} to M(I) site in NaCa{sub 3}Bi{sub 0.95}Eu{sub 0.05}(PO{sub 4}){sub 3}F. - Abstract: Eu{sup 3+} luminescence was used as a structural probe in understanding the preferential site occupancy of lone pair cation, Bi{sup 3+}, in fluorapatite by comparing the photoluminescence (PL) emission spectral features with that of in analogous La{sup 3+} based fluorapatite. The fluorapatites, NaCa{sub 3}Bi{sub 0.95}Eu{sub 0.05}(PO{sub 4}){sub 3}F and NaCa{sub 3}La{sub 0.95}Eu{sub 0.05}(PO{sub 4}){sub 3}F, were synthesized by conventional high temperature solid state reaction method and characterized by powder X-ray diffraction (XRD) and FT-IR spectroscopy. The Eu{sup 3+} PL results revealed a difference in the emission spectral features in NaCa{sub 3}Bi{sub 0.95}Eu{sub 0.05}(PO{sub 4}){sub 3}F and NaCa{sub 3}La{sub 0.95}Eu{sub 0.05}(PO{sub 4}){sub 3}F. This difference in Eu{sup 3+} PL emission can be attributed to the difference in its site occupancy in the studied fluorapatites.« less

Sequencing of the amylopullulanase (apu) gene of Thermoanaerobacter ethanolicus 39E, and identification of the active site by site-directed mutagenesis.

PubMed

Mathupala, S P; Lowe, S E; Podkovyrov, S M; Zeikus, J G

1993-08-05

The complete nucleotide sequence of the gene encoding the dual active amylopullulanase of Thermoanaerobacter ethanolicus 39E (formerly Clostridium thermohydrosulfuricum) was determined. The structural gene (apu) contained a single open reading frame 4443 base pairs in length, corresponding to 1481 amino acids, with an estimated molecular weight of 162,780. Analysis of the deduced sequence of apu with sequences of alpha-amylases and alpha-1,6 debranching enzymes enabled the identification of four conserved regions putatively involved in substrate binding and in catalysis. The conserved regions were localized within a 2.9-kilobase pair gene fragment, which encoded a M(r) 100,000 protein that maintained the dual activities and thermostability of the native enzyme. The catalytic residues of amylopullulanase were tentatively identified by using hydrophobic cluster analysis for comparison of amino acid sequences of amylopullulanase and other amylolytic enzymes. Asp597, Glu626, and Asp703 were individually modified to their respective amide form, or the alternate acid form, and in all cases both alpha-amylase and pullulanase activities were lost, suggesting the possible involvement of 3 residues in a catalytic triad, and the presence of a putative single catalytic site within the enzyme. These findings substantiate amylopullulanase as a new type of amylosaccharidase.

Preferential Redistribution of Fine-Grained Particles in the Panama Basin and Potential Errors in 230Th-Derived Focusing Factors

NASA Astrophysics Data System (ADS)

Marcantonio, F.; Lyle, M. W.; Ibrahim, R.

2013-12-01

The 230Th constant-flux proxy technique, commonly used in paleoceanography to estimate sediment fluxes, is thought to differentiate lateral from vertical fluxes of sediment at sites that have undergone sediment redistribution. However, redistribution processes (focusing or winnowing) are expected to fractionate fine particles from those that are coarse. Since fine particles with greater surface area are known to contain greater concentrations of 230Th, one might expect that sediment redistribution would bias 230Th-derived sediment mass accumulation rates (MARs). We investigate this possibility in two regions of the Panama Basin where significant sediment focusing has been hypothesized to occur. We examine multicore sediments from paired sites at two locations, one close to the equator at the southern limit of the Panama Basin (Carnegie Ridge) where upwelling and primary productivity are high, and one at 6°N at the northern boundary of the Panama Basin (Cocos Ridge), where primary productivity is lower. The multicores, which are constrained by radiocarbon ages that span the latest Holocene at each paired site, represent regions that have undergone potential winnowing and focusing (thin vs thick sediment drapes identified using seismic reflection) at each Panama Basin location. Since the distance separating the paired sites at each location is no more than about 50 km, one would expect the 230Th-derived MARs to be similar, i.e., the rain rate should not be significantly different at each of the paired sites. The radiocarbon-derived sand fraction (>63-μm) MARs, which likely represent the vertical rain of particles not transported by bottom currents, are identical at each of the paired sites, with fluxes at the Carnegie Ridge about 3.5 times greater than those at the Cocos Ridge over the past several thousand years. Over the same time period, the 230Th-normalized MARs are relatively similar at both the Carnegie and Cocos sites, but are different by about 60% at each of the paired sites, with the higher MARs always at the potentially winnowed sites. The 'thick' Carnegie Ridge site has a 230Th-derived focusing factor of about 6. However, we believe that, given our observations of the radiocarbon-derived fluxes of sand, the high 230Th-derived focusing factor is likely an overestimate of the degree of focusing, and the average 230Th-derived MAR is likely an underestimate of the true MAR. Similarly, the biasing for the 'thin' Cocos site that has a 230Th-derived focusing factor of 0.2 (i.e., potential winnowing) is expected to be the opposite, namely, 230Th-derived fluxes are likely being overestimated there. The quantitative extent to which 230Th-derived focusing factors have been over- and under-estimated in the Panama Basin will be discussed. We hypothesize that size fractionation, as well as 230Th focusing errors, occur most frequently at lower current velocities where the fine and coarse fraction of the sediment components are more effectively sorted from each other.

In trans paired nicking triggers seamless genome editing without double-stranded DNA cutting.

PubMed

Chen, Xiaoyu; Janssen, Josephine M; Liu, Jin; Maggio, Ignazio; 't Jong, Anke E J; Mikkers, Harald M M; Gonçalves, Manuel A F V

2017-09-22

Precise genome editing involves homologous recombination between donor DNA and chromosomal sequences subjected to double-stranded DNA breaks made by programmable nucleases. Ideally, genome editing should be efficient, specific, and accurate. However, besides constituting potential translocation-initiating lesions, double-stranded DNA breaks (targeted or otherwise) are mostly repaired through unpredictable and mutagenic non-homologous recombination processes. Here, we report that the coordinated formation of paired single-stranded DNA breaks, or nicks, at donor plasmids and chromosomal target sites by RNA-guided nucleases based on CRISPR-Cas9 components, triggers seamless homology-directed gene targeting of large genetic payloads in human cells, including pluripotent stem cells. Importantly, in addition to significantly reducing the mutagenicity of the genome modification procedure, this in trans paired nicking strategy achieves multiplexed, single-step, gene targeting, and yields higher frequencies of accurately edited cells when compared to the standard double-stranded DNA break-dependent approach.CRISPR-Cas9-based gene editing involves double-strand breaks at target sequences, which are often repaired by mutagenic non-homologous end-joining. Here the authors use Cas9 nickases to generate coordinated single-strand breaks in donor and target DNA for precise homology-directed gene editing.

CO2 exchange following peat extraction - a comparison of two paired restored/unrestored peatlands

NASA Astrophysics Data System (ADS)

Strachan, Ian; Strack, Maria; Pelletier, Luc; Nugent, Kelly; Rankin, Tracy

2016-04-01

Peat extraction is an important industry in parts of Canada and elsewhere globally. The resulting disturbance from drainage and vacuum-harvesting is mitigated through best practices which now incorporate restoration intended to return the peatland's biodiversity and greenhouse gas (GHG) exchange to that resembling the pre-disturbance state. We examine the net ecosystem exchange of CO2 (NEE) in two sets of paired peatlands. Within each pair, the extraction year was the same and the sites were treated identically post-extraction in terms of management (blocking drains or leveling as applicable). The first pair is located in the vicinity of Rivière-du-Loup, Québec, Canada and were harvested in 1980. The Bois-des-Bel (BDB) site was restored in 1999 following the methods of Quinty and Rochefort (2003). GHG fluxes have been studied at various points since restoration (e.g. Strack and Zuback, 2013) largely using chamber measurements. The site now hosts a thriving bog ecosystem with Sphagnum, Eriophorum and shrub communities. A site 30 km away near Saint-Alexandre de Kamouraska (SAK) was managed post-harvest as BDB with drains blocked but was left unrestored and now has only sparse Eriophorum with invasive species. The second pair of peatlands represents a newly extracted site near Seba Beach, Alberta, Canada. One field was restored (SBR) in autumn 2012 as per the Québec sites but with ditches infilled when the fields were levelled while the other (SBU) was left unrestored. In the summer of 2013, eddy covariance towers were installed at each location and measured NEE continuously at 10Hz throughout the subsequent periods. BDB and SBR remain operational today while SBU was removed in fall 2014 and SAK in fall 2015. In this presentation, we will focus on the coincident years of operation. After 15 years, BDB has measured NEE in the range of that observed at natural peatlands. A summer sink and winter release lead to annual uptake of CO2. At SAK, the lack of establishment of moss cover has led to the site remaining a source of CO2 to the atmosphere. SBR follows a trend towards becoming a weak sink for CO2 as vegetation re-establishes. SBU remained a weak source of CO2 to the atmosphere. The two restored sites showed more difference between years than did the unrestored sites, presumably caused by vegetation responding to the different environmental conditions within a growing season.

Loss of Asparagine-Linked Glycosylation Sites in Variable Region 5 of Human Immunodeficiency Virus Type 1 Envelope Is Associated with Resistance to CD4 Antibody Ibalizumab ▿

PubMed Central

Toma, Jonathan; Weinheimer, Steven P.; Stawiski, Eric; Whitcomb, Jeannette M.; Lewis, Stanley T.; Petropoulos, Christos J.; Huang, Wei

2011-01-01

Ibalizumab (formerly TNX-355) is a first-in-class, monoclonal antibody inhibitor of CD4-mediated human immunodeficiency type 1 (HIV-1) entry. Multiple clinical trials with HIV-infected patients have demonstrated the antiviral activity, safety, and tolerability of ibalizumab treatment. A 9-week phase Ib study adding ibalizumab monotherapy to failing drug regimens led to transient reductions in HIV viral loads and the evolution of HIV-1 variants with reduced susceptibility to ibalizumab. This report characterizes these variants by comparing the phenotypic susceptibilities and envelope (env) sequences of (i) paired baseline and on-treatment virus populations, (ii) individual env clones from selected paired samples, and (iii) env clones containing site-directed mutations. Viruses with reduced susceptibility to ibalizumab were found to exhibit reduced susceptibility to the anti-CD4 antibody RPA-T4. Conversely, susceptibility to soluble CD4, which targets the HIV-1 gp120 envelope protein, was enhanced. No changes in susceptibility to the fusion inhibitor enfuvirtide or the CCR5 antagonist maraviroc were observed. Functionally, viruses with reduced ibalizumab susceptibility also displayed high levels of infectivity relative to those of paired baseline viruses. Individual env clones exhibiting reduced ibalizumab susceptibility contained multiple amino acid changes in different regions relative to the paired baseline clones. In particular, clones with reduced susceptibility to ibalizumab contained fewer potential asparagine-linked glycosylation sites (PNGSs) in variable region 5 (V5) than did paired ibalizumab-susceptible clones. The reduction in ibalizumab susceptibility due to the loss of V5 PNGSs was confirmed by site-directed mutagenesis. Taken together, these findings provide important insights into resistance to this new class of antiretroviral drug. PMID:21289125

Toward rules relating zinc finger protein sequences and DNA binding site preferences.

PubMed

Desjarlais, J R; Berg, J M

1992-08-15

Zinc finger proteins of the Cys2-His2 type consist of tandem arrays of domains, where each domain appears to contact three adjacent base pairs of DNA through three key residues. We have designed and prepared a series of variants of the central zinc finger within the DNA binding domain of Sp1 by using information from an analysis of a large data base of zinc finger protein sequences. Through systematic variations at two of the three contact positions (underlined), relatively specific recognition of sequences of the form 5'-GGGGN(G or T)GGG-3' has been achieved. These results provide the basis for rules that may develop into a code that will allow the design of zinc finger proteins with preselected DNA site specificity.

Effects of the adenovirus 2 late promoter on simian virus 40 transcription and replication.

PubMed Central

Grass, D S; Manley, J L

1986-01-01

A 100-base-pair fragment of adenovirus 2 (Ad2) DNA encompassing the major late transcriptional promoter was inserted into the simian virus 40 (SV40) late promoter region at SV40 nucleotide 294 to study the effects of a strong TATA box-containing promoter on SV40 late transcription. pSVAdE contains the insert in an orientation such that it would promote transcription towards the origin and early region of SV40, while the insert is in the opposite orientation in pSVAdL. Nuclease S1 analysis with 5'-end-labeled probes showed that in cells transfected with pSVAdE, the late mRNA initiation sites are essentially the same as in wild type, demonstrating that an insert of 100 base pairs can have no effect on utilization of the SV40 late start sites. In pSVAdL-transfected cells, however, the major late viral initiation site is now in the insert at +1 with respect to the Ad2 major late cap site. However, all of the SV40 initiation sites are still utilized and with the same efficiency relative to each other as in wild type. Thus, it appears that the Ad2 late promoter and the SV40 late promoter can function independently on the same DNA molecule, even when one promoter is embedded within the other. By using cytosine arabinoside to block DNA replication and thereby inhibit the onset of late expression, it has been shown that both the Ad2 late promoter and the SV40 late promoter have similar requirement for DNA replication in this context. In addition, pSVAdL showed dramatically diminished virus viability and VPI expression compared with both wildtype and pSVAdE. Possible explanations for this unexpected finding are discussed. Images PMID:3001338

DNA-bending properties of TF1.

PubMed

Schneider, G J; Sayre, M H; Geiduschek, E P

1991-10-05

Transcription factor 1 (TF1) is the Bacillus subtilis phage SPO1-encoded member of the family of DNA-binding proteins that includes Escherichia coli HU and integration host factor, IHF. A gel electrophoretic retardation method has been used to show that a TF1 dimer binding to one of its preferred sites in (5-hydroxymethyl)uracil (hmUra)-containing DNA sharply bends the latter. In fact, the DNA-bending properties of TF1 and E. coli IHF are indistinguishable. Substitutions at amino acid 61 in the DNA-binding "arm" of TF1 are known to affect DNA-binding affinity and site selectivity. Experiments described here show that these substitutions also affect DNA bending. The selectivity of TF1 binding is very greatly diminished and the affinity is reduced when hmUra is replaced in DNA by thymine (T). An extension of the gel retardation method that permits an analysis of DNA bending by non-specifically bound TF1 is proposed. Under the assumptions of this analysis, the reduced affinity of TF1 for T-containing DNA is shown to be associated with bending that is still sharp. The analysis of the TF1-DNA interaction has also been extended by hydroxyl radical (.OH) and methylation interference footprinting at two DNA sites. At each of these sites, and on each strand, TF1 strongly protects three segments of DNA from attack by OH. Patches of protected DNA are centered approximately ten base-pairs apart and fall on one side of the B-helix. Methylation in either the major or minor groove in the central ten base-pairs of the two TF1 binding sites quantitatively diminishes, but does not abolish, TF1 binding. We propose that multiple protein contacts allow DNA to wrap around the relatively small TF1 dimer, considerably deforming the DNA B-helix in the process.

Automatic Traffic Advisory and Resolution Service (ATARS) Algorithms Including Resolution-Advisory-Register Logic. Volume 2. Sections 12 through 19. Appendices,

DTIC Science & Technology

1981-06-01

pairwise conflict or an indication of BCAS control . A Pair Record is also created when an aircraft receives a resolution advisory from BCAS or from a non ...replying site: Update track numbers: ILS!I’ (pair record shows a non -connected site in control ) T"_N CALL AI!CPAFTPAIRriwTIFICRTaOI: ( both aircraft...Springfield, Virginia 22161 a>- U S Department of Transportain Systems Research & Development Service LWashington, D.C. 20590 94 This document is

Mapping DNA cleavage by the Type ISP restriction-modification enzymes following long-range communication between DNA sites in different orientations

PubMed Central

van Aelst, Kara; Saikrishnan, Kayarat; Szczelkun, Mark D.

2015-01-01

The prokaryotic Type ISP restriction-modification enzymes are single-chain proteins comprising an Mrr-family nuclease, a superfamily 2 helicase-like ATPase, a coupler domain, a methyltransferase, and a DNA-recognition domain. Upon recognising an unmodified DNA target site, the helicase-like domain hydrolyzes ATP to cause site release (remodeling activity) and to then drive downstream translocation consuming 1–2 ATP per base pair (motor activity). On an invading foreign DNA, double-strand breaks are introduced at random wherever two translocating enzymes form a so-called collision complex following long-range communication between a pair of target sites in inverted (head-to-head) repeat. Paradoxically, structural models for collision suggest that the nuclease domains are too far apart (>30 bp) to dimerise and produce a double-strand DNA break using just two strand-cleavage events. Here, we examined the organisation of different collision complexes and how these lead to nuclease activation. We mapped DNA cleavage when a translocating enzyme collides with a static enzyme bound to its site. By following communication between sites in both head-to-head and head-to-tail orientations, we could show that motor activity leads to activation of the nuclease domains via distant interactions of the helicase or MTase-TRD. Direct nuclease dimerization is not required. To help explain the observed cleavage patterns, we also used exonuclease footprinting to demonstrate that individual Type ISP domains can swing off the DNA. This study lends further support to a model where DNA breaks are generated by multiple random nicks due to mobility of a collision complex with an overall DNA-binding footprint of ∼30 bp. PMID:26507855

Statistical Evaluation of the Rodin–Ohno Hypothesis: Sense/Antisense Coding of Ancestral Class I and II Aminoacyl-tRNA Synthetases

PubMed Central

Chandrasekaran, Srinivas Niranj; Yardimci, Galip Gürkan; Erdogan, Ozgün; Roach, Jeffrey; Carter, Charles W.

2013-01-01

We tested the idea that ancestral class I and II aminoacyl-tRNA synthetases arose on opposite strands of the same gene. We assembled excerpted 94-residue Urgenes for class I tryptophanyl-tRNA synthetase (TrpRS) and class II Histidyl-tRNA synthetase (HisRS) from a diverse group of species, by identifying and catenating three blocks coding for secondary structures that position the most highly conserved, active-site residues. The codon middle-base pairing frequency was 0.35 ± 0.0002 in all-by-all sense/antisense alignments for 211 TrpRS and 207 HisRS sequences, compared with frequencies between 0.22 ± 0.0009 and 0.27 ± 0.0005 for eight different representations of the null hypothesis. Clustering algorithms demonstrate further that profiles of middle-base pairing in the synthetase antisense alignments are correlated along the sequences from one species-pair to another, whereas this is not the case for similar operations on sets representing the null hypothesis. Most probable reconstructed sequences for ancestral nodes of maximum likelihood trees show that middle-base pairing frequency increases to approximately 0.42 ± 0.002 as bacterial trees approach their roots; ancestral nodes from trees including archaeal sequences show a less pronounced increase. Thus, contemporary and reconstructed sequences all validate important bioinformatic predictions based on descent from opposite strands of the same ancestral gene. They further provide novel evidence for the hypothesis that bacteria lie closer than archaea to the origin of translation. Moreover, the inverse polarity of genetic coding, together with a priori α-helix propensities suggest that in-frame coding on opposite strands leads to similar secondary structures with opposite polarity, as observed in TrpRS and HisRS crystal structures. PMID:23576570

Detection of specific protein-protein interactions in nanocages by engineering bipartite FlAsH binding sites.

PubMed

Cornell, Thomas A; Fu, Jing; Newland, Stephanie H; Orner, Brendan P

2013-11-06

Proteins that form cage-like structures have been of much recent cross-disciplinary interest due to their application to bioconjugate and materials chemistry, their biological functions spanning multiple essential cellular processes, and their complex structure, often defined by highly symmetric protein–protein interactions. Thus, establishing the fundamentals of their formation, through detecting and quantifying important protein–protein interactions, could be crucial to understanding essential cellular machinery, and for further development of protein-based technologies. Herein we describe a method to monitor the assembly of protein cages by detecting specific, oligomerization state dependent, protein–protein interactions. Our strategy relies on engineering protein monomers to include cysteine pairs that are presented proximally if the cage state assembles. These assembled pairs of cysteines act as binding sites for the fluorescent reagent FlAsH, which, once bound, provides a readout for successful oligomerization. As a proof of principle, we applied this technique to the iron storage protein, DNA-binding protein from starved cells from E. coli. Several linker lengths and conformations for the presentation of the cysteine pairs were screened to optimize the engineered binding sites. We confirmed that our designs were successful in both lysates and with purified proteins, and that FlAsH binding was dependent upon cage assembly. Following successful characterization of the assay, its throughput was expanded. A two-dimension matrix of pH and denaturing buffer conditions was screened to optimize nanocage stability. We intend to use this method for the high throughput screening of protein cage libraries and of conditions for the generation of inorganic nanoparticles within the cavity of these and other cage proteins.

Pairing FLUXNET sites to validate model representations of land-use/land-cover change

NASA Astrophysics Data System (ADS)

Chen, Liang; Dirmeyer, Paul A.; Guo, Zhichang; Schultz, Natalie M.

2018-01-01

Land surface energy and water fluxes play an important role in land-atmosphere interactions, especially for the climatic feedback effects driven by land-use/land-cover change (LULCC). These have long been documented in model-based studies, but the performance of land surface models in representing LULCC-induced responses has not been investigated well. In this study, measurements from proximate paired (open versus forest) flux tower sites are used to represent observed deforestation-induced changes in surface fluxes, which are compared with simulations from the Community Land Model (CLM) and the Noah Multi-Parameterization (Noah-MP) land model. Point-scale simulations suggest the CLM can represent the observed diurnal and seasonal changes in net radiation (Rnet) and ground heat flux (G), but difficulties remain in the energy partitioning between latent (LE) and sensible (H) heat flux. The CLM does not capture the observed decreased daytime LE, and overestimates the increased H during summer. These deficiencies are mainly associated with models' greater biases over forest land-cover types and the parameterization of soil evaporation. Global gridded simulations with the CLM show uncertainties in the estimation of LE and H at the grid level for regional and global simulations. Noah-MP exhibits a similar ability to simulate the surface flux changes, but with larger biases in H, G, and Rnet change during late winter and early spring, which are related to a deficiency in estimating albedo. Differences in meteorological conditions between paired sites is not a factor in these results. Attention needs to be devoted to improving the representation of surface heat flux processes in land models to increase confidence in LULCC simulations.

Epigenomic profiling of DNA methylation in paired prostate cancer versus adjacent benign tissue

PubMed Central

Geybels, Milan S.; Zhao, Shanshan; Wong, Chao-Jen; Bibikova, Marina; Klotzle, Brandy; Wu, Michael; Ostrander, Elaine A.; Fan, Jian-Bing; Feng, Ziding; Stanford, Janet L.

2016-01-01

Background Aberrant DNA methylation may promote prostate carcinogenesis. We investigated epigenome-wide DNA methylation profiles in prostate cancer (PCa) compared to adjacent benign tissue to identify differentially methylated CpG sites. Methods The study included paired PCa and adjacent benign tissue samples from 20 radical prostatectomy patients. Epigenetic profiling was done using the Infinium HumanMethylation450 BeadChip. Linear models that accounted for the paired study design and False Discovery Rate Q-values were used to evaluate differential CpG methylation. mRNA expression levels of the genes with the most differentially methylated CpG sites were analyzed. Results In total, 2,040 differentially methylated CpG sites were identified in PCa versus adjacent benign tissue (Q-value <0.001), the majority of which were hypermethylated (n = 1,946; 95%). DNA methylation profiles accurately distinguished between PCa and benign tissue samples. Twenty-seven top-ranked hypermethylated CpGs had a mean methylation difference of at least 40% between tissue types, which included 25 CpGs in 17 genes. Furthermore, for ten genes over 50% of promoter region CpGs were hypermethylated in PCa versus benign tissue. The top-ranked differentially methylated genes included three genes that were associated with both promoter hypermethylation and reduced gene expression: SCGB3A1, HIF3A, and AOX1. Analysis of The Cancer Genome Atlas (TCGA) data provided confirmatory evidence for our findings. Conclusions This study of PCa versus adjacent benign tissue showed many differentially methylated CpGs and regions in and outside gene promoter regions, which may potentially be used for the development of future epigenetic-based diagnostic tests or as therapeutic targets. PMID:26383847

Epigenomic profiling of DNA methylation in paired prostate cancer versus adjacent benign tissue.

PubMed

Geybels, Milan S; Zhao, Shanshan; Wong, Chao-Jen; Bibikova, Marina; Klotzle, Brandy; Wu, Michael; Ostrander, Elaine A; Fan, Jian-Bing; Feng, Ziding; Stanford, Janet L

2015-12-01

Aberrant DNA methylation may promote prostate carcinogenesis. We investigated epigenome-wide DNA methylation profiles in prostate cancer (PCa) compared to adjacent benign tissue to identify differentially methylated CpG sites. The study included paired PCa and adjacent benign tissue samples from 20 radical prostatectomy patients. Epigenetic profiling was done using the Infinium HumanMethylation450 BeadChip. Linear models that accounted for the paired study design and False Discovery Rate Q-values were used to evaluate differential CpG methylation. mRNA expression levels of the genes with the most differentially methylated CpG sites were analyzed. In total, 2,040 differentially methylated CpG sites were identified in PCa versus adjacent benign tissue (Q-value < 0.001), the majority of which were hypermethylated (n = 1,946; 95%). DNA methylation profiles accurately distinguished between PCa and benign tissue samples. Twenty-seven top-ranked hypermethylated CpGs had a mean methylation difference of at least 40% between tissue types, which included 25 CpGs in 17 genes. Furthermore, for 10 genes over 50% of promoter region CpGs were hypermethylated in PCa versus benign tissue. The top-ranked differentially methylated genes included three genes that were associated with both promoter hypermethylation and reduced gene expression: SCGB3A1, HIF3A, and AOX1. Analysis of The Cancer Genome Atlas (TCGA) data provided confirmatory evidence for our findings. This study of PCa versus adjacent benign tissue showed many differentially methylated CpGs and regions in and outside gene promoter regions, which may potentially be used for the development of future epigenetic-based diagnostic tests or as therapeutic targets. © 2015 Wiley Periodicals, Inc.

Manipulative interplay of two adozelesin molecules with d(ATTAAT)₂achieving ligand-stacked Watson-Crick and Hoogsteen base-paired duplex adducts.

PubMed

Hopton, Suzanne R; Thompson, Andrew S

2011-05-17

Previous structural studies of the cyclopropapyrroloindole (CPI) antitumor antibiotics have shown that these ligands bind covalently edge-on into the minor groove of double-stranded DNA. Reversible covalent modification of the DNA via N3 of adenine occurs in a sequence-specific fashion. Early nuclear magnetic resonance and molecular modeling studies with both mono- and bis-alkylating ligands indicated that the ligands fit tightly within the minor groove, causing little distortion of the helix. In this study, we propose a new binding model for several of the CPI-based analogues, in which the aromatic secondary rings form π-stacked complexes within the minor groove. One of the adducts, formed with adozelesin and the d(ATTAAT)(2) sequence, also demonstrates the ability of these ligands to manipulate the DNA of the binding site, resulting in a Hoogsteen base-paired adduct. Although this type of base pairing has been previously observed with the bisfunctional CPI analogue bizelesin, this is the first time that such an observation has been made with a monoalkylating nondimeric analogue. Together, these results provide a new model for the design of CPI-based antitumor antibiotics, which also has a significant bearing on other structurally related and structurally unrelated minor groove-binding ligands. They indicate the dynamic nature of ligand-DNA interactions, demonstrating both DNA conformational flexibility and the ability of two DNA-bound ligands to interact to form stable covalent modified complexes.

Sporadic and thermospheric enhanced sodium layers observed by a lidar chain over China

NASA Astrophysics Data System (ADS)

Dou, X. K.; Qiu, S. C.; Xue, X. H.; Chen, T. D.; Ning, B. Q.

2013-10-01

We report the statistical features of sporadic sodium layers (SSLs) and the thermospheric enhanced sodium layers (TeSLs) observed by a lidar chain located at Beijing (40.2°N, 116.2°E), Hefei (31.8°N, 117.3°E), Wuhan (30.5°N, 114.4°E), and Haikou (19.5°N, 109.1°E). The average SSL occurrence rate was approximately 46.0, 12.3, 13.8, and 15.0 h per SSL at Beijing, Hefei, Wuhan, and Haikou, respectively. However, the TeSLs occurred relatively infrequently and were more likely to appear at low and high latitudinal sites. Both the SSLs and TeSLs at four lidar sites showed evident summer enhancements and correlated well with Es (foEs>4 MHz). The coobservations of SSLs at three lidar site pairs, i.e., Hefei-Beijing, Hefei-Wuhan, and Hefei-Beijing, indicated that a large-scale SSL extended horizontally for at least a few hundred kilometers and exhibited a tidal-induced modulation. Moreover, the SSLs were better correlated for the Hefei-Wuhan and Hefei-Haikou pairs than the Hefei-Beijing pair, which suggested a difference in the dynamical/chemical process in mesosphere and lower thermosphere (MLT) between the Beijing site and the other sites.

Sporadic and Thermospheric Enhanced Sodium Layers Observed by a Lidar Chain over China

NASA Astrophysics Data System (ADS)

Xue, X.

2013-12-01

We report the statistical features of sporadic sodium layers (SSLs) and the thermospheric enhanced sodium layers (TeSLs) observed by a lidar chain located at Beijing (40.2N,116.2E), Hefei (31.8N, 117.3E), Wuhan (30.5N, 114.4E), and Haikou (19.5N, 109.1E). The average SSL occurrence rate was approximately 46.0, 12.3, 13.8, and 15.0 hr per SSL at Beijing, Hefei, Wuhan, and Haikou, respectively. However, the TeSLs occurred relatively infrequently and were more likely to appear at low and high latitudinal sites. Both the SSLs and TeSLs at four lidar sites showed evident summer enhancements and correlated well with Es (foEs>4MHz). The co-observations of SSLs at three lidar site pairs, i.e., Hefei -- Beijing, Hefei -- Wuhan and Hefei -- Beijing, indicated that a large-scale SSL extended horizontally for at least a few hundred kilometers and exhibited a tidal-induced modulation. Moreover, the SSLs were better correlated for the Hefei -- Wuhan and Hefei -- Haikou pairs than the Hefei -- Beijing pair, which suggested a difference in the dynamical/chemical process in mesosphere and lower thermosphere (MLT) between the Beijing site and the other sites.

A small modified hammerhead ribozyme and its conformational characteristics determined by mutagenesis and lattice calculation.

PubMed Central

Lustig, B; Lin, N H; Smith, S M; Jernigan, R L; Jeang, K T

1995-01-01

A prototypic hammerhead ribozyme has three helices that surround an asymmetrical central core loop. We have mutagenized a hammerhead type ribozyme. In agreement with previous studies, progressive removal of stem-loop II from a three stemmed ribozyme showed that this region is not absolutely critical for catalysis. However, complete elimination of stem II and its loop did reduce, but did not eliminate, function. In a stem-loop II-deleted ribozyme, activity was best preserved when a purine, preferably a G, was present at position 10.1. This G contributed to catalysis irregardless of its role as either one part of a canonical pair with a C residue at 11.1 or a lone nucleotide with C (11.1) deleted. Computational methods using lattices generated 87 million three-dimensional chain forms for a stem-loop II-deleted RNA complex that preserved one potential G.C base pair at positions 10.1 and 11.1. This exhaustive set of chain forms included one major class of structures with G(10.1) being spatially proximal to the GUCX cleavage site of the substrate strand. Strong correlations were observed between colinear arrangement of stems I and III, constraints of base-pairing in the central core loop, and one particular placement of G(10.1) relative to the cleavage site. Our calculations of a stem-loop II-deleted ribozyme indicate that without needing to invoke any other constraints, the inherent asymmetry in the lengths of the two loop strands (3 nt in one and 7 nt in the other) that compose the core and flank G10.1-C11.1 stipulated strongly this particular G placement. This suggests that the hammerhead ribozyme maintains an asymmetry in its internal loop for a necessary structure/function reason. Images PMID:7567466

Multiscale analysis of restoration priorities for marine shoreline planning.

PubMed

Diefenderfer, Heida L; Sobocinski, Kathryn L; Thom, Ronald M; May, Christopher W; Borde, Amy B; Southard, Susan L; Vavrinec, John; Sather, Nichole K

2009-10-01

Planners are being called on to prioritize marine shorelines for conservation status and restoration action. This study documents an approach to determining the management strategy most likely to succeed based on current conditions at local and landscape scales. The conceptual framework based in restoration ecology pairs appropriate restoration strategies with sites based on the likelihood of producing long-term resilience given the condition of ecosystem structures and processes at three scales: the shorezone unit (site), the drift cell reach (nearshore marine landscape), and the watershed (terrestrial landscape). The analysis is structured by a conceptual ecosystem model that identifies anthropogenic impacts on targeted ecosystem functions. A scoring system, weighted by geomorphic class, is applied to available spatial data for indicators of stress and function using geographic information systems. This planning tool augments other approaches to prioritizing restoration, including historical conditions and change analysis and ecosystem valuation.

An experimentally-informed coarse-grained 3-site-per-nucleotide model of DNA: Structure, thermodynamics, and dynamics of hybridization

PubMed Central

Hinckley, Daniel M.; Freeman, Gordon S.; Whitmer, Jonathan K.; de Pablo, Juan J.

2013-01-01

A new 3-Site-Per-Nucleotide coarse-grained model for DNA is presented. The model includes anisotropic potentials between bases involved in base stacking and base pair interactions that enable the description of relevant structural properties, including the major and minor grooves. In an improvement over available coarse-grained models, the correct persistence length is recovered for both ssDNA and dsDNA, allowing for simulation of non-canonical structures such as hairpins. DNA melting temperatures, measured for duplexes and hairpins by integrating over free energy surfaces generated using metadynamics simulations, are shown to be in quantitative agreement with experiment for a variety of sequences and conditions. Hybridization rate constants, calculated using forward-flux sampling, are also shown to be in good agreement with experiment. The coarse-grained model presented here is suitable for use in biological and engineering applications, including nucleosome positioning and DNA-templated engineering. PMID:24116642

Identifying involvement of Lys251/Asp252 pair in electron transfer and associated proton transfer at the quinone reduction site of Rhodobacter capsulatus cytochrome bc1.

PubMed

Kuleta, Patryk; Sarewicz, Marcin; Postila, Pekka; Róg, Tomasz; Osyczka, Artur

2016-10-01

Describing dynamics of proton transfers in proteins is challenging, but crucial for understanding processes which use them for biological functions. In cytochrome bc1, one of the key enzymes of respiration or photosynthesis, proton transfers engage in oxidation of quinol (QH2) and reduction of quinone (Q) taking place at two distinct catalytic sites. Here we evaluated by site-directed mutagenesis the contribution of Lys251/Asp252 pair (bacterial numbering) in electron transfers and associated with it proton uptake to the quinone reduction site (Qi site). We showed that the absence of protonable group at position 251 or 252 significantly changes the equilibrium levels of electronic reactions including the Qi-site mediated oxidation of heme bH, reverse reduction of heme bH by quinol and heme bH/Qi semiquinone equilibrium. This implicates the role of H-bonding network in binding of quinone/semiquinone and defining thermodynamic properties of Q/SQ/QH2 triad. The Lys251/Asp252 proton path is disabled only when both protonable groups are removed. With just one protonable residue from this pair, the entrance of protons to the catalytic site is sustained, albeit at lower rates, indicating that protons can travel through parallel routes, possibly involving water molecules. This shows that proton paths display engineering tolerance for change as long as all the elements available for functional cooperation secure efficient proton delivery to the catalytic site. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Prediction of proprotein convertase cleavage sites.

PubMed

Duckert, Peter; Brunak, Søren; Blom, Nikolaj

2004-01-01

Many secretory proteins and peptides are synthesized as inactive precursors that in addition to signal peptide cleavage undergo post-translational processing to become biologically active polypeptides. Precursors are usually cleaved at sites composed of single or paired basic amino acid residues by members of the subtilisin/kexin-like proprotein convertase (PC) family. In mammals, seven members have been identified, with furin being the one first discovered and best characterized. Recently, the involvement of furin in diseases ranging from Alzheimer's disease and cancer to anthrax and Ebola fever has created additional focus on proprotein processing. We have developed a method for prediction of cleavage sites for PCs based on artificial neural networks. Two different types of neural networks have been constructed: a furin-specific network based on experimental results derived from the literature, and a general PC-specific network trained on data from the Swiss-Prot protein database. The method predicts cleavage sites in independent sequences with a sensitivity of 95% for the furin neural network and 62% for the general PC network. The ProP method is made publicly available at http://www.cbs.dtu.dk/services/ProP.

Report on Pairing-based Cryptography.

PubMed

Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

2015-01-01

This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.

Report on Pairing-based Cryptography

PubMed Central

Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

2015-01-01

This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST’s position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed. PMID:26958435

Incorporating a guanidine-modified cytosine base into triplex-forming PNAs for the recognition of a C-G pyrimidine–purine inversion site of an RNA duplex

PubMed Central

Toh, Desiree-Faye Kaixin; Devi, Gitali; Patil, Kiran M.; Qu, Qiuyu; Maraswami, Manikantha; Xiao, Yunyun; Loh, Teck Peng; Zhao, Yanli; Chen, Gang

2016-01-01

RNA duplex regions are often involved in tertiary interactions and protein binding and thus there is great potential in developing ligands that sequence-specifically bind to RNA duplexes. We have developed a convenient synthesis method for a modified peptide nucleic acid (PNA) monomer with a guanidine-modified 5-methyl cytosine base. We demonstrated by gel electrophoresis, fluorescence and thermal melting experiments that short PNAs incorporating the modified residue show high binding affinity and sequence specificity in the recognition of an RNA duplex containing an internal inverted Watson-Crick C-G base pair. Remarkably, the relatively short PNAs show no appreciable binding to DNA duplexes or single-stranded RNAs. The attached guanidine group stabilizes the base triple through hydrogen bonding with the G base in a C-G pair. Selective binding towards an RNA duplex over a single-stranded RNA can be rationalized by the fact that alkylation of the amine of a 5-methyl C base blocks the Watson–Crick edge. PNAs incorporating multiple guanidine-modified cytosine residues are able to enter HeLa cells without any transfection agent. PMID:27596599

Engineering Translational Activators with CRISPR-Cas System.

PubMed

Du, Pei; Miao, Chensi; Lou, Qiuli; Wang, Zefeng; Lou, Chunbo

2016-01-15

RNA parts often serve as critical components in genetic engineering. Here we report a design of translational activators which is composed of an RNA endoribonuclease (Csy4) and two exchangeable RNA modules. Csy4, a member of Cas endoribonuclease, cleaves at a specific recognition site; this cleavage releases a cis-repressive RNA module (crRNA) from the masked ribosome binding site (RBS), which subsequently allows the downstream translation initiation. Unlike small RNA as a translational activator, the endoribonuclease-based activator is able to efficiently unfold the perfect RBS-crRNA pairing. As an exchangeable module, the crRNA-RBS duplex was forwardly and reversely engineered to modulate the dynamic range of translational activity. We further showed that Csy4 and its recognition site, together as a module, can also be replaced by orthogonal endoribonuclease-recognition site homologues. These modularly structured, high-performance translational activators would endow the programming of gene expression in the translation level with higher feasibility.

Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics

PubMed Central

Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.

2015-01-01

Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

Structural studies on Pax-8 Prd domain/DNA complex.

PubMed

Campagnolo, M; Pesaresi, A; Zelezetsky, I; Geremia, S; Randaccio, L; Bisca, A; Tell, G

2007-04-01

Pax-8 is a member of the Pax family of transcription factors and is essential in the development of thyroid follicular cells. Pax-8 has two DNA-binding domains: the paired domain and the homeo domain. In this study, a preliminary X-ray diffraction analysis of the mammalian Pax-8 paired domain in complex with the C-site of the thyroglobulin promoter was achieved. The Pax-8 paired domain was crystallized by the hanging-drop vapor-diffusion method in complex with both a blunt-ended 26 bp DNA fragment and with a sticky-ended 24 bp DNA fragment with two additional overhanging bases. Crystallization experiments make clear that the growth of transparent crystals with large dimensions and regular shape is particularly influenced by ionic strength. The crystals of Pax-8 complex with blunt-ended and sticky-ended DNA, diffracted synchrotron radiation to 6.0 and 8.0 A resolution and belongs both to the C centered monoclinic system with cell dimensions: a = 89.88 A, b = 80.05 A, c = 67.73 A, and beta = 124.3 degrees and a = 256.56, b = 69.07, c = 99.32 A, and beta = 98.1 degrees , respectively. Fluorescence experiments suggest that the crystalline disorder, deduced by the poor diffraction, can be attributed to the low homogeneity of the protein-DNA sample. The theoretical comparative model of the Pax-8 paired domain complexed with the C-site of the thyroglobulin promoter shows the probable presence of some specific protein-DNA interactions already observed in other Pax proteins and the important role of the cysteine residues of PAI subdomain in the redox control of the DNA recognition.

Accounting for epistatic interactions improves the functional analysis of protein structures.

PubMed

Wilkins, Angela D; Venner, Eric; Marciano, David C; Erdin, Serkan; Atri, Benu; Lua, Rhonald C; Lichtarge, Olivier

2013-11-01

The constraints under which sequence, structure and function coevolve are not fully understood. Bringing this mutual relationship to light can reveal the molecular basis of binding, catalysis and allostery, thereby identifying function and rationally guiding protein redesign. Underlying these relationships are the epistatic interactions that occur when the consequences of a mutation to a protein are determined by the genetic background in which it occurs. Based on prior data, we hypothesize that epistatic forces operate most strongly between residues nearby in the structure, resulting in smooth evolutionary importance across the structure. We find that when residue scores of evolutionary importance are distributed smoothly between nearby residues, functional site prediction accuracy improves. Accordingly, we designed a novel measure of evolutionary importance that focuses on the interaction between pairs of structurally neighboring residues. This measure that we term pair-interaction Evolutionary Trace yields greater functional site overlap and better structure-based proteome-wide functional predictions. Our data show that the structural smoothness of evolutionary importance is a fundamental feature of the coevolution of sequence, structure and function. Mutations operate on individual residues, but selective pressure depends in part on the extent to which a mutation perturbs interactions with neighboring residues. In practice, this principle led us to redefine the importance of a residue in terms of the importance of its epistatic interactions with neighbors, yielding better annotation of functional residues, motivating experimental validation of a novel functional site in LexA and refining protein function prediction. lichtarge@bcm.edu. Supplementary data are available at Bioinformatics online.

Accounting for epistatic interactions improves the functional analysis of protein structures

PubMed Central

Wilkins, Angela D.; Venner, Eric; Marciano, David C.; Erdin, Serkan; Atri, Benu; Lua, Rhonald C.; Lichtarge, Olivier

2013-01-01

Motivation: The constraints under which sequence, structure and function coevolve are not fully understood. Bringing this mutual relationship to light can reveal the molecular basis of binding, catalysis and allostery, thereby identifying function and rationally guiding protein redesign. Underlying these relationships are the epistatic interactions that occur when the consequences of a mutation to a protein are determined by the genetic background in which it occurs. Based on prior data, we hypothesize that epistatic forces operate most strongly between residues nearby in the structure, resulting in smooth evolutionary importance across the structure. Methods and Results: We find that when residue scores of evolutionary importance are distributed smoothly between nearby residues, functional site prediction accuracy improves. Accordingly, we designed a novel measure of evolutionary importance that focuses on the interaction between pairs of structurally neighboring residues. This measure that we term pair-interaction Evolutionary Trace yields greater functional site overlap and better structure-based proteome-wide functional predictions. Conclusions: Our data show that the structural smoothness of evolutionary importance is a fundamental feature of the coevolution of sequence, structure and function. Mutations operate on individual residues, but selective pressure depends in part on the extent to which a mutation perturbs interactions with neighboring residues. In practice, this principle led us to redefine the importance of a residue in terms of the importance of its epistatic interactions with neighbors, yielding better annotation of functional residues, motivating experimental validation of a novel functional site in LexA and refining protein function prediction. Contact: lichtarge@bcm.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:24021383

Designing heteropolymers to fold into unique structures via water-mediated interactions.

PubMed

Jamadagni, Sumanth N; Bosoy, Christian; Garde, Shekhar

2010-10-28

Hydrophobic homopolymers collapse into globular structures in water driven by hydrophobic interactions. Here we employ extensive molecular dynamics simulations to study the collapse of heteropolymers containing one or two pairs of oppositely charged monomers. We show that charging a pair of monomers can dramatically alter the most stable conformations from compact globular to more open hairpin-like. We systematically explore a subset of the sequence space of one- and two-charge-pair polymers, focusing on the locations of the charge pairs. Conformational stability is governed by a balance of hydrophobic interactions, hydration and interactions of charge groups, water-mediated charged-hydrophobic monomer repulsions, and other factors. As a result, placing charge pairs in the middle, away from the hairpin ends, leads to stable hairpin-like structures. Turning off the monomer-water attractions enhances hydrophobic interactions significantly leading to a collapse into compact globular structures even for two-charge-pair heteropolymers. In contrast, the addition of salt leads to open and extended structures, suggesting that solvation of charged monomer sites by salt ions dominates the salt-induced enhancement of hydrophobic interactions. We also test the ability of a predictive scheme based on the additivity of free energy of contact formation. The success of the scheme for symmetric two-charge-pair sequences and the failure for their flipped versions highlight the complexity of the heteropolymer conformation space and of the design problem. Collectively, our results underscore the ability of tuning water-mediated interactions to design stable nonglobular structures in water and present model heteropolymers for further studies in the extended thermodynamic space and in inhomogeneous environments.

Aqua-vanadyl ion interaction with Nafion® membranes

DOE PAGES

Vijayakumar, Murugesan; Govind, Niranjan; Li, Bin; ...

2015-03-23

Lack of comprehensive understanding about the interactions between Nafion membrane and battery electrolytes prevents the straightforward tailoring of optimal materials for redox flow battery applications. In this work, we analyzed the interaction between aqua-vanadyl cation and sulfonic sites within the pores of Nafion membranes using combined theoretical and experimental X-ray spectroscopic methods. Molecular level interactions, namely, solvent share and contact pair mechanisms are discussed based on Vanadium and Sulfur K-edge spectroscopic analysis.

The Effects of Check-In, Check-Up, Check-Out for Students with Moderate Intellectual Disability during On- and Off-Site Vocational Training

ERIC Educational Resources Information Center

Boden, Lauren J.; Jolivette, Kristine; Alberto, Paul A.

2018-01-01

Check-in/check-out is a secondary-tier intervention within the positive behavior interventions and supports framework. Check-in/check-out pairs the use of an adult mentor with a daily progress report to help students meet individualized behavioral goals. This study adds to the research base by examining the effects of check-in, check-up, check-out…

Mechanistic Basis for the Bypass of a Bulky DNA Adduct Catalyzed by a Y-Family DNA Polymerase

PubMed Central

Vyas, Rajan; Efthimiopoulos, Georgia; Tokarsky, E. John; Malik, Chanchal K.; Basu, Ashis K.; Suo, Zucai

2015-01-01

1-Nitropyrene (1-NP), an environmental pollutant, induces DNA damage in vivo and is considered to be carcinogenic. The DNA adducts formed by the 1-NP metabolites stall replicative DNA polymerases but are presumably bypassed by error-prone Y-family DNA polymerases at the expense of replication fidelity and efficiency in vivo. Our running start assays confirmed that a site-specifically placed 8-(deoxyguanosin-N2-yl)-1-aminopyrene (dG1,8), one of the DNA adducts derived from 1-NP, can be bypassed by Sulfolobus solfataricus DNA polymerase IV (Dpo4), although this representative Y-family enzyme was paused strongly by the lesion. Pre-steady-state kinetic assays were employed to determine the low nucleotide incorporation fidelity and establish a minimal kinetic mechanism for the dG1,8 bypass by Dpo4. To reveal a structural basis for dCTP incorporation opposite dG1,8, we solved the crystal structures of the complexes of Dpo4 and DNA containing a templating dG1,8 lesion in the absence or presence of dCTP. The Dpo4·DNA-dG1,8 binary structure shows that the aminopyrene moiety of the lesion stacks against the primer/template junction pair, while its dG moiety projected into the cleft between the Finger and Little Finger domains of Dpo4. In the Dpo4·DNA-dG1,8·dCTP ternary structure, the aminopyrene moiety of the dG1,8 lesion, is sandwiched between the nascent and junction base pairs, while its base is present in the major groove. Moreover, dCTP forms a Watson–Crick base pair with dG, two nucleotides upstream from the dG1,8 site, creating a complex for “-2” frameshift mutation. Mechanistically, these crystal structures provide additional insight into the aforementioned minimal kinetic mechanism. PMID:26327169

PM 10 levels in communities close to and away from opencast coal mining sites in Northeast England

NASA Astrophysics Data System (ADS)

Pless-Mulloli, Tanja; King, Andrew; Howel, Denise; Stone, Ian; Merefield, John

Concerns about levels of particulate matter of less than 10 μm (PM 10) and their potential health effects have been raised by residents living near opencast coal mining sites in the UK. PM 10 levels were measured by TEOM in 5 matched pairs of communities in northeast England, 5 near active opencast sites and 5 further away, to characterise the PM 10 exposure of residents. 14 609 paired 30-min TEOM readings, and weather data were collected during 1996-97, over 6 weeks each in four pairs and for 24 weeks in one pair. Co-located samplers collected PM 10 on an approximately weekly basis and samples were analysed using scanning electron microscopy with energy dispersive analysis (SEM-EDS). The patterns of PM 10 levels over time were similar in Opencast and Control Communities and were mostly similar to readings from nearby automated urban network stations. This suggested regional influences on PM 10 levels. The geometric mean PM 10 was 17.0 μg m -3 in Opencast and 14.9 μg m -3 in Control Communities (arithmetic mean 22.1 μg m -3 in Opencast 18.2 μg m -3 in Control Communities): Opencast Communities thus had 14% higher PM 10 levels than Control Communities on average. While the size distribution and proportion of shale particles indicated the opencast site as contributor to the PM 10 load in adjacent communities, elevated PM 10 levels in Opencast Communities were not positively linked with permitted working hours or wind direction being from the site to the community. No consistent relationship was found between PM 10 levels and wind speed or day of the week.

Incorporating evolution of transcription factor binding sites into annotated alignments.

PubMed

Bais, Abha S; Grossmann, Stefen; Vingron, Martin

2007-08-01

Identifying transcription factor binding sites (TFBSs) is essential to elucidate putative regulatory mechanisms. A common strategy is to combine cross-species conservation with single sequence TFBS annotation to yield "conserved TFBSs". Most current methods in this field adopt a multi-step approach that segregates the two aspects. Again, it is widely accepted that the evolutionary dynamics of binding sites differ from those of the surrounding sequence. Hence, it is desirable to have an approach that explicitly takes this factor into account. Although a plethora of approaches have been proposed for the prediction of conserved TFBSs, very few explicitly model TFBS evolutionary properties, while additionally being multi-step. Recently, we introduced a novel approach to simultaneously align and annotate conserved TFBSs in a pair of sequences. Building upon the standard Smith-Waterman algorithm for local alignments, SimAnn introduces additional states for profiles to output extended alignments or annotated alignments. That is, alignments with parts annotated as gaplessly aligned TFBSs (pair-profile hits)are generated. Moreover,the pair- profile related parameters are derived in a sound statistical framework. In this article, we extend this approach to explicitly incorporate evolution of binding sites in the SimAnn framework. We demonstrate the extension in the theoretical derivations through two position-specific evolutionary models, previously used for modelling TFBS evolution. In a simulated setting, we provide a proof of concept that the approach works given the underlying assumptions,as compared to the original work. Finally, using a real dataset of experimentally verified binding sites in human-mouse sequence pairs,we compare the new approach (eSimAnn) to an existing multi-step tool that also considers TFBS evolution. Although it is widely accepted that binding sites evolve differently from the surrounding sequences, most comparative TFBS identification methods do not explicitly consider this.Additionally, prediction of conserved binding sites is carried out in a multi-step approach that segregates alignment from TFBS annotation. In this paper, we demonstrate how the simultaneous alignment and annotation approach of SimAnn can be further extended to incorporate TFBS evolutionary relationships. We study how alignments and binding site predictions interplay at varying evolutionary distances and for various profile qualities.

The structure of ribosome-lankacidin complex reveals ribosomal sites for synergistic antibiotics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Auerbach, Tamar; Mermershtain, Inbal; Davidovich, Chen

2010-04-26

Crystallographic analysis revealed that the 17-member polyketide antibiotic lankacidin produced by Streptomyces rochei binds at the peptidyl transferase center of the eubacterial large ribosomal subunit. Biochemical and functional studies verified this finding and showed interference with peptide bond formation. Chemical probing indicated that the macrolide lankamycin, a second antibiotic produced by the same species, binds at a neighboring site, at the ribosome exit tunnel. These two antibiotics can bind to the ribosome simultaneously and display synergy in inhibiting bacterial growth. The binding site of lankacidin and lankamycin partially overlap with the binding site of another pair of synergistic antibiotics, themore » streptogramins. Thus, at least two pairs of structurally dissimilar compounds have been selected in the course of evolution to act synergistically by targeting neighboring sites in the ribosome. These results underscore the importance of the corresponding ribosomal sites for development of clinically relevant synergistic antibiotics and demonstrate the utility of structural analysis for providing new directions for drug discovery.« less

Nucleic acid duplexes incorporating a dissociable covalent base pair

NASA Technical Reports Server (NTRS)

Gao, K.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

1999-01-01

We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure.

Fish assemblages of the Casiquiare River, a corridor and zoogeographical filter for dispersal between the Orinoco and Amazon basins

USGS Publications Warehouse

Winemiller, K.O.; Lopez-Fernandez, H.; Taphorn, D.C.; Nico, L.G.; Duque, A.B.

2008-01-01

Aim: The aim of this study was to determine whether the Casiquiare River functions as a free dispersal corridor or as a partial barrier (i.e. filter) for the interchange of fish species of the Orinoco and Negro/Amazon basins using species assemblage patterns according to geographical location and environmental features. Location: The Casiquiare, Upper Orinoco and Upper Negro rivers in southern Venezuela, South America. Methods: Our study was based on an analysis of species presence/absence data and environmental information (11 habitat characteristics) collected by the authors and colleagues between the years 1984 and 1999. The data set consisted of 269 sampled sites and 452 fish species (> 50,000 specimens). A wide range of habitat types was included in the samples, and the collection sites were located at various points along the entire length of the Casiquiare main channel, at multiple sites on its tributary streams, as well as at various nearby sites outside the Casiquiare drainage, within the Upper Orinoco and Upper Rio Negro river systems. Most specimens and field data used in this analysis are archived in the Museo de Ciencias Naturales in Guanare, Venezuela. We performed canonical correspondence analysis (CCA) based on species presence/absence using two versions of the data set: one that eliminated sites having < 5 species and species occurring at < 5 sites; and another that eliminated sites having < 10 species and species occurring at < 10 sites. Cluster analysis was performed on sites based on species assemblage similarity, and a separate analysis was performed on species based on CCA loadings. Results: The CCA results for the two versions of the data set were qualitatively the same. The dominant environmental axis contrasted assemblages and sites associated with blackwater vs. clearwater conditions. Longitudinal position on the Casiquiare River was correlated (r2 = 0.33) with CCA axis-1 scores, reflecting clearwater conditions nearer to its origin (bifurcation of the Orinoco) and blackwater conditions nearer to its mouth (junction with the Rio Negro). The second CCA axis was most strongly associated with habitat size and structural complexity. Species associations derived from the unweighted pair-group average clustering method and pair-wise squared Euclidean distances calculated from species loadings on CCA axes 1 and 2 showed seven ecological groupings. Cluster analysis of species assemblages according to watershed revealed a stronger influence of local environmental conditions than of geographical proximity. Main conclusions: Fish assemblage composition is more consistently associated with local environmental conditions than with geographical position within the river drainages. Nonetheless, the results support the hypothesis that the mainstem Casiquiare represents a hydrochemical gradient between clearwaters at its origin and blackwaters at its mouth, and as such appears to function as a semi-permeable barrier (environmental filter) to dispersal and faunal exchanges between the partially vicariant fish faunas of the Upper Orinoco and Upper Negro rivers. ?? 2008 The Authors.

An integrated, structure- and energy-based view of the genetic code.

PubMed

Grosjean, Henri; Westhof, Eric

2016-09-30

The principles of mRNA decoding are conserved among all extant life forms. We present an integrative view of all the interaction networks between mRNA, tRNA and rRNA: the intrinsic stability of codon-anticodon duplex, the conformation of the anticodon hairpin, the presence of modified nucleotides, the occurrence of non-Watson-Crick pairs in the codon-anticodon helix and the interactions with bases of rRNA at the A-site decoding site. We derive a more information-rich, alternative representation of the genetic code, that is circular with an unsymmetrical distribution of codons leading to a clear segregation between GC-rich 4-codon boxes and AU-rich 2:2-codon and 3:1-codon boxes. All tRNA sequence variations can be visualized, within an internal structural and energy framework, for each organism, and each anticodon of the sense codons. The multiplicity and complexity of nucleotide modifications at positions 34 and 37 of the anticodon loop segregate meaningfully, and correlate well with the necessity to stabilize AU-rich codon-anticodon pairs and to avoid miscoding in split codon boxes. The evolution and expansion of the genetic code is viewed as being originally based on GC content with progressive introduction of A/U together with tRNA modifications. The representation we present should help the engineering of the genetic code to include non-natural amino acids. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Tunable multiple emissions in manganese-concentrated sulfide through simultaneous tailoring of Mn-site coordination and Mn-Mn pair geometry

NASA Astrophysics Data System (ADS)

Chen, Zitao; Song, Enhai; Ye, Shi; Zhang, Qinyuan

2017-12-01

In contrast to generally single-band visible emission feature from Mn2+, simultaneous visible (VIS) and near-infrared (NIR) multiple emissions are demonstrated in Mn2+ concentrated sulfide (MnS) by only involving a single crystallographic site. Upon varying the Mn2+-site coordination and/or Mn-Mn pairs geometry in different structural MnS, the multiple emissions from divalent manganese can be easily tuned from 575 to 720 nm (VIS) or from 880 to 900 or 1380 nm (NIR), respectively. The excitation spectroscopy and the luminescent decay, together with crystal structural analyses, are employed to investigate the electronic transition and the excited state dynamics of these Mn2+ concentrated systems. It is found that the VIS and NIR emissions can be ascribed to the isolated Mn2+ ion and exchange coupled Mn-Mn pair center, respectively. The effect of crystal field and bridging geometry, as well as temperature on the exchange coupled Mn2+ pairs NIR emissive center, is also investigated in detail. This work not only provides keen insights into the de-excitation pathway of Mn2+-concentrated material, but also offers the possibilities of designing a novel NIR emitting source for various photonic applications.

Correlation between pairing initiation sites, recombination nodules and meiotic recombination in Sordaria macrospora.

PubMed

Zickler, D; Moreau, P J; Huynh, A D; Slezec, A M

1992-09-01

The decrease of meiotic exchanges (crossing over and conversion) in two mutants of Sordaria macrospora correlated strongly with a reduction of chiasmata and of both types of "recombination nodules." Serial section reconstruction electron microscopy was used to compare the synapsis pattern of meiotic prophase I in wild type and mutants. First, synapsis occurred but the number of synaptonemal complex initiation sites was reduced in both mutants. Second, this reduction was accompanied by, or resulted in, modifications of the pattern of synapsis. Genetic and synaptonemal complex maps were compared in three regions along one chromosome arm divided into well marked intervals. Reciprocal exchange frequencies and number of recombination nodules correlated in wild type in the three analyzed intervals, but disparity was found between the location of recombination nodules and exchanges in the mutants. Despite the twofold exchange decrease, sections of the genome such as the short arm of chromosome 2 and telomere regions were sheltered from nodule decrease and from pairing modifications. This indicated a certain amount of diversity in the control of these features and suggested that exchange frequency was dependent not only on the amount of effective pairing but also on the localization of the pairing sites, as revealed by the synaptonemal complex progression in the mutants.

Correlation between Pairing Initiation Sites, Recombination Nodules and Meiotic Recombination in Sordaria Macrospora

PubMed Central

Zickler, D.; Moreau, PJF.; Huynh, A. D.; Slezec, A. M.

1992-01-01

The decrease of meiotic exchanges (crossing over and conversion) in two mutants of Sordaria macrospora correlated strongly with a reduction of chiasmata and of both types of ``recombination nodules.'' Serial section reconstruction electron microscopy was used to compare the synapsis pattern of meiotic prophase I in wild type and mutants. First, synapsis occurred but the number of synaptonemal complex initiation sites was reduced in both mutants. Second, this reduction was accompanied by, or resulted in, modifications of the pattern of synapsis. Genetic and synaptonemal complex maps were compared in three regions along one chromosome arm divided into well marked intervals. Reciprocal exchange frequencies and number of recombination nodules correlated in wild type in the three analyzed intervals, but disparity was found between the location of recombination nodules and exchanges in the mutants. Despite the twofold exchange decrease, sections of the genome such as the short arm of chromosome 2 and telomere regions were sheltered from nodule decrease and from pairing modifications. This indicated a certain amount of diversity in the control of these features and suggested that exchange frequency was dependent not only on the amount of effective pairing but also on the localization of the pairing sites, as revealed by the synaptonemal complex progression in the mutants. PMID:1398050

Measurement of flows for two irrigation districts in the lower Colorado River basin, Texas

USGS Publications Warehouse

Coplin, L.S.; Liscum, Fred; East, J.W.; Goldstein, L.B.

1996-01-01

The Lower Colorado River Authority sells and distributes water for irrigation of rice farms in two irrigation districts, the Lakeside district and the Gulf Coast district, in the lower Colorado River Basin of Texas. In 1993, the Lower Colorado River Authority implemented a water-measurement program to account for the water delivered to rice farms and to promote water conservation. During the rice-irrigation season (summer and fall) of 1995, the U.S. Geological Survey measured flows at 30 sites in the Lakeside district and 24 sites in the Gulf Coast district coincident with Lower Colorado River Authority measuring sites. In each district, the Survey made essentially simultaneous flow measurements with different types of meters twice a day once in the morning and once in the afternoon at each site on selected days for comparison with Lower Colorado River Authority measurements. One-hundred pairs of corresponding (same site, same date) Lower Colorado River Authority and U.S. Geological Survey measurements from the Lakeside district and 104 measurement pairs from the Gulf Coast district are compared statistically and graphically. For comparison, the measurement pairs are grouped by irrigation district and further subdivided by the time difference between corresponding measurements less than or equal to 1 hour or more than 1 hour. Wilcoxon signed-rank tests (to indicate whether two groups of paired observations are statistically different) on Lakeside district measurement pairs with 1 hour or less between measurements indicate that the Lower Colorado River Authority and U.S. Geological Survey measurements are not statistically different. The median absolute percent difference between the flow measurements is 5.9 percent; and 33 percent of the flow measurements differ by more than 10 percent. Similar statistical tests on Gulf Coast district measurement pairs with 1 hour or less between measurements indicate that the Lower Colorado River Authority and U.S. Geological Survey measurements are not statistically different. The median absolute percent difference between the flow measurements is 2.6 percent; and 30 percent of the flow measurements differ by more than 10 percent. The differences noted above between Lower Colorado River Authority and U.S. Geological Survey measurements with 1 hour or less between measurements and the differences between essentially simultaneous U.S. Geological Survey measurements are of similar orders of magnitude and, in some cases, very close.

An assessment of African test sites in the context of a global network of quality-assured reference standards

USGS Publications Warehouse

Chander, G.; Xiong, X.; Angal, A.; Choi, T.

2009-01-01

The Committee on Earth Observation Satellites (CEOS) Infrared and Visible Optical Sensors (IVOS) subgroup members established a set of CEOS-endorsed globally distributed reference standard test sites for the postlaunch calibration of space-based optical imaging sensors. This paper discusses the top five African pseudo-invariant sites (Libya 4, Mauritania 1/2, Algeria 3, Libya 1, and Algeria 5) that were identified by the IVOS subgroup. This paper focuses on monitoring the long-term radiometric stability of the Terra Moderate Resolution Imaging Spectroradiometer (MODIS) and the Landsat 7 (L7) Enhanced Thematic Mapper Plus (ETM+) sensors using near-simultaneous and cloud-free image pairs acquired from launch to December 2008 over the five African desert sites. Residual errors and coefficients of determination were also generated to support the quality assessment of the calibration differences between the two sensors. An effort was also made to evaluate the relative stability of these sites for long-term monitoring of the optical sensors. ??2009 IEEE.

Theory of the interplay between the superconductivity and the blocked antiferromagnetic order in A(y)Fe(2-x)Se2.

PubMed

Jiang, Hong-Min

2012-09-26

Based on an effective two-orbital tight-binding model, we examine the possible superconducting states in iron-vacancy-ordered A(y)Fe(2-x)Se(2). In the presence of ordered vacancies and blocked antiferromagnetic order, it is shown that the emergent SC pairing is the nodeless next-nearest-neighbor (NNN)-pairing due to the dominant antiferromagnetic (AFM) interaction between the inter-block NNN sites. In particular, we show that due to the ordered vacancies and the associated blocked AFM order, the interplay between the superconducting and AFM states results in three distinct states in the phase diagram as doping is varied. The divergent experimental observations can be accounted for by considering the different charge carrier concentrations in their respective compounds.

Structural identification of Zn xZr yO z catalysts for Cascade aldolization and self-deoxygenation reactions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baylon, Rebecca A. L.; Sun, Junming; Kovarik, Libor

Complementary characterizations, such as nitrogen sorption, X-ray diffraction (XRD), X-ray photoelectron spectroscopy (XPS), visible Raman, scanning transmission electron microscopy (STEM) coupled with elemental mapping, NH3/CO2 temperature programmed desorption (NH3/CO2-TPD), infrared spectroscopic analysis of adsorbed pyridine (Py-IR), and CO2-IR, have been employed to identify the structure and surface chemistry (i.e., acid-base) of mixed Zn xZr yO z oxide catalysts of varied ratios of Zn/Zr. Atomically dispersed Zn2+ species are present in the framework within a thin surface shell (1.5-2.0 nm) of ZrO2 particles when the Zn/Zr ratio is smaller than 1/10; when the ratio is above this, both atomically dispersed Zn2+more » and ZnO clusters coexist in mixed Zn xZr yO z oxide catalysts. The presence of ZnO clusters shows no significant side effect but only a slight increase of selectivity to CO2, caused by steam reforming. The incorporation of atomic Zn2+ into the ZrO2 framework was found to not only passivate strong Lewis acid sites (i.e., Zr-O-Zr) on ZrO2, but to also generate new Lewis acid-base site pairs with enhanced Lewis basicity on the bridged O (i.e., ). In the mixed ketone (i.e., acetone and methyl ethyl ketone (MEK)) reactions, while the passivation of strong acid sites can be correlated to the inhibition of side reactions, such as ketone decomposition and coking, the new Lewis acid-base pairs introduced enhance the cascade aldolization and self-deoxygenation reactions involved in olefin (C3=-C6=) production. More importantly, the surface acid-base properties change with varying Zn/Zr ratios, which in turn affect the cross- and self-condensation reactivity and subsequent distribution of olefins.« less

Structural Identification of Zn xZr yO z Catalysts for Cascade Aldolization and Self-Deoxygenation Reactions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baylon, Rebecca A. L.; Sun, Junming; Kovarik, Libor

Here, complementary characterizations, such as nitrogen sorption, X-ray diffraction (XRD), X-ray photoelectron spectroscopy (XPS), visible Raman, scanning transmission electron microscopy (STEM) coupled with elemental mapping, NH 3/CO 2 temperature programmed desorption (NH 3/CO 2-TPD), infrared spectroscopic analysis of adsorbed pyridine (Py-IR), and CO 2-IR, have been employed to identify the structure and surface chemistry (i.e., acid-base) of mixed Zn xZr yO z oxide catalysts of varied ratios of Zn/Zr. Atomically dispersed Zn 2+ species are present in the framework within a thin surface shell (1.5-2.0 nm) of ZrO 2 particles when the Zn/Zr ratio is smaller than 1/10; when the ratio is above this, both atomically dispersed Zn 2+ and ZnO clusters coexist in mixed Zn xZr yO z oxide catalysts. The presence of ZnO clusters shows no significant side effect but only a slight increase of selectivity to CO 2, caused by steam reforming. The incorporation of atomic Zn 2+ into the ZrO 2 framework was found to not only passivate strong Lewis acid sites (i.e., Zr-O-Zr) on ZrO 2, but to also generate new Lewis acid-base site pairs with enhanced Lewis basicity on the bridged O (i.e., Zr—omore » $$\\curvearrowleft\\atop{e\\atop—}$$Zn). In the mixed ketone (i.e., acetone and methyl ethyl ketone (MEK)) reactions, while the passivation of strong acid sites can be correlated to the inhibition of side reactions, such as ketone decomposition and coking, the new Lewis acid-base pairs introduced enhance the cascade aldolization and self-deoxygenation reactions involved in olefin (C 3 =-C 6 =) production. More importantly, the surface acid-base properties change with varying Zn/Zr ratios, which in turn affect the cross- and self-condensation reactivity and subsequent distribution of olefins.« less

Structural Identification of Zn xZr yO z Catalysts for Cascade Aldolization and Self-Deoxygenation Reactions

DOE PAGES

Baylon, Rebecca A. L.; Sun, Junming; Kovarik, Libor; ...

2018-04-22

Here, complementary characterizations, such as nitrogen sorption, X-ray diffraction (XRD), X-ray photoelectron spectroscopy (XPS), visible Raman, scanning transmission electron microscopy (STEM) coupled with elemental mapping, NH 3/CO 2 temperature programmed desorption (NH 3/CO 2-TPD), infrared spectroscopic analysis of adsorbed pyridine (Py-IR), and CO 2-IR, have been employed to identify the structure and surface chemistry (i.e., acid-base) of mixed Zn xZr yO z oxide catalysts of varied ratios of Zn/Zr. Atomically dispersed Zn 2+ species are present in the framework within a thin surface shell (1.5-2.0 nm) of ZrO 2 particles when the Zn/Zr ratio is smaller than 1/10; when the ratio is above this, both atomically dispersed Zn 2+ and ZnO clusters coexist in mixed Zn xZr yO z oxide catalysts. The presence of ZnO clusters shows no significant side effect but only a slight increase of selectivity to CO 2, caused by steam reforming. The incorporation of atomic Zn 2+ into the ZrO 2 framework was found to not only passivate strong Lewis acid sites (i.e., Zr-O-Zr) on ZrO 2, but to also generate new Lewis acid-base site pairs with enhanced Lewis basicity on the bridged O (i.e., Zr—omore » $$\\curvearrowleft\\atop{e\\atop—}$$Zn). In the mixed ketone (i.e., acetone and methyl ethyl ketone (MEK)) reactions, while the passivation of strong acid sites can be correlated to the inhibition of side reactions, such as ketone decomposition and coking, the new Lewis acid-base pairs introduced enhance the cascade aldolization and self-deoxygenation reactions involved in olefin (C 3 =-C 6 =) production. More importantly, the surface acid-base properties change with varying Zn/Zr ratios, which in turn affect the cross- and self-condensation reactivity and subsequent distribution of olefins.« less

High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

PubMed

Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

2015-11-02

Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Impact of a low-technology simulation-based obstetric and newborn care training scheme on non-emergency delivery practices in Guatemala.

PubMed

Walton, Anna; Kestler, Edgar; Dettinger, Julia C; Zelek, Sarah; Holme, Francesca; Walker, Dilys

2016-03-01

To assess the effect of a low-technology simulation-based training scheme for obstetric and perinatal emergency management (PRONTO; Programa de Rescate Obstétrico y Neonatal: Tratamiento Óptimo y Oportuno) on non-emergency delivery practices at primary level clinics in Guatemala. A paired cross-sectional birth observation study was conducted with a convenience sample of 18 clinics (nine pairs of intervention and control clinics) from June 28 to August 7, 2013. Outcomes included implementation of practices known to decrease maternal and/or neonatal mortality and improve patient care. Overall, 25 and 17 births occurred in intervention and control clinics, respectively. Active management of the third stage of labor was appropriately performed by 20 (83%) of 24 intervention teams versus 7 (50%) of 14 control teams (P=0.015). Intervention teams implemented more practices to decrease neonatal mortality than did control teams (P<0.001). Intervention teams ensured patient privacy in 23 (92%) of 25 births versus 11 (65%) of 17 births for control teams (P=0.014). All 15 applicable intervention teams kept patients informed versus 6 (55%) of 11 control teams (P=0.001). Differences were also noted in teamwork; in particular, skill-based tools were used more often at intervention sites than control sites (P=0.012). Use of PRONTO enhanced non-emergency delivery care by increasing evidence-based practice, patient-centered care, and teamwork. Copyright © 2015 International Federation of Gynecology and Obstetrics. Published by Elsevier Ireland Ltd. All rights reserved.

Mapping shallow waters habitats using OBIA by applying several approaches of depth invariant index in North Kepulauan Seribu

NASA Astrophysics Data System (ADS)

Siregar, V. P.; Agus, S. B.; Subarno, T.; Prabowo, N. W.

2018-05-01

The availability of satellite imagery with a variety of spatial resolution, both free access and commercial become as an option in utilizing the remote sensing technology. Variability of the water column is one of the factors affecting the interpretation results when mapping marine shallow waters. This study aimed to evaluate the influence of water column correction (depth-invariant index) on the accuracy of shallow water habitat classification results using OBIA. This study was conducted in North of Kepulauan Seribu, precisely in Harapan Island and its surrounding areas. Habitat class schemes were based on field observations, which were then used to build habitat classes on satellite imagery. The water column correction was applied to the three pairs of SPOT-7 multispectral bands, which were subsequently used in object-based classification. Satellite image classification was performed with four different approaches, namely (i) using DII transformed bands with single pair band input (B1B2), (ii) multi pairs bands (B1B2, B1B3, and B2B3), (iii) combination of multi pairs band and initial bands, and (iv) only using initial bands. The accuracy test results of the four inputs show the values of Overall Accuracy and Kappa Statistics, respectively 55.84 and 0.48; 68.53 and 0.64; 78.68 and 0.76; 77.66 and 0.74. It shows that the best results when using DII and initial band combination for shallow water benthic classification in this study site.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harner, E.J.; Gilfillan, E.S.

Two large shoreline assessment studies conducted in 1990 in Prince William Sound, Alaska, after the Exxon Valdez oil spill used different design strategies to determine the impact of oiling on shoreline biota. One of the studies, the Coastal Habitat Injury Assessment (CHIA) conducted for the Exxon Valdez Oil Spill Council, used matched pairs of sites, normal population distributions for biota, and meta-analysis. The power of the CHIA study to detect oiling impacts depends on being able to identify and select appropriate pairs of sites for comparison. The CHIA study also increased the oiling signal by focusing on moderate to heavilymore » oiled sites. The Shoreline Ecology Program (SEP), conducted for Exxon, used a stratified-random-sampling study design, normal and non-normal population distributions and covariates. The SEP study was able to detect oiling impacts by using a sufficient number of sites and widely spaced transects.« less

The nearest neighbor and next nearest neighbor effects on the thermodynamic and kinetic properties of RNA base pair

NASA Astrophysics Data System (ADS)

Wang, Yujie; Wang, Zhen; Wang, Yanli; Liu, Taigang; Zhang, Wenbing

2018-01-01

The thermodynamic and kinetic parameters of an RNA base pair with different nearest and next nearest neighbors were obtained through long-time molecular dynamics simulation of the opening-closing switch process of the base pair near its melting temperature. The results indicate that thermodynamic parameters of GC base pair are dependent on the nearest neighbor base pair, and the next nearest neighbor base pair has little effect, which validated the nearest-neighbor model. The closing and opening rates of the GC base pair also showed nearest neighbor dependences. At certain temperature, the closing and opening rates of the GC pair with nearest neighbor AU is larger than that with the nearest neighbor GC, and the next nearest neighbor plays little role. The free energy landscape of the GC base pair with the nearest neighbor GC is rougher than that with nearest neighbor AU.

Cooperation and competition in business on example of Internet research of opto-electronic companies

NASA Astrophysics Data System (ADS)

Kaliczyńska, Małgorzata

2006-10-01

Based on findings from earlier studies which showed that links to academic web sites contain important information, the following study examines the practicability of using co-link data to describe cooperation and competition in optoelec-tronic business. The analysis was based on 32 companies and organizations which were found in an issue of a specialist magazine. For the purpose of the research three search engines - Google, Yahoo! and MSN Search were used. Assuming that a number of co-links to a pair of Web sites is a measure of the similarity between the two companies, the study aims at search for the sets of companies that would be similar to one another. The method applied is the MDS - multidimensional scaling that allows to present results of the analysis on a 2D map.

[Structural and Dipole Structure Peculiarities of Hoogsteen Base Pairs Formed in Complementary Nucleobases according to ab initio Quantum Mechanics Studies].

PubMed

Petrenko, Y M

2015-01-01

Ab initio quantum mechanics studies for the detection of structure and dipole structure peculiarities of Hoogsteen base pairs relative to Watson-Crick base pairs, were performed during our work. These base pairs are formed as a result of complementary interactions. It was revealed, that adenine-thymine Hoogsteen base pair and adenine-thymine Watson-Crick base pairs can be formed depending on initial configuration. Cytosine-guanine Hoogsteen pairs are formed only when cytosine was originally protonated. Both types of Hoogsteen pairs have noticeable difference in the bond distances and angles. These differences appeared in purine as well as in pyrimidine parts of the pairs. Hoogsteen pairs have mostly shorter hydrogen bond lengths and significantly larger angles of hydrogen bonds and larger angles between the hydrogen bonds than Watson-Crick base pairs. Notable differences are also observed with respect to charge distribution and dipole moment. Quantitative data on these differences are shown in our work. It is also reported that the values of local parameters (according to Cambridge classification of the parameters which determine DNA properties) in Hoogsteen base pairs, are greatly different from Watson-Crick ones.

Nucleic acid duplexes incorporating a dissociable covalent base pair

PubMed Central

Gao, Kui; Orgel, Leslie E.

1999-01-01

We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure. PMID:10611299

The interval between cancer diagnosis among mothers and offspring in a population-based cohort.

PubMed

Paltiel, Ora; Friedlander, Yehiel; Deutsch, Lisa; Yanetz, Rebecca; Calderon-Margalit, Ronit; Tiram, Efrat; Hochner, Hagit; Barchana, Micha; Harlap, Susan; Manor, Orly

2007-01-01

Familial cancers may be due to shared genes or environment, or chance aggregation. We explored the possibility that ascertainment bias influences cancer detection in families, bearing upon the time interval between diagnosis of affected mothers and offspring. The Jerusalem Perinatal Study (JPS) comprises all mothers (n = 39,734) from Western Jerusalem who gave birth 1964 -1976 and their offspring (n = 88,829). After linking identification numbers with Israel's Cancer Registry we measured the absolute time interval between initial cancer diagnoses in affected mother-offspring pairs. We tested the probability of obtaining intervals as short as those observed by chance alone, using a permutation test on the median interval. By June 2003 cancer had developed in 105 mother-offspring pairs within the cohort. Common sites among mothers were breast (47%), colorectal (9%), non-Hodgkin lymphoma (NHL) (8%) and cervix (7%), while for offspring in affected pairs common cancers were leukemia (12.4%), thyroid (13.3%), NHL (10.5%), breast (10.5%) and melanoma (7.6%). The median interval between diagnoses was 5.9 years, but for 33% of affected pairs the interval was < or =3 years. The probability of this occurring by chance alone was 0.03. This held true whether the offspring's or mother's diagnosis was first (P < 0.01). In a population-based cohort followed for three decades, the absolute interval between the diagnosis of cancer in mothers and their offspring is shorter than expected by chance. Explanations include shared environmental exposures or the possibility that cancer ascertainment in one pair member affects health behaviors in the other resulting in early diagnosis. The latter may bias the estimation of anticipation and survival in familial cancers.

Generation of a pair of independently binding DNA aptamers in a single round of selection using proximity ligation.

PubMed

Chumphukam, O; Le, T T; Piletsky, S; Cass, A E G

2015-05-28

The ability to rapidly generate a pair of aptamers that bind independently to a protein target would greatly extend their use as reagents for two site ('sandwich') assays. We describe here a method to achieve this through proximity ligation. Using lysozyme as a target we demonstrate that under optimal conditions such a pair of aptamers, with nanomolar affinities, can be generated in a single round.

Diethylpyrocarbonate and permanganate provide evidence for an unusual DNA conformation induced by binding of the antitumour antibiotics bleomycin and phleomycin.

PubMed Central

Fox, K R; Grigg, G W

1988-01-01

DNA structural changes induced by bleomycin have been investigated using diethylpyrocarbonate and permanganate as probes under conditions in which the antibiotic binds to, but does not cut the DNA. Diethyl-pyrocarbonate shows an enhanced reaction with adenines in the presence of the antibiotic in the sequences GTA greater than GCA greater than GAA, on the 3' side of the drug cutting site (GPy). Permanganate ions display an enhanced reactivity at the second pyrimidine of the sequence GPyPy. The results are consistent with a model in which bleomycin distorts the structure of the base pair on the 3' side of its binding site. Images PMID:2451809

Heterochromatin and rDNA sites distribution in the holocentric chromosomes of Cuscuta approximata Bab. (Convolvulaceae).

PubMed

Guerra, Marcelo; García, Miguel A

2004-02-01

Cuscuta is a widely distributed genus of holoparasitic plants. Holocentric chromosomes have been reported only in species of one of its subgenera (Cuscuta subg. Cuscuta). In this work, a representative of this subgenus, Cuscuta approximata, was investigated looking for its mitotic and meiotic chromosome behaviour and the heterochromatin distribution. The mitotic chromosomes showed neither primary constriction nor Rabl orientation whereas the meiotic ones exhibited the typical quadripartite structure characteristic of holocentrics, supporting the assumption of holocentric chromosomes as a synapomorphy of Cuscuta subg. Cuscuta. Chromosomes and interphase nuclei displayed many heterochromatic blocks that stained deeply with hematoxylin, 4',6-diamidino-2-phenylindole (DAPI), or after C banding. The banded karyotype showed terminal or subterminal bands in all chromosomes and central bands in some of them. The single pair of 45S rDNA sites was observed at the end of the largest chromosome pair, close to a DAPI band and a 5S rDNA site. Two other 5S rDNA site pairs were found, both closely associated with DAPI bands. The noteworthy giant nuclei of glandular cells of petals and ovary wall exhibited large chromocentres typical of polytenic nuclei. The chromosomal location of heterochromatin and rDNA sites and the structure of the endoreplicated nuclei of C. approximata seemed to be similar to those known in monocentric nuclei, suggesting that centromeric organization has little or no effect on chromatin organization.

Long-term application of winery wastewater - Effect on soil microbial populations and soil chemistry

NASA Astrophysics Data System (ADS)

Mosse, Kim; Patti, Antonio; Smernik, Ron; Cavagnaro, Timothy

2010-05-01

The ability to reuse winery wastewater (WWW) has potential benefits both with respect to treatment of a waste stream, as well as providing a beneficial water resource in water limited regions such as south-eastern Australia, California and South Africa. Over an extended time period, this practice leads to changes in soil chemistry, and potentially, also to soil microbial populations. In this study, we compared the short term effects of WWW (both treated and untreated) application on soil biology and chemistry in two adjacent paired sites with the same soil type, one of which had received WWW for approximately 30 years, and the other which had not. The paired sites were treated with an industrially relevant quantity of WWW, and the soil microbial activity (measured as soil CO2 efflux) and common soil physicochemical properties were monitored over a 16-day period. In addition, Solid State 13C NMR was employed on whole soil samples from the two sites, to measure and compare the chemical nature of the soil organic matter at the paired sites. The acclimatised soil showed a high level of organic matter and a greater spike in microbial activity following WWW addition, in comparison with the non-acclimatised soil, suggesting differences in soil chemistry and soil microbial communities between the two sites. Soil nitrate and phosphorus levels showed significant differences between WWW treatments; these differences likely to be microbially mediated.

Impact of Supplementary Feeding on Reproductive Success of White Storks

PubMed Central

Hilgartner, Roland; Stahl, Daniel; Zinner, Dietmar

2014-01-01

European white stork (Ciconia ciconia) populations have been object to several conservation measures such as reintroduction programs, habitat improvement or supplementary feeding in the last decades. Although recent white stork censuses revealed an upward trend of most of the western populations, evaluations of the relative importance of certain conservation measures are still scarce or even lacking. In our study we analyzed the effect of supplementary feeding on the reproductive success of white storks in conjunction with other factors such as weather or nest site characteristics. We present data of 569 breeding events at 80 different nest sites located in variable distances to an artificial feeding site at Affenberg Salem (south-western Germany) collected from 1990–2012. A multilevel Poisson regression revealed that in our study population (1) reproductive success was negatively affected by monthly precipitation in April, May and June, (2) pairs breeding on power poles had a lower reproductive success than pairs breeding on platforms or trees and (3) reproductive success was significantly higher in pairs breeding in close distance to the feeding site. The number of fledglings per nest decreased by 8% per kilometer distance to the feeding site. Our data suggest that supplementary feeding increases fledgling populations which may be a tool to attenuate population losses caused by factors such as habitat deterioration or unfavorable conditions in wintering habitats. PMID:25119566

Enzyme-coupled nanoparticles-assisted laser desorption ionization mass spectrometry for searching for low-mass inhibitors of enzymes in complex mixtures.

PubMed

Salwiński, Aleksander; Da Silva, David; Delépée, Raphaël; Maunit, Benoît

2014-04-01

In this report, enzyme-coupled magnetic nanoparticles (EMPs) were shown to be an effective affinity-based tool for finding specific interactions between enzymatic targets and the low-mass molecules in complex mixtures using classic MALDI-TOF apparatus. EMPs used in this work act as nonorganic matrix enabling ionization of small molecules without any interference in the low-mass range (enzyme-coupled nanoparticles-assisted laser desorption ionization MS, ENALDI MS) and simultaneously carry the superficial specific binding sites to capture inhibitors present in a studied mixture. We evaluated ENALDI approach in two complementary variations: 'ion fading' (IF-ENALDI), based on superficial adsorption of inhibitors and 'ion hunting' (IH-ENALDI), based on selective pre-concentration of inhibitors. IF-ENALDI was applied for two sets of enzyme-inhibitor pairs: tyrosinase-glabridin and trypsin-leupeptin and for the real plant sample: Sparrmannia discolor leaf and stem methanol extract. The efficacy of IH-ENALDI was shown for the pair of trypsin-leupeptin. Both ENALDI approaches pose an alternative for bioassay-guided fractionation, the common method for finding inhibitors in the complex mixtures.

Monte Carlo approach in assessing damage in higher order structures of DNA

NASA Technical Reports Server (NTRS)

Chatterjee, A.; Schmidt, J. B.; Holley, W. R.

1994-01-01

We have developed a computer monitor of nuclear DNA in the form of chromatin fibre. The fibres are modeled as a ideal solenoid consisting of twenty helical turns with six nucleosomes per turn. The chromatin model, in combination with are Monte Carlo theory of radiation damage induces by charged particles, based on general features of tack structure and stopping power theory, has been used to evaluate the influence of DNA structure on initial damage. An interesting has emerged from our calculations. Our calculated results predict the existence of strong spatial correlations in damage sites associated with the symmetries in the solenoidal model. We have calculated spectra of short fragments of double stranded DNA produced by multiple double strand breaks induced by both high and low LET radiation. The spectra exhibit peaks at multiples of approximately 85 base pairs (the nucleosome periodicity), and approximately 1000 base pairs (solenoid periodicity). Preliminary experiments to investigate the fragment distributions from irradiated DNA, made by B. Rydberg at Lawrence Berkeley Laboratory, confirm the existence of short DNA fragments and are in substantial agreement with the predictions of our theory.

GRIL-Seq, a method for identifying direct targets of bacterial small regulatory RNA by in vivo proximity ligation

PubMed Central

Han, Kook; Tjaden, Brian; Lory, Stephen

2017-01-01

The first step in the post-transcriptional regulatory function of most bacterial small non-coding RNAs (sRNAs) is base-pairing with partially complementary sequences of targeted transcripts. We present a simple method for identifying sRNA targets in vivo and defining processing sites of the regulated transcripts. The technique (referred to as GRIL-Seq) is based on preferential ligation of sRNAs to ends of base-paired targets in bacteria co-expressing T4 RNA ligase, followed by sequencing to identify the chimeras. In addition to the RNA chaperone Hfq, the GRIL-Seq method depends on the activity of the pyrophosphorylase RppH. Using PrrF1, an iron-regulated sRNA in Pseudomonas aeruginosa, we demonstrate that direct regulatory targets of this sRNA can be readily identified. Therefore, GRIL-Seq represents a powerful tool not only for identifying direct targets of sRNAs in a variety of environments, but can also result in uncovering novel roles for sRNAs and their targets in complex regulatory networks. PMID:28005055

GRIL-seq provides a method for identifying direct targets of bacterial small regulatory RNA by in vivo proximity ligation.

PubMed

Han, Kook; Tjaden, Brian; Lory, Stephen

2016-12-22

The first step in the post-transcriptional regulatory function of most bacterial small non-coding RNAs (sRNAs) is base pairing with partially complementary sequences of targeted transcripts. We present a simple method for identifying sRNA targets in vivo and defining processing sites of the regulated transcripts. The technique, referred to as global small non-coding RNA target identification by ligation and sequencing (GRIL-seq), is based on preferential ligation of sRNAs to the ends of base-paired targets in bacteria co-expressing T4 RNA ligase, followed by sequencing to identify the chimaeras. In addition to the RNA chaperone Hfq, the GRIL-seq method depends on the activity of the pyrophosphorylase RppH. Using PrrF1, an iron-regulated sRNA in Pseudomonas aeruginosa, we demonstrated that direct regulatory targets of this sRNA can readily be identified. Therefore, GRIL-seq represents a powerful tool not only for identifying direct targets of sRNAs in a variety of environments, but also for uncovering novel roles for sRNAs and their targets in complex regulatory networks.

Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)

NASA Astrophysics Data System (ADS)

Risqi, A. M.; Yudiarsah, E.

2017-07-01

Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.

Trans-activation of the Tetrahymena group I intron ribozyme via a non-native RNA-RNA interaction.

PubMed Central

Ikawa, Y; Shiraishi, H; Inoue, T

1999-01-01

The peripheral P2.1 domain of the Tetrahymena group I intron ribozyme has been shown to be non-essential for splicing. We found, however, that separately prepared P2.1 RNA efficiently accelerates the 3' splice-site-specific hydrolysis reaction of a mutant ribozyme lacking both P2.1 and its upstream region in trans. We report here the unusual properties of this trans-activation. Compensatory mutational analysis revealed that non-native long-range base-pairings between the loop region of P2.1 RNA and L5c region of the mutant ribozyme are needed for the activation in spite of the fact that P2.1 forms base-pairings with P9.1 in the Tetrahymena ribozyme. The trans -activation depends on the non-native RNA-RNA interaction together with the higher order structure of P2.1 RNA. This activation is unique among the known trans-activations that utilize native tertiary interactions or RNA chaperons. PMID:10075996

Control of myogenesis by rodent SINE-containing lncRNAs

PubMed Central

Wang, Jiashi; Gong, Chenguang; Maquat, Lynne E.

2013-01-01

Staufen1-mediated mRNA decay (SMD) degrades mRNAs that harbor a Staufen1-binding site (SBS) in their 3′ untranslated regions (UTRs). Human SBSs can form by intermolecular base-pairing between a 3′ UTR Alu element and an Alu element within a long noncoding RNA (lncRNA) called a ½-sbsRNA. Since Alu elements are confined to primates, it was unclear how SMD occurs in rodents. Here we identify mouse mRNA 3′ UTRs and lncRNAs that contain a B1, B2, B4, or identifier (ID) element. We show that SMD occurs in mouse cells via mRNA–lncRNA base-pairing of partially complementary elements and that mouse ½-sbsRNA (m½-sbsRNA)-triggered SMD regulates C2C12 cell myogenesis. Our findings define new roles for lncRNAs as well as B and ID short interspersed elements (SINEs) in mice that undoubtedly influence many developmental and homeostatic pathways. PMID:23558772

mRNA–mRNA duplexes that auto-elicit Staufen1-mediated mRNA decay

PubMed Central

Gong, Chenguang; Tang, Yalan; Maquat, Lynne E.

2013-01-01

We report a new mechanism by which human mRNAs crosstalk: an Alu element in the 3'-untranslated region (3' UTR) of one mRNA can base-pair with a partially complementary Alu element in the 3' UTR of a different mRNA thereby creating a Staufen1 (STAU1)-binding site (SBS). STAU1 binding to a 3' UTR SBS was previously shown to trigger STAU1-mediated mRNA decay (SMD) by directly recruiting the ATP-dependent RNA helicase UPF1, which is also a key factor in the mechanistically related nonsense-mediated mRNA decay (NMD) pathway. In the case of a 3' UTR SBS created via mRNA–mRNA base-pairing, we show that SMD targets both mRNAs in the duplex provided that both mRNAs are translated. If only one mRNA is translated, then it alone is targeted for SMD. We demonstrate the importance of mRNA–mRNA-triggered SMD to the processes of cell migration and invasion. PMID:24056942

DNA barcoding Indian freshwater fishes.

PubMed

Lakra, Wazir Singh; Singh, M; Goswami, Mukunda; Gopalakrishnan, A; Lal, K K; Mohindra, V; Sarkar, U K; Punia, P P; Singh, K V; Bhatt, J P; Ayyappan, S

2016-11-01

DNA barcoding is a promising technique for species identification using a short mitochondrial DNA sequence of cytochrome c oxidase I (COI) gene. In the present study, DNA barcodes were generated from 72 species of freshwater fish covering the Orders Cypriniformes, Siluriformes, Perciformes, Synbranchiformes, and Osteoglossiformes representing 50 genera and 19 families. All the samples were collected from diverse sites except the species endemic to a particular location. Species were represented by multiple specimens in the great majority of the barcoded species. A total of 284 COI sequences were generated. After amplification and sequencing of 700 base pair fragment of COI, primers were trimmed which invariably generated a 655 base pair barcode sequence. The average Kimura two-parameter (K2P) distances within-species, genera, families, and orders were 0.40%, 9.60%, 13.10%, and 17.16%, respectively. DNA barcode discriminated congeneric species without any confusion. The study strongly validated the efficiency of COI as an ideal marker for DNA barcoding of Indian freshwater fishes.

Real-time observation of the initiation of RNA polymerase II transcription.

PubMed

Fazal, Furqan M; Meng, Cong A; Murakami, Kenji; Kornberg, Roger D; Block, Steven M

2015-09-10

Biochemical and structural studies have shown that the initiation of RNA polymerase II transcription proceeds in the following stages: assembly of the polymerase with general transcription factors and promoter DNA in a 'closed' preinitiation complex (PIC); unwinding of about 15 base pairs of the promoter DNA to form an 'open' complex; scanning downstream to a transcription start site; synthesis of a short transcript, thought to be about 10 nucleotides long; and promoter escape. Here we have assembled a 32-protein, 1.5-megadalton PIC derived from Saccharomyces cerevisiae, and observe subsequent initiation processes in real time with optical tweezers. Contrary to expectation, scanning driven by the transcription factor IIH involved the rapid opening of an extended transcription bubble, averaging 85 base pairs, accompanied by the synthesis of a transcript up to the entire length of the extended bubble, followed by promoter escape. PICs that failed to achieve promoter escape nevertheless formed open complexes and extended bubbles, which collapsed back to closed or open complexes, resulting in repeated futile scanning.

Approved Methods and Algorithms for DoD Risk-Based Explosives Siting

DTIC Science & Technology

2007-02-02

glass. Pgha Probability of a person being in the glass hazard area Phit Probability of hit Phit (f) Probability of hit for fatality Phit (maji...Probability of hit for major injury Phit (mini) Probability of hit for minor injury Pi Debris probability densities at the ES PMaj (pair) Individual...combined high-angle and combined low-angle tables. A unique probability of hit is calculated for the three consequences of fatality, Phit (f), major injury

Analysis of Structural Flexibility of Damaged DNA Using Thiol-Tethered Oligonucleotide Duplexes

PubMed Central

Fujita, Masashi; Watanabe, Shun; Yoshizawa, Mariko; Yamamoto, Junpei; Iwai, Shigenori

2015-01-01

Bent structures are formed in DNA by the binding of small molecules or proteins. We developed a chemical method to detect bent DNA structures. Oligonucleotide duplexes in which two mercaptoalkyl groups were attached to the positions facing each other across the major groove were prepared. When the duplex contained the cisplatin adduct, which was proved to induce static helix bending, interstrand disulfide bond formation under an oxygen atmosphere was detected by HPLC analyses, but not in the non-adducted duplex, when the two thiol-tethered nucleosides were separated by six base pairs. When the insert was five and seven base pairs, the disulfide bond was formed and was not formed, respectively, regardless of the cisplatin adduct formation. The same reaction was observed in the duplexes containing an abasic site analog and the (6–4) photoproduct. Compared with the cisplatin case, the disulfide bond formation was slower in these duplexes, but the reaction rate was nearly independent of the linker length. These results indicate that dynamic structural changes of the abasic site- and (6–4) photoproduct-containing duplexes could be detected by our method. It is strongly suggested that the UV-damaged DNA-binding protein, which specifically binds these duplexes and functions at the first step of global-genome nucleotide excision repair, recognizes the easily bendable nature of damaged DNA. PMID:25679955

Development of a spatial analysis method using ground-based repeat photography to detect changes in the alpine treeline ecotone, Glacier National Park, Montana, U.S.A.

USGS Publications Warehouse

Roush, W.; Munroe, Jeffrey S.; Fagre, D.B.

2007-01-01

Repeat photography is a powerful tool for detection of landscape change over decadal timescales. Here a novel method is presented that applies spatial analysis software to digital photo-pairs, allowing vegetation change to be categorized and quantified. This method is applied to 12 sites within the alpine treeline ecotone of Glacier National Park, Montana, and is used to examine vegetation changes over timescales ranging from 71 to 93 years. Tree cover at the treeline ecotone increased in 10 out of the 12 photo-pairs (mean increase of 60%). Establishment occurred at all sites, infilling occurred at 11 sites. To demonstrate the utility of this method, patterns of tree establishment at treeline are described and the possible causes of changes within the treeline ecotone are discussed. Local factors undoubtedly affect the magnitude and type of the observed changes, however the ubiquity of the increase in tree cover implies a common forcing mechanism. Mean minimum summer temperatures have increased by 1.5??C over the past century and, coupled with variations in the amount of early spring snow water equivalent, likely account for much of the increase in tree cover at the treeline ecotone. Lastly, shortcomings of this method are presented along with possible solutions and areas for future research. ?? 2007 Regents of the University of Colorado.

Quantifying the visual appearance of sunscreens applied to the skin using indirect computer image colorimetry.

PubMed

Richer, Vincent; Kharazmi, Pegah; Lee, Tim K; Kalia, Sunil; Lui, Harvey

2018-03-01

There is no accepted method to objectively assess the visual appearance of sunscreens on the skin. We present a method for sunscreen application, digital photography, and computer analysis to quantify the appearance of the skin after sunscreen application. Four sunscreen lotions were applied randomly at densities of 0.5, 1.0, 1.5, and 2.0 mg/cm 2 to areas of the back of 29 subjects. Each application site had a matched contralateral control area. High-resolution standardized photographs including a color card were taken after sunscreen application. After color balance correction, CIE L*a*b* color values were extracted from paired sites. Differences in skin appearance attributed to sunscreen were represented by ΔE, which in turn was calculated from the linear Euclidean distance within the L*a*b* color space between the paired sites. Sunscreen visibility as measured by median ΔE varied across different products and application densities and ranged between 1.2 and 12.1. The visibility of sunscreens varied according to product SPF, composition (organic vs inorganic), presence of tint, and baseline b* of skin (P < .05 for all). Standardized sunscreen application followed by digital photography and indirect computer-based colorimetry represents a potential method to objectively quantify visibility of sunscreen on the skin. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Astronomical tunings of the Oligocene-Miocene transition from Pacific Ocean Site U1334 and implications for the carbon cycle

NASA Astrophysics Data System (ADS)

Beddow, Helen M.; Liebrand, Diederik; Wilson, Douglas S.; Hilgen, Frits J.; Sluijs, Appy; Wade, Bridget S.; Lourens, Lucas J.

2018-03-01

Astronomical tuning of sediment sequences requires both unambiguous cycle pattern recognition in climate proxy records and astronomical solutions, as well as independent information about the phase relationship between these two. Here we present two different astronomically tuned age models for the Oligocene-Miocene transition (OMT) from Integrated Ocean Drilling Program Site U1334 (equatorial Pacific Ocean) to assess the effect tuning has on astronomically calibrated ages and the geologic timescale. These alternative age models (roughly from ˜ 22 to ˜ 24 Ma) are based on different tunings between proxy records and eccentricity: the first age model is based on an aligning CaCO3 weight (wt%) to Earth's orbital eccentricity, and the second age model is based on a direct age calibration of benthic foraminiferal stable carbon isotope ratios (δ13C) to eccentricity. To independently test which tuned age model and associated tuning assumptions are in best agreement with independent ages based on tectonic plate-pair spreading rates, we assign the tuned ages to magnetostratigraphic reversals identified in deep-marine magnetic anomaly profiles. Subsequently, we compute tectonic plate-pair spreading rates based on the tuned ages. The resultant alternative spreading-rate histories indicate that the CaCO3 tuned age model is most consistent with a conservative assumption of constant, or linearly changing, spreading rates. The CaCO3 tuned age model thus provides robust ages and durations for polarity chrons C6Bn.1n-C7n.1r, which are not based on astronomical tuning in the latest iteration of the geologic timescale. Furthermore, it provides independent evidence that the relatively large (several 10 000 years) time lags documented in the benthic foraminiferal isotope records relative to orbital eccentricity constitute a real feature of the Oligocene-Miocene climate system and carbon cycle. The age constraints from Site U1334 thus indicate that the delayed responses of the Oligocene-Miocene climate-cryosphere system and (marine) carbon cycle resulted from highly non-linear feedbacks to astronomical forcing.

Detailed analysis of stem I and its 5' and 3' neighbor regions in the trans-acting HDV ribozyme.

PubMed Central

Nishikawa, F; Roy, M; Fauzi, H; Nishikawa, S

1999-01-01

To determine the stem I structure of the human hepatitis delta virus (HDV) ribozyme, which is related to the substrate sequence in the trans -acting system, we kinetically studied stem I length and sequences. Stem I extension from 7 to 8 or 9 bp caused a loss of activity and a low amount of active complex with 9 bp in the trans -acting system. In a previous report, we presented cleavage in a 6 bp stem I. The observed reaction rates indicate that the original 7 bp stem I is in the most favorable location for catalytic reaction among the possible 6-8 bp stems. To test base specificity, we replaced the original GC-rich sequence in stem I with AU-rich sequences containing six AU or UA base pairs with the natural +1G.U wobble base pair at the cleavage site. The cis -acting AU-rich molecules demonstrated similar catalytic activity to that of the wild-type. In trans -acting molecules, due to stem I instability, reaction efficiency strongly depended on the concentration of the ribozyme-substrate complex and reaction temperature. Multiple turnover was observed at 37 degreesC, strongly suggesting that stem I has no base specificity and more efficient activity can be expected under multiple turnover conditions by substituting several UA or AU base pairs into stem I. We also studied the substrate damaging sequences linked to both ends of stem I for its development in therapeutic applications and confirmed the functions of the unique structure. PMID:9862958

Complementarity to an miRNA seed region is sufficient to induce moderate repression of a target transcript in the unicellular green alga Chlamydomonas reinhardtii.

PubMed

Yamasaki, Tomohito; Voshall, Adam; Kim, Eun-Jeong; Moriyama, Etsuko; Cerutti, Heriberto; Ohama, Takeshi

2013-12-01

MicroRNAs (miRNAs) are 20-24 nt non-coding RNAs that play important regulatory roles in a broad range of eukaryotes by pairing with mRNAs to direct post-transcriptional repression. The mechanistic details of miRNA-mediated post-transcriptional regulation have been well documented in multicellular model organisms. However, this process remains poorly studied in algae such as Chlamydomonas reinhardtii, and specific features of miRNA biogenesis, target mRNA recognition and subsequent silencing are not well understood. In this study, we report on the characterization of a Chlamydomonas miRNA, cre-miR1174.2, which is processed from a near-perfect hairpin RNA. Using Gaussia luciferase (gluc) reporter genes, we have demonstrated that cre-miR1174.2 is functional in Chlamydomonas and capable of triggering site-specific cleavage at the center of a perfectly complementary target sequence. A mismatch tolerance test assay, based on pools of transgenic strains, revealed that target hybridization to nucleotides of the seed region, at the 5' end of an miRNA, was sufficient to induce moderate repression of expression. In contrast, pairing to the 3' region of the miRNA was not critical for silencing. Our results suggest that the base-pairing requirements for small RNA-mediated repression in C. reinhardtii are more similar to those of metazoans compared with the extensive complementarity that is typical of land plants. Individual Chlamydomonas miRNAs may potentially modulate the expression of numerous endogenous targets as a result of these relaxed base-pairing requirements. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

PubMed

Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

2010-10-14

Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which implies that the anti orientation of the damaged base will be favored by hydrogen bonding in DNA helices. Additionally, regardless of the hydrogen-bonding face involved, cytosine forms the most stable base pair with the ortho adduct, which implies that misincorporation due to this type of damage is unlikely. Similarly, cytosine is the preferred binding partner for the Watson-Crick face of the para adduct. However, Hoogsteen interactions with the para adduct are stronger than those with natural 2'-deoxyguanosine or the ortho adduct, and this form of damage binds with nearly equal stability to both cytosine and guanine in the Hoogsteen orientation. Therefore, the para adduct may adopt multiple orientations in DNA helices and potentially cause mutations by forming pairs with different natural bases. Models of oligonucleotide duplexes must be used in future work to further evaluate other factors (stacking, major groove contacts) that may influence the conformation and binding preference of these adducts in DNA helices.

Soil organic matter fractions in experimental forested watersheds

Treesearch

Jennifer L. Parker; Ivan J. Fernandez; Lindsey E. Rustad; Stephen A. Norton

2002-01-01

Recent concerns about climate change and atmospheric greenhouse gas concentrations have demonstrated the importance of understanding ecosystem C source/sink relationships. Soil organic matter fractionation was carried out in three paired, forested watershed sites where one of each watershed pair represented a different ecosystem perturbation. The perturbations were 8...

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

MicroRNA duplication accelerates the recruitment of new targets during vertebrate evolution

PubMed Central

Luo, Junjie; Wang, Yirong; Yuan, Jian

2018-01-01

The repertoire of miRNAs has considerably expanded during metazoan evolution, and duplication is an important mechanism for generating new functional miRNAs. However, relatively little is known about the functional divergence between paralogous miRNAs and the possible coevolution between duplicated miRNAs and the genomic contexts. By systematically examining small RNA expression profiles across various human tissues and interrogating the publicly available miRNA:mRNA pairing chimeras, we found that changes in expression patterns and targeting preferences are widespread for duplicated miRNAs in vertebrates. Both the empirical interactions and target predictions suggest that evolutionarily conserved homo-seed duplicated miRNAs pair with significantly higher numbers of target sites compared to the single-copy miRNAs. Our birth-and-death evolutionary analysis revealed that the new target sites of miRNAs experienced frequent gains and losses during function development. Our results suggest that a newly emerged target site has a higher probability to be functional and maintained by natural selection if it is paired to a seed shared by multiple paralogous miRNAs rather than being paired to a single-copy miRNA. We experimentally verified the divergence in target repression between two paralogous miRNAs by transfecting let-7a and let-7b mimics into kidney-derived cell lines of four mammalian species and measuring the resulting transcriptome alterations by extensive high-throughput sequencing. Our results also suggest that the gains and losses of let-7 target sites might be associated with the evolution of repressiveness of let-7 across mammalian species. PMID:29511046

Unique Thermal Stability of Unnatural Hydrophobic Ds Bases in Double-Stranded DNAs.

PubMed

Kimoto, Michiko; Hirao, Ichiro

2017-10-20

Genetic alphabet expansion technology, the introduction of unnatural bases or base pairs into replicable DNA, has rapidly advanced as a new synthetic biology area. A hydrophobic unnatural base pair between 7-(2-thienyl)imidazo[4,5-b]pyridine (Ds) and 2-nitro-4-propynylpyrrole (Px) exhibited high fidelity as a third base pair in PCR. SELEX methods using the Ds-Px pair enabled high-affinity DNA aptamer generation, and introducing a few Ds bases into DNA aptamers extremely augmented their affinities and selectivities to target proteins. Here, to further scrutinize the functions of this highly hydrophobic Ds base, the thermal stabilities of double-stranded DNAs (dsDNA) containing a noncognate Ds-Ds or G-Ds pair were examined. The thermal stability of the Ds-Ds self-pair was as high as that of the natural G-C pair, and apart from the generally higher stability of the G-C pair than that of the A-T pair, most of the 5'-pyrimidine-Ds-purine-3' sequences, such as CDsA and TDsA, exhibited higher stability than the 5'-purine-Ds-pyrimidine-3' sequences, such as GDsC and ADsC, in dsDNAs. This trait enabled the GC-content-independent control of the thermal stability of the designed dsDNA fragments. The melting temperatures of dsDNA fragments containing the Ds-Ds pair can be predicted from the nearest-neighbor parameters including the Ds base. In addition, the noncognate G-Ds pair can efficiently distinguish its neighboring cognate natural base pairs from noncognate pairs. We demonstrated that real-time PCR using primers containing Ds accurately detected a single-nucleotide mismatch in target DNAs. These unique properties of the Ds base that affect the stabilities of the neighboring base pairs could impart new functions to DNA molecules and technologies.

The Minimal Replicator of Epstein-Barr Virus oriP

PubMed Central

Yates, John L.; Camiolo, Sarah M.; Bashaw, Jacqueline M.

2000-01-01

oriP is a 1.7-kb region of the Epstein-Barr virus (EBV) chromosome that supports the replication and stable maintenance of plasmids in human cells. oriP contains two essential components, called the DS and the FR, both of which contain multiple binding sites for the EBV-encoded protein, EBNA-1. The DS appears to function as the replicator of oriP, while the FR acts in conjunction with EBNA-1 to prevent the loss of plasmids from proliferating cells. Because of EBNA-1's role in stabilizing plasmids through the FR, it has not been entirely clear to what extent EBNA-1 might be required for replication from oriP per se, and a recent study has questioned whether EBNA-1 has any direct role in replication. In the present study we found that plasmids carrying oriP required EBNA-1 to replicate efficiently even when assayed only 2 days after plasmids were introduced into the cell lines 143B and 293. Significantly, using 293 cells it was demonstrated that the plasmid-retention function of EBNA-1 and the FR did not contribute significantly to the accumulation of replicated plasmids, and the DS supported efficient EBNA-1-dependent replication in the absence of the FR. The DS contains two pairs of closely spaced EBNA-1 binding sites, and a previous study had shown that both sites within either pair are required for activity. However, it was unclear from previous work what additional sequences within the DS might be required. We found that each “half” of the DS, including a pair of closely spaced EBNA-1 binding sites, had significant replicator activity when the other half had been deleted. The only significant DNA sequences that the two halves of the DS share in common, other than EBNA-1 binding sites, is a 9-bp sequence that is present twice in the “left half” and once in the “right half.” These nonamer repeats, while not essential for activity, contributed significantly to the activity of each half of the DS. Two thymines occur at unique positions within EBNA-1 binding sites 1 and 4 at the DS and become sensitive to oxidation by permanganate when EBNA-1 binds, but mutation of each to the consensus base, adenine, actually improved the activity of each half of the DS slightly. In conclusion, the DS of oriP is an EBNA-1-dependent replicator, and its minimal active core appears to be simply two properly spaced EBNA-1 binding sites. PMID:10775587

Simultaneous fluorescence light-up and selective multicolor nucleobase recognition based on sequence-dependent strong binding of berberine to DNA abasic site.

PubMed

Wu, Fei; Shao, Yong; Ma, Kun; Cui, Qinghua; Liu, Guiying; Xu, Shujuan

2012-04-28

Label-free DNA nucleobase recognition by fluorescent small molecules has received much attention due to its simplicity in mutation identification and drug screening. However, sequence-dependent fluorescence light-up nucleobase recognition and multicolor emission with individual emission energy for individual nucleobases have been seldom realized. Herein, an abasic site (AP site) in a DNA duplex was employed as a binding field for berberine, one of isoquinoline alkaloids. Unlike weak binding of berberine to the fully matched DNAs without the AP site, strong binding of berberine to the AP site occurs and the berberine's fluorescence light-up behaviors are highly dependent on the target nucleobases opposite the AP site in which the targets thymine and cytosine produce dual emission bands, while the targets guanine and adenine only give a single emission band. Furthermore, more intense emissions are observed for the target pyrimidines than purines. The flanking bases of the AP site also produce some modifications of the berberine's emission behavior. The binding selectivity of berberine at the AP site is also confirmed by measurements of fluorescence resonance energy transfer, excited-state lifetime, DNA melting and fluorescence quenching by ferrocyanide and sodium chloride. It is expected that the target pyrimidines cause berberine to be stacked well within DNA base pairs near the AP site, which results in a strong resonance coupling of the electronic transitions to the particular vibration mode to produce the dual emissions. The fluorescent signal-on and emission energy-modulated sensing for nucleobases based on this fluorophore is substantially advantageous over the previously used fluorophores. We expect that this approach will be developed as a practical device for differentiating pyrimidines from purines by positioning an AP site toward a target that is available for readout by this alkaloid probe. This journal is © The Royal Society of Chemistry 2012

Differentiating founder and chronic HIV envelope sequences

PubMed Central

Maher, Stephen; Mota, Talia; Suzuki, Kazuo; Kelleher, Anthony D.

2017-01-01

Significant progress has been made in characterizing broadly neutralizing antibodies against the HIV envelope glycoprotein Env, but an effective vaccine has proven elusive. Vaccine development would be facilitated if common features of early founder virus required for transmission could be identified. Here we employ a combination of bioinformatic and operations research methods to determine the most prevalent features that distinguish 78 subtype B and 55 subtype C founder Env sequences from an equal number of chronic sequences. There were a number of equivalent optimal networks (based on the fewest covarying amino acid (AA) pairs or a measure of maximal covariance) that separated founders from chronics: 13 pairs for subtype B and 75 for subtype C. Every subtype B optimal solution contained the founder pairs 178–346 Asn-Val, 232–236 Thr-Ser, 240–340 Lys-Lys, 279–315 Asp-Lys, 291–792 Ala-Ile, 322–347 Asp-Thr, 535–620 Leu-Asp, 742–837 Arg-Phe, and 750–836 Asp-Ile; the most common optimal pairs for subtype C were 644–781 Lys-Ala (74 of 75 networks), 133–287 Ala-Gln (73/75) and 307–337 Ile-Gln (73/75). No pair was present in all optimal subtype C solutions highlighting the difficulty in targeting transmission with a single vaccine strain. Relative to the size of its domain (0.35% of Env), the α4β7 binding site occurred most frequently among optimal pairs, especially for subtype C: 4.2% of optimal pairs (1.2% for subtype B). Early sequences from 5 subtype B pre-seroconverters each exhibited at least one clone containing an optimal feature 553–624 (Ser-Asn), 724–747 (Arg-Arg), or 46–293 (Arg-Glu). PMID:28187204

On the use of total aerobic spore bacteria to make treatment decisions due to Cryptosporidium risk at public water system wells.

PubMed

Berger, Philip; Messner, Michael J; Crosby, Jake; Vacs Renwick, Deborah; Heinrich, Austin

2018-05-01

Spore reduction can be used as a surrogate measure of Cryptosporidium natural filtration efficiency. Estimates of log10 (log) reduction were derived from spore measurements in paired surface and well water samples in Casper Wyoming and Kearney Nebraska. We found that these data were suitable for testing the hypothesis (H 0 ) that the average reduction at each site was 2 log or less, using a one-sided Student's t-test. After establishing data quality objectives for the test (expressed as tolerable Type I and Type II error rates), we evaluated the test's performance as a function of the (a) true log reduction, (b) number of paired samples assayed and (c) variance of observed log reductions. We found that 36 paired spore samples are sufficient to achieve the objectives over a wide range of variance, including the variances observed in the two data sets. We also explored the feasibility of using smaller numbers of paired spore samples to supplement bioparticle counts for screening purposes in alluvial aquifers, to differentiate wells with large volume surface water induced recharge from wells with negligible surface water induced recharge. With key assumptions, we propose a normal statistical test of the same hypothesis (H 0 ), but with different performance objectives. As few as six paired spore samples appear adequate as a screening metric to supplement bioparticle counts to differentiate wells in alluvial aquifers with large volume surface water induced recharge. For the case when all available information (including failure to reject H 0 based on the limited paired spore data) leads to the conclusion that wells have large surface water induced recharge, we recommend further evaluation using additional paired biweekly spore samples. Published by Elsevier GmbH.

Structural basis for microRNA targeting

DOE PAGES

Schirle, Nicole T.; Sheu-Gruttadauria, Jessica; MacRae, Ian J.

2014-10-31

MicroRNAs (miRNAs) control expression of thousands of genes in plants and animals. miRNAs function by guiding Argonaute proteins to complementary sites in messenger RNAs (mRNAs) targeted for repression. In this paper, we determined crystal structures of human Argonaute-2 (Ago2) bound to a defined guide RNA with and without target RNAs representing miRNA recognition sites. These structures suggest a stepwise mechanism, in which Ago2 primarily exposes guide nucleotides (nt) 2 to 5 for initial target pairing. Pairing to nt 2 to 5 promotes conformational changes that expose nt 2 to 8 and 13 to 16 for further target recognition. Interactions withmore » the guide-target minor groove allow Ago2 to interrogate target RNAs in a sequence-independent manner, whereas an adenosine binding-pocket opposite guide nt 1 further facilitates target recognition. Spurious slicing of miRNA targets is avoided through an inhibitory coordination of one catalytic magnesium ion. Finally, these results explain the conserved nucleotide-pairing patterns in animal miRNA target sites first observed over two decades ago.« less

X-ray Structure of a Hg 2+ Complex of Mercuric Reductase (MerA) and Quantum Mechanical/Molecular Mechanical Study of Hg 2+ Transfer between the C-Terminal and Buried Catalytic Site Cysteine Pairs

DOE PAGES

Lian, Peng; Guo, Hao-Bo; Riccardi, Demian; ...

2014-10-24

Here we report that mercuric reductase, MerA, is a key enzyme in bacterial mercury resistance. This homodimeric enzyme captures and reduces toxic Hg 2+ to Hg 0, which is relatively unreactive and can exit the cell passively. Prior to reduction, the Hg 2+ is transferred from a pair of cysteines (C558' and C559' using Tn501 numbering) at the C-terminus of one monomer to another pair of cysteines (C136 and C141) in the catalytic site of the other monomer. Here, we present the X-ray structure of the C-terminal Hg 2+ complex of the C136A/C141A double mutant of the Tn501 MerA catalyticmore » core and explore the molecular mechanism of this Hg transfer with quantum mechanical/molecular mechanical (QM/MM) calculations. The transfer is found to be nearly thermoneutral and to pass through a stable tricoordinated intermediate that is marginally less stable than the two end states. For the overall process, Hg 2+ is always paired with at least two thiolates and thus is present at both the C-terminal and catalytic binding sites as a neutral complex. Prior to Hg 2+ transfer, C141 is negatively charged. As Hg 2+ is transferred into the catalytic site, a proton is transferred from C136 to C559' while C558' becomes negatively charged, resulting in the net transfer of a negative charge over a distance of ~7.5 Å. Thus, the transport of this soft divalent cation is made energetically feasible by pairing a competition between multiple Cys thiols and/or thiolates for Hg 2+ with a competition between the Hg 2+ and protons for the thiolates.« less

Ten-Meter Scale Topography and Roughness of Mars Exploration Rovers Landing Sites and Martian Polar Regions

NASA Technical Reports Server (NTRS)

Ivanov, Anton B.

2003-01-01

The Mars Orbiter Camera (MOC) has been operating on board of the Mars Global Surveyor (MGS) spacecraft since 1998. It consists of three cameras - Red and Blue Wide Angle cameras (FOV=140 deg.) and Narrow Angle camera (FOV=0.44 deg.). The Wide Angle camera allows surface resolution down to 230 m/pixel and the Narrow Angle camera - down to 1.5 m/pixel. This work is a continuation of the project, which we have reported previously. Since then we have refined and improved our stereo correlation algorithm and have processed many more stereo pairs. We will discuss results of our stereo pair analysis located in the Mars Exploration rovers (MER) landing sites and address feasibility of recovering topography from stereo pairs (especially in the polar regions), taken during MGS 'Relay-16' mode.

Realization of a Quantum Integer-Spin Chain with Controllable Interactions

DTIC Science & Technology

2015-06-17

site participate in the dynamics. We observe the time evolution of the system and verify its coherence by entangling a pair of effective three-level...states generated by the XY Hamiltonian, we can verify entangle - ment between a pair of three-level systems with fidelities of up to 86%. Adding a time...3(b) shows an example of the measured parity curve used to extract the amplitude A and verify entanglement between the qutrit pair . Such measurements

Spin-orbit effects on the (119)Sn magnetic-shielding tensor in solids: a ZORA/DFT investigation.

PubMed

Alkan, Fahri; Holmes, Sean T; Iuliucci, Robbie J; Mueller, Karl T; Dybowski, Cecil

2016-07-28

Periodic-boundary and cluster calculations of the magnetic-shielding tensors of (119)Sn sites in various co-ordination and stereochemical environments are reported. The results indicate a significant difference between the predicted NMR chemical shifts for tin(ii) sites that exhibit stereochemically-active lone pairs and tin(iv) sites that do not have stereochemically-active lone pairs. The predicted magnetic shieldings determined either with the cluster model treated with the ZORA/Scalar Hamiltonian or with the GIPAW formalism are dependent on the oxidation state and the co-ordination geometry of the tin atom. The inclusion of relativistic effects at the spin-orbit level removes systematic differences in computed magnetic-shielding parameters between tin sites of differing stereochemistries, and brings computed NMR shielding parameters into significant agreement with experimentally-determined chemical-shift principal values. Slight improvement in agreement with experiment is noted in calculations using hybrid exchange-correlation functionals.

Intracortical microstimulation induced changes in spectral and temporal response properties in cat auditory cortex.

PubMed

Valentine, Pamela A; Eggermont, Jos J

2003-09-01

Intracortical microstimulation (ICMS), consisting of a 40 ms burst (rate 300 Hz) of 10 microA pulses, repetitively administered once per second, for a total duration of 1 h, induced cortical reorganization in the primary auditory cortical field of the anesthetized cat. Multiple single-unit activity was simultaneously recorded from three to nine microelectrodes. Spiking activity was recorded from the same units prior to and following the application of ICMS in conjunction with tone pips at the characteristic frequency (CF) of the stimulus electrode. ICMS produced a significant increase in the mean firing rate, and in the occurrence of burst activity. There was an increase in the cross-correlation coefficient (R) for unit pairs recorded from sites distant from the ICMS site, and a decrease in R for unit pairs that were recorded at the stimulation site. ICMS induced a shift in the CF, dependent on the difference between the baseline CF and the ICMS-paired tone pip frequency. ICMS also resulted in broader tuning curves, increased driven peak firing rate and reduced response latency. This suggests a lasting reduction in inhibition in a small region surrounding the ICMS site that allows expansion of the frequency range normally represented in the vicinity of the stimulation electrode.

Phoenix Trenches

NASA Technical Reports Server (NTRS)

2008-01-01

[figure removed for brevity, see original site] Annotated Version

[figure removed for brevity, see original site] Left-eye view of a stereo pair [figure removed for brevity, see original site] Right-eye view of a stereo pair

This image is a stereo, panoramic view of various trenches dug by NASA's Phoenix Mars Lander. The images that make up this panorama were taken by Phoenix's Surface Stereo Imager at about 4 p.m., local solar time at the landing site, on the 131st, Martian day, or sol, of the mission (Oct. 7, 2008).

In figure 1, the trenches are labeled in orange and other features are labeled in blue. Figures 2 and 3 are the left- and right-eye members of a stereo pair.

For scale, the 'Pet Donkey' trench just to the right of center is approximately 38 centimeters (15 inches) long and 31 to 34 centimeters (12 to 13 inches) wide. In addition, the rock in front of it, 'Headless,' is about 11.5 by 8.5 centimeters (4.5 by 3.3 inches), and about 5 centimeters (2 inches) tall.

The Phoenix Mission is led by the University of Arizona, Tucson, on behalf of NASA. Project management of the mission is by NASA's Jet Propulsion Laboratory, Pasadena, Calif. Spacecraft development is by Lockheed Martin Space Systems, Denver.

Base-Pairing Energies of Protonated Nucleoside Base Pairs of dCyd and m5dCyd: Implications for the Stability of DNA i-Motif Conformations

NASA Astrophysics Data System (ADS)

Yang, Bo; Rodgers, M. T.

2015-08-01

Hypermethylation of cytosine in expanded (CCG)n•(CGG)n trinucleotide repeats results in Fragile X syndrome, the most common cause of inherited mental retardation. The (CCG)n•(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of protonated base pairs of cytosine. Here we investigate the effects of 5-methylation and the sugar moiety on the base-pairing energies (BPEs) of protonated cytosine base pairs by examining protonated nucleoside base pairs of 2'-deoxycytidine (dCyd) and 5-methyl-2'-deoxycytidine (m5dCyd) using threshold collision-induced dissociation techniques. 5-Methylation of a single or both cytosine residues leads to very small change in the BPE. However, the accumulated effect may be dramatic in diseased state trinucleotide repeats where many methylated base pairs may be present. The BPEs of the protonated nucleoside base pairs examined here significantly exceed those of Watson-Crick dGuo•dCyd and neutral dCyd•dCyd base pairs, such that these base-pairing interactions provide the major forces responsible for stabilization of DNA i-motif conformations. Compared with isolated protonated nucleobase pairs of cytosine and 1-methylcytosine, the 2'-deoxyribose sugar produces an effect similar to the 1-methyl substituent, and leads to a slight decrease in the BPE. These results suggest that the base-pairing interactions may be slightly weaker in nucleic acids, but that the extended backbone is likely to exert a relatively small effect on the total BPE. The proton affinity (PA) of m5dCyd is also determined by competitive analysis of the primary dissociation pathways that occur in parallel for the protonated (m5dCyd)H+(dCyd) nucleoside base pair and the absolute PA of dCyd previously reported.

CasA mediates Cas3-catalyzed target degradation during CRISPR RNA-guided interference.

PubMed

Hochstrasser, Megan L; Taylor, David W; Bhat, Prashant; Guegler, Chantal K; Sternberg, Samuel H; Nogales, Eva; Doudna, Jennifer A

2014-05-06

In bacteria, the clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) DNA-targeting complex Cascade (CRISPR-associated complex for antiviral defense) uses CRISPR RNA (crRNA) guides to bind complementary DNA targets at sites adjacent to a trinucleotide signature sequence called the protospacer adjacent motif (PAM). The Cascade complex then recruits Cas3, a nuclease-helicase that catalyzes unwinding and cleavage of foreign double-stranded DNA (dsDNA) bearing a sequence matching that of the crRNA. Cascade comprises the CasA-E proteins and one crRNA, forming a structure that binds and unwinds dsDNA to form an R loop in which the target strand of the DNA base pairs with the 32-nt RNA guide sequence. Single-particle electron microscopy reconstructions of dsDNA-bound Cascade with and without Cas3 reveal that Cascade positions the PAM-proximal end of the DNA duplex at the CasA subunit and near the site of Cas3 association. The finding that the DNA target and Cas3 colocalize with CasA implicates this subunit in a key target-validation step during DNA interference. We show biochemically that base pairing of the PAM region is unnecessary for target binding but critical for Cas3-mediated degradation. In addition, the L1 loop of CasA, previously implicated in PAM recognition, is essential for Cas3 activation following target binding by Cascade. Together, these data show that the CasA subunit of Cascade functions as an essential partner of Cas3 by recognizing DNA target sites and positioning Cas3 adjacent to the PAM to ensure cleavage.

Breeding biology and nest-site selection of red-tailed hawks in an altered desert grassland

USGS Publications Warehouse

Hobbs, R.J.; DeStefano, S.; Halvorson, W.L.

2006-01-01

Red-tailed Hawks (Buteo jamaicensis) have expanded their range as trees have invaded formerly-open grasslands. Desert grasslands of southern Arizona have been invaded by mesquite trees (Prosopis velutina) since Anglo-American settlement and now support a large population of Red-tailed Hawks. We studied a population of Red-tailed Hawks in an altered desert grassland in southern Arizona. Our objectives were to determine what environmental characteristics influence Red-tailed Hawk habitat selection in mesquite-invaded desert grasslands and to evaluate the habitat quality of these grasslands for Red-tailed Hawks based on nesting density, nest success, and productivity. Red-tailed Hawks had 86% (95% C.I. = 73-99) nest success and 1.82 young per breeding pair (95% C.I. = 1.41-2.23). Nesting density was 0.15 (95% CI = 0.08-0.21) breeding pairs/km2 and the mean nearest-neighbor distance was 1.95 km (95% C.I. = 1.74-2.16). Red-tailed Hawks selected nest-sites with taller nest-trees and greater tree height and cover than were available at random. Mesquite trees in desert grasslands provide abundant potential nesting structures for Red-tailed Hawks. ?? 2006 The Raptor Research Foundation, Inc.

Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

PubMed

Takezawa, Yusuke; Shionoya, Mitsuhiko

2012-12-18

With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional DNA molecules such as artificial DNAzymes and DNA machines. In addition, the metallo-base pairing system is a powerful tool for the construction of homogeneous and heterogeneous metal arrays, which can lead to DNA-based nanomaterials such as electronic wires and magnetic devices. Recently researchers have investigated these systems as enzyme replacements, which may offer an additional contribution to chemical biology and synthetic biology through the expansion of the genetic alphabet.

Theoretical determination of one-electron redox potentials for DNA bases, base pairs, and stacks.

PubMed

Paukku, Y; Hill, G

2011-05-12

Electron affinities, ionization potentials, and redox potentials for DNA bases, base pairs, and N-methylated derivatives are computed at the DFT/M06-2X/6-31++G(d,p) level of theory. Redox properties of a guanine-guanine stack model are explored as well. Reduction and oxidation potentials are in good agreement with the experimental ones. Electron affinities of base pairs were found to be negative. Methylation of canonical bases affects the ionization potentials the most. Base pair formation and base stacking lower ionization potentials by 0.3 eV. Pairing of guanine with the 5-methylcytosine does not seem to influence the redox properties of this base pair much.

Detection of a variable number of ribosomal DNA loci by fluorescent in situ hybridization in Populus species.

PubMed

Prado, E A; Faivre-Rampant, P; Schneider, C; Darmency, M A

1996-10-01

Fluorescent in situ hybridization (FISH) was applied to related Populus species (2n = 19) in order to detect rDNA loci. An interspecific variability in the number of hybridization sites was revealed using as probe an homologous 25S clone from Populus deltoides. The application of image analysis methods to measure fluorescence intensity of the hybridization signals has enabled us to characterize major and minor loci in the 18S-5.8S-25S rDNA. We identified one pair of such rDNA clusters in Populus alba; two pairs, one major and one minor, in both Populus nigra and P. deltoides; and three pairs in Populus balsamifera, (two major and one minor) and Populus euroamericana (one major and two minor). FISH results are in agreement with those based on RFLP analysis. The pBG13 probe containing 5S sequence from flax detected two separate clusters corresponding to the two size classes of units that coexist within 5S rDNA of most Populus species. Key words : Populus spp., fluorescent in situ hybridization, FISH, rDNA variability, image analysis.

Chromosome evolution in three Brazilian Leptodactylus species (Anura, Leptodactylidae), with phylogenetic considerations.

PubMed

Reinaldo Cruz Campos, João; Ananias, Fernando; Aguirre Brasileiro, Cinthia; Yamamoto, Marcos; Fernando Baptista Haddad, Célio; Kasahara, Sanae

2009-05-01

Karyotypic analyses on three species of the Leptodactylus from Brazil showed 2n=24 in L. cf. marmoratus, 2n=23 in Leptodactylus sp. (aff. bokermanni), and 2n=26 in L. hylaedactylus, with distinct numbers of bi and uni-armed chromosomes. Leptodactylus cf. marmoratus presented a variation as regard to the morphology of pair 12. All specimens of L. cf. marmoratus had Ag-NOR in pair 6, confirmed by FISH, but the sample from one of the localities presented additional Ag-NOR, in one of the chromosomes 8. In Leptodactylus sp. (aff. bokermanni) and L. hylaedactylus the chromosome pairs bearing Ag-NOR are 11 and 7, respectively. The C banding patterns are predominantly centromeric, but only in L. marmoratus this heterochromatin appeared very brilliant with DAPI. On the other hand, bright labelling was noticed with CMA(3) in the three species, on the Ag-NOR site. The data obtained here are in accordance with the proposed phylogeny to the genus, and the chromosomal analyses in these Leptodactylus showed that the karyotype evolution was based mainly in centric fusion and pericentric inversion.

Biochemical investigations into the mutagenic potential of 8-oxo-2'-deoxyguanosine using nucleotide analogues.

PubMed

Hamm, Michelle L; Crowley, Kelly A; Ghio, Michael; Lindell, Maria A M; McFadden, Emily J; Silberg, Jordan S L; Weaver, Amelia M

2012-11-19

8-Oxo-2'-deoxyguanosine (OdG) is an abundant DNA lesion produced during oxidative damage to DNA. It can form relatively stable base pairs with both dC and dA that mimic natural dG:dC and dT:dA base pairs, respectively. Thus, when in the template strand, OdG can direct the insertion of either dCTP or dATP during replication, the latter of which can lead to a dG → T transversion. The potential for OdG to cause mutation is dependent on the preference for dCTP or dATP insertion opposite OdG, as well as the ability to extend past the resulting base pairs. The C2-amine and C8-oxygen could play major roles during these reactions since both would lie outside the Watson-Crick cognate base pairs shape in the major groove when OdG base pairs to dA and dC, respectively, and both have the ability to form strong interactions, like hydrogen bonds. To gain a more generalized understanding of how the C2-amine and C8-oxygen of OdG affect its mutagenic potential, the incorporation opposite and extension past seven analogues of dG/OdG that vary at C2 and/or C8 were characterized for three DNA polymerases, including an exonuclease-deficient version of the replicative polymerase from RB69 (RB69), human polymerase (pol) β, and polymerase IV from Sulfolobus solfataricus P2 (Dpo4). Based on the results from these studies, as well as those from previous studies with RB69, pol β, Dpo4, and two A-family polymerases, the influence of the C2-amine and C8-oxygen during each incorporation and extension reaction with each polymerase is discussed. In general, it appears that when the C2-amine and the C8-oxygen are in the minor groove, they allow OdG to retain interactions that are normally present during insertion and extension. However, when the two groups are in the major groove, they each tend to form novel active site interactions, both stabilizing and destabilizing, that are not present during insertion and extension with natural DNA.

Development of a Lunar Scintillometer as part of the national large optical telescope site survey

NASA Astrophysics Data System (ADS)

Surendran, Avinash; Parihar, Padmakar S.; Banyal, Ravinder K.; Kalyaan, Anusha

2018-03-01

Ground layer turbulence is a very important site characterization parameter used to assess the quality of an astronomical site. The Lunar Scintillometer is a simple and effective site-testing device for measuring the ground layer turbulence. It consists of a linear array of photodiodes which are sensitive to the slight variations in the moon's brightness due to scintillation by the lower layers of the Earth's atmosphere. The covariance of intensity values between the non-redundant photodiode baselines can be used to measure the turbulence profile from the ground up to a height determined by the furthest pair of detectors. The six channel lunar scintillometer that has been developed at the Indian Institute of Astrophysics is based closely on an instrument built by the team led by Andrei Tokovinin of Cerro Tololo Inter-American Observatory (CTIO), Chile (Tokovinin et al., Mon. Not. R. Astron. Soc. 404(3), 1186-1196 2010). We have fabricated the instrument based on the existing electronic design, and have worked on the noise analysis, an EMI (Electromagnetic Induction) resistant PCB design and the software pipeline for analyzing the data from the same. The results from the instrument's multi-year campaign at Mount Saraswati, Hanle is also presented.

Does 8-Nitroguanine Form 8-Oxoguanine? An Insight from Its Reaction with •OH Radical.

PubMed

Bhattacharjee, Kanika; Shukla, P K

2018-02-15

8-Nitroguanine (8-nitroG) formed due to nitration of guanine base of DNA plays an important role in mutagenesis and carcinogenesis. In the present contribution, state-of-the-art quantum chemical calculations using M06-2X density functional and domain-based local pair natural orbital-coupled cluster theory with single, double, and perturbative triple excitations (DLPNO-CCSD(T)) methods have been carried out to investigate the mechanism of reaction of • OH radical with 8-nitroG leading to the formation of 8-oxoguanine (8-oxoG) (one of the most mutagenic and carcinogenic derivatives of guanine) in gas phase and aqueous media. Calculations of barrier energies and rate constants involved in the addition reactions of • OH radical at different sites of 8-nitroguanine show that C8 and C2 sites are the most and least reactive sites, respectively. Relative stability and Boltzmann populations of adducts show that the adduct formed at the C8 site occurs predominantly in equilibrium. Our calculations reveal that 8-nitroG is very reactive toward • OH radical and is converted readily into 8-oxoG when attacked by • OH radicals, in agreement with available experimental observations.

Pairing phase diagram of three holes in the generalized Hubbard model

DOE Office of Scientific and Technical Information (OSTI.GOV)

Navarro, O.; Espinosa, J.E.

Investigations of high-{Tc} superconductors suggest that the electronic correlation may play a significant role in the formation of pairs. Although the main interest is on the physic of two-dimensional highly correlated electron systems, the one-dimensional models related to high temperature superconductivity are very popular due to the conjecture that properties of the 1D and 2D variants of certain models have common aspects. Within the models for correlated electron systems, that attempt to capture the essential physics of high-temperature superconductors and parent compounds, the Hubbard model is one of the simplest. Here, the pairing problem of a three electrons system hasmore » been studied by using a real-space method and the generalized Hubbard Hamiltonian. This method includes the correlated hopping interactions as an extension of the previously proposed mapping method, and is based on mapping the correlated many body problem onto an equivalent site- and bond-impurity tight-binding one in a higher dimensional space, where the problem was solved in a non-perturbative way. In a linear chain, the authors analyzed the pairing phase diagram of three correlated holes for different values of the Hamiltonian parameters. For some value of the hopping parameters they obtain an analytical solution for all kind of interactions.« less

New methods to characterize site amplification

USGS Publications Warehouse

Safak, Erdal

1993-01-01

Methods alternative to spectral ratios are introduced to characterize site amplification. The methods are developed by using a range of models, from the simple constant amplification model to the time-varying filter model. Examples are given for each model by using a pair of rock- and soil-site recordings from the Loma Prieta earthquake.

A splice-site mutation affecting the paired box of PAX3 in a three generation family with Waardenburg syndrome type I (WS1).

PubMed

Attaie, A; Kim, E; Wilcox, E R; Lalwani, A K

1997-06-01

Waardenburg syndrome, an autosomal dominant disorder characterized by sensorineural hearing loss, pigmentary disturbances and other developmental defects, is the most frequent form of congenital deafness in humans. Mutations in the PAX3 gene, a transcription factor expressed during embryonic development, is associated with WS types I and III. Here we report the identification of a novel acceptor splice site mutation (86-2 A-->G) in the paired domain of the human PAX3 gene causing WS type I in a three generation family.

Spin polarization transfer by the radical pair mechanism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zarea, Mehdi, E-mail: m-zarea@northwestern.edu; Ratner, Mark A.; Wasielewski, Michael R.

2015-08-07

In a three-site representation, we study a spin polarization transfer from radical pair spins to a nearby electron or nuclear spin. The quantum dynamics of the radical pair spins is governed by a constant exchange interaction between the radical pair spins which have different Zeeman frequencies. Radical pair spins can recombine to the singlet ground state or to lower energy triplet states. It is then shown that the coherent dynamics of the radical pair induces spin polarization on the nearby third spin in the presence of a magnetic field. The spin polarization transfer depends on the difference between Zeeman frequencies,more » the singlet and triplet recombination rates, and on the exchange and dipole-dipole interactions between the different spins. In particular, the sign of the polarization depends on the exchange coupling between radical pair spins and also on the difference between singlet and triplet recombination rate constants.« less

Base pairing and base mis-pairing in nucleic acids

NASA Technical Reports Server (NTRS)

Wang, A. H. J.; Rich, A.

1986-01-01

In recent years we have learned that DNA is conformationally active. It can exist in a number of different stable conformations including both right-handed and left-handed forms. Using single crystal X-ray diffraction analysis we are able to discover not only additional conformations of the nucleic acids but also different types of hydrogen bonded base-base interactions. Although Watson-Crick base pairings are the predominant type of interaction in double helical DNA, they are not the only types. Recently, we have been able to examine mismatching of guanine-thymine base pairs in left-handed Z-DNA at atomic resolution (1A). A minimum amount of distortion of the sugar phosphate backbone is found in the G x T pairing in which the bases are held together by two hydrogen bonds in the wobble pairing interaction. Because of the high resolution of the analysis we can visualize water molecules which fill in to accommodate the other hydrogen bonding positions in the bases which are not used in the base-base interactions. Studies on other DNA oligomers have revealed that other types of non-Watson-Crick hydrogen bonding interactions can occur. In the structure of a DNA octamer with the sequence d(GCGTACGC) complexed to an antibiotic triostin A, it was found that the two central AT base pairs are held together by Hoogsteen rather than Watson-Crick base pairs. Similarly, the G x C base pairs at the ends are also Hoogsteen rather than Watson-Crick pairing. Hoogsteen base pairs make a modified helix which is distinct from the Watson-Crick double helix.

Hidden in Plain Sight: Subtle Effects of the 8-Oxoguanine Lesion on the Structure, Dynamics, and Thermodynamics of a 15-Base-Pair Oligodeoxynucleotide Duplex†

PubMed Central

Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.

2011-01-01

The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242

Vocabulary Learning through an Online Computerized Flashcard Site

ERIC Educational Resources Information Center

McLean, Stuart; Hogg, Nicholas; Rush, Thomas W.

2013-01-01

Recent research has shown that paired-associate learning is an effective way to acquire second language vocabulary. However, much research in the field has measured small-scale vocabulary learning. This is due to the methods which learners used to conduct paired-associate learning: paper flash cards. This project sought to measure vocabulary…

Productivity and breeding habitat of loggerhead shrikes in a southwestern urban environment

USGS Publications Warehouse

Boal, C.W.; Estabrook, T.S.; Duerr, A.E.

2003-01-01

Declines in loggerhead shrike (Lanius ludovicianus) populations have been associated in part with habitat loss and degradation, including that resulting from urbanization. We monitored the productivity and examined nesting habitat of loggerhead shrikes nesting in an urban environment in Tucson, Arizona. We located 22 breeding pairs in 1997 and 26 breeding pairs in 1998, with a 72% breeding area reoccupancy between years. Mean fledgling numbers were 2.28/ nesting attempt and 3.11/successful nest. Although some pairs initially failed and renested, 91% and 73% of shrike pairs successfully fledged young in 1997 and 1998, respectively. Mayfield estimates of nesting success were 78% in 1997 and 65% in 1998. Nest sites were characterized by more trees >3 m in height, taller nest trees than those randomly available, and a greater proportion of bare ground surface than at random sites. Shrike breeding territories had lower proportions of residential and commercial development and greater proportions of open areas with low-growing vegetation than randomly available. Some shrikes nested in school playgrounds, residential front yards, and parking lots, if adjacent open space was available.

Promoters, toll like receptors and microRNAs: a strange association.

PubMed

Korla, Kalyani; Arrigo, Patrizio; Mitra, Chanchal K

2013-06-01

Toll-like receptors (TLRs) are proteins that play key role in the innate immune system. In the present study, -1000 base pairs upstream are taken from the transcription start site of the various TLR genes (10 known) in human. About 40 microRNAs have been identified that share 12-19 nucleotide sequence similarity with the promoter regions of 10 TLRs. It is proposed that the microRNA performs potential role in identification of promoter sequence and initiation of transcription.

Controlling ferromagnetism of (In,Fe)As semiconductors by electron doping

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dang Vu, Nguyen; Fukushima, Tetsuya; Katayama-Yoshida, Hiroshi

2014-02-21

Based on experimental results, using the Korringa-Kohn-Rostoker coherent potential approximation (KKR-CPA) method and Monte Carlo simulation, we study the mechanism of ferromagnetic behavior of (In,Fe)As. We show that with doped Be atoms occupying in interstitial sites, chemical pair interactions between atoms and magnetic exchange interactions between Fe atoms change due to electron concentration. Therefore, by controlling the doping process, magnetic behavior of (In,Fe)As is controlled and ferromagnetism is observed in this semiconductor.

A molecular model for illegitimate recombination in Bacillus subtilis.

PubMed

Temeyer, K B; Hopkins, K M; Chapman, L F

1991-01-01

The recombinant DNA junctions at which pUB110 and Bacillus subtilis chromosomal DNA were joined to form the plasmid pKBT1 were cloned and sequenced. From the sequencing data we conclude that the pUB110 sequence is intact in the pair of cloned pKBT1 fragments and pTL12 sequences are not present. A molecular model for the formation of pKBT1 based on structural motifs characteristic of the joint sites is presented.

Introducing a model of pairing based on base pair specific interactions between identical DNA sequences

NASA Astrophysics Data System (ADS)

(O' Lee, Dominic J.

2018-02-01

At present, there have been suggested two types of physical mechanism that may facilitate preferential pairing between DNA molecules, with identical or similar base pair texts, without separation of base pairs. One mechanism solely relies on base pair specific patterns of helix distortion being the same on the two molecules, discussed extensively in the past. The other mechanism proposes that there are preferential interactions between base pairs of the same composition. We introduce a model, built on this second mechanism, where both thermal stretching and twisting fluctuations are included, as well as the base pair specific helix distortions. Firstly, we consider an approximation for weak pairing interactions, or short molecules. This yields a dependence of the energy on the square root of the molecular length, which could explain recent experimental data. However, analysis suggests that this approximation is no longer valid at large DNA lengths. In a second approximation, for long molecules, we define two adaptation lengths for twisting and stretching, over which the pairing interaction can limit the accumulation of helix disorder. When the pairing interaction is sufficiently strong, both adaptation lengths are finite; however, as we reduce pairing strength, the stretching adaptation length remains finite but the torsional one becomes infinite. This second state persists to arbitrarily weak values of the pairing strength; suggesting that, if the molecules are long enough, the pairing energy scales as length. To probe differences between the two pairing mechanisms, we also construct a model of similar form. However, now, pairing between identical sequences solely relies on the intrinsic helix distortion patterns. Between the two models, we see interesting qualitative differences. We discuss our findings, and suggest new work to distinguish between the two mechanisms.

Identification of novel alleles of the rice blast resistance gene Pi54

NASA Astrophysics Data System (ADS)

Vasudevan, Kumar; Gruissem, Wilhelm; Bhullar, Navreet K.

2015-10-01

Rice blast is one of the most devastating rice diseases and continuous resistance breeding is required to control the disease. The rice blast resistance gene Pi54 initially identified in an Indian cultivar confers broad-spectrum resistance in India. We explored the allelic diversity of the Pi54 gene among 885 Indian rice genotypes that were found resistant in our screening against field mixture of naturally existing M. oryzae strains as well as against five unique strains. These genotypes are also annotated as rice blast resistant in the International Rice Genebank database. Sequence-based allele mining was used to amplify and clone the Pi54 allelic variants. Nine new alleles of Pi54 were identified based on the nucleotide sequence comparison to the Pi54 reference sequence as well as to already known Pi54 alleles. DNA sequence analysis of the newly identified Pi54 alleles revealed several single polymorphic sites, three double deletions and an eight base pair deletion. A SNP-rich region was found between a tyrosine kinase phosphorylation site and the nucleotide binding site (NBS) domain. Together, the newly identified Pi54 alleles expand the allelic series and are candidates for rice blast resistance breeding programs.

Terminal Restriction Fragment Length Polymorphism Analysis Program, a Web-Based Research Tool for Microbial Community Analysis

PubMed Central

Marsh, Terence L.; Saxman, Paul; Cole, James; Tiedje, James

2000-01-01

Rapid analysis of microbial communities has proven to be a difficult task. This is due, in part, to both the tremendous diversity of the microbial world and the high complexity of many microbial communities. Several techniques for community analysis have emerged over the past decade, and most take advantage of the molecular phylogeny derived from 16S rRNA comparative sequence analysis. We describe a web-based research tool located at the Ribosomal Database Project web site (http://www.cme.msu.edu/RDP/html/analyses.html) that facilitates microbial community analysis using terminal restriction fragment length polymorphism of 16S ribosomal DNA. The analysis function (designated TAP T-RFLP) permits the user to perform in silico restriction digestions of the entire 16S sequence database and derive terminal restriction fragment sizes, measured in base pairs, from the 5′ terminus of the user-specified primer to the 3′ terminus of the restriction endonuclease target site. The output can be sorted and viewed either phylogenetically or by size. It is anticipated that the site will guide experimental design as well as provide insight into interpreting results of community analysis with terminal restriction fragment length polymorphisms. PMID:10919828

Fatigue-Induced Damage in Zr-Based Bulk Metallic Glasses

PubMed Central

Chuang, Chih-Pin; Yuan, Tao; Dmowski, Wojciech; Wang, Gong-Yao; Freels, Matt; Liaw, Peter K.; Li, Ran; Zhang, Tao

2013-01-01

In the present work, we investigate the effect of “fatigue” on the fatigue behavior and atomic structure of Zr-based BMGs. Fatigue experiments on the failed-by-fatigue samples indicate that the remnants generally have similar or longer fatigue life than the as-cast samples. Meanwhile, the pair-distribution-function (PDF) analysis of the as-cast and post-fatigue samples showed very small changes of local atomic structures. These observations suggest that the fatigue life of the 6-mm in-diameter Zr-based BMG is dominated by the number of pre-existing crack-initiation sites in the sample. Once the crack initiates in the specimen, the fatigue-induced damage is accumulated locally on these initiated sites, while the rest of the region deforms elastically. The results suggest that the fatigue failure of BMGs under compression-compression fatigue experiments is a defect-controlled process. The present work indicates the significance of the improved fatigue resistance with decreasing the sample size. PMID:23999496

An experimentally-informed coarse-grained 3-site-per-nucleotide model of DNA: Structure, thermodynamics, and dynamics of hybridization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hinckley, Daniel M.; Freeman, Gordon S.; Whitmer, Jonathan K.

2013-10-14

A new 3-Site-Per-Nucleotide coarse-grained model for DNA is presented. The model includes anisotropic potentials between bases involved in base stacking and base pair interactions that enable the description of relevant structural properties, including the major and minor grooves. In an improvement over available coarse-grained models, the correct persistence length is recovered for both ssDNA and dsDNA, allowing for simulation of non-canonical structures such as hairpins. DNA melting temperatures, measured for duplexes and hairpins by integrating over free energy surfaces generated using metadynamics simulations, are shown to be in quantitative agreement with experiment for a variety of sequences and conditions. Hybridizationmore » rate constants, calculated using forward-flux sampling, are also shown to be in good agreement with experiment. The coarse-grained model presented here is suitable for use in biological and engineering applications, including nucleosome positioning and DNA-templated engineering.« less

Specific CA3 neurons decode neural information of dentate granule cells evoked by paired-pulse stimulation in co-cultured networks.

PubMed

Poli, Daniele; DeMarse, Thomas B; Wheeler, Bruce C; Brewer, Gregory J

2017-07-01

CA3 and dentate gyrus (DG) neurons are cultured in two-chamber devices on multi-electrode arrays (MEAs) and connected via micro-tunnels. In order to evoke time-locked activity, paired-pulse stimulation is applied to 22 different sites and repeated 25 times in each well in 5 MEA co-cultures and results compared to CA3-CA3 and DG-DG networks homologous controls. In these hippocampal sub-regions, we focus on the mechanisms underpinning a network's ability to decode the identity of site specific stimulation from analysis of evoked network responses using a support vector machine classifier. Our results indicate that a pool of CA3 neurons is able to reliably decode the identity of DG stimulation site information.

Cloud Computing for Protein-Ligand Binding Site Comparison

PubMed Central

2013-01-01

The proteome-wide analysis of protein-ligand binding sites and their interactions with ligands is important in structure-based drug design and in understanding ligand cross reactivity and toxicity. The well-known and commonly used software, SMAP, has been designed for 3D ligand binding site comparison and similarity searching of a structural proteome. SMAP can also predict drug side effects and reassign existing drugs to new indications. However, the computing scale of SMAP is limited. We have developed a high availability, high performance system that expands the comparison scale of SMAP. This cloud computing service, called Cloud-PLBS, combines the SMAP and Hadoop frameworks and is deployed on a virtual cloud computing platform. To handle the vast amount of experimental data on protein-ligand binding site pairs, Cloud-PLBS exploits the MapReduce paradigm as a management and parallelizing tool. Cloud-PLBS provides a web portal and scalability through which biologists can address a wide range of computer-intensive questions in biology and drug discovery. PMID:23762824

Cloud computing for protein-ligand binding site comparison.

PubMed

Hung, Che-Lun; Hua, Guan-Jie

2013-01-01

The proteome-wide analysis of protein-ligand binding sites and their interactions with ligands is important in structure-based drug design and in understanding ligand cross reactivity and toxicity. The well-known and commonly used software, SMAP, has been designed for 3D ligand binding site comparison and similarity searching of a structural proteome. SMAP can also predict drug side effects and reassign existing drugs to new indications. However, the computing scale of SMAP is limited. We have developed a high availability, high performance system that expands the comparison scale of SMAP. This cloud computing service, called Cloud-PLBS, combines the SMAP and Hadoop frameworks and is deployed on a virtual cloud computing platform. To handle the vast amount of experimental data on protein-ligand binding site pairs, Cloud-PLBS exploits the MapReduce paradigm as a management and parallelizing tool. Cloud-PLBS provides a web portal and scalability through which biologists can address a wide range of computer-intensive questions in biology and drug discovery.

Biotechnological applications of mobile group II introns and their reverse transcriptases: gene targeting, RNA-seq, and non-coding RNA analysis.

PubMed

Enyeart, Peter J; Mohr, Georg; Ellington, Andrew D; Lambowitz, Alan M

2014-01-13

Mobile group II introns are bacterial retrotransposons that combine the activities of an autocatalytic intron RNA (a ribozyme) and an intron-encoded reverse transcriptase to insert site-specifically into DNA. They recognize DNA target sites largely by base pairing of sequences within the intron RNA and achieve high DNA target specificity by using the ribozyme active site to couple correct base pairing to RNA-catalyzed intron integration. Algorithms have been developed to program the DNA target site specificity of several mobile group II introns, allowing them to be made into 'targetrons.' Targetrons function for gene targeting in a wide variety of bacteria and typically integrate at efficiencies high enough to be screened easily by colony PCR, without the need for selectable markers. Targetrons have found wide application in microbiological research, enabling gene targeting and genetic engineering of bacteria that had been intractable to other methods. Recently, a thermostable targetron has been developed for use in bacterial thermophiles, and new methods have been developed for using targetrons to position recombinase recognition sites, enabling large-scale genome-editing operations, such as deletions, inversions, insertions, and 'cut-and-pastes' (that is, translocation of large DNA segments), in a wide range of bacteria at high efficiency. Using targetrons in eukaryotes presents challenges due to the difficulties of nuclear localization and sub-optimal magnesium concentrations, although supplementation with magnesium can increase integration efficiency, and directed evolution is being employed to overcome these barriers. Finally, spurred by new methods for expressing group II intron reverse transcriptases that yield large amounts of highly active protein, thermostable group II intron reverse transcriptases from bacterial thermophiles are being used as research tools for a variety of applications, including qRT-PCR and next-generation RNA sequencing (RNA-seq). The high processivity and fidelity of group II intron reverse transcriptases along with their novel template-switching activity, which can directly link RNA-seq adaptor sequences to cDNAs during reverse transcription, open new approaches for RNA-seq and the identification and profiling of non-coding RNAs, with potentially wide applications in research and biotechnology.

CCC CGA is a weak translational recoding site in Escherichia coli.

PubMed

Shu, Ping; Dai, Huacheng; Mandecki, Wlodek; Goldman, Emanuel

2004-12-08

Previously published experiments had indicated unexpected expression of a control vector in which a beta-galactosidase reporter was in the +1 reading frame relative to the translation start. This control vector contained the codon pair CCC CGA in the zero reading frame, raising the possibility that ribosomes rephased on this sequence, with peptidyl-tRNA(Pro) pairing with CCC in the +1 frame. This putative rephasing might also be exacerbated by the rare CGA Arg codon in the second position due to increased vacancy of the ribosomal A-site. To test this hypothesis, a series of site-directed mutants was constructed, including mutations in both the first and second codons of this codon pair. The results show that interrupting the continuous run of C residues with synonymous codon changes essentially abolishes the frameshift. Further, changing the rare Arg codon to a common Arg codon also reduces the frequency of the frameshift. These results provide strong support for the hypothesis that CCC CGA in the zero frame is indeed a weak translational frameshift site in Escherichia coli, with a 1-2% efficiency. Because the vector sequence also contains another CCC triplet in the +1 reading frame starting within the next codon after the CGA, our data also support possible contribution to expression of a +7 nucleotide ribosome hop into the same +1 reading frame. We also confirm here a previous report that CCC UGA is a translational frameshift site, in these experiments, with about 5% efficiency.

The K+/site and H+/site stoichiometry of mitochondrial electron transport.

PubMed

Reynafarje, B; Lehninger, A L

1978-09-25

Electrode measurements of the average number of H+ ejected and K+ taken up (in the presence of valinomycin) per pair of electrons passing the energy-conserving sites of the respiratory chain of rat liver and rat heart mitochondria have given identical values of the H+/site and 5+/site ratios very close to 4 in the presence of N-ethylmaleimide, an inhibitor of interfering respiration-coupled uptake of H+ + H2PO4-. The K+/site uptake ratio of 4 not only shows that inward movement of K+ provides quantitative charge-compensation for the 4 H+ ejected, but also confirms that 4 charges are separated per pair of electrons per site. When N-ethylmaleimide is omitted, the H+/site ejection ratio is depressed, because of the interfering secondary uptake of H/+ with H2PO4- on the phosphate carrier, but the K+/site uptake ratio remains at 4.0. Addition of phosphate or acetate, which can carry H+ into respiring mitochondria, further depresses the H+/site ratio, but does not affect the K+/site ratio, which remains at 4.0. These and other considerations thus confirm our earlier stoichiometric measurements that the average H+/site ratio is 4.0 and also show that the K+/site uptake ratio can be used as a measure of the intrinsic H+/site ratio, regardless of the presence of phosphate in the medium and without the necessity of adding N-ethylmaleimide or other inhibitors of H+ + H2PO4- transport.

pKa shifting in double-stranded RNA is highly dependent upon nearest neighbors and bulge positioning.

PubMed

Wilcox, Jennifer L; Bevilacqua, Philip C

2013-10-22

Shifting of pKa's in RNA is important for many biological processes; however, the driving forces responsible for shifting are not well understood. Herein, we determine how structural environments surrounding protonated bases affect pKa shifting in double-stranded RNA (dsRNA). Using (31)P NMR, we determined the pKa of the adenine in an A(+)·C base pair in various sequence and structural environments. We found a significant dependence of pKa on the base pairing strength of nearest neighbors and the location of a nearby bulge. Increasing nearest neighbor base pairing strength shifted the pKa of the adenine in an A(+)·C base pair higher by an additional 1.6 pKa units, from 6.5 to 8.1, which is well above neutrality. The addition of a bulge two base pairs away from a protonated A(+)·C base pair shifted the pKa by only ~0.5 units less than a perfectly base paired hairpin; however, positioning the bulge just one base pair away from the A(+)·C base pair prohibited formation of the protonated base pair as well as several flanking base pairs. Comparison of data collected at 25 °C and 100 mM KCl to biological temperature and Mg(2+) concentration revealed only slight pKa changes, suggesting that similar sequence contexts in biological systems have the potential to be protonated at biological pH. We present a general model to aid in the determination of the roles protonated bases may play in various dsRNA-mediated processes including ADAR editing, miRNA processing, programmed ribosomal frameshifting, and general acid-base catalysis in ribozymes.

Database of non-canonical base pairs found in known RNA structures

NASA Technical Reports Server (NTRS)

Nagaswamy, U.; Voss, N.; Zhang, Z.; Fox, G. E.

2000-01-01

Atomic resolution RNA structures are being published at an increasing rate. It is common to find a modest number of non-canonical base pairs in these structures in addition to the usual Watson-Crick pairs. This database summarizes the occurrence of these rare base pairs in accordance with standard nomenclature. The database, http://prion.bchs.uh.edu/, contains information such as sequence context, sugar pucker conformation, anti / syn base conformations, chemical shift, p K (a)values, melting temperature and free energy. Of the 29 anticipated pairs with two or more hydrogen bonds, 20 have been encountered to date. In addition, four unexpected pairs with two hydrogen bonds have been reported bringing the total to 24. Single hydrogen bond versions of five of the expected geometries have been encountered among the single hydrogen bond interactions. In addition, 18 different types of base triplets have been encountered, each of which involves three to six hydrogen bonds. The vast majority of the rare base pairs are antiparallel with the bases in the anti configuration relative to the ribose. The most common are the GU wobble, the Sheared GA pair, the Reverse Hoogsteen pair and the GA imino pair.

Binding of warfarin influences the acid-base equilibrium of H242 in sudlow site I of human serum albumin.

PubMed

Perry, Jennifer L; Goldsmith, Michael R; Williams, T Richard; Radack, Kyle P; Christensen, Trine; Gorham, Justin; Pasquinelli, Melissa A; Toone, Eric J; Beratan, David N; Simon, John D

2006-01-01

Sudlow Site I of human serum albumin (HSA) is located in subdomain IIA of the protein and serves as a binding cavity for a variety of ligands. In this study, the binding of warfarin (W) is examined using computational techniques and isothermal titration calorimetry (ITC). The structure of the docked warfarin anion (W-) to Site I is similar to that revealed by X-ray crystallography, with a calculated binding constant of 5.8 x 10(5) M(-1). ITC experiments (pH 7.13 and I = 0.1) carried out in three different buffers (MOPs, phosphate and Tris) reveal binding of W- is accompanied by uptake of 0.30+/-0.02 protons from the solvent. This measurement suggests that the binding of W- is stabilized by an ion-pair interaction between protonated H242 and the phenoxide group of W-.

Caught in the act: the first record of copulating fossil vertebrates.

PubMed

Joyce, Walter G; Micklich, Norbert; Schaal, Stephan F K; Scheyer, Torsten M

2012-10-23

The behaviour of fossil organisms can typically be inferred only indirectly, but rare fossil finds can provide surprising insights. Here, we report from the Eocene Messel Pit Fossil Site between Darmstadt and Frankfurt, Germany numerous pairs of the fossil carettochelyid turtle Allaeochelys crassesculpta that represent for the first time among fossil vertebrates couples that perished during copulation. Females of this taxon can be distinguished from males by their relatively shorter tails and development of plastral kinesis. The preservation of mating pairs has important taphonomic implications for the Messel Pit Fossil Site, as it is unlikely that the turtles would mate in poisonous surface waters. Instead, the turtles initiated copulation in habitable surface waters, but perished when their skin absorbed poisons while sinking into toxic layers. The mating pairs from Messel are therefore more consistent with a stratified, volcanic maar lake with inhabitable surface waters and a deadly abyss.

Temporal Wind Pairs for Space Launch Vehicle Capability Assessment and Risk Mitigation

NASA Technical Reports Server (NTRS)

Decker, Ryan K.; Barbre, Robert E., Jr.

2015-01-01

Space launch vehicles incorporate upper-level wind assessments to determine wind effects on the vehicle and for a commit to launch decision. These assessments make use of wind profiles measured hours prior to launch and may not represent the actual wind the vehicle will fly through. Uncertainty in the winds over the time period between the assessment and launch introduces uncertainty in assessment of vehicle controllability and structural integrity that must be accounted for to ensure launch safety. Temporal wind pairs are used in engineering development of allowances to mitigate uncertainty. Five sets of temporal wind pairs at various times (0.75, 1.5, 2, 3 and 4-hrs) at the United States Air Force Eastern Range and Western Range, as well as the National Aeronautics and Space Administration's Wallops Flight Facility are developed for use in upper-level wind assessments on vehicle performance. Historical databases are compiled from balloon-based and vertically pointing Doppler radar wind profiler systems. Various automated and manual quality control procedures are used to remove unacceptable profiles. Statistical analyses on the resultant wind pairs from each site are performed to determine if the observed extreme wind changes in the sample pairs are representative of extreme temporal wind change. Wind change samples in the Eastern Range and Western Range databases characterize extreme wind change. However, the small sample sizes in the Wallops Flight Facility databases yield low confidence that the sample population characterizes extreme wind change that could occur.

Temporal Wind Pairs for Space Launch Vehicle Capability Assessment and Risk Mitigation

NASA Technical Reports Server (NTRS)

Decker, Ryan K.; Barbre, Robert E., Jr.

2014-01-01

Space launch vehicles incorporate upper-level wind assessments to determine wind effects on the vehicle and for a commit to launch decision. These assessments make use of wind profiles measured hours prior to launch and may not represent the actual wind the vehicle will fly through. Uncertainty in the winds over the time period between the assessment and launch introduces uncertainty in assessment of vehicle controllability and structural integrity that must be accounted for to ensure launch safety. Temporal wind pairs are used in engineering development of allowances to mitigate uncertainty. Five sets of temporal wind pairs at various times (0.75, 1.5, 2, 3 and 4-hrs) at the United States Air Force Eastern Range and Western Range, as well as the National Aeronautics and Space Administration's Wallops Flight Facility are developed for use in upper-level wind assessments on vehicle performance. Historical databases are compiled from balloon-based and vertically pointing Doppler radar wind profiler systems. Various automated and manual quality control procedures are used to remove unacceptable profiles. Statistical analyses on the resultant wind pairs from each site are performed to determine if the observed extreme wind changes in the sample pairs are representative of extreme temporal wind change. Wind change samples in the Eastern Range and Western Range databases characterize extreme wind change. However, the small sample sizes in the Wallops Flight Facility databases yield low confidence that the sample population characterizes extreme wind change that could occur.

Bioinformatic analysis of the effects and mechanisms of decitabine and cytarabine on acute myeloid leukemia

PubMed Central

Zhou, Shiyong; Liu, Pengfei; Zhang, Huilai

2017-01-01

Acute myeloid leukemia (AML) is a frequently occurring malignant disease of the blood and may result from a variety of genetic disorders. The present study aimed to identify the underlying mechanisms associated with the therapeutic effects of decitabine and cytarabine on AML, using microarray analysis. The microarray datasets GSE40442 and GSE40870 were downloaded from the Gene Expression Omnibus database. Differentially expressed genes (DEGs) and differentially methylated sites were identified in AML cells treated with decitabine compared with those treated with cytarabine via the Linear Models for Microarray Data package, following data pre-processing. Gene Ontology (GO) analysis of DEGs was performed using the Database for Annotation, Visualization and Integrated Analysis Discovery. Genes corresponding to the differentially methylated sites were obtained using the annotation package of the methylation microarray platform. The overlapping genes were identified, which exhibited the opposite variation trend between gene expression and DNA methylation. Important transcription factor (TF)-gene pairs were screened out, and a regulated network subsequently constructed. A total of 190 DEGs and 540 differentially methylated sites were identified in AML cells treated with decitabine compared with those treated with cytarabine. A total of 36 GO terms of DEGs were enriched, including nucleosomes, protein-DNA complexes and the nucleosome assembly. The 540 differentially methylated sites were located on 240 genes, including the acid-repeat containing protein (ACRC) gene that was additionally differentially expressed. In addition, 60 TF pairs and overlapped methylated sites, and 140 TF-pairs and DEGs were screened out. The regulated network included 68 nodes and 140 TF-gene pairs. The present study identified various genes including ACRC and proliferating cell nuclear antigen, in addition to various TFs, including TATA-box binding protein associated factor 1 and CCCTC-binding factor, which may be potential therapeutic targets of AML. PMID:28498449

Bioinformatic analysis of the effects and mechanisms of decitabine and cytarabine on acute myeloid leukemia.

PubMed

Zhou, Shiyong; Liu, Pengfei; Zhang, Huilai

2017-07-01

Acute myeloid leukemia (AML) is a frequently occurring malignant disease of the blood and may result from a variety of genetic disorders. The present study aimed to identify the underlying mechanisms associated with the therapeutic effects of decitabine and cytarabine on AML, using microarray analysis. The microarray datasets GSE40442 and GSE40870 were downloaded from the Gene Expression Omnibus database. Differentially expressed genes (DEGs) and differentially methylated sites were identified in AML cells treated with decitabine compared with those treated with cytarabine via the Linear Models for Microarray Data package, following data pre‑processing. Gene Ontology (GO) analysis of DEGs was performed using the Database for Annotation, Visualization and Integrated Analysis Discovery. Genes corresponding to the differentially methylated sites were obtained using the annotation package of the methylation microarray platform. The overlapping genes were identified, which exhibited the opposite variation trend between gene expression and DNA methylation. Important transcription factor (TF)‑gene pairs were screened out, and a regulated network subsequently constructed. A total of 190 DEGs and 540 differentially methylated sites were identified in AML cells treated with decitabine compared with those treated with cytarabine. A total of 36 GO terms of DEGs were enriched, including nucleosomes, protein‑DNA complexes and the nucleosome assembly. The 540 differentially methylated sites were located on 240 genes, including the acid‑repeat containing protein (ACRC) gene that was additionally differentially expressed. In addition, 60 TF pairs and overlapped methylated sites, and 140 TF‑pairs and DEGs were screened out. The regulated network included 68 nodes and 140 TF‑gene pairs. The present study identified various genes including ACRC and proliferating cell nuclear antigen, in addition to various TFs, including TATA‑box binding protein associated factor 1 and CCCTC‑binding factor, which may be potential therapeutic targets of AML.

Paired measurements of K and Mg isotopes and clay authigenesis in marine sediments

NASA Astrophysics Data System (ADS)

Santiago Ramos, D. P.; Dunlea, A. G.; Higgins, J. A.

2016-12-01

Despite its importance as a major sink for seawater K and Mg, estimates of clay authigenesis in marine sediments remain poorly constrained. Previous work on Mg isotope fractionation during clay formation has revealed a preferential uptake of 26Mg, yielding authigenic clay products with potentially distinct δ26Mg compared to the detrital component. In a similar manner, we aim to quantify the K isotope fractionation during authigenic clay formation and to use paired δ26Mg and δ41K measurements as proxies for the identification and quantification of authigenic clays in shallow and deep marine sedimentary systems. To better understand the behavior of paired Mg and K isotopes during authigenic clay formation in marine sediments, we measured δ26Mg and δ41K values of pore-fluids and sediments from ODP/IODP sites 1052, U1395, U1403 and U1366. We find that while pore-fluid K concentrations at sites 1052, U1395 and U1403 all decline with depth, δ41K profiles differ significantly. These differences might be a result of a complex interplay between clay authigenesis, sedimentation rate, and fractionation of K isotopes during diffusion. Results from 1-D diffusion-advection-reaction models suggest that, in contrast to Mg, diffusion may play an important role in determining the overall K isotope fractionation during clay authigenesis in sites with low-sedimentation rates. Sites with high sedimentation rates may act as close systems where diffusion is negligible. In such cases, K uptake can be modeled as a Rayleigh distillation process and K isotope fractionation can be estimated. Measurements of δ26Mg and δ41K of pore-fluids from site U1395 and bulk sediments from U1366 suggest that paired measurements of these isotopic systems in siliciclastic marine sediments can provide new insights into rates of marine clay authigenesis, a globally important but understudied component of many geochemical cycles.

Radiometric cross-calibration of the Terra MODIS and Landsat 7 ETM+ using an invariant desert site

USGS Publications Warehouse

Choi, T.; Angal, A.; Chander, G.; Xiong, X.

2008-01-01

A methodology for long-term radiometric cross-calibration between the Terra Moderate Resolution Imaging Spectroradiometer (MODIS) and Landsat 7 (L7) Enhanced Thematic Mapper Plus (ETM+) sensors was developed. The approach involves calibration of near-simultaneous surface observations between 2000 and 2007. Fifty-seven cloud-free image pairs were carefully selected over the Libyan desert for this study. The Libyan desert site (+28.55??, +23.39??), located in northern Africa, is a high reflectance site with high spatial, spectral, and temporal uniformity. Because the test site covers about 12 kmx13 km, accurate geometric preprocessing is required to match the footprint size between the two sensors to avoid uncertainties due to residual image misregistration. MODIS Level IB radiometrically corrected products were reprojected to the corresponding ETM+ image's Universal Transverse Mercator (UTM) grid projection. The 30 m pixels from the ETM+ images were aggregated to match the MODIS spatial resolution (250 m in Bands 1 and 2, or 500 m in Bands 3 to 7). The image data from both sensors were converted to absolute units of at-sensor radiance and top-ofatmosphere (TOA) reflectance for the spectrally matching band pairs. For each band pair, a set of fitted coefficients (slope and offset) is provided to quantify the relationships between the testing sensors. This work focuses on long-term stability and correlation of the Terra MODIS and L7 ETM+ sensors using absolute calibration results over the entire mission of the two sensors. Possible uncertainties are also discussed such as spectral differences in matching band pairs, solar zenith angle change during a collection, and differences in solar irradiance models.

The crystal structure of the Rv0301-Rv0300 VapBC-3 toxin-antitoxin complex from M. tuberculosis reveals a Mg 2+ ion in the active site and a putative RNA-binding site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Min, Andrew B; Miallau, Linda; Sawaya, Michael R

VapBC pairs account for 45 out of 88 identified toxin-antitoxin (TA) pairs in the Mycobacterium tuberculosis (Mtb) H37Rv genome. A working model suggests that under times of stress, antitoxin molecules are degraded, releasing the toxins to slow the metabolism of the cell, which in the case of VapC toxins is via their RNase activity. Otherwise the TA pairs remain bound to their promoters, autoinhibiting transcription. The crystal structure of Rv0301-Rv0300, an Mtb VapBC TA complex determined at 1.49 Å resolution, suggests a mechanism for these three functions: RNase activity, its inhibition by antitoxin, and its ability to bind promoter DNA.more » The Rv0301 toxin consists of a core of five parallel beta strands flanked by alpha helices. Three proximal aspartates coordinate a Mg2+ ion forming the putative RNase active site. The Rv0300 antitoxin monomer is extended in structure, consisting of an N-terminal beta strand followed by four helices. The last two helices wrap around the toxin and terminate near the putative RNase active site, but with different conformations. In one conformation, the C-terminal arginine interferes with Mg2+ ion coordination, suggesting a mechanism by which the antitoxin can inhibit toxin activity. At the N-terminus of the antitoxin, two pairs of Ribbon-Helix-Helix (RHH) motifs are related by crystallographic twofold symmetry. The resulting hetero-octameric complex is similar to the FitAB system, but the two RHH motifs are about 30 Å closer together in the Rv0301-Rv0300 complex, suggesting either a different span of the DNA recognition sequence or a conformational change.« less

Site Dependency of the High Conductivity of Ga 2 In 6 Sn 2 O 16 : The Role of the 7-Coordinate Site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rickert, Karl; Huq, Ashfia; Lapidus, Saul H.

The 6-coordinated cation site is the fundamental building block of the most effective transparent conducting oxides. Ga2In6Sn2O16, however, maintains 4-, 6-, 7-, and 8-coordinated cation sites and still exhibits desirable transparency and high conductivity. To investigate the potential impact of these alternative sites, we partially replace the Sn in Ga2In6Sn2O16 with Ti, Zr, or Hf and use a combined approach of DFT-based calculations, X-ray diffraction, and neutron diffraction to establish that the substitution occurs preferentially on the 7-coordinate site. In contrast to Sn, the empty d orbitals of Ti, Zr, and Hf promote spd covalency with the surrounding oxygen whichmore » decreases the conductivity. Pairing the substitutional site preference with the magnitude of this decrease demonstrates that the 7-coordinate site is the major contributor to the conductivity. The optical band gaps, in contrast, are shown to be site independent and composition dependent. Continued replacement of Sn after all 7-coordinate Sn has been substituted results in the formation of a 7-coordinate In antisite or replacement of 6-coordinate Sn, depending on the identity of the d0 substitute.« less

Site Dependency of the High Conductivity of Ga 2 In 6 Sn 2 O 16 : The Role of the 7-Coordinate Site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rickert, Karl; Huq, Ashfia; Lapidus, Saul H.

In 6-coordinated cation sites, we find that it is the fundamental building block of the most effective transparent conducting oxides. Ga 2In 6SnO 16, however, maintains 4-, 6-, 7-, and 8-coordinated cation sites and still exhibits desirable transparency and high conductivity. To investigate the potential impact of these alternative sites, we partially replace the Sn in Ga 2In 6Sn 2O 16 with Ti, Zr, or Hf and use a combined approach of density functional theory-based calculations, X-ray diffraction, and neutron diffraction to establish that the substitution occurs preferentially on the 7-coordinate site. Conversely to Sn, the empty d orbitals ofmore » Ti, Zr, and Hf promote spd covalency with the surrounding oxygen, which decreases the conductivity. Pairing the substitutional site preference with the magnitude of this decrease demonstrates that the 7-coordinate site is the V major contributor to conductivity. The optical band gaps, in contrast, are shown to be site-independent and composition-dependent. After all 7-coordinate Sn has been replaced, the continued substitution of Sn results in the formation of a 7-coordinate In antisite or replacement of 6-coordinate Sn, depending on the identity of the d(0) substitute.« less

Site Dependency of the High Conductivity of Ga 2 In 6 Sn 2 O 16 : The Role of the 7-Coordinate Site

DOE PAGES

Rickert, Karl; Huq, Ashfia; Lapidus, Saul H.; ...

2015-11-11

In 6-coordinated cation sites, we find that it is the fundamental building block of the most effective transparent conducting oxides. Ga 2In 6SnO 16, however, maintains 4-, 6-, 7-, and 8-coordinated cation sites and still exhibits desirable transparency and high conductivity. To investigate the potential impact of these alternative sites, we partially replace the Sn in Ga 2In 6Sn 2O 16 with Ti, Zr, or Hf and use a combined approach of density functional theory-based calculations, X-ray diffraction, and neutron diffraction to establish that the substitution occurs preferentially on the 7-coordinate site. Conversely to Sn, the empty d orbitals ofmore » Ti, Zr, and Hf promote spd covalency with the surrounding oxygen, which decreases the conductivity. Pairing the substitutional site preference with the magnitude of this decrease demonstrates that the 7-coordinate site is the V major contributor to conductivity. The optical band gaps, in contrast, are shown to be site-independent and composition-dependent. After all 7-coordinate Sn has been replaced, the continued substitution of Sn results in the formation of a 7-coordinate In antisite or replacement of 6-coordinate Sn, depending on the identity of the d(0) substitute.« less

Spectrum of cisplatin-induced mutations in Escherichia coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Burnouf, D.; Duane, M.; Fuchs, R.P.

1987-06-01

Using a forward-mutation assay based on the inactivation of the tetracycline-resistance gene located on plasmid pBR322, we have determined the mutation spectrum induced in Escherichia coli by cisplatin (cis-diamminedichloroplatinum(II)), a widely used antitumor drug. Cisplatin is known to form mainly intrastrand diadducts at ApG and GpG sites. We found that cisplatin efficiently induces mutations in an SOS-dependent way (i.e., dependent upon UV irradiation of the host bacteria). More than 90% of the mutations are single-base-pair substitutions occurring at the potential sites of cisplatin adducts (ApG and GpG). Taking into account the relative proportions of ApG and GpG adducts, we foundmore » that the ApG adducts are at least 5 times more mutagenic than the GpG adducts. Moreover, a strong mutation specificity was seen at the 5' side of the ApG adducts (A X T----T X A transversions). The observation that most mutations occur at the 5' end of the adduct at both ApG and GpG sites is discussed in relation to recent structural data.« less

The effectiveness of nutrition education: Applying the Health Belief Model in child-feeding practices to use pulses for complementary feeding in Southern Ethiopia.

PubMed

Mulualem, Demmelash; Henry, Carol J; Berhanu, Getenesh; Whiting, Susan J

2016-01-01

Complementary foods (CFs) in Ethiopia are cereal based and adding locally grown pulses (legumes) to CF would provide needed nutrients. To assess the effects of nutrition education (NEd) using Health Belief Model (HBM) in promoting pulses for CF, a 6-month quasi-experimental study was conducted in 160 mother-child pairs. Knowledge, attitude, and practice (KAP) questions were given to mothers at baseline, midline, and endline, along with anthropometric measurements of children. NEd involving discussions and recipe demonstrations was given twice monthly for 6 months to the intervention group (n = 80) while control mothers received usual education. At baseline, mothers' KAP scores were low at both sites; at 3 and 6 months of NEd, mean KAP scores of mothers increased (p < 0.05) compared to the control site. Significant improvements in children's mean weight, weight for height, and weight for age occurred in the intervention site only. Nutritional status of children improved after providing mothers with pulse-based NEd.

Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs

PubMed Central

2017-01-01

Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package. PMID:29107980

Environmental management framework for wind farm siting: methodology and case study.

PubMed

Tegou, Leda-Ioanna; Polatidis, Heracles; Haralambopoulos, Dias A

2010-11-01

This paper develops an integrated framework to evaluate land suitability for wind farm siting that combines multi-criteria analysis (MCA) with geographical information systems (GIS); an application of the proposed framework for the island of Lesvos, Greece, is further illustrated. A set of environmental, economic, social, and technical constraints, based on recent Greek legislation, identifies the potential sites for wind power installation. Furthermore, the area under consideration is evaluated by a variety of criteria, such as wind power potential, land cover type, electricity demand, visual impact, land value, and distance from the electricity grid. The pair-wise comparison method in the context of the analytic hierarchy process (AHP) is applied to estimate the criteria weights in order to establish their relative importance in site evaluation. The overall suitability of the study region for wind farm siting is appraised through the weighted summation rule. Results showed that only a very small percentage of the total area of Lesvos could be suitable for wind farm installation, although favourable wind potential exists in many more areas of the island. Copyright 2010 Elsevier Ltd. All rights reserved.

Evolution of multispectral aerosol optical properties in a biogenically-influenced urban environment during the CARES campaign

NASA Astrophysics Data System (ADS)

Gyawali, M.; Arnott, W. P.; Zaveri, R. A.; Song, C.; Pekour, M.; Flowers, B.; Dubey, M. K.; Setyan, A.; Zhang, Q.; Harworth, J. W.; Radney, J. G.; Atkinson, D. B.; China, S.; Mazzoleni, C.; Gorkowski, K.; Subramanian, R.; Jobson, B. T.; Moosmüller, H.

2013-03-01

Ground-based aerosol measurements made in June 2010 within Sacramento urban area (site T0) and at a 40-km downwind location (site T1) in the forested Sierra Nevada foothills area are used to investigate the evolution of multispectral optical properties as the urban aerosols aged and interacted with biogenic emissions. Along with black carbon and non-refractory aerosol mass and composition observations, spectral absorptio (βabs), scattering (βsca), and extinction (βext) coefficients for wavelengths ranging from 355 to 1064 nm were measured at both sites using photoacoustic (PA) instruments with integrating nephelometers and using cavity ring-down (CRD) instruments. The daytime average Ångström exponent of absorption (AEA) was ~1.6 for the wavelength pair 405 and 870 nm at T0, while it was ~1.8 for the wavelength pair 355 and 870 nm at T1, indicating a modest wavelength-dependent enhancement of absorption at both sites throughout the study. The measured and Mie theory calculations of multispectral βsca showed good correlation (R2=0.85-0.94). The average contribution of supermicron aerosol (mainly composed of sea salt particles advected in from the Pacific Ocean) to the total scattering coefficient ranged from less than 20% at 405 nm to greater than 80% at 1064 nm. From 22 to 28 June, secondary organic aerosol mass increased significantly at both sites due to increased biogenic emissions coupled with intense photochemical activity and air mass recirculation in the area. During this period, the short wavelength scattering coefficients at both sites gradually increased due to increase in the size of submicron aerosols. At the same time, BC mass-normalized absorption cross-section (MAC) values for ultraviolet wavelengths at T1 increased by ~60% compared to the relatively less aged urban emissions at the T0 site. In contrast, the average MAC values for 870 nm wavelength were identical at both sites. These results suggest formation of moderately brown secondary organic aerosols formed in biogenically-influenced urban air.

DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

PubMed

Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

2012-10-11

Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

Teaching the Anatomy of Oncology: Evaluating the Impact of a Dedicated Oncoanatomy Course

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chino, Junzo P., E-mail: junzo.chino@duke.ed; Lee, W. Robert; Madden, Richard

Purpose: Anatomic considerations are often critical in multidisciplinary cancer care. We developed an anatomy-focused educational program for radiation oncology residents integrating cadaver dissection into the didactic review of diagnostic, surgical, radiologic, and treatment planning, and herein assess its efficacy. Methods and Materials: Monthly, anatomic-site based educational modules were designed and implemented during the 2008-2009 academic year at Duke University Medical Center. Ten radiation oncology residents participated in these modules consisting of a 1-hour didactic introduction followed by a 1-hour session in the gross anatomy lab with cadavers prepared by trained anatomists. Pretests and posttests were given for six modules, andmore » post-module feedback surveys were distributed. Additional review questions testing knowledge from prior sessions were integrated into the later testing to evaluate knowledge retention. Paired analyses of pretests and postests were performed by Wilcoxon signed-rank test. Results: Ninety tests were collected and scored with 35 evaluable pretest and posttest pairs for six site-specific sessions. Posttests had significantly higher scores (median percentage correct 66% vs. 85%, p < 0.001). Of 47 evaluable paired pretest and review questions given 1-3 months after the intervention, correct responses rates were significantly higher for the later (59% vs. 86%, p = 0.008). Resident course satisfaction was high, with a median rating of 9 of 10 (IQR 8-9); with 1 being 'less effective than most educational interventions' and 10 being 'more effective than most educational interventions.' Conclusions: An integrated oncoanatomy course is associated with improved scores on post-intervention tests, sustained knowledge retention, and high resident satisfaction.« less

Schizophrenia: A genome scan targets chromosomes 3p and 8p as potential sites of susceptibility genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pulver, A.E.; Lasseter, V.K.; Kasch, L.

Using a systematically ascertained sample of 57 families, each having 2 or more members with a consensus diagnosis of schizophrenia (DSM-III-R criteria), we have carried out linkage studies of 520 loci, covering approximately 70% of the genome for susceptibility loci for schizophrenia. A two-stage strategy based on lod score thresholds from simulation studies of our sample identified regions for further exploration. In each region, a dense map of highly informative dinucleotide repeat polymorphisms (heterozygosity greater than .70) was analyzed using dominant, recessive, and {open_quotes}affected only{close_quotes} models and nonparametric sib pair identity-by-descent methods. For one region, 8p22-p21, affected sib-pair analyses gavemore » a P value = .0001, corresponding to a lod score approximately equal to 3.00. For 8p22-p21, the maximum two-point lod score occurred using the {open_quotes}affected only{close_quotes} recessive model (Z{sub max} = 2.35; {theta}{sub M} = {theta}{sub F}); allowing for a constant sex difference in recombination fractions found in reference pedigrees, Z{sub max} = 2.78 ({theta}{sub M}/{theta}{sub F} = 3). For a second region, 3p26-p24, the maximum two-point lod score was 2.34 ({open_quotes}affected only{close_quotes} dominant model), and the affected sib-pair P value was .01. These two regions are worthy of further exploration as potential sites of susceptibility genes for schizophrenia. 59 refs., 2 figs., 4 tabs.« less

Application of fluorescence resonance energy transfer techniques to the study of lectin-binding site distribution on Paramecium primaurelia (Protista, Ciliophora) cell surface.

PubMed

Locatelli, D; Delmonte Corrado, M U; Politi, H; Bottiroli, G

1998-01-01

Fluorescence resonance energy transfer (FRET) is a photophysical phenomenon occurring between the molecules of two fluorochromes with suitable spectral characteristics (donor-acceptor dye pair), and consisting in an excitation energy migration through a non-radiative process. Since the efficiency of the process is strictly dependent on the distance and reciprocal orientation of the donor and acceptor molecules, FRET-based techniques can be successfully applied to the study of biomolecules and cell component organisation and distribution. These techniques have been employed in studying Paramecium primaurelia surface membrane for the reciprocal distribution of N-acetylneuraminic acid (NeuAc) and N-acetylglucosamine (GlcNAc) glycosidic residues, which were found to be involved in mating cell pairing. NeuAc and GlcNAc were detected by their specific binding lectins, Limulus polyphemus agglutinin (LPA) and wheat germ agglutinin (WGA), respectively. Microspectrofluorometric analysis afforded the choice of fluorescein isothiocyanate and Texas red conjugated with LPA and WGA, respectively, as a suitable donor-acceptor couple efficiently activating FRET processes. Studies performed both in solution and in cells allowed to define the experimental conditions favourable for a FRET analysis. The comparative study carried out both on the conjugating-region and the non conjugating region of the surface membrane, indicates that FRET distribution appears quite homogeneous in mating-competent mating type (mt) I, whereas, in mating-competent mt II cells, FRET distribution seems to be preferentially localised on the conjugating-region functionally involved in mating cell pairing. This difference in the distribution of lectin-binding sites is suggested to be related to mating-competence acquisition.

Root system structure in planted and seeded loblolly and shortleaf pine

Treesearch

Constance A. Harrington; John C. Brissette; William C. Carlson

1989-01-01

Differences in root system structure attributable to stand origin were examined by pairing seeded and planted stands of loblolly (Pinus taeda L.) and shortleaf pine (P. echinata Mill.). The 17 paired stands were 3 to 9 years old and located in Arkansas, Oklahoma, and Texas on similar soil and site conditions. Root systems from 12...

Analysis of Heritability and Shared Heritability Based on Genome-Wide Association Studies for 13 Cancer Types

PubMed Central

Wheeler, William A.; Yeager, Meredith; Panagiotou, Orestis; Wang, Zhaoming; Berndt, Sonja I.; Lan, Qing; Abnet, Christian C.; Amundadottir, Laufey T.; Figueroa, Jonine D.; Landi, Maria Teresa; Mirabello, Lisa; Savage, Sharon A.; Taylor, Philip R.; Vivo, Immaculata De; McGlynn, Katherine A.; Purdue, Mark P.; Rajaraman, Preetha; Adami, Hans-Olov; Ahlbom, Anders; Albanes, Demetrius; Amary, Maria Fernanda; An, She-Juan; Andersson, Ulrika; Andriole, Gerald; Andrulis, Irene L.; Angelucci, Emanuele; Ansell, Stephen M.; Arici, Cecilia; Armstrong, Bruce K.; Arslan, Alan A.; Austin, Melissa A.; Baris, Dalsu; Barkauskas, Donald A.; Bassig, Bryan A.; Becker, Nikolaus; Benavente, Yolanda; Benhamou, Simone; Berg, Christine; Van Den Berg, David; Bernstein, Leslie; Bertrand, Kimberly A.; Birmann, Brenda M.; Black, Amanda; Boeing, Heiner; Boffetta, Paolo; Boutron-Ruault, Marie-Christine; Bracci, Paige M.; Brinton, Louise; Brooks-Wilson, Angela R.; Bueno-de-Mesquita, H. Bas; Burdett, Laurie; Buring, Julie; Butler, Mary Ann; Cai, Qiuyin; Cancel-Tassin, Geraldine; Canzian, Federico; Carrato, Alfredo; Carreon, Tania; Carta, Angela; Chan, John K. C.; Chang, Ellen T.; Chang, Gee-Chen; Chang, I-Shou; Chang, Jiang; Chang-Claude, Jenny; Chen, Chien-Jen; Chen, Chih-Yi; Chen, Chu; Chen, Chung-Hsing; Chen, Constance; Chen, Hongyan; Chen, Kexin; Chen, Kuan-Yu; Chen, Kun-Chieh; Chen, Ying; Chen, Ying-Hsiang; Chen, Yi-Song; Chen, Yuh-Min; Chien, Li-Hsin; Chirlaque, María-Dolores; Choi, Jin Eun; Choi, Yi Young; Chow, Wong-Ho; Chung, Charles C.; Clavel, Jacqueline; Clavel-Chapelon, Françoise; Cocco, Pierluigi; Colt, Joanne S.; Comperat, Eva; Conde, Lucia; Connors, Joseph M.; Conti, David; Cortessis, Victoria K.; Cotterchio, Michelle; Cozen, Wendy; Crouch, Simon; Crous-Bou, Marta; Cussenot, Olivier; Davis, Faith G.; Ding, Ti; Diver, W. Ryan; Dorronsoro, Miren; Dossus, Laure; Duell, Eric J.; Ennas, Maria Grazia; Erickson, Ralph L.; Feychting, Maria; Flanagan, Adrienne M.; Foretova, Lenka; Fraumeni, Joseph F.; Freedman, Neal D.; Beane Freeman, Laura E.; Fuchs, Charles; Gago-Dominguez, Manuela; Gallinger, Steven; Gao, Yu-Tang; Gapstur, Susan M.; Garcia-Closas, Montserrat; García-Closas, Reina; Gascoyne, Randy D.; Gastier-Foster, Julie; Gaudet, Mia M.; Gaziano, J. Michael; Giffen, Carol; Giles, Graham G.; Giovannucci, Edward; Glimelius, Bengt; Goggins, Michael; Gokgoz, Nalan; Goldstein, Alisa M.; Gorlick, Richard; Gross, Myron; Grubb, Robert; Gu, Jian; Guan, Peng; Gunter, Marc; Guo, Huan; Habermann, Thomas M.; Haiman, Christopher A.; Halai, Dina; Hallmans, Goran; Hassan, Manal; Hattinger, Claudia; He, Qincheng; He, Xingzhou; Helzlsouer, Kathy; Henderson, Brian; Henriksson, Roger; Hjalgrim, Henrik; Hoffman-Bolton, Judith; Hohensee, Chancellor; Holford, Theodore R.; Holly, Elizabeth A.; Hong, Yun-Chul; Hoover, Robert N.; Horn-Ross, Pamela L.; Hosain, G. M. Monawar; Hosgood, H. Dean; Hsiao, Chin-Fu; Hu, Nan; Hu, Wei; Hu, Zhibin; Huang, Ming-Shyan; Huerta, Jose-Maria; Hung, Jen-Yu; Hutchinson, Amy; Inskip, Peter D.; Jackson, Rebecca D.; Jacobs, Eric J.; Jenab, Mazda; Jeon, Hyo-Sung; Ji, Bu-Tian; Jin, Guangfu; Jin, Li; Johansen, Christoffer; Johnson, Alison; Jung, Yoo Jin; Kaaks, Rudolph; Kamineni, Aruna; Kane, Eleanor; Kang, Chang Hyun; Karagas, Margaret R.; Kelly, Rachel S.; Khaw, Kay-Tee; Kim, Christopher; Kim, Hee Nam; Kim, Jin Hee; Kim, Jun Suk; Kim, Yeul Hong; Kim, Young Tae; Kim, Young-Chul; Kitahara, Cari M.; Klein, Alison P.; Klein, Robert J.; Kogevinas, Manolis; Kohno, Takashi; Kolonel, Laurence N.; Kooperberg, Charles; Kricker, Anne; Krogh, Vittorio; Kunitoh, Hideo; Kurtz, Robert C.; Kweon, Sun-Seog; LaCroix, Andrea; Lawrence, Charles; Lecanda, Fernando; Lee, Victor Ho Fun; Li, Donghui; Li, Haixin; Li, Jihua; Li, Yao-Jen; Li, Yuqing; Liao, Linda M.; Liebow, Mark; Lightfoot, Tracy; Lim, Wei-Yen; Lin, Chien-Chung; Lin, Dongxin; Lindstrom, Sara; Linet, Martha S.; Link, Brian K.; Liu, Chenwei; Liu, Jianjun; Liu, Li; Ljungberg, Börje; Lloreta, Josep; Lollo, Simonetta Di; Lu, Daru; Lund, Eiluv; Malats, Nuria; Mannisto, Satu; Marchand, Loic Le; Marina, Neyssa; Masala, Giovanna; Mastrangelo, Giuseppe; Matsuo, Keitaro; Maynadie, Marc; McKay, James; McKean-Cowdin, Roberta; Melbye, Mads; Melin, Beatrice S.; Michaud, Dominique S.; Mitsudomi, Tetsuya; Monnereau, Alain; Montalvan, Rebecca; Moore, Lee E.; Mortensen, Lotte Maxild; Nieters, Alexandra; North, Kari E.; Novak, Anne J.; Oberg, Ann L.; Offit, Kenneth; Oh, In-Jae; Olson, Sara H.; Palli, Domenico; Pao, William; Park, In Kyu; Park, Jae Yong; Park, Kyong Hwa; Patiño-Garcia, Ana; Pavanello, Sofia; Peeters, Petra H. M.; Perng, Reury-Perng; Peters, Ulrike; Petersen, Gloria M.; Picci, Piero; Pike, Malcolm C.; Porru, Stefano; Prescott, Jennifer; Prokunina-Olsson, Ludmila; Qian, Biyun; Qiao, You-Lin; Rais, Marco; Riboli, Elio; Riby, Jacques; Risch, Harvey A.; Rizzato, Cosmeri; Rodabough, Rebecca; Roman, Eve; Roupret, Morgan; Ruder, Avima M.; de Sanjose, Silvia; Scelo, Ghislaine; Schned, Alan; Schumacher, Fredrick; Schwartz, Kendra; Schwenn, Molly; Scotlandi, Katia; Seow, Adeline; Serra, Consol; Serra, Massimo; Sesso, Howard D.; Setiawan, Veronica Wendy; Severi, Gianluca; Severson, Richard K.; Shanafelt, Tait D.; Shen, Hongbing; Shen, Wei; Shin, Min-Ho; Shiraishi, Kouya; Shu, Xiao-Ou; Siddiq, Afshan; Sierrasesúmaga, Luis; Sihoe, Alan Dart Loon; Skibola, Christine F.; Smith, Alex; Smith, Martyn T.; Southey, Melissa C.; Spinelli, John J.; Staines, Anthony; Stampfer, Meir; Stern, Marianna C.; Stevens, Victoria L.; Stolzenberg-Solomon, Rachael S.; Su, Jian; Su, Wu-Chou; Sund, Malin; Sung, Jae Sook; Sung, Sook Whan; Tan, Wen; Tang, Wei; Tardón, Adonina; Thomas, David; Thompson, Carrie A.; Tinker, Lesley F.; Tirabosco, Roberto; Tjønneland, Anne; Travis, Ruth C.; Trichopoulos, Dimitrios; Tsai, Fang-Yu; Tsai, Ying-Huang; Tucker, Margaret; Turner, Jenny; Vajdic, Claire M.; Vermeulen, Roel C. H.; Villano, Danylo J.; Vineis, Paolo; Virtamo, Jarmo; Visvanathan, Kala; Wactawski-Wende, Jean; Wang, Chaoyu; Wang, Chih-Liang; Wang, Jiu-Cun; Wang, Junwen; Wei, Fusheng; Weiderpass, Elisabete; Weiner, George J.; Weinstein, Stephanie; Wentzensen, Nicolas; White, Emily; Witzig, Thomas E.; Wolpin, Brian M.; Wong, Maria Pik; Wu, Chen; Wu, Guoping; Wu, Junjie; Wu, Tangchun; Wu, Wei; Wu, Xifeng; Wu, Yi-Long; Wunder, Jay S.; Xiang, Yong-Bing; Xu, Jun; Xu, Ping; Yang, Pan-Chyr; Yang, Tsung-Ying; Ye, Yuanqing; Yin, Zhihua; Yokota, Jun; Yoon, Ho-Il; Yu, Chong-Jen; Yu, Herbert; Yu, Kai; Yuan, Jian-Min; Zelenetz, Andrew; Zeleniuch-Jacquotte, Anne; Zhang, Xu-Chao; Zhang, Yawei; Zhao, Xueying; Zhao, Zhenhong; Zheng, Hong; Zheng, Tongzhang; Zheng, Wei; Zhou, Baosen; Zhu, Meng; Zucca, Mariagrazia; Boca, Simina M.; Cerhan, James R.; Ferri, Giovanni M.; Hartge, Patricia; Hsiung, Chao Agnes; Magnani, Corrado; Miligi, Lucia; Morton, Lindsay M.; Smedby, Karin E.; Teras, Lauren R.; Vijai, Joseph; Wang, Sophia S.; Brennan, Paul; Caporaso, Neil E.; Hunter, David J.; Kraft, Peter; Rothman, Nathaniel; Silverman, Debra T.; Slager, Susan L.; Chanock, Stephen J.; Chatterjee, Nilanjan

2015-01-01

Background: Studies of related individuals have consistently demonstrated notable familial aggregation of cancer. We aim to estimate the heritability and genetic correlation attributable to the additive effects of common single-nucleotide polymorphisms (SNPs) for cancer at 13 anatomical sites. Methods: Between 2007 and 2014, the US National Cancer Institute has generated data from genome-wide association studies (GWAS) for 49 492 cancer case patients and 34 131 control patients. We apply novel mixed model methodology (GCTA) to this GWAS data to estimate the heritability of individual cancers, as well as the proportion of heritability attributable to cigarette smoking in smoking-related cancers, and the genetic correlation between pairs of cancers. Results: GWAS heritability was statistically significant at nearly all sites, with the estimates of array-based heritability, hl 2, on the liability threshold (LT) scale ranging from 0.05 to 0.38. Estimating the combined heritability of multiple smoking characteristics, we calculate that at least 24% (95% confidence interval [CI] = 14% to 37%) and 7% (95% CI = 4% to 11%) of the heritability for lung and bladder cancer, respectively, can be attributed to genetic determinants of smoking. Most pairs of cancers studied did not show evidence of strong genetic correlation. We found only four pairs of cancers with marginally statistically significant correlations, specifically kidney and testes (ρ = 0.73, SE = 0.28), diffuse large B-cell lymphoma (DLBCL) and pediatric osteosarcoma (ρ = 0.53, SE = 0.21), DLBCL and chronic lymphocytic leukemia (CLL) (ρ = 0.51, SE =0.18), and bladder and lung (ρ = 0.35, SE = 0.14). Correlation analysis also indicates that the genetic architecture of lung cancer differs between a smoking population of European ancestry and a nonsmoking Asian population, allowing for the possibility that the genetic etiology for the same disease can vary by population and environmental exposures. Conclusion: Our results provide important insights into the genetic architecture of cancers and suggest new avenues for investigation. PMID:26464424

Management and protection protocols for the threatened Piping Plover (Charadrius Melodus) on Cape Hatteras National Seashore, North Carolina

USGS Publications Warehouse

Cohen, J.B.

2005-01-01

Executive Summary 1. The breeding population of the piping plover (Charadrius melodus), a federally-threatened shorebird, at Cape Hatteras National Seashore (CAHA) declined from 15 pairs/yr to 3 pairs/yr from 1989-2004. A population of this size may face immediate risk of extirpation from several sources. At several former breeding sites at CAHA, there have been no nesting pairs in recent years. 2. Only one plover chick has survived to fledging at CAHA, 2001-2004. While survival of eggs has often been moderate to high since 1989, survival of chicks has generally been low. Reproductive rate improved in 2005, with 6 chicks fledging from 2 pairs in conjunction with more actively managed closures in brood-rearing areas. 3. Inclement weather, predation, and recreational disturbance may negatively impact reproductive success of piping plovers at CAHA. Recreational disturbance and habitat loss caused by ORVs may discourage pairs from attempting to nest. 4. To recover the breeding plover population at CAHA, it will be necessary to create disturbance-free areas containing high-quality nesting and foraging habitat from the territory-establishment phase to the brood-rearing phase of the breeding cycle. We provide three management options to reduce risk of disturbance and mortality. They entail full closure of the seashore to recreation, closure of historical breeding sites to ORVs, or restriction of recreation to an oceanside corridor. 5. To reduce the risk of egg and chick mortality, we recommend continued efforts to trap and remove mammalian predators from all aforementioned sites and the continued use of predator exclosures around nests. We further recommend intensive monitoring and surveillance of protected areas to determine the extent and timing of threats to nests and broods, including nest overwash, predation, and disturbance or vandalism by humans. 6. Even if reproductive success improves under our recommendations, however, a population of this size will take several years to recover in the absence of immigrants from other sites, and there may not be a noticeable increase in population size in the short term. We recommend using an Adaptive Management approach, combining research, monitoring and management to assess the effectiveness of management actions in achieving our goals to recovery this threatened species at Cape Hatteras. 7. The size of nonbreeding flocks, their habitat use, their site tenacity, and sources of disturbance and mortality are not known with high precision. We recommend monitoring standards and research to address this problem, while at the same time restricting recreation adjacent to important migration and wintering sites to afford nonbreeding birds increased protection.

The chicken skeletal alpha-actin gene promoter region exhibits partial dyad symmetry and a capacity to drive bidirectional transcription.

PubMed Central

Grichnik, J M; French, B A; Schwartz, R J

1988-01-01

The chicken skeletal alpha-actin gene promoter region (-202 to -12) provides myogenic transcriptional specificity. This promoter contains partial dyad symmetry about an axis at nucleotide -108 and in transfection experiments is capable of directing transcription in a bidirectional manner. At least three different transcription initiation start sites, oriented toward upstream sequences, were mapped 25 to 30 base pairs from TATA-like regions. The opposing transcriptional activity was potentiated upon the deletion of sequences proximal to the alpha-actin transcription start site. Thus, sequences which serve to position RNA polymerase for alpha-actin transcription may allow, in their absence, the selection of alternative and reverse-oriented start sites. Nuclear runoff transcription assays of embryonic muscle indicated that divergent transcription may occur in vivo but with rapid turnover of nuclear transcripts. Divergent transcriptional activity enabled us to define the 3' regulatory boundary of the skeletal alpha-actin promoter which retains a high level of myogenic transcriptional activity. The 3' regulatory border was detected when serial 3' deletions bisected the element (-91 CCAAA TATGG -82) which reduced transcriptional activity by 80%. Previously we showed that disruption of its upstream counterpart (-127 CCAAAGAAGG -136) resulted in about a 90% decrease in activity. These element pairs, which we describe as CCAAT box-associated repeats, are conserved in all sequenced vertebrate sarcomeric actin genes and may act in a cooperative manner to facilitate transcription in myogenic cells. Images PMID:3211124

Low energy ion-solid interactions and chemistry effects in a series of pyrochlores

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dong, Liyuan; Li, Yuhong; Devanathan, Ram

The effect of chemistry on low energy recoil events was investigated at 10 K for each type of atom in pyrochlores using molecular dynamics simulation. Contour plots of the threshold displacement energy (Ed) in Gd2Zr2O7 have been produced along more than 80 directions for each individual species. The Ed surface for each type of atom in Gd2Zr2O7 is highly anisotropic; Ed of Zr exhibits the largest degree of anisotropy, while that of O8b exhibits the smallest. The recommended values of Ed in Gd2Zr2O7 based on the observed minima are 56, 94 and 25 eV, respectively for Gd, Zr and O.more » The influence of cation radius on Ed in pyrochlores A2B2O7 (with A-site ranging from Lu3+ to La3+ and B-site ranging from Ti4+ to Ce4+) was also investigated along three directions [100], [110] and [111]. The Ed in pyrochlores strongly depended on the atom type, atom mass, knock-on direction, and lattice position. The defects produced after low energy displacement events included cation antisite defects, cation Frenkel pairs, anion Frenkel pairs, various vacancies and interstitials. Ce doping in pyrochlores may affect the radiation response, because it resulted in drastic changes in cation and anion displacement energies and formation of an unusual type of anti-site defect. This work demonstrates links between Ed and amorphization resistance.« less

Next-generation sequencing is a robust strategy for the high-throughput detection of zygosity in transgenic maize.

PubMed

Fritsch, Leonie; Fischer, Rainer; Wambach, Christoph; Dudek, Max; Schillberg, Stefan; Schröper, Florian

2015-08-01

Simple and reliable, high-throughput techniques to detect the zygosity of transgenic events in plants are valuable for biotechnology and plant breeding companies seeking robust genotyping data for the assessment of new lines and the monitoring of breeding programs. We show that next-generation sequencing (NGS) applied to short PCR products spanning the transgene integration site provides accurate zygosity data that are more robust and reliable than those generated by PCR-based methods. The NGS reads covered the 5' border of the transgenic events (incorporating part of the transgene and the flanking genomic DNA), or the genomic sequences flanking the unfilled transgene integration site at the wild-type locus. We compared the NGS method to competitive real-time PCR with transgene-specific and wild-type-specific primer/probe pairs, one pair matching the 5' genomic flanking sequence and 5' part of the transgene and the other matching the unfilled transgene integration site. Although both NGS and real-time PCR provided useful zygosity data, the NGS technique was favorable because it needed fewer optimization steps. It also provided statistically more-reliable evidence for the presence of each allele because each product was often covered by more than 100 reads. The NGS method is also more suitable for the genotyping of large panels of plants because up to 80 million reads can be produced in one sequencing run. Our novel method is therefore ideal for the rapid and accurate genotyping of large numbers of samples.

Clearing the waters: Evaluating the need for site-specific field fluorescence corrections based on turbidity measurements

USGS Publications Warehouse

Saraceno, John F.; Shanley, James B.; Downing, Bryan D.; Pellerin, Brian A.

2017-01-01

In situ fluorescent dissolved organic matter (fDOM) measurements have gained increasing popularity as a proxy for dissolved organic carbon (DOC) concentrations in streams. One challenge to accurate fDOM measurements in many streams is light attenuation due to suspended particles. Downing et al. (2012) evaluated the need for corrections to compensate for particle interference on fDOM measurements using a single sediment standard in a laboratory study. The application of those results to a large river improved unfiltered field fDOM accuracy. We tested the same correction equation in a headwater tropical stream and found that it overcompensated fDOM when turbidity exceeded ∼300 formazin nephelometric units (FNU). Therefore, we developed a site-specific, field-based fDOM correction equation through paired in situ fDOM measurements of filtered and unfiltered streamwater. The site-specific correction increased fDOM accuracy up to a turbidity as high as 700 FNU, the maximum observed in this study. The difference in performance between the laboratory-based correction equation of Downing et al. (2012) and our site-specific, field-based correction equation likely arises from differences in particle size distribution between the sediment standard used in the lab (silt) and that observed in our study (fine to medium sand), particularly during high flows. Therefore, a particle interference correction equation based on a single sediment type may not be ideal when field sediment size is significantly different. Given that field fDOM corrections for particle interference under turbid conditions are a critical component in generating accurate DOC estimates, we describe a way to develop site-specific corrections.

Transition State Charge Stabilization and Acid-Base Catalysis of mRNA Cleavage by the Endoribonuclease RelE

PubMed Central

Dunican, Brian F.; Hiller, David A.; Strobel, Scott A.

2015-01-01

The bacterial toxin RelE is a ribosome-dependent endoribonuclease. It is part of a type II toxin-antitoxin system that contributes to antibiotic resistance and biofilm formation. During amino acid starvation RelE cleaves mRNA in the ribosomal A-site, globally inhibiting protein translation. RelE is structurally similar to microbial RNases that employ general acid-base catalysis to facilitate RNA cleavage. The RelE active-site is atypical for acid-base catalysis, in that it is enriched for positively charged residues and lacks the prototypical histidine-glutamate catalytic pair, making the mechanism of mRNA cleavage unclear. In this study we use a single-turnover kinetic analysis to measure the effect of pH and phosphorothioate substitution on the rate constant for cleavage of mRNA by wild-type RelE and seven active-site mutants. Mutation and thio-effects indicate a major role for stabilization of increased negative change in the transition state by arginine 61. The wild-type RelE cleavage rate constant is pH-independent, but the reaction catalyzed by many of the mutants is strongly pH dependent, suggestive of general acid-base catalysis. pH-rate curves indicate that wild-type RelE operates with the pKa of at least one catalytic residue significantly downshifted by the local environment. Mutation of any single active-site residue is sufficient to disrupt this microenvironment and revert the shifted pKa back above neutrality. pH-rate curves are consistent with K54 functioning as a general base and R81 as a general acid. The capacity of RelE to effect a large pKa shift and facilitate a common catalytic mechanism by uncommon means furthers our understanding of other atypical enzymatic active sites. PMID:26535789

Solar dimming above temperate forests and its impact on local climate

NASA Astrophysics Data System (ADS)

Tudoroiu, M.; Genesio, L.; Gioli, B.; Schume, H.; Knohl, A.; Brümmer, C.; Miglietta, F.

2018-06-01

Vegetation has a substantial impact on the local climate. Land cover changes through afforestation or deforestation can amplify or mitigate climate warming by changes in biophysical and biogeochemical mechanisms. In the montane to subalpine area of the Eastern Alps in Europe, where forests have constantly expanded in the last four decades, data of meteorological stations show a consistent reduction in incoming global radiation for the period 2000–2015. To assess the potential role of forests in contributing to such a reduction, three site pairs in Central Europe with neighbouring forest and non-forest sites were analysed. In all the pairs, a lower amount of incoming radiation was recorded at the forest site. When biophysical mechanisms such as albedo, surface roughness and Bowen ratio changes were modelled together with changes in global radiation, the total radiative forcing accounted for a rate of change in air temperature was equal to 0.032 °C ± 0.01 °C per Wm‑2. These results suggest that local climate is influenced by land cover change through afforestation both via albedo and radiation feedbacks but also by means of indirect biophysical and species-dependent mechanisms. The data obtained for the site pairs in Central Europe are finally discussed to infer the occurrence of similar forest-driven effects in the Eastern Alps which may explain part of the solar dimming observed in high elevation weather stations.

High-temperature atomic superfluidity in lattice Bose-Fermi mixtures.

PubMed

Illuminati, Fabrizio; Albus, Alexander

2004-08-27

We consider atomic Bose-Fermi mixtures in optical lattices and study the superfluidity of fermionic atoms due to s-wave pairing induced by boson-fermion interactions. We prove that the induced fermion-fermion coupling is always attractive if the boson-boson on-site interaction is repulsive, and predict the existence of an enhanced BEC-BCS crossover as the strength of the lattice potential is varied. We show that for direct on-site fermion-fermion repulsion, the induced attraction can give rise to superfluidity via s-wave pairing at striking variance with the case of pure systems of fermionic atoms with direct repulsive interactions.

The mosaics of Mars: As seen by the Viking Lander cameras

NASA Technical Reports Server (NTRS)

Levinthal, E. C.; Jones, K. L.

1980-01-01

The mosaics and derivative products produced from many individual high resolution images acquired by the Viking Lander Camera Systems are described: A morning and afternoon mosaic for both cameras at the Lander 1 Chryse Planitia site, and a morning, noon, and afternoon camera pair at Utopia Planitia, the Lander 11 site. The derived products include special geometric projections of the mosaic data sets, polar stereographic (donut), stereoscopic, and orthographic. Contour maps and vertical profiles of the topography were overlaid on the mosaics from which they were derived. Sets of stereo pairs were extracted and enlarged from stereoscopic projections of the mosaics.

The 5΄ UTR of the type I toxin ZorO can both inhibit and enhance translation

PubMed Central

Wen, Jia; Harp, John R.

2017-01-01

Abstract Many bacterial type I toxin mRNAs possess a long 5΄ untranslated region (UTR) that serves as the target site of the corresponding antitoxin sRNA. This is the case for the zorO-orzO type I system where the OrzO antitoxin base pairs to the 174-nucleotide zorO 5΄ UTR. Here, we demonstrate that the full-length 5΄ UTR of the zorO type I toxin hinders its own translation independent of the sRNA whereas a processed 5΄ UTR (zorO Δ28) promotes translation. The full-length zorO 5΄ UTR folds into an extensive secondary structure sequestering the ribosome binding site (RBS). Processing of the 5΄ UTR does not alter the RBS structure, but opens a large region (EAP region) located upstream of the RBS. Truncation of this EAP region impairs zorO translation, but this defect can be rescued upon exposing the RBS. Additionally, the region spanning +35 to +50 of the zorO mRNA is needed for optimal translation of zorO. Importantly, the positive and negative effects on translation imparted by the 5΄ UTR can be transferred onto a reporter gene, indicative that the 5΄ UTR can solely drive regulation. Moreover, we show that the OrzO sRNA can inhibit zorO translation via base pairing to the of the EAP region. PMID:27903909

Identification of somatic mutations in cancer through Bayesian-based analysis of sequenced genome pairs

PubMed Central

2013-01-01

Background The field of cancer genomics has rapidly adopted next-generation sequencing (NGS) in order to study and characterize malignant tumors with unprecedented resolution. In particular for cancer, one is often trying to identify somatic mutations – changes specific to a tumor and not within an individual’s germline. However, false positive and false negative detections often result from lack of sufficient variant evidence, contamination of the biopsy by stromal tissue, sequencing errors, and the erroneous classification of germline variation as tumor-specific. Results We have developed a generalized Bayesian analysis framework for matched tumor/normal samples with the purpose of identifying tumor-specific alterations such as single nucleotide mutations, small insertions/deletions, and structural variation. We describe our methodology, and discuss its application to other types of paired-tissue analysis such as the detection of loss of heterozygosity as well as allelic imbalance. We also demonstrate the high level of sensitivity and specificity in discovering simulated somatic mutations, for various combinations of a) genomic coverage and b) emulated heterogeneity. Conclusion We present a Java-based implementation of our methods named Seurat, which is made available for free academic use. We have demonstrated and reported on the discovery of different types of somatic change by applying Seurat to an experimentally-derived cancer dataset using our methods; and have discussed considerations and practices regarding the accurate detection of somatic events in cancer genomes. Seurat is available at https://sites.google.com/site/seuratsomatic. PMID:23642077

Identification of somatic mutations in cancer through Bayesian-based analysis of sequenced genome pairs.

PubMed

Christoforides, Alexis; Carpten, John D; Weiss, Glen J; Demeure, Michael J; Von Hoff, Daniel D; Craig, David W

2013-05-04

The field of cancer genomics has rapidly adopted next-generation sequencing (NGS) in order to study and characterize malignant tumors with unprecedented resolution. In particular for cancer, one is often trying to identify somatic mutations--changes specific to a tumor and not within an individual's germline. However, false positive and false negative detections often result from lack of sufficient variant evidence, contamination of the biopsy by stromal tissue, sequencing errors, and the erroneous classification of germline variation as tumor-specific. We have developed a generalized Bayesian analysis framework for matched tumor/normal samples with the purpose of identifying tumor-specific alterations such as single nucleotide mutations, small insertions/deletions, and structural variation. We describe our methodology, and discuss its application to other types of paired-tissue analysis such as the detection of loss of heterozygosity as well as allelic imbalance. We also demonstrate the high level of sensitivity and specificity in discovering simulated somatic mutations, for various combinations of a) genomic coverage and b) emulated heterogeneity. We present a Java-based implementation of our methods named Seurat, which is made available for free academic use. We have demonstrated and reported on the discovery of different types of somatic change by applying Seurat to an experimentally-derived cancer dataset using our methods; and have discussed considerations and practices regarding the accurate detection of somatic events in cancer genomes. Seurat is available at https://sites.google.com/site/seuratsomatic.

Structural analysis of the human U3 ribonucleoprotein particle reveal a conserved sequence available for base pairing with pre-rRNA.

PubMed Central

Parker, K A; Steitz, J A

1987-01-01

The human U3 ribonucleoprotein (RNP) has been analyzed to determine its protein constituents, sites of protein-RNA interaction, and RNA secondary structure. By using anti-U3 RNP antibodies and extracts prepared from HeLa cells labeled in vivo, the RNP was found to contain four nonphosphorylated proteins of 36, 30, 13, and 12.5 kilodaltons and two phosphorylated proteins of 74 and 59 kilodaltons. U3 nucleotides 72-90, 106-121, 154-166, and 190-217 must contain sites that interact with proteins since these regions are immunoprecipitated after treatment of the RNP with RNase A or T1. The secondary structure was probed with specific nucleases and by chemical modification with single-strand-specific reagents that block subsequent reverse transcription. Regions that are single stranded (and therefore potentially able to interact with a substrate RNA) include an evolutionarily conserved sequence at nucleotides 104-112 and nonconserved sequences at nucleotides 65-74, 80-84, and 88-93. Nucleotides 159-168 do not appear to be highly accessible, thus making it unlikely that this U3 sequence base pairs with sequences near the 5.8S rRNA-internal transcribed spacer II junction, as previously proposed. Alternative functions of the U3 RNP are discussed, including the possibility that U3 may participate in a processing event near the 3' end of 28S rRNA. Images PMID:2959855

Resistance to Nucleotide Excision Repair of Bulky Guanine Adducts Opposite Abasic Sites in DNA Duplexes and Relationships between Structure and Function

PubMed Central

Liu, Zhi; Ding, Shuang; Kropachev, Konstantin; Lei, Jia; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.

2015-01-01

The nucleotide excision repair of certain bulky DNA lesions is abrogated in some specific non-canonical DNA base sequence contexts, while the removal of the same lesions by the nucleotide excision repair mechanism is efficient in duplexes in which all base pairs are complementary. Here we show that the nucleotide excision repair activity in human cell extracts is moderate-to-high in the case of two stereoisomeric DNA lesions derived from the pro-carcinogen benzo[a]pyrene (cis- and trans-B[a]P-N 2-dG adducts) in a normal DNA duplex. By contrast, the nucleotide excision repair activity is completely abrogated when the canonical cytosine base opposite the B[a]P-dG adducts is replaced by an abasic site in duplex DNA. However, base excision repair of the abasic site persists. In order to understand the structural origins of these striking phenomena, we used NMR and molecular spectroscopy techniques to evaluate the conformational features of 11mer DNA duplexes containing these B[a]P-dG lesions opposite abasic sites. Our results show that in these duplexes containing the clustered lesions, both B[a]P-dG adducts adopt base-displaced intercalated conformations, with the B[a]P aromatic rings intercalated into the DNA helix. To explain the persistence of base excision repair in the face of the opposed bulky B[a]P ring system, molecular modeling results suggest how the APE1 base excision repair endonuclease, that excises abasic lesions, can bind productively even with the trans-B[a]P-dG positioned opposite the abasic site. We hypothesize that the nucleotide excision repair resistance is fostered by local B[a]P residue—DNA base stacking interactions at the abasic sites, that are facilitated by the absence of the cytosine partner base in the complementary strand. More broadly, this study sets the stage for elucidating the interplay between base excision and nucleotide excision repair in processing different types of clustered DNA lesions that are substrates of nucleotide excision repair or base excision repair mechanisms. PMID:26340000

The N-terminal cysteine pair of yeast sulfhydryl oxidase Erv1p is essential for in vivo activity and interacts with the primary redox centre.

PubMed

Hofhaus, Götz; Lee, Jeung-Eun; Tews, Ivo; Rosenberg, Beate; Lisowsky, Thomas

2003-04-01

Yeast Erv1p is a ubiquitous FAD-dependent sulfhydryl oxidase, located in the intermembrane space of mitochondria. The dimeric enzyme is essential for survival of the cell. Besides the redox-active CXXC motif close to the FAD, Erv1p harbours two additional cysteine pairs. Site-directed mutagenesis has identified all three cysteine pairs as essential for normal function. The C-terminal cysteine pair is of structural importance as it contributes to the correct arrangement of the FAD-binding fold. Variations in dimer formation and unique colour changes of mutant proteins argue in favour of an interaction between the N-terminal cysteine pair with the redox centre of the partner monomer.

d -wave superconductivity in the presence of nearest-neighbor Coulomb repulsion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jiang, M.; Hahner, U. R.; Schulthess, T. C.

Dynamic cluster quantum Monte Carlo calculations for a doped two-dimensional extended Hubbard model are used to study the stability and dynamics of d-wave pairing when a nearest-neighbor Coulomb repulsion V is present in addition to the on-site Coulomb repulsion U. We find that d-wave pairing and the superconducting transition temperature Tc are only weakly suppressed as long as V does not exceed U/2. This stability is traced to the strongly retarded nature of pairing that allows the d-wave pairs to minimize the repulsive effect of V. When V approaches U/2, large momentum charge fluctuations are found to become important andmore » to give rise to a more rapid suppression of d-wave pairing and T c than for smaller V.« less

Synaptonemal Complex Components Are Required for Meiotic Checkpoint Function in Caenorhabditis elegans

PubMed Central

Bohr, Tisha; Ashley, Guinevere; Eggleston, Evan; Firestone, Kyra; Bhalla, Needhi

2016-01-01

Synapsis involves the assembly of a proteinaceous structure, the synaptonemal complex (SC), between paired homologous chromosomes, and is essential for proper meiotic chromosome segregation. In Caenorhabditis elegans, the synapsis checkpoint selectively removes nuclei with unsynapsed chromosomes by inducing apoptosis. This checkpoint depends on pairing centers (PCs), cis-acting sites that promote pairing and synapsis. We have hypothesized that the stability of homolog pairing at PCs is monitored by this checkpoint. Here, we report that SC components SYP-3, HTP-3, HIM-3, and HTP-1 are required for a functional synapsis checkpoint. Mutation of these components does not abolish PC function, demonstrating they are bona fide checkpoint components. Further, we identify mutant backgrounds in which the instability of homolog pairing at PCs does not correlate with the synapsis checkpoint response. Altogether, these data suggest that, in addition to homolog pairing, SC assembly may be monitored by the synapsis checkpoint. PMID:27605049

Properties of promoters cloned randomly from the Saccharomyces cerevisiae genome.

PubMed Central

Santangelo, G M; Tornow, J; McLaughlin, C S; Moldave, K

1988-01-01

Promoters were isolated at random from the genome of Saccharomyces cerevisiae by using a plasmid that contains a divergently arrayed pair of promoterless reporter genes. A comprehensive library was constructed by inserting random (DNase I-generated) fragments into the intergenic region upstream from the reporter genes. Simple in vivo assays for either reporter gene product (alcohol dehydrogenase or beta-galactosidase) allowed the rapid identification of promoters from among these random fragments. Poly(dA-dT) homopolymer tracts were present in three of five randomly cloned promoters. With two exceptions, each RNA start site detected was 40 to 100 base pairs downstream from a TATA element. All of the randomly cloned promoters were capable of activating reporter gene transcription bidirectionally. Interestingly, one of the promoter fragments originated in a region of the S. cerevisiae rDNA spacer; regulated divergent transcription (presumably by RNA polymerase II) initiated in the same region. Images PMID:2847031

Local structure analysis on (La,Ba)(Ga,Mg)O3-δ by the pair distribution function method using a neutron source and density functional theory calculations

NASA Astrophysics Data System (ADS)

Kitamura, Naoto; Vogel, Sven C.; Idemoto, Yasushi

2013-06-01

In this work, we focused on La0.95Ba0.05Ga0.8Mg0.2O3-δ with the perovskite structure, and investigated the local structure around the oxygen vacancy by pair distribution function (PDF) method and density functional theory (DFT) calculation. By comparing the G(r) simulated based on the DFT calculation and the experimentally-observed G(r), it was suggested that the oxygen vacancy was trapped by Ba2+ at the La3+ site at least at room temperature. Such a defect association may be one of the reasons why the La0.95Ba0.05Ga0.8Mg0.2O3-δ showed lower oxide-ion conductivity than (La,Sr)(Ga,Mg)O3-δ which was widely-used as an electrolyte of the solid oxide fuel cell.

The structural impact of DNA mismatches

PubMed Central

Rossetti, Giulia; Dans, Pablo D.; Gomez-Pinto, Irene; Ivani, Ivan; Gonzalez, Carlos; Orozco, Modesto

2015-01-01

The structure and dynamics of all the transversion and transition mismatches in three different DNA environments have been characterized by molecular dynamics simulations and NMR spectroscopy. We found that the presence of mismatches produced significant local structural alterations, especially in the case of purine transversions. Mismatched pairs often show promiscuous hydrogen bonding patterns, which interchange among each other in the nanosecond time scale. This therefore defines flexible base pairs, where breathing is frequent, and where distortions in helical parameters are strong, resulting in significant alterations in groove dimension. Even if the DNA structure is plastic enough to absorb the structural impact of the mismatch, local structural changes can be propagated far from the mismatch site, following the expected through-backbone and a previously unknown through-space mechanism. The structural changes related to the presence of mismatches help to understand the different susceptibility of mismatches to the action of repairing proteins. PMID:25820425

Sulphur responsiveness of the Chlamydomonas reinhardtii LHCBM9 promoter.

PubMed

Sawyer, Anne L; Hankamer, Ben D; Ross, Ian L

2015-05-01

A 44-base-pair region in the Chlamydomonas reinhardtii LHCBM9 promoter is essential for sulphur responsiveness. The photosynthetic light-harvesting complex (LHC) proteins play essential roles both in light capture, the first step of photosynthesis, and in photoprotective mechanisms. In contrast to the other LHC proteins and the majority of photosynthesis proteins, the Chlamydomonas reinhardtii photosystem II-associated LHC protein, LHCBM9, was recently reported to be up-regulated under sulphur deprivation conditions, which also induce hydrogen production. Here, we examined the sulphur responsiveness of the LHCBM9 gene at the transcriptional level, through promoter deletion analysis. The LHCBM9 promoter was found to be responsive to sulphur deprivation, with a 44-base-pair region between nucleotide positions -136 and -180 relative to the translation start site identified as essential for this response. Anaerobiosis was found to enhance promoter activity under sulphur deprivation conditions, however, alone was unable to induce promoter activity. The study of LHCBM9 is of biological and biotechnological importance, as its expression is linked to photobiological hydrogen production, theoretically the most efficient process for biofuel production, while the simplicity of using an S-deprivation trigger enables the development of a novel C. reinhardtii-inducible promoter system based on LHCBM9.

Concordance of Beta-papillomavirus across anogenital and oral anatomic sites of men: The HIM Study.

PubMed

Nunes, Emily M; López, Rossana V M; Sudenga, Staci L; Gheit, Tarik; Tommasino, Massimo; Baggio, Maria L; Ferreira, Silvaneide; Galan, Lenice; Silva, Roberto C; Lazcano-Ponce, Eduardo; Giuliano, Anna R; Villa, Luisa L; Sichero, Laura

2017-10-01

We evaluated the concordance between β-HPVs detected in external genital skin, anal canal, and oral cavity specimens collected simultaneously from 717 men that were participating in the multinational HIM Study. Viral genotyping was performed using the Luminex technology. Species- and type-specific concordance was measured using kappa statistics for agreement. Overall, concordance of β-HPVs across sites was low and mainly observed among paired genital/anal canal samples. When grouped by species, solely β-4 HPVs showed moderate concordance in genital/anal pairs (κ = 0.457), which could be attributed to the substantial concordance of HPV-92 in men from Brazil and Mexico (κ > 0.610). β-HPV type concordance was higher in Mexico, where HPV-19 was consistently concordant in all anatomic site combinations. Our analysis indicates that type-specific concordance across sites is limited to few viral types; however, these infections seem to occur more often than would be expected by chance, suggesting that although rare, there is agreement among sites. Copyright © 2017 Elsevier Inc. All rights reserved.

Assessment of potential effects of water produced from coalbed natural gas development on macroinvertebrate and algal communities in the Powder River and Tongue River, Wyoming and Montana, 2010

USGS Publications Warehouse

Peterson, David A.; Hargett, Eric G.; Feldman, David L.

2011-01-01

Ongoing development of coalbed natural gas in the Powder River structural basin in Wyoming and Montana led to formation of an interagency aquatic task group to address concerns about the effects of the resulting production water on biological communities in streams of the area. Ecological assessments, made from 2005–08 under the direction of the task group, indicated biological condition of the macroinvertebrate and algal communities in the middle reaches of the Powder was lower than in the upper or lower reaches. On the basis of the 2005–08 results, sampling of the macroinvertebrate and algae communities was conducted at 18 sites on the mainstem Powder River and 6 sites on the mainstem Tongue River in 2010. Sampling-site locations were selected on a paired approach, with sites located upstream and downstream of discharge points and tributaries associated with coalbed natural gas development. Differences in biological condition among site pairs were evaluated graphically and statistically using multiple lines of evidence that included macroinvertebrate and algal community metrics (such as taxa richness, relative abundance, functional feeding groups, and tolerance) and output from observed/expected (O/E) macroinvertebrate models from Wyoming and Montana. Multiple lines of evidence indicated a decline in biological condition in the middle reaches of the Powder River, potentially indicating cumulative effects from coalbed natural gas discharges within one or more reaches between Flying E Creek and Wild Horse Creek in Wyoming. The maximum concentrations of alkalinity in the Powder River also occurred in the middle reaches. Biological condition in the upper and lower reaches of the Powder River was variable, with declines between some site pairs, such as upstream and downstream of Dry Fork and Willow Creek, and increases at others, such as upstream and downstream of Beaver Creek. Biological condition at site pairs on the Tongue River showed an increase in one case, near the Wyoming-Montana border, and a decrease in another case, upstream of Tongue River Reservoir. Few significant differences were noted from upstream to downstream of Prairie Dog Creek, a major tributary to the Tongue River. Further study would be needed to confirm the observed patterns and choose areas to examine in greater detail.

Activation of both acfA and acfD transcription by Vibrio cholerae ToxT requires binding to two centrally located DNA sites in an inverted repeat conformation.

PubMed

Withey, Jeffrey H; DiRita, Victor J

2005-05-01

The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.

Rotational-translational fourier imaging system

NASA Technical Reports Server (NTRS)

Campbell, Jonathan W. (Inventor)

2004-01-01

This invention has the ability to create Fourier-based images with only two grid pairs. The two grid pairs are manipulated in a manner that allows (1) a first grid pair to provide multiple real components of the Fourier-based image and (2) a second grid pair to provide multiple imaginary components of the Fourier-based image. The novelty of this invention resides in the use of only two grid pairs to provide the same imaging information that has been traditionally collected with multiple grid pairs.

Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

PubMed

Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

2011-03-14

We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

The Lumbar Artery Perforator Flap: 3-Dimensional Anatomical Study and Clinical Applications.

PubMed

Bissell, Mary Beth; Greenspun, David T; Levine, Josh; Rahal, William; Al-Dhamin, Ammar; AlKhawaji, Ali; Morris, Steven F

2016-10-01

The lumbar region is a potential donor site for perforator-based rotational or free flaps or as a recipient site for free flaps to obtain coverage for deficits in the sacral region. Because of the lack of consensus regarding the microvascular anatomy of this potential flap site, a robust investigation of the anatomy of this region is required. Three-dimensional reconstructions (n = 6) of the microvasculature of the lumbar region were generated using MIMICS software (Materialise, Belgium) for each of the four paired lumbar vessels. Diameter, course, and pedicle length were recorded for all lumbar artery (LA) perforators. Statistical analysis was performed using SigmaStat 4.0 and graphs were generated using GraphPad Prism 6 Software. Perforators arising from the first pair of LAs are reliably detected along the inferior margin of the 12th rib, extending inferiorly and laterally from the midline while perforators arising from the fourth pair of LA perforate the fascia along a horizontal plane connecting the posterior iliac crests. There are significantly more cutaneous perforators arising from the first (L1) and fourth (L4) pairs of LA than from the second (L2) and third (L3) (mean ± SD: L1, 5.5 ± 1.2; L2, 1.4 ± 0.7; L3, 1.3 ± 0.7; L4, 4.8 ± 1.0; P < 0.05). The average perforator diameter arising from L1 is greater than those arising from L4 (diameter ± SD: L1, 1.2 mm ± 0.2 >L4, 0.8 mm ± 0.2; P < 0.0001). L1 and L4 perforators have longer pedicle lengths than those arising from L2 and L3 (length ± SD: L1, 98.2 mm ± 57.8; L4, 106.1 mm ± 23.3 >L2, 67.5 mm ± 27.4; L3, 78.5 mm ± 30.3; P < 0.05). Perforators arising from the first and fourth LAs arise in a predictable fashion, have adequate pedicle lengths, and are of suitable diameter to support a perforator flap. We present a case to support the potential use of this flap for microvascular breast reconstruction.

The Economic Influences of Elementary School Sites on Residential Property Tax Revenue in Selected Urban Neighborhoods.

ERIC Educational Resources Information Center

Grube, Karl William

This study attempted to: (1) develop research criteria and statistically valid analyses; (2) measure the economic influences of well-developed and undeveloped elementary school sites, large open space and small, or limited space school sites, on the market sale prices of comparable single-family residential housing units in matched pairs of urban…

First-Year Students' Use of Social Network Sites to Reduce the Uncertainty of Anticipatory Socialization

ERIC Educational Resources Information Center

Anderson, Isolde K.; Lerstrom, Alan; Tintle, Nathan

2014-01-01

This study surveyed 399 incoming first-year students at two colleges in the Midwest on their use of social network sites before college entry and its impact on various dimensions of the first-year experience. Significant correlations were found for two pairs of variables: (a) students who used social network sites before arriving on campus…

Co-evolution of somatic variation in primary and metastatic colorectal cancer may expand biopsy indications in the molecular era.

PubMed

Kim, Richard; Schell, Michael J; Teer, Jamie K; Greenawalt, Danielle M; Yang, Mingli; Yeatman, Timothy J

2015-01-01

Metastasis is thought to be a clonal event whereby a single cell initiates the development of a new tumor at a distant site. However the degree to which primary and metastatic tumors differ on a molecular level remains unclear. To further evaluate these concepts, we used next generation sequencing (NGS) to assess the molecular composition of paired primary and metastatic colorectal cancer tissue specimens. 468 colorectal tumor samples from a large personalized medicine initiative were assessed by targeted gene sequencing of 1,321 individual genes. Eighteen patients produced genomic profiles for 17 paired primary:metastatic (and 2 metastatic:metastatic) specimens. An average of 33.3 mutations/tumor were concordant (shared) between matched samples, including common well-known genes (APC, KRAS, TP53). An average of 2.3 mutations/tumor were discordant (unshared) among paired sites. KRAS mutational status was always concordant. The overall concordance rate for mutations was 93.5%; however, nearly all (18/19 (94.7%)) paired tumors showed at least one mutational discordance. Mutations were seen in: TTN, the largest gene (5 discordant pairs), ADAMTS20, APC, MACF1, RASA1, TP53, and WNT2 (2 discordant pairs), SMAD2, SMAD3, SMAD4, FBXW7, and 66 others (1 discordant pair). Whereas primary and metastatic tumors displayed little variance overall, co-evolution produced incremental mutations in both. These results suggest that while biopsy of the primary tumor alone is likely sufficient in the chemotherapy-naïve patient, additional biopsies of primary or metastatic disease may be necessary to precisely tailor therapy following chemotherapy resistance or insensitivity in order to adequately account for tumor evolution.

Co-Evolution of Somatic Variation in Primary and Metastatic Colorectal Cancer May Expand Biopsy Indications in the Molecular Era

PubMed Central

Kim, Richard; Schell, Michael J.; Teer, Jamie K.; Greenawalt, Danielle M.; Yang, Mingli; Yeatman, Timothy J.

2015-01-01

Introduction Metastasis is thought to be a clonal event whereby a single cell initiates the development of a new tumor at a distant site. However the degree to which primary and metastatic tumors differ on a molecular level remains unclear. To further evaluate these concepts, we used next generation sequencing (NGS) to assess the molecular composition of paired primary and metastatic colorectal cancer tissue specimens. Methods 468 colorectal tumor samples from a large personalized medicine initiative were assessed by targeted gene sequencing of 1,321 individual genes. Eighteen patients produced genomic profiles for 17 paired primary:metastatic (and 2 metastatic:metastatic) specimens. Results An average of 33.3 mutations/tumor were concordant (shared) between matched samples, including common well-known genes (APC, KRAS, TP53). An average of 2.3 mutations/tumor were discordant (unshared) among paired sites. KRAS mutational status was always concordant. The overall concordance rate for mutations was 93.5%; however, nearly all (18/19 (94.7%)) paired tumors showed at least one mutational discordance. Mutations were seen in: TTN, the largest gene (5 discordant pairs), ADAMTS20, APC, MACF1, RASA1, TP53, and WNT2 (2 discordant pairs), SMAD2, SMAD3, SMAD4, FBXW7, and 66 others (1 discordant pair). Conclusions Whereas primary and metastatic tumors displayed little variance overall, co-evolution produced incremental mutations in both. These results suggest that while biopsy of the primary tumor alone is likely sufficient in the chemotherapy-naïve patient, additional biopsies of primary or metastatic disease may be necessary to precisely tailor therapy following chemotherapy resistance or insensitivity in order to adequately account for tumor evolution. PMID:25974029

Superconductivity in the Penson-Kolb Model on a Triangular Lattice

NASA Astrophysics Data System (ADS)

Ptok, A.; Mierzejewski, M.

2008-07-01

We investigate properties of the two-dimensional Penson-Kolb model with repulsive pair hopping interaction. In the case of a bipartite square lattice this interaction may lead to the η-type pairing, when the phase of superconducting order parameter changes from one lattice site to the neighboring one. We show that this interaction may be responsible for the onset of superconductivity also for a triangular lattice. We discuss the spatial dependence of the superconducting order parameter and demonstrate that the total momentum of the paired electrons is determined by the lattice geometry.

Particle sorting during sediment redistribution processes and the effect on 230Th-normalized mass accumulation rates

NASA Astrophysics Data System (ADS)

Marcantonio, Franco; Lyle, Mitchell; Ibrahim, Rami

2014-08-01

The 230Th method of determining mass accumulation rates (MARs) assumes that little to no fractionation occurs during sediment redistribution processes at the seafloor. We examine 230Th inventories in radiocarbon-dated multicore sediments from paired winnowed and focused sites at Cocos and Carnegie Ridges, Panama Basin. Radiocarbon-derived sand MARs, which likely represent the vertical rain of particles poorly transported by bottom currents, are similar at each of the paired sites but are different using 230Th normalization. 230Th-normalized MARs are about 60% lower at focused sites and likely underestimate vertical MARs, while the reverse is true for winnowed sites. We hypothesize that size fractionation occurs most frequently at lower current velocities, resulting in the coarse fraction being left behind and primarily the fine 230Th-rich grains being transported downslope. 230Th-normalization works well for recording fine-grained (detrital and opal), but not coarse-grained (carbonate), fluxes in regions that have undergone sediment redistribution.

Transposon Tn10 contains two structural genes with opposite polarity between tetA and IS10R.

PubMed Central

Schollmeier, K; Hillen, W

1984-01-01

The nucleotide sequence of the central part of Tn10 has been determined from the rightmost HindIII site to IS10R. This sequence contains two open reading frames with opposite polarity. The in vivo transcription start points in this sequence have been determined by S1 mapping. These results define one minor and two major promoters. The transcription starts of the two major promoters are only 18 base pairs apart, and the transcripts show different polarity and overlap by 18 base pairs. The nucleotide sequence reveals two regions with palindromic symmetry which may serve as operators. Their possible involvement in the regulation of transcription of both genes is discussed. Taken together these results allow for a maximal coding capacity of 138 amino acids directed toward IS10R and 197 amino acids directed toward tetA. The possible function of these gene products is discussed. The accompanying article (Braus et al., J. Bacteriol. 160:504-509, 1984) presents evidence that these genes are expressed. Images PMID:6094471