Sample records for base pairing properties

  1. Theoretical determination of one-electron redox potentials for DNA bases, base pairs, and stacks.

    PubMed

    Paukku, Y; Hill, G

    2011-05-12

    Electron affinities, ionization potentials, and redox potentials for DNA bases, base pairs, and N-methylated derivatives are computed at the DFT/M06-2X/6-31++G(d,p) level of theory. Redox properties of a guanine-guanine stack model are explored as well. Reduction and oxidation potentials are in good agreement with the experimental ones. Electron affinities of base pairs were found to be negative. Methylation of canonical bases affects the ionization potentials the most. Base pair formation and base stacking lower ionization potentials by 0.3 eV. Pairing of guanine with the 5-methylcytosine does not seem to influence the redox properties of this base pair much.

  2. On twelve types of covering-based rough sets.

    PubMed

    Safari, Samira; Hooshmandasl, Mohammad Reza

    2016-01-01

    Covering approximation spaces are a generalization of equivalence-based rough set theories. In this paper, we will consider twelve types of covering based approximation operators by combining four types of covering lower approximation operators and three types of covering upper approximation operators. Then, we will study the properties of these new pairs and show they have most of the common properties among existing covering approximation pairs. Finally, the relation between these new pairs is studied.

  3. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Leszczynski, Jerzy; Sponer, Judit; Sponer, Jiri

    Recent experimental studies on the Watson Crick type base pairing of triazine and aminopyrimidine derivatives suggest that acid/base properties of the constituent bases might be related to the duplex stabilities measured in solution. Herein we use high-level quantum chemical calculations and molecular dynamics simulations to evaluate the base pairing and stacking interactions of seven selected base pairs, which are common in that they are stabilized by two NH O hydrogen bonds separated by one NH N hydrogen bond. We show that neither the base pairing nor the base stacking interaction energies correlate with the reported pKa data of the basesmore » and the melting points of the duplexes. This suggests that the experimentally observed correlation between the melting point data of the duplexes and the pKa values of the constituent bases is not rooted in the intrinsic base pairing and stacking properties. The physical chemistry origin of the observed experimental correlation thus remains unexplained and requires further investigations. In addition, since our calculations are carried out with extrapolation to the complete basis set of atomic orbitals and with inclusion of higher electron correlation effects, they provide reference data for stacking and base pairing energies of non-natural bases.« less

  4. DNA bases ring-expanded with a cyclopentadiene free radical: a theoretical investigation of building blocks with diradical character.

    PubMed

    Zhao, Peiwen; Bu, Yuxiang

    2016-01-14

    In this work, we computationally design radical nucleobases which possess improved electronic properties, especially diradical properties through introducing a cyclopentadiene radical. We predict that the detailed electromagnetic features of base assemblies are based on the orientation of the extra five-membered cyclopentadiene ring. Broken symmetry DFT calculations take into account the relevant structures and properties. Our results reveal that both the radicalized DNA bases and the base pairs formed when they combine with their counterparts remain stable and display larger spin delocalization. The mode of embedding the cyclopentadiene free radical in the structures has some influence on the degree of π-conjugation, which results in various diradical characteristics. Single-layered radical base pairs all have an open-shell singlet ground state, but the energy difference between singlet and triplet is not significant. For two-layered radical base pairs, the situation is more complex. All of them have an open-shell state as their ground state, including an open-shell singlet state and an open-shell triplet state. That is, the majority of radical base pairs possess anti-ferromagnetic or ferromagnetic characteristics. We present here a more in-depth discussion and analyses to study the magnetic characteristics of radical bases and base pairs. As an important factor, two-layered radical base pairs also have been carefully analyzed. We hope that all the measurements and results presented here will stimulate further detailed insights into the related mechanisms in modified DNA bases and the design of better ring-expanded DNA magnetic materials.

  5. The nearest neighbor and next nearest neighbor effects on the thermodynamic and kinetic properties of RNA base pair

    NASA Astrophysics Data System (ADS)

    Wang, Yujie; Wang, Zhen; Wang, Yanli; Liu, Taigang; Zhang, Wenbing

    2018-01-01

    The thermodynamic and kinetic parameters of an RNA base pair with different nearest and next nearest neighbors were obtained through long-time molecular dynamics simulation of the opening-closing switch process of the base pair near its melting temperature. The results indicate that thermodynamic parameters of GC base pair are dependent on the nearest neighbor base pair, and the next nearest neighbor base pair has little effect, which validated the nearest-neighbor model. The closing and opening rates of the GC base pair also showed nearest neighbor dependences. At certain temperature, the closing and opening rates of the GC pair with nearest neighbor AU is larger than that with the nearest neighbor GC, and the next nearest neighbor plays little role. The free energy landscape of the GC base pair with the nearest neighbor GC is rougher than that with nearest neighbor AU.

  6. Developing Topological Insulator Fiber Based Photon Pairs Source for Ultrafast Optoelectronic Applications

    DTIC Science & Technology

    2016-04-01

    DEVELOPING TOPOLOGICAL INSULATOR FIBER BASED PHOTON PAIRS SOURCE FOR ULTRAFAST OPTOELECTRONIC APPLICATIONS NORTHWESTERN UNIVERSITY...REPORT TYPE FINAL TECHNICAL REPORT 3. DATES COVERED (From - To) APRIL 2015 – DEC 2015 4. TITLE AND SUBTITLE DEVELOPING TOPOLOGICAL INSULATOR FIBER BASED...in developing a new source for the production of correlated/entangled photon pairs based on the unique nanolayer properties of topological insulator

  7. DFT investigation of the vibrational properties of GC Watson-Crick and Hoogsteen base pairs in the presence of Mg²⁺, Ca²⁺, and Cu²⁺ ions.

    PubMed

    Morari, Cristian; Muntean, Cristina M; Tripon, Carmen; Buimaga-Iarinca, Luiza; Calborean, Adrian

    2014-04-01

    The binding effects of Mg²⁺, Ca²⁺, and Cu²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. Both Watson-Crick and Hoogsteen configurations of the base pairs were investigated. In Watson-Crick configuration, the metal was coordinated at N7 atom of guanine, while in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the geometric properties of the metal-GC base pairs structure, as well as the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen GC structures. For the geometric models used by us, the vibrational amplitudes of metallic atoms were stronger for wavenumbers lower than 500 cm⁻¹. This suggests that in the experimental studies on DNA the presence of the three metallic atoms (Mg, Ca, and Cu) can be explicitly detected at low frequencies.

  8. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Egli, Martin; Pallan, Pradeep S.; Pattanayek, Rekha

    An experimental rationalization of the structure type encountered in DNA and RNA by systematically investigating the chemical and physical properties of alternative nucleic acids has identified systems with a variety of sugar-phosphate backbones that are capable of Watson-Crick base pairing and in some cases cross-pairing with the natural nucleic acids. The earliest among the model systems tested to date, (4{prime} {yields} 6{prime})-linked oligo(2{prime},3{prime}-dideoxy-{beta}-d-glucopyranosyl)nucleotides or homo-DNA, shows stable self-pairing, but the pairing rules for the four natural bases are not the same as those in DNA. However, a complete interpretation and understanding of the properties of the hexapyranosyl (4{prime} {yields} 6{prime})more » family of nucleic acids has been impeded until now by the lack of detailed 3D-structural data. We have determined the crystal structure of a homo-DNA octamer. It reveals a weakly twisted right-handed duplex with a strong inclination between the hexose-phosphate backbones and base-pair axes, and highly irregular values for helical rise and twist at individual base steps. The structure allows a rationalization of the inability of allo-, altro-, and glucopyranosyl-based oligonucleotides to form stable pairing systems.« less

  9. [Structural and Dipole Structure Peculiarities of Hoogsteen Base Pairs Formed in Complementary Nucleobases according to ab initio Quantum Mechanics Studies].

    PubMed

    Petrenko, Y M

    2015-01-01

    Ab initio quantum mechanics studies for the detection of structure and dipole structure peculiarities of Hoogsteen base pairs relative to Watson-Crick base pairs, were performed during our work. These base pairs are formed as a result of complementary interactions. It was revealed, that adenine-thymine Hoogsteen base pair and adenine-thymine Watson-Crick base pairs can be formed depending on initial configuration. Cytosine-guanine Hoogsteen pairs are formed only when cytosine was originally protonated. Both types of Hoogsteen pairs have noticeable difference in the bond distances and angles. These differences appeared in purine as well as in pyrimidine parts of the pairs. Hoogsteen pairs have mostly shorter hydrogen bond lengths and significantly larger angles of hydrogen bonds and larger angles between the hydrogen bonds than Watson-Crick base pairs. Notable differences are also observed with respect to charge distribution and dipole moment. Quantitative data on these differences are shown in our work. It is also reported that the values of local parameters (according to Cambridge classification of the parameters which determine DNA properties) in Hoogsteen base pairs, are greatly different from Watson-Crick ones.

  10. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    NASA Astrophysics Data System (ADS)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  11. Synthesis and Properties of Size-expanded DNAs: Toward Designed, Functional Genetic Systems

    PubMed Central

    Krueger, Andrew T.; Lu, Haige; Lee, Alex H. F.; Kool, Eric T.

    2008-01-01

    We describe the design, synthesis, and properties of DNA-like molecules in which the base pairs are expanded by benzo homologation. The resulting size-expanded genetic helices are called xDNA (“expanded DNA”) and yDNA (“wide DNA”). The large component bases are fluorescent, and they display high stacking affinity. When singly substituted into natural DNA, they are destabilizing because the benzo-expanded base pair size is too large for the natural helix. However, when all base pairs are expanded, xDNA and yDNA form highly stable, sequence-selective double helices. The size-expanded DNAs are candidates for components of new, functioning genetic systems. In addition, the fluorescence of expanded DNA bases makes them potentially useful in probing nucleic acids. PMID:17309194

  12. Charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta

    By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency.more » The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.« less

  13. Pairing States of Spin-3/2 Fermions: Symmetry-Enforced Topological Gap Functions

    NASA Astrophysics Data System (ADS)

    Venderbos, Jörn W. F.; Savary, Lucile; Ruhman, Jonathan; Lee, Patrick A.; Fu, Liang

    2018-01-01

    We study the topological properties of superconductors with paired j =3/2 quasiparticles. Higher spin Fermi surfaces can arise, for instance, in strongly spin-orbit coupled band-inverted semimetals. Examples include the Bi-based half-Heusler materials, which have recently been established as low-temperature and low-carrier density superconductors. Motivated by this experimental observation, we obtain a comprehensive symmetry-based classification of topological pairing states in systems with higher angular momentum Cooper pairing. Our study consists of two main parts. First, we develop the phenomenological theory of multicomponent (i.e., higher angular momentum) pairing by classifying the stationary points of the free energy within a Ginzburg-Landau framework. Based on the symmetry classification of stationary pairing states, we then derive the symmetry-imposed constraints on their gap structures. We find that, depending on the symmetry quantum numbers of the Cooper pairs, different types of topological pairing states can occur: fully gapped topological superconductors in class DIII, Dirac superconductors, and superconductors hosting Majorana fermions. Notably, we find a series of nematic fully gapped topological superconductors, as well as double- and triple-Dirac superconductors, with quadratic and cubic dispersion, respectively. Our approach, applied here to the case of j =3/2 Cooper pairing, is rooted in the symmetry properties of pairing states, and can therefore also be applied to other systems with higher angular momentum and high-spin pairing. We conclude by relating our results to experimentally accessible signatures in thermodynamic and dynamic probes.

  14. Bifacial Base-Pairing Behaviors of 5-Hydroxyuracil DNA Bases through Hydrogen Bonding and Metal Coordination.

    PubMed

    Takezawa, Yusuke; Nishiyama, Kotaro; Mashima, Tsukasa; Katahira, Masato; Shionoya, Mitsuhiko

    2015-10-12

    A novel bifacial ligand-bearing nucleobase, 5-hydroxyuracil (U(OH) ), which forms both a hydrogen-bonded base pair (U(OH) -A) and a metal-mediated base pair (U(OH) -M-U(OH) ) has been developed. The U(OH) -M-U(OH) base pairs were quantitatively formed in the presence of lanthanide ions such as Gd(III) when U(OH) -U(OH) pairs were consecutively incorporated into DNA duplexes. This result established metal-assisted duplex stabilization as well as DNA-templated assembly of lanthanide ions. Notably, a duplex possessing U(OH) -A base pairs was destabilized by addition of Gd(III) ions. This observation suggests that the hybridization behaviors of the U(OH) -containing DNA strands are altered by metal complexation. Thus, the U(OH) nucleobase with a bifacial base-pairing property holds great promise as a component for metal-responsive DNA materials. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Imidazopyridine/Pyrrole and hydroxybenzimidazole/pyrrole pairs for DNA minor groove recognition.

    PubMed

    Renneberg, Dorte; Dervan, Peter B

    2003-05-14

    The DNA binding properties of fused heterocycles imidazo[4,5-b]pyridine (Ip) and hydroxybenzimidazole (Hz) paired with pyrrole (Py) in eight-ring hairpin polyamides are reported. The recognition profile of Ip/Py and Hz/Py pairs were compared to the five-membered ring pairs Im/Py and Hp/Py on a DNA restriction fragment at four 6-base pair recognition sites which vary at a single position 5'-TGTNTA-3', where N = G, C, T, A. The Ip/Py pair distinguishes G.C from C.G, T.A, and A.T, and the Hz/Py pair distinguishes T.A from A.T, G.C, and C.G, affording a new set of heterocycle pairs to target the four Watson-Crick base pairs in the minor groove of DNA.

  16. Are herb-pairs of traditional Chinese medicine distinguishable from others? Pattern analysis and artificial intelligence classification study of traditionally defined herbal properties.

    PubMed

    Ung, Choong Yong; Li, Hu; Cao, Zhi Wei; Li, Yi Xue; Chen, Yu Zong

    2007-05-04

    Multi-herb prescriptions of traditional Chinese medicine (TCM) often include special herb-pairs for mutual enhancement, assistance, and restraint. These TCM herb-pairs have been assembled and interpreted based on traditionally defined herbal properties (TCM-HPs) without knowledge of mechanism of their assumed synergy. While these mechanisms are yet to be determined, properties of TCM herb-pairs can be investigated to determine if they exhibit features consistent with their claimed unique synergistic combinations. We analyzed distribution patterns of TCM-HPs of TCM herb-pairs to detect signs indicative of possible synergy and used artificial intelligence (AI) methods to examine whether combination of their TCM-HPs are distinguishable from those of non-TCM herb-pairs assembled by random combinations and by modification of known TCM herb-pairs. Patterns of the majority of 394 known TCM herb-pairs were found to exhibit signs of herb-pair correlation. Three AI systems, trained and tested by using 394 TCM herb-pairs and 2470 non-TCM herb-pairs, correctly classified 72.1-87.9% of TCM herb-pairs and 91.6-97.6% of the non-TCM herb-pairs. The best AI system predicted 96.3% of the 27 known non-TCM herb-pairs and 99.7% of the other 1,065,100 possible herb-pairs as non-TCM herb-pairs. Our studies suggest that TCM-HPs of known TCM herb-pairs contain features distinguishable from those of non-TCM herb-pairs consistent with their claimed synergistic or modulating combinations.

  17. Effect of Destined High-Pressure Torsion on the Structure and Mechanical Properties of Rare Earth-Based Metallic Glasses

    NASA Astrophysics Data System (ADS)

    Zhao, W.; Cheng, H.; Jiang, X.; Wu, M. L.; Li, G.

    2018-03-01

    Changes in the atomic structure and mechanical properties of rare earth-based metallic glasses caused by destined high-pressure torsion (HPT) were studied by X-ray diffraction synchrotron radiation and nanoindentation. Results showed that destined HPT improved nanohardness and wear resistance, which indicated the significant contributions of this technique. The diffraction patterns showed that the contents of pairs between solvent and solute atoms with a large negative mixing enthalpy increased, whereas those of pairs between solvent atoms and between solute atoms decreased after destined HPT. Thus, the process was improved by increasing the proportion of high-intensity pairs between solvent and solute atoms.

  18. [Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

    PubMed

    Brovarets', O O

    2013-01-01

    At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

  19. Molecular recognition of DNA base pairs by the formamido/pyrrole and formamido/imidazole pairings in stacked polyamides.

    PubMed

    Buchmueller, Karen L; Staples, Andrew M; Uthe, Peter B; Howard, Cameron M; Pacheco, Kimberly A O; Cox, Kari K; Henry, James A; Bailey, Suzanna L; Horick, Sarah M; Nguyen, Binh; Wilson, W David; Lee, Moses

    2005-01-01

    Polyamides containing an N-terminal formamido (f) group bind to the minor groove of DNA as staggered, antiparallel dimers in a sequence-specific manner. The formamido group increases the affinity and binding site size, and it promotes the molecules to stack in a staggered fashion thereby pairing itself with either a pyrrole (Py) or an imidazole (Im). There has not been a systematic study on the DNA recognition properties of the f/Py and f/Im terminal pairings. These pairings were analyzed here in the context of f-ImPyPy, f-ImPyIm, f-PyPyPy and f-PyPyIm, which contain the central pairing modes, -ImPy- and -PyPy-. The specificity of these triamides towards symmetrical recognition sites allowed for the f/Py and f/Im terminal pairings to be directly compared by SPR, CD and DeltaT (M) experiments. The f/Py pairing, when placed next to the -ImPy- or -PyPy- central pairings, prefers A/T and T/A base pairs to G/C base pairs, suggesting that f/Py has similar DNA recognition specificity to Py/Py. With -ImPy- central pairings, f/Im prefers C/G base pairs (>10 times) to the other Watson-Crick base pairs; therefore, f/Im behaves like the Py/Im pair. However, the f/Im pairing is not selective for the C/G base pair when placed next to the -PyPy- central pairings.

  20. Growth properties associated with A-U replacement of specific G-C base pairs in 16S rRNA from Escherichia coli.

    PubMed Central

    Triman, K L

    1995-01-01

    Mutations that disrupt each of seven specific G-C base pairs in 16S rRNA from Escherichia coli confer loss of expression of a plasmid-encoded 16S rRNA selectable marker (spectinomycin resistance). However, A-U replacement of G-C base pairs at nucleotides 359/52 or 1292/1245 in 16S rRNA permits normal expression of the marker. By contrast, A-U replacements at 146/176, 153/168, 350/339, or 1293/1244 are associated with loss of expression of the marker. These genetic studies are designed to determine the importance of specific base pairs by assessment of the structural and functional impairments of 16S rRNA molecules resulting from expression of base pair substitutions at these positions. PMID:7543481

  1. Thermal transport in topological-insulator-based superconducting hybrid structures with mixed singlet and triplet pairing states.

    PubMed

    Li, Hai; Zhao, Yuan Yuan

    2017-11-22

    In the framework of the Bogoliubov-de Gennes equation, we investigate the thermal transport properties in topological-insulator-based superconducting hybrid structures with mixed spin-singlet and spin-triplet pairing states, and emphasize the different manifestations of the spin-singlet and spin-triplet pairing states in the thermal transport signatures. It is revealed that the temperature-dependent differential thermal conductance strongly depends on the components of the pairing state, and the negative differential thermal conductance only occurs in the spin-singlet pairing state dominated regime. It is also found that the thermal conductance is profoundly sensitive to the components of the pairing state. In the spin-singlet pairing state controlled regime, the thermal conductance obviously oscillates with the phase difference and junction length. With increasing the proportion of the spin-triplet pairing state, the oscillating characteristic of the thermal conductance fades out distinctly. These results suggest an alternative route for distinguishing the components of pairing states in topological-insulator-based superconducting hybrid structures.

  2. Molecular recognition of DNA base pairs by the formamido/pyrrole and formamido/imidazole pairings in stacked polyamides

    PubMed Central

    Buchmueller, Karen L.; Staples, Andrew M.; Uthe, Peter B.; Howard, Cameron M.; Pacheco, Kimberly A. O.; Cox, Kari K.; Henry, James A.; Bailey, Suzanna L.; Horick, Sarah M.; Nguyen, Binh; Wilson, W. David; Lee, Moses

    2005-01-01

    Polyamides containing an N-terminal formamido (f) group bind to the minor groove of DNA as staggered, antiparallel dimers in a sequence-specific manner. The formamido group increases the affinity and binding site size, and it promotes the molecules to stack in a staggered fashion thereby pairing itself with either a pyrrole (Py) or an imidazole (Im). There has not been a systematic study on the DNA recognition properties of the f/Py and f/Im terminal pairings. These pairings were analyzed here in the context of f-ImPyPy, f-ImPyIm, f-PyPyPy and f-PyPyIm, which contain the central pairing modes, –ImPy– and –PyPy–. The specificity of these triamides towards symmetrical recognition sites allowed for the f/Py and f/Im terminal pairings to be directly compared by SPR, CD and ΔTM experiments. The f/Py pairing, when placed next to the –ImPy– or –PyPy– central pairings, prefers A/T and T/A base pairs to G/C base pairs, suggesting that f/Py has similar DNA recognition specificity to Py/Py. With –ImPy– central pairings, f/Im prefers C/G base pairs (>10 times) to the other Watson–Crick base pairs; therefore, f/Im behaves like the Py/Im pair. However, the f/Im pairing is not selective for the C/G base pair when placed next to the –PyPy– central pairings. PMID:15703305

  3. Unique Thermal Stability of Unnatural Hydrophobic Ds Bases in Double-Stranded DNAs.

    PubMed

    Kimoto, Michiko; Hirao, Ichiro

    2017-10-20

    Genetic alphabet expansion technology, the introduction of unnatural bases or base pairs into replicable DNA, has rapidly advanced as a new synthetic biology area. A hydrophobic unnatural base pair between 7-(2-thienyl)imidazo[4,5-b]pyridine (Ds) and 2-nitro-4-propynylpyrrole (Px) exhibited high fidelity as a third base pair in PCR. SELEX methods using the Ds-Px pair enabled high-affinity DNA aptamer generation, and introducing a few Ds bases into DNA aptamers extremely augmented their affinities and selectivities to target proteins. Here, to further scrutinize the functions of this highly hydrophobic Ds base, the thermal stabilities of double-stranded DNAs (dsDNA) containing a noncognate Ds-Ds or G-Ds pair were examined. The thermal stability of the Ds-Ds self-pair was as high as that of the natural G-C pair, and apart from the generally higher stability of the G-C pair than that of the A-T pair, most of the 5'-pyrimidine-Ds-purine-3' sequences, such as CDsA and TDsA, exhibited higher stability than the 5'-purine-Ds-pyrimidine-3' sequences, such as GDsC and ADsC, in dsDNAs. This trait enabled the GC-content-independent control of the thermal stability of the designed dsDNA fragments. The melting temperatures of dsDNA fragments containing the Ds-Ds pair can be predicted from the nearest-neighbor parameters including the Ds base. In addition, the noncognate G-Ds pair can efficiently distinguish its neighboring cognate natural base pairs from noncognate pairs. We demonstrated that real-time PCR using primers containing Ds accurately detected a single-nucleotide mismatch in target DNAs. These unique properties of the Ds base that affect the stabilities of the neighboring base pairs could impart new functions to DNA molecules and technologies.

  4. Coherence properties of spontaneous parametric down-conversion pumped by a multi-mode cw diode laser.

    PubMed

    Kwon, Osung; Ra, Young-Sik; Kim, Yoon-Ho

    2009-07-20

    Coherence properties of the photon pair generated via spontaneous parametric down-conversion pumped by a multi-mode cw diode laser are studied with a Mach-Zehnder interferometer. Each photon of the pair enters a different input port of the interferometer and the biphoton coherence properties are studied with a two-photon detector placed at one output port. When the photon pair simultaneously enters the interferometer, periodic recurrence of the biphoton de Broglie wave packet is observed, closely resembling the coherence properties of the pump diode laser. With non-zero delays between the photons at the input ports, biphoton interference exhibits the same periodic recurrence but the wave packet shapes are shown to be dependent on both the input delay as well as the interferometer delay. These properties could be useful for building engineered entangled photon sources based on diode laser-pumped spontaneous parametric down-conversion.

  5. Localization and anharmonicity of the vibrational modes for GC Watson-Crick and Hoogsteen base pairs.

    PubMed

    Bende, Attila; Bogdan, Diana; Muntean, Cristina M; Morari, Cristian

    2011-12-01

    We present an ab initio study of the vibrational properties of cytosine and guanine in the Watson-Crick and Hoogsteen base pair configurations. The results are obtained by using two different implementations of the DFT method. We assign the vibrational frequencies to cytosine or to guanine using the vibrational density of states. Next, we investigate the importance of anharmonic corrections for the vibrational modes. In particular, the unusual anharmonic effect of the H(+) vibration in the case of the Hoogsteen base pair configuration is discussed.

  6. Acuity of a Cryptochrome and Vision-Based Magnetoreception System in Birds

    PubMed Central

    Solov'yov, Ilia A.; Mouritsen, Henrik; Schulten, Klaus

    2010-01-01

    Abstract The magnetic compass of birds is embedded in the visual system and it has been hypothesized that the primary sensory mechanism is based on a radical pair reaction. Previous models of magnetoreception have assumed that the radical pair-forming molecules are rigidly fixed in space, and this assumption has been a major objection to the suggested hypothesis. In this article, we investigate theoretically how much disorder is permitted for the radical pair-forming, protein-based magnetic compass in the eye to remain functional. Our study shows that only one rotational degree of freedom of the radical pair-forming protein needs to be partially constrained, while the other two rotational degrees of freedom do not impact the magnetoreceptive properties of the protein. The result implies that any membrane-associated protein is sufficiently restricted in its motion to function as a radical pair-based magnetoreceptor. We relate our theoretical findings to the cryptochromes, currently considered the likeliest candidate to furnish radical pair-based magnetoreception. PMID:20655831

  7. Conformation of viroids.

    PubMed Central

    Henco, K; Riesner, D; Sanger, H L

    1977-01-01

    Viroids are uncoated infectious RNA molecules (MW 107 000-127 000) known as pathogens of certain higher plants. Thermodynamic and kinetic studies were carried out on highly purified viroid preparations by applying UV-absorption melting analysis and temperature jump methods. The thermal denaturation of viroids is characterized by high thermal stability, high cooperativity and a high degree of base pairing. Two relaxation processes could be resolved; a process in the sec range could be evaluated as an independent all-or-none-transition with the following properties: reaction enthalpy= 550 kcal/mol, activation enthalpy of the dissociation = 470 kcal/mol; G : C content = 72 %. These data indicate the existence of an uninterrupted double helix of 52 base pairs. A process in the msec range involves 15 - 25 base pairs which are most probably distributed over several short double helical stretches. A tentative model for the secondary structure of viroids isproposed and the possible functional implications of their physicochemical properties are discussed. PMID:866174

  8. Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

    PubMed Central

    Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

    2003-01-01

    Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

  9. Long-term leisure time physical activity and properties of bone: a twin study.

    PubMed

    Ma, Hongqiang; Leskinen, Tuija; Alen, Markku; Cheng, Sulin; Sipilä, Sarianna; Heinonen, Ari; Kaprio, Jaakko; Suominen, Harri; Kujala, Urho M

    2009-08-01

    Effects of physical activity on bone properties, when controlled for genetic effects, are not fully understood. We aimed to study the association between long-term leisure time physical activity (LTPA) and bone properties using twin pairs known to be discordant for leisure time physical activity for at least 30 yr. Volumetric BMD and geometric properties were measured at the tibia shaft and distal end using pQCT in 16 middle-aged (50-74 yr) same-sex twin pairs (seven monozygotic [MZ] and nine dizygotic [DZ] pairs) selected from a population-based cohort. Paired differences between active and inactive co-twins were studied. Active members of MZ twin pairs had larger cortical bone cross-sectional area (intrapair difference: 8%, p = 0.006), thicker cortex (12%, p = 0.003), and greater moment of inertia (I(max), 20%, p = 0.024) at the tibia shaft than their inactive co-twins. At the distal tibia, trabecular BMD (12%, p = 0.050) and compressive strength index (18%, p = 0.038) were also higher in physically active MZ pair members than their inactive co-twins. The trends were similar, but less consistently so, in DZ pairs as in MZ pairs. Our genetically controlled study design shows that LTPA during adulthood strengthens bones in a site-specific manner, that is, the long bone shaft has a thicker cortex, and thus higher bending strength, whereas the distal bone has higher trabecular density and compressive strength. These results suggest that LTPA has a potential causal role in decreasing the long-term risk of osteoporosis and thus preventing osteoporotic fractures.

  10. Automated property optimization via ab initio O(N) elongation method: Application to (hyper-)polarizability in DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Orimoto, Yuuichi, E-mail: orimoto.yuuichi.888@m.kyushu-u.ac.jp; Aoki, Yuriko; Japan Science and Technology Agency, CREST, 4-1-8 Hon-chou, Kawaguchi, Saitama 332-0012

    An automated property optimization method was developed based on the ab initio O(N) elongation (ELG) method and applied to the optimization of nonlinear optical (NLO) properties in DNA as a first test. The ELG method mimics a polymerization reaction on a computer, and the reaction terminal of a starting cluster is attacked by monomers sequentially to elongate the electronic structure of the system by solving in each step a limited space including the terminal (localized molecular orbitals at the terminal) and monomer. The ELG-finite field (ELG-FF) method for calculating (hyper-)polarizabilities was used as the engine program of the optimization method,more » and it was found to show linear scaling efficiency while maintaining high computational accuracy for a random sequenced DNA model. Furthermore, the self-consistent field convergence was significantly improved by using the ELG-FF method compared with a conventional method, and it can lead to more feasible NLO property values in the FF treatment. The automated optimization method successfully chose an appropriate base pair from four base pairs (A, T, G, and C) for each elongation step according to an evaluation function. From test optimizations for the first order hyper-polarizability (β) in DNA, a substantial difference was observed depending on optimization conditions between “choose-maximum” (choose a base pair giving the maximum β for each step) and “choose-minimum” (choose a base pair giving the minimum β). In contrast, there was an ambiguous difference between these conditions for optimizing the second order hyper-polarizability (γ) because of the small absolute value of γ and the limitation of numerical differential calculations in the FF method. It can be concluded that the ab initio level property optimization method introduced here can be an effective step towards an advanced computer aided material design method as long as the numerical limitation of the FF method is taken into account.« less

  11. Automated property optimization via ab initio O(N) elongation method: Application to (hyper-)polarizability in DNA.

    PubMed

    Orimoto, Yuuichi; Aoki, Yuriko

    2016-07-14

    An automated property optimization method was developed based on the ab initio O(N) elongation (ELG) method and applied to the optimization of nonlinear optical (NLO) properties in DNA as a first test. The ELG method mimics a polymerization reaction on a computer, and the reaction terminal of a starting cluster is attacked by monomers sequentially to elongate the electronic structure of the system by solving in each step a limited space including the terminal (localized molecular orbitals at the terminal) and monomer. The ELG-finite field (ELG-FF) method for calculating (hyper-)polarizabilities was used as the engine program of the optimization method, and it was found to show linear scaling efficiency while maintaining high computational accuracy for a random sequenced DNA model. Furthermore, the self-consistent field convergence was significantly improved by using the ELG-FF method compared with a conventional method, and it can lead to more feasible NLO property values in the FF treatment. The automated optimization method successfully chose an appropriate base pair from four base pairs (A, T, G, and C) for each elongation step according to an evaluation function. From test optimizations for the first order hyper-polarizability (β) in DNA, a substantial difference was observed depending on optimization conditions between "choose-maximum" (choose a base pair giving the maximum β for each step) and "choose-minimum" (choose a base pair giving the minimum β). In contrast, there was an ambiguous difference between these conditions for optimizing the second order hyper-polarizability (γ) because of the small absolute value of γ and the limitation of numerical differential calculations in the FF method. It can be concluded that the ab initio level property optimization method introduced here can be an effective step towards an advanced computer aided material design method as long as the numerical limitation of the FF method is taken into account.

  12. Utilizing Molecular Dynamics ' Multipotent Methodologies to Measure Microscopic Motions of DNA Molecules: A Magniloquent Manuscript On DNA's Means and Mannerisms

    NASA Astrophysics Data System (ADS)

    Kingsland, Addie

    DNA is an amazing molecule which is the basic template for all genetics. It is the primary molecule for storing biological information, and has many applications in nanotechnology. Double-stranded DNA may contain mismatched base pairs beyond the Watson-Crick pairs guanine-cytosine and adenine-thymine. To date, no one has found a physical property of base pair mismatches which describes the behavior of naturally occurring mismatch repair enzymes. Many materials properties of DNA are also unknown, for instance, when pulling DNA in different configurations, different energy differences are observed with no obvious reason why. DNA mismatches also affect their local environment, for instance changing the quantum yield of nearby azobenzene moieties. We utilize molecular dynamics computer simulations to study the structure and dynamics for both matched and mismatched base pairs, within both biological and materials contexts, and in both equilibrium and biased dynamics. We show that mismatched pairs shift further in the plane normal to the DNA strand and are more likely to exhibit non-canonical structures, including the e-motif. Base pair mismatches alter their local environment, affecting the trans- to cis- photoisomerization quantum yield of azobenzene, as well as increasing the likelihood of observing the e-motif. We also show that by using simulated data, we can give new insights on theoretical models to calculate the energetics of pulling DNA strands apart. These results, all relatively inexpensive on modern computer hardware, can help guide the design of DNA-based nanotechnologies, as well as give new insights into the functioning of mismatch repair systems in cancer prevention.

  13. Accurate quantification of magnetic particle properties by intra-pair magnetophoresis for nanobiotechnology

    NASA Astrophysics Data System (ADS)

    van Reenen, Alexander; Gao, Yang; Bos, Arjen H.; de Jong, Arthur M.; Hulsen, Martien A.; den Toonder, Jaap M. J.; Prins, Menno W. J.

    2013-07-01

    The application of magnetic particles in biomedical research and in-vitro diagnostics requires accurate characterization of their magnetic properties, with single-particle resolution and good statistics. Here, we report intra-pair magnetophoresis as a method to accurately quantify the field-dependent magnetic moments of magnetic particles and to rapidly generate histograms of the magnetic moments with good statistics. We demonstrate our method with particles of different sizes and from different sources, with a measurement precision of a few percent. We expect that intra-pair magnetophoresis will be a powerful tool for the characterization and improvement of particles for the upcoming field of particle-based nanobiotechnology.

  14. An improved CCA-secure conditional proxy re-encryption without pairings

    NASA Astrophysics Data System (ADS)

    Chang, Yanni; He, Mingxing; Li, Xiao; Xing, Pengfei

    2014-10-01

    In order to solve fine-grained delegation, the definition of conditional proxy re-encryption was proposed and soon draws a lot of attention in recent years. All of the existing schemes except one are based on bilinear pairings, which computation is costly. We point out that the only one existing conditional proxy re-encryption scheme without pairings can not solve fine-grained delegation essentially. Then we propose a new property of conditional proxy re-encryption scheme, that is non-diffusibility, that means if the proxy with a re-encryption key under one condition conclude with delegatee, they can obtain the re-encryption keys under any other conditions. We also propose a concrete CCA-secure conditional proxy re-encryption scheme without pairings. To the best of our knowledge, this is the first CCA-secure conditional proxy re-encryption scheme without pairings, which satisfies the non-diffusibility property.

  15. Optical properties and electronic transitions of DNA oligonucleotides as a function of composition and stacking sequence.

    PubMed

    Schimelman, Jacob B; Dryden, Daniel M; Poudel, Lokendra; Krawiec, Katherine E; Ma, Yingfang; Podgornik, Rudolf; Parsegian, V Adrian; Denoyer, Linda K; Ching, Wai-Yim; Steinmetz, Nicole F; French, Roger H

    2015-02-14

    The role of base pair composition and stacking sequence in the optical properties and electronic transitions of DNA is of fundamental interest. We present and compare the optical properties of DNA oligonucleotides (AT)10, (AT)5(GC)5, and (AT-GC)5 using both ab initio methods and UV-vis molar absorbance measurements. Our data indicate a strong dependence of both the position and intensity of UV absorbance features on oligonucleotide composition and stacking sequence. The partial densities of states for each oligonucleotide indicate that the valence band edge arises from a feature associated with the PO4(3-) complex anion, and the conduction band edge arises from anti-bonding states in DNA base pairs. The results show a strong correspondence between the ab initio and experimentally determined optical properties. These results highlight the benefit of full spectral analysis of DNA, as opposed to reductive methods that consider only the 260 nm absorbance (A260) or simple purity ratios, such as A260/A230 or A260/A280, and suggest that the slope of the absorption edge onset may provide a useful metric for the degree of base pair stacking in DNA. These insights may prove useful for applications in biology, bioelectronics, and mesoscale self-assembly.

  16. An interatomic pair potential for cadmium selenide

    NASA Astrophysics Data System (ADS)

    Rabani, Eran

    2002-01-01

    We have developed a set of interatomic pair potentials for cadmium selenide based on a form similar to the Born-Mayer model. We show that this simple form of the pair potential, which has been used to describe the properties of alkali halides in the sixfold-coordinate structure, provides a realistic description of the properties of cadmium selenide in all three crystal structures: wurtzite, zinc blende, and rocksalt. Using the new pair potential we have studied the pressure-induced phase transition from the fourfold-coordinate wurtzite structure to the sixfold-coordinate rocksalt structure. The pressure transformation and the equation of state are in good agreement with experimental observations. Using the dispersion term in our pair potential we have also calculated the Hamaker constant for cadmium selenide within the framework of the original microscopic approach due to Hamaker. The results indicate that for ionic materials many-body terms that are included in the Lifshitz theory are well captured by the simple pair potential.

  17. Theoretical study on the binding mechanism between N6-methyladenine and natural DNA bases.

    PubMed

    Song, Qi-Xia; Ding, Zhen-Dong; Liu, Jian-Hua; Li, Yan; Wang, Hai-Jun

    2013-03-01

    N6-methyladenine (m(6)A) is a rare base naturally occurring in DNA. It is different from the base adenine due to its N-CH(3). Therefore, the base not only pairs with thymine, but also with other DNA bases (cytosine, adenine and guanine). In this work, Møller-Plesset second-order (MP2) method has been used to investigate the binding mechanism between m(6)A and natural DNA bases in gas phase and in aqueous solution. The results show that N-CH(3) changed the way of N6-methyladenine binding to natural DNA bases. The binding style significantly influences the stability of base pairs. The trans-m(6)A:G and trans-m(6)A:C conformers are the most stable among all the base pairs. The existence of solvent can remarkably reduce the stability of the base pairs, and the DNA bases prefer pairing with trans-m(6)A to cis-m(6)A. Besides, the properties of these hydrogen bonds have been analyzed by atom in molecules (AIM) theory, natural bond orbital (NBO) analysis and Wiberg bond indexes (WBI). In addition, pairing with m(6)A decreases the binding energies compared to the normal Watson-Crick base pairs, it may explain the instability of the N6 site methylated DNA in theory.

  18. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

    PubMed

    Takezawa, Yusuke; Shionoya, Mitsuhiko

    2012-12-18

    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional DNA molecules such as artificial DNAzymes and DNA machines. In addition, the metallo-base pairing system is a powerful tool for the construction of homogeneous and heterogeneous metal arrays, which can lead to DNA-based nanomaterials such as electronic wires and magnetic devices. Recently researchers have investigated these systems as enzyme replacements, which may offer an additional contribution to chemical biology and synthetic biology through the expansion of the genetic alphabet.

  19. Study on Incompatibility of Traditional Chinese Medicine: Evidence from Formula Network, Chemical Space, and Metabolism Room

    PubMed Central

    Zhang, Xiao-Dong; Wu, Hong-Ying; Jin, Jin; Yu, Guang-Yun; He, Xin; Wang, Hao; Shen, Xiu; Zhou, Ze-Wei; Liu, Pei-Xun; Fan, Sai-Jun

    2013-01-01

    A traditional Chinese medicine (TCM) formula network including 362 TCM formulas was built by using complex network methodologies. The properties of this network were analyzed including network diameter, average distance, clustering coefficient, and average degree. Meanwhile, we built a TCM chemical space and a TCM metabolism room under the theory of chemical space. The properties of chemical space and metabolism room were calculated and analyzed. The properties of the medicine pairs in “eighteen antagonisms and nineteen mutual inhibitors,” an ancient rule for TCM incompatibility, were studied based on the TCM formula network, chemical space, and metabolism room. The results showed that the properties of these incompatible medicine pairs are different from those of the other TCM based on the analysis of the TCM formula network, chemical space, and metabolism room. The lines of evidence derived from our work demonstrated that the ancient rule of TCM incompatibility, “eighteen antagonisms and nineteen mutual inhibitors,” is probably scientifically based. PMID:24369478

  20. A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities.

    PubMed

    Bastien, Olivier; Ortet, Philippe; Roy, Sylvaine; Maréchal, Eric

    2005-03-10

    Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons) and be the basis for a novel method of consistent and stable phylogenetic reconstruction. We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space) and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP) allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.

  1. Binding effects of Mn²⁺ and Zn²⁺ ions on the vibrational properties of guanine-cytosine base pairs in the Watson-Crick and Hoogsteen configurations.

    PubMed

    Morari, Cristian; Bogdan, Diana; Muntean, Cristina M

    2012-11-01

    The binding effects of Mn²⁺ and Zn²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. The calculations were carried out on Watson-Crick and Hoogsteen configurations of the base pairs. We have found, that in Watson-Crick configuration, the metal is coordinated to N7 atom of guanine while, in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen structures. Our results show that the vibrational amplitudes of metallic atoms are strong for wavenumbers lower than 600 cm⁻¹. Also, we predict that the distinction between Watson-Crick and Hoogsteen configurations can be seen around 85, 170 and 310 cm⁻¹.

  2. The role of the AT pairs in the acid denaturation of DNA.

    PubMed Central

    Hermann, P; Fredericq, E

    1977-01-01

    It has been determined previously that the protonation of the GC pairs induces a DNA conformation change which leads to a "metastable" structure. The role of the AT pairs, however, is no well known because the protonation does not modify their spectral properties. By means of an indirect method based on the binding of proflavine, it has been determined that the AT pairs are protonated before the acid-induced denaturation and that they seem to be unable to assume a conformation change when protonated. These results would indicate that the protonated AT pairs may be responsible for the induction of the acid denaturation and not the GC pairs as it was thought previously. PMID:20604

  3. Recent advances in 193-nm single-layer photoresists based on alternating copolymers of cycloolefins

    NASA Astrophysics Data System (ADS)

    Houlihan, Francis M.; Wallow, Thomas I.; Timko, Allen G.; Neria, E.; Hutton, Richard S.; Cirelli, Raymond A.; Nalamasu, Omkaram; Reichmanis, Elsa

    1997-07-01

    We report on our recent investigations on the formulation and processing of 193 nm single layer photoresists based on alternating copolymers of cycloolefins with maleic anhydride. Resists formulated with cycloolefin copolymers are compatible with 0.262 N tetramethylammonium developers, have excellent adhesion, sensitivity, etch resistance and thermal flow properties. The effect of polymer structure and composition, dissolution inhibitor structure and loading as well as the effect of the photoacid generator on the resist dissolution properties was investigated. Based on the results high contrast formulations were evaluated on a GCA XLS (NA equals 0.53, 4X reduction optics) deep-UV stepper to exhibit 0.27 micrometer L/S pair resolution with excellent photosensitivity. Based on the dissolution properties and a spectroscopic examination of the resist, we have designed materials that show less than 0.17 micrometer L/S pair resolution with 193 nm exposures. In this paper, the formulation methodology is detailed and the most recent results upon both with 248 and 193 nm irradiation are described.

  4. Easy design of colorimetric logic gates based on nonnatural base pairing and controlled assembly of gold nanoparticles.

    PubMed

    Zhang, Li; Wang, Zhong-Xia; Liang, Ru-Ping; Qiu, Jian-Ding

    2013-07-16

    Utilizing the principles of metal-ion-mediated base pairs (C-Ag-C and T-Hg-T), the pH-sensitive conformational transition of C-rich DNA strand, and the ligand-exchange process triggered by DL-dithiothreitol (DTT), a system of colorimetric logic gates (YES, AND, INHIBIT, and XOR) can be rationally constructed based on the aggregation of the DNA-modified Au NPs. The proposed logic operation system is simple, which consists of only T-/C-rich DNA-modified Au NPs, and it is unnecessary to exquisitely design and alter the DNA sequence for different multiple molecular logic operations. The nonnatural base pairing combined with unique optical properties of Au NPs promises great potential in multiplexed ion sensing, molecular-scale computers, and other computational logic devices.

  5. Prospective very young asteroid pairs

    NASA Astrophysics Data System (ADS)

    Galád, A.; Vokrouhlický, D.; Zizka, J.

    2014-07-01

    Several tens of asteroid pairs can be discerned from the background main-belt asteroids. The majority of them are thought to have formed within only the last few 10^6 yr. The youngest recognized pairs have formed more than ≈ 10 kyr ago. As some details of pair formation are still not understood well, the study of young pairs is of great importance. It is mainly because the conditions at the time of the pair formation could be deduced much more reliably for young pairs. For example, space weathering on the surfaces of the components, or changes in their rotational properties (in spin rates, tumbling, coordinates of rotational pole) could be negligible since the formation of young pairs. Also, possible strong perturbations by main-belt bodies on pair formation can be reliably studied only for extremely young pairs. Some pairs can quickly blend in with the background asteroids, so even the frequency of asteroid pair formation could be determined more reliably based on young pairs (though only after a statistically significant sample is at disposal). In our regular search for young pairs in the growing asteroid database, only multiopposition asteroids with very similar orbital and proper elements are investigated. Every pair component is represented by a number of clones within orbital uncertainties and drifting in semimajor axis due to the Yarkovsky effect. We found that, if the previously unrecognized pairs (87887) 2000 SS_{286} - 2002 AT_{49} and (355258) 2007 LY_{4} - 2013AF_{40} formed at the recent very close approach of their components, they could become the youngest known pairs. In both cases, the relative encounter velocities of the components were only ˜ 0.1 m s^{-1}. However, the minimum distances between some clones are too large and a few clones of the latter pair did not encounter recently (within ≈ 10 kyr). The age of some prospective young pairs cannot be determined reliably without improved orbital properties (e.g., the second component of a pair (320025) 2007 DT_{76} - 2007 DP_{16}). It is because some components suffered recently repeated close approaches to Ceres or other large main-belt perturbers. In general, the uncertainties in age estimation can be heavily reduced after the physical properties (e.g., sense of rotation, shape, size, binarity) of the pair components are determined.

  6. Superconducting properties of the s ± -wave state: Fe-based superconductors

    DOE PAGES

    Bang, Yunkyu; Stewart, G. R.

    2017-02-13

    Although the pairing mechanism of Fe-based superconductors (FeSCs) has not yet been settled with consensus with regard to the pairing symmetry and the superconducting (SC) gap function, the vast majority of experiments support the existence of spin-singlet signchanging s-wave SC gaps on multi-bands (s±-wave state). This multi-band s±-wave state is a very unique gap state per se and displays numerous unexpected novel SC properties, such as a strong reduction of the coherence peak, non-trivial impurity effects, nodal-gap-like nuclear magnetic resonance signals, various Volovik effects in the specific heat (SH) and thermal conductivity, and anomalous scaling behaviors with a SH jumpmore » and condensation energy versus Tc, etc. In particular, many of these non-trivial SC properties can easily be mistaken as evidence for a nodal-gap state such as a d-wave gap. In this review, we provide detailed explanations of the theoretical principles for the various non-trivial SC properties of the s±-wave pairing state, and then critically compare the theoretical predictions with experiments on FeSCs. This will provide a pedagogical overview of to what extent we can coherently understand the wide range of different experiments on FeSCs within the s±-wave gap model.« less

  7. Thermodynamic properties of water molecules in the presence of cosolute depend on DNA structure: a study using grid inhomogeneous solvation theory

    PubMed Central

    Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki

    2015-01-01

    In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600

  8. Anomeric 2'-Deoxycytidines and Silver Ions: Hybrid Base Pairs with Greatly Enhanced Stability and Efficient DNA Mismatch Detection with α-dC.

    PubMed

    Guo, Xiurong; Seela, Frank

    2017-09-04

    α-d-Nucleosides are rare in nature but can develop fascinating properties when incorporated into DNA. This work reports on the first silver-mediated base pair constructed from two anomeric nucleosides: α-dC and β-dC. The hybrid base pair was integrated into the DNA and DNA/RNA double helix. A 12-mer duplex with α-dC and β-dC pair exhibits a higher thermal stability (T m =43 °C) than that incorporating the β-dC-Ag + -β-dC homo pair (T m =34 °C). Furthermore, α-dC shows excellent mismatch discrimination for DNA single nucleotide polymorphism (SNP). All four SNPs were identified on the basis of large T m value differences measured in the presence of silver ions. High resolution melting was not required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Coexistence of Multiple Attractors in an Active Diode Pair Based Chua’s Circuit

    NASA Astrophysics Data System (ADS)

    Bao, Bocheng; Wu, Huagan; Xu, Li; Chen, Mo; Hu, Wen

    This paper focuses on the coexistence of multiple attractors in an active diode pair based Chua’s circuit with smooth nonlinearity. With dimensionless equations, dynamical properties, including boundness of system orbits and stability distributions of two nonzero equilibrium points, are investigated, and complex coexisting behaviors of multiple kinds of disconnected attractors of stable point attractors, limit cycles and chaotic attractors are numerically revealed. The results show that unlike the classical Chua’s circuit, the proposed circuit has two stable nonzero node-foci for the specified circuit parameters, thereby resulting in the emergence of multistability phenomenon. Based on two general impedance converters, the active diode pair based Chua’s circuit with an adjustable inductor and an adjustable capacitor is made in hardware, from which coexisting multiple attractors are conveniently captured.

  10. Light-emitting self-assembled peptide nucleic acids exhibit both stacking interactions and Watson-Crick base pairing.

    PubMed

    Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud

    2015-04-01

    The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.

  11. Complexes of oligo(poly)nucleotides with structural anomalies

    NASA Astrophysics Data System (ADS)

    Dolinnaya, N. G.; Gryaznova, O. I.

    1989-08-01

    The results of studies on the structure and properties of DNA-RNA hybrids and complexes of oligo(poly)nucleotides containing non-canonical base pairs or unpaired bases both within and at the ends of the double helix are surveyed. The methods used in the study of such systems are briefly characterised: X-ray diffraction analysis, NMR and UV spectroscopy, circular dichroism, scanning microcalorimetry, etc. A comparative analysis of the influence of the non-canonical pairs on the structure and the energetic and kinetic parameters of the formation and dissociation of the oligonucleotide complexes has been carried out. The question of the stability of the non-canonical pairs as a function of their nature and position in the double helix is considered. The mechanisms of the formation of the hydrogen bonds between the bases of non-complementary pairs are discussed. The bibliography includes 171 references.

  12. Transport properties of dilute α -Fe (X ) solid solutions (X = C, N, O)

    NASA Astrophysics Data System (ADS)

    Schuler, Thomas; Nastar, Maylise

    2016-06-01

    We extend the self-consistent mean field (SCMF) method to the calculation of the Onsager matrix of Fe-based interstitial solid solutions. Both interstitial jumps and substitutional atom-vacancy exchanges are accounted for. A general procedure is introduced to split the Onsager matrix of a dilute solid solution into intrinsic cluster Onsager matrices, and extract from them flux-coupling ratios, mobilities, and association-dissociation rates for each cluster. The formalism is applied to vacancy-interstitial solute pairs in α -Fe (V X pairs, X = C, N, O), with ab initio based thermodynamic and kinetic parameters. Convergence of the cluster mobility contribution gives a controlled estimation of the cluster definition distance, taking into account both its thermodynamic and kinetic properties. Then, the flux-coupling behavior of each V X pair is discussed, and qualitative understanding is achieved from the comparison between various contributions to the Onsager matrix. Also, the effect of low-activation energy second-nearest-neighbor interstitial solute jumps around a vacancy on these results is addressed.

  13. A systematic molecular dynamics study of nearest-neighbor effects on base pair and base pair step conformations and fluctuations in B-DNA

    PubMed Central

    Lavery, Richard; Zakrzewska, Krystyna; Beveridge, David; Bishop, Thomas C.; Case, David A.; Cheatham, Thomas; Dixit, Surjit; Jayaram, B.; Lankas, Filip; Laughton, Charles; Maddocks, John H.; Michon, Alexis; Osman, Roman; Orozco, Modesto; Perez, Alberto; Singh, Tanya; Spackova, Nada; Sponer, Jiri

    2010-01-01

    It is well recognized that base sequence exerts a significant influence on the properties of DNA and plays a significant role in protein–DNA interactions vital for cellular processes. Understanding and predicting base sequence effects requires an extensive structural and dynamic dataset which is currently unavailable from experiment. A consortium of laboratories was consequently formed to obtain this information using molecular simulations. This article describes results providing information not only on all 10 unique base pair steps, but also on all possible nearest-neighbor effects on these steps. These results are derived from simulations of 50–100 ns on 39 different DNA oligomers in explicit solvent and using a physiological salt concentration. We demonstrate that the simulations are converged in terms of helical and backbone parameters. The results show that nearest-neighbor effects on base pair steps are very significant, implying that dinucleotide models are insufficient for predicting sequence-dependent behavior. Flanking base sequences can notably lead to base pair step parameters in dynamic equilibrium between two conformational sub-states. Although this study only provides limited data on next-nearest-neighbor effects, we suggest that such effects should be analyzed before attempting to predict the sequence-dependent behavior of DNA. PMID:19850719

  14. A fully synthetic human Fab antibody library based on fixed VH/VL framework pairings with favorable biophysical properties

    PubMed Central

    Tiller, Thomas; Schuster, Ingrid; Deppe, Dorothée; Siegers, Katja; Strohner, Ralf; Herrmann, Tanja; Berenguer, Marion; Poujol, Dominique; Stehle, Jennifer; Stark, Yvonne; Heßling, Martin; Daubert, Daniela; Felderer, Karin; Kaden, Stefan; Kölln, Johanna; Enzelberger, Markus; Urlinger, Stefanie

    2013-01-01

    This report describes the design, generation and testing of Ylanthia, a fully synthetic human Fab antibody library with 1.3E+11 clones. Ylanthia comprises 36 fixed immunoglobulin (Ig) variable heavy (VH)/variable light (VL) chain pairs, which cover a broad range of canonical complementarity-determining region (CDR) structures. The variable Ig heavy and Ig light (VH/VL) chain pairs were selected for biophysical characteristics favorable to manufacturing and development. The selection process included multiple parameters, e.g., assessment of protein expression yield, thermal stability and aggregation propensity in fragment antigen binding (Fab) and IgG1 formats, and relative Fab display rate on phage. The framework regions are fixed and the diversified CDRs were designed based on a systematic analysis of a large set of rearranged human antibody sequences. Care was taken to minimize the occurrence of potential posttranslational modification sites within the CDRs. Phage selection was performed against various antigens and unique antibodies with excellent biophysical properties were isolated. Our results confirm that quality can be built into an antibody library by prudent selection of unmodified, fully human VH/VL pairs as scaffolds. PMID:23571156

  15. Thin-Film Coated Plastic Wrap for Food Packaging

    PubMed Central

    Wu, Hsin-Yu; Liu, Ting-Xuan; Hsu, Chia-Hsun; Cho, Yun-Shao; Xu, Zhi-Jia; Liao, Shu-Chuan; Zeng, Bo-Han; Jiang, Yeu-Long; Lien, Shui-Yang

    2017-01-01

    In this study, the antimicrobial property and food package capability of polymethylpentene (PMP) substrate with silicon oxdie (SiOx) and organic silicon (SiCxHy) stacked layers deposited by an inductively coupled plasma chemical vapor deposition system were investigated. The experimental results show that the stacked pair number of SiOx/SiCxHy on PMP is limited to three pairs, beyond which the films will crack and cause package failure. The three-pair SiOx/SiCxHy on PMP shows a low water vapor transmission rate of 0.57 g/m2/day and a high water contact angle of 102°. Three-pair thin-film coated PMP demonstrates no microbe adhesion and exhibits antibacterial properties within 24 h. Food shelf life testing performed at 28 °C and 80% humidity reports that the three-pair thin-film coated PMP can enhance the food shelf-life to 120 h. The results indicate that the silicon-based thin film may be a promising material for antibacterial food packaging applications to extend the shelf-life of food products. PMID:28773178

  16. Galaxy pairs in the SDSS - XIII. The connection between enhanced star formation and molecular gas properties in galaxy mergers

    NASA Astrophysics Data System (ADS)

    Violino, Giulio; Ellison, Sara L.; Sargent, Mark; Coppin, Kristen E. K.; Scudder, Jillian M.; Mendel, Trevor J.; Saintonge, Amelie

    2018-05-01

    We investigate the connection between star formation and molecular gas properties in galaxy mergers at low redshift (z ≤ 0.06). The study we present is based on IRAM 30-m CO(1-0) observations of 11 galaxies with a close companion selected from the Sloan Digital Sky Survey (SDSS). The pairs have mass ratios ≤4, projected separations rp ≤ 30 kpc and velocity separations ΔV ≤ 300 km s-1, and have been selected to exhibit enhanced specific star formation rates (sSFRs). We calculate molecular gas (H2) masses, assigning to each galaxy a physically motivated conversion factor αCO, and we derive molecular gas fractions and depletion times. We compare these quantities with those of isolated galaxies from the extended CO Legacy Data base for the GALEX Arecibo SDSS Survey sample (xCOLDGASS; Saintonge et al.) with gas quantities computed in an identical way. Ours is the first study which directly compares the gas properties of galaxy pairs and those of a control sample of normal galaxies with rigorous control procedures and for which SFR and H2 masses have been estimated using the same method. We find that the galaxy pairs have shorter depletion times and an average molecular gas fraction enhancement of 0.4 dex compared to the mass matched control sample drawn from xCOLDGASS. However, the gas masses (and fractions) in galaxy pairs and their depletion times are consistent with those of non-mergers whose SFRs are similarly elevated. We conclude that both external interactions and internal processes may lead to molecular gas enhancement and decreased depletion times.

  17. Alignment of RNA molecules: Binding energy and statistical properties of random sequences

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Valba, O. V., E-mail: valbaolga@gmail.com; Nechaev, S. K., E-mail: sergei.nechaev@gmail.com; Tamm, M. V., E-mail: thumm.m@gmail.com

    2012-02-15

    A new statistical approach to the problem of pairwise alignment of RNA sequences is proposed. The problem is analyzed for a pair of interacting polymers forming an RNA-like hierarchical cloverleaf structures. An alignment is characterized by the numbers of matches, mismatches, and gaps. A weight function is assigned to each alignment; this function is interpreted as a free energy taking into account both direct monomer-monomer interactions and a combinatorial contribution due to formation of various cloverleaf secondary structures. The binding free energy is determined for a pair of RNA molecules. Statistical properties are discussed, including fluctuations of the binding energymore » between a pair of RNA molecules and loop length distribution in a complex. Based on an analysis of the free energy per nucleotide pair complexes of random RNAs as a function of the number of nucleotide types c, a hypothesis is put forward about the exclusivity of the alphabet c = 4 used by nature.« less

  18. Pearson's chi-square test and rank correlation inferences for clustered data.

    PubMed

    Shih, Joanna H; Fay, Michael P

    2017-09-01

    Pearson's chi-square test has been widely used in testing for association between two categorical responses. Spearman rank correlation and Kendall's tau are often used for measuring and testing association between two continuous or ordered categorical responses. However, the established statistical properties of these tests are only valid when each pair of responses are independent, where each sampling unit has only one pair of responses. When each sampling unit consists of a cluster of paired responses, the assumption of independent pairs is violated. In this article, we apply the within-cluster resampling technique to U-statistics to form new tests and rank-based correlation estimators for possibly tied clustered data. We develop large sample properties of the new proposed tests and estimators and evaluate their performance by simulations. The proposed methods are applied to a data set collected from a PET/CT imaging study for illustration. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.

  19. Thermodynamic properties of water molecules in the presence of cosolute depend on DNA structure: a study using grid inhomogeneous solvation theory.

    PubMed

    Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-Ichi; Sugimoto, Naoki

    2015-12-02

    In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water-water interactions, (ii) ethylene glycol more effectively disrupted water-water interactions around Watson-Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson-Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. mmpdb: An Open-Source Matched Molecular Pair Platform for Large Multiproperty Data Sets.

    PubMed

    Dalke, Andrew; Hert, Jérôme; Kramer, Christian

    2018-05-29

    Matched molecular pair analysis (MMPA) enables the automated and systematic compilation of medicinal chemistry rules from compound/property data sets. Here we present mmpdb, an open-source matched molecular pair (MMP) platform to create, compile, store, retrieve, and use MMP rules. mmpdb is suitable for the large data sets typically found in pharmaceutical and agrochemical companies and provides new algorithms for fragment canonicalization and stereochemistry handling. The platform is written in Python and based on the RDKit toolkit. It is freely available from https://github.com/rdkit/mmpdb .

  1. Contact ion pair formation between hard acids and soft bases in aqueous solutions observed with 2DIR spectroscopy.

    PubMed

    Sun, Zheng; Zhang, Wenkai; Ji, Minbiao; Hartsock, Robert; Gaffney, Kelly J

    2013-12-12

    The interaction of charged species in aqueous solution has important implications for chemical, biological, and environmental processes. We have used 2DIR spectroscopy to study the equilibrium dynamics of thiocyanate chemical exchange between free ion (NCS(-)) and contact ion pair configurations (MNCS(+)), where M(2+) = Mg(2+) or Ca(2+). Detailed studies of the influence of anion concentration and anion speciation show that the chemical exchange observed with the 2DIR measurements results from NCS(-) exchanging with other anion species in the first solvation shell surrounding Mg(2+) or Ca(2+). The presence of chemical exchange in the 2DIR spectra provides an indirect, but robust, determinant of contact ion pair formation. We observe preferential contact ion pair formation between soft Lewis base anions and hard Lewis acid cations. This observation cannot be easily reconciled with Pearson's acid-base concept or Collins' Law of Matching Water Affinities. The anions that form contact ion pairs also correspond to the ions with an affinity for water and protein surfaces, so similar physical and chemical properties may control these distinct phenomena.

  2. Imino proton exchange and base-pair kinetics in the AMP-RNA aptamer complex.

    PubMed

    Nonin, S; Jiang, F; Patel, D J

    1997-05-02

    We report on the dynamics of base-pair opening in the ATP-binding asymmetric internal loop and flanking base-pairs of the AMP-RNA aptamer complex by monitoring the exchange characteristics of the extremely well resolved imino protons in the NMR spectrum of the complex. The kinetics of imino proton exchange as a function of basic pH or added ammonia catalyst are used to measure the apparent base-pair dissociation constants and lifetimes of Watson-Crick and mismatched base-pairs, as well as the solvent accessibility of the unpaired imino protons in the complex. The exchange characteristics of the imino protons identify the existence of four additional hydrogen bonds stabilizing the conformation of the asymmetric ATP-binding internal loop that were not detected by NOEs and coupling constants alone, but are readily accommodated in the previously reported solution structure of the AMP-RNA aptamer complex published from our laboratory. The hydrogen exchange kinetics of the non-Watson-Crick pairs in the asymmetric internal loop of the AMP-RNA aptamer complex have been characterized and yield apparent dissociation constants (alphaKd) that range from 10(-2) to 10(-7). Surprisingly, three of these alphaKd values are amongst the lowest measured for all base-pairs in the AMP-RNA aptamer complex. Comparative studies of hydrogen exchange of the imino protons in the free RNA aptamer and the AMP-RNA aptamer complex establish that complexation stabilizes not only the bases within the ATP-binding asymmetric internal loop, but also the flanking stem base-pairs (two pairs on either side) of the binding site. We also outline some preliminary results related to the exchange properties of a sugar 2'-hydroxyl proton of a guanosine residue involved in a novel hydrogen bond that has been shown to contribute to the immobilization of the bound AMP by the RNA aptamer, and whose resonance is narrow and downfield shifted in the spectrum.

  3. Effect of proton transfer on the electronic coupling in DNA

    NASA Astrophysics Data System (ADS)

    Rak, Janusz; Makowska, Joanna; Voityuk, Alexander A.

    2006-06-01

    The effects of single and double proton transfer within Watson-Crick base pairs on donor-acceptor electronic couplings, Vda, in DNA are studied on the bases of quantum chemical calculations. Four dimers [AT,AT], [GC,GC], [GC,AT] and [GC,TA)] are considered. Three techniques - the generalized Mulliken-Hush scheme, the fragment charge method and the diabatic states method - are employed to estimate Vda for hole transfer between base pairs. We show that both single- and double proton transfer (PT) reactions may substantially affect the electronic coupling in DNA. The electronic coupling in [AT,AT] is predicted to be most sensitive to PT. Single PT within the first base pair in the dimer leads to increase in the hole transfer efficiency by a factor of 4, while proton transfer within the second pair should substantially, by 2.7 times, decrease the rate of charge transfer. Thus, directional asymmetry of the PT effects on the electronic coupling is predicted. The changes in the Vda matrix elements correlate with the topological properties of orbitals of donor and acceptor and can be qualitatively rationalized in terms of resonance structures of donor and acceptor. Atomic pair contributions to the Vda matrix elements are also analyzed.

  4. Structure and electronic properties of ion pairs accompanying cyclic morpholinium cation and alkylphosphite anion based ionic liquids

    NASA Astrophysics Data System (ADS)

    Verma, Prakash L.; Singh, Priti; Gejji, Shridhar P.

    2017-07-01

    Molecular insights for the formation of ion pairs accompanying the cyclic ammonium cation based room temperature ionic liquids (RTILs) composed of alkyl substituted N-methylmorpholinium (RMMor) and alkylphosphite [(Rsbnd O)2PHdbnd O] (Rdbnd ethyl, butyl, hexyl, octyl) anion have been derived from the M06-2x level of theory. Electronic structures, binding energies, and spectral characteristics of the ion pairs underlying these RTILs have been characterized. The ion pair formation is largely governed by Csbnd H⋯O and other intermolecular interactions. Calculated binding energies increase with the increasing alkyl chain on either cation or alkylphosphite anion. The cation-anion binding reveals signature in the frequency down-(red) shift of the characteristic anionic Pdbnd O stretching whereas the Psbnd H stretching exhibits a shift in the opposite direction in vibrational spectra which has further been rationalized through molecular electron density topography. Correlations of measured electrochemical stability with the separation of frontier orbital energies and binding energies in the ion pairs have further been established.

  5. Insights into an original pocket-ligand pair classification: a promising tool for ligand profile prediction.

    PubMed

    Pérot, Stéphanie; Regad, Leslie; Reynès, Christelle; Spérandio, Olivier; Miteva, Maria A; Villoutreix, Bruno O; Camproux, Anne-Claude

    2013-01-01

    Pockets are today at the cornerstones of modern drug discovery projects and at the crossroad of several research fields, from structural biology to mathematical modeling. Being able to predict if a small molecule could bind to one or more protein targets or if a protein could bind to some given ligands is very useful for drug discovery endeavors, anticipation of binding to off- and anti-targets. To date, several studies explore such questions from chemogenomic approach to reverse docking methods. Most of these studies have been performed either from the viewpoint of ligands or targets. However it seems valuable to use information from both ligands and target binding pockets. Hence, we present a multivariate approach relating ligand properties with protein pocket properties from the analysis of known ligand-protein interactions. We explored and optimized the pocket-ligand pair space by combining pocket and ligand descriptors using Principal Component Analysis and developed a classification engine on this paired space, revealing five main clusters of pocket-ligand pairs sharing specific and similar structural or physico-chemical properties. These pocket-ligand pair clusters highlight correspondences between pocket and ligand topological and physico-chemical properties and capture relevant information with respect to protein-ligand interactions. Based on these pocket-ligand correspondences, a protocol of prediction of clusters sharing similarity in terms of recognition characteristics is developed for a given pocket-ligand complex and gives high performances. It is then extended to cluster prediction for a given pocket in order to acquire knowledge about its expected ligand profile or to cluster prediction for a given ligand in order to acquire knowledge about its expected pocket profile. This prediction approach shows promising results and could contribute to predict some ligand properties critical for binding to a given pocket, and conversely, some key pocket properties for ligand binding.

  6. Insights into an Original Pocket-Ligand Pair Classification: A Promising Tool for Ligand Profile Prediction

    PubMed Central

    Reynès, Christelle; Spérandio, Olivier; Miteva, Maria A.; Villoutreix, Bruno O.; Camproux, Anne-Claude

    2013-01-01

    Pockets are today at the cornerstones of modern drug discovery projects and at the crossroad of several research fields, from structural biology to mathematical modeling. Being able to predict if a small molecule could bind to one or more protein targets or if a protein could bind to some given ligands is very useful for drug discovery endeavors, anticipation of binding to off- and anti-targets. To date, several studies explore such questions from chemogenomic approach to reverse docking methods. Most of these studies have been performed either from the viewpoint of ligands or targets. However it seems valuable to use information from both ligands and target binding pockets. Hence, we present a multivariate approach relating ligand properties with protein pocket properties from the analysis of known ligand-protein interactions. We explored and optimized the pocket-ligand pair space by combining pocket and ligand descriptors using Principal Component Analysis and developed a classification engine on this paired space, revealing five main clusters of pocket-ligand pairs sharing specific and similar structural or physico-chemical properties. These pocket-ligand pair clusters highlight correspondences between pocket and ligand topological and physico-chemical properties and capture relevant information with respect to protein-ligand interactions. Based on these pocket-ligand correspondences, a protocol of prediction of clusters sharing similarity in terms of recognition characteristics is developed for a given pocket-ligand complex and gives high performances. It is then extended to cluster prediction for a given pocket in order to acquire knowledge about its expected ligand profile or to cluster prediction for a given ligand in order to acquire knowledge about its expected pocket profile. This prediction approach shows promising results and could contribute to predict some ligand properties critical for binding to a given pocket, and conversely, some key pocket properties for ligand binding. PMID:23840299

  7. Atomic-scale properties of Ni-based FCC ternary, and quaternary alloys

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tamm, Artur; Aabloo, Alvo; Klintenberg, Mattias

    2015-08-26

    The aim of our study is to characterize some atomic-scale properties of Ni-based FCC multicomponent alloys. For this purpose, we use Monte Carlo method combined with density functional theory calculations to study short-range order (SRO), atomic displacements, electronic density of states, and magnetic moments in equimolar ternary NiCrCo, and quaternary NiCrCoFe alloys. The salient features for the ternary alloy are a negative SRO parameter between Ni Cr and a positive between Cr Cr pairs as well as a weakly magnetic state. For the quaternary alloy we predict negative SRO parameter for Ni Cr and Ni Fe pairs and positive formore » Cr Cr and Fe Fe pairs. Atomic displacements for both ternary and quaternary alloys are negligible. In contrast to the ternary, the quaternary alloy shows a complex magnetic structure. The electronic structure of the ternary and quaternary alloys shows differences near the Fermi energy between a random solid solution and the predicted structure with SRO. Despite that, the calculated EXAFS spectra does not show enough contrast to discriminate between random and ordered structures. Finally, the predicted SRO has an impact on point-defect energetics, electron phonon coupling and thermodynamic functions and thus, SRO should not be neglected when studying properties of these two alloys.« less

  8. Intermolecular ‘cross-torque’: the N4-cytosine propargyl residue is rotated to the ‘CH’-edge as a result of Watson–Crick interaction

    PubMed Central

    Domingo, Olwen; Hellmuth, Isabell; Jäschke, Andres; Kreutz, Christoph; Helm, Mark

    2015-01-01

    Propargyl groups are attractive functional groups for labeling purposes, as they allow CuAAC-mediated bioconjugation. Their size minimally exceeds that of a methyl group, the latter being frequent in natural nucleotide modifications. To understand under which circumstances propargyl-containing oligodeoxynucleotides preserve base pairing, we focused on the exocyclic amine of cytidine. Residues attached to the exocyclic N4 may orient away from or toward the Watson–Crick face, ensuing dramatic alteration of base pairing properties. ROESY-NMR experiments suggest a uniform orientation toward the Watson–Crick face of N4-propargyl residues in derivatives of both deoxycytidine and 5-methyl-deoxycytidine. In oligodeoxynucleotides, however, UV-melting indicated that N4-propargyl-deoxycytidine undergoes standard base pairing. This implies a rotation of the propargyl moiety toward the ‘CH’-edge as a result of base pairing on the Watson–Crick face. In oligonucleotides containing the corresponding 5-methyl-deoxycytidine derivative, dramatically reduced melting temperatures indicate impaired Watson–Crick base pairing. This was attributed to a steric clash of the propargyl moiety with the 5-methyl group, which prevents back rotation to the ‘CH’-edge, consequently preventing Watson–Crick geometry. Our results emphasize the tendency of an opposing nucleic acid strand to mechanically rotate single N4-substituents to make way for Watson–Crick base pairing, providing no steric hindrance is present on the ‘CH’-edge. PMID:25934805

  9. Glide-plane symmetry and superconducting gap structure of iron-based superconductors

    DOE PAGES

    Wang, Yan; Berlijn, Tom; Hirschfeld, Peter J.; ...

    2015-03-10

    We consider the effect of glide-plane symmetry of the Fe-pnictogen/chalcogen layer in Fe-based superconductors on pairing in spin fluctuation models. Recent theories propose that so-called η-pairing states with nonzero total momentum can be realized and possess such exotic properties as odd parity spin singlet symmetry and time-reversal symmetry breaking. Here we show that when there is orbital weight at the Fermi level from orbitals with even and odd mirror reflection symmetry in z, η pairing is inevitable; however, we conclude from explicit calculation that the gap function appearing in observable quantities is identical to that found in earlier pseudocrystal momentummore » calculations with 1 Fe per unit cell.« less

  10. High-Fidelity Down-Conversion Source for Secure Communications Using On-Demand Single Photons

    NASA Technical Reports Server (NTRS)

    Roberts, Tony

    2015-01-01

    AdvR, Inc., has built an efficient, fully integrated, waveguide-based source of spectrally uncorrelated photon pairs that will accelerate research and development (R&D) in the emerging field of quantum information science. Key to the innovation is the use of submicron periodically poled waveguides to produce counter propagating photon pairs, which is enabled by AdvR's patented segmented microelectrode poling technique. This novel device will provide a high brightness source of down-conversion pairs with enhanced spectral properties and low attenuation, and it will operate in the visible to the mid-infrared spectral region. A waveguide-based source of spectrally and spatially pure heralded photons will contribute to a wide range of NASA's advanced technology development efforts, including on-demand single photon sources for high-rate spaced-based secure communications.

  11. Communication: Exact analytical derivatives for the domain-based local pair natural orbital MP2 method (DLPNO-MP2)

    NASA Astrophysics Data System (ADS)

    Pinski, Peter; Neese, Frank

    2018-01-01

    Electron correlation methods based on pair natural orbitals (PNOs) have gained an increasing degree of interest in recent years, as they permit energy calculations to be performed on systems containing up to many hundred atoms, while maintaining chemical accuracy for reaction energies. We present an approach for taking exact analytical first derivatives of the energy contributions in the simplest method of the family of Domain-based Local Pair Natural Orbital (DLPNO) methods, closed-shell DLPNO-MP2. The Lagrangian function contains constraints to account for the relaxation of PNOs. RI-MP2 reference geometries are reproduced accurately, as exemplified for four systems with a substantial degree of nonbonding interactions. By the example of electric field gradients, we demonstrate that omitting PNO-specific constraints can lead to dramatic errors for orbital-relaxed properties.

  12. On the generality of the topological theory of visual shape perception.

    PubMed

    Kanbe, Fumio

    2013-01-01

    This study used a series of six closely related experiments to examine whether individuals use topological structures to discriminate figures. Strict control was exerted over the selection of stimuli, which were a specific type of randomly generated lined figures that can be classified using isomorphic sets defined by graph theory. Any two figures within an isomorphic set possessed the same topological structure. The experiments described here used a same/different discrimination task with simultaneously presented pairs of figures: (a) identical pairs (Id pairs), in which each pair of figures had the same topological and superficial properties; (b) nonidentical and isomorphic pairs (Iso pairs), in which each pair had the same topological but different superficial properties; and (c) nonidentical and nonisomorphic pairs (Noniso pairs), in which each pair had different topological properties. Within these experiments I varied the conditions related to the intersecting line segments, presentation of points defining each figure, figure complexity, stimulus aspect ratios, and the parity of the total line-segment lengths between the figures in each pair. These variations showed that the latencies for making accurate discriminations were shorter for Noniso pairs than for Iso pairs, suggesting that individuals are sensitive to topology when distinguishing figures.

  13. Modified nucleotides reveal the indirect role of the central base pairs in stabilizing the lac repressor-operator complex.

    PubMed Central

    Zhang, X; Gottlieb, P A

    1995-01-01

    Guanine residues in the lac operator were replaced by 2-aminopurine or purine analogues, pairing the modified nucleotides with C. The observed equilibrium dissociation constants for lac repressor binding to substituted operators were measured in 10 mM Tris, 150 mM KCl, 0.1 mM EDTA, 0.1 mM DTE, pH 7.6 at 25 degrees C. These measurements revealed five positions that destabilized the complex when substituted with either analogue. Two positions, which are related by a 2-fold symmetry, are in the major groove of the operator thought to directly interact with the protein. Three sites were in the central region of the operator. A purine analogue at a sixth site perturbed the local DNA structure and destabilized the complex. Alkylation interference experiments of the 2-aminopurine substituted operators demonstrated that, of the five affected, two substitutions displayed altered phosphate interference patterns at the phosphate adjacent to the substituted base. For these operators, complex formation was measured in different concentrations of KCl to assess the contribution of counterion release to the bimolecular process. The results indicated that both complexes were similar to wild-type, although minor changes were observed. The Kobs of the complex was then measured when 2-aminopurine or purine analogues were paired with uracil nucleotide, a base pair that serves to stabilize the DNA. The introduction of the new base pairs revealed two effects on the bimolecular interaction. For those operator sites that are thought to perturb the interaction directly, the affinity of the complex was weakened to levels observed for the singly-substituted operators. In contrast, the nucleotides of 2-aminopurine paired with uracil positioned in the central region of the operator served to enhance the stability of the complex. The purine-uracil base pair substitution on the other hand had a significant destabilizing effect on the interaction. We propose that the central base pairs modulate binding of the complex by altering the intrinsic properties of the DNA. Two specific attributes are required to achieve the lowest free energy of interaction. The DNA must have two interstrand hydrogen bonds to stabilize the duplex and it must have properties associated with directional bending or unwinding. This analysis does not rule out contributions by direct interactions between the protein and the central region of the operator but underscores how indirect effects play a major role in complex formation in this system. Images PMID:7784203

  14. Universal spectral signatures in pnictides and cuprates: the role of quasiparticle-pair coupling.

    PubMed

    Sacks, William; Mauger, Alain; Noat, Yves

    2017-11-08

    Understanding the physical properties of a large variety of high-T c superconductors (SC), the cuprate family as well as the more recent iron-based superconductors, is still a major challenge. In particular, these materials exhibit the 'peak-dip-hump' structure in the quasiparticle density of states (DOS). The origin of this structure is explained within our pair-pair interaction (PPI) model: The non-superconducting state consists of incoherent pairs, a 'Cooper-pair glass' which, due to the PPI, undergoes a Bose-like condensation below T c to the coherent SC state. We derive the equations of motion for the quasiparticle operators showing that the DOS 'peak-dip-hump' is caused by the coupling between quasiparticles and excited pair states, or 'super-quasiparticles'. The renormalized SC gap function becomes energy-dependent and non retarded, reproducing accurately the experimental spectra of both pnictides and cuprates, despite the large difference in gap value.

  15. FLASHFLOOD: A 3D Field-based similarity search and alignment method for flexible molecules

    NASA Astrophysics Data System (ADS)

    Pitman, Michael C.; Huber, Wolfgang K.; Horn, Hans; Krämer, Andreas; Rice, Julia E.; Swope, William C.

    2001-07-01

    A three-dimensional field-based similarity search and alignment method for flexible molecules is introduced. The conformational space of a flexible molecule is represented in terms of fragments and torsional angles of allowed conformations. A user-definable property field is used to compute features of fragment pairs. Features are generalizations of CoMMA descriptors (Silverman, B.D. and Platt, D.E., J. Med. Chem., 39 (1996) 2129.) that characterize local regions of the property field by its local moments. The features are invariant under coordinate system transformations. Features taken from a query molecule are used to form alignments with fragment pairs in the database. An assembly algorithm is then used to merge the fragment pairs into full structures, aligned to the query. Key to the method is the use of a context adaptive descriptor scaling procedure as the basis for similarity. This allows the user to tune the weights of the various feature components based on examples relevant to the particular context under investigation. The property fields may range from simple, phenomenological fields, to fields derived from quantum mechanical calculations. We apply the method to the dihydrofolate/methotrexate benchmark system, and show that when one injects relevant contextual information into the descriptor scaling procedure, better results are obtained more efficiently. We also show how the method works and include computer times for a query from a database that represents approximately 23 million conformers of seventeen flexible molecules.

  16. Orbital-selective pairing and superconductivity in iron selenides

    NASA Astrophysics Data System (ADS)

    Nica, Emilian M.; Yu, Rong; Si, Qimiao

    2017-12-01

    An important challenge in condensed matter physics is understanding iron-based superconductors. Among these systems, the iron selenides hold the record for highest superconducting transition temperature and pose especially striking puzzles regarding the nature of superconductivity. The pairing state of the alkaline iron selenides appears to be of d-wave type based on the observation of a resonance mode in neutron scattering, while it seems to be of s-wave type from the nodeless gaps observed everywhere on the Fermi surface. Here we propose an orbital-selective pairing state, dubbed sτ3, as a natural explanation of these disparate properties. The pairing function, containing a matrix τ3 in the basis of 3d-electron orbitals, does not commute with the kinetic part of the Hamiltonian. This dictates the existence of both intraband and interband pairing terms in the band basis. A spin resonance arises from a d-wave-type sign change in the intraband pairing component, whereas the quasiparticle excitation is fully gapped on the FS due to an s-wave-like form factor associated with the addition in quadrature of the intraband and interband pairing terms. We demonstrate that this pairing state is energetically favored when the electron correlation effects are orbitally selective. More generally, our results illustrate how the multiband nature of correlated electrons affords unusual types of superconducting states, thereby shedding new light not only on the iron-based materials but also on a broad range of other unconventional superconductors such as heavy fermion and organic systems.

  17. Magnetic properties and pairing tendencies of the iron-based superconducting ladder BaFe 2 S 3 : Combined ab initio and density matrix renormalization group study

    DOE PAGES

    Patel, Niravkumar D.; Nocera, Alberto; Alvarez, Gonzalo; ...

    2016-08-10

    The recent discovery of superconductivity under high pressure in the two-leg ladder compound BaFe 2S 3 [H. Takahashi et al., Nat. Mater. 14, 1008 (2015)] opens a broad avenue of research, because it represents the first report of pairing tendencies in a quasi-one-dimensional iron-based high-critical-temperature superconductor. Similarly, as in the case of the cuprates, ladders and chains can be far more accurately studied using many-body techniques and model Hamiltonians than their layered counterparts, particularly if several orbitals are active. In this publication, we derive a two-orbital Hubbard model from first principles that describes individual ladders of BaFe 2S 3. Themore » model is studied with the density matrix renormalization group. These first reported results are exciting for two reasons: (i) at half-filling, ferromagnetic order emerges as the dominant magnetic pattern along the rungs of the ladder, and antiferromagnetic order along the legs, in excellent agreement with neutron experiments; and (ii) with hole doping, pairs form in the strong coupling regime, as found by studying the binding energy of two holes doped on the half-filled system. In addition, orbital selective Mott phase characteristics develop with doping, with only oneWannier orbital receiving the hole carriers while the other remains half-filled. Lastly, these results suggest that the analysis of models for iron-based two-leg ladders could clarify the origin of pairing tendencies and other exotic properties of iron-based high-critical-temperature superconductors in general.« less

  18. Milestone Report:3.2.2.26 Appliances, HVAC & Water Heating R&D-Select Sorption Technology

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ally, Moonis Raza

    The purpose of this report is to select a sorption technology based on recent work completed on characterizing working pairs for both absorption and adsorption technologies based on Global Warming Potential (GWP) of less than 100 (relative to carbon dioxide, 100-year atmospheric life span) and zero Ozone Depletion Potential (ODP). From a total of eighty-three potential working pairs (absorption technology), there were only two candidate working pairs for the absorption technology, and 8 potential working pairs for adsorption technology. After screening these ten potential candidates on the basis of sizes of the desorber, absorber/adsorber, evaporator, condenser, and rectifier (where applicable),more » the ORNL-Georgia Tech study concluded that best working pairs are NH3-H2O for the most compact system in terms of heat transfer equipment surface area, and NH3-LiNO3 and MeOH-[mmin][DMP] where efficiency is most important. Based on a single-stage absorption and adsorption modeling using the Engineering Equation Solver (EES), the performance of both sorption systems was evaluated from known heat transfer correlations, and thermos-physical properties. Based on these results, the technology chosen is absorption technology. The selected technology is absorption for the reasons cited in Section 4.« less

  19. Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing.

    PubMed

    Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon

    2010-08-18

    It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

  20. Characterization of the LCLS “nanosecond two-bunch” mode for x-ray speckle visibility spectroscopy experiments

    DOE PAGES

    Sun, Yanwen; Zhu, Diling; Song, Sanghoon; ...

    2017-05-23

    The generation of two X-ray pulses with tunable nanosecond scale time separations has recently been demonstrated at the Linac Coherent Light Source using an accelerator based technique. This approach offers the opportunity to extend X-ray Photon Correlation Spectroscopy techniques to the yet unexplored regime of nanosecond timescales by means of X-ray Speckle Visibility Spectroscopy. As the two pulses originate from two independent Spontaneous Amplified Stimulated Emission processes, the beam properties fluctuate from pulse pair to pulse pair, but as well between the individual pulses within a pair. However, two-pulse XSVS experiments require the intensity of the individual pulses to bemore » either identical in the ideal case, or with a accurately known intensity ratio. We present the design and performances of a non-destructive intensity diagnostic based on measurement of scattering from a transparent target using a high-speed photo-detector. Individual pulses within a pulse pair with time delays as short as 0.7 ns can be resolved. Moreover, using small angle coherent scattering, we characterize the averaged spatial overlap of the focused pulse pairs. Furthermore, the multi-shot average-speckle contrasts from individual pulses and pulse pairs are compared.« less

  1. Systematization of actinides using cluster analysis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kopyrin, A.A.; Terent`eva, T.N.; Khramov, N.N.

    1994-11-01

    A representation of the actinides in multidimensional property space is proposed for systematization of these elements using cluster analysis. Literature data for their atomic properties are used. Owing to the wide variation of published ionization potentials, medians are used to estimate them. Vertical dendograms are used for classification on the basis of distances between the actinides in atomic-property space. The properties of actinium and lawrencium are furthest removed from the main group. Thorium and mendelevium exhibit individualized properties. A cluster based on the einsteinium-fermium pair is joined by californium.

  2. Error-correcting pairs for a public-key cryptosystem

    NASA Astrophysics Data System (ADS)

    Pellikaan, Ruud; Márquez-Corbella, Irene

    2017-06-01

    Code-based Cryptography (CBC) is a powerful and promising alternative for quantum resistant cryptography. Indeed, together with lattice-based cryptography, multivariate cryptography and hash-based cryptography are the principal available techniques for post-quantum cryptography. CBC was first introduced by McEliece where he designed one of the most efficient Public-Key encryption schemes with exceptionally strong security guarantees and other desirable properties that still resist to attacks based on Quantum Fourier Transform and Amplitude Amplification. The original proposal, which remains unbroken, was based on binary Goppa codes. Later, several families of codes have been proposed in order to reduce the key size. Some of these alternatives have already been broken. One of the main requirements of a code-based cryptosystem is having high performance t-bounded decoding algorithms which is achieved in the case the code has a t-error-correcting pair (ECP). Indeed, those McEliece schemes that use GRS codes, BCH, Goppa and algebraic geometry codes are in fact using an error-correcting pair as a secret key. That is, the security of these Public-Key Cryptosystems is not only based on the inherent intractability of bounded distance decoding but also on the assumption that it is difficult to retrieve efficiently an error-correcting pair. In this paper, the class of codes with a t-ECP is proposed for the McEliece cryptosystem. Moreover, we study the hardness of distinguishing arbitrary codes from those having a t-error correcting pair.

  3. An investigation on the physicochemical properties of the nanostructured [(4-X)PMAT][N(CN)2] ion pairs as energetic and tunable aryl alkyl amino tetrazolium based ionic liquids

    NASA Astrophysics Data System (ADS)

    Khalili, Behzad; Rimaz, Mehdi

    2017-06-01

    In this study the different class of tunable and high nitrogen content ionic liquids termed TAMATILs (Tunable Aryl Methyl Amino Tetrazolium based Ionic Liquids) were designed. The physicochemical properties of the nanostructured TAMATILs composed of para substituted phenyl methyl amino tetrazolium cations [(4-X)PMAT]+ (X = H, Me, OCH3, OH, NH2, NO2, F, CN, CHO, CF3, COMe and CO2Me) and dicyanimide anion [N(CN)2]- were fully investigated using M06-2X functional in conjunction with the 6-311++G(2d,2p) basis set. For all of the studied nanostructured ILs the structural parameters, interaction energy, cation's enthalpy of formation, natural charges, charge transfer values and topological properties were calculated and discussed. The substituent effect on the interaction energy and physicochemical properties also is taking into account. The results showed that the strength of interaction has a linear correlation with electron content of the phenyl ring in a way the substituents with electron withdrawing effects lead to make more stable ion pairs with higher interaction energies. Some of the main physical properties of ILs such as surface tension, melting point, critical-point temperature, electrochemical stability and conductivity are discussed and estimated for studying ion pairs using quantum chemical computationally obtained thermochemical data. Finally the enthalpy and Gibbs free energy of formation for twelve nanostructured individual cations with the general formula of [(4-X)PMAT]+ (X = 4-H, 4-Me, 4-OMe, 4-OH, 4-NH2, 4-NO2, 4-F, 4-CN, 4-CHO, 4-CF3, 4-COMe and 4-CO2Me) are calculated.

  4. Splitting efficiency and interference effects in a Cooper pair splitter based on a triple quantum dot with ferromagnetic contacts

    NASA Astrophysics Data System (ADS)

    Bocian, Kacper; Rudziński, Wojciech; Weymann, Ireneusz

    2018-05-01

    We theoretically study the spin-resolved subgap transport properties of a Cooper pair splitter based on a triple quantum dot attached to superconducting and ferromagnetic leads. Using the Keldysh Green's function formalism, we analyze the dependence of the Andreev conductance, Cooper pair splitting efficiency, and tunnel magnetoresistance on the gate and bias voltages applied to the system. We show that the system's transport properties are strongly affected by spin dependence of tunneling processes and quantum interference between different local and nonlocal Andreev reflections. We also study the effects of finite hopping between the side quantum dots on the Andreev current. This allows for identifying the optimal conditions for enhancing the Cooper pair splitting efficiency of the device. We find that the splitting efficiency exhibits a nonmonotonic dependence on the degree of spin polarization of the leads and the magnitude and type of hopping between the dots. An almost perfect splitting efficiency is predicted in the nonlinear response regime when the energies of the side quantum dots are tuned to the energies of the corresponding Andreev bound states. In addition, we analyzed features of the tunnel magnetoresistance (TMR) for a wide range of the gate and bias voltages, as well as for different model parameters, finding the corresponding sign changes of the TMR in certain transport regimes. The mechanisms leading to these effects are thoroughly discussed.

  5. An algebraic hypothesis about the primeval genetic code architecture.

    PubMed

    Sánchez, Robersy; Grau, Ricardo

    2009-09-01

    A plausible architecture of an ancient genetic code is derived from an extended base triplet vector space over the Galois field of the extended base alphabet {D,A,C,G,U}, where symbol D represents one or more hypothetical bases with unspecific pairings. We hypothesized that the high degeneration of a primeval genetic code with five bases and the gradual origin and improvement of a primeval DNA repair system could make possible the transition from ancient to modern genetic codes. Our results suggest that the Watson-Crick base pairing G identical with C and A=U and the non-specific base pairing of the hypothetical ancestral base D used to define the sum and product operations are enough features to determine the coding constraints of the primeval and the modern genetic code, as well as, the transition from the former to the latter. Geometrical and algebraic properties of this vector space reveal that the present codon assignment of the standard genetic code could be induced from a primeval codon assignment. Besides, the Fourier spectrum of the extended DNA genome sequences derived from the multiple sequence alignment suggests that the called period-3 property of the present coding DNA sequences could also exist in the ancient coding DNA sequences. The phylogenetic analyses achieved with metrics defined in the N-dimensional vector space (B(3))(N) of DNA sequences and with the new evolutionary model presented here also suggest that an ancient DNA coding sequence with five or more bases does not contradict the expected evolutionary history.

  6. Results on top-quark physics and top-quark-like signatures by CMS

    NASA Astrophysics Data System (ADS)

    Chabert, Eric; CMS Collaboration

    2017-07-01

    This report reviews the results obtained by the CMS Collaboration on top quark physics, focusing on the latest ones based on p-p collisions provided by the LHC at \\sqrt{s}=13{{TeV}} during Run II. It covers measurements of single-top, top quark pairs and associated productions as well as measurements of top quark properties. Finally several beyond the standard model searches involving top quark in the final states are presented, such as searches for supersymmetry in the third generation, heavy resonances decaying into a top quark pair, or dark matter produced in association to a single-top or a top quark pair.

  7. Optimizing photon-pair generation electronically using a p-i-n diode incorporated in a silicon microring resonator

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Savanier, Marc, E-mail: msavanier@eng.ucsd.edu; Kumar, Ranjeet; Mookherjea, Shayan, E-mail: smookherjea@eng.ucsd.edu

    Silicon photonic microchips may be useful for compact, inexpensive, room-temperature optically pumped photon-pair sources, which unlike conventional photon-pair generators based on crystals or optical fibers, can be manufactured using CMOS-compatible processes on silicon wafers. It has been shown that photon pairs can be created in simple structures such as microring resonators at a rate of a few hundred kilohertz using less than a milliwatt of optical pump power, based on the process of spontaneous four-wave mixing. To create a practical photon-pair source, however, also requires some way of monitoring the device and aligning the pump wavelength when the temperature varies,more » since silicon resonators are highly sensitive to temperature. In fact, monitoring photodiodes are standard components in classical laser diodes, but the incorporation of germanium or InGaAs photodiodes would raise the cost and fabrication complexity. Here, we present a simple and effective all-electronic technique for finding the optimum operating point for the microring used to generate photon pairs, based on measuring the reverse-biased current in a silicon p-i-n junction diode fabricated across the waveguide that constitutes the silicon microring. We show that by monitoring the current, and using it to tune the pump laser wavelength, the photon-pair generation properties of the microring can be preserved over a temperature range of more than 30 °C.« less

  8. The Influence of Item Properties on Association-Memory

    ERIC Educational Resources Information Center

    Madan, Christopher R.; Glaholt, Mackenzie G.; Caplan, Jeremy B.

    2010-01-01

    Word properties like imageability and word frequency improve cued recall of verbal paired-associates. We asked whether these enhancements follow simply from prior effects on item-memory, or also strengthen associations between items. Participants studied word pairs varying in imageability or frequency: pairs were "pure" (high-high, low-low) or…

  9. Properties of solid and gaseous hydrogen, based upon anisotropic pair interactions

    NASA Technical Reports Server (NTRS)

    Etters, R. D.; Danilowicz, R.; England, W.

    1975-01-01

    Properties of H2 are studied on the basis of an analytic anisotropic potential deduced from atomic orbital and perturbation calculations. The low-pressure solid results are based on a spherical average of the anisotropic potential. The ground state energy and the pressure-volume relation are calculated. The metal-insulator phase transition pressure is predicted. Second virial coefficients are calculated for H2 and D2, as is the difference in second virial coefficients between ortho and para H2 and D2.

  10. Real-time line matching from stereo images using a nonparametric transform of spatial relations and texture information

    NASA Astrophysics Data System (ADS)

    Park, Jonghee; Yoon, Kuk-Jin

    2015-02-01

    We propose a real-time line matching method for stereo systems. To achieve real-time performance while retaining a high level of matching precision, we first propose a nonparametric transform to represent the spatial relations between neighboring lines and nearby textures as a binary stream. Since the length of a line can vary across images, the matching costs between lines are computed within an overlap area (OA) based on the binary stream. The OA is determined for each line pair by employing the properties of a rectified image pair. Finally, the line correspondence is determined using a winner-takes-all method with a left-right consistency check. To reduce the computational time requirements further, we filter out unreliable matching candidates in advance based on their rectification properties. The performance of the proposed method was compared with state-of-the-art methods in terms of the computational time, matching precision, and recall. The proposed method required 47 ms to match lines from an image pair in the KITTI dataset with an average precision of 95%. We also verified the proposed method under image blur, illumination variation, and viewpoint changes.

  11. Ionic force field optimization based on single-ion and ion-pair solvation properties: Going beyond standard mixing rules

    NASA Astrophysics Data System (ADS)

    Fyta, Maria; Netz, Roland R.

    2012-03-01

    Using molecular dynamics (MD) simulations in conjunction with the SPC/E water model, we optimize ionic force-field parameters for seven different halide and alkali ions, considering a total of eight ion-pairs. Our strategy is based on simultaneous optimizing single-ion and ion-pair properties, i.e., we first fix ion-water parameters based on single-ion solvation free energies, and in a second step determine the cation-anion interaction parameters (traditionally given by mixing or combination rules) based on the Kirkwood-Buff theory without modification of the ion-water interaction parameters. In doing so, we have introduced scaling factors for the cation-anion Lennard-Jones (LJ) interaction that quantify deviations from the standard mixing rules. For the rather size-symmetric salt solutions involving bromide and chloride ions, the standard mixing rules work fine. On the other hand, for the iodide and fluoride solutions, corresponding to the largest and smallest anion considered in this work, a rescaling of the mixing rules was necessary. For iodide, the experimental activities suggest more tightly bound ion pairing than given by the standard mixing rules, which is achieved in simulations by reducing the scaling factor of the cation-anion LJ energy. For fluoride, the situation is different and the simulations show too large attraction between fluoride and cations when compared with experimental data. For NaF, the situation can be rectified by increasing the cation-anion LJ energy. For KF, it proves necessary to increase the effective cation-anion Lennard-Jones diameter. The optimization strategy outlined in this work can be easily adapted to different kinds of ions.

  12. Technological applications arising from the interactions of DNA bases with metal ions.

    PubMed

    Park, Ki Soo; Park, Hyun Gyu

    2014-08-01

    An intense interest has grown in the unique interactions of nucleic acids with metal ions, which lead to the formation of metal-base pairs and the generation of fluorescent nanomaterials. In this review, different types of metal-base pairs, especially those formed from naturally occurring nucleosides, are described with emphasis also being given to recent advances made in employing these complexes to govern enzymatic reactions. The review also contains a comprehensive description of DNA-templated inorganic nanomaterials such as silver nanoclusters which possess excellent fluorescence properties. Finally, a summary is given about how these materials have led to recent advances in the field of nanobiotechnology. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Statistical properties of DNA sequences

    NASA Technical Reports Server (NTRS)

    Peng, C. K.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Simons, M.; Stanley, H. E.

    1995-01-01

    We review evidence supporting the idea that the DNA sequence in genes containing non-coding regions is correlated, and that the correlation is remarkably long range--indeed, nucleotides thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene. We resolve the problem of the "non-stationarity" feature of the sequence of base pairs by applying a new algorithm called detrended fluctuation analysis (DFA). We address the claim of Voss that there is no difference in the statistical properties of coding and non-coding regions of DNA by systematically applying the DFA algorithm, as well as standard FFT analysis, to every DNA sequence (33301 coding and 29453 non-coding) in the entire GenBank database. Finally, we describe briefly some recent work showing that the non-coding sequences have certain statistical features in common with natural and artificial languages. Specifically, we adapt to DNA the Zipf approach to analyzing linguistic texts. These statistical properties of non-coding sequences support the possibility that non-coding regions of DNA may carry biological information.

  14. On the Harmonic Coupling of Components in Pairs of IIIb-III Bursts at Decameter Wavelengths

    NASA Astrophysics Data System (ADS)

    Brazhenko, A. I.; Melnik, V. N.; Frantsuzenko, A. V.; Dorovskyy, V. V.; Rucker, H. O.; Panchenko, M.

    2015-06-01

    The properties of IIIb-III pairs observed by the URAN-2 radioThe properties of IIIb-III pairs observed by the URAN-2 radiotelescope at frequencies 16-32 MHz are analyzed. Observations of these bursts were hold in April, June and September 2011. Durations, frequency drift rates, simultaneous frequency ratio of pairs components and their polarizations are analyzed. Pro and contra of IIIb-III harmonic connection are discussed.

  15. Quasiparticle properties of DNA bases from GW calculations in a Wannier basis

    NASA Astrophysics Data System (ADS)

    Qian, Xiaofeng; Marzari, Nicola; Umari, Paolo

    2009-03-01

    The quasiparticle GW-Wannier (GWW) approach [1] has been recently developed to overcome the size limitations of conventional planewave GW calculations. By taking advantage of the localization properties of the maximally-localized Wannier functions and choosing a small set of polarization basis we reduce the number of Bloch wavefunctions products required for the evaluation of dynamical polarizabilities, and in turn greatly reduce memory requirements and computational efficiency. We apply GWW to study quasiparticle properties of different DNA bases and base-pairs, and solvation effects on the energy gap, demonstrating in the process the key advantages of this approach. [1] P. Umari,G. Stenuit, and S. Baroni, cond-mat/0811.1453

  16. Effect of chromatic-dispersion-induced chirp on the temporal coherence properties of individual beams from spontaneous four-wave mixing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ma Xiaoxin; Li Xiaoying; Cui Liang

    2011-08-15

    Temporal coherence of individual signal or idler beam, determined by the spectral correlation property of photon pairs, is important for realizing quantum interference among independent sources. Based on spontaneous four-wave mixing in optical fibers, we study the effect of chirp on the temporal coherence property by introducing a different amount of chirp into either the pulsed pump or individual signal (idler) beam. The investigation shows that the pump chirp induces additional frequency correlation into photon pairs; the mutual spectral correlation of photon pairs and the coherence of individual beam can be characterized by measuring the intensity correlation function g{sup (2)}more » of the individual beam. To improve the coherence degree, the pump chirp should be minimized. Moreover, a Hong-Ou-Mandel-type two-photon interference experiment with the signal beams generated in two different fibers illustrates that the chirp of the individual signal (idler) beam does not change the temporal coherence degree, but affects the temporal mode matching. To achieve high visibility among multiple sources, apart from improving the coherence degree, mode matching should be optimized by managing the chirps of individual beams.« less

  17. Real-time spectral characterization of a photon pair source using a chirped supercontinuum seed.

    PubMed

    Erskine, Jennifer; England, Duncan; Kupchak, Connor; Sussman, Benjamin

    2018-02-15

    Photon pair sources have wide ranging applications in a variety of quantum photonic experiments and protocols. Many of these protocols require well controlled spectral correlations between the two output photons. However, due to low cross-sections, measuring the joint spectral properties of photon pair sources has historically been a challenging and time-consuming task. Here, we present an approach for the real-time measurement of the joint spectral properties of a fiber-based four wave mixing source. We seed the four wave mixing process using a broadband chirped pulse, studying the stimulated process to extract information regarding the spontaneous process. In addition, we compare stimulated emission measurements with the spontaneous process to confirm the technique's validity. Joint spectral measurements have taken many hours historically and several minutes with recent techniques. Here, measurements have been demonstrated in 5-30 s depending on resolution, offering substantial improvement. Additional benefits of this approach include flexible resolution, large measurement bandwidth, and reduced experimental overhead.

  18. Facile Modulation of FLP Properties: A Phosphinylvinyl Grignard Reagent and Ga/P- and In/P2 -Based Frustrated Lewis Pairs.

    PubMed

    Backs, Jana; Lange, Merten; Possart, Josephine; Wollschläger, Agnes; Mück-Lichtenfeld, Christian; Uhl, Werner

    2017-03-06

    An Al/P-based frustrated Lewis pair (FLP) reacted with PhMgCl by an unexpected transmetalation and formation of a phosphinylvinyl Grignard reagent. This compound is well suited for the transfer of the basic FLP component to other Lewis acidic metal atoms and allowed the generation of a Ga/P and an In/P 2 FLP. The Ga FLP showed a behavior different to that of the corresponding Al FLP, the In FLP allowed the chelating coordination of an Au atom by Au-Cl bond activation. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Properties of Decameter IIIb-III Pairs

    NASA Astrophysics Data System (ADS)

    Melnik, V. N.; Brazhenko, A. I.; Frantsuzenko, A. V.; Dorovskyy, V. V.; Rucker, H. O.

    2018-02-01

    A large number of Type IIIb-III pairs, in which the first component is a Type IIIb burst and the second one is a Type III burst, are often recorded during decameter Type III burst storms. From the beginning of their observation, the question of whether the components of these pairs are the first and the second harmonics of radio emission or not has remained open. We discuss properties of decameter IIIb-III pairs in detail to answer this question. The components of these pairs, Type IIIb bursts and Type III bursts, have essentially different durations and polarizations. At the same time their frequency drift rates are rather close, provided that the drift rates of Type IIIb bursts are a little larger those of Type III bursts at the same frequency. Frequency ratios of the bursts at the same moment are close to two. This points at a harmonic connection of the components in IIIb-III pairs. At the same time there was a serious difficulty, namely why the first harmonic had fine frequency structure in the form of striae and the second harmonic did not have it. Recently Loi, Cairns, and Li ( Astrophys. J. 790, 67, 2014) succeeded in solving this problem. The physical aspects of observational properties of decameter IIIb-III pairs are discussed and pros and cons of harmonic character of Type IIIb bursts and Type III bursts in IIIb-III pairs are presented. We conclude that practically all properties of the IIIb-III pair components can be understood in the framework of the harmonic relation of the components of the IIIb-III pairs.

  20. A natural language processing pipeline for pairing measurements uniquely across free-text CT reports.

    PubMed

    Sevenster, Merlijn; Bozeman, Jeffrey; Cowhy, Andrea; Trost, William

    2015-02-01

    To standardize and objectivize treatment response assessment in oncology, guidelines have been proposed that are driven by radiological measurements, which are typically communicated in free-text reports defying automated processing. We study through inter-annotator agreement and natural language processing (NLP) algorithm development the task of pairing measurements that quantify the same finding across consecutive radiology reports, such that each measurement is paired with at most one other ("partial uniqueness"). Ground truth is created based on 283 abdomen and 311 chest CT reports of 50 patients each. A pre-processing engine segments reports and extracts measurements. Thirteen features are developed based on volumetric similarity between measurements, semantic similarity between their respective narrative contexts and structural properties of their report positions. A Random Forest classifier (RF) integrates all features. A "mutual best match" (MBM) post-processor ensures partial uniqueness. In an end-to-end evaluation, RF has precision 0.841, recall 0.807, F-measure 0.824 and AUC 0.971; with MBM, which performs above chance level (P<0.001), it has precision 0.899, recall 0.776, F-measure 0.833 and AUC 0.935. RF (RF+MBM) has error-free performance on 52.7% (57.4%) of report pairs. Inter-annotator agreement of three domain specialists with the ground truth (κ>0.960) indicates that the task is well defined. Domain properties and inter-section differences are discussed to explain superior performance in abdomen. Enforcing partial uniqueness has mixed but minor effects on performance. A combined machine learning-filtering approach is proposed for pairing measurements, which can support prospective (supporting treatment response assessment) and retrospective purposes (data mining). Copyright © 2014 Elsevier Inc. All rights reserved.

  1. Poincaré recurrences of DNA sequences

    NASA Astrophysics Data System (ADS)

    Frahm, K. M.; Shepelyansky, D. L.

    2012-01-01

    We analyze the statistical properties of Poincaré recurrences of Homo sapiens, mammalian, and other DNA sequences taken from the Ensembl Genome data base with up to 15 billion base pairs. We show that the probability of Poincaré recurrences decays in an algebraic way with the Poincaré exponent β≈4 even if the oscillatory dependence is well pronounced. The correlations between recurrences decay with an exponent ν≈0.6 that leads to an anomalous superdiffusive walk. However, for Homo sapiens sequences, with the largest available statistics, the diffusion coefficient converges to a finite value on distances larger than one million base pairs. We argue that the approach based on Poncaré recurrences determines new proximity features between different species and sheds a new light on their evolution history.

  2. Design and Applications of Noncanonical DNA Base Pairs.

    PubMed

    Jissy, A K; Datta, Ayan

    2014-01-02

    While the Watson-Crick base pairs are known to stabilize the DNA double helix and play a vital role in storage/replication of genetic information, their replacement with non-Watson-Crick base pairs has recently been shown to have interesting practical applications. Nowadays, theoretical calculations are routinely performed on very complex systems to gain a better understanding of how molecules interact with each other. We not only bring together some of the basic concepts of how mispaired or unnatural nucleobases interact with each other but also look at how such an understanding influences the prediction of novel properties and development of new materials. We highlight the recent developments in this field of research. In this Perspective, we discuss the success of DFT methods, particularly, dispersion-corrected DFT, for applications such as pH-controlled molecular switching, electric-field-induced stacking of disk-like molecules with guanine quartets, and optical birefringence of alkali-metal-coordinated guanine quartets. The synergy between theoretical models and real applications is highlighted.

  3. UGC 4703 Interacting Pair Near the Isolated Spiral Galaxy NGC 2718: A Milky Way Magellanic Cloud Analog

    NASA Astrophysics Data System (ADS)

    Paudel, Sanjaya; Sengupta, C.

    2017-11-01

    We present an analysis of physical and morphological properties of an interacting pair of dwarf galaxies, UGC 4703, located in the vicinity of an isolated Milky Way (MW) type spiral galaxy NGC 2718. Based on the comparison of physical and morphological properties with that of the Large and Small Magellanic Clouds (LMC and SMC), we report that the UGC 4703 pair-NGC 2718 system is probably an LMC-SMC-MW analog. Located at a sky-projected distance of 81 kpc from NGC 2718, we find that UGC 4703 is clearly interacting with its nearby lower-mass companion UGC 4703B, forming a bridge of stellar stream between them. Total B-band luminosity of UGC 4703 and its companion is -17.75 and -16.25 mag, respectively. We obtained H I 21 cm line data of UGC 4703 using the GMRT to get a more detailed view of neutral hydrogen (H I) emission. The H I image revealed evidence of interaction between the dwarf galaxy pair but no extended emission, such as the Magellanic Stream. We also detected star-forming regions along the UGC 4703/4703B bridge with stellar mass exceeding 107 M ⊙. While comparing the optical and H I morphology of the interacting dwarf pairs (UGC 4703-4703B and LMC-SMC), we discuss possible differences in interaction histories of these systems.

  4. Transdermal penetration of vasoconstrictors--present understanding and assessment of the human epidermal flux and retention of free bases and ion-pairs.

    PubMed

    Cross, Sheree E; Thompson, Melanie J; Roberts, Michael S

    2003-02-01

    As reductions in dermal clearance increase the residence time of solutes in the skin and underlying tissues we compared the topical penetration of potentially useful vasoconstrictors (VCs) through human epidermis as both free bases and ion-pairs with salicylic acid (SA). We determined the in vitro epidermal flux of ephedrine, naphazoline, oxymetazoline, phenylephrine, and xylometazoline applied as saturated solutions in propylene glycol:water (1:1) and of ephedrine, naphazoline and tetrahydrozoline as 10% solutions of 1:1 molar ratio ion-pairs with SA in liquid paraffin. As free bases, ephedrine had the highest maximal flux, Jmax = 77.4 +/- 11.7 microg/cm2/h, being 4-fold higher than tetrahydrozoline and xylometazoline, 6-fold higher than phenylephrine, 10-fold higher than naphazoline and 100-fold higher than oxymetazoline. Stepwise regression of solute physicochemical properties identified melting point as the most significant predictor of flux. As ion-pairs with SA, ephedrine and naphazoline had similar fluxes (11.5 +/- 2.3 and 12.0 +/- 1.6 microg/cm2/h respectively), whereas tetrahydrozoline was approximately 3-fold slower. Corresponding fluxes of SA from the ion-pairs were 18.6 +/- 0.6, 7.8+/- 0.8 and 1.1 +/- 0.1 respectively. Transdermal transport of VC's is discussed. Epidermal retention of VCs and SA did not correspond to their molar ratio on application and confirmed that following partitioning into the stratum corneum, ion-pairs separate and further penetration is governed by individual solute characteristics.

  5. Theoretical Studies of N2-broadened Half-widths of H2O Lines Involving High j States

    NASA Technical Reports Server (NTRS)

    Ma, Q.; Tipping, R. H.; Lavrentieva, N. N.

    2012-01-01

    Based on the properties of the energy levels and wave functions of H2O states, one can categorize H2O lines into individually defined groups such that within the same group, the energy levels and the wave functions associated with two paired lines have an identity property while those associated with different pairs have a similarity property. Meanwhile, by thoroughly analyzing processes used to calculate N2-broadened half-widths, it was found that the 'Fourier series' of W(sup a)(sub L(sub 1))(sub K(sub 1))(sub K(sub 1)) (t; j(sub f) T(sub f) and W(sup a)(sub L(sub 1))(sub K(sub 1))(sub K(sub 1)) (t; j(sub i) T(sub i), and a factor P(sub 222) (j(sub f) T(sub f) j(sub i) T(sub i)) are the key items in the Robert-Bonamy formalism to distinguish contributions to ReS2(r(sub c)) among different transitions of j(sub f) T(sub f) - j(sub i). However, these items are completely determined by the energy levels and the wave functions associated with their initial and final states and they must bear the latter's features as well. Thus, it becomes obvious that for two paired lines in the same group, their calculated half-widths must be almost identical and the values associated with different pairs must vary smoothly as their ji values vary. Thus, the pair identity and the smooth variation rules are established within individual groups of lines. One can use these rules to screen half-width data listed in HITRAN and to improve the data accuracies.

  6. Tuning the tetrahedrality of the hydrogen-bonded network of water: Comparison of the effects of pressure and added salts

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Prasad, Saurav, E-mail: saurav7188@gmail.com, E-mail: cyz118212@chemistry.iitd.ac.in; Chakravarty, Charusita

    Experiments and simulations demonstrate some intriguing equivalences in the effect of pressure and electrolytes on the hydrogen-bonded network of water. Here, we examine the extent and nature of equivalence effects between pressure and salt concentration using relationships between structure, entropy, and transport properties based on two key ideas: first, the approximation of the excess entropy of the fluid by the contribution due to the atom-atom pair correlation functions and second, Rosenfeld-type excess entropy scaling relations for transport properties. We perform molecular dynamics simulations of LiCl–H{sub 2}O and bulk SPC/E water spanning the concentration range 0.025–0.300 molefraction of LiCl at 1more » atm and pressure range from 0 to 7 GPa, respectively. The temperature range considered was from 225 to 350 K for both the systems. To establish that the time-temperature-transformation behaviour of electrolyte solutions and water is equivalent, we use the additional observation based on our simulations that the pair entropy behaves as a near-linear function of pressure in bulk water and of composition in LiCl–H{sub 2}O. This allows for the alignment of pair entropy isotherms and allows for a simple mapping of pressure onto composition. Rosenfeld-scaling implies that pair entropy is semiquantitatively related to the transport properties. At a given temperature, equivalent state points in bulk H{sub 2}O and LiCl–H{sub 2}O (at 1 atm) are defined as those for which the pair entropy, diffusivity, and viscosity are nearly identical. The microscopic basis for this equivalence lies in the ability of both pressure and ions to convert the liquid phase into a pair-dominated fluid, as demonstrated by the O–O–O angular distribution within the first coordination shell of a water molecule. There are, however, sharp differences in local order and mechanisms for the breakdown of tetrahedral order by pressure and electrolytes. Increasing pressure increases orientational disorder within the first neighbour shell while addition of ions shifts local orientational order from tetrahedral to close-packed as water molecules get incorporated in ionic hydration shells. The variations in local order within the first hydration shell may underlie ion-specific effects, such as the Hofmeister series.« less

  7. Tuning the tetrahedrality of the hydrogen-bonded network of water: Comparison of the effects of pressure and added salts

    NASA Astrophysics Data System (ADS)

    Prasad, Saurav; Chakravarty, Charusita

    2016-06-01

    Experiments and simulations demonstrate some intriguing equivalences in the effect of pressure and electrolytes on the hydrogen-bonded network of water. Here, we examine the extent and nature of equivalence effects between pressure and salt concentration using relationships between structure, entropy, and transport properties based on two key ideas: first, the approximation of the excess entropy of the fluid by the contribution due to the atom-atom pair correlation functions and second, Rosenfeld-type excess entropy scaling relations for transport properties. We perform molecular dynamics simulations of LiCl-H2O and bulk SPC/E water spanning the concentration range 0.025-0.300 molefraction of LiCl at 1 atm and pressure range from 0 to 7 GPa, respectively. The temperature range considered was from 225 to 350 K for both the systems. To establish that the time-temperature-transformation behaviour of electrolyte solutions and water is equivalent, we use the additional observation based on our simulations that the pair entropy behaves as a near-linear function of pressure in bulk water and of composition in LiCl-H2O. This allows for the alignment of pair entropy isotherms and allows for a simple mapping of pressure onto composition. Rosenfeld-scaling implies that pair entropy is semiquantitatively related to the transport properties. At a given temperature, equivalent state points in bulk H2O and LiCl-H2O (at 1 atm) are defined as those for which the pair entropy, diffusivity, and viscosity are nearly identical. The microscopic basis for this equivalence lies in the ability of both pressure and ions to convert the liquid phase into a pair-dominated fluid, as demonstrated by the O-O-O angular distribution within the first coordination shell of a water molecule. There are, however, sharp differences in local order and mechanisms for the breakdown of tetrahedral order by pressure and electrolytes. Increasing pressure increases orientational disorder within the first neighbour shell while addition of ions shifts local orientational order from tetrahedral to close-packed as water molecules get incorporated in ionic hydration shells. The variations in local order within the first hydration shell may underlie ion-specific effects, such as the Hofmeister series.

  8. Common Coupled Fixed Point Theorems for Two Hybrid Pairs of Mappings under φ-ψ Contraction

    PubMed Central

    Handa, Amrish

    2014-01-01

    We introduce the concept of (EA) property and occasional w-compatibility for hybrid pair F : X × X → 2X and f : X → X. We also introduce common (EA) property for two hybrid pairs F, G : X → 2X and f, g : X → X. We establish some common coupled fixed point theorems for two hybrid pairs of mappings under φ-ψ contraction on noncomplete metric spaces. An example is also given to validate our results. We improve, extend and generalize several known results. The results of this paper generalize the common fixed point theorems for hybrid pairs of mappings and essentially contain fixed point theorems for hybrid pair of mappings. PMID:27340688

  9. Elliptic net and its cryptographic application

    NASA Astrophysics Data System (ADS)

    Muslim, Norliana; Said, Mohamad Rushdan Md

    2017-11-01

    Elliptic net is a generalization of elliptic divisibility sequence and in cryptography field, most cryptographic pairings that are based on elliptic curve such as Tate pairing can be improved by applying elliptic nets algorithm. The elliptic net is constructed by using n dimensional array of values in rational number satisfying nonlinear recurrence relations that arise from elliptic divisibility sequences. The two main properties hold in the recurrence relations are for all positive integers m>n, hm +nhm -n=hm +1hm -1hn2-hn +1hn -1hm2 and hn divides hm whenever n divides m. In this research, we discuss elliptic divisibility sequence associated with elliptic nets based on cryptographic perspective and its possible research direction.

  10. High-power, cladding-pumped all-fiber laser with selective transverse mode generation property.

    PubMed

    Li, Lei; Wang, Meng; Liu, Tong; Leng, Jinyong; Zhou, Pu; Chen, Jinbao

    2017-06-10

    We demonstrate, to the best of our knowledge, the first cladding-pumped all-fiber oscillator configuration with selective transverse mode generation based on a mode-selective fiber Bragg grating pair. Operating in the second-order (LP 11 ) mode, maximum output power of 4.2 W is obtained with slope efficiency of about 38%. This is the highest reported output power of single higher-order transverse mode generation in an all-fiber configuration. The intensity distribution profile and spectral evolution have also been investigated in this paper. Our work suggests the potential of realizing higher power with selective transverse mode operation based on a mode-selective fiber Bragg grating pair.

  11. All-optical diffractive/transmissive switch based on coupled cycloidal diffractive waveplates.

    PubMed

    Serak, Svetlana V; Hakobyan, Rafael S; Nersisyan, Sarik R; Tabiryan, Nelson V; White, Timothy J; Bunning, Timothy J; Steeves, Diane M; Kimball, Brian R

    2012-02-27

    Pairs of cycloidal diffractive waveplates can be used to doubly diffract or collinearly propagate laser radiation of the appropriate wavelength. The use of a dynamic phase retarder placed in between the pair can be utilized to switch between the two optical states. We present results from the implementation of an azo-based retarder whose optical properties can be modulated using light itself. We show fast and efficient switching between the two states for both CW and single nanosecond laser pulses of green radiation. Contrasts greater than 100:1 were achieved. The temporal response as a function of light intensity is presented and the optical switching is shown to be polarization independent.

  12. Monte Carlo investigation of thrust imbalance of solid rocket motor pairs

    NASA Technical Reports Server (NTRS)

    Sforzini, R. H.; Foster, W. A., Jr.

    1976-01-01

    The Monte Carlo method of statistical analysis is used to investigate the theoretical thrust imbalance of pairs of solid rocket motors (SRMs) firing in parallel. Sets of the significant variables are selected using a random sampling technique and the imbalance calculated for a large number of motor pairs using a simplified, but comprehensive, model of the internal ballistics. The treatment of burning surface geometry allows for the variations in the ovality and alignment of the motor case and mandrel as well as those arising from differences in the basic size dimensions and propellant properties. The analysis is used to predict the thrust-time characteristics of 130 randomly selected pairs of Titan IIIC SRMs. A statistical comparison of the results with test data for 20 pairs shows the theory underpredicts the standard deviation in maximum thrust imbalance by 20% with variability in burning times matched within 2%. The range in thrust imbalance of Space Shuttle type SRM pairs is also estimated using applicable tolerances and variabilities and a correction factor based on the Titan IIIC analysis.

  13. Isoscalar neutron-proton pairing and SU(4)-symmetry breaking in Gamow-Teller transitions

    NASA Astrophysics Data System (ADS)

    Kaneko, K.; Sun, Y.; Mizusaki, T.

    2018-05-01

    The isoscalar neutron-proton pairing is thought to be important for nuclei with equal number of protons and neutrons but its manifestation in structure properties remains to be understood. We investigate the Gamow-Teller (GT) transitions for the f7 /2-shell nuclei in large-scale shell-model calculations with the realistic Hamiltonian. We show that the isoscalar T =0 ,Jπ=1+ neutron-proton pairing interaction plays a decisive role for the concentration of GT strengths at the first-excited 11+ state in 42Sc, and that the suppression of these strengths in 46V, 50Mn, and 54Co is mainly caused by the spin-orbit force supplemented by the quadrupole-quadrupole interaction. Based on the good reproduction of the charge-exchange reaction data, we further analyze the interplay between the isoscalar and isovector pairing correlations. We conclude that even for the most promising A =42 nuclei where the SU(4) isoscalar-isovector-pairing symmetry is less broken, the probability of forming an isoscalar neutron-proton pairing condensation is less than 60% as compared to the expectation at the SU(4)-symmetry limit.

  14. Polyelectrolyte properties of single stranded DNA measured using SAXS and single molecule FRET: beyond the wormlike chain model

    PubMed Central

    Meisburger, Steve P.; Sutton, Julie L.; Chen, Huimin; Pabit, Suzette A.; Kirmizialtin, Serdal; Elber, Ron; Pollack, Lois

    2013-01-01

    Nucleic acids are highly charged polyelectrolytes that interact strongly with salt ions. Rigid, base-paired regions are successfully described with worm like chain models, but non base-paired single stranded regions have fundamentally different polymer properties because of their greater flexibility. Recently, attention has turned to single stranded nucleic acids due to the growing recognition of their biological importance, as well as the availability of sophisticated experimental techniques sensitive to the conformation of individual molecules. We investigate polyelectrolyte properties of poly(dT), an important and widely studied model system for flexible single stranded nucleic acids, in physiologically important mixed mono- and di-valent salt. We report measurements of the form factor and interparticle interactions using SAXS, end to end distances using smFRET, and number of excess ions using ASAXS. We present a coarse-grained model that accounts for flexibility, excluded volume, and electrostatic interactions in these systems. Predictions of the model are validated against experiment. We also discuss the state of all-atom, explicit solvent Molecular Dynamics simulations of poly(dT), the next step in understanding the complexities of ion interactions with these highly charged and flexible polymers. PMID:23606337

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bang, Yunkyu; Stewart, G. R.

    Although the pairing mechanism of Fe-based superconductors (FeSCs) has not yet been settled with consensus with regard to the pairing symmetry and the superconducting (SC) gap function, the vast majority of experiments support the existence of spin-singlet signchanging s-wave SC gaps on multi-bands (s±-wave state). This multi-band s±-wave state is a very unique gap state per se and displays numerous unexpected novel SC properties, such as a strong reduction of the coherence peak, non-trivial impurity effects, nodal-gap-like nuclear magnetic resonance signals, various Volovik effects in the specific heat (SH) and thermal conductivity, and anomalous scaling behaviors with a SH jumpmore » and condensation energy versus Tc, etc. In particular, many of these non-trivial SC properties can easily be mistaken as evidence for a nodal-gap state such as a d-wave gap. In this review, we provide detailed explanations of the theoretical principles for the various non-trivial SC properties of the s±-wave pairing state, and then critically compare the theoretical predictions with experiments on FeSCs. This will provide a pedagogical overview of to what extent we can coherently understand the wide range of different experiments on FeSCs within the s±-wave gap model.« less

  16. Modeling the mechanical properties of DNA nanostructures.

    PubMed

    Arbona, Jean Michel; Aimé, Jean-Pierre; Elezgaray, Juan

    2012-11-01

    We discuss generalizations of a previously published coarse-grained description [Mergell et al., Phys. Rev. E 68, 021911 (2003)] of double stranded DNA (dsDNA). The model is defined at the base-pair level and includes the electrostatic repulsion between neighbor helices. We show that the model reproduces mechanical and elastic properties of several DNA nanostructures (DNA origamis). We also show that electrostatic interactions are necessary to reproduce atomic force microscopy measurements on planar DNA origamis.

  17. Computer simulation of surface and film processes

    NASA Technical Reports Server (NTRS)

    Tiller, W. A.

    1981-01-01

    A molecular dynamics technique based upon Lennard-Jones type pair interactions is used to investigate time-dependent as well as equilibrium properties. The case study deals with systems containing Si and O atoms. In this case a more involved potential energy function (PEF) is employed and the system is simulated via a Monte-Carlo procedure. This furnishes the equilibrium properties of the system at its interfaces and surfaces as well as in the bulk.

  18. Design of multi-wavelength tunable filter based on Lithium Niobate

    NASA Astrophysics Data System (ADS)

    Zhang, Ailing; Yao, Yuan; Zhang, Yue; Song, Hongyun

    2018-05-01

    A multi-wavelength tunable filter is designed. It consists of multiple waveguides among multiple waveguide gratings. A pair of electrodes were placed on both sides of each waveguide. The tunable filter uses the electro-optic effect of Lithium Niobate to tune the phase caused by each waveguide. Consequently, the wavelength and wavelength spacing of the filter are tuned by changing external voltages added on the electrode pairs. The tunable property of the filter is analyzed by phase matching condition and transfer-matrix method. Numerical results show that not only multiple wavelengths with narrow bandwidth are tuned with nearly equal spacing by synchronously changing the voltages added on all electrode pairs, but also the number of wavelengths is determined by the number of phase shifts caused by electrode pairs. Furthermore, due to the electro-optic effect of Lithium Niobate, the tuning speed of the filter can reach the order of ns.

  19. Corresponding-states laws for protein solutions.

    PubMed

    Katsonis, Panagiotis; Brandon, Simon; Vekilov, Peter G

    2006-09-07

    The solvent around protein molecules in solutions is structured and this structuring introduces a repulsion in the intermolecular interaction potential at intermediate separations. We use Monte Carlo simulations with isotropic, pair-additive systems interacting with such potentials. We test if the liquid-liquid and liquid-solid phase lines in model protein solutions can be predicted from universal curves and a pair of experimentally determined parameters, as done for atomic and colloid materials using several laws of corresponding states. As predictors, we test three properties at the critical point for liquid-liquid separation: temperature, as in the original van der Waals law, the second virial coefficient, and a modified second virial coefficient, all paired with the critical volume fraction. We find that the van der Waals law is best obeyed and appears more general than its original formulation: A single universal curve describes all tested nonconformal isotropic pair-additive systems. Published experimental data for the liquid-liquid equilibrium for several proteins at various conditions follow a single van der Waals curve. For the solid-liquid equilibrium, we find that no single system property serves as its predictor. We go beyond corresponding-states correlations and put forth semiempirical laws, which allow prediction of the critical temperature and volume fraction solely based on the range of attraction of the intermolecular interaction potential.

  20. Electron attraction mediated by Coulomb repulsion.

    PubMed

    Hamo, A; Benyamini, A; Shapir, I; Khivrich, I; Waissman, J; Kaasbjerg, K; Oreg, Y; von Oppen, F; Ilani, S

    2016-07-21

    One of the defining properties of electrons is their mutual Coulomb repulsion. However, in solids this basic property may change; for example, in superconductors, the coupling of electrons to lattice vibrations makes the electrons attract one another, leading to the formation of bound pairs. Fifty years ago it was proposed that electrons can be made attractive even when all of the degrees of freedom in the solid are electronic, by exploiting their repulsion from other electrons. This attraction mechanism, termed 'excitonic', promised to achieve stronger and more exotic superconductivity. Yet, despite an extensive search, experimental evidence for excitonic attraction has yet to be found. Here we demonstrate this attraction by constructing, from the bottom up, the fundamental building block of the excitonic mechanism. Our experiments are based on quantum devices made from pristine carbon nanotubes, combined with cryogenic precision manipulation. Using this platform, we demonstrate that two electrons can be made to attract each other using an independent electronic system as the 'glue' that mediates attraction. Owing to its tunability, our system offers insights into the underlying physics, such as the dependence of the emergent attraction on the underlying repulsion, and the origin of the pairing energy. We also demonstrate transport signatures of excitonic pairing. This experimental demonstration of excitonic pairing paves the way for the design of exotic states of matter.

  1. Electron attraction mediated by Coulomb repulsion

    NASA Astrophysics Data System (ADS)

    Hamo, A.; Benyamini, A.; Shapir, I.; Khivrich, I.; Waissman, J.; Kaasbjerg, K.; Oreg, Y.; von Oppen, F.; Ilani, S.

    2016-07-01

    One of the defining properties of electrons is their mutual Coulomb repulsion. However, in solids this basic property may change; for example, in superconductors, the coupling of electrons to lattice vibrations makes the electrons attract one another, leading to the formation of bound pairs. Fifty years ago it was proposed that electrons can be made attractive even when all of the degrees of freedom in the solid are electronic, by exploiting their repulsion from other electrons. This attraction mechanism, termed ‘excitonic’, promised to achieve stronger and more exotic superconductivity. Yet, despite an extensive search, experimental evidence for excitonic attraction has yet to be found. Here we demonstrate this attraction by constructing, from the bottom up, the fundamental building block of the excitonic mechanism. Our experiments are based on quantum devices made from pristine carbon nanotubes, combined with cryogenic precision manipulation. Using this platform, we demonstrate that two electrons can be made to attract each other using an independent electronic system as the ‘glue’ that mediates attraction. Owing to its tunability, our system offers insights into the underlying physics, such as the dependence of the emergent attraction on the underlying repulsion, and the origin of the pairing energy. We also demonstrate transport signatures of excitonic pairing. This experimental demonstration of excitonic pairing paves the way for the design of exotic states of matter.

  2. Genetic code, hamming distance and stochastic matrices.

    PubMed

    He, Matthew X; Petoukhov, Sergei V; Ricci, Paolo E

    2004-09-01

    In this paper we use the Gray code representation of the genetic code C=00, U=10, G=11 and A=01 (C pairs with G, A pairs with U) to generate a sequence of genetic code-based matrices. In connection with these code-based matrices, we use the Hamming distance to generate a sequence of numerical matrices. We then further investigate the properties of the numerical matrices and show that they are doubly stochastic and symmetric. We determine the frequency distributions of the Hamming distances, building blocks of the matrices, decomposition and iterations of matrices. We present an explicit decomposition formula for the genetic code-based matrix in terms of permutation matrices, which provides a hypercube representation of the genetic code. It is also observed that there is a Hamiltonian cycle in a genetic code-based hypercube.

  3. Differences in Tribological Behaviors upon Switching Fixed and Moving Materials of Tribo-pairs including Metal and Polymer.

    PubMed

    Xu, Aijie; Tian, Pengyi; Wen, Shizhu; Guo, Fei; Hu, Yueqiang; Jia, Wenpeng; Dong, Conglin; Tian, Yu

    2017-10-12

    The coefficient of friction (COF) between two materials is usually believed to be an intrinsic property of the materials themselves. In this study, metals of stainless steel (304) and brass (H62), and polymers of polypropylene (PP) and polytetrafluoroethylene (PTFE) were tested on a standard ball-on-three-plates test machine. Significantly different tribological behaviors were observed when fixed and moving materials of tribo-pairs (metal/polymer) were switched. As an example, under the same applied load and rotating speed, the COF (0.49) between a rotating PP ball and three fixed H62 plates was approximately 2.3 times higher than that between switched materials of tribo-pairs. Meanwhile, the COF between H62 and PTFE was relatively stable. The unexpected tribological behaviors were ascribed to the thermal and mechanical properties of tribo-pairs. Theoretical analysis revealed that the differences in the maximum local temperature between switching the fixed and moving materials of tribo-pairs were consistent with the differences in the tested COF. This result indicated the precise prediction of the COF of two materials is complexcity, and that thermal and mechanical properties should be properly considered in designing tribo-pairs, because these properties may significantly affect tribological performance.

  4. MAJOR-MERGER GALAXY PAIRS AT Z = 0: DUST PROPERTIES AND COMPANION MORPHOLOGY

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Domingue, Donovan L.; Ronca, Joseph; Hill, Emily

    We present an analysis of dust properties of a sample of close major-merger galaxy pairs selected by K {sub s} magnitude and redshift. The pairs represent the two populations of spiral–spiral (S+S) and mixed morphology spiral–elliptical (S+E). The Code Investigating GALaxy Emission software is used to fit dust models to the Two Micron All Sky Survey, Wide-Field Infrared Survey Explorer , and Herschel flux density measurements, and to derive the parameters describing the polycyclic aromatic hydrocarbons contribution, interstellar radiation field, and photodissociation regions. Model fits verify our previous Spitzer Space Telescope analysis that S+S and S+E pairs do not havemore » the same level of enhancement of star formation and differ in dust composition. The spirals of mixed-morphology galaxy pairs do not exhibit the enhancements in interstellar radiation field and therefore dust temperature for spirals in S+S pairs in contrast to what would be expected according to standard models of gas redistribution due to encounter torques. This suggests the importance of the companion environment/morphology in determining the dust properties of a spiral galaxy in a close major-merger pair.« less

  5. Support Vector Machine-based classification of protein folds using the structural properties of amino acid residues and amino acid residue pairs.

    PubMed

    Shamim, Mohammad Tabrez Anwar; Anwaruddin, Mohammad; Nagarajaram, H A

    2007-12-15

    Fold recognition is a key step in the protein structure discovery process, especially when traditional sequence comparison methods fail to yield convincing structural homologies. Although many methods have been developed for protein fold recognition, their accuracies remain low. This can be attributed to insufficient exploitation of fold discriminatory features. We have developed a new method for protein fold recognition using structural information of amino acid residues and amino acid residue pairs. Since protein fold recognition can be treated as a protein fold classification problem, we have developed a Support Vector Machine (SVM) based classifier approach that uses secondary structural state and solvent accessibility state frequencies of amino acids and amino acid pairs as feature vectors. Among the individual properties examined secondary structural state frequencies of amino acids gave an overall accuracy of 65.2% for fold discrimination, which is better than the accuracy by any method reported so far in the literature. Combination of secondary structural state frequencies with solvent accessibility state frequencies of amino acids and amino acid pairs further improved the fold discrimination accuracy to more than 70%, which is approximately 8% higher than the best available method. In this study we have also tested, for the first time, an all-together multi-class method known as Crammer and Singer method for protein fold classification. Our studies reveal that the three multi-class classification methods, namely one versus all, one versus one and Crammer and Singer method, yield similar predictions. Dataset and stand-alone program are available upon request.

  6. New size-expanded RNA nucleobase analogs: a detailed theoretical study.

    PubMed

    Zhang, Laibin; Zhang, Zhenwei; Ren, Tingqi; Tian, Jianxiang; Wang, Mei

    2015-04-05

    Fluorescent nucleobase analogs have attracted much attention in recent years due to their potential applications in nucleic acids research. In this work, four new size-expanded RNA base analogs were computationally designed and their structural, electronic, and optical properties are investigated by means of DFT calculations. The results indicate that these analogs can form stable Watson-Crick base pairs with natural counterparts and they have smaller ionization potentials and HOMO-LUMO gaps than natural ones. Particularly, the electronic absorption spectra and fluorescent emission spectra are calculated. The calculated excitation maxima are greatly red-shifted compared with their parental and natural bases, allowing them to be selectively excited. In gas phase, the fluorescence from them would be expected to occur around 526, 489, 510, and 462 nm, respectively. The influences of water solution and base pairing on the relevant absorption spectra of these base analogs are also examined. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Modeling uncertainty and correlation in soil properties using Restricted Pairing and implications for ensemble-based hillslope-scale soil moisture and temperature estimation

    NASA Astrophysics Data System (ADS)

    Flores, A. N.; Entekhabi, D.; Bras, R. L.

    2007-12-01

    Soil hydraulic and thermal properties (SHTPs) affect both the rate of moisture redistribution in the soil column and the volumetric soil water capacity. Adequately constraining these properties through field and lab analysis to parameterize spatially-distributed hydrology models is often prohibitively expensive. Because SHTPs vary significantly at small spatial scales individual soil samples are also only reliably indicative of local conditions, and these properties remain a significant source of uncertainty in soil moisture and temperature estimation. In ensemble-based soil moisture data assimilation, uncertainty in the model-produced prior estimate due to associated uncertainty in SHTPs must be taken into account to avoid under-dispersive ensembles. To treat SHTP uncertainty for purposes of supplying inputs to a distributed watershed model we use the restricted pairing (RP) algorithm, an extension of Latin Hypercube (LH) sampling. The RP algorithm generates an arbitrary number of SHTP combinations by sampling the appropriate marginal distributions of the individual soil properties using the LH approach, while imposing a target rank correlation among the properties. A previously-published meta- database of 1309 soils representing 12 textural classes is used to fit appropriate marginal distributions to the properties and compute the target rank correlation structure, conditioned on soil texture. Given categorical soil textures, our implementation of the RP algorithm generates an arbitrarily-sized ensemble of realizations of the SHTPs required as input to the TIN-based Realtime Integrated Basin Simulator with vegetation dynamics (tRIBS+VEGGIE) distributed parameter ecohydrology model. Soil moisture ensembles simulated with RP- generated SHTPs exhibit less variance than ensembles simulated with SHTPs generated by a scheme that neglects correlation among properties. Neglecting correlation among SHTPs can lead to physically unrealistic combinations of parameters that exhibit implausible hydrologic behavior when input to the tRIBS+VEGGIE model.

  8. Superconducting properties of copper oxide high-temperature superconductors

    PubMed Central

    Chen, Guanhua; Langlois, Jean-Marc; Guo, Yuejin; Goddard, William A.

    1989-01-01

    The equations for the magnon pairing theory of high-temperature copper-oxide-based superconductors are solved and used to calculate several properties, leading to results for specific heat and critical magnetic fields consistent with experimental results. In addition, the theory suggests an explanation of why there are two sets of transition temperatures (Tc ≈ 90 K and Tc ≈ 55 K) for the Y1Ba2Cu3O6+x class of superconductors. It also provides an explanation of why La2-xSrxCuO4 is a superconductor for only a small range of x (and suggests an experiment to independently test the theory). These results provide support for the magnon pairing theory of high-temperature superconductors. On the basis of the theory, some suggestions are made for improving these materials. PMID:16594038

  9. Verbal Discrimination: Re-pairing, Language Frequency, and Associative Properties of the Stimuli

    ERIC Educational Resources Information Center

    Lovelace, Eugene A.; Bansal, Leslie

    1973-01-01

    The present paper reports the results of four experiments on verbal discrimination learning. These experiments manipulated the associative properties and the language frequency of stimuli, as well as the pairings of "right' and "wrong' items within a list. (Author)

  10. Modeling Spin Testing Using Location Specific Material Properties

    DTIC Science & Technology

    2012-04-01

    taken to be b. is the antiphase boundary energy (=0.20 J/m2). M is the Taylor factor of fcc (=3). 4. shearing/bowing of tertiary strong pair coupling...crystal orientation can be represented by an isotropic strength knockdown factor of 2/3 based on the reciprocal product of the polycrystal Taylor factor...Tensile and Creep Property Characterization of Potential Brayton Cycle Impeller and Duct Materials" (NASA/TM-2006-204110; Gabb, T; Gayda, J 5 Tresa

  11. Submolecular Structure and Orientation of Oligonucleotide Duplexes Tethered to Gold Electrodes Probed by Infrared Reflection Absorption Spectroscopy: Effect of the Electrode Potentials.

    PubMed

    Kékedy-Nagy, László; Ferapontova, Elena E; Brand, Izabella

    2017-02-23

    Unique electronic and ligand recognition properties of the DNA double helix provide basis for DNA applications in biomolecular electronic and biosensor devices. However, the relation between the structure of DNA at electrified interfaces and its electronic properties is still not well understood. Here, potential-driven changes in the submolecular structure of DNA double helices composed of either adenine-thymine (dAdT) 25 or cytosine-guanine (dGdC) 20 base pairs tethered to the gold electrodes are for the first time analyzed by in situ polarization modulation infrared reflection absorption spectroscopy (PM IRRAS) performed under the electrochemical control. It is shown that the conformation of the DNA duplexes tethered to gold electrodes via the C 6 alkanethiol linker strongly depends on the nucleic acid sequence composition. The tilt of purine and pyrimidine rings of the complementary base pairs (dAdT and dGdC) depends on the potential applied to the electrode. By contrast, neither the conformation nor orientation of the ionic in character phosphate-sugar backbone is affected by the electrode potentials. At potentials more positive than the potential of zero charge (pzc), a gradual tilting of the double helix is observed. In this tilted orientation, the planes of the complementary purine and pyrimidine rings lie ideally parallel to each other. These potentials do not affect the integral stability of the DNA double helix at the charged interface. At potentials more negative than the pzc, DNA helices adopt a vertical to the gold surface orientation. Tilt of the purine and pyrimidine rings depends on the composition of the double helix. In monolayers composed of (dAdT) 25 molecules the rings of the complementary base pairs lie parallel to each other. By contrast, the tilt of purine and pyrimidine rings in (dGdC) 20 helices depends on the potential applied to the electrode. Such potential-induced mobility of the complementary base pairs can destabilize the helix structure at a submolecular level. These pioneer results on the potential-driven changes in the submolecular structure of double stranded DNA adsorbed on conductive supports contribute to further understanding of the potential-driven sequence-specific electronic properties of surface-tethered oligonucleotides.

  12. Semantic Entity Pairing for Improved Data Validation and Discovery

    NASA Astrophysics Data System (ADS)

    Shepherd, Adam; Chandler, Cyndy; Arko, Robert; Chen, Yanning; Krisnadhi, Adila; Hitzler, Pascal; Narock, Tom; Groman, Robert; Rauch, Shannon

    2014-05-01

    One of the central incentives for linked data implementations is the opportunity to leverage the rich logic inherent in structured data. The logic embedded in semantic models can strengthen capabilities for data discovery and data validation when pairing entities from distinct, contextually-related datasets. The creation of links between the two datasets broadens data discovery by using the semantic logic to help machines compare similar entities and properties that exist on different levels of granularity. This semantic capability enables appropriate entity pairing without making inaccurate assertions as to the nature of the relationship. Entity pairing also provides a context to accurately validate the correctness of an entity's property values - an exercise highly valued by data management practices who seek to ensure the quality and correctness of their data. The Biological and Chemical Oceanography Data Management Office (BCO-DMO) semantically models metadata surrounding oceanographic researchcruises, but other sources outside of BCO-DMO exist that also model metadata about these same cruises. For BCO-DMO, the process of successfully pairing its entities to these sources begins by selecting sources that are decidedly trustworthy and authoritative for the modeled concepts. In this case, the Rolling Deck to Repository (R2R) program has a well-respected reputation among the oceanographic research community, presents a data context that is uniquely different and valuable, and semantically models its cruise metadata. Where BCO-DMO exposes the processed, analyzed data products generated by researchers, R2R exposes the raw shipboard data that was collected on the same research cruises. Interlinking these cruise entities expands data discovery capabilities but also allows for validating the contextual correctness of both BCO-DMO's and R2R's cruise metadata. Assessing the potential for a link between two datasets for a similar entity consists of aligning like properties and deciding on the appropriate semantic markup to describe the link. This highlights the desire for research organizations like BCO-DMO and R2R to ensure the complete accuracy of their exposed metadata, as it directly reflects on their reputations as successful and trustworthy source of research data. Therefore, data validation reaches beyond simple syntax of property values into contextual correctness. As a human process, this is a time-intensive task that does not scale well for finite human and funding resources. Therefore, to assess contextual correctness across datasets at different levels of granularity, BCO-DMO is developing a system that employs semantic technologies to aid the human process by organizing potential links and calculating a confidence coefficient as to the correctness of the potential pairing based on the distance between certain entity property values. The system allows humans to quickly scan potential links and their confidence coefficients for asserting persistence and correcting and investigating misaligned entity property values.

  13. Probing and Manipulating Ultracold Fermi Superfluids

    NASA Astrophysics Data System (ADS)

    Jiang, Lei

    Ultracold Fermi gas is an exciting field benefiting from atomic physics, optical physics and condensed matter physics. It covers many aspects of quantum mechanics. Here I introduce some of my work during my graduate study. We proposed an optical spectroscopic method based on electromagnetically-induced transparency (EIT) as a generic probing tool that provides valuable insights into the nature of Fermi paring in ultracold Fermi gases of two hyperfine states. This technique has the capability of allowing spectroscopic response to be determined in a nearly non-destructive manner and the whole spectrum may be obtained by scanning the probe laser frequency faster than the lifetime of the sample without re-preparing the atomic sample repeatedly. Both quasiparticle picture and pseudogap picture are constructed to facilitate the physical explanation of the pairing signature in the EIT spectra. Motivated by the prospect of realizing a Fermi gas of 40K atoms with a synthetic non-Abelian gauge field, we investigated theoretically BEC-HCS crossover physics in the presence of a Rashba spin-orbit coupling in a system of two-component Fermi gas with and without a Zeeman field that breaks the population balance. A new bound state (Rashba pair) emerges because of the spin-orbit interaction. We studied the properties of Rashba pairs using a standard pair fluctuation theory. As the two-fold spin degeneracy is lifted by spin-orbit interaction, bound pairs with mixed singlet and triplet pairings (referred to as rashbons) emerge, leading to an anisotropic superfluid. We discussed in detail the experimental signatures for observing the condensation of Rashba pairs by calculating various physical observables which characterize the properties of the system and can be measured in experiment. The role of impurities as experimental probes in the detection of quantum material properties is well appreciated. Here we studied the effect of a single classical impurity in trapped ultracold Fermi superfluids. Although a non-magnetic impurity does not change macroscopic properties of s-wave Fermi superfluids, depending on its shape and strength, a magnetic impurity can induce single or multiple mid-gap bound states. The multiple mid-gap states could coincide with the development of a Fulde-Ferrell-Larkin-Ovchinnikov (FFLO) phase within the superfluid. As an analog of the Scanning Tunneling Microscope, we proposed a modified radio frequency spectroscopic method to measure the focal density of states which can be employed to detect these states and other quantum phases of cold atoms. A key result of our self consistent Bogoliubov-de Gennes calculations is that a magnetic impurity can controllably induce an FFLO state at currently accessible experimental parameters.

  14. Carbon Nanotube-based Sensor and Method for Continually Sensing Changes in a Structure

    NASA Technical Reports Server (NTRS)

    Jordan, Jeffry D. (Inventor); Watkins, Anthony Neal (Inventor); Oglesby, Donald M. (Inventor); Ingram, JoAnne L. (Inventor)

    2007-01-01

    A sensor has a plurality of carbon nanotube (CNT)-based conductors operatively positioned on a substrate. The conductors are arranged side-by-side, such as in a substantially parallel relationship to one another. At least one pair of spaced-apart electrodes is coupled to opposing ends of the conductors. A portion of each of the conductors spanning between each pair of electrodes comprises a plurality of carbon nanotubes arranged end-to-end and substantially aligned along an axis. Because a direct correlation exists between resistance of a carbon nanotube and carbon nanotube strain, changes experienced by the portion of the structure to which the sensor is coupled induce a change in electrical properties of the conductors.

  15. The Kadomtsev{endash}Petviashvili equation as a source of integrable model equations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maccari, A.

    1996-12-01

    A new integrable and nonlinear partial differential equation (PDE) in 2+1 dimensions is obtained, by an asymptotically exact reduction method based on Fourier expansion and spatiotemporal rescaling, from the Kadomtsev{endash}Petviashvili equation. The integrability property is explicitly demonstrated, by exhibiting the corresponding Lax pair, that is obtained by applying the reduction technique to the Lax pair of the Kadomtsev{endash}Petviashvili equation. This model equation is likely to be of applicative relevance, because it may be considered a consistent approximation of a large class of nonlinear evolution PDEs. {copyright} {ital 1996 American Institute of Physics.}

  16. Theoretical Probing of Weak Anion-Cation Interactions in Certain Pyridinium-Based Ionic Liquid Ion Pairs and the Application of Molecular Electrostatic Potential in Their Ionic Crystal Density Determination: A Comparative Study Using Density Functional Approach.

    PubMed

    Joseph, Aswathy; Thomas, Vibin Ipe; Żyła, Gaweł; Padmanabhan, A S; Mathew, Suresh

    2018-01-11

    A comprehensive study on the structure, nature of interaction, and properties of six ionic pairs of 1-butylpyridinium and 1-butyl-4-methylpyridinium cations in combination with tetrafluoroborate (BF 4 - ), chloride (Cl - ), and bromide (Br - ) anions have been carried out using density functional theory (DFT). The anion-cation interaction energy (ΔE int ), thermochemistry values, theoretical band gap, molecular orbital energy order, DFT-based chemical activity descriptors [chemical potential (μ), chemical hardness (η), and electrophilicity index (ω)], and distribution of density of states (DOS) of these ion pairs were investigated. The ascendancy of the -CH 3 substituent at the fourth position of the 1-butylpyridinium cation ring on the values of ΔE int , theoretical band gap and chemical activity descriptors was evaluated. The ΔE int values were negative for all six ion pairs and were highest for Cl - containing ion pairs. The theoretical band gap value after -CH 3 substitution increased from 3.78 to 3.96 eV (for Cl - ) and from 2.74 to 2.88 eV (for Br - ) and decreased from 4.9 to 4.89 eV (for BF 4 - ). Ion pairs of BF 4 - were more susceptible to charge transfer processes as inferred from their significantly high η values and comparatively small difference in ω value after -CH 3 substitution. The change in η and μ values due to the -CH 3 substituent is negligibly small in all cases except for the ion pairs of Cl - . Critical-point (CP) analyses were carried out to investigate the AIM topological parameters at the interionic bond critical points (BCPs). The RDG isosurface analysis indicated that the anion-cation interaction was dominated by strong H cat ···X ani and C cat ···X ani interactions in ion pairs of Cl - and Br - whereas a weak van der Waal's effect dominated in ion pairs of BF 4 - . The molecular electrostatic potential (MESP)-based parameter ΔΔV min measuring the anion-cation interaction strength showed a good linear correlation with ΔE int for all 1-butylpyridinium ion pairs (R 2 = 0.9918). The ionic crystal density values calculated by using DFT-based MESP showed only slight variations from experimentally reported values.

  17. Duality of two pairs of double-walled nanotubes consisting of S=1 and S=3/2 spins probed by means of a quantum simulation approach

    NASA Astrophysics Data System (ADS)

    Liu, Zhaosen; Ian, Hou

    2017-01-01

    Using a quantum simulation approach, we investigate in the present work the spontaneous magnetic properties of two pairs of double-walled cylindrical nanotubes consisting of different spins. Our simulated magnetic and thermodynamic properties for each pair of them are precisely identical, exhibiting a fascinating property of the nature world and demonstrating the correctness of our simulation approach. The second pair of nanotubes are frustrated, two magnetic phases of distinct spin configurations appear in the low temperature region, but only the inner layer consisting of small spins is frustrated evidently, its magnetization is considerably suppressed in the high temperature phase. Moreover, the nanosystems exhibit typical Ising-like behavior due to the uniaxial anisotropy along the z-direction, and evident finite-size effects as well.

  18. Orotidine-Containing RNA: Implications for the Hierarchical Selection (Systems Chemistry Emergence) of RNA.

    PubMed

    Kim, Eun-Kyong; Martin, Vincent; Krishnamurthy, Ramanarayanan

    2017-09-12

    The prebiotic synthesis of canonical nucleobases from HCN is a cornerstone for the RNA world hypothesis. However, their role in the primordial pathways to RNA is still debated. The very same process starting from HCN also gives rise to orotic acid, which (via orotidine) plays a crucial role in extant biology in the de novo synthesis of uridine and cytidine, the informational base-pairs in RNA. However, orotidine itself is absent in RNA. Given the prebiotic and biological relevance of orotic acid vis-à-vis uracil, we investigated orotidine-containing RNA oligonucleotides and show that they have severely compromised base-pairing properties. While not unexpected, these results suggest that the emergence of extant RNA cannot just be a consequence of the plausible prebiotic formation of its chemical constituents/building blocks. In combination with other investigations on alternative prebiotic nucleobases, sugars, and linkers, these findings imply that the selection of the components of extant RNA occurred at a higher hierarchical level of an oligomer/polymer based on its functional properties-pointing to a systems chemistry emergence of RNA from a library of precursors. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. The Radical Pair Mechanism and the Avian Chemical Compass: Quantum Coherence and Entanglement

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Yiteng; Kais, Sabre; Berman, Gennady Petrovich

    2015-02-02

    We review the spin radical pair mechanism which is a promising explanation of avian navigation. This mechanism is based on the dependence of product yields on 1) the hyperfine interaction involving electron spins and neighboring nuclear spins and 2) the intensity and orientation of the geomagnetic field. One surprising result is that even at ambient conditions quantum entanglement of electron spins can play an important role in avian magnetoreception. This review describes the general scheme of chemical reactions involving radical pairs generated from singlet and triplet precursors; the spin dynamics of the radical pairs; and the magnetic field dependence ofmore » product yields caused by the radical pair mechanism. The main part of the review includes a description of the chemical compass in birds. We review: the general properties of the avian compass; the basic scheme of the radical pair mechanism; the reaction kinetics in cryptochrome; quantum coherence and entanglement in the avian compass; and the effects of noise. We believe that the quantum avian compass can play an important role in avian navigation and can also provide the foundation for a new generation of sensitive and selective magnetic-sensing nano-devices.« less

  20. Tunneling spectroscopy of close-spaced dangling-bond pairs in Si(001):H

    PubMed Central

    Engelund, Mads; Zuzak, Rafał; Godlewski, Szymon; Kolmer, Marek; Frederiksen, Thomas; García-Lekue, Aran; Sánchez-Portal, Daniel; Szymonski, Marek

    2015-01-01

    We present a combined experimental and theoretical study of the electronic properties of close-spaced dangling-bond (DB) pairs in a hydrogen-passivated Si(001):H p-doped surface. Two types of DB pairs are considered, called “cross” and “line” structures. Our scanning tunneling spectroscopy (STS) data show that, although the spectra taken over different DBs in each pair exhibit a remarkable resemblance, they appear shifted by a constant energy that depends on the DB-pair type. This spontaneous asymmetry persists after repeated STS measurements. By comparison with density functional theory (DFT) calculations, we demonstrate that the magnitude of this shift and the relative position of the STS peaks can be explained by distinct charge states for each DB in the pair. We also explain how the charge state is modified by the presence of the scanning tunneling microscopy (STM) tip and the applied bias. Our results indicate that, using the STM tip, it is possible to control the charge state of individual DBs in complex structures, even if they are in close proximity. This observation might have important consequences for the design of electronic circuits and logic gates based on DBs in passivated silicon surfaces. PMID:26404520

  1. Resolving the structure of Ti 3C 2T x MXenes through multilevel structural modeling of the atomic pair distribution function

    DOE PAGES

    Wesolowski, David J.; Wang, Hsiu -Wen; Page, Katharine L.; ...

    2015-12-08

    MXenes are a recently discovered family of two-dimensional (2D) early transition metal carbides and carbonitrides, which have already shown many attractive properties and great promise in energy storage and many other applications. But, a complex surface chemistry and small coherence length have been obstacles in some applications of MXenes, also limiting the accuracy of predictions of their properties. In this study, we describe and benchmark a novel way of modeling layered materials with real interfaces (diverse surface functional groups and stacking order between the adjacent monolayers) against experimental data. The structures of three kinds of Ti 3C 2T x MXenesmore » (T stands for surface terminating species, including O, OH, and F) produced under different synthesis conditions were resolved for the first time using atomic pair distribution function obtained by high-quality neutron total scattering. We present the true nature of the material can be easily captured with the sensitivity of neutron scattering to the surface species of interest and the detailed “third-generation” structure model. The modeling approach leads to new understanding of MXene structural properties and can replace the currently used idealized models in predictions of a variety of physical, chemical, and functional properties of Ti 3C 2-based MXenes. Moreover, the developed models can be employed to guide the design of new MXene materials with selected surface termination and controlled contact angle, catalytic, optical, electrochemical, and other properties. Finally, we suggest that the multilevel structural modeling should form the basis for a generalized methodology on modeling diffraction and pair distribution function data for 2D and layered materials.« less

  2. Freezing transition of the random bond RNA model: Statistical properties of the pairing weights

    NASA Astrophysics Data System (ADS)

    Monthus, Cécile; Garel, Thomas

    2007-03-01

    To characterize the pairing specificity of RNA secondary structures as a function of temperature, we analyze the statistics of the pairing weights as follows: for each base (i) of the sequence of length N , we consider the (N-1) pairing weights wi(j) with the other bases (j≠i) of the sequence. We numerically compute the probability distributions P1(w) of the maximal weight wimax=maxj[wi(j)] , the probability distribution Π(Y2) of the parameter Y2(i)=∑jwi2(j) , as well as the average values of the moments Yk(i)=∑jwik(j) . We find that there are two important temperatures TcTgap , the distribution P1(w) vanishes at some value w0(T)<1 , and accordingly the moments Yk(i)¯ decay exponentially as [w0(T)]k in k . For T

  3. Ion-ion dynamic structure factor, acoustic modes, and equation of state of two-temperature warm dense aluminum

    NASA Astrophysics Data System (ADS)

    Harbour, L.; Förster, G. D.; Dharma-wardana, M. W. C.; Lewis, Laurent J.

    2018-04-01

    The ion-ion dynamical structure factor and the equation of state of warm dense aluminum in a two-temperature quasiequilibrium state, with the electron temperature higher than the ion temperature, are investigated using molecular-dynamics simulations based on ion-ion pair potentials constructed from a neutral pseudoatom model. Such pair potentials based on density functional theory are parameter-free and depend directly on the electron temperature and indirectly on the ion temperature, enabling efficient computation of two-temperature properties. Comparison with ab initio simulations and with other average-atom calculations for equilibrium aluminum shows good agreement, justifying a study of quasiequilibrium situations. Analyzing the van Hove function, we find that ion-ion correlations vanish in a time significantly smaller than the electron-ion relaxation time so that dynamical properties have a physical meaning for the quasiequilibrium state. A significant increase in the speed of sound is predicted from the modification of the dispersion relation of the ion acoustic mode as the electron temperature is increased. The two-temperature equation of state including the free energy, internal energy, and pressure is also presented.

  4. Border and surface tracing--theoretical foundations.

    PubMed

    Brimkov, Valentin E; Klette, Reinhard

    2008-04-01

    In this paper we define and study digital manifolds of arbitrary dimension, and provide (in particular)a general theoretical basis for curve or surface tracing in picture analysis. The studies involve properties such as one-dimensionality of digital curves and (n-1)-dimensionality of digital hypersurfaces that makes them discrete analogs of corresponding notions in continuous topology. The presented approach is fully based on the concept of adjacency relation and complements the concept of dimension as common in combinatorial topology. This work appears to be the first one on digital manifolds based ona graph-theoretical definition of dimension. In particular, in the n-dimensional digital space, a digital curve is a one-dimensional object and a digital hypersurface is an (n-1)-dimensional object, as it is in the case of curves and hypersurfaces in the Euclidean space. Relying on the obtained properties of digital hypersurfaces, we propose a uniform approach for studying good pairs defined by separations and obtain a classification of good pairs in arbitrary dimension. We also discuss possible applications of the presented definitions and results.

  5. Hybrid microfiber-lithium-niobate nanowaveguide structures as high-purity heralded single-photon sources

    NASA Astrophysics Data System (ADS)

    Main, Philip; Mosley, Peter J.; Ding, Wei; Zhang, Lijian; Gorbach, Andrey V.

    2016-12-01

    We propose a compact, fiber-integrated architecture for photon-pair generation by parametric downconversion with unprecedented flexibility in the properties of the photons produced. Our approach is based on a thin-film lithium niobate nanowaveguide, evanescently coupled to a tapered silica microfiber. We demonstrate how controllable mode hybridization between the fiber and waveguide yields control over the joint spectrum of the photon pairs. We also investigate how independent engineering of the linear and nonlinear properties of the structure can be achieved through the addition of a tapered, proton-exchanged layer to the waveguide. This allows further refinement of the joint spectrum through custom profiling of the effective nonlinearity, drastically improving the purity of the heralded photons. We give details of a source design capable of generating heralded single photons in the telecom wavelength range with purity of at least 0.95, and we provide a feasible fabrication methodology.

  6. Optical Properties of Vibronically Coupled Cy3 Dimers on DNA Scaffolds.

    PubMed

    Cunningham, Paul D; Kim, Young C; Díaz, Sebastián A; Buckhout-White, Susan; Mathur, Divita; Medintz, Igor L; Melinger, Joseph S

    2018-05-17

    We examine the effect of electronic coupling on the optical properties of Cy3 dimers attached to DNA duplexes as a function of base pair (bp) separation using steady-state and time-resolved spectroscopy. For close Cy3-Cy3 separations, 0 and 1 bp between dyes, intermediate to strong electronic coupling is revealed by modulation of the absorption and fluorescence properties including spectral band shape, peak wavelength, and excited-state lifetime. Using a vibronic exciton model, we estimate coupling strengths of 150 and 266 cm -1 for the 1 and 0 bp separations, respectively, which are comparable to those found in natural light-harvesting complexes. For the strongest electronic coupling (0 bp separation), we observe that the absorption band shape is strongly affected by the base pairs that surround the dyes, where more strongly hydrogen-bonded G-C pairs produce a red-shifted absorption spectrum consistent with a J-type dimer. This effect is studied theoretically using molecular dynamics simulation, which predicts an in-line dye configuration that is consistent with the experimental J-type spectrum. When the Cy3 dimers are in a standard aqueous buffer, the presence of relatively strong electronic coupling is accompanied by decreased fluorescence lifetime, suggesting that it promotes nonradiative relaxation in cyanine dyes. However, we show that the use of a viscous solvent can suppress this nonradiative recombination and thereby restore the dimer fluorescent emission. Ultrafast transient absorption measurements of Cy3 dimers in both standard aqueous buffer and viscous glycerol buffer suggest that sufficiently strong electronic coupling increases the probability of excited-state relaxation through a dark state that is related to Cy3 torsional motion.

  7. Shape Effect Undermined by Surface Reconstruction: Ethanol Dehydrogenation over Shape-Controlled SrTiO 3 Nanocrystals

    DOE PAGES

    Foo, Guo Shiou; Hood, Zachary D.; Wu, Zili

    2017-12-05

    For this research, to gain an in-depth understanding of the surface properties relevant for catalysis using ternary oxides, we report the acid–base pair reactivity of shape-controlled SrTiO 3 (STO) nanocrystals for the dehydrogenation of ethanol. Cubes, truncated cubes, dodecahedra, and etched cubes of STO with varying ratios of (001) and (110) crystal facets were synthesized using a hydrothermal method. Low-energy ion scattering (LEIS) analysis revealed that the (001) surface on cubes of STO is enriched with SrO due to surface reconstruction, resulting in a high ratio of strong base sites. Chemical treatment with dilute nitric acid to form etched cubesmore » of STO resulted in a surface enriched with Ti cations and strong acidity. Furthermore, the strength and distribution of surface acidic sites increase with the ratio of (110) facet from cubes to truncated cubes to dodecahedra for STO. Kinetic, isotopic, and spectroscopy methods show that the dehydrogenation of ethanol proceeds through the facile dissociation of the alcohol group, followed by the cleavage of the C α–H bond, which is the rate-determining step. Co-feeding of various probe molecules during catalysis, such as NH 3, 2,6-di-tert-butylpyridine, CO 2, and SO 2, reveals that a pair of Lewis acid site and basic surface oxygen atom is involved in the dehydrogenation reaction. The surface density of acid–base site pairs was measured using acetic acid as a probe molecule, allowing initial acetaldehyde formation turnover rates to be obtained. Comparison among various catalysts reveals no simple correlation between ethanol turnover rate and the percentage of either surface facet ((001) or (110)) of the STO nanocrystals. Instead, the reaction rate is found to increase with the strength of acid sites but reversely with the strength of base sites. The acid–base property is directly related to the surface composition as a result from different surface reconstruction behaviors of the shaped STO nanocrystals. Lastly, the finding in this work underscores the importance of characterizing the top surface compositions and sites properties when assessing the catalytic performance of shape-controlled complex oxides such as perovskites.« less

  8. Shape Effect Undermined by Surface Reconstruction: Ethanol Dehydrogenation over Shape-Controlled SrTiO 3 Nanocrystals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Foo, Guo Shiou; Hood, Zachary D.; Wu, Zili

    For this research, to gain an in-depth understanding of the surface properties relevant for catalysis using ternary oxides, we report the acid–base pair reactivity of shape-controlled SrTiO 3 (STO) nanocrystals for the dehydrogenation of ethanol. Cubes, truncated cubes, dodecahedra, and etched cubes of STO with varying ratios of (001) and (110) crystal facets were synthesized using a hydrothermal method. Low-energy ion scattering (LEIS) analysis revealed that the (001) surface on cubes of STO is enriched with SrO due to surface reconstruction, resulting in a high ratio of strong base sites. Chemical treatment with dilute nitric acid to form etched cubesmore » of STO resulted in a surface enriched with Ti cations and strong acidity. Furthermore, the strength and distribution of surface acidic sites increase with the ratio of (110) facet from cubes to truncated cubes to dodecahedra for STO. Kinetic, isotopic, and spectroscopy methods show that the dehydrogenation of ethanol proceeds through the facile dissociation of the alcohol group, followed by the cleavage of the C α–H bond, which is the rate-determining step. Co-feeding of various probe molecules during catalysis, such as NH 3, 2,6-di-tert-butylpyridine, CO 2, and SO 2, reveals that a pair of Lewis acid site and basic surface oxygen atom is involved in the dehydrogenation reaction. The surface density of acid–base site pairs was measured using acetic acid as a probe molecule, allowing initial acetaldehyde formation turnover rates to be obtained. Comparison among various catalysts reveals no simple correlation between ethanol turnover rate and the percentage of either surface facet ((001) or (110)) of the STO nanocrystals. Instead, the reaction rate is found to increase with the strength of acid sites but reversely with the strength of base sites. The acid–base property is directly related to the surface composition as a result from different surface reconstruction behaviors of the shaped STO nanocrystals. Lastly, the finding in this work underscores the importance of characterizing the top surface compositions and sites properties when assessing the catalytic performance of shape-controlled complex oxides such as perovskites.« less

  9. Evolving a polymerase for hydrophobic base analogues.

    PubMed

    Loakes, David; Gallego, José; Pinheiro, Vitor B; Kool, Eric T; Holliger, Philipp

    2009-10-21

    Hydrophobic base analogues (HBAs) have shown great promise for the expansion of the chemical and coding potential of nucleic acids but are generally poor polymerase substrates. While extensive synthetic efforts have yielded examples of HBAs with favorable substrate properties, their discovery has remained challenging. Here we describe a complementary strategy for improving HBA substrate properties by directed evolution of a dedicated polymerase using compartmentalized self-replication (CSR) with the archetypal HBA 5-nitroindole (d5NI) and its derivative 5-nitroindole-3-carboxamide (d5NIC) as selection substrates. Starting from a repertoire of chimeric polymerases generated by molecular breeding of DNA polymerase genes from the genus Thermus, we isolated a polymerase (5D4) with a generically enhanced ability to utilize HBAs. The selected polymerase. 5D4 was able to form and extend d5NI and d5NIC (d5NI(C)) self-pairs as well as d5NI(C) heteropairs with all four bases with efficiencies approaching, or exceeding, those of the cognate Watson-Crick pairs, despite significant distortions caused by the intercalation of the d5NI(C) heterocycles into the opposing strand base stack, as shown by nuclear magnetic resonance spectroscopy (NMR). Unlike Taq polymerase, 5D4 was also able to extend HBA pairs such as Pyrene: varphi (abasic site), d5NI: varphi, and isocarbostyril (ICS): 7-azaindole (7AI), allowed bypass of a chemically diverse spectrum of HBAs, and enabled PCR amplification with primers comprising multiple d5NI(C)-substitutions, while maintaining high levels of catalytic activity and fidelity. The selected polymerase 5D4 promises to expand the range of nucleobase analogues amenable to replication and should find numerous applications, including the synthesis and replication of nucleic acid polymers with expanded chemical and functional diversity.

  10. Stochasticity of bacterial attachment and its predictability by the extended derjaguin-landau-verwey-overbeek theory.

    PubMed

    Chia, Teck Wah R; Nguyen, Vu Tuan; McMeekin, Thomas; Fegan, Narelle; Dykes, Gary A

    2011-06-01

    Bacterial attachment onto materials has been suggested to be stochastic by some authors but nonstochastic and based on surface properties by others. We investigated this by attaching pairwise combinations of two Salmonella enterica serovar Sofia (S. Sofia) strains (with different physicochemical and attachment properties) with one strain each of S. enterica serovar Typhimurium, S. enterica serovar Infantis, or S. enterica serovar Virchow (all with similar physicochemical and attachment abilities) in ratios of 0.428, 1, and 2.333 onto glass, stainless steel, Teflon, and polysulfone. Attached bacterial cells were recovered and counted. If the ratio of attached cells of each Salmonella serovar pair recovered was the same as the initial inoculum ratio, the attachment process was deemed stochastic. Experimental outcomes from the study were compared to those predicted by the extended Derjaguin-Landau-Verwey-Overbeek (XDLVO) theory. Significant differences (P < 0.05) between the initial and the attached ratios for serovar pairs containing S. Sofia S1296a for all different ratios were apparent for all materials. For S. Sofia S1635-containing pairs, 7 out of 12 combinations of serovar pairs and materials had attachment ratios not significantly different (P > 0.05) from the initial ratio of 0.428. Five out of 12 and 10 out of 12 samples had attachment ratios not significantly different (P > 0.05) from the initial ratios of 1 and 2.333, respectively. These results demonstrate that bacterial attachment to different materials is likely to be nonstochastic only when the key physicochemical properties of the bacteria were significantly different (P < 0.05) from each other. XDLVO theory could successfully predict the attachment of some individual isolates to particular materials but could not be used to predict the likelihood of stochasticity in pairwise attachment experiments.

  11. Accurate coarse-grained models for mixtures of colloids and linear polymers under good-solvent conditions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D’Adamo, Giuseppe, E-mail: giuseppe.dadamo@sissa.it; Pelissetto, Andrea, E-mail: andrea.pelissetto@roma1.infn.it; Pierleoni, Carlo, E-mail: carlo.pierleoni@aquila.infn.it

    2014-12-28

    A coarse-graining strategy, previously developed for polymer solutions, is extended here to mixtures of linear polymers and hard-sphere colloids. In this approach, groups of monomers are mapped onto a single pseudoatom (a blob) and the effective blob-blob interactions are obtained by requiring the model to reproduce some large-scale structural properties in the zero-density limit. We show that an accurate parametrization of the polymer-colloid interactions is obtained by simply introducing pair potentials between blobs and colloids. For the coarse-grained (CG) model in which polymers are modelled as four-blob chains (tetramers), the pair potentials are determined by means of the iterative Boltzmannmore » inversion scheme, taking full-monomer (FM) pair correlation functions at zero-density as targets. For a larger number n of blobs, pair potentials are determined by using a simple transferability assumption based on the polymer self-similarity. We validate the model by comparing its predictions with full-monomer results for the interfacial properties of polymer solutions in the presence of a single colloid and for thermodynamic and structural properties in the homogeneous phase at finite polymer and colloid density. The tetramer model is quite accurate for q ≲ 1 (q=R{sup ^}{sub g}/R{sub c}, where R{sup ^}{sub g} is the zero-density polymer radius of gyration and R{sub c} is the colloid radius) and reasonably good also for q = 2. For q = 2, an accurate coarse-grained description is obtained by using the n = 10 blob model. We also compare our results with those obtained by using single-blob models with state-dependent potentials.« less

  12. Extractive Spectrophotometric Methods for the Determination of Zolmitriptan in Bulk Drug and Pharmaceutical Formulation Using Bromocresol Green

    NASA Astrophysics Data System (ADS)

    Prashanth, K. N.; Swamy, N.; Basavaiah, K.

    2013-11-01

    Considering the basic property of zolmitriptan (ZMT) to generate ion-pairs with sulfonephthalein dyes two methods have been developed for its assay in bulk drug and dosage form. The first method (method A) is based on the formation of a colored ion-pair complex (1:1 drug:dye) of ZMT with bromocresol green (BCG) at pH 4.20 ± 0.01 and extraction of the complex into chloroform followed by measurement of the yellow ion-pair complex at 435 nm. In the second method (method B), the drug-dye ion-pair complex was treated with ethanolic potassium hydroxide in ethanolic medium and the resulting base form of the dye was measured at 630 nm. Beer's law was obeyed in the concentration range of 0.8-18.0 and 0.08-1.4 μg/ml for method A and B, respectively, and the corresponding molar absorptivity values were 1.50ṡ104 and 1.52ṡ105 l/(molṡcm). The Sandell sensitivity values were 0.0191 and 0.0019 μg/cm2 for method A and method B, respectively. The stoichiometry of the ion-pair complex formed between the drug and dye (1:1) was determined by Job's continuous variation method and the stability constant of the complex was also calculated. The proposed method was successfully extended to dosage form (tablets).

  13. Pair-correlations in swimmer suspensions

    NASA Astrophysics Data System (ADS)

    Nambiar, Sankalp; Subramanian, Ganesh

    2017-11-01

    Suspensions of rear-actuated swimming microorganisms, such as E.coli, exhibit several interesting phenomena including spontaneous pattern formation above a critical concentration, novel rheological properties, shear-induced concentration banding etc. Explanations based on mean-field theory are only qualitative, since interactions between swimmers are important for typical experimental concentrations. We analytically characterize the hydrodynamic pair-interactions in a quiescent suspension of slender straight swimmers. The pair-correlation, calculated at leading order by integrating the swimmer velocity disturbances along straight trajectories, decays as 1/r2 for r >> L (L being the swimmer size). This allows us to characterize both polar and nematic correlations in an interacting swimmer suspension. In the absence of correlations, the velocity covariance asymptotes from a constant for r << L to a far-field decay of O(1/r2) for r >> L, the latter being characteristic of a suspension of non-interacting point force-dipoles. On including correlations, the slow decay of the pair-orientation correlation leads to an additional contribution to the velocity covariance that diverges logarithmically with system size.

  14. CL-20/DNB co-crystal based PBX with PEG: molecular dynamics simulation

    NASA Astrophysics Data System (ADS)

    Zhang, Jiang; Gao, Pei; Xiao, Ji Jun; Zhao, Feng; Xiao, He Ming

    2016-12-01

    Molecular dynamics simulation was carried out for CL-20/DNB co-crystal based PBX (polymer-bonded explosive) blended with polymer PEG (polyethylene glycol). In this paper, the miscibility of the PBX models is investigated through the calculated binding energy. Pair correlation function (PCF) analysis is applied to study the interaction of the interface structures in the PBX models. The mechanical properties of PBXs are also discussed to understand the change of the mechanical properties after adding the polymer. Moreover, the calculated diffusion coefficients of the interfacial explosive molecules are used to discuss the dispersal ability of CL-20 and DNB molecules in the interface layer.

  15. Excimers from stable and persistent supramolecular radical-pairs in red/NIR-emitting organic nanoparticles and polymeric films.

    PubMed

    Blasi, Davide; Nikolaidou, Domna M; Terenziani, Francesca; Ratera, Imma; Veciana, Jaume

    2017-03-29

    In this work, the luminescence properties of new materials based on open-shell molecular systems are studied. In particular, we prepared polymeric films and organic nanoparticles (ONPs) doped with triphenylmethyl radical molecules. ONPs exhibit a uniform size distribution, spherical morphology and high colloidal stability. The emission spectrum of low-doped ONP suspensions and low-doped films is very similar to the emission spectrum of TTM in solution, while the luminescence lifetime and the luminescence quantum yield (LQY) are highly increased. Increasing the radical doping leads to a progressive decrease of the LQY and the appearance of a new broad excimeric band at longer wavelengths, both for ONPs and films. Thus, not only the luminescence properties were improved, but also the formation of excimers from stable and persistent supramolecular radical-pairs was observed for the first time. The good stability and luminescence properties with emission in the red-NIR region (650-800 nm), together with the open-shell nature of the emitter, make these free-radical excimer-forming materials promising candidates for optoelectronic and bioimaging applications.

  16. Evaluating Transport Properties and Ionic Dissociation of LiPF 6 in Concentrated Electrolyte

    DOE PAGES

    Feng, Zhange; Higa, Kenneth; Han, Kee Sung; ...

    2017-08-17

    The presence of lithium hexafluorophosphate (LiPF 6) ion pairs in carbonate-based electrolyte solutions is widely accepted in the field of battery electrolyte research and is expected to affect solution transport properties. No existing techniques are capable of directly quantifying salt dissociation in these solutions. Previous publications by others have provided estimates of dissociation degrees using dilute solution theory and pulsed field gradient nuclear magnetic resonance spectroscopy (PFG-NMR) measurements of self-diffusivity. However, the behavior of a concentrated electrolyte solution can deviate significantly from dilute solution theory predictions. This paper, for the first time, instead uses Onsager–Stefan–Maxwell concentrated solution theory and themore » generalized Darken relation with PFG-NMR measurements to quantify the degrees of dissociation in electrolyte solutions (LiPF 6 in ethylene carbonate/diethyl carbonate, 1:1 by weight). At LiPF 6 concentrations ranging from 0.1 M to 1.5 M, the salt dissociation degree is found to range from 61% to 37%. Finally, transport properties are then calculated through concentrated solution theory with corrections for these significant levels of ion pairing.« less

  17. Emergence of innovative properties by replacement of nitrogen atom with phosphorus atom in quaternary ammonium ionic liquids: Insights from ab initio calculations and MD simulations

    NASA Astrophysics Data System (ADS)

    Ghatee, Mohammad Hadi; Bahrami, Maryam

    2017-06-01

    We investigate to contrasting structure, dynamic and thermophysical properties of quaternary ammonium and phosphonium ionic liquids (ILs) based on triethylalkylammonium [N222n]+ and triethylalkylphosphonium [P222n]+ cations (n = 5, 8, 12) and (bis(trifluoromethylsulfonyl)imide) anion [NTf2]- by quantum chemical calculations (QCC) and molecular dynamics (MD) simulations. QCCs conform to previous studies, showing that phosphonium cation alkyl chain rotational-energy-barrier is lower than ammonium cation. These molecular nature leads to no appreciable differences in their liquid density. However, their simulated transport properties (self-diffusion, conductivity, etc) are appreciably different. In particular, viscosity of phosphoniums are much lower than ammoniums. Ammoniums make nano-scale structural domains larger than phosphoniums. Employed analysis, vector re-orientational dynamics, ion-pair lifetime and nanostructure domain are in favor of faster dynamic for phosphoniums than ammoniums. [NTf2]- anion features a long lived pairing with ammoniums than phosphoniums. Overall, phosphoniums possess higher transference number, higher conductivity, and appreciably lower viscosity favorable for higher electrochemical performances.

  18. Evaluating Transport Properties and Ionic Dissociation of LiPF 6 in Concentrated Electrolyte

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Feng, Zhange; Higa, Kenneth; Han, Kee Sung

    2017-01-01

    The presence of lithium hexafluorophosphate (LiPF6) ion pairs in carbonate-based electrolyte solutions is widely accepted in the field of battery electrolyte research and is expected to affect solution transport properties. No existing techniques are capable of directly quantifying salt dissociation in these solutions. Previous publications by others have provided estimates of dissociation degrees using dilute solution theory and pulsed field gradient nuclear magnetic resonance spectroscopy (PFG-NMR) measurements of self-diffusivity. However, the behavior of a concentrated electrolyte solution can deviate significantly from dilute solution theory predictions. This work, for the first time, instead uses Onsager–Stefan–Maxwell concentrated solution theory and the generalized.more » Darken relation with PFG-NMR measurements to quantify the degrees of dissociation in electrolyte solutions (LiPF6 in ethylene carbonate/diethyl carbonate, 1:1 by weight). At LiPF6 concentrations ranging from 0.1 M to 1.5 M, the salt dissociation degree is found to range from 61% to 37%. Transport properties are then calculated through concentrated solution theory with corrections for these significant levels of ion pairing.« less

  19. Ionic structures and transport properties of hot dense W and U plasmas

    NASA Astrophysics Data System (ADS)

    Hou, Yong; Yuan, Jianmin

    2016-10-01

    We have combined the average-atom model with the hyper-netted chain approximation (AAHNC) to describe the electronic and ionic structure of uranium and tungsten in the hot dense matter regime. When the electronic structure is described within the average-atom model, the effects of others ions on the electronic structure are considered by the correlation functions. And the ionic structure is calculated though using the hyper-netted chain (HNC) approximation. The ion-ion pair potential is calculated using the modified Gordon-Kim model based on the electronic density distribution in the temperature-depended density functional theory. And electronic and ionic structures are determined self-consistently. On the basis of the ion-ion pair potential, we perform the classical (CMD) and Langevin (LMD) molecular dynamics to simulate the ionic transport properties, such as ionic self-diffusion and shear viscosity coefficients, through the ionic velocity correlation functions. Due that the free electrons become more and more with increasing the plasma temperature, the influence of the electron-ion collisions on the transport properties become more and more important.

  20. Topological Crystalline Superconductivity in Locally Noncentrosymmetric Multilayer Superconductors

    NASA Astrophysics Data System (ADS)

    Yoshida, Tomohiro; Sigrist, Manfred; Yanase, Youichi

    2015-07-01

    Topological crystalline superconductivity in locally noncentrosymmetric multilayer superconductors (SCs) is proposed. We study the odd-parity pair-density wave (PDW) state induced by the spin-singlet pairing interaction through the spin-orbit coupling. It is shown that the PDW state is a topological crystalline SC protected by a mirror symmetry, although it is topologically trivial according to the classification based on the standard topological periodic table. The topological property of the mirror subsectors is intuitively explained by adiabatically changing the Bogoliubov-de Gennes Hamiltonian. A subsector of the bilayer PDW state reduces to the two-dimensional noncentrosymmetric SC, while a subsector of the trilayer PDW state is topologically equivalent to the spinless p -wave SC. Chiral Majorana edge modes in trilayers can be realized without Cooper pairs in the spin-triplet channel and chemical potential tuning.

  1. Properties of entangled photon pairs generated in one-dimensional nonlinear photonic-band-gap structures

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Perina, Jan Jr.; Centini, Marco; Sibilia, Concita

    We have developed a rigorous quantum model of spontaneous parametric down-conversion in a nonlinear 1D photonic-band-gap structure based upon expansion of the field into monochromatic plane waves. The model provides a two-photon amplitude of a created photon pair. The spectra of the signal and idler fields, their intensity profiles in the time domain, as well as the coincidence-count interference pattern in a Hong-Ou-Mandel interferometer are determined both for cw and pulsed pumping regimes in terms of the two-photon amplitude. A broad range of parameters characterizing the emitted down-converted fields can be used. As an example, a structure composed of 49more » layers of GaN/AlN is analyzed as a suitable source of photon pairs having high efficiency.« less

  2. Topological Crystalline Superconductivity in Locally Noncentrosymmetric Multilayer Superconductors.

    PubMed

    Yoshida, Tomohiro; Sigrist, Manfred; Yanase, Youichi

    2015-07-10

    Topological crystalline superconductivity in locally noncentrosymmetric multilayer superconductors (SCs) is proposed. We study the odd-parity pair-density wave (PDW) state induced by the spin-singlet pairing interaction through the spin-orbit coupling. It is shown that the PDW state is a topological crystalline SC protected by a mirror symmetry, although it is topologically trivial according to the classification based on the standard topological periodic table. The topological property of the mirror subsectors is intuitively explained by adiabatically changing the Bogoliubov-de Gennes Hamiltonian. A subsector of the bilayer PDW state reduces to the two-dimensional noncentrosymmetric SC, while a subsector of the trilayer PDW state is topologically equivalent to the spinless p-wave SC. Chiral Majorana edge modes in trilayers can be realized without Cooper pairs in the spin-triplet channel and chemical potential tuning.

  3. Super-Chelators for Advanced Protein Labeling in Living Cells.

    PubMed

    Gatterdam, Karl; Joest, Eike F; Dietz, Marina S; Heilemann, Mike; Tampé, Robert

    2018-05-14

    Live-cell labeling, super-resolution microscopy, single-molecule applications, protein localization, or chemically induced assembly are emerging approaches, which require specific and very small interaction pairs. The minimal disturbance of protein function is essential to derive unbiased insights into cellular processes. Herein, we define a new class of hexavalent N-nitrilotriacetic acid (hexaNTA) chelators, displaying the highest affinity and stability of all NTA-based small interaction pairs described so far. Coupled to bright organic fluorophores with fine-tuned photophysical properties, the super-chelator probes were delivered into human cells by chemically gated nanopores. These super-chelators permit kinetic profiling, multiplexed labeling of His 6 - and His 12 -tagged proteins as well as single-molecule-based super-resolution imaging. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Carbon nanotube-based sensor and method for detection of crack growth in a structure

    NASA Technical Reports Server (NTRS)

    Smits, Jan M. (Inventor); Moore, Thomas C. (Inventor); Kite, Marlen T. (Inventor); Wincheski, Russell A. (Inventor); Ingram, JoAnne L. (Inventor); Watkins, Anthony N. (Inventor); Williams, Phillip A. (Inventor)

    2007-01-01

    A sensor has a plurality of carbon nanotube (CNT)-based conductors operatively positioned on a substrate. The conductors are arranged side-by-side, such as in a substantially parallel relationship to one another. At least one pair of spaced-apart electrodes is coupled to opposing ends of the conductors. A portion of each of the conductors spanning between each pair of electrodes comprises a plurality of carbon nanotubes arranged end-to-end and substantially aligned along an axis. Because a direct correlation exists between the resistance of a carbon nanotube and its strain, changes experienced by the portion of the structure to which the sensor is coupled induce a corresponding change in the electrical properties of the conductors, thereby enabling detection of crack growth in the structure.

  5. Anomalous scaling of Δ C versus T c in the Fe-based superconductors: the $${S}_{\\pm }$$-wave pairing state model

    DOE PAGES

    Bang, Yunkyu; Stewart, G. R.

    2016-02-01

    The strong power law behavior of the specific heat jumpmore » $${\\rm{\\Delta }}C\\;$$ versus T c $$({\\rm{\\Delta }}C/{T}_{{\\rm{c}}}\\sim {T}_{{\\rm{c}}}^{\\alpha },\\alpha \\approx 2)$$, first observed by Bud'ko et al (2009 Phys. Rev. B 79 220516), has been confirmed with several families of the Fe-based superconducting compounds with various dopings. We tested a minimal two band BCS model to understand this anomalous behavior and showed that this non-BCS relation between $${\\rm{\\Delta }}C\\;$$ versus T c is a generic property of the multiband superconducting state paired by a dominant interband interaction ($${V}_{\\mathrm{inter}}\\gt {V}_{\\mathrm{intra}}$$) reflecting the relation $$\\frac{{{\\rm{\\Delta }}}_{{\\rm{h}}}}{{{\\rm{\\Delta }}}_{{\\rm{e}}}}\\sim \\sqrt{\\frac{{N}_{{\\rm{e}}}}{{N}_{{\\rm{h}}}}}$$ near T c, as in the $${S}_{\\pm }$$-wave pairing state. We also found that this $${\\rm{\\Delta }}C\\;$$ versus T c power law can continuously change from the ideal BNC scaling to a considerable deviation by a moderate variation of the impurity scattering rate $${{\\rm{\\Gamma }}}_{0}$$ (non-pair-breaking). Finally, as a result, our model provides a consistent explanation why the electron-doped Fe-based superconductors follow the ideal BNC scaling very well while the hole-doped systems often show varying degree of deviations.« less

  6. Multiple point mutations in a shuttle vector propagated in human cells: evidence for an error-prone DNA polymerase activity.

    PubMed

    Seidman, M M; Bredberg, A; Seetharam, S; Kraemer, K H

    1987-07-01

    Mutagenesis was studied at the DNA-sequence level in human fibroblast and lymphoid cells by use of a shuttle vector plasmid, pZ189, containing a suppressor tRNA marker gene. In a series of experiments, 62 plasmids were recovered that had two to six base substitutions in the 160-base-pair marker gene. Approximately 20-30% of the mutant plasmids that were recovered after passing ultraviolet-treated pZ189 through a repair-proficient human fibroblast line contained these multiple mutations. In contrast, passage of ultraviolet-treated pZ189 through an excision-repair-deficient (xeroderma pigmentosum) line yielded only 2% multiple base substitution mutants. Introducing a single-strand nick in otherwise unmodified pZ189 adjacent to the marker, followed by passage through the xeroderma pigmentosum cells, resulted in about 66% multiple base substitution mutants. The multiple mutations were found in a 160-base-pair region containing the marker gene but were rarely found in an adjacent 170-base-pair region. Passing ultraviolet-treated or nicked pZ189 through a repair-proficient human B-cell line also yielded multiple base substitution mutations in 20-33% of the mutant plasmids. An explanation for these multiple mutations is that they were generated by an error-prone polymerase while filling gaps. These mutations share many of the properties displayed by mutations in the immunoglobulin hypervariable regions.

  7. Isospectral drums and simple groups

    NASA Astrophysics Data System (ADS)

    Thas, Koen

    Nearly every known pair of isospectral but nonisometric manifolds — with as most famous members isospectral bounded ℝ-planar domains which makes one “not hear the shape of a drum” [M. Kac, Can one hear the shape of a drum? Amer. Math. Monthly 73(4 part 2) (1966) 1-23] — arise from the (group theoretical) Gassmann-Sunada method. Moreover, all the known ℝ-planar examples (so counter examples to Kac’s question) are constructed through a famous specialization of this method, called transplantation. We first describe a number of very general classes of length equivalent manifolds, with as particular cases isospectral manifolds, in each of the constructions starting from a given example that arises itself from the Gassmann-Sunada method. The constructions include the examples arising from the transplantation technique (and thus in particular the known planar examples). To that end, we introduce four properties — called FF, MAX, PAIR and INV — inspired by natural physical properties (which rule out trivial constructions), that are satisfied for each of the known planar examples. Vice versa, we show that length equivalent manifolds with FF, MAX, PAIR and INV which arise from the Gassmann-Sunada method, must fall under one of our prior constructions, thus describing a precise classification of these objects. Due to the nature of our constructions and properties, a deep connection with finite simple groups occurs which seems, perhaps, rather surprising in the context of this paper. On the other hand, our properties define in some sense physically irreducible pairs of length equivalent manifolds — “atoms” of general pairs of length equivalent manifolds, in that such a general pair of manifolds is patched up out of irreducible pairs — and that is precisely what simple groups are for general groups.

  8. Generation of optical vortices with controllable topological charges and polarization patterns

    NASA Astrophysics Data System (ADS)

    Yang, Ching-Han; Fuh, Andy Ying-Guey

    2017-02-01

    We present a simple and flexible method of generating various vectorial vortex beams (VVBs) based on the scheme of double modulations from a single liquid crystal spatial light modulator (SLM). In this configuration, a half-wave plate (HWP) placed in front of the SLM is first used to control the weights of linear polarization components of incident light. Then, we respectively encode two orbital angular momentum (OAM) eigenstates displayed on each half of the SLM onto each of the linear components of light. This yields the generation of VVB fields spanned by a pair of linearly polarized OAM eigenstates. In order to convert polarization bases from the linear pair into another orthogonal pair, a quarter-wave plate (QWP) placed behind the SLM is used. This enables us to generate VVBs spanned by any pair of orthogonally polarized OAM eigenstates. Generally, the light states of polarization (SOP) can be presented as a geodesic path located on the plane perpendicular to the axis connecting the pair of bases used on the Poincaré sphere. The light property is adjustable depending on both slow axes of HWP and QWP, as well as via computer generated holograms. To validate generated beams, two measurement procedures are subsequently applied. First, Stokes polarimetry is used to measure the light SOP over the transverse plane. Next, a Shack-Hartmann wavefront sensor is used to measure the OAM charge. Both the simulated and experimental results are shown to be in a good qualitative agreement. In addition, both polarization patterns and OAM charges can be controlled independently using the proposed method.

  9. a Norm Pairing in Formal Modules

    NASA Astrophysics Data System (ADS)

    Vostokov, S. V.

    1980-02-01

    A pairing of the multiplicative group of a local field (a finite extension of the field of p-adic numbers Qp) with the group of points of a Lubin-Tate formal group is defined explicitly. The values of the pairing are roots of an isogeny of the formal group. The main properties of this pairing are established: bilinearity, invariance under the choice of a local uniformizing element, and independence of the method of expanding elements into series with respect to this uniformizing element. These properties of the pairing are used to prove that it agrees with the generalized Hilbert norm residue symbol when the field over whose ring of integers the formal group is defined is totally ramified over Qp. This yields an explicit expression for the generalized Hilbert symbol on the group of points of the formal group. Bibliography: 12 titles.

  10. Impact of pairing on clustering and neutrino transport properties in low-density stellar matter

    NASA Astrophysics Data System (ADS)

    Burrello, S.; Colonna, M.; Matera, F.

    2017-11-01

    We analyze the effects of pairing correlations on the behavior of stellar matter, focusing on thermodynamical conditions close to the onset of the liquid-gas phase transition, which are characterized by quite large density fluctuations and where clustering phenomena occur. We concentrate on the neutrino transport properties and we show, within a thermodynamical treatment, that at moderate temperatures, where pairing effects are still active, the scattering of neutrinos in the nuclear medium is significantly affected by the matter superfluidity. The pairing correlations can indeed enhance neutrino trapping and reduce the energy flux carried out by neutrino emission. New hints about an important impact of pairing on the cooling mechanism, by neutrino emission, are so envisaged and therefore this study could be of relevant interest for the evolution of proto-neutron stars and in modelization of supernova explosions.

  11. Size-expanded DNA bases: An ab-initio study of their structural and electronic properties

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fuentes-Cabrera, Miguel A; Sumpter, Bobby G; Wells, Jack C

    2005-01-01

    The size-expanded DNA bases, xA, xC, xG, and xT, are benzo-homologue forms of the natural DNA bases; i.e., their structure can be seen as the fusion of a natural base and a benzene ring. Recently, a variety of DNAs, known as xDNAs, have been synthesized in which size-expanded and natural bases are paired. In this paper we use second-order Moeller-Plesset perturbation theory and density functional theory to investigate the structural and electronic properties of xA, xC, xG, and xT and their natural counterparts. We find that whereas natural and size-expanded bases have both nonplanar amino groups the latter have alsomore » nonplanar aromatic rings. When density functional theory is used to investigate the electronic properties of size-expanded and natural bases, it is found that the HOMO-LUMO gap of the size-expanded bases is smaller than that of the natural bases. Also, xG should be easier to oxidize than G.« less

  12. Understanding the impact of the central atom on the ionic liquid behavior: phosphonium vs ammonium cations.

    PubMed

    Carvalho, Pedro J; Ventura, Sónia P M; Batista, Marta L S; Schröder, Bernd; Gonçalves, Fernando; Esperança, José; Mutelet, Fabrice; Coutinho, João A P

    2014-02-14

    The influence of the cation's central atom in the behavior of pairs of ammonium- and phosphonium-based ionic liquids was investigated through the measurement of densities, viscosities, melting temperatures, activity coefficients at infinite dilution, refractive indices, and toxicity against Vibrio fischeri. All the properties investigated are affected by the cation's central atom nature, with ammonium-based ionic liquids presenting higher densities, viscosities, melting temperatures, and enthalpies. Activity coefficients at infinite dilution show the ammonium-based ionic liquids to present slightly higher infinite dilution activity coefficients for non-polar solvents, becoming slightly lower for polar solvents, suggesting that the ammonium-based ionic liquids present somewhat higher polarities. In good agreement these compounds present lower toxicities than the phosphonium congeners. To explain this behavior quantum chemical gas phase DFT calculations were performed on isolated ion pairs at the BP-TZVP level of theory. Electronic density results were used to derive electrostatic potentials of the identified minimum conformers. Electrostatic potential-derived CHelpG and Natural Population Analysis charges show the P atom of the tetraalkylphosphonium-based ionic liquids cation to be more positively charged than the N atom in the tetraalkylammonium-based analogous IL cation, and a noticeable charge delocalization occurring in the tetraalkylammonium cation, when compared with the respective phosphonium congener. It is argued that this charge delocalization is responsible for the enhanced polarity observed on the ammonium based ionic liquids explaining the changes in the thermophysical properties observed.

  13. Understanding the impact of the central atom on the ionic liquid behavior: Phosphonium vs ammonium cations

    NASA Astrophysics Data System (ADS)

    Carvalho, Pedro J.; Ventura, Sónia P. M.; Batista, Marta L. S.; Schröder, Bernd; Gonçalves, Fernando; Esperança, José; Mutelet, Fabrice; Coutinho, João A. P.

    2014-02-01

    The influence of the cation's central atom in the behavior of pairs of ammonium- and phosphonium-based ionic liquids was investigated through the measurement of densities, viscosities, melting temperatures, activity coefficients at infinite dilution, refractive indices, and toxicity against Vibrio fischeri. All the properties investigated are affected by the cation's central atom nature, with ammonium-based ionic liquids presenting higher densities, viscosities, melting temperatures, and enthalpies. Activity coefficients at infinite dilution show the ammonium-based ionic liquids to present slightly higher infinite dilution activity coefficients for non-polar solvents, becoming slightly lower for polar solvents, suggesting that the ammonium-based ionic liquids present somewhat higher polarities. In good agreement these compounds present lower toxicities than the phosphonium congeners. To explain this behavior quantum chemical gas phase DFT calculations were performed on isolated ion pairs at the BP-TZVP level of theory. Electronic density results were used to derive electrostatic potentials of the identified minimum conformers. Electrostatic potential-derived CHelpG and Natural Population Analysis charges show the P atom of the tetraalkylphosphonium-based ionic liquids cation to be more positively charged than the N atom in the tetraalkylammonium-based analogous IL cation, and a noticeable charge delocalization occurring in the tetraalkylammonium cation, when compared with the respective phosphonium congener. It is argued that this charge delocalization is responsible for the enhanced polarity observed on the ammonium based ionic liquids explaining the changes in the thermophysical properties observed.

  14. Nanogranular SiO2 proton gated silicon layer transistor mimicking biological synapses

    NASA Astrophysics Data System (ADS)

    Liu, M. J.; Huang, G. S.; Feng, P.; Guo, Q. L.; Shao, F.; Tian, Z. A.; Li, G. J.; Wan, Q.; Mei, Y. F.

    2016-06-01

    Silicon on insulator (SOI)-based transistors gated by nanogranular SiO2 proton conducting electrolytes were fabricated to mimic synapse behaviors. This SOI-based device has both top proton gate and bottom buried oxide gate. Electrical transfer properties of top proton gate show hysteresis curves different from those of bottom gate, and therefore, excitatory post-synaptic current and paired pulse facilitation (PPF) behavior of biological synapses are mimicked. Moreover, we noticed that PPF index can be effectively tuned by the spike interval applied on the top proton gate. Synaptic behaviors and functions, like short-term memory, and its properties are also experimentally demonstrated in our device. Such SOI-based electronic synapses are promising for building neuromorphic systems.

  15. Dynamic investigation of DNA bending and wrapping by type II topoisomerases

    NASA Astrophysics Data System (ADS)

    Shao, Qing; Finzi, Laura; Dunlap, David

    2009-11-01

    Type II topoisomerases catalyze DNA decatenation and unwinding which is crucial for cell division, and therefore type II topoisomerases are some of the main targets of anti-cancer drugs. A recent crystal structure shows that, during the catalytic cycle, a yeast type II topoimerase can bend a 10 base pair DNA segment by up to 150 degrees. Bacterial gyrase, another type II topoisomerase, can wrap DNA into a tight 180 degree turn. Bending a stiff polymer like DNA requires considerable energy and could represent the rate limiting step in the catalytic (topological) cycle. Using modified deoxyribonucleotides in PCR reactions, stiffer DNA fragments have been produced and used as substrates for topoisomerase II-mediated relaxation of plectonemes introduced in single molecules using magnetic tweezers. The wrapping ability of gyrase decreases for diamino-purine-substituted DNA in which every base pair has three hydrogen-bonds. The overall rate of relaxation of plectonemes by recombinant human topoisomerase II alpha also decreases. These results reveal the dynamic properties of DNA bending and wrapping by type II topisomerases and suggest that A:T base pair melting is a rate determining step for bending and wrapping.

  16. Complexes of DNA bases and Watson-Crick base pairs interaction with neutral silver Agn (n = 8, 10, 12) clusters: a DFT and TDDFT study.

    PubMed

    Srivastava, Ruby

    2018-03-01

    We study the binding of the neutral Ag n (n = 8, 10, 12) to the DNA base-adenine (A), guanine (G) and Watson-Crick -adenine-thymine, guanine-cytosine pairs. Geometries of complexes were optimized at the DFT level using the hybrid B3LYP functional. LANL2DZ effective core potential was used for silver and 6-31 + G ** was used for all other atoms. NBO charges were analyzed using the Natural population analysis. The absorption properties of Ag n -A,G/WC complexes were also studied using time-dependent density functional theory. The absorption spectra for these complexes show wavelength in the visible region. It was revealed that silver clusters interact more strongly with WC pairs than with isolated DNA complexes. Furthermore, it was found that the electronic charge transferred from silver to isolated DNA clusters are less than the electronic charge transferred from silver to the Ag n -WC complexes. The vertical ionization potential, vertical electron affinity, hardness, and electrophilicity index of Ag n -DNA/WC complexes have also been discussed.

  17. Analytic energy derivatives for the calculation of the first-order molecular properties using the domain-based local pair-natural orbital coupled-cluster theory

    NASA Astrophysics Data System (ADS)

    Datta, Dipayan; Kossmann, Simone; Neese, Frank

    2016-09-01

    The domain-based local pair-natural orbital coupled-cluster (DLPNO-CC) theory has recently emerged as an efficient and powerful quantum-chemical method for the calculation of energies of molecules comprised of several hundred atoms. It has been demonstrated that the DLPNO-CC approach attains the accuracy of a standard canonical coupled-cluster calculation to about 99.9% of the basis set correlation energy while realizing linear scaling of the computational cost with respect to system size. This is achieved by combining (a) localized occupied orbitals, (b) large virtual orbital correlation domains spanned by the projected atomic orbitals (PAOs), and (c) compaction of the virtual space through a truncated pair natural orbital (PNO) basis. In this paper, we report on the implementation of an analytic scheme for the calculation of the first derivatives of the DLPNO-CC energy for basis set independent perturbations within the singles and doubles approximation (DLPNO-CCSD) for closed-shell molecules. Perturbation-independent one-particle density matrices have been implemented in order to account for the response of the CC wave function to the external perturbation. Orbital-relaxation effects due to external perturbation are not taken into account in the current implementation. We investigate in detail the dependence of the computed first-order electrical properties (e.g., dipole moment) on the three major truncation parameters used in a DLPNO-CC calculation, namely, the natural orbital occupation number cutoff used for the construction of the PNOs, the weak electron-pair cutoff, and the domain size cutoff. No additional truncation parameter has been introduced for property calculation. We present benchmark calculations on dipole moments for a set of 10 molecules consisting of 20-40 atoms. We demonstrate that 98%-99% accuracy relative to the canonical CCSD results can be consistently achieved in these calculations. However, this comes with the price of tightening the threshold for the natural orbital occupation number cutoff by an order of magnitude compared to the DLPNO-CCSD energy calculations.

  18. Freed by interaction kinetic states in the Harper model

    NASA Astrophysics Data System (ADS)

    Frahm, Klaus M.; Shepelyansky, Dima L.

    2015-12-01

    We study the problem of two interacting particles in a one-dimensional quasiperiodic lattice of the Harper model. We show that a short or long range interaction between particles leads to emergence of delocalized pairs in the non-interacting localized phase. The properties of these freed by interaction kinetic states (FIKS) are analyzed numerically including the advanced Arnoldi method. We find that the number of sites populated by FIKS pairs grows algebraically with the system size with the maximal exponent b = 1, up to a largest lattice size N = 10 946 reached in our numerical simulations, thus corresponding to a complete delocalization of pairs. For delocalized FIKS pairs the spectral properties of such quasiperiodic operators represent a deep mathematical problem. We argue that FIKS pairs can be detected in the framework of recent cold atom experiments [M. Schreiber et al., Science 349, 842 (2015)] by a simple setup modification. We also discuss possible implications of FIKS pairs for electron transport in the regime of charge-density wave and high T c superconductivity.

  19. Effects of ligand electronegativity on recoupled pair bonds with application to sulfurane precursors.

    PubMed

    Lindquist, Beth A; Woon, David E; Dunning, Thom H

    2014-07-31

    Recoupled pair bonds (RPBs) are conditional bonds-they only form for selected central atoms and ligands. A complete theoretical description of RPBs requires an understanding of the properties of the central atom and ligands that enable such bonds to be formed. In this work, we show that ligand electronegativity is positively correlated with recoupled pair bond strength for a variety of ligands interacting with the 3p(2) pair of sulfur. We also describe substituent (X) effects on the SF(a(4)Σ(-)) state by investigating X2SF species. These effects generally mirror those observed for covalently bound analogues, but we found that recoupled pair bonding can lead to breakdowns in the expected relationships among bond length, strength, and force constant for some of these species. Finally, we compare the properties of two molecules of practical interest that are bound by recoupled pair bonds: the dimethyl sulfur fluoride and hydroxide radicals (DMS-F and DMS-OH).

  20. Synthesis and triplex forming properties of pyrimidine derivative containing extended functionality.

    PubMed

    Gianolio, D A; McLaughlin, L W

    1999-08-01

    Two pyrimidine nucleosides have been synthesized containing extended hydrogen bonding functionality. In one case the side chain is based upon semicarbazide and in the second monoacetylated carbohydrazide was employed. DNA sequences could be prepared using both analogue nucleosides in a reverse coupling protocol, and provided that the normal capping step was eliminated and that the iodine-based oxidizing solution was replaced with one based upon 10-camphorsulfonyl oxaziridine. Both derivatives exhibited moderate effects in targeting selectively C-G base pairs embedded within a polypurine target sequence.

  1. Measurements of top quark properties at CDF

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kraan, Aafke C.; /Pennsylvania U.

    The top quark with its mass of about 172 GeV/c{sup 2} is the most massive fundamental particle observed by experiment. In this talk they highlight the most recent measurements of several top quark properties performed with the CDF detector based on data samples corresponding to integrated luminosities up to 1 fb{sup -1}. These results include a search for top quark pair production via new massive resonances, measurements of the helicity of the W boson from top-quark decay, and a direct limit on the lifetime of the top quark.

  2. Interplay of quasiparticle-vibration coupling and pairing correlations on β-decay half-lives

    NASA Astrophysics Data System (ADS)

    Niu, Y. F.; Niu, Z. M.; Colò, G.; Vigezzi, E.

    2018-05-01

    The nuclear β-decay half-lives of Ni and Sn isotopes, around the closed shell nuclei 78Ni and 132Sn, are investigated by computing the distribution of the Gamow-Teller strength using the Quasiparticle Random Phase Approximation (QRPA) with quasiparticle-vibration coupling (QPVC), based on ground-state properties obtained by Hartree-Fock-Bogoliubov (HFB) calculations. We employ the effective interaction SkM* and a zero-range effective pairing force. The half-lives are strongly reduced by including the QPVC. We study in detail the effects of isovector (IV) and isoscalar (IS) pairing. Increasing the IV strength tends to increase the lifetime for nuclei in the proximity of, but lighter than, the closed-shell ones in QRPA calculations, while the effect is significantly reduced by taking into account the QPVC. On the contrary, the IS pairing mainly plays a role for nuclei after the shell closure. Increasing its strength decreases the half-lives, and the effect at QRPA and QRPA+QPVC level is comparable. The effect of IS pairing is particularly pronounced in the case of the Sn isotopes, where it turns out to be instrumental to obtain good agreement with experimental data.

  3. Ion pair reinforced semi-interpenetrating polymer network for direct methanol fuel cell applications.

    PubMed

    Fang, Chunliu; Julius, David; Tay, Siok Wei; Hong, Liang; Lee, Jim Yang

    2012-06-07

    This paper describes the synthesis of ion-pair-reinforced semi-interpenetrating polymer networks (SIPNs) as proton exchange membranes (PEMs) for the direct methanol fuel cells (DMFCs). Specifically, sulfonated poly(2,6-dimethyl-1,4-phenylene oxide) (SPPO), a linear polymer proton source, was immobilized in a brominated PPO (BPPO) network covalently cross-linked by ethylenediamine (EDA). The immobilization of SPPO in the SIPN network was accomplished not only by the usual means of mechanical interlocking but also by ion pair formation between the sulfonic acid groups of SPPO and the amine moieties formed during the cross-linking reaction of BPPO with EDA. Through the ion pair interactions, the immobilization of SPPO polymer in the BPPO network was made more effective, resulting in a greater uniformity of sulfonic acid cluster distribution in the membrane. The hydrophilic amine-containing cross-links also compensated for some of the decrease in proton conductivity caused by ion pair formation. The SIPN membranes prepared as such showed good proton conductivity, low methanol permeability, good mechanical properties, and dimensional stability. Consequently, the PPO based SIPN membranes were able to deliver a higher maximum power density than Nafion, demonstrating the potential of the SIPN structure for PEM designs.

  4. A sharp image or a sharp knife: norms for the modality-exclusivity of 774 concept-property items.

    PubMed

    van Dantzig, Saskia; Cowell, Rosemary A; Zeelenberg, René; Pecher, Diane

    2011-03-01

    According to recent embodied cognition theories, mental concepts are represented by modality-specific sensory-motor systems. Much of the evidence for modality-specificity in conceptual processing comes from the property-verification task. When applying this and other tasks, it is important to select items based on their modality-exclusivity. We collected modality ratings for a set of 387 properties, each of which was paired with two different concepts, yielding a total of 774 concept-property items. For each item, participants rated the degree to which the property could be experienced through five perceptual modalities (vision, audition, touch, smell, and taste). Based on these ratings, we computed a measure of modality exclusivity, the degree to which a property is perceived exclusively through one sensory modality. In this paper, we briefly sketch the theoretical background of conceptual knowledge, discuss the use of the property-verification task in cognitive research, provide our norms and statistics, and validate the norms in a memory experiment. We conclude that our norms are important for researchers studying modality-specific effects in conceptual processing.

  5. Fractional statistics and quantum scaling properties of the integrable Penson-Kolb-Hubbard chain

    NASA Astrophysics Data System (ADS)

    Vitoriano, Carlindo; Coutinho-Filho, M. D.

    2010-09-01

    We investigate the ground-state and low-temperature properties of the integrable version of the Penson-Kolb-Hubbard chain. The model obeys fractional statistical properties, which give rise to fractional elementary excitations and manifest differently in the four regions of the phase diagram U/t versus n , where U is the Coulomb coupling, t is the correlated hopping amplitude, and n is the particle density. In fact, we can find local pair formation, fractionalization of the average occupation number per orbital k , or U - and n -dependent average electric charge per orbital k . We also study the scaling behavior near the U -driven quantum phase transitions and characterize their universality classes. Finally, it is shown that in the regime of parameters where local pair formation is energetically more favorable, the ground state exhibits power-law superconductivity; we also stress that above half filling the pair-hopping term stabilizes local Cooper pairs in the repulsive- U regime for U

  6. Three candidate double clusters in the LMC: truth or dare?

    NASA Astrophysics Data System (ADS)

    Dalessandro, Emanuele; Zocchi, Alice; Varri, Anna Lisa; Mucciarelli, Alessio; Bellazzini, Michele; Ferraro, Francesco R.; Lanzoni, Barbara; Lapenna, Emilio; Origlia, Livia

    2018-02-01

    The Large Magellanic Cloud (LMC) hosts a large number of candidate stellar cluster pairs. Binary stellar clusters provide important clues about cluster formation processes and the evolutionary history of the host galaxy. However, to properly extract and interpret this information, it is crucial to fully constrain the fraction of real binary systems and their physical properties. Here we present a detailed photometric analysis based on ESO-FORS2 images of three candidate cluster multiplets in the LMC, namely SL349-SL353, SL385-SL387-NGC 1922 and NGC 1836-BRHT4b-NGC 1839. For each cluster, we derived ages, structural parameters and morphological properties. We have also estimated the degree of filling of their Roche lobe, as an approximate tool to measure the strength of the tidal perturbations induced by the LMC. We find that the members of the possible pairs SL349-SL353 and BRHT4b-NGC 1839 have a similar age (t = 1.00 ± 0.12 Gyr and t = 140 ± 15 Myr, respectively), thus possibly hinting at a common origin of their member systems. We also find that all candidate pairs in our sample show evidence of intracluster overdensities that can be a possible indication of real binarity. Particularly interesting is the case of SL349-SL353. In fact, SL353 is relatively close to the condition of critical filling, thus suggesting that these systems might actually constitute an energetically bound pair. It is therefore key to pursue a detailed kinematic screening of such clusters, without which, at present, we do not dare making a conclusive statement about the true nature of this putative pair.

  7. Generation of arbitrary vector fields based on a pair of orthogonal elliptically polarized base vectors.

    PubMed

    Xu, Danfeng; Gu, Bing; Rui, Guanghao; Zhan, Qiwen; Cui, Yiping

    2016-02-22

    We present an arbitrary vector field with hybrid polarization based on the combination of a pair of orthogonal elliptically polarized base vectors on the Poincaré sphere. It is shown that the created vector field is only dependent on the latitude angle 2χ but is independent on the longitude angle 2ψ on the Poincaré sphere. By adjusting the latitude angle 2χ, which is related to two identical waveplates in a common path interferometric arrangement, one could obtain arbitrary type of vector fields. Experimentally, we demonstrate the generation of such kind of vector fields and confirm the distribution of state of polarization by the measurement of Stokes parameters. Besides, we investigate the tight focusing properties of these vector fields. It is found that the additional degree of freedom 2χ provided by arbitrary vector field with hybrid polarization allows one to control the spatial structure of polarization and to engineer the focusing field.

  8. Properties of isoscalar-pair condensates

    DOE PAGES

    Van Isacker, P.; Macchiavelli, A. O.; Fallon, P.; ...

    2016-08-17

    In this work, it is pointed out that the ground state of $n$ neutrons and n protons in a single-$j$ shell, interacting through an isoscalar ($T=0$) pairing force, is not paired, $J=0$, but rather spin aligned, $J=n$. This observation is explained in the context of a model of isoscalar $P(J=1)$ pairs, which is mapped onto a system of $p$ bosons, leading to an approximate analytic solution of the isoscalar-pairing limit in $jj$ coupling.

  9. The instrumental genesis process in future primary teachers using Dynamic Geometry Software

    NASA Astrophysics Data System (ADS)

    Ruiz-López, Natalia

    2018-05-01

    This paper, which describes a study undertaken with pairs of future primary teachers using GeoGebra software to solve geometry problems, includes a brief literature review, the theoretical framework and methodology used. An analysis of the instrumental genesis process for a pair participating in the case study is also provided. This analysis addresses the techniques and types of dragging used, the obstacles to learning encountered, a description of the interaction between the pair and their interaction with the teacher, and the type of language used. Based on this analysis, possibilities and limitations of the instrumental genesis process are identified for the development of geometric competencies such as conjecture creation, property checking and problem researching. It is also suggested that the methodology used in the analysis of the problem solving process may be useful for those teachers and researchers who want to integrate Dynamic Geometry Software (DGS) in their classrooms.

  10. Enhanced Security and Pairing-free Handover Authentication Scheme for Mobile Wireless Networks

    NASA Astrophysics Data System (ADS)

    Chen, Rui; Shu, Guangqiang; Chen, Peng; Zhang, Lijun

    2017-10-01

    With the widely deployment of mobile wireless networks, we aim to propose a secure and seamless handover authentication scheme that allows users to roam freely in wireless networks without worrying about security and privacy issues. Given the open characteristic of wireless networks, safety and efficiency should be considered seriously. Several previous protocols are designed based on a bilinear pairing mapping, which is time-consuming and inefficient work, as well as unsuitable for practical situations. To address these issues, we designed a new pairing-free handover authentication scheme for mobile wireless networks. This scheme is an effective improvement of the protocol by Xu et al., which is suffer from the mobile node impersonation attack. Security analysis and simulation experiment indicate that the proposed protocol has many excellent security properties when compared with other recent similar handover schemes, such as mutual authentication and resistance to known network threats, as well as requiring lower computation and communication cost.

  11. A homonuclear spin-pair filter for solid-state NMR based on adiabatic-passage techniques

    NASA Astrophysics Data System (ADS)

    Verel, René; Baldus, Marc; Ernst, Matthias; Meier, Beat H.

    1998-05-01

    A filtering scheme for the selection of spin pairs (and larger spin clusters) under fast magic-angle spinning is proposed. The scheme exploits the avoided level crossing in spin pairs during an adiabatic amplitude sweep through the so-called HORROR recoupling condition. The advantages over presently used double-quantum filters are twofold. (i) The maximum theoretical filter efficiency is, due to the adiabatic variation, 100% instead of 73% as for transient methods. (ii) Since the filter does not rely on the phase-cycling properties of the double-quantum coherence, there is no need to obtain the full double-quantum intensity for all spins in the sample at one single point in time. The only important requirement is that all coupled spins pass through a two-spin state during the amplitude sweep. This makes the pulse scheme robust with respect to rf-amplitude missetting, rf-field inhomogeneity and chemical-shift offset.

  12. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kondo, Takeshi; Palczewski, Ari; Hamaya, Yoichiro

    We use angle-resolved photoemission spectroscopy and a new quantitative approach based on the partial density of states to study properties of seemingly disconnected portions of the Fermi surface (FS) that are present in the pseudogap state of cuprates called Fermi arcs. We find that the normal state FS collapses very abruptly into Fermi arcs at the pseudogap temperature (T*). Surprisingly, the length of the Fermi arcs remains constant over an extended temperature range between (T*) and T pair, consistent with the presence of an ordered state below T*. These arcs collapse again at the temperature below which pair formation occursmore » (T pair) either to a point or a very short arc, whose length is limited by our experimental resolution. The tips of the arcs span between points defining a set of wave vectors in momentum space, which are the fingerprints of the ordered state that causes the pseudogap.« less

  13. A molecular-field approximation for quantum crystals. Ph.D. Thesis; [considering ground state properties

    NASA Technical Reports Server (NTRS)

    Danilowicz, R.

    1973-01-01

    Ground-state properties of quantum crystals have received considerable attention from both theorists and experimentalists. The theoretical results have varied widely with the Monte Carlo calculations being the most successful. The molecular field approximation yields ground-state properties which agree closely with the Monte Carlo results. This approach evaluates the dynamical behavior of each pair of molecules in the molecular field of the other N-2 molecules. In addition to predicting ground-state properties that agree well with experiment, this approach yields data on the relative importance of interactions of different nearest neighbor pairs.

  14. Mixtures of amino-acid based ionic liquids and water.

    PubMed

    Chaban, Vitaly V; Fileti, Eudes Eterno

    2015-09-01

    New ionic liquids (ILs) involving increasing numbers of organic and inorganic ions are continuously being reported. We recently developed a new force field; in the present work, we applied that force field to investigate the structural properties of a few novel imidazolium-based ILs in aqueous mixtures via molecular dynamics (MD) simulations. Using cluster analysis, radial distribution functions, and spatial distribution functions, we argue that organic ions (imidazolium, deprotonated alanine, deprotonated methionine, deprotonated tryptophan) are well dispersed in aqueous media, irrespective of the IL content. Aqueous dispersions exhibit desirable properties for chemical engineering. The ILs exist as ion pairs in relatively dilute aqueous mixtures (10 mol%), while more concentrated mixtures feature a certain amount of larger ionic aggregates.

  15. Correspondence between ion-cluster and bulk thermodynamics: on the validity of the cluster pair approximation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vlcek, Lukas; Chialvo, Ariel; Simonson, J Michael

    2013-01-01

    Molecular models and experimental estimates based on the cluster pair approximation (CPA) provide inconsistent predictions of absolute single-ion hydration properties. To understand the origin of this discrepancy we used molecular simulations to study the transition between hydration of alkali metal and halide ions in small aqueous clusters and bulk water. The results demonstrate that the assumptions underlying the CPA are not generally valid as a result of a significant shift in the ion hydration free energies (~15 kJ/mol) and enthalpies (~47 kJ/mol) in the intermediate range of cluster sizes. When this effect is accounted for, the systematic differences between modelsmore » and experimental predictions disappear, and the value of absolute proton hydration enthalpy based on the CPA gets in closer agreement with other estimates.« less

  16. Implementing Diffie-Hellman key exchange using quantum EPR pairs

    NASA Astrophysics Data System (ADS)

    Mandal, Sayonnha; Parakh, Abhishek

    2015-05-01

    This paper implements the concepts of perfect forward secrecy and the Diffie-Hellman key exchange using EPR pairs to establish and share a secret key between two non-authenticated parties and transfer messages between them without the risk of compromise. Current implementations of quantum cryptography are based on the BB84 protocol, which is susceptible to siphoning attacks on the multiple photons emitted by practical laser sources. This makes BB84-based quantum cryptography protocol unsuitable for network computing environments. Diffie-Hellman does not require the two parties to be mutually authenticated to each other, yet it can provide a basis for a number of authenticated protocols, most notably the concept of perfect forward secrecy. The work proposed in this paper provides a new direction in utilizing quantum EPR pairs in quantum key exchange. Although, classical cryptography boasts of efficient and robust protocols like the Diffie-Hellman key exchange, in the current times, with the advent of quantum computing they are very much vulnerable to eavesdropping and cryptanalytic attacks. Using quantum cryptographic principles, however, these classical encryption algorithms show more promise and a more robust and secure structure for applications. The unique properties of quantum EPR pairs also, on the other hand, go a long way in removing attacks like eavesdropping by their inherent nature of one particle of the pair losing its state if a measurement occurs on the other. The concept of perfect forward secrecy is revisited in this paper to attribute tighter security to the proposed protocol.

  17. 41 CFR 301-10.106 - When must I use a contract city-pair fare?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... contract city-pair fare? 301-10.106 Section 301-10.106 Public Contracts and Property Management Federal...-TRANSPORTATION EXPENSES Common Carrier Transportation Use of Contract City-Pair Fares § 301-10.106 When must I use a contract city-pair fare? If you are a civilian employee of an agency as defined in § 301-1.1 of...

  18. 41 CFR 301-10.107 - Are there any exceptions to the use of a contract city-pair fare?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... to the use of a contract city-pair fare? 301-10.107 Section 301-10.107 Public Contracts and Property... 10-TRANSPORTATION EXPENSES Common Carrier Transportation Use of Contract City-Pair Fares § 301-10.107 Are there any exceptions to the use of a contract city-pair fare? Yes, your agency may authorize use...

  19. 41 CFR 301-10.107 - Are there any exceptions to the use of a contract city-pair fare?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... to the use of a contract city-pair fare? 301-10.107 Section 301-10.107 Public Contracts and Property... 10-TRANSPORTATION EXPENSES Common Carrier Transportation Use of Contract City-Pair Fares § 301-10.107 Are there any exceptions to the use of a contract city-pair fare? Yes, your agency may authorize use...

  20. 41 CFR 301-10.106 - When must I use a contract city-pair fare?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... contract city-pair fare? 301-10.106 Section 301-10.106 Public Contracts and Property Management Federal...-TRANSPORTATION EXPENSES Common Carrier Transportation Use of Contract City-Pair Fares § 301-10.106 When must I use a contract city-pair fare? If you are a civilian employee of an agency as defined in § 301-1.1 of...

  1. The Negative Repetition Effect

    ERIC Educational Resources Information Center

    Mulligan, Neil W.; Peterson, Daniel J.

    2013-01-01

    A fundamental property of human memory is that repetition enhances memory. Peterson and Mulligan (2012) recently documented a surprising "negative repetition effect," in which participants who studied a list of cue-target pairs twice recalled fewer targets than a group who studied the pairs only once. Words within a pair rhymed, and…

  2. Electric Conduction in Semiconductors: A Pedagogical Model Based on the Monte Carlo Method

    ERIC Educational Resources Information Center

    Capizzo, M. C.; Sperandeo-Mineo, R. M.; Zarcone, M.

    2008-01-01

    We present a pedagogic approach aimed at modelling electric conduction in semiconductors in order to describe and explain some macroscopic properties, such as the characteristic behaviour of resistance as a function of temperature. A simple model of the band structure is adopted for the generation of electron-hole pairs as well as for the carrier…

  3. A pair of novel Cd(II) enantiomers based on lactate derivatives: Synthesis, crystal structures and properties

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xu, Zhong-Xuan, E-mail: xuzhongxuan1974@163.com; State Key Laboratory of Structural Chemistry, Fujian Institute of Research on the Structure of Matter, the Chinese Academy of Sciences, Fuzhou, Fujian 350002; Ao, Ke-Hou

    A pair of novel 3D homochiral metal−organic frameworks (HMOFs), namely [Cd{sub 2.5}((R)-CIA){sub 6}(1,4-DIB)(H{sub 2}O){sub 2}]·((CH{sub 3}){sub 2}NH{sub 2})·H{sub 2}O (1-D), [Cd{sub 2.5}((S)-CIA){sub 6}(1,4-DIB)(H{sub 2}O){sub 2}]·((CH{sub 3}){sub 2}NH{sub 2})·H{sub 2}O (1-L), have been synthesized using lactic acid derivative ligands ((R)-H{sub 3}CIA and (S)-H{sub 3}CIA) and 1,4-DIB. Crystallographic analyses indicate that the complexes 1-D and 1-L are packed by cage substructures. Some physical characteristics, such as solid-state circular dichroism (CD), thermal stabilities and photoluminescent properties are also investigated. Our results highlight the effective method to apply lactic acid derivative ligands to form interesting HMOFs. - Graphical abstract: Using lactic acid derivative ligandsmore » ((R)-H{sub 3}CIA and (S)-H{sub 3}CIA) and 1,4-DIB to assemble with Cd{sup 2+} ions, a pair of novel 3D homochiral metal-organic frameworks (HMOFs) with cage substructures have been synthesized. Display Omitted - Highlights: • Lactic acid derivative ligands • Cage substructure • Enantiomers.« less

  4. Predicting RNA Duplex Dimerization Free-Energy Changes upon Mutations Using Molecular Dynamics Simulations.

    PubMed

    Sakuraba, Shun; Asai, Kiyoshi; Kameda, Tomoshi

    2015-11-05

    The dimerization free energies of RNA-RNA duplexes are fundamental values that represent the structural stability of RNA complexes. We report a comparative analysis of RNA-RNA duplex dimerization free-energy changes upon mutations, estimated from a molecular dynamics simulation and experiments. A linear regression for nine pairs of double-stranded RNA sequences, six base pairs each, yielded a mean absolute deviation of 0.55 kcal/mol and an R(2) value of 0.97, indicating quantitative agreement between simulations and experimental data. The observed accuracy indicates that the molecular dynamics simulation with the current molecular force field is capable of estimating the thermodynamic properties of RNA molecules.

  5. Report on Pairing-based Cryptography.

    PubMed

    Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

    2015-01-01

    This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.

  6. Report on Pairing-based Cryptography

    PubMed Central

    Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

    2015-01-01

    This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST’s position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed. PMID:26958435

  7. AzaHx, a novel fluorescent, DNA minor groove and G·C recognition element: Synthesis and DNA binding properties of a p-anisyl-4-aza-benzimidazole-pyrrole-imidazole (azaHx-PI) polyamide.

    PubMed

    Satam, Vijay; Babu, Balaji; Patil, Pravin; Brien, Kimberly A; Olson, Kevin; Savagian, Mia; Lee, Megan; Mepham, Andrew; Jobe, Laura Beth; Bingham, John P; Pett, Luke; Wang, Shuo; Ferrara, Maddi; Bruce, Chrystal D; Wilson, W David; Lee, Moses; Hartley, John A; Kiakos, Konstantinos

    2015-09-01

    The design, synthesis, and DNA binding properties of azaHx-PI or p-anisyl-4-aza-benzimidazole-pyrrole-imidazole (5) are described. AzaHx, 2-(p-anisyl)-4-aza-benzimidazole-5-carboxamide, is a novel, fluorescent DNA recognition element, derived from Hoechst 33258 to recognize G·C base pairs. Supported by theoretical data, the results from DNase I footprinting, CD, ΔT(M), and SPR studies provided evidence that an azaHx/IP pairing, formed from antiparallel stacking of two azaHx-PI molecules in a side-by-side manner in the minor groove, selectively recognized a C-G doublet. AzaHx-PI was found to target 5'-ACGCGT-3', the Mlu1 Cell Cycle Box (MCB) promoter sequence with specificity and significant affinity (K(eq) 4.0±0.2×10(7) M(-1)). Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Atomic and electronic properties of quasi-one-dimensional MOS2 nanowires

    PubMed Central

    Seivane, Lucas Fernandez; Barron, Hector; Botti, Silvana; Marques, Miguel Alexandre Lopes; Rubio, Ángel; López-Lozano, Xóchitl

    2013-01-01

    The structural, electronic and magnetic properties of quasi-one-dimensional MoS2 nanowires, passivated by extra sulfur, have been determined using ab initio density-functional theory. The nanostructures were simulated using several different models based on experimental electron microscopy images. It is found that independently of the geometrical details and the coverage of extra sulfur at the Mo-edge, quasi-one-dimensional metallic states are predominant in all the low-energy model structures despite their reduced dimensionality. These metallic states are localized mainly at the edges. However, the electronic and magnetic character of the NWs does not depend only on the S saturation but also on the symmetry configuration of the S edge atoms. Our results show that for the same S saturation the magnetization can be decreased by increasing the pairing of the S and Mo edge atoms. In spite of the observed pairing of S dimers at the Mo-edge, the nanowires do not experience a Peierls-like metal-insulator transition PMID:25429189

  9. Dual-Vivaldi wideband nanoantenna with high radiation efficiency over the infrared frequency band.

    PubMed

    Iluz, Zeev; Boag, Amir

    2011-08-01

    A dual-Vivaldi nanoantenna is proposed to demonstrate the possibility of wideband operation at IR frequencies. The antenna geometry design is guided by the material properties of metals at IR frequencies. According to our numerical results, this nanoantenna has both high radiation efficiency and good impedance-matching properties over a wide frequency band (more than 122%) in the IR frequency band. The design is based on the well-known Vivaldi antenna placed on quartz substrate but operating as a pair instead of a single element. Such a pair of Vivaldi antennas oriented in opposite directions produces the main lobe in the broadside direction (normal to the axes of the antennas) rather than the usual peak gain along the axis (end fire) of a single Vivaldi antenna. The dual-Vivaldi nanoantenna is easy to fabricate in a conventional electron-beam lithography process, and it provides a large number of degrees of freedom, facilitating design for ultra-wideband operation. © 2011 Optical Society of America

  10. Diffusion and viscosity of liquid tin: Green-Kubo relationship-based calculations from molecular dynamics simulations

    NASA Astrophysics Data System (ADS)

    Mouas, Mohamed; Gasser, Jean-Georges; Hellal, Slimane; Grosdidier, Benoît; Makradi, Ahmed; Belouettar, Salim

    2012-03-01

    Molecular dynamics (MD) simulations of liquid tin between its melting point and 1600 °C have been performed in order to interpret and discuss the ionic structure. The interactions between ions are described by a new accurate pair potential built within the pseudopotential formalism and the linear response theory. The calculated structure factor that reflects the main information on the local atomic order in liquids is compared to diffraction measurements. Having some confidence in the ability of this pair potential to give a good representation of the atomic structure, we then focused our attention on the investigation of the atomic transport properties through the MD computations of the velocity autocorrelation function and stress autocorrelation function. Using the Green-Kubo formula (for the first time to our knowledge for liquid tin) we determine the macroscopic transport properties from the corresponding microscopic time autocorrelation functions. The selfdiffusion coefficient and the shear viscosity as functions of temperature are found to be in good agreement with the experimental data.

  11. Can nuclear physics explain the anomaly observed in the internal pair production in the Beryllium-8 nucleus?

    NASA Astrophysics Data System (ADS)

    Zhang, Xilin; Miller, Gerald A.

    2017-10-01

    Recently the experimentalists in Krasznahorkay (2016) [1] announced observing an unexpected enhancement of the e+-e- pair production signal in one of the 8Be nuclear transitions. The subsequent studies have been focused on possible explanations based on introducing new types of particle. In this work, we improve the nuclear physics modeling of the reaction by studying the pair emission anisotropy and the interferences between different multipoles in an effective field theory inspired framework, and examine their possible relevance to the anomaly. The connection between the previously measured on-shell photon production and the pair production in the same nuclear transitions is established. These improvements, absent in the original experimental analysis, should be included in extracting new particle's properties from the experiment of this type. However, the improvements can not explain the anomaly. We then explore the nuclear transition form factor as a possible origin of the anomaly, and find the required form factor to be unrealistic for the 8Be nucleus. The reduction of the anomaly's significance by simply rescaling our predicted event count is also investigated.

  12. VizieR Online Data Catalog: Dust properties of major-merger galaxy pairs (Domingue+, 2016)

    NASA Astrophysics Data System (ADS)

    Domingue, D. L.; Cao, C.; Xu, C. K.; Jarrett, T. H.; Ronca, J.; Hill, E.; Jacques, A.

    2018-04-01

    We present an analysis of dust properties of a sample of close major-merger galaxy pairs selected by Ks magnitude and redshift. The pairs represent the two populations of spiral-spiral (S+S) and mixed morphology spiral-elliptical (S+E). The Code Investigating GALaxy Emission (CIGALE) software is used to fit dust models to the Two Micron All Sky Survey, Wide-Field Infrared Survey Explorer, and Herschel flux density measurements, and to derive the parameters describing the polycyclic aromatic hydrocarbons contribution, interstellar radiation field, and photodissociation regions. Model fits verify our previous Spitzer Space Telescope analysis that S+S and S+E pairs do not have the same level of enhancement of star formation and differ in dust composition. (1 data file).

  13. Monitoring molecular interactions using photon arrival-time interval distribution analysis

    DOEpatents

    Laurence, Ted A [Livermore, CA; Weiss, Shimon [Los Angels, CA

    2009-10-06

    A method for analyzing/monitoring the properties of species that are labeled with fluorophores. A detector is used to detect photons emitted from species that are labeled with one or more fluorophores and located in a confocal detection volume. The arrival time of each of the photons is determined. The interval of time between various photon pairs is then determined to provide photon pair intervals. The number of photons that have arrival times within the photon pair intervals is also determined. The photon pair intervals are then used in combination with the corresponding counts of intervening photons to analyze properties and interactions of the molecules including brightness, concentration, coincidence and transit time. The method can be used for analyzing single photon streams and multiple photon streams.

  14. Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics

    PubMed Central

    Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.

    2015-01-01

    Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

  15. Influence of ion pairing in ionic liquids on electrical double layer structures and surface force using classical density functional approach.

    PubMed

    Ma, Ke; Forsman, Jan; Woodward, Clifford E

    2015-05-07

    We explore the influence of ion pairing in room temperature ionic liquids confined by planar electrode surfaces. Using a coarse-grained model for the aromatic ionic liquid [C4MIM(+)][BF4 (-)], we account for an ion pairing component as an equilibrium associating species within a classical density functional theory. We investigated the resulting structure of the electrical double layer as well as the ensuing surface forces and differential capacitance, as a function of the degree of ion association. We found that the short-range structure adjacent to surfaces was remarkably unaffected by the degree of ion pairing, up to several molecular diameters. This was even the case for 100% of ions being paired. The physical implications of ion pairing only become apparent in equilibrium properties that depend upon the long-range screening of charges, such as the asymptotic behaviour of surface forces and the differential capacitance, especially at low surface potential. The effect of ion pairing on capacitance is consistent with their invocation as a source of the anomalous temperature dependence of the latter. This work shows that ion pairing effects on equilibrium properties are subtle and may be difficult to extract directly from simulations.

  16. Near Earth Asteroid Characterization for Threat Assessment

    NASA Technical Reports Server (NTRS)

    Dotson, Jessie; Mathias, Donovan; Wheeler, Lorien; Wooden, Diane; Bryson, Kathryn; Ostrowski, Daniel

    2017-01-01

    Physical characteristics of NEAs are an essential input to modeling behavior during atmospheric entry and to assess the risk of impact but determining these properties requires a non-trivial investment of time and resources. The characteristics relevant to these models include size, density, strength and ablation coefficient. Some of these characteristics cannot be directly measured, but rather must be inferred from related measurements of asteroids and/or meteorites. Furthermore, for the majority of NEAs, only the basic measurements exist so often properties must be inferred from statistics of the population of more completely characterized objects. The Asteroid Threat Assessment Project at NASA Ames Research Center has developed a probabilistic asteroid impact risk (PAIR) model in order to assess the risk of asteroid impact. Our PAIR model and its use to develop probability distributions of impact risk are discussed in other contributions to PDC 2017 (e.g., Mathias et al.). Here we utilize PAIR to investigate which NEA characteristics are important for assessing the impact threat by investigating how changes in these characteristics alter the damage predicted by PAIR. We will also provide an assessment of the current state of knowledge of the NEA characteristics of importance for asteroid threat assessment. The relative importance of different properties as identified using PAIR will be combined with our assessment of the current state of knowledge to identify potential high impact investigations. In addition, we will discuss an ongoing effort to collate the existing measurements of NEA properties of interest to the planetary defense community into a readily accessible database.

  17. A facile approach to prepare a dual functionalized DNA based material in a bio-deep eutectic solvent.

    PubMed

    Mondal, Dibyendu; Bhatt, Jitkumar; Sharma, Mukesh; Chatterjee, Shruti; Prasad, Kamalesh

    2014-04-18

    DNA (Salmon testes) was functionalized by Fe3O4 nanoparticles and protonated layered dititanate sheets (H2·Ti2O5·H2O) in a mixture of choline chloride and ethylene glycol (a deep eutectic solvent) to yield a hybrid material having magnetic and antibacterial properties. Ti sheets were found to interact with the phosphate moieties, while Fe interacted with the base pair of DNA in the hybrid material.

  18. Detection of figure and caption pairs based on disorder measurements

    NASA Astrophysics Data System (ADS)

    Faure, Claudie; Vincent, Nicole

    2010-01-01

    Figures inserted in documents mediate a kind of information for which the visual modality is more appropriate than the text. A complete understanding of a figure often necessitates the reading of its caption or to establish a relationship with the main text using a numbered figure identifier which is replicated in the caption and in the main text. A figure and its caption are closely related; they constitute single multimodal components (FC-pair) that Document Image Analysis cannot extract with text and graphics segmentation. We propose a method to go further than the graphics and text segmentation in order to extract FC-pairs without performing a full labelling of the page components. Horizontal and vertical text lines are detected in the pages. The graphics are associated with selected text lines to initiate the detector of FC-pairs. Spatial and visual disorders are introduced to define a layout model in terms of properties. It enables to cope with most of the numerous spatial arrangements of graphics and text lines. The detector of FC-pairs performs operations in order to eliminate the layout disorder and assigns a quality value to each FC-pair. The processed documents were collected in medic@, the digital historical collection of the BIUM (Bibliothèque InterUniversitaire Médicale). A first set of 98 pages constitutes the design set. Then 298 pages were collected to evaluate the system. The performances are the result of a full process, from the binarisation of the digital images to the detection of FC-pairs.

  19. Isoguanine and 5-Methyl-Isocytosine Bases, In Vitro and In Vivo

    PubMed Central

    Bande, Omprakash; Abu El Asrar, Rania; Braddick, Darren; Dumbre, Shrinivas; Pezo, Valérie; Schepers, Guy; Pinheiro, Vitor B; Lescrinier, Eveline; Holliger, Philipp; Marlière, Philippe; Herdewijn, Piet

    2015-01-01

    The synthesis, base-pairing properties and in vitro and in vivo characteristics of 5-methyl-isocytosine (isoCMe) and isoguanine (isoG) nucleosides, incorporated in an HNA(h) (hexitol nucleic acid)–DNA(d) mosaic backbone, are described. The required h-isoG phosphoramidite was prepared by a selective deamination as a key step. As demonstrated by Tm measurements the hexitol sugar showed slightly better mismatch discrimination against dT. The d-isoG base mispairing follows the order T>G>C while the h-isoG base mispairing follows the order G>C>T. The h- and d-isoCMe bases mainly mispair with G. Enzymatic incorporation experiments show that the hexitol backbone has a variable effect on selectivity. In the enzymatic assays, isoG misincorporates mainly with T, and isoCMe misincorporates mainly with A. Further analysis in vivo confirmed the patterns of base-pair interpretation for the deoxyribose and hexitol isoCMe/isoG bases in a cellular context, through incorporation of the bases into plasmidic DNA. Results in vivo demonstrated that mispairing and misincorporation was dependent on the backbone scaffold of the base, which indicates rational advances towards orthogonality. PMID:25684598

  20. Systematic and simulation-free coarse graining of homopolymer melts: a relative-entropy-based study.

    PubMed

    Yang, Delian; Wang, Qiang

    2015-09-28

    We applied the systematic and simulation-free strategy proposed in our previous work (D. Yang and Q. Wang, J. Chem. Phys., 2015, 142, 054905) to the relative-entropy-based (RE-based) coarse graining of homopolymer melts. RE-based coarse graining provides a quantitative measure of the coarse-graining performance and can be used to select the appropriate analytic functional forms of the pair potentials between coarse-grained (CG) segments, which are more convenient to use than the tabulated (numerical) CG potentials obtained from structure-based coarse graining. In our general coarse-graining strategy for homopolymer melts using the RE framework proposed here, the bonding and non-bonded CG potentials are coupled and need to be solved simultaneously. Taking the hard-core Gaussian thread model (K. S. Schweizer and J. G. Curro, Chem. Phys., 1990, 149, 105) as the original system, we performed RE-based coarse graining using the polymer reference interaction site model theory under the assumption that the intrachain segment pair correlation functions of CG systems are the same as those in the original system, which de-couples the bonding and non-bonded CG potentials and simplifies our calculations (that is, we only calculated the latter). We compared the performance of various analytic functional forms of non-bonded CG pair potential and closures for CG systems in RE-based coarse graining, as well as the structural and thermodynamic properties of original and CG systems at various coarse-graining levels. Our results obtained from RE-based coarse graining are also compared with those from structure-based coarse graining.

  1. The First Row Anomaly and Recoupled Pair Bonding in the Halides of the Late p-Block Elements

    PubMed Central

    2012-01-01

    The dramatic differences between the properties of molecules formed from the late p-block elements of the first row of the periodic table (N–F) and those of the corresponding elements in subsequent rows is well recognized as the first row anomaly. Certain properties of the atoms, such as the relative energies and spatial extents of the ns and np orbitals, can explain some of these differences, but not others. In this Account, we summarize the results of our recent computational studies of the halides of the late p-block elements. Our studies point to a single underlying cause for many of these differences: the ability of the late p-block elements in the second and subsequent rows of the periodic table to form recoupled pair bonds and recoupled pair bond dyads with very electronegative ligands. Recoupled pair bonds form when an electron in a singly occupied ligand orbital recouples the pair of electrons in a doubly occupied lone pair orbital on the central atom, leading to a central atom-ligand bond. Recoupled pair bond dyads occur when a second ligand forms a bond with the orbital left over from the initial recoupled pair bond. Recoupled pair bonds and recoupled pair bond dyads enable the late p-block elements to form remarkably stable hypervalent compounds such as PF5 and SF6 and lead to unexpected excited states in smaller halides of the late p-block elements such as SF and SF2. Recoupled pair bonding also causes the Fn–1X–F bond energies to oscillate dramatically once the normal valences of the central atoms have been satisfied. In addition, recoupled pair bonding provides a lower-energy pathway for inversion in heavily fluorinated compounds (PF3 and PF2H, but not PH2F and PH3) and leads to unusual intermediates and products in reactions involving halogens and late p-block element compounds, such as (CH3)2S + F2. Although this Account focuses on the halides of the second row, late p-block elements, recoupled pair bonds and recoupled pair bond dyads are important in the chemistry of p-block elements beyond the second row (As, Se, and Br) and for compounds of these elements with other very electronegative ligands, such as OH and O. Knowledge of recoupled pair bonding is thus critical to understanding the properties and reactivity of molecules containing the late p-block elements beyond the first row. PMID:23151313

  2. The first row anomaly and recoupled pair bonding in the halides of the late p-block elements.

    PubMed

    Dunning, Thom H; Woon, David E; Leiding, Jeff; Chen, Lina

    2013-02-19

    The dramatic differences between the properties of molecules formed from the late p-block elements of the first row of the periodic table (N-F) and those of the corresponding elements in subsequent rows is well recognized as the first row anomaly. Certain properties of the atoms, such as the relative energies and spatial extents of the ns and np orbitals, can explain some of these differences, but not others. In this Account, we summarize the results of our recent computational studies of the halides of the late p-block elements. Our studies point to a single underlying cause for many of these differences: the ability of the late p-block elements in the second and subsequent rows of the periodic table to form recoupled pair bonds and recoupled pair bond dyads with very electronegative ligands. Recoupled pair bonds form when an electron in a singly occupied ligand orbital recouples the pair of electrons in a doubly occupied lone pair orbital on the central atom, leading to a central atom-ligand bond. Recoupled pair bond dyads occur when a second ligand forms a bond with the orbital left over from the initial recoupled pair bond. Recoupled pair bonds and recoupled pair bond dyads enable the late p-block elements to form remarkably stable hypervalent compounds such as PF(5) and SF(6) and lead to unexpected excited states in smaller halides of the late p-block elements such as SF and SF(2). Recoupled pair bonding also causes the F(n-1)X-F bond energies to oscillate dramatically once the normal valences of the central atoms have been satisfied. In addition, recoupled pair bonding provides a lower-energy pathway for inversion in heavily fluorinated compounds (PF(3) and PF(2)H, but not PH(2)F and PH(3)) and leads to unusual intermediates and products in reactions involving halogens and late p-block element compounds, such as (CH(3))(2)S + F(2). Although this Account focuses on the halides of the second row, late p-block elements, recoupled pair bonds and recoupled pair bond dyads are important in the chemistry of p-block elements beyond the second row (As, Se, and Br) and for compounds of these elements with other very electronegative ligands, such as OH and O. Knowledge of recoupled pair bonding is thus critical to understanding the properties and reactivity of molecules containing the late p-block elements beyond the first row.

  3. Nucleic acid duplexes incorporating a dissociable covalent base pair

    NASA Technical Reports Server (NTRS)

    Gao, K.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    1999-01-01

    We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure.

  4. Equations of state and transport properties of mixtures in the warm dense regime

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hou, Yong; Dai, Jiayu; Kang, Dongdong

    2015-02-15

    We have performed average-atom molecular dynamics to simulate the CH and LiH mixtures in the warm dense regime, and obtained equations of state and the ionic transport properties. The electronic structures are calculated by using the modified average-atom model, which have included the broadening of energy levels, and the ion-ion pair potentials of mixtures are constructed based on the temperature-dependent density functional theory. The ionic transport properties, such as ionic diffusion and shear viscosity, are obtained through the ionic velocity correlation functions. The equations of state and transport properties for carbon, hydrogen and lithium, hydrogen mixtures in a wide regionmore » of density and temperature are calculated. Through our computing the average ionization degree, average ion-sphere diameter and transition properties in the mixture, it is shown that transport properties depend not only on the ionic mass but also on the average ionization degree.« less

  5. Identification of repeating earthquakes and spatio-temporal variations of fault zone properties around the Parkfield section of the San Andreas fault and the central Calaveras fault

    NASA Astrophysics Data System (ADS)

    Zhao, P.; Peng, Z.

    2008-12-01

    We systemically identify repeating earthquakes and investigate spatio-temporal variations of fault zone properties associated with the 2004 Mw6.0 Parkfield earthquake along the Parkfield section of the San Andreas fault, and the 1984 Mw6.2 Morgan Hill earthquake along the central Calaveras fault. The procedure for identifying repeating earthquakes is based on overlapping of the source regions and the waveform similarity, and is briefly described as follows. First, we estimate the source radius of each event based on a circular crack model and a normal stress drop of 3 MPa. Next, we compute inter-hypocentral distance for events listed in the relocated catalog of Thurber et al. (2006) around Parkfield, and Schaff et al. (2002) along the Calaveras fault. Then, we group all events into 'initial' clusters by requiring the separation distance between each event pair to be less than the source radius of larger event, and their magnitude difference to be less than 1. Next, we calculate the correlation coefficients between every event pair within each 'initial' cluster using a 3-s time window around the direct P waves for all available stations. The median value of the correlation coefficients is used as a measure of similarity between each event pair. We drop an event if the median similarity to the rest events in that cluster is less than 0.9. After identifying repeating clusters in both regions, our next step is to apply a sliding window waveform cross-correlation technique (Niu et al., 2003; Peng and Ben-Zion, 2006) to calculate the delay time and decorrelation index for each repeating cluster. By measuring temporal changes in waveforms of repeating clusters at different locations and depth, we hope to obtain a better constraint on spatio-temporal variations of fault zone properties and near-surface layers associated with the occurrence of major earthquakes.

  6. Utilizing Intrinsic Properties of Polyaniline to Detect Nucleic Acid Hybridization through UV-Enhanced Electrostatic Interaction.

    PubMed

    Sengupta, Partha Pratim; Gloria, Jared N; Amato, Dahlia N; Amato, Douglas V; Patton, Derek L; Murali, Beddhu; Flynt, Alex S

    2015-10-12

    Detection of specific RNA or DNA molecules by hybridization to "probe" nucleic acids via complementary base-pairing is a powerful method for analysis of biological systems. Here we describe a strategy for transducing hybridization events through modulating intrinsic properties of the electroconductive polymer polyaniline (PANI). When DNA-based probes electrostatically interact with PANI, its fluorescence properties are increased, a phenomenon that can be enhanced by UV irradiation. Hybridization of target nucleic acids results in dissociation of probes causing PANI fluorescence to return to basal levels. By monitoring restoration of base PANI fluorescence as little as 10(-11) M (10 pM) of target oligonucleotides could be detected within 15 min of hybridization. Detection of complementary oligos was specific, with introduction of a single mismatch failing to form a target-probe duplex that would dissociate from PANI. Furthermore, this approach is robust and is capable of detecting specific RNAs in extracts from animals. This sensor system improves on previously reported strategies by transducing highly specific probe dissociation events through intrinsic properties of a conducting polymer without the need for additional labels.

  7. High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

    PubMed

    Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2015-11-02

    Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Chemical Isotope Labeling LC-MS for High Coverage and Quantitative Profiling of the Hydroxyl Submetabolome in Metabolomics.

    PubMed

    Zhao, Shuang; Luo, Xian; Li, Liang

    2016-11-01

    A key step in metabolomics is to perform accurate relative quantification of the metabolomes in comparative samples with high coverage. Hydroxyl-containing metabolites are an important class of the metabolome with diverse structures and physical/chemical properties; however, many of them are difficult to detect with high sensitivity. We present a high-performance chemical isotope labeling liquid chromatography mass spectrometry (LC-MS) technique for in-depth profiling of the hydroxyl submetabolome, which involves the use of acidic liquid-liquid extraction to enrich hydroxyl metabolites into ethyl acetate from an aqueous sample. After drying and then redissolving in acetonitrile, the metabolite extract is labeled using a base-activated 12 C- or 13 C-dansylation reaction. A fast step-gradient LC-UV method is used to determine the total concentration of labeled metabolites. On the basis of the concentration information, a 12 C-labeled individual sample is mixed with an equal mole amount of a 13 C-labeled pool or control for relative metabolite quantification. The 12 C-/ 13 C-labeled mixtures are individually analyzed by LC-MS, and the resultant peak pairs of labeled metabolites in MS are measured for relative quantification and metabolite identification. A standard library of 85 hydroxyl compounds containing MS, retention time, and MS/MS information was constructed for positive metabolite identification based on matches of two or all three of these parameters with those of an unknown. Using human urine as an example, we analyzed samples of 1:1 12 C-/ 13 C-labeled urine in triplicate with triplicate runs per sample and detected an average of 3759 ± 45 peak pairs or metabolites per run and 3538 ± 71 pairs per sample with 3093 pairs in common (n = 9). Out of the 3093 peak pairs, 2304 pairs (75%) could be positively or putatively identified based on metabolome database searches, including 20 pairs positively identified using the dansylated hydroxyl standards library. The majority of detected metabolites were those containing hydroxyl groups. This technique opens a new avenue for the detailed characterization of the hydroxyl submetabolome in metabolomics research.

  9. Radiation Effects on the Electrical Properties of Hafnium Oxide Based MOS Capacitors

    DTIC Science & Technology

    2011-03-01

    Figures Figure Page 1. Conceptual illustration of the creation of electron-hole pairs and displacement damage in a n -type silicon metal-oxide-silicon...Illustration of the effect, in a CV plot, of oxide trapped charge for a hypothetical n -type device...8 5. Illustration of the effect, in a CV plot, of interface trapped charge for a hypothetical n -type device

  10. Experimental generation of complex noisy photonic entanglement

    NASA Astrophysics Data System (ADS)

    Dobek, K.; Karpiński, M.; Demkowicz-Dobrzański, R.; Banaszek, K.; Horodecki, P.

    2013-02-01

    We present an experimental scheme based on spontaneous parametric down-conversion to produce multiple-photon pairs in maximally entangled polarization states using an arrangement of two type-I nonlinear crystals. By introducing correlated polarization noise in the paths of the generated photons we prepare mixed-entangled states whose properties illustrate fundamental results obtained recently in quantum information theory, in particular those concerning bound entanglement and privacy.

  11. Pilot-based parametric channel estimation algorithm for DCO-OFDM-based visual light communications

    NASA Astrophysics Data System (ADS)

    Qian, Xuewen; Deng, Honggui; He, Hailang

    2017-10-01

    Due to wide modulation bandwidth in optical communication, multipath channels may be non-sparse and deteriorate communication performance heavily. Traditional compressive sensing-based channel estimation algorithm cannot be employed in this kind of situation. In this paper, we propose a practical parametric channel estimation algorithm for orthogonal frequency division multiplexing (OFDM)-based visual light communication (VLC) systems based on modified zero correlation code (ZCC) pair that has the impulse-like correlation property. Simulation results show that the proposed algorithm achieves better performances than existing least squares (LS)-based algorithm in both bit error ratio (BER) and frequency response estimation.

  12. Nature of the C2-methylation effect on the properties of imidazolium ionic liquids.

    PubMed

    Rodrigues, Ana S M C; Lima, Carlos F R A C; Coutinho, João A P; Santos, Luís M N B F

    2017-02-15

    Methylation at the C2 position of 1,3-disubstituted imidazolium-based ionic liquids (ILs) is one of the structural features that has gained attention due to its drastic impact on thermophysical and transport properties. Several hypotheses have been proposed to explain this effect but there is still much discrepancy. Aiming for the rationalization of the effects of these structural features on the properties of imidazolium ILs, we present a thermodynamic and computational study of two methylated ILs at the C2 position of imidazolium, [ 1 C 4 2 C 1 3 C 1 im][NTf 2 ] and [ 1 C 3 2 C 1 3 C 1 im][NTf 2 ]. The phase behaviour (glass transition and vaporization equilibrium) and computational studies of the anion rotation around the cation and ion pair interaction energies for both ILs were explored. The results have shown that C2-methylation has no impact on the enthalpy of vaporization. However, it decreases the entropy of vaporization, which is a consequence of the change in the ion pair dynamics that affects both the liquid and gas phases. In addition, the more hindered dynamics of the ion pair are also reflected in the increase in the glass transition temperature, T g . The entropic contribution of anion-around-cation rotation in the imidazolium [NTf 2 ] ILs was quantified experimentally by the comparative analysis of the entropy of vaporization, and computationally by the calculation of the entropies of hindered internal rotation. The global results exclude the existence of significant H-bonding in the C2-protonated (non-methylated) ILs and explain the C2-methylation effect in terms of reduced entropy of the ion pair in the liquid and gas phases. In light of these results, the C2-methylation effect is intrinsically entropic and originates from the more hindered anion-around-cation rotation as a consequence of the substitution of the -H with a bulkier -CH 3 group.

  13. Understanding the differences between genome sequences of Escherichia coli B strains REL606 and BL21(DE3), and comparison of the closely related E. coli B and K-12 genomes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Studier, F.W.; Daegelen, P.; Lenski, R. E.

    2009-12-01

    Each difference between the genome sequences of Escherichia coli B strains REL606 and BL21(DE3) can be interpreted in light of known laboratory manipulations plus a gene conversion between ribosomal RNA operons. Two treatments with 1-methyl-3-nitro-1-nitrosoguanidine in the REL606 lineage produced at least 93 single-base-pair mutations ({approx} 90% GC-to-AT transitions) and 3 single-base-pair GC deletions. Two UV treatments in the BL21(DE3) lineage produced only 4 single-base-pair mutations but 16 large deletions. P1 transductions from K-12 into the two B lineages produced 317 single-base-pair differences and 9 insertions or deletions, reflecting differences between B DNA in BL21(DE3) and integrated restriction fragments ofmore » K-12 DNA inherited by REL606. Two sites showed selective enrichment of spontaneous mutations. No unselected spontaneous single-base-pair mutations were evident. The genome sequences revealed that a progenitor of REL606 had been misidentified, explaining initially perplexing differences. Limited sequencing of other B strains defined characteristic properties of B and allowed assembly of the inferred genome of the ancestral B of Delbrueck and Luria. Comparison of the B and K-12 genomes shows that more than half of the 3793 proteins of their basic genomes are predicted to be identical, although {approx} 310 appear to be functional in either B or K-12 but not in both. The ancestral basic genome appears to have had {approx} 4039 coding sequences occupying {approx} 4.0 Mbp. Repeated horizontal transfer from diverged Escherichia coli genomes and homologous recombination may explain the observed variable distribution of single-base-pair differences. Fifteen sites are occupied by phage-related elements, but only six by comparable elements at the same site. More than 50 sites are occupied by IS elements in both B and K, 16 in common, and likely founding IS elements are identified. A signature of widespread cryptic phage P4-type mobile elements was identified. Complex deletions (dense clusters of small deletions and substitutions) apparently removed nonessential genes from {approx} 30 sites in the basic genomes.« less

  14. High-Performance Oligomeric Catholytes for Effective Macromolecular Separation in Nonaqueous Redox Flow Batteries

    PubMed Central

    2018-01-01

    Nonaqueous redox flow batteries (NRFBs) represent an attractive technology for energy storage from intermittent renewable sources. In these batteries, electrical energy is stored in and extracted from electrolyte solutions of redox-active molecules (termed catholytes and anolytes) that are passed through an electrochemical flow cell. To avoid battery self-discharge, the anolyte and catholyte solutions must be separated by a membrane in the flow cell. This membrane prevents crossover of the redox active molecules, while simultaneously allowing facile transport of charge-balancing ions. A key unmet challenge for the field is the design of redox-active molecule/membrane pairs that enable effective electrolyte separation while maintaining optimal battery properties. Herein, we demonstrate the development of oligomeric catholytes based on tris(dialkylamino)cyclopropenium (CP) salts that are specifically tailored for pairing with size-exclusion membranes composed of polymers of intrinsic microporosity (PIMs). Systematic studies were conducted to evaluate the impact of oligomer size/structure on properties that are crucial for flow battery performance, including cycling stability, charge capacity, solubility, electron transfer kinetics, and crossover rates. These studies have led to the identification of a CP-derived tetramer in which these properties are all comparable, or significantly improved, relative to the monomeric counterpart. Finally, a proof-of-concept flow battery is demonstrated by pairing this tetrameric catholyte with a PIM membrane. After 6 days of cycling, no crossover is detected, demonstrating the promise of this approach. These studies provide a template for the future design of other redox-active oligomers for this application. PMID:29532018

  15. High-Performance Oligomeric Catholytes for Effective Macromolecular Separation in Nonaqueous Redox Flow Batteries

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hendriks, Koen H.; Robinson, Sophia G.; Braten, Miles N.

    Nonaqueous redox flow batteries (NRFBs) represent an attractive technology for energy storage from intermittent renewable sources. In these batteries, electrical energy is stored in and extracted from electrolyte solutions of redox-active molecules (termed catholytes and anolytes) that are passed through an electrochemical flow cell. To avoid battery self-discharge, the anolyte and catholyte solutions must be separated by a membrane in the flow cell. This membrane prevents crossover of the redox active molecules, while simultaneously allowing facile transport of charge-balancing ions. A key unmet challenge for the field is the design of redox-active molecule/membrane pairs that enable effective electrolyte separation whilemore » maintaining optimal battery properties. Herein, we demonstrate the development of oligomeric catholytes based on tris(dialkylamino)cyclopropenium (CP) salts that are specifically tailored for pairing with size-exclusion membranes composed of polymers of intrinsic microporosity (PIMs). Systematic studies were conducted to evaluate the impact of oligomer size/structure on properties that are crucial for flow battery performance, including cycling stability, charge capacity, solubility, electron transfer kinetics, and crossover rates. These studies have led to the identification of a CP-derived tetramer in which these properties are all comparable, or significantly improved, relative to the monomeric counterpart. Finally, a proof-of-concept flow battery is demonstrated by pairing this tetrameric catholyte with a PIM membrane. After 6 days of cycling, no crossover is detected, demonstrating the promise of this approach. Finally, these studies provide a template for the future design of other redox-active oligomers for this application.« less

  16. High-Performance Oligomeric Catholytes for Effective Macromolecular Separation in Nonaqueous Redox Flow Batteries.

    PubMed

    Hendriks, Koen H; Robinson, Sophia G; Braten, Miles N; Sevov, Christo S; Helms, Brett A; Sigman, Matthew S; Minteer, Shelley D; Sanford, Melanie S

    2018-02-28

    Nonaqueous redox flow batteries (NRFBs) represent an attractive technology for energy storage from intermittent renewable sources. In these batteries, electrical energy is stored in and extracted from electrolyte solutions of redox-active molecules (termed catholytes and anolytes) that are passed through an electrochemical flow cell. To avoid battery self-discharge, the anolyte and catholyte solutions must be separated by a membrane in the flow cell. This membrane prevents crossover of the redox active molecules, while simultaneously allowing facile transport of charge-balancing ions. A key unmet challenge for the field is the design of redox-active molecule/membrane pairs that enable effective electrolyte separation while maintaining optimal battery properties. Herein, we demonstrate the development of oligomeric catholytes based on tris(dialkylamino)cyclopropenium (CP) salts that are specifically tailored for pairing with size-exclusion membranes composed of polymers of intrinsic microporosity (PIMs). Systematic studies were conducted to evaluate the impact of oligomer size/structure on properties that are crucial for flow battery performance, including cycling stability, charge capacity, solubility, electron transfer kinetics, and crossover rates. These studies have led to the identification of a CP-derived tetramer in which these properties are all comparable, or significantly improved, relative to the monomeric counterpart. Finally, a proof-of-concept flow battery is demonstrated by pairing this tetrameric catholyte with a PIM membrane. After 6 days of cycling, no crossover is detected, demonstrating the promise of this approach. These studies provide a template for the future design of other redox-active oligomers for this application.

  17. High-Performance Oligomeric Catholytes for Effective Macromolecular Separation in Nonaqueous Redox Flow Batteries

    DOE PAGES

    Hendriks, Koen H.; Robinson, Sophia G.; Braten, Miles N.; ...

    2018-01-17

    Nonaqueous redox flow batteries (NRFBs) represent an attractive technology for energy storage from intermittent renewable sources. In these batteries, electrical energy is stored in and extracted from electrolyte solutions of redox-active molecules (termed catholytes and anolytes) that are passed through an electrochemical flow cell. To avoid battery self-discharge, the anolyte and catholyte solutions must be separated by a membrane in the flow cell. This membrane prevents crossover of the redox active molecules, while simultaneously allowing facile transport of charge-balancing ions. A key unmet challenge for the field is the design of redox-active molecule/membrane pairs that enable effective electrolyte separation whilemore » maintaining optimal battery properties. Herein, we demonstrate the development of oligomeric catholytes based on tris(dialkylamino)cyclopropenium (CP) salts that are specifically tailored for pairing with size-exclusion membranes composed of polymers of intrinsic microporosity (PIMs). Systematic studies were conducted to evaluate the impact of oligomer size/structure on properties that are crucial for flow battery performance, including cycling stability, charge capacity, solubility, electron transfer kinetics, and crossover rates. These studies have led to the identification of a CP-derived tetramer in which these properties are all comparable, or significantly improved, relative to the monomeric counterpart. Finally, a proof-of-concept flow battery is demonstrated by pairing this tetrameric catholyte with a PIM membrane. After 6 days of cycling, no crossover is detected, demonstrating the promise of this approach. Finally, these studies provide a template for the future design of other redox-active oligomers for this application.« less

  18. Highly efficient heralded single-photon source for telecom wavelengths based on a PPLN waveguide.

    PubMed

    Bock, Matthias; Lenhard, Andreas; Chunnilall, Christopher; Becher, Christoph

    2016-10-17

    We present the realization of a highly efficient photon pair source based on spontaneous parametric downconversion (SPDC) in a periodically poled lithium niobate (PPLN) ridge waveguide. The source is suitable for long distance quantum communication applications as the photon pairs are located at the centers of the telecommunication O- and C- band at 1312 nm and 1557 nm. The high efficiency is confirmed by a conversion efficiency of 4 × 10-6 - which is to our knowledge among the highest conversion efficiencies reported so far - and a heralding efficiency of 64.1 ± 2.1%. The heralded single-photon properties are confirmed by the measurement of the photon statistics with a Click/No-Click method as well as the heralded g(2)-function. A minimum value for g(2)(0) of 0.001 ± 0.0003 indicating clear antibunching has been observed.

  19. Temperature dependent structural and dynamical properties of liquid Cu80Si20 binary alloy

    NASA Astrophysics Data System (ADS)

    Suthar, P. H.; Shah, A. K.; Gajjar, P. N.

    2018-05-01

    Ashcroft and Langreth binary structure factor have been used to study for pair correlation function and the study of dynamical variable: velocity auto correlation functions, power spectrum and mean square displacement calculated based on the static harmonic well approximation in liquid Cu80Si20 binary alloy at wide temperature range (1140K, 1175K, 1210K, 1250K, 1373K, 1473K.). The effective interaction for the binary alloy is computed by our well established local pseudopotential along with the exchange and correction functions Sarkar et al(S). The negative dip in velocity auto correlation decreases as the various temperature is increases. For power spectrum as temperature increases, the peak of power spectrum shifts toward lower ω. Good agreement with the experiment is observed for the pair correlation functions. Velocity auto correlation showing the transferability of the local pseudopotential used for metallic liquid environment in the case of copper based binary alloys.

  20. Anisotropic nanomaterials: Synthesis, optical and magnetic properties, and applications

    NASA Astrophysics Data System (ADS)

    Banholzer, Matthew John

    As nanoscience and nanotechnology mature, anisotropic metal nanostructures are emerging in a variety of contexts as valuable class of nanostructures due to their distinctive attributes. With unique properties ranging from optical to magnetic and beyond, these structures are useful in many new applications. Chapter two discusses the nanodisk code: a linear array of metal disk pairs that serve as surface-enhanced Raman scattering substrates. These multiplexing structures employ a binary encoding scheme, perform better than previous nanowires designs (in the context of SERS) and are useful for both convert encoding and tagging of substrates (based both on spatial disk position and spectroscopic response) as well as biomolecule detection (e.g. DNA). Chapter three describes the development of improved, silver-based nanodisk code structures. Work was undertaken to generate structures with high yield and reproducibility and to reoptimize the geometry of each disk pair for maximum Raman enhancement. The improved silver structures exhibit greater enhancement than Au structures (leading to lower DNA detection limits), convey additional flexibility, and enable trinary encoding schemes where far more unique structures can be created. Chapter four considers the effect of roughness on the plasmonic properties of nanorod structures and introduces a novel method to smooth the end-surfaces of nanorods structures. The smoothing technique is based upon a two-step process relying upon diffusion control during nanowires growth and selective oxidation after each step of synthesis is complete. Empirical and theoretical work show that smoothed nanostructures have superior and controllable optical properties. Chapter five concerns silica-encapsulated gold nanoprisms. This encapsulation allows these highly sensitive prisms to remain stable and protected in solution, enabling their use as class-leading sensors. Theoretical study complements the empirical work, exploring the effect of encapsulation on the SPR of these structures. Chapter six focuses on the magnetic properties of Au-Ni heterostructures. In addition to demonstration of nanoconfinement effects based upon the anisotropy of the nanorods/nanodisk structure, the magnetic coupling of rod-disk heterostructures is examined. Subsequent investigations suggest that the magnetic behavior of disks can be influenced by nearby rod segments, leading to the creation of a three-state spin system that may prove useful in device applications.

  1. Statistical and linguistic features of DNA sequences

    NASA Technical Reports Server (NTRS)

    Havlin, S.; Buldyrev, S. V.; Goldberger, A. L.; Mantegna, R. N.; Peng, C. K.; Simons, M.; Stanley, H. E.

    1995-01-01

    We present evidence supporting the idea that the DNA sequence in genes containing noncoding regions is correlated, and that the correlation is remarkably long range--indeed, base pairs thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene. We resolve the problem of the "non-stationary" feature of the sequence of base pairs by applying a new algorithm called Detrended Fluctuation Analysis (DFA). We address the claim of Voss that there is no difference in the statistical properties of coding and noncoding regions of DNA by systematically applying the DFA algorithm, as well as standard FFT analysis, to all eukaryotic DNA sequences (33 301 coding and 29 453 noncoding) in the entire GenBank database. We describe a simple model to account for the presence of long-range power-law correlations which is based upon a generalization of the classic Levy walk. Finally, we describe briefly some recent work showing that the noncoding sequences have certain statistical features in common with natural languages. Specifically, we adapt to DNA the Zipf approach to analyzing linguistic texts, and the Shannon approach to quantifying the "redundancy" of a linguistic text in terms of a measurable entropy function. We suggest that noncoding regions in plants and invertebrates may display a smaller entropy and larger redundancy than coding regions, further supporting the possibility that noncoding regions of DNA may carry biological information.

  2. Competing pseudogap and impurity effects on the normal-state specific heat properties of cuprate superconductors

    NASA Astrophysics Data System (ADS)

    Dzhumanov, S.; Karimboev, E. X.

    2014-07-01

    In this paper, we show that the pseudogap in the excitation spectra of high-Tc cuprates together with the impurity phase and charge inhomogeneity plays key roles in determining the essential features of their anomalous specific heat properties observed above Tc. We consider the doped cuprate superconductor as a multi-carrier model system (which consists of intrinsic and extrinsic polarons and pre-formed bosonic Cooper pairs) and study the competing pseudogap and impurity effects on the normal-state electronic specific heat of high-Tc cuprates taking into account charge inhomogeneities. We argue that unconventional electron-phonon interactions are responsible for the precursor Cooper pairing in the polaronic band below a mean-field temperature T∗ and the existence of a pseudogap above Tc in the cuprates. The electronic specific heat Ce(T) of doped cuprates below T∗ is calculated taking into account three contributions coming from the excited components of Cooper pairs, the ideal Bose-gas of incoherent Cooper pairs and the unpaired carriers in the impurity band. Above T∗, two contributions to Ce(T) coming from the unpaired intrinsic and extrinsic polarons are calculated within the two-component degenerate Fermi-gas model. By comparing our results with the experimental Ce(T) data obtained for La- and Y-based cuprates, we find that the observed behaviors of Ce(T) (below and above T∗) are similar to the calculated results for Ce(T) and the BCS-type jumps of Ce(T) at T∗ may be depressed by the impurity effects and may become more or less pronounced BCS-type anomalies in Ce(T) .

  3. Thermophysical properties of krypton-helium gas mixtures from ab initio pair potentials

    PubMed Central

    2017-01-01

    A new potential energy curve for the krypton-helium atom pair was developed using supermolecular ab initio computations for 34 interatomic distances. Values for the interaction energies at the complete basis set limit were obtained from calculations with the coupled-cluster method with single, double, and perturbative triple excitations and correlation consistent basis sets up to sextuple-zeta quality augmented with mid-bond functions. Higher-order coupled-cluster excitations up to the full quadruple level were accounted for in a scheme of successive correction terms. Core-core and core-valence correlation effects were included. Relativistic corrections were considered not only at the scalar relativistic level but also using full four-component Dirac–Coulomb and Dirac–Coulomb–Gaunt calculations. The fitted analytical pair potential function is characterized by a well depth of 31.42 K with an estimated standard uncertainty of 0.08 K. Statistical thermodynamics was applied to compute the krypton-helium cross second virial coefficients. The results show a very good agreement with the best experimental data. Kinetic theory calculations based on classical and quantum-mechanical approaches for the underlying collision dynamics were utilized to compute the transport properties of krypton-helium mixtures in the dilute-gas limit for a large temperature range. The results were analyzed with respect to the orders of approximation of kinetic theory and compared with experimental data. Especially the data for the binary diffusion coefficient confirm the predictive quality of the new potential. Furthermore, inconsistencies between two empirical pair potential functions for the krypton-helium system from the literature could be resolved. PMID:28595411

  4. Thermophysical properties of krypton-helium gas mixtures from ab initio pair potentials

    NASA Astrophysics Data System (ADS)

    Jäger, Benjamin; Bich, Eckard

    2017-06-01

    A new potential energy curve for the krypton-helium atom pair was developed using supermolecular ab initio computations for 34 interatomic distances. Values for the interaction energies at the complete basis set limit were obtained from calculations with the coupled-cluster method with single, double, and perturbative triple excitations and correlation consistent basis sets up to sextuple-zeta quality augmented with mid-bond functions. Higher-order coupled-cluster excitations up to the full quadruple level were accounted for in a scheme of successive correction terms. Core-core and core-valence correlation effects were included. Relativistic corrections were considered not only at the scalar relativistic level but also using full four-component Dirac-Coulomb and Dirac-Coulomb-Gaunt calculations. The fitted analytical pair potential function is characterized by a well depth of 31.42 K with an estimated standard uncertainty of 0.08 K. Statistical thermodynamics was applied to compute the krypton-helium cross second virial coefficients. The results show a very good agreement with the best experimental data. Kinetic theory calculations based on classical and quantum-mechanical approaches for the underlying collision dynamics were utilized to compute the transport properties of krypton-helium mixtures in the dilute-gas limit for a large temperature range. The results were analyzed with respect to the orders of approximation of kinetic theory and compared with experimental data. Especially the data for the binary diffusion coefficient confirm the predictive quality of the new potential. Furthermore, inconsistencies between two empirical pair potential functions for the krypton-helium system from the literature could be resolved.

  5. Nucleic acid duplexes incorporating a dissociable covalent base pair

    PubMed Central

    Gao, Kui; Orgel, Leslie E.

    1999-01-01

    We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure. PMID:10611299

  6. Nitrogen vacancy, self-interstitial diffusion, and Frenkel-pair formation/dissociation in B 1 TiN studied by ab initio and classical molecular dynamics with optimized potentials

    NASA Astrophysics Data System (ADS)

    Sangiovanni, D. G.; Alling, B.; Steneteg, P.; Hultman, L.; Abrikosov, I. A.

    2015-02-01

    We use ab initio and classical molecular dynamics (AIMD and CMD) based on the modified embedded-atom method (MEAM) potential to simulate diffusion of N vacancy and N self-interstitial point defects in B 1 TiN. TiN MEAM parameters are optimized to obtain CMD nitrogen point-defect jump rates in agreement with AIMD predictions, as well as an excellent description of Ti Nx(˜0.7

  7. An Insilico Design of Nanoclay Based Nanocomposites and Scaffolds in Bone Tissue Engineering

    NASA Astrophysics Data System (ADS)

    Sharma, Anurag

    A multiscale in silico approach to design polymer nanocomposites and scaffolds for bone tissue engineering applications is described in this study. This study focuses on the role of biomaterials design and selection, structural integrity and mechanical properties evolution during degradation and tissue regeneration in the successful design of polymer nanocomposite scaffolds. Polymer nanocomposite scaffolds are synthesized using aminoacid modified montmorillonite nanoclay with biomineralized hydroxyapatite and polycaprolactone (PCL/in situ HAPclay). Representative molecular models of polymer nanocomposite system are systematically developed using molecular dynamics (MD) technique and successfully validated using material characterization techniques. The constant force steered molecular dynamics (fSMD) simulation results indicate a two-phase nanomechanical behavior of the polymer nanocomposite. The MD and fSMD simulations results provide quantitative contributions of molecular interactions between different constituents of representative models and their effect on nanomechanical responses of nanoclay based polymer nanocomposite system. A finite element (FE) model of PCL/in situ HAPclay scaffold is built using micro-computed tomography images and bridging the nanomechanical properties obtained from fSMD simulations into the FE model. A new reduction factor, K is introduced into modeling results to consider the effect of wall porosity of the polymer scaffold. The effect of accelerated degradation under alkaline conditions and human osteoblast cells culture on the evolution of mechanical properties of scaffolds are studied and the damage mechanics based analytical models are developed. Finally, the novel multiscale models are developed that incorporate the complex molecular and microstructural properties, mechanical properties at nanoscale and structural levels and mechanical properties evolution during degradation and tissue formation in the polymer nanocomposite scaffold. Overall, this study provides a leap into methodologies for in silico design of biomaterials for bone tissue engineering applications. Furthermore, as a part of this work, a molecular dynamics study of rice DNA in the presence of single walled carbon nanotube is carried out to understand the role played by molecular interactions in the conformation changes of rice DNA. The simulations results showed wrapping of DNA onto SWCNT, breaking and forming of hydrogen bonds due to unzipping of Watson-Crick (WC) nucleobase pairs and forming of new non-WC nucleobase pairs in DNA.

  8. Tribological Properties of Ti-Based Alloys in a Simulated Bone-Implant Interface with Ringer's Solution at Fretting Contacts

    PubMed Central

    Ramos-Saenz, C.R.; Sundaram, P.A.; Diffoot-Carlo, N.

    2010-01-01

    The wear properties of oxidized and non-oxidized gamma-TiAl (a potential biomaterial) as well as Ti-6Al-4V and CP-Ti disks were studied and characterized by means of standard wear tests using a custom made bone pin arrangement. The Ti-base disks were oxidized in air at 500°C and 800°C for one hour. The tribological properties of the oxides formed over the disks were studied using a linear reciprocating wear testing machine under both dry and simulated biological conditions using Ringer's solution. Loss of metal oxide and coefficient of friction values were determined from the wear testing. From the results, abrasion and adhesion were the primary wear mechanisms in each of the three alloy-bone pairs. Specifically, the oxide formed on gamma-TiAl possessed the highest COF and wear resistance of the three materials which were studied. Also, as expected, bone wears down faster than the Ti-base metal oxide. PMID:20826360

  9. Insights into the mechanisms of RNA secondary structure destabilization by the HIV-1 nucleocapsid protein

    PubMed Central

    Belfetmi, Anissa; Zargarian, Loussiné; Tisné, Carine; Sleiman, Dona; Morellet, Nelly; Lescop, Ewen; Maskri, Ouerdia; René, Brigitte; Mély, Yves; Fossé, Philippe; Mauffret, Olivier

    2016-01-01

    The mature HIV-1 nucleocapsid protein NCp7 (NC) plays a key role in reverse transcription facilitating the two obligatory strand transfers. Several properties contribute to its efficient chaperon activity: preferential binding to single-stranded regions, nucleic acid aggregation, helix destabilization, and rapid dissociation from nucleic acids. However, little is known about the relationships between these different properties, which are complicated by the ability of the protein to recognize particular HIV-1 stem–loops, such as SL1, SL2, and SL3, with high affinity and without destabilizing them. These latter properties are important in the context of genome packaging, during which NC is part of the Gag precursor. We used NMR to investigate destabilization of the full-length TAR (trans activating response element) RNA by NC, which is involved in the first strand transfer step of reverse transcription. NC was used at a low protein:nucleotide (nt) ratio of 1:59 in these experiments. NMR data for the imino protons of TAR identified most of the base pairs destabilized by NC. These base pairs were adjacent to the loops in the upper part of the TAR hairpin rather than randomly distributed. Gel retardation assays showed that conversion from the initial TAR–cTAR complex to the fully annealed form occurred much more slowly at the 1:59 ratio than at the higher ratios classically used. Nevertheless, NC significantly accelerated the formation of the initial complex at a ratio of 1:59. PMID:26826129

  10. Aesthetic perception of visual textures: a holistic exploration using texture analysis, psychological experiment, and perception modeling.

    PubMed

    Liu, Jianli; Lughofer, Edwin; Zeng, Xianyi

    2015-01-01

    Modeling human aesthetic perception of visual textures is important and valuable in numerous industrial domains, such as product design, architectural design, and decoration. Based on results from a semantic differential rating experiment, we modeled the relationship between low-level basic texture features and aesthetic properties involved in human aesthetic texture perception. First, we compute basic texture features from textural images using four classical methods. These features are neutral, objective, and independent of the socio-cultural context of the visual textures. Then, we conduct a semantic differential rating experiment to collect from evaluators their aesthetic perceptions of selected textural stimuli. In semantic differential rating experiment, eights pairs of aesthetic properties are chosen, which are strongly related to the socio-cultural context of the selected textures and to human emotions. They are easily understood and connected to everyday life. We propose a hierarchical feed-forward layer model of aesthetic texture perception and assign 8 pairs of aesthetic properties to different layers. Finally, we describe the generation of multiple linear and non-linear regression models for aesthetic prediction by taking dimensionality-reduced texture features and aesthetic properties of visual textures as dependent and independent variables, respectively. Our experimental results indicate that the relationships between each layer and its neighbors in the hierarchical feed-forward layer model of aesthetic texture perception can be fitted well by linear functions, and the models thus generated can successfully bridge the gap between computational texture features and aesthetic texture properties.

  11. Hole pairing and ground state properties of high-Tc superconductivity within the t-t'-J-V model

    NASA Astrophysics Data System (ADS)

    Roy, Krishanu; Pal, Papiya; Nath, Subhadip; Ghosh, Nanda Kumar

    2018-04-01

    The t-t'-J-V model, one of the realistic models for studying high-Tc cuprates, has been investigated to explore the hole pairing and other ground state properties using exact diagonalization (ED) technique with 2 holes in a small 8-site cluster. The role of next-nearest-neighbor (NNN) hopping and nearest-neighbor (NN) Coulomb repulsion has been considered. It appears that qualitative behavior of the ground state energies of an 8-site and 16- or 18-site cluster is similar. Results show that a small short-ranged antiferromagnetic (AF) correlation exists in the 2 hole case which is favored by large V/t. A superconducting phase emerges at 0 ≤ V/t ≤ 4J. Hole-hole correlation calculation also suggests that the two holes of the pair are either at |i - j| = 1 or √2. Negative t'/t suppresses the possibility of pairing of holes. Though s-wave pairing susceptibility is dominant, pairing correlation length calculation indicates that the long range pairing, which is suitable for superconductivity, is in the d-wave channel. Both s- and d-wave pairing susceptibility gets suppressed by V/t while d-(s-) wave susceptibility gets favored (suppressed) by t'/t. The charge gap shows a gapped behavior while a spin-gapless region exists at small V/t for finite t'/t.

  12. Interpreting anomalous electron pairs as new particle decays

    NASA Astrophysics Data System (ADS)

    Wilczynski, Henryk

    1999-08-01

    In heavy particle decays found in cosmic ray interactions recorded in the JACEE emulsion chambers, multiple electron pairs were previously reported. These pairs apparently originated from conversions of photons emitted in the decays. It is difficult to explain the overall properties of these decays in terms of known heavy particle decay modes. A recently published compilation of low-energy nuclear data suggests existence of excess electron pairs with invariant mass about 9 MeV/c2 , which may be explained by postulating a new neutral boson decaying into the electron pair. The feasibility of explaining the JACEE electron pairs with this hypothesis is presented.

  13. Mechanics of wafer bonding: Effect of clamping

    NASA Astrophysics Data System (ADS)

    Turner, K. T.; Thouless, M. D.; Spearing, S. M.

    2004-01-01

    A mechanics-based model is developed to examine the effects of clamping during wafer bonding processes. The model provides closed-form expressions that relate the initial geometry and elastic properties of the wafers to the final shape of the bonded pair and the strain energy release rate at the interface for two different clamping configurations. The results demonstrate that the curvature of bonded pairs may be controlled through the use of specific clamping arrangements during the bonding process. Furthermore, it is demonstrated that the strain energy release rate depends on the clamping configuration and that using applied loads usually leads to an undesirable increase in the strain energy release rate. The results are discussed in detail and implications for process development and bonding tool design are highlighted.

  14. RSRM-3 (360L003) Ballistics/Mass Properties Report

    NASA Technical Reports Server (NTRS)

    Laubacher, B. A.; Richards, M. C.

    1989-01-01

    The propulsion performance and reconstructed mass properties data from Morton Thiokol's RSRM-3 motors which were assigned to the STS-29 launch are presented. The composite type solid propellant burn rates were close to predicted. The performance of the pair of motors were compared to some CEI Specifications. The performance from each motor as well as matched pair performance values were well within the CEI specification requirements. The nominal thrust time curve and impulse gate information is included. Post flight reconstructed Redesigned Solid Rocket Motor (RSRM) mass properties are within expected values for the lightweight configuration.

  15. Unique Dynamic Properties of DNA Duplexes Containing Interstrand Crosslinks†

    PubMed Central

    Friedman, Joshua I.; Jiang, Yu Lin; Miller, Paul S.; Stivers, James T.

    2010-01-01

    Bifunctional DNA alkylating agents form a diverse assortment of covalent DNA interstrand crosslinked (ICL) structures that are potent cytotoxins. Since it is implausible that cells could possess distinct DNA repair systems for each individual ICL, it is believed that common structural and dynamic features of ICL damage are recognized, rather than specific structural characteristics of each cross-linking agent. Investigation of the structural and dynamic properties of ICLs that might be important for recognition has been complicated by heterogeneous incorporation of these lesions into DNA. To address this problem we have synthesized and characterized several homogenous ICL-DNAs containing site–specific staggered N4-cytosine-ethyl-N4-cytosine crosslinks. Staggered crosslinks were introduced in two ways: in a manner that preserves the overall structure of B-form duplex DNA, and in a manner that highly distorts the DNA structure, with the goal of understanding how structural and dynamic properties of diverse ICL duplexes might flag these sites for repair. Measurements of base pair opening dynamics in the B-form ICL duplex by 1H NMR linewidth or imino proton solvent exchange showed that the guanine base opposite to the crosslinked cytosine opened at least an order of magnitude more slowly than when in a control matched normal duplex. To a lesser degree, the B-form ICL also induced a decrease in base pair opening dynamics that extended from the site of the crosslink to adjacent base pairs. In contrast, the non-B-form ICL showed extensive conformational dynamics at the site of the cross link, which extended over the entire DNA sequence. Since DNA duplexes containing the B-form and non-B-form ICL crosslinks have both been shown to be incised when incubated in mammalian whole cell extracts, while a matched normal duplex is not, we conclude that intrinsic DNA dynamics is not a requirement for specific damage incision of these ICLs. Instead, we propose a general model where destabilized ICL-duplexes serve to energetically facilitate binding of DNA repair factors that must induce bubbles or other distortions in the duplex. However, the essential requirement for incision is an immobile Y-junction where the repair factors are stably bound at the site of the ICL, and the two DNA strands are unpaired. PMID:21174443

  16. Hole pairing and thermodynamic properties of the two dimensional frustrated t-J model

    NASA Astrophysics Data System (ADS)

    Roy, K.; Pal, P.; Nath, S.; Ghosh, N. K.

    2018-04-01

    The frustrated t-J model is investigated by using the exact-diagonalization (ED) method on an 8-site cluster. The effect on next-nearest-neighbor (NNN) exchange interaction J' (frustration) on the hole pairing and the thermodynamic properties of the system is considered. Two holes initially remain unbound at smaller value of J'/t, but tend to bind at larger value. The maximum possibility of pair formation has been observed to be at NNN sites. Entropy calculation shows that the system goes to more disordered state with J'. The specific heat curves show a single peak structure. A decrease in effective exchange energy is observed due to the frustration.

  17. Locating pairs of comparable study areas...new system developed

    Treesearch

    Raymond D. Ratliff; Jack N. Reppert

    1966-01-01

    A new system developed for locating pairs of comparable areas consists of three steps: (a) characterizing each of two areas according to 18 site factors and soil properties, (b) rating each pair of characteristics for comparability, and (c) rating the two areas for comparability by using the individual ratings as the basis. Two areas scoring 85 or more points out of a...

  18. Joint spectral characterization of photon-pair sources

    NASA Astrophysics Data System (ADS)

    Zielnicki, Kevin; Garay-Palmett, Karina; Cruz-Delgado, Daniel; Cruz-Ramirez, Hector; O'Boyle, Michael F.; Fang, Bin; Lorenz, Virginia O.; U'Ren, Alfred B.; Kwiat, Paul G.

    2018-06-01

    The ability to determine the joint spectral properties of photon pairs produced by the processes of spontaneous parametric downconversion (SPDC) and spontaneous four-wave mixing (SFWM) is crucial for guaranteeing the usability of heralded single photons and polarization-entangled pairs for multi-photon protocols. In this paper, we compare six different techniques that yield either a characterization of the joint spectral intensity or of the closely related purity of heralded single photons. These six techniques include: (i) scanning monochromator measurements, (ii) a variant of Fourier transform spectroscopy designed to extract the desired information exploiting a resource-optimized technique, (iii) dispersive fibre spectroscopy, (iv) stimulated-emission-based measurement, (v) measurement of the second-order correlation function ? for one of the two photons, and (vi) two-source Hong-Ou-Mandel interferometry. We discuss the relative performance of these techniques for the specific cases of a SPDC source designed to be factorable and SFWM sources of varying purity, and compare the techniques' relative advantages and disadvantages.

  19. Frictional Behavior of Micro/nanotextured Surfaces Investigated by Atomic Force Microscope: a Review

    NASA Astrophysics Data System (ADS)

    Zhang, Xiaoliang; Jia, Junhong

    2015-08-01

    Tribological issues between friction pair are fundamental problems for minimized devices because of their higher surface-to-volume ratio. Micro/nanotexturing is an effective technique to reduce actual contact area between contact pair at the nanoscale. Micro/nanotexture made a great impact on the frictional behavior of textured surfaces. This paper summarizes the recent advancements in the field of frictional behavior of micro/nanotextured surfaces, which are based on solid surface contact in atmosphere environment, especially focusing on the factors influencing the frictional behavior: Surface property, texturing density, texturing height, texturing structure and size of contact pair (atomic force microscope (AFM) tip) and texturing structures. Summarizing the effects of these factors on the frictional behavior is helpful for the understanding and designing of the surfaces in sliding micro/nanoelectromechanical systems (MEMS/NEMS). Controlling and reducing the friction force in moving mechanical systems is very important for the performance and reliability of nanosystems, which contribute to a sustainable future.

  20. A minimal model for kinetochore-microtubule dynamics

    NASA Astrophysics Data System (ADS)

    Liu, Andrea

    2014-03-01

    During mitosis, chromosome pairs align at the center of a bipolar microtubule (MT) spindle and oscillate as MTs attaching them to the cell poles polymerize and depolymerize. The cell fixes misaligned pairs by a tension-sensing mechanism. Pairs later separate as shrinking MTs pull each chromosome toward its respective cell pole. We present a minimal model for these processes based on properties of MT kinetics. We apply the measured tension-dependence of single MT kinetics to a stochastic many MT model, which we solve numerically and with master equations. We find that the force-velocity curve for the single chromosome system is bistable and hysteretic. Above some threshold load, tension fluctuations induce MTs to spontaneously switch from a pulling state into a growing, pushing state. To recover pulling from the pushing state, the load must be reduced far below the threshold. This leads to oscillations in the two-chromosome system. Our minimal model quantitatively captures several aspects of kinetochore dynamics observed experimentally. This work was supported by NSF-DMR-1104637.

  1. Saccharin Aza Bioisosteres-Synthesis and Preclinical Property Comparisons.

    PubMed

    Chen, Yantao; Aurell, Carl-Johan; Pettersen, Anna; Lewis, Richard J; Hayes, Martin A; Lepistö, Matti; Jonson, Anna C; Leek, Hanna; Thunberg, Linda

    2017-06-08

    Saccharin is a well-known scaffold in drug discovery. Herein, we report the synthesis and preclinical property comparisons of three bioisosteres of saccharin: aza-pseudosaccharins (cluster B ), and two new types of aza-saccharins (clusters C and D ). We demonstrate a convenient protocol to selectively synthesize products in cluster C or D when primary amines are used. Preclinical characterization of selected matched-pair products is reported. Through comparison of two diastereomers, we highlight how stereochemistry affects the preclinical properties. Given that saccharin-based derivatives are widely used in many chemistry fields, we foresee that structures exemplified by clusters C and D offer new opportunities for novel drug design, creating a chiral center on the sulfur atom and the option of substitution at two different nitrogens.

  2. High-dimensional entanglement certification

    PubMed Central

    Huang, Zixin; Maccone, Lorenzo; Karim, Akib; Macchiavello, Chiara; Chapman, Robert J.; Peruzzo, Alberto

    2016-01-01

    Quantum entanglement is the ability of joint quantum systems to possess global properties (correlation among systems) even when subsystems have no definite individual property. Whilst the 2-dimensional (qubit) case is well-understood, currently, tools to characterise entanglement in high dimensions are limited. We experimentally demonstrate a new procedure for entanglement certification that is suitable for large systems, based entirely on information-theoretics. It scales more efficiently than Bell’s inequality and entanglement witness. The method we developed works for arbitrarily large system dimension d and employs only two local measurements of complementary properties. This procedure can also certify whether the system is maximally entangled. We illustrate the protocol for families of bipartite states of qudits with dimension up to 32 composed of polarisation-entangled photon pairs. PMID:27311935

  3. High-dimensional entanglement certification

    NASA Astrophysics Data System (ADS)

    Huang, Zixin; Maccone, Lorenzo; Karim, Akib; Macchiavello, Chiara; Chapman, Robert J.; Peruzzo, Alberto

    2016-06-01

    Quantum entanglement is the ability of joint quantum systems to possess global properties (correlation among systems) even when subsystems have no definite individual property. Whilst the 2-dimensional (qubit) case is well-understood, currently, tools to characterise entanglement in high dimensions are limited. We experimentally demonstrate a new procedure for entanglement certification that is suitable for large systems, based entirely on information-theoretics. It scales more efficiently than Bell’s inequality and entanglement witness. The method we developed works for arbitrarily large system dimension d and employs only two local measurements of complementary properties. This procedure can also certify whether the system is maximally entangled. We illustrate the protocol for families of bipartite states of qudits with dimension up to 32 composed of polarisation-entangled photon pairs.

  4. Laboratory and Modeling Studies of Insect Swarms

    DTIC Science & Technology

    2016-03-10

    and measuring the response. These novel methods allowed us for the first time to characterize precisely properties of the swarm at the group level... Time series for a randomly chosen pair as well as its continuous wavelet transform (CWT; bottom panel). Nearly all of the power in the signal for... based time -frequency analysis to identify such transient interactions, as long as they modified the frequency structure of the insect flight

  5. Broadly absorbing metalloporphyrin-based multichromophoric arrays for triplet harvesting

    DOEpatents

    Thompson, Mark E.; Whited, Matthew T.; Djurovich, Peter I.

    2016-09-20

    The present disclosure relates to multichromophoric assemblies comprising metalloporphyrin scaffolds. The present disclosure also relates, in part, to methods for generating electric-field-stabilized geminate polaron pairs comprising applying electric fields to the multichromophoric assemblies described herein, or alternatively, directly to the metalloporphyrins provided by the present disclosure. The present disclosure further relates, in part, to multichromophoric assemblies comprising metalloporphyrin scaffolds, which exhibit enhanced energy transfer properties.

  6. Gender in facial representations: a contrast-based study of adaptation within and between the sexes.

    PubMed

    Oruç, Ipek; Guo, Xiaoyue M; Barton, Jason J S

    2011-01-18

    Face aftereffects are proving to be an effective means of examining the properties of face-specific processes in the human visual system. We examined the role of gender in the neural representation of faces using a contrast-based adaptation method. If faces of different genders share the same representational face space, then adaptation to a face of one gender should affect both same- and different-gender faces. Further, if these aftereffects differ in magnitude, this may indicate distinct gender-related factors in the organization of this face space. To control for a potential confound between physical similarity and gender, we used a Bayesian ideal observer and human discrimination data to construct a stimulus set in which pairs of different-gender faces were equally dissimilar as same-gender pairs. We found that the recognition of both same-gender and different-gender faces was suppressed following a brief exposure of 100 ms. Moreover, recognition was more suppressed for test faces of a different-gender than those of the same-gender as the adaptor, despite the equivalence in physical and psychophysical similarity. Our results suggest that male and female faces likely occupy the same face space, allowing transfer of aftereffects between the genders, but that there are special properties that emerge along gender-defining dimensions of this space.

  7. Excitonic couplings between molecular crystal pairs by a multistate approximation

    NASA Astrophysics Data System (ADS)

    Aragó, Juan; Troisi, Alessandro

    2015-04-01

    In this paper, we present a diabatization scheme to compute the excitonic couplings between an arbitrary number of states in molecular pairs. The method is based on an algebraic procedure to find the diabatic states with a desired property as close as possible to that of some reference states. In common with other diabatization schemes, this method captures the physics of the important short-range contributions (exchange, overlap, and charge-transfer mediated terms) but it becomes particularly suitable in presence of more than two states of interest. The method is formulated to be usable with any level of electronic structure calculations and to diabatize different types of states by selecting different molecular properties. These features make the diabatization scheme presented here especially appropriate in the context of organic crystals, where several excitons localized on the same molecular pair may be found close in energy. In this paper, the method is validated on the tetracene crystal dimer, a well characterized case where the charge transfer (CT) states are closer in energy to the Frenkel excitons (FE). The test system was studied as a function of an external electric field (to explore the effect of changing the relative energy of the CT excited state) and as a function of different intermolecular distances (to probe the strength of the coupling between FE and CT states). Additionally, we illustrate how the approximation can be used to include the environment polarization effect.

  8. Effects of buspirone on the immediate positive and delayed negative properties of intravenous cocaine as measured in the conditioned place preference test

    PubMed Central

    Ettenberg, Aaron; Bernardi, Rick E.

    2007-01-01

    In prior work, we have demonstrated that the behavioral effects of cocaine adhere to the predictions of the opponent-process theory of drug action. Animals develop conditioned place preferences for distinct locations paired with the immediate effects of IV cocaine, but learn to avoid places paired with the effects present 15-min post injection. It was of interest to assess the putative role of 5-HT in producing the negative properties of cocaine since cocaine acts to inhibit the reuptake of serotonin (5-HT) and since such actions have been associated with anxiogenic consequences. Male rats were administered a reinforcing dose of cocaine (1.0 mg/kg IV) and then placed – either immediately or after a 15-min delay -- into one side of a two-compartment (black-white) Conditioned Place Preference (CPP) box for 5-min. On alternate days, the animals received IV saline injections and were placed in the opposite side of the CPP box. This continued for eight days after which animals had experienced 4 pairings of cocaine with one side (black or white) of the CPP apparatus, and 4 saline pairings with the opposite side. Other groups of rats were treated identically except that 30-min prior to placement into the apparatus, these animals received an IP injection of saline or buspirone (a partial 5-HT1A agonist) at a dose that we have shown to be anxiolytic (2.5 mg/kg IP). Control animals experienced either buspirone or saline pretreatments without cocaine. Our results confirm that animals increase the time spent on the side paired with the immediate effects of cocaine (compared to baseline), but tend to avoid the side paired with effects present 15-min post-injection. Buspirone had no effect on the immediate rewarding properties of cocaine, but completely reversed the negative properties present 15-min post-cocaine. These results are consistent with the view that attenuation of 5-HT neurotransmission (via the autoreceptor agonist properties of buspirone) can reverse the negative impact of IV cocaine. PMID:17524462

  9. Base-Pairing Energies of Protonated Nucleoside Base Pairs of dCyd and m5dCyd: Implications for the Stability of DNA i-Motif Conformations

    NASA Astrophysics Data System (ADS)

    Yang, Bo; Rodgers, M. T.

    2015-08-01

    Hypermethylation of cytosine in expanded (CCG)n•(CGG)n trinucleotide repeats results in Fragile X syndrome, the most common cause of inherited mental retardation. The (CCG)n•(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of protonated base pairs of cytosine. Here we investigate the effects of 5-methylation and the sugar moiety on the base-pairing energies (BPEs) of protonated cytosine base pairs by examining protonated nucleoside base pairs of 2'-deoxycytidine (dCyd) and 5-methyl-2'-deoxycytidine (m5dCyd) using threshold collision-induced dissociation techniques. 5-Methylation of a single or both cytosine residues leads to very small change in the BPE. However, the accumulated effect may be dramatic in diseased state trinucleotide repeats where many methylated base pairs may be present. The BPEs of the protonated nucleoside base pairs examined here significantly exceed those of Watson-Crick dGuo•dCyd and neutral dCyd•dCyd base pairs, such that these base-pairing interactions provide the major forces responsible for stabilization of DNA i-motif conformations. Compared with isolated protonated nucleobase pairs of cytosine and 1-methylcytosine, the 2'-deoxyribose sugar produces an effect similar to the 1-methyl substituent, and leads to a slight decrease in the BPE. These results suggest that the base-pairing interactions may be slightly weaker in nucleic acids, but that the extended backbone is likely to exert a relatively small effect on the total BPE. The proton affinity (PA) of m5dCyd is also determined by competitive analysis of the primary dissociation pathways that occur in parallel for the protonated (m5dCyd)H+(dCyd) nucleoside base pair and the absolute PA of dCyd previously reported.

  10. Augmenting comprehension of geological relationships by integrating 3D laser scanned hand samples within a GIS environment

    NASA Astrophysics Data System (ADS)

    Harvey, A. S.; Fotopoulos, G.; Hall, B.; Amolins, K.

    2017-06-01

    Geological observations can be made on multiple scales, including micro- (e.g. thin section), meso- (e.g. hand-sized to outcrop) and macro- (e.g. outcrop and larger) scales. Types of meso-scale samples include, but are not limited to, rocks (including drill cores), minerals, and fossils. The spatial relationship among samples paired with physical (e.g. granulometric composition, density, roughness) and chemical (e.g. mineralogical and isotopic composition) properties can aid in interpreting geological settings, such as paleo-environmental and formational conditions as well as geomorphological history. Field samples are collected along traverses in the area of interest based on characteristic representativeness of a region, predetermined rate of sampling, and/or uniqueness. The location of a sample can provide relative context in seeking out additional key samples. Beyond labelling and recording of geospatial coordinates for samples, further analysis of physical and chemical properties may be conducted in the field and laboratory. The main motivation for this paper is to present a workflow for the digital preservation of samples (via 3D laser scanning) paired with the development of cyber infrastructure, which offers geoscientists and engineers the opportunity to access an increasingly diverse worldwide collection of digital Earth materials. This paper describes a Web-based graphical user interface developed using Web AppBuilder for ArcGIS for digitized meso-scale 3D scans of geological samples to be viewed alongside the macro-scale environment. Over 100 samples of virtual rocks, minerals and fossils populate the developed geological database and are linked explicitly with their associated attributes, characteristic properties, and location. Applications of this new Web-based geological visualization paradigm in the geosciences demonstrate the utility of such a tool in an age of increasing global data sharing.

  11. Correlation in photon pairs generated using four-wave mixing in a cold atomic ensemble

    NASA Astrophysics Data System (ADS)

    Ferdinand, Andrew Richard; Manjavacas, Alejandro; Becerra, Francisco Elohim

    2017-04-01

    Spontaneous four-wave mixing (FWM) in atomic ensembles can be used to generate narrowband entangled photon pairs at or near atomic resonances. While extensive research has been done to investigate the quantum correlations in the time and polarization of such photon pairs, the study and control of high dimensional quantum correlations contained in their spatial degrees of freedom has not been fully explored. In our work we experimentally investigate the generation of correlated light from FWM in a cold ensemble of cesium atoms as a function of the frequencies of the pump fields in the FWM process. In addition, we theoretically study the spatial correlations of the photon pairs generated in the FWM process, specifically the joint distribution of their orbital angular momentum (OAM). We investigate the width of the distribution of the OAM modes, known as the spiral bandwidth, and the purity of OAM correlations as a function of the properties of the pump fields, collected photons, and the atomic ensemble. These studies will guide experiments involving high dimensional entanglement of photons generated from this FWM process and OAM-based quantum communication with atomic ensembles. This work is supported by AFORS Grant FA9550-14-1-0300.

  12. How to test for partially predictable chaos.

    PubMed

    Wernecke, Hendrik; Sándor, Bulcsú; Gros, Claudius

    2017-04-24

    For a chaotic system pairs of initially close-by trajectories become eventually fully uncorrelated on the attracting set. This process of decorrelation can split into an initial exponential decrease and a subsequent diffusive process on the chaotic attractor causing the final loss of predictability. Both processes can be either of the same or of very different time scales. In the latter case the two trajectories linger within a finite but small distance (with respect to the overall extent of the attractor) for exceedingly long times and remain partially predictable. Standard tests for chaos widely use inter-orbital correlations as an indicator. However, testing partially predictable chaos yields mostly ambiguous results, as this type of chaos is characterized by attractors of fractally broadened braids. For a resolution we introduce a novel 0-1 indicator for chaos based on the cross-distance scaling of pairs of initially close trajectories. This test robustly discriminates chaos, including partially predictable chaos, from laminar flow. Additionally using the finite time cross-correlation of pairs of initially close trajectories, we are able to identify laminar flow as well as strong and partially predictable chaos in a 0-1 manner solely from the properties of pairs of trajectories.

  13. A Biochemical Magic Frequency

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1993-01-01

    Life is composed principally of four classes of biomolecules - protein, nucleic acid, polysaccharide and lipid. Using 1) estimates of the reducing equivalents (electron pairs) needed to synthesize these biomolecules from carbon dioxide, and 2) measurements of the molecular composition of different organisms, we calculated the average number of electron pairs required for the reduction of carbon dioxide to biological carbon (electron pairs/carbon atom). These calculations showed that the carbon of the Earths biosphere is at the reduction level of formaldehyde that requires 2 electron pairs/carbon atom to be synthesized from carbon dioxide. This was also the reduction level of carbon of individual organisms, except for those that stored large amounts of fuel as lipid. Since this chemical property of life is easily discovered and probably universal, it's most likely known by other intelligent life in the universe. It could be the one thing we know about other carbon-based life in the universe, and the one thing that other intelligent life knows about us. We believe this common knowledge that formaldehyde represents the reduction level of life's carbon could lead to the selection of the 72.83814 GHz line of the 0,0,0,1,0,1 ground-state rotational transition of formaldehyde as a frequency for interstellar communication.

  14. Neurons in cat V1 show significant clustering by degree of tuning

    PubMed Central

    Ziskind, Avi J.; Emondi, Al A.; Kurgansky, Andrei V.; Rebrik, Sergei P.

    2015-01-01

    Neighboring neurons in cat primary visual cortex (V1) have similar preferred orientation, direction, and spatial frequency. How diverse is their degree of tuning for these properties? To address this, we used single-tetrode recordings to simultaneously isolate multiple cells at single recording sites and record their responses to flashed and drifting gratings of multiple orientations, spatial frequencies, and, for drifting gratings, directions. Orientation tuning width, spatial frequency tuning width, and direction selectivity index (DSI) all showed significant clustering: pairs of neurons recorded at a single site were significantly more similar in each of these properties than pairs of neurons from different recording sites. The strength of the clustering was generally modest. The percent decrease in the median difference between pairs from the same site, relative to pairs from different sites, was as follows: for different measures of orientation tuning width, 29–35% (drifting gratings) or 15–25% (flashed gratings); for DSI, 24%; and for spatial frequency tuning width measured in octaves, 8% (drifting gratings). The clusterings of all of these measures were much weaker than for preferred orientation (68% decrease) but comparable to that seen for preferred spatial frequency in response to drifting gratings (26%). For the above properties, little difference in clustering was seen between simple and complex cells. In studies of spatial frequency tuning to flashed gratings, strong clustering was seen among simple-cell pairs for tuning width (70% decrease) and preferred frequency (71% decrease), whereas no clustering was seen for simple-complex or complex-complex cell pairs. PMID:25652921

  15. A base-modified PNA-graphene oxide platform as a turn-on fluorescence sensor for the detection of human telomeric repeats

    NASA Astrophysics Data System (ADS)

    Sabale, Pramod M.; George, Jerrin Thomas; Srivatsan, Seergazhi G.

    2014-08-01

    Given the biological and therapeutic significance of telomeres and other G-quadruplex forming sequences in human genome, it is highly desirable to develop simple methods to study these structures, which can also be implemented in screening formats for the discovery of G-quadruplex binders. The majority of telomere detection methods developed so far are laborious and use elaborate assay and instrumental setups, and hence, are not amenable to discovery platforms. Here, we describe the development of a simple homogeneous fluorescence turn-on method, which uses a unique combination of an environment-sensitive fluorescent nucleobase analogue, the superior base pairing property of PNA, and DNA-binding and fluorescence quenching properties of graphene oxide, to detect human telomeric DNA repeats of varying lengths. Our results demonstrate that this method, which does not involve a rigorous assay setup, would provide new opportunities to study G-quadruplex structures.Given the biological and therapeutic significance of telomeres and other G-quadruplex forming sequences in human genome, it is highly desirable to develop simple methods to study these structures, which can also be implemented in screening formats for the discovery of G-quadruplex binders. The majority of telomere detection methods developed so far are laborious and use elaborate assay and instrumental setups, and hence, are not amenable to discovery platforms. Here, we describe the development of a simple homogeneous fluorescence turn-on method, which uses a unique combination of an environment-sensitive fluorescent nucleobase analogue, the superior base pairing property of PNA, and DNA-binding and fluorescence quenching properties of graphene oxide, to detect human telomeric DNA repeats of varying lengths. Our results demonstrate that this method, which does not involve a rigorous assay setup, would provide new opportunities to study G-quadruplex structures. Electronic supplementary information (ESI) available. Figures, tables, experimental procedures and NMR spectra. See DOI: 10.1039/c4nr00878b

  16. Base pairing and base mis-pairing in nucleic acids

    NASA Technical Reports Server (NTRS)

    Wang, A. H. J.; Rich, A.

    1986-01-01

    In recent years we have learned that DNA is conformationally active. It can exist in a number of different stable conformations including both right-handed and left-handed forms. Using single crystal X-ray diffraction analysis we are able to discover not only additional conformations of the nucleic acids but also different types of hydrogen bonded base-base interactions. Although Watson-Crick base pairings are the predominant type of interaction in double helical DNA, they are not the only types. Recently, we have been able to examine mismatching of guanine-thymine base pairs in left-handed Z-DNA at atomic resolution (1A). A minimum amount of distortion of the sugar phosphate backbone is found in the G x T pairing in which the bases are held together by two hydrogen bonds in the wobble pairing interaction. Because of the high resolution of the analysis we can visualize water molecules which fill in to accommodate the other hydrogen bonding positions in the bases which are not used in the base-base interactions. Studies on other DNA oligomers have revealed that other types of non-Watson-Crick hydrogen bonding interactions can occur. In the structure of a DNA octamer with the sequence d(GCGTACGC) complexed to an antibiotic triostin A, it was found that the two central AT base pairs are held together by Hoogsteen rather than Watson-Crick base pairs. Similarly, the G x C base pairs at the ends are also Hoogsteen rather than Watson-Crick pairing. Hoogsteen base pairs make a modified helix which is distinct from the Watson-Crick double helix.

  17. Hidden in Plain Sight: Subtle Effects of the 8-Oxoguanine Lesion on the Structure, Dynamics, and Thermodynamics of a 15-Base-Pair Oligodeoxynucleotide Duplex†

    PubMed Central

    Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.

    2011-01-01

    The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242

  18. Ionic micelles and aromatic additives: a closer look at the molecular packing parameter.

    PubMed

    Lutz-Bueno, Viviane; Isabettini, Stéphane; Walker, Franziska; Kuster, Simon; Liebi, Marianne; Fischer, Peter

    2017-08-16

    Wormlike micellar aggregates formed from the mixture of ionic surfactants with aromatic additives result in solutions with impressive viscoelastic properties. These properties are of high interest for numerous industrial applications and are often used as model systems for soft matter physics. However, robust and simple models for tailoring the viscoelastic response of the solution based on the molecular structure of the employed additive are required to fully exploit the potential of these systems. We address this shortcoming with a modified packing parameter based model, considering the additive-surfactant pair. The role of charge neutralization on anisotropic micellar growth was investigated with derivatives of sodium salicylate. The impact of the additives on the morphology of the micellar aggregates is explained from the molecular level to the macroscopic viscoelasticity. Changes in the micelle's volume, headgroup area and additive structure are explored to redefine the packing parameter. Uncharged additives penetrated deeper into the hydrophobic region of the micelle, whilst charged additives remained trapped in the polar region, as revealed by a combination of 1 H-NMR, SAXS and rheological measurements. A deeper penetration of the additives densified the hydrophobic core of the micelle and induced anisotropic growth by increasing the effective volume of the additive-surfactant pair. This phenomenon largely influenced the viscosity of the solutions. Partially penetrating additives reduced the electrostatic repulsions between surfactant headgroups and neighboring micelles. The resulting increased network density governed the elasticity of the solutions. Considering a packing parameter composed of the additive-surfactant pair proved to be a facile means of engineering the viscoelastic response of surfactant solutions. The self-assembly of the wormlike micellar aggregates could be tailored to desired morphologies resulting in a specific and predictable rheological response.

  19. Analysis of blocking of flavor-preference conditioning based on nutrients and palatable tastes in rats.

    PubMed

    González, Felisa; Garcia-Burgos, David; Hall, Geoffrey

    2014-09-01

    In Experiment 1 rats were given training in which a mixture of two flavors was paired with sucrose. This established a substantial preference for each of the flavors; however, when rats were given prior experience with just one of the flavors paired with sucrose, training with the compound produced only a weak preference for the other - an example of the blocking effect, well known in other associative learning paradigms. Both the palatable taste of sucrose and its nutrient properties contribute to its ability to reinforce preference acquisition. The role of these two forms of learning was examined in two further experiments in which the reinforcer used was fructose (which is considered to support preference learning because it is palatable but not through its nutrient properties) or maltodextrin (thought to support preference learning by way of its nutrient properties). In neither case was blocking observed. At the theoretical level, this outcome constitutes a challenge to the attempt to explain flavor-preference learning in terms of the standard principles of associative learning theory. Its implication at the level of application is that the potential of the blocking procedure as a technique for preventing the development of unwanted flavor preferences may be limited. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. SparseMaps—A systematic infrastructure for reduced-scaling electronic structure methods. III. Linear-scaling multireference domain-based pair natural orbital N-electron valence perturbation theory

    NASA Astrophysics Data System (ADS)

    Guo, Yang; Sivalingam, Kantharuban; Valeev, Edward F.; Neese, Frank

    2016-03-01

    Multi-reference (MR) electronic structure methods, such as MR configuration interaction or MR perturbation theory, can provide reliable energies and properties for many molecular phenomena like bond breaking, excited states, transition states or magnetic properties of transition metal complexes and clusters. However, owing to their inherent complexity, most MR methods are still too computationally expensive for large systems. Therefore the development of more computationally attractive MR approaches is necessary to enable routine application for large-scale chemical systems. Among the state-of-the-art MR methods, second-order N-electron valence state perturbation theory (NEVPT2) is an efficient, size-consistent, and intruder-state-free method. However, there are still two important bottlenecks in practical applications of NEVPT2 to large systems: (a) the high computational cost of NEVPT2 for large molecules, even with moderate active spaces and (b) the prohibitive cost for treating large active spaces. In this work, we address problem (a) by developing a linear scaling "partially contracted" NEVPT2 method. This development uses the idea of domain-based local pair natural orbitals (DLPNOs) to form a highly efficient algorithm. As shown previously in the framework of single-reference methods, the DLPNO concept leads to an enormous reduction in computational effort while at the same time providing high accuracy (approaching 99.9% of the correlation energy), robustness, and black-box character. In the DLPNO approach, the virtual space is spanned by pair natural orbitals that are expanded in terms of projected atomic orbitals in large orbital domains, while the inactive space is spanned by localized orbitals. The active orbitals are left untouched. Our implementation features a highly efficient "electron pair prescreening" that skips the negligible inactive pairs. The surviving pairs are treated using the partially contracted NEVPT2 formalism. A detailed comparison between the partial and strong contraction schemes is made, with conclusions that discourage the strong contraction scheme as a basis for local correlation methods due to its non-invariance with respect to rotations in the inactive and external subspaces. A minimal set of conservatively chosen truncation thresholds controls the accuracy of the method. With the default thresholds, about 99.9% of the canonical partially contracted NEVPT2 correlation energy is recovered while the crossover of the computational cost with the already very efficient canonical method occurs reasonably early; in linear chain type compounds at a chain length of around 80 atoms. Calculations are reported for systems with more than 300 atoms and 5400 basis functions.

  1. Structural landscape of base pairs containing post-transcriptional modifications in RNA

    PubMed Central

    Seelam, Preethi P.; Sharma, Purshotam

    2017-01-01

    Base pairs involving post-transcriptionally modified nucleobases are believed to play important roles in a wide variety of functional RNAs. Here we present our attempts toward understanding the structural and functional role of naturally occurring modified base pairs using a combination of X-ray crystal structure database analysis, sequence analysis, and advanced quantum chemical methods. Our bioinformatics analysis reveals that despite their presence in all major secondary structural elements, modified base pairs are most prevalent in tRNA crystal structures and most commonly involve guanine or uridine modifications. Further, analysis of tRNA sequences reveals additional examples of modified base pairs at structurally conserved tRNA regions and highlights the conservation patterns of these base pairs in three domains of life. Comparison of structures and binding energies of modified base pairs with their unmodified counterparts, using quantum chemical methods, allowed us to classify the base modifications in terms of the nature of their electronic structure effects on base-pairing. Analysis of specific structural contexts of modified base pairs in RNA crystal structures revealed several interesting scenarios, including those at the tRNA:rRNA interface, antibiotic-binding sites on the ribosome, and the three-way junctions within tRNA. These scenarios, when analyzed in the context of available experimental data, allowed us to correlate the occurrence and strength of modified base pairs with their specific functional roles. Overall, our study highlights the structural importance of modified base pairs in RNA and points toward the need for greater appreciation of the role of modified bases and their interactions, in the context of many biological processes involving RNA. PMID:28341704

  2. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Feng, Zhange; Higa, Kenneth; Han, Kee Sung

    The presence of lithium hexafluorophosphate (LiPF 6) ion pairs in carbonate-based electrolyte solutions is widely accepted in the field of battery electrolyte research and is expected to affect solution transport properties. No existing techniques are capable of directly quantifying salt dissociation in these solutions. Previous publications by others have provided estimates of dissociation degrees using dilute solution theory and pulsed field gradient nuclear magnetic resonance spectroscopy (PFG-NMR) measurements of self-diffusivity. However, the behavior of a concentrated electrolyte solution can deviate significantly from dilute solution theory predictions. This paper, for the first time, instead uses Onsager–Stefan–Maxwell concentrated solution theory and themore » generalized Darken relation with PFG-NMR measurements to quantify the degrees of dissociation in electrolyte solutions (LiPF 6 in ethylene carbonate/diethyl carbonate, 1:1 by weight). At LiPF 6 concentrations ranging from 0.1 M to 1.5 M, the salt dissociation degree is found to range from 61% to 37%. Finally, transport properties are then calculated through concentrated solution theory with corrections for these significant levels of ion pairing.« less

  3. Ground state, collective mode, phase soliton and vortex in multiband superconductors.

    PubMed

    Lin, Shi-Zeng

    2014-12-10

    This article reviews theoretical and experimental work on the novel physics in multiband superconductors. Multiband superconductors are characterized by multiple superconducting energy gaps in different bands with interaction between Cooper pairs in these bands. The discovery of prominent multiband superconductors MgB2 and later iron-based superconductors, has triggered enormous interest in multiband superconductors. The most recently discovered superconductors exhibit multiband features. The multiband superconductors possess novel properties that are not shared with their single-band counterpart. Examples include: the time-reversal symmetry broken state in multiband superconductors with frustrated interband couplings; the collective oscillation of number of Cooper pairs between different bands, known as the Leggett mode; and the phase soliton and fractional vortex, which are the main focus of this review. This review presents a survey of a wide range of theoretical exploratory and experimental investigations of novel physics in multiband superconductors. A vast amount of information derived from these studies is shown to highlight unusual and unique properties of multiband superconductors and to reveal the challenges and opportunities in the research on the multiband superconductivity.

  4. Pseudo-random generator based on Chinese Remainder Theorem

    NASA Astrophysics Data System (ADS)

    Bajard, Jean Claude; Hördegen, Heinrich

    2009-08-01

    Pseudo-Random Generators (PRG) are fundamental in cryptography. Their use occurs at different level in cipher protocols. They need to verify some properties for being qualified as robust. The NIST proposes some criteria and a tests suite which gives informations on the behavior of the PRG. In this work, we present a PRG constructed from the conversion between further residue systems of representation of the elements of GF(2)[X]. In this approach, we use some pairs of co-prime polynomials of degree k and a state vector of 2k bits. The algebraic properties are broken by using different independent pairs during the process. Since this method is reversible, we also can use it as a symmetric crypto-system. We evaluate the cost of a such system, taking into account that some operations are commonly implemented on crypto-processors. We give the results of the different NIST Tests and we explain this choice compare to others found in the literature. We describe the behavior of this PRG and explain how the different rounds are chained for ensuring a fine secure randomness.

  5. Weak-coupling superconductivity in a strongly correlated iron pnictide

    PubMed Central

    Charnukha, A.; Post, K. W.; Thirupathaiah, S.; Pröpper, D.; Wurmehl, S.; Roslova, M.; Morozov, I.; Büchner, B.; Yaresko, A. N.; Boris, A. V.; Borisenko, S. V.; Basov, D. N.

    2016-01-01

    Iron-based superconductors have been found to exhibit an intimate interplay of orbital, spin, and lattice degrees of freedom, dramatically affecting their low-energy electronic properties, including superconductivity. Albeit the precise pairing mechanism remains unidentified, several candidate interactions have been suggested to mediate the superconducting pairing, both in the orbital and in the spin channel. Here, we employ optical spectroscopy (OS), angle-resolved photoemission spectroscopy (ARPES), ab initio band-structure, and Eliashberg calculations to show that nearly optimally doped NaFe0.978Co0.022As exhibits some of the strongest orbitally selective electronic correlations in the family of iron pnictides. Unexpectedly, we find that the mass enhancement of itinerant charge carriers in the strongly correlated band is dramatically reduced near the Γ point and attribute this effect to orbital mixing induced by pronounced spin-orbit coupling. Embracing the true band structure allows us to describe all low-energy electronic properties obtained in our experiments with remarkable consistency and demonstrate that superconductivity in this material is rather weak and mediated by spin fluctuations. PMID:26729630

  6. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

    PubMed

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

    2004-03-01

    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson-Crick base pair in SECIS element plays an important role in the selenocysteine expression by UGA codon.

  7. Introducing a model of pairing based on base pair specific interactions between identical DNA sequences

    NASA Astrophysics Data System (ADS)

    (O' Lee, Dominic J.

    2018-02-01

    At present, there have been suggested two types of physical mechanism that may facilitate preferential pairing between DNA molecules, with identical or similar base pair texts, without separation of base pairs. One mechanism solely relies on base pair specific patterns of helix distortion being the same on the two molecules, discussed extensively in the past. The other mechanism proposes that there are preferential interactions between base pairs of the same composition. We introduce a model, built on this second mechanism, where both thermal stretching and twisting fluctuations are included, as well as the base pair specific helix distortions. Firstly, we consider an approximation for weak pairing interactions, or short molecules. This yields a dependence of the energy on the square root of the molecular length, which could explain recent experimental data. However, analysis suggests that this approximation is no longer valid at large DNA lengths. In a second approximation, for long molecules, we define two adaptation lengths for twisting and stretching, over which the pairing interaction can limit the accumulation of helix disorder. When the pairing interaction is sufficiently strong, both adaptation lengths are finite; however, as we reduce pairing strength, the stretching adaptation length remains finite but the torsional one becomes infinite. This second state persists to arbitrarily weak values of the pairing strength; suggesting that, if the molecules are long enough, the pairing energy scales as length. To probe differences between the two pairing mechanisms, we also construct a model of similar form. However, now, pairing between identical sequences solely relies on the intrinsic helix distortion patterns. Between the two models, we see interesting qualitative differences. We discuss our findings, and suggest new work to distinguish between the two mechanisms.

  8. DNA interactions of non-chelating tinidazole-based coordination compounds and their structural, redox and cytotoxic properties.

    PubMed

    Castro-Ramírez, Rodrigo; Ortiz-Pastrana, Naytzé; Caballero, Ana B; Zimmerman, Matthew T; Stadelman, Bradley S; Gaertner, Andrea A E; Brumaghim, Julia L; Korrodi-Gregório, Luís; Pérez-Tomás, Ricardo; Gamez, Patrick; Barba-Behrens, Norah

    2018-05-23

    Novel tinidazole (tnz) coordination compounds of different geometries were synthesised, whose respective solid-state packing appears to be driven by inter- and intramolecular lone pairπ interactions. The copper(ii) compounds exhibit interesting redox properties originating from both the tnz and the metal ions. These complexes interact with DNA through two distinct ways, namely via electrostatic interactions or/and groove binding, and they can mediate the generation of ROS that damage the biomolecule. Cytotoxic studies revealed an interesting activity of the dinuclear compound [Cu(tnz)2(μ-Cl)Cl]2 7, which is further more efficient towards cancer cells, compared with normal cells.

  9. Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

    PubMed

    Kryachko, E S; Remacle, F

    2005-12-08

    The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

  10. QM and QM/MM Studies on Excited-State Relaxation Mechanisms of Unnatural Bases in Vacuo and Base Pairs in DNA.

    PubMed

    Wang, Qian; Xie, Xiao-Ying; Han, Juan; Cui, Ganglong

    2017-11-22

    Semisynthetic alphabet can potentially increase the genetic information stored in DNA through the formation of unusual base pairs such as d5SICS:dNaM. However, recent experiments show that near-visible-light irradiation on the d5SICS and dNaM chromophores could lead to genetic mutations and damages. Until now, their photophysical mechanisms remain elusive. Herein, we have employed MS-CASPT2//CASSCF and QM(MS-CASPT2//CASSCF)/MM methods to explore the spectroscopic properties and excited-state relaxation mechanisms of d5SICS, dNaM, and d5SICS:dNaM in DNA. We have found that (1) the S 2 state of d5SICS, the S 1 state of dNaM, and the S 2 state of d5SICS:dNaM are initially populated upon near-visible-light irradiation and (2) for d5SICS and d5SICS:dNaM, there are several parallel relaxation pathways to populate the lowest triplet state, but for dNaM, a main relaxation pathway is uncovered. Moreover, we have found that the excited-state relaxation mechanism of d5SICS:dNaM in DNA is similar to that of the isolated d5SICS chromophore. These mechanistic insights contribute to the understanding of photophysics and photochemistry of unusual base pairs and to the design of better semisynthetic genetic alphabet.

  11. Optimum electrode configuration selection for electrical resistance change based damage detection in composites using an effective independence measure

    NASA Astrophysics Data System (ADS)

    Escalona, Luis; Díaz-Montiel, Paulina; Venkataraman, Satchi

    2016-04-01

    Laminated carbon fiber reinforced polymer (CFRP) composite materials are increasingly used in aerospace structures due to their superior mechanical properties and reduced weight. Assessing the health and integrity of these structures requires non-destructive evaluation (NDE) techniques to detect and measure interlaminar delamination and intralaminar matrix cracking damage. The electrical resistance change (ERC) based NDE technique uses the inherent changes in conductive properties of the composite to characterize internal damage. Several works that have explored the ERC technique have been limited to thin cross-ply laminates with simple linear or circular electrode arrangements. This paper investigates a method of optimum selection of electrode configurations for delamination detection in thick cross-ply laminates using ERC. Inverse identification of damage requires numerical optimization of the measured response with a model predicted response. Here, the electrical voltage field in the CFRP composite laminate is calculated using finite element analysis (FEA) models for different specified delamination size and locations, and location of ground and current electrodes. Reducing the number of sensor locations and measurements is needed to reduce hardware requirements, and computational effort needed for inverse identification. This paper explores the use of effective independence (EI) measure originally proposed for sensor location optimization in experimental vibration modal analysis. The EI measure is used for selecting the minimum set of resistance measurements among all possible combinations of selecting a pair of electrodes among the n electrodes. To enable use of EI to ERC required, it is proposed in this research a singular value decomposition SVD to obtain a spectral representation of the resistance measurements in the laminate. The effectiveness of EI measure in eliminating redundant electrode pairs is demonstrated by performing inverse identification of damage using the full set of resistance measurements and the reduced set of measurements. The investigation shows that the EI measure is effective for optimally selecting the electrode pairs needed for resistance measurements in ERC based damage detection.

  12. A study of N-methylacetamide in water clusters: based on atom-bond electronegativity equalization method fused into molecular mechanics.

    PubMed

    Yang, Zhong-Zhi; Qian, Ping

    2006-08-14

    N-methylacetamide (NMA) is a very interesting compound and often serves as a model of the peptide bond. The interaction between NMA and water provides a convenient prototype for the solvation of the peptides in aqueous solutions. Here we present NMA-water potential model based on atom-bond electronegativity equalization method fused into molecular mechanics (ABEEM/MM) that is to take ABEEM charges of all atoms, bonds, and lone-pair electrons of NMA and water molecules into the electrostatic interaction term in molecular mechanics. The model has the following characters: (1)it allows the charges in system to fluctuate responding to the ambient environment; (2) for two major types of intermolecular hydrogen bonds, which are the hydrogen bond forming between the lone-pair electron on amide oxygen and the water hydrogen, and the one forming between the lone-pair electron on water oxygen and the amide hydrogen, we take special treatments in describing the electrostatic interaction by the use of the parameters k(lpO=, H) and k(lpO(-), HN(-)), respectively. The newly constructed potential model based on ABEEM/MM is first applied to amide-water clusters and reproduces gas-phase state properties of NMA(H(2)O)(n) (n=1-3) including optimal structures, dipole moments, ABEEM charge distributions, energy difference of the isolated trans- and cis-NMA, interaction energies, hydrogen bonding cooperative effects, and so on, whose results show the good agreement with those measured by available experiments and calculated by ab initio methods. In order to further test the reasonableness of this model and the correctness and transferability of the parameters, many static properties of the larger NMA-water complexes NMA(H(2)O)(n) (n=4-6) are also studied including optimal structures and interaction energies. The results also show fair consistency with those of our quantum chemistry calculations.

  13. Anticancer property of sediment actinomycetes against MCF-7 and MDA-MB-231 cell lines.

    PubMed

    Ravikumar, S; Fredimoses, M; Gnanadesigan, M

    2012-02-01

    To investigate the anticancer property of marine sediment actinomycetes against two different breast cancer cell lines. In vitro anticancer activity was carried out against breast (MCF-7 and MDA-MB-231) cancer cell lines. Partial sequences of the 16s rRNA gene, phylogenetic tree construction, multiple sequence analysis and secondary structure analysis were also carried out with the actinomycetes isolates. Of the selected five actinomycete isolates, ACT01 and ACT02 showed the IC50 value with (10.13±0.92) and (22.34±5.82) µg/mL concentrations, respectively for MCF-7 cell line at 48 h, but ACT01 showed the minimum (18.54±2.49 µg/mL) level of IC50 value with MDA-MB-231 cell line. Further, the 16s rRNA partial sequences of ACT01, ACT02, ACT03, ACT04 and ACT05 isolates were also deposited in NCBI data bank with the accession numbers of GQ478246, GQ478247, GQ478248, GQ478249 and GQ478250, respectively. The phylogenetic tree analysis showed that, the isolates of ACT02 and ACT03 were represented in group I and III, respectively, but ACT01 and ACT02 were represented in group II. The multiple sequence alignment of the actinomycete isolates showed that, the maximum identical conserved regions were identified with the nucleotide regions of 125 to 221st base pairs, 65 to 119th base pairs and 55, 48 and 31st base pairs. Secondary structure prediction of the 16s rRNA showed that, the maximum free energy was consumed with ACT03 isolate (-45.4 kkal/mol) and the minimum free energy was consumed with ACT04 isolate (-57.6 kkal/mol). The actinomycete isolates of ACT01 and ACT02 (GQ478246 and GQ478247) which are isolated from sediment sample can be further used as anticancer agents against breast cancer cell lines.

  14. Voice Register in Mon: Acoustics and Electroglottography

    PubMed Central

    Abramson, Arthur S.; Tiede, Mark K.; Luangthongkum, Theraphan

    2016-01-01

    Mon is spoken in villages in Thailand and Myanmar. The dialect of Ban Nakhonchum, Thailand has two voice registers, modal and breathy; these phonation types, along with other phonetic properties, distinguish minimal pairs. Four native speakers of this dialect recorded repetitions of 14 randomized words (seven minimal pairs) for acoustic analysis. We used a subset of these pairs in a listening test to verify the perceptual robustness of the register distinction. Acoustic analysis found significant differences in noise component, spectral slope, and fundamental frequency. In a subsequent session four speakers were also recorded using electroglottography (EGG), which showed systematic differences in the contact quotient (CQ). The salience of these properties in maintaining the register distinction is discussed in the context of possible tonogenesis for this language. PMID:26636544

  15. pKa shifting in double-stranded RNA is highly dependent upon nearest neighbors and bulge positioning.

    PubMed

    Wilcox, Jennifer L; Bevilacqua, Philip C

    2013-10-22

    Shifting of pKa's in RNA is important for many biological processes; however, the driving forces responsible for shifting are not well understood. Herein, we determine how structural environments surrounding protonated bases affect pKa shifting in double-stranded RNA (dsRNA). Using (31)P NMR, we determined the pKa of the adenine in an A(+)·C base pair in various sequence and structural environments. We found a significant dependence of pKa on the base pairing strength of nearest neighbors and the location of a nearby bulge. Increasing nearest neighbor base pairing strength shifted the pKa of the adenine in an A(+)·C base pair higher by an additional 1.6 pKa units, from 6.5 to 8.1, which is well above neutrality. The addition of a bulge two base pairs away from a protonated A(+)·C base pair shifted the pKa by only ~0.5 units less than a perfectly base paired hairpin; however, positioning the bulge just one base pair away from the A(+)·C base pair prohibited formation of the protonated base pair as well as several flanking base pairs. Comparison of data collected at 25 °C and 100 mM KCl to biological temperature and Mg(2+) concentration revealed only slight pKa changes, suggesting that similar sequence contexts in biological systems have the potential to be protonated at biological pH. We present a general model to aid in the determination of the roles protonated bases may play in various dsRNA-mediated processes including ADAR editing, miRNA processing, programmed ribosomal frameshifting, and general acid-base catalysis in ribozymes.

  16. Database of non-canonical base pairs found in known RNA structures

    NASA Technical Reports Server (NTRS)

    Nagaswamy, U.; Voss, N.; Zhang, Z.; Fox, G. E.

    2000-01-01

    Atomic resolution RNA structures are being published at an increasing rate. It is common to find a modest number of non-canonical base pairs in these structures in addition to the usual Watson-Crick pairs. This database summarizes the occurrence of these rare base pairs in accordance with standard nomenclature. The database, http://prion.bchs.uh.edu/, contains information such as sequence context, sugar pucker conformation, anti / syn base conformations, chemical shift, p K (a)values, melting temperature and free energy. Of the 29 anticipated pairs with two or more hydrogen bonds, 20 have been encountered to date. In addition, four unexpected pairs with two hydrogen bonds have been reported bringing the total to 24. Single hydrogen bond versions of five of the expected geometries have been encountered among the single hydrogen bond interactions. In addition, 18 different types of base triplets have been encountered, each of which involves three to six hydrogen bonds. The vast majority of the rare base pairs are antiparallel with the bases in the anti configuration relative to the ribose. The most common are the GU wobble, the Sheared GA pair, the Reverse Hoogsteen pair and the GA imino pair.

  17. Label-free DNA biosensor based on resistance change of platinum nanoparticles assemblies.

    PubMed

    Skotadis, Evangelos; Voutyras, Konstantinos; Chatzipetrou, Marianneza; Tsekenis, Georgios; Patsiouras, Lampros; Madianos, Leonidas; Chatzandroulis, Stavros; Zergioti, Ioanna; Tsoukalas, Dimitris

    2016-07-15

    A novel nanoparticle based biosensor for the fast and simple detection of DNA hybridization events is presented. The sensor utilizes hybridized DNA's charge transport properties, combining them with metallic nanoparticle networks that act as nano-gapped electrodes. The DNA hybridization events can be detected by a significant reduction in the sensor's resistance due to the conductive bridging offered by hybridized DNA. By modifying the nanoparticle surface coverage, which can be controlled experimentally being a function of deposition time, and the structural properties of the electrodes, an optimized biosensor for the in situ detection of DNA hybridization events is ultimately fabricated. The fabricated biosensor exhibits a wide response range, covering four orders of magnitude, a limit of detection of 1nM and can detect a single base pair mismatch between probe and complementary DNA. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs

    PubMed Central

    2017-01-01

    Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package. PMID:29107980

  19. Coincidence detection of spatially correlated photon pairs with a monolithic time-resolving detector array.

    PubMed

    Unternährer, Manuel; Bessire, Bänz; Gasparini, Leonardo; Stoppa, David; Stefanov, André

    2016-12-12

    We demonstrate coincidence measurements of spatially entangled photons by means of a multi-pixel based detection array. The sensor, originally developed for positron emission tomography applications, is a fully digital 8×16 silicon photomultiplier array allowing not only photon counting but also per-pixel time stamping of the arrived photons with an effective resolution of 265 ps. Together with a frame rate of 500 kfps, this property exceeds the capabilities of conventional charge-coupled device cameras which have become of growing interest for the detection of transversely correlated photon pairs. The sensor is used to measure a second-order correlation function for various non-collinear configurations of entangled photons generated by spontaneous parametric down-conversion. The experimental results are compared to theory.

  20. Coherent States for Kronecker Products of Non Compact Groups: Formulation and Applications

    NASA Technical Reports Server (NTRS)

    Bambah, Bindu A.; Agarwal, Girish S.

    1996-01-01

    We introduce and study the properties of a class of coherent states for the group SU(1,1) X SU(1,1) and derive explicit expressions for these using the Clebsch-Gordan algebra for the SU(1,1) group. We restrict ourselves to the discrete series representations of SU(1,1). These are the generalization of the 'Barut Girardello' coherent states to the Kronecker Product of two non-compact groups. The resolution of the identity and the analytic phase space representation of these states is presented. This phase space representation is based on the basis of products of 'pair coherent states' rather than the standard number state canonical basis. We discuss the utility of the resulting 'bi-pair coherent states' in the context of four-mode interactions in quantum optics.

  1. Sensitization of photoconductivity in ferrocene-containing oligomer by squarylium and merocyanine dyes

    NASA Astrophysics Data System (ADS)

    Davidenko, N. A.; Ishchenko, A. A.; Kozinets, A. V.; Kostenko, L. I.; Kurdyukova, I. V.; Mokrinskaya, E. V.; Studzinskii, S. L.; Chuprina, N. G.

    2011-03-01

    We have studied the photoconducting properties of films of ferrocene-containing oligomer with additives of squarylium and merocyanine dyes based on ferrocene and tetranitrofluorene in the dye absorption region. We have studied the characteristic features of the effect of an external magnetic field on the photocurrents. After the magnetic field is turned on, the photocurrent increases in the samples with squarylium dye and decreases in the samples with merocyanine dye. We discuss the hypothesis that in the first case, as a result of an internal photoelectric effect, predominantly triplet charge pairs are formed, while in the second case predominantly singlet charge pairs are formed. The latter may be one of the reasons for the higher photoconductivity of films with squarylium dye compared with merocyanine dye.

  2. Easy Words: Reference Resolution in a Malevolent Referent World.

    PubMed

    Gleitman, Lila R; Trueswell, John C

    2018-06-15

    This article describes early stages in the acquisition of a first vocabulary by infants and young children. It distinguishes two major stages, the first of which operates by a stand-alone word-to-world pairing procedure and the second of which, using the evidence so acquired, builds a domain-specific syntax-sensitive structure-to-world pairing procedure. As we show, the first stage of learning is slow, restricted in character, and to some extent errorful, whereas the second procedure is determinative, rapid, and essentially errorless. Our central claim here is that the early, referentially based learning procedure succeeds at all because it is reined in by attention-focusing properties of word-to-world timing and related indicants of referential intent. Copyright © 2018 Cognitive Science Society, Inc.

  3. Evaluation of antioxidant activity and electronic structure of aspirin and paracetamol

    NASA Astrophysics Data System (ADS)

    Motozaki, W.; Nagatani, Y.; Kimura, Y.; Endo, K.; Takemura, T.; Kurmaev, E. Z.; Moewes, A.

    2011-01-01

    We present a study of electronic structure, chemical bonding, and antioxidant activity of phenolic antioxidants (aspirin and paracetamol). X-ray photoelectron and emission spectra of the antioxidants have been simulated by deMon density functional theory (DFT) calculations of the molecules. The chemical bonding of aspirin is characterized by the formation of oxygen 'lone-pair' π-orbitals which can neutralize free radicals and thus be related to antioxidant properties of the drug. In the case of paracetamol the additional nitrogen 'lone pair' is formed which can explain toxicity of the drug. We propose an evaluation method of antioxidant activity based on the relationship between experimental half-wave oxidation potential ( Ep/2 ) and calculated ionization potentials ( IP) by the DFT calculations, and can conclude that paracetamol has the higher antioxidant activity than aspirin.

  4. Sensitivity of Asteroid Impact Risk to Uncertainty in Asteroid Properties and Entry Parameters

    NASA Astrophysics Data System (ADS)

    Wheeler, Lorien; Mathias, Donovan; Dotson, Jessie L.; NASA Asteroid Threat Assessment Project

    2017-10-01

    A central challenge in assessing the threat posed by asteroids striking Earth is the large amount of uncertainty inherent throughout all aspects of the problem. Many asteroid properties are not well characterized and can range widely from strong, dense, monolithic irons to loosely bound, highly porous rubble piles. Even for an object of known properties, the specific entry velocity, angle, and impact location can swing the potential consequence from no damage to causing millions of casualties. Due to the extreme rarity of large asteroid strikes, there are also large uncertainties in how different types of asteroids will interact with the atmosphere during entry, how readily they may break up or ablate, and how much surface damage will be caused by the resulting airbursts or impacts.In this work, we use our Probabilistic Asteroid Impact Risk (PAIR) model to investigate the sensitivity of asteroid impact damage to uncertainties in key asteroid properties, entry parameters, or modeling assumptions. The PAIR model combines physics-based analytic models of asteroid entry and damage in a probabilistic Monte Carlo framework to assess the risk posed by a wide range of potential impacts. The model samples from uncertainty distributions of asteroid properties and entry parameters to generate millions of specific impact cases, and models the atmospheric entry and damage for each case, including blast overpressure, thermal radiation, tsunami inundation, and global effects. To assess the risk sensitivity, we alternately fix and vary the different input parameters and compare the effect on the resulting range of damage produced. The goal of these studies is to help guide future efforts in asteroid characterization and model refinement by determining which properties most significantly affect the potential risk.

  5. Rabbit-Ears Hybrids, VSEPR Sterics, and Other Orbital Anachronisms

    ERIC Educational Resources Information Center

    Clauss, Allen D.; Nelsen, Stephen F.; Ayoub, Mohamed; Moore, John W.; Landis, Clark R.; Weinhold, Frank

    2014-01-01

    We describe the logical flaws, experimental contradictions, and unfortunate educational repercussions of common student misconceptions regarding the shapes and properties of lone pairs, inspired by overemphasis on ''valence shell electron pair repulsion'' (VSEPR) rationalizations in current freshmanlevel chemistry textbooks. VSEPR-style…

  6. Insights into the mechanisms of RNA secondary structure destabilization by the HIV-1 nucleocapsid protein.

    PubMed

    Belfetmi, Anissa; Zargarian, Loussiné; Tisné, Carine; Sleiman, Dona; Morellet, Nelly; Lescop, Ewen; Maskri, Ouerdia; René, Brigitte; Mély, Yves; Fossé, Philippe; Mauffret, Olivier

    2016-04-01

    The mature HIV-1 nucleocapsid protein NCp7 (NC) plays a key role in reverse transcription facilitating the two obligatory strand transfers. Several properties contribute to its efficient chaperon activity: preferential binding to single-stranded regions, nucleic acid aggregation, helix destabilization, and rapid dissociation from nucleic acids. However, little is known about the relationships between these different properties, which are complicated by the ability of the protein to recognize particular HIV-1 stem-loops, such as SL1, SL2, and SL3, with high affinity and without destabilizing them. These latter properties are important in the context of genome packaging, during which NC is part of the Gag precursor. We used NMR to investigate destabilization of the full-length TAR (trans activating response element) RNA by NC, which is involved in the first strand transfer step of reverse transcription. NC was used at a low protein:nucleotide (nt) ratio of 1:59 in these experiments. NMR data for the imino protons of TAR identified most of the base pairs destabilized by NC. These base pairs were adjacent to the loops in the upper part of the TAR hairpin rather than randomly distributed. Gel retardation assays showed that conversion from the initial TAR-cTAR complex to the fully annealed form occurred much more slowly at the 1:59 ratio than at the higher ratios classically used. Nevertheless, NC significantly accelerated the formation of the initial complex at a ratio of 1:59. © 2016 Belfetmi et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  7. DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

    PubMed

    Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

    2012-10-11

    Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

  8. Unique active site promotes error-free replication opposite an 8-oxo-guanine lesion by human DNA polymerase iota

    PubMed Central

    Kirouac, Kevin N.; Ling, Hong

    2011-01-01

    The 8-oxo-guanine (8-oxo-G) lesion is the most abundant and mutagenic oxidative DNA damage existing in the genome. Due to its dual coding nature, 8-oxo-G causes most DNA polymerases to misincorporate adenine. Human Y-family DNA polymerase iota (polι) preferentially incorporates the correct cytosine nucleotide opposite 8-oxo-G. This unique specificity may contribute to polι’s biological role in cellular protection against oxidative stress. However, the structural basis of this preferential cytosine incorporation is currently unknown. Here we present four crystal structures of polι in complex with DNA containing an 8-oxo-G lesion, paired with correct dCTP or incorrect dATP, dGTP, and dTTP nucleotides. An exceptionally narrow polι active site restricts the purine bases in a syn conformation, which prevents the dual coding properties of 8-oxo-G by inhibiting syn/anti conformational equilibrium. More importantly, the 8-oxo-G base in a syn conformation is not mutagenic in polι because its Hoogsteen edge does not form a stable base pair with dATP in the narrow active site. Instead, the syn 8-oxo-G template base forms the most stable replicating base pair with correct dCTP due to its small pyrimidine base size and enhanced hydrogen bonding with the Hoogsteen edge of 8-oxo-G. In combination with site directed mutagenesis, we show that Gln59 in the finger domain specifically interacts with the additional O8 atom of the lesion base, which influences nucleotide selection, enzymatic efficiency, and replication stalling at the lesion site. Our work provides the structural mechanism of high-fidelity 8-oxo-G replication by a human DNA polymerase. PMID:21300901

  9. Structure, Stiffness and Substates of the Dickerson-Drew Dodecamer

    PubMed Central

    Dršata, Tomáš; Pérez, Alberto; Orozco, Modesto; Morozov, Alexandre V.; Šponer, Jiřĺ; Lankaš, Filip

    2013-01-01

    The Dickerson–Drew dodecamer (DD) d-[CGCGAATTCGCG]2 is a prototypic B-DNA molecule whose sequence-specific structure and dynamics have been investigated by many experimental and computational studies. Here, we present an analysis of DD properties based on extensive atomistic molecular dynamics (MD) simulations using different ionic conditions and water models. The 0.6–2.4-µs-long MD trajectories are compared to modern crystallographic and NMR data. In the simulations, the duplex ends can adopt an alternative base-pairing, which influences the oligomer structure. A clear relationship between the BI/BII backbone substates and the basepair step conformation has been identified, extending previous findings and exposing an interesting structural polymorphism in the helix. For a given end pairing, distributions of the basepair step coordinates can be decomposed into Gaussian-like components associated with the BI/BII backbone states. The nonlocal stiffness matrices for a rigid-base mechanical model of DD are reported for the first time, suggesting salient stiffness features of the central A-tract. The Riemann distance and Kullback–Leibler divergence are used for stiffness matrix comparison. The basic structural parameters converge very well within 300 ns, convergence of the BI/BII populations and stiffness matrices is less sharp. Our work presents new findings about the DD structural dynamics, mechanical properties, and the coupling between basepair and backbone configurations, including their statistical reliability. The results may also be useful for optimizing future force fields for DNA. PMID:23976886

  10. Molecular dynamics simulation of polymer electrolytes based on poly(ethylene oxide) and ionic liquids. II. Dynamical properties.

    PubMed

    Costa, Luciano T; Ribeiro, Mauro C C

    2007-10-28

    Dynamical properties of polymer electrolytes based on poly(ethylene oxide) (PEO) and ionic liquids of 1-alkyl-3-methylimidazolium cations were calculated by molecular dynamics simulations with previously proposed models [L. T. Costa and M. C. Ribeiro, J. Chem. Phys. 124, 184902 (2006)]. The effect of changing the ionic liquid concentration, temperature, and the 1-alkyl-chain lengths, [1,3-dimethylimidazolium]PF(6) and [1-butyl-3-methylimidazolium]PF(6) ([dmim]PF(6) and [bmim]PF(6)), was investigated. Cation diffusion coefficient is higher than those of anion and oxygen atoms of PEO chains. Ionic mobility in PEO[bmim]PF(6) is higher than in PEO[dmim]PF(6), so that the ionic conductivity kappa of the former is approximately ten times larger than the latter. The ratio between kappa and its estimate from the Nernst-Einstein equation kappa/kappa(NE), which is inversely proportional to the strength of ion pairs, is higher in ionic liquid polymer electrolytes than in polymer electrolytes based on inorganic salts with Li(+) cations. Calculated time correlation functions corroborate previous evidence from the analysis of equilibrium structure that the ion pairs in ionic liquid polymer electrolytes are relatively weak. Structural relaxation at distinct spatial scales is revealed by the calculation of the intermediate scattering function at different wavevectors. These data are reproduced with stretched exponential functions, so that temperature and wavevector dependences of best fit parameters can be compared with corresponding results for polymer electrolytes containing simpler ions.

  11. Quantifying cancer cell receptors with paired-agent fluorescent imaging: a novel method to account for tissue optical property effects

    NASA Astrophysics Data System (ADS)

    Sadeghipour, Negar; Davis, Scott C.; Tichauer, Kenneth M.

    2018-02-01

    Dynamic fluorescence imaging approaches can be used to estimate the concentration of cell surface receptors in vivo. Kinetic models are used to generate the final estimation by taking the targeted imaging agent concentration as a function of time. However, tissue absorption and scattering properties cause the final readout signal to be on a different scale than the real fluorescent agent concentration. In paired-agent imaging approaches, simultaneous injection of a suitable control imaging agent with a targeted one can account for non-specific uptake and retention of the targeted agent. Additionally, the signal from the control agent can be a normalizing factor to correct for tissue optical property differences. In this study, the kinetic model used for paired-agent imaging analysis (i.e., simplified reference tissue model) is modified and tested in simulation and experimental data in a way that accounts for the scaling correction within the kinetic model fit to the data to ultimately extract an estimate of the targeted biomarker concentration.

  12. Pairing Instability and Quasiparticle Properties of an Unconventional Superconductor with a Skyrmion Texture of Localized Spins

    NASA Astrophysics Data System (ADS)

    Zhu, Jian-Xin; Tai, Yuan-Yen

    Majorana fermions are believed to perform better than regular fermions in keeping quantum coherence, which is an important factor for quantum computation. Recently there has been intensive interest in their realization in solid-state systems. Zero-energy quasiparticle modes in a superconductor serve as a promising candidate. We present a theoretical study on the influence of a two-dimensional (2D) skyrmion texture of localized spins on the pairing instability and quasiparticle properties in an unconventional superconductor. By solving the Bogoliubov-de Gennes equations for an effective BCS model Hamiltonian with nearest-neighbor pairing interaction on a 2D square lattice, we analyze the spatial dependence of superconducting order parameter for varying strength of spin-exchange interaction. The quasiparticle properties are studied by calculating local density of states and its spatial dependence. This work was supported by U.S. DOE NNSA through the LANL LDRD Program, and by Center for Integrated Nanotechnologies, a U.S. DOE BES user facility.

  13. Ion Pairing and Diffusion in Magnesium Electrolytes Based on Magnesium Borohydride.

    PubMed

    Samuel, Devon; Steinhauser, Carl; Smith, Jeffrey G; Kaufman, Aaron; Radin, Maxwell D; Naruse, Junichi; Hiramatsu, Hidehiko; Siegel, Donald J

    2017-12-20

    One obstacle to realizing a practical, rechargeable magnesium-ion battery is the development of efficient Mg electrolytes. Electrolytes based on simple Mg(BH 4 ) 2 salts suffer from poor salt solubility and/or low conductivity, presumably due to strong ion pairing. Understanding the molecular-scale processes occurring in these electrolytes would aid in overcoming these performance limitations. Toward this goal, the present study examines the solvation, agglomeration, and transport properties of a family of Mg electrolytes based on the Mg(BH 4 ) 2 salt using classical molecular dynamics. These properties were examined across five different solvents (tetrahydrofuran and the glymes G1-G4) and at four salt concentrations ranging from the dilute limit up to 0.4 M. Significant and irreversible salt agglomeration was observed in all solvents at all nondilute Mg(BH 4 ) 2 concentrations. The degree of clustering observed in these divalent Mg systems is much larger than that reported for electrolytes containing monovalent cations, such as Li. The salt agglomeration rate and diffusivity of Mg 2+ were both observed to correlate with solvent self-diffusivity: electrolytes using longer- (shorter-) chain solvents had the lowest (highest) Mg 2+ diffusivity and agglomeration rates. Incorporation of Mg 2+ into Mg 2+ -BH 4 - clusters significantly reduces the diffusivity of Mg 2+ by restricting displacements to localized motion within largely immobile agglomerates. Consequently, diffusion is increasingly impeded with increasing Mg(BH 4 ) 2 concentration. These data are consistent with the solubility limitations observed experimentally for Mg(BH 4 ) 2 -based electrolytes and highlight the need for strategies that minimize salt agglomeration in electrolytes containing divalent cations.

  14. Lewis acid properties of alumina based catalysts: study by paramagnetic complexes of probe molecules

    NASA Astrophysics Data System (ADS)

    Fionov, Alexander V.

    2002-06-01

    Lewis acid properties of LiAl 5O 8/Al 2O 3 (2 wt.% Li) and MgAl 2O 4/Al 2O 3 (3 wt.% Mg) catalysts were studied by EPR of adsorbed probe molecules--anthraquinone and 2,2,6,6-tetramethylpiperidine- N-oxyl (TEMPO). The lesser (in comparison with γ-Al 2O 3) concentration and the strength of Lewis acid sites (LAS) formed on the surface of aluminate layer has been shown. The stability of this layer plays important role in the change of Lewis acid properties during the calcination of modified alumina. The lithium aluminate layer was stable at used calcination temperature, 773 K, meanwhile magnesium aluminate layer observed only at calcination temperature below 723 K. The increase of the calcination temperature to 773 K caused the segregation of MgAl 2O 4 on the surface resulted in the release of alumina surface and recovery of the Lewis acid properties. The differences in the LAS manifestations towards TEMPO and anthraquinone was discussed. The mechanism of the formation of anthraquinone paramagnetic complexes with LAS--three-coordinated aluminum ions--was proposed. This mechanism includes the formation of anthrasemiquinone, and then--anthrasemiquinone ion pair or triple ion. Fragments like -O-Al +-O- play the role of cations in these ion pairs and triple ions. Proposed mechanism can also be applied for the consideration of similar anthraquinone paramagnetic complexes on the surface of gallium oxide containing systems.

  15. A simple quasi-diabatization scheme suitable for spectroscopic problems based on one-electron properties of interacting states

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cave, Robert J., E-mail: Robert-Cave@hmc.edu; Stanton, John F., E-mail: JFStanton@gmail.com

    We present a simple quasi-diabatization scheme applicable to spectroscopic studies that can be applied using any wavefunction for which one-electron properties and transition properties can be calculated. The method is based on rotation of a pair (or set) of adiabatic states to minimize the difference between the given transition property at a reference geometry of high symmetry (where the quasi-diabatic states and adiabatic states coincide) and points of lower symmetry where quasi-diabatic quantities are desired. Compared to other quasi-diabatization techniques, the method requires no special coding, facilitates direct comparison between quasi-diabatic quantities calculated using different types of wavefunctions, and ismore » free of any selection of configurations in the definition of the quasi-diabatic states. On the other hand, the method appears to be sensitive to multi-state issues, unlike recent methods we have developed that use a configurational definition of quasi-diabatic states. Results are presented and compared with two other recently developed quasi-diabatization techniques.« less

  16. The effect of various quantum mechanically derived partial atomic charges on the bulk properties of chloride-based ionic liquids

    NASA Astrophysics Data System (ADS)

    Zolghadr, Amin Reza; Ghatee, Mohammad Hadi; Moosavi, Fatemeh

    2016-08-01

    Partial atomic charges using various quantum mechanical calculations for [Cnmim]Cl (n = 1, 4) ionic liquids (ILs) are obtained and used for development of molecular dynamics simulation (MD) force fields. The isolated ion pairs are optimized using HF, B3LYP, and MP2 methods for electronic structure with 6-311++G(d,p) basis set. Partial atomic charges are assigned to the atomic center with CHELPG and NBO methods. The effect of these sets of partial charges on the static and dynamic properties of ILs is evaluated by performing a series of MD simulations and comparing the essential thermodynamic properties with the available experimental data and available molecular dynamics simulation results. In contrast to the general trends reported for ionic liquids with BF4, PF6, and iodide anions (in which restrained electrostatic potential (RESP) charges are preferred), partial charges derived by B3LYP-NBO method are relatively good in prediction of the structural, dynamical, and thermodynamic energetic properties of the chloride based ILs.

  17. Mining protein database using machine learning techniques.

    PubMed

    Camargo, Renata da Silva; Niranjan, Mahesan

    2008-08-25

    With a large amount of information relating to proteins accumulating in databases widely available online, it is of interest to apply machine learning techniques that, by extracting underlying statistical regularities in the data, make predictions about the functional and evolutionary characteristics of unseen proteins. Such predictions can help in achieving a reduction in the space over which experiment designers need to search in order to improve our understanding of the biochemical properties. Previously it has been suggested that an integration of features computable by comparing a pair of proteins can be achieved by an artificial neural network, hence predicting the degree to which they may be evolutionary related and homologous.
    We compiled two datasets of pairs of proteins, each pair being characterised by seven distinct features. We performed an exhaustive search through all possible combinations of features, for the problem of separating remote homologous from analogous pairs, we note that significant performance gain was obtained by the inclusion of sequence and structure information. We find that the use of a linear classifier was enough to discriminate a protein pair at the family level. However, at the superfamily level, to detect remote homologous pairs was a relatively harder problem. We find that the use of nonlinear classifiers achieve significantly higher accuracies.
    In this paper, we compare three different pattern classification methods on two problems formulated as detecting evolutionary and functional relationships between pairs of proteins, and from extensive cross validation and feature selection based studies quantify the average limits and uncertainties with which such predictions may be made. Feature selection points to a \\"knowledge gap\\" in currently available functional annotations. We demonstrate how the scheme may be employed in a framework to associate an individual protein with an existing family of evolutionarily related proteins.

  18. Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)

    NASA Astrophysics Data System (ADS)

    Risqi, A. M.; Yudiarsah, E.

    2017-07-01

    Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.

  19. Toolbox for the design of LiNbO3-based passive and active integrated quantum circuits

    NASA Astrophysics Data System (ADS)

    Sharapova, P. R.; Luo, K. H.; Herrmann, H.; Reichelt, M.; Meier, T.; Silberhorn, C.

    2017-12-01

    We present and discuss perspectives of current developments on advanced quantum optical circuits monolithically integrated in the lithium niobate platform. A set of basic components comprising photon pair sources based on parametric down conversion (PDC), passive routing elements and active electro-optically controllable switches and polarisation converters are building blocks of a toolbox which is the basis for a broad range of diverse quantum circuits. We review the state-of-the-art of these components and provide models that properly describe their performance in quantum circuits. As an example for applications of these models we discuss design issues for a circuit providing on-chip two-photon interference. The circuit comprises a PDC section for photon pair generation followed by an actively controllable modified mach-Zehnder structure for observing Hong-Ou-Mandel interference. The performance of such a chip is simulated theoretically by taking even imperfections of the properties of the individual components into account.

  20. Trans-activation of the Tetrahymena group I intron ribozyme via a non-native RNA-RNA interaction.

    PubMed Central

    Ikawa, Y; Shiraishi, H; Inoue, T

    1999-01-01

    The peripheral P2.1 domain of the Tetrahymena group I intron ribozyme has been shown to be non-essential for splicing. We found, however, that separately prepared P2.1 RNA efficiently accelerates the 3' splice-site-specific hydrolysis reaction of a mutant ribozyme lacking both P2.1 and its upstream region in trans. We report here the unusual properties of this trans-activation. Compensatory mutational analysis revealed that non-native long-range base-pairings between the loop region of P2.1 RNA and L5c region of the mutant ribozyme are needed for the activation in spite of the fact that P2.1 forms base-pairings with P9.1 in the Tetrahymena ribozyme. The trans -activation depends on the non-native RNA-RNA interaction together with the higher order structure of P2.1 RNA. This activation is unique among the known trans-activations that utilize native tertiary interactions or RNA chaperons. PMID:10075996

  1. Harnessing the landscape of microbial culture media to predict new organism–media pairings

    PubMed Central

    Oberhardt, Matthew A.; Zarecki, Raphy; Gronow, Sabine; Lang, Elke; Klenk, Hans-Peter; Gophna, Uri; Ruppin, Eytan

    2015-01-01

    Culturing microorganisms is a critical step in understanding and utilizing microbial life. Here we map the landscape of existing culture media by extracting natural-language media recipes into a Known Media Database (KOMODO), which includes >18,000 strain–media combinations, >3300 media variants and compound concentrations (the entire collection of the Leibniz Institute DSMZ repository). Using KOMODO, we show that although media are usually tuned for individual strains using biologically common salts, trace metals and vitamins/cofactors are the most differentiating components between defined media of strains within a genus. We leverage KOMODO to predict new organism–media pairings using a transitivity property (74% growth in new in vitro experiments) and a phylogeny-based collaborative filtering tool (83% growth in new in vitro experiments and stronger growth on predicted well-scored versus poorly scored media). These resources are integrated into a web-based platform that predicts media given an organism's 16S rDNA sequence, facilitating future cultivation efforts. PMID:26460590

  2. SPY: A new scission point model based on microscopic ingredients to predict fission fragments properties

    NASA Astrophysics Data System (ADS)

    Lemaître, J.-F.; Dubray, N.; Hilaire, S.; Panebianco, S.; Sida, J.-L.

    2013-12-01

    Our purpose is to determine fission fragments characteristics in a framework of a scission point model named SPY for Scission Point Yields. This approach can be considered as a theoretical laboratory to study fission mechanism since it gives access to the correlation between the fragments properties and their nuclear structure, such as shell correction, pairing, collective degrees of freedom, odd-even effects. Which ones are dominant in final state? What is the impact of compound nucleus structure? The SPY model consists in a statistical description of the fission process at the scission point where fragments are completely formed and well separated with fixed properties. The most important property of the model relies on the nuclear structure of the fragments which is derived from full quantum microscopic calculations. This approach allows computing the fission final state of extremely exotic nuclei which are inaccessible by most of the fission model available on the market.

  3. Flexible ultraviolet photodetectors based on ZnO-SnO2 heterojunction nanowire arrays

    NASA Astrophysics Data System (ADS)

    Lou, Zheng; Yang, Xiaoli; Chen, Haoran; Liang, Zhongzhu

    2018-02-01

    A ZnO-SnO2 nanowires (NWs) array, as a metal oxide semiconductor, was successfully synthesized by a near-field electrospinning method for the applications as high performance ultraviolet photodetectors. Ultraviolet photodetectors based on a single nanowire exhibited excellent photoresponse properties to 300 nm ultraviolet light illumination including ultrahigh I on/I off ratios (up to 103), good stability and reproducibility because of the separation between photo-generated electron-hole pairs. Moreover, the NWs array shows an enhanced photosensing performance. Flexible photodetectors on the PI substrates with similar tendency properties were also fabricated. In addition, under various bending curvatures and cycles, the as-fabricated flexible photodetectors revealed mechanical flexibility and good stable electrical properties, showing that they have the potential for applications in future flexible photoelectron devices. Project supported by the National Science Foundation of China (No. 61504136) and the State Key Laboratory of Applied Optics, Changchun Institute of Optics, Fine and Physics, Chinese Academy of Sciences.

  4. HI properties and star formation history of a fly-by pair of blue compact dwarf galaxies

    NASA Astrophysics Data System (ADS)

    Kim, Jinhyub; Chung, Aeree; Wong, O. Ivy; Lee, Bumhyun; Sung, Eon-Chang; Staveley-Smith, Lister

    2017-09-01

    A fly-by interaction has been suggested to be one of the major explanations for enhanced star formation in blue compact dwarf (BCD) galaxies, yet no direct evidence for this scenario has been found to date. In the Hi Parkes all-sky survey (HIPASS), ESO 435-IG 020 and ESO 435-G 016, a BCD pair were found in a common, extended gas envelope of atomic hydrogen, providing an ideal case to test the hypothesis that the starburst in BCDs can be indeed triggered by a fly-by interaction. Using high-resolution data from the Australia Telescope Compact Array (ATCA), we investigated Hi properties and the spectral energy distribution (SED) of the BCD pair to study their interaction and star formation histories. The high-resolution Hi data of both BCDs reveal a number of peculiarities, which are suggestive of tidal perturbation. Meanwhile, 40% of the HIPASS flux is not accounted for in the ATCA observations with no Hi gas bridge found between the two BCDs. Intriguingly, in the residual of the HIPASS and the ATCA data, 10% of the missing flux appears to be located between the two BCDs. While the SED-based age of the most dominant young stellar population is old enough to have originated from the interaction with any neighbors (including the other of the two BCDs), the most recent star formation activity traced by strong Hα emission in ESO 435-IG 020 and the shear motion of gas in ESO 435-G 016, suggest a more recent or current tidal interaction. Based on these and the residual emission between the HIPASS and the ATCA data, we propose an interaction between the two BCDs as the origin of their recently enhanced star formation activity. The shear motion on the gas disk, potentially with re-accretion of the stripped gas, could be responsible for the active star formation in this BCD pair. The reduced datacube (FITS file) is only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (http://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/605/A54

  5. A big data geospatial analytics platform - Physical Analytics Integrated Repository and Services (PAIRS)

    NASA Astrophysics Data System (ADS)

    Hamann, H.; Jimenez Marianno, F.; Klein, L.; Albrecht, C.; Freitag, M.; Hinds, N.; Lu, S.

    2015-12-01

    A big data geospatial analytics platform:Physical Analytics Information Repository and Services (PAIRS)Fernando Marianno, Levente Klein, Siyuan Lu, Conrad Albrecht, Marcus Freitag, Nigel Hinds, Hendrik HamannIBM TJ Watson Research Center, Yorktown Heights, NY 10598A major challenge in leveraging big geospatial data sets is the ability to quickly integrate multiple data sources into physical and statistical models and be run these models in real time. A geospatial data platform called Physical Analytics Information and Services (PAIRS) is developed on top of open source hardware and software stack to manage Terabyte of data. A new data interpolation and re gridding is implemented where any geospatial data layers can be associated with a set of global grid where the grid resolutions is doubling for consecutive layers. Each pixel on the PAIRS grid have an index that is a combination of locations and time stamp. The indexing allow quick access to data sets that are part of a global data layers and allowing to retrieve only the data of interest. PAIRS takes advantages of parallel processing framework (Hadoop) in a cloud environment to digest, curate, and analyze the data sets while being very robust and stable. The data is stored on a distributed no-SQL database (Hbase) across multiple server, data upload and retrieval is parallelized where the original analytics task is broken up is smaller areas/volume, analyzed independently, and then reassembled for the original geographical area. The differentiating aspect of PAIRS is the ability to accelerate model development across large geographical regions and spatial resolution ranging from 0.1 m up to hundreds of kilometer. System performance is benchmarked on real time automated data ingestion and retrieval of Modis and Landsat data layers. The data layers are curated for sensor error, verified for correctness, and analyzed statistically to detect local anomalies. Multi-layer query enable PAIRS to filter different data layers based on specific conditions (e.g analyze flooding risk of a property based on topography, soil ability to hold water, and forecasted precipitation) or retrieve information about locations that share similar weather and vegetation patterns during extreme weather events like heat wave.

  6. Rotational-translational fourier imaging system

    NASA Technical Reports Server (NTRS)

    Campbell, Jonathan W. (Inventor)

    2004-01-01

    This invention has the ability to create Fourier-based images with only two grid pairs. The two grid pairs are manipulated in a manner that allows (1) a first grid pair to provide multiple real components of the Fourier-based image and (2) a second grid pair to provide multiple imaginary components of the Fourier-based image. The novelty of this invention resides in the use of only two grid pairs to provide the same imaging information that has been traditionally collected with multiple grid pairs.

  7. Electromagnetic properties of impure superconductors with pair-breaking processes

    NASA Astrophysics Data System (ADS)

    Herman, František; Hlubina, Richard

    2017-07-01

    Recently, a generic model was proposed for the single-particle properties of gapless superconductors with simultaneously present pair-conserving and pair-breaking impurity scatterings (the so-called Dynes superconductors). Here we calculate the optical conductivity of the Dynes superconductors. Our approach is applicable for all disorder strengths from the clean limit up to the dirty limit and for all relative ratios of the two types of scattering; nevertheless, the complexity of our description is equivalent to that of the widely used Mattis-Bardeen theory. We identify two optical fingerprints of the Dynes superconductors: (i) the presence of two absorption edges and (ii) finite absorption at vanishing frequencies even at the lowest temperatures. We demonstrate that the recent anomalous optical data on thin MoN films can be reasonably fitted by our theory.

  8. Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

    PubMed

    Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-03-14

    We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

  9. CO-ORBITING PLANES OF SUB-HALOS ARE SIMILARLY UNLIKELY AROUND PAIRED AND ISOLATED HOSTS

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pawlowski, Marcel S.; McGaugh, Stacy S., E-mail: marcel.pawlowski@case.edu

    2014-07-01

    Sub-halos in dark-matter-based cosmological simulations tend to be distributed approximately isotropically around their host. The existence of highly flattened, co-orbiting planes of satellite galaxies has therefore been identified as a possible problem for these cosmological models, but so far studies have not considered the hosts' environments. That satellite planes are now known around both major galaxies in the Local Group raises the question whether they are more likely to be found around paired hosts. In a first attempt to investigate this possibility, we focus on the flattening and orbital coherence of the 11 brightest satellite galaxies of the vast polarmore » structure (VPOS) around the Milky Way (MW). We search for VPOS analogs in the ''Exploring the Local Volume in Simulations'' suite of cosmological simulations, which consist of 24 paired and 24 isolated host halos. We do not find significant differences between the properties of sub-halo distributions around paired and isolated hosts. The observed flattening and the observed orbital alignment are each reproduced by only 0.2%-2% of paired and isolated systems incorporating the obscuration of satellites by randomly oriented galactic disks. Only 1 of all 4800 analyzed realizations (0.02%) reproduces both parameters simultaneously, but the average orbital pole of this sub-halo system does not align as well with the normal to the plane fit as observed. That the MW is part of a galaxy pair thus does not help to explain the existence of the VPOS if the satellite galaxies are identified with sub-halos found in dissipationless simulations.« less

  10. Novel schemes for measurement-based quantum computation.

    PubMed

    Gross, D; Eisert, J

    2007-06-01

    We establish a framework which allows one to construct novel schemes for measurement-based quantum computation. The technique develops tools from many-body physics-based on finitely correlated or projected entangled pair states-to go beyond the cluster-state based one-way computer. We identify resource states radically different from the cluster state, in that they exhibit nonvanishing correlations, can be prepared using nonmaximally entangling gates, or have very different local entanglement properties. In the computational models, randomness is compensated in a different manner. It is shown that there exist resource states which are locally arbitrarily close to a pure state. We comment on the possibility of tailoring computational models to specific physical systems.

  11. Efficient Implementation of the Pairing on Mobilephones Using BREW

    NASA Astrophysics Data System (ADS)

    Yoshitomi, Motoi; Takagi, Tsuyoshi; Kiyomoto, Shinsaku; Tanaka, Toshiaki

    Pairing based cryptosystems can accomplish novel security applications such as ID-based cryptosystems, which have not been constructed efficiently without the pairing. The processing speed of the pairing based cryptosystems is relatively slow compared with the other conventional public key cryptosystems. However, several efficient algorithms for computing the pairing have been proposed, namely Duursma-Lee algorithm and its variant ηT pairing. In this paper, we present an efficient implementation of the pairing over some mobilephones. Moreover, we compare the processing speed of the pairing with that of the other standard public key cryptosystems, i. e. RSA cryptosystem and elliptic curve cryptosystem. Indeed the processing speed of our implementation in ARM9 processors on BREW achieves under 100 milliseconds using the supersingular curve over F397. In addition, the pairing is more efficient than the other public key cryptosystems, and the pairing can be achieved enough also on BREW mobilephones. It has become efficient enough to implement security applications, such as short signature, ID-based cryptosystems or broadcast encryption, using the pairing on BREW mobilephones.

  12. Decomposition of Proteins into Dynamic Units from Atomic Cross-Correlation Functions.

    PubMed

    Calligari, Paolo; Gerolin, Marco; Abergel, Daniel; Polimeno, Antonino

    2017-01-10

    In this article, we present a clustering method of atoms in proteins based on the analysis of the correlation times of interatomic distance correlation functions computed from MD simulations. The goal is to provide a coarse-grained description of the protein in terms of fewer elements that can be treated as dynamically independent subunits. Importantly, this domain decomposition method does not take into account structural properties of the protein. Instead, the clustering of protein residues in terms of networks of dynamically correlated domains is defined on the basis of the effective correlation times of the pair distance correlation functions. For these properties, our method stands as a complementary analysis to the customary protein decomposition in terms of quasi-rigid, structure-based domains. Results obtained for a prototypal protein structure illustrate the approach proposed.

  13. Spectroscopic scanning tunneling microscopy insights into Fe-based superconductors

    NASA Astrophysics Data System (ADS)

    Hoffman, Jennifer E.

    2011-12-01

    In the first three years since the discovery of Fe-based high Tc superconductors, scanning tunneling microscopy (STM) and spectroscopy have shed light on three important questions. First, STM has demonstrated the complexity of the pairing symmetry in Fe-based materials. Phase-sensitive quasiparticle interference (QPI) imaging and low temperature spectroscopy have shown that the pairing order parameter varies from nodal to nodeless s± within a single family, FeTe1-xSex. Second, STM has imaged C4 → C2 symmetry breaking in the electronic states of both parent and superconducting materials. As a local probe, STM is in a strong position to understand the interactions between these broken symmetry states and superconductivity. Finally, STM has been used to image the vortex state, giving insights into the technical problem of vortex pinning, and the fundamental problem of the competing states introduced when superconductivity is locally quenched by a magnetic field. Here we give a pedagogical introduction to STM and QPI imaging, discuss the specific challenges associated with extracting bulk properties from the study of surfaces, and report on progress made in understanding Fe-based superconductors using STM techniques.

  14. Two-dimensional IR spectroscopy of the anti-HIV agent KP1212 reveals protonated and neutral tautomers that influence pH-dependent mutagenicity.

    PubMed

    Peng, Chunte Sam; Fedeles, Bogdan I; Singh, Vipender; Li, Deyu; Amariuta, Tiffany; Essigmann, John M; Tokmakoff, Andrei

    2015-03-17

    Antiviral drugs designed to accelerate viral mutation rates can drive a viral population to extinction in a process called lethal mutagenesis. One such molecule is 5,6-dihydro-5-aza-2'-deoxycytidine (KP1212), a selective mutagen that induces A-to-G and G-to-A mutations in the genome of replicating HIV. The mutagenic property of KP1212 was hypothesized to originate from its amino-imino tautomerism, which would explain its ability to base pair with either G or A. To test the multiple tautomer hypothesis, we used 2D IR spectroscopy, which offers subpicosecond time resolution and structural sensitivity to distinguish among rapidly interconverting tautomers. We identified several KP1212 tautomers and found that >60% of neutral KP1212 is present in the enol-imino form. The abundant proportion of this traditionally rare tautomer offers a compelling structure-based mechanism for pairing with adenine. Additionally, the pKa of KP1212 was measured to be 7.0, meaning a substantial population of KP1212 is protonated at physiological pH. Furthermore, the mutagenicity of KP1212 was found to increase dramatically at pH <7, suggesting a significant biological role for the protonated KP1212 molecules. Overall, our data reveal that the bimodal mutagenic properties of KP1212 result from its unique shape shifting ability that utilizes both tautomerization and protonation.

  15. Gender in Facial Representations: A Contrast-Based Study of Adaptation within and between the Sexes

    PubMed Central

    Oruç, Ipek; Guo, Xiaoyue M.; Barton, Jason J. S.

    2011-01-01

    Face aftereffects are proving to be an effective means of examining the properties of face-specific processes in the human visual system. We examined the role of gender in the neural representation of faces using a contrast-based adaptation method. If faces of different genders share the same representational face space, then adaptation to a face of one gender should affect both same- and different-gender faces. Further, if these aftereffects differ in magnitude, this may indicate distinct gender-related factors in the organization of this face space. To control for a potential confound between physical similarity and gender, we used a Bayesian ideal observer and human discrimination data to construct a stimulus set in which pairs of different-gender faces were equally dissimilar as same-gender pairs. We found that the recognition of both same-gender and different-gender faces was suppressed following a brief exposure of 100ms. Moreover, recognition was more suppressed for test faces of a different-gender than those of the same-gender as the adaptor, despite the equivalence in physical and psychophysical similarity. Our results suggest that male and female faces likely occupy the same face space, allowing transfer of aftereffects between the genders, but that there are special properties that emerge along gender-defining dimensions of this space. PMID:21267414

  16. Syntheses, crystal structures, and properties of four complexes based on polycarboxylate and imidazole ligands

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Qiao, Rui; Chen, Shui-Sheng, E-mail: chenss@fync.edu.cn; Coordination Chemistry Institute, State Key Laboratory of Coordination Chemistry, Nanjing University, Nanjing 210093

    2015-08-15

    Four metal–organic coordination polymers [Zn(HL)(H{sub 2}O)]·4H{sub 2}O (1), [Zn(HL)(L{sub 1})]·4H{sub 2}O (2), [Cu(HL)(H{sub 2}O)]·3H{sub 2}O (3) and [Cu(HL)(L{sub 1})]·5H{sub 2}O (4) were synthesized by reactions of the corresponding metal(II) salts with semirigid polycarboxylate ligand (5-((4-carboxypiperidin-1-yl)methyl)isophthalic acid hydrochloride, H{sub 3}L·HCl) or auxiliary ligand (1,4-di(1H-imidazol-4-yl)benzene, L{sub 1}). The structures of the compounds were characterized by elemental analysis, FT-IR spectroscopy and single-crystal X-ray diffraction. The use of auxiliary ligand L{sub 1} has great influence on the structures of two pairs of complexes 1, 2 and 3, 4. Complex 1 is a uninodal 3-connected rare 2-fold interpenetrating ZnSc net with a Point (Schlafli) symbolmore » of (10{sup 3}) while 2 is a one-dimensional (1D) ladder structure. Compound 3 features a two-dimensional (2D) honeycomb network with typical 6{sup 3}-hcb topology, while 4 is 2D network with (4, 4) sql topology based on binuclear Cu{sup II} subunits. The non-covalent bonding interactions such as hydrogen bonds, π···π stacking and C–H···π exist in complexes 1–4, which contributes to stabilize crystal structure and extend the low-dimensional entities into high-dimensional frameworks. And the photoluminescent property of 1 and 2 and gas sorption property of 4 have been investigated. - Graphical abstract: Four new coordination polymers have been obtained and their photoluminescent and gas sorption properties have also been investigated. - Highlights: • Two pairs of Zn{sup II}/ Cu{sup II} compounds have been synthesized. • Auxiliary ligand-controlled assembly of the complexes is reported. • The luminescent properties of complexes 1–2 were investigated. • The gas sorption property of 4 has been investigated.« less

  17. An ensemble of SVM classifiers based on gene pairs.

    PubMed

    Tong, Muchenxuan; Liu, Kun-Hong; Xu, Chungui; Ju, Wenbin

    2013-07-01

    In this paper, a genetic algorithm (GA) based ensemble support vector machine (SVM) classifier built on gene pairs (GA-ESP) is proposed. The SVMs (base classifiers of the ensemble system) are trained on different informative gene pairs. These gene pairs are selected by the top scoring pair (TSP) criterion. Each of these pairs projects the original microarray expression onto a 2-D space. Extensive permutation of gene pairs may reveal more useful information and potentially lead to an ensemble classifier with satisfactory accuracy and interpretability. GA is further applied to select an optimized combination of base classifiers. The effectiveness of the GA-ESP classifier is evaluated on both binary-class and multi-class datasets. Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. Semantic relations differentially impact associative recognition memory: electrophysiological evidence.

    PubMed

    Kriukova, Olga; Bridger, Emma; Mecklinger, Axel

    2013-10-01

    Though associative recognition memory is thought to rely primarily on recollection, recent research indicates that familiarity might also make a substantial contribution when to-be-learned items are integrated into a coherent structure by means of an existing semantic relation. It remains unclear how different types of semantic relations, such as categorical (e.g., dancer-singer) and thematic (e.g., dancer-stage) relations might affect associative recognition, however. Using event-related potentials (ERPs), we addressed this question by manipulating the type of semantic link between paired words in an associative recognition memory experiment. An early midfrontal old/new effect, typically linked to familiarity, was observed across the relation types. In contrast, a robust left parietal old/new effect was found in the categorical condition only, suggesting a clear contribution of recollection to associative recognition for this kind of pairs. One interpretation of this pattern is that familiarity was sufficiently diagnostic for associative recognition of thematic relations, which could result from the integrative nature of the thematic relatedness compared to the similarity-based nature of categorical pairs. The present study suggests that the extent to which recollection and familiarity are involved in associative recognition is at least in part determined by the properties of semantic relations between the paired associates. Copyright © 2013 Elsevier Inc. All rights reserved.

  19. Pairing phase diagram of three holes in the generalized Hubbard model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Navarro, O.; Espinosa, J.E.

    Investigations of high-{Tc} superconductors suggest that the electronic correlation may play a significant role in the formation of pairs. Although the main interest is on the physic of two-dimensional highly correlated electron systems, the one-dimensional models related to high temperature superconductivity are very popular due to the conjecture that properties of the 1D and 2D variants of certain models have common aspects. Within the models for correlated electron systems, that attempt to capture the essential physics of high-temperature superconductors and parent compounds, the Hubbard model is one of the simplest. Here, the pairing problem of a three electrons system hasmore » been studied by using a real-space method and the generalized Hubbard Hamiltonian. This method includes the correlated hopping interactions as an extension of the previously proposed mapping method, and is based on mapping the correlated many body problem onto an equivalent site- and bond-impurity tight-binding one in a higher dimensional space, where the problem was solved in a non-perturbative way. In a linear chain, the authors analyzed the pairing phase diagram of three correlated holes for different values of the Hamiltonian parameters. For some value of the hopping parameters they obtain an analytical solution for all kind of interactions.« less

  20. Controlled finite momentum pairing and spatially varying order parameter in proximitized HgTe quantum wells

    NASA Astrophysics Data System (ADS)

    Hart, Sean; Ren, Hechen; Kosowsky, Michael; Ben-Shach, Gilad; Leubner, Philipp; Bruene, Christoph; Buhmann, Hartmut; Molenkamp, Laurens; Halperin, Bertrand; Yacoby, Amir

    Conventional s-wave superconductivity arises from singlet pairing of electrons with opposite Fermi momenta, forming Cooper pairs with zero net momentum. Recent studies have focused on coupling s-wave superconductors to systems with an unusual configuration of electronic spin and momentum at the Fermi surface, where the nature of the paired state can be modified and the system may even undergo a topological phase transition. Here we present measurements on Josephson junctions based on HgTe quantum wells coupled to aluminum or niobium superconductors, and subject to a magnetic field in the plane of the quantum well. We observe that the in-plane magnetic field modulates the Fraunhofer interference pattern, and that this modulation depends both on electron density and on the direction of the in-plane field with respect to the junction. However, the orientation of the junction with respect to the underlying crystal lattice does not impact the measurements. These findings suggest that spin-orbit coupling plays a role in the observed behavior, and that measurements of Josephson junctions in the presence of an in-plane field can elucidate the Fermi surface properties of the weak link material. NSF DMR-1206016; STC Center for Integrated Quantum Materials under NSF Grant No. DMR-1231319; NSF GRFP under Grant DGE1144152, Microsoft Corporation Project Q.

  1. Dusty Pair Plasma—Wave Propagation and Diffusive Transition of Oscillations

    NASA Astrophysics Data System (ADS)

    Atamaniuk, Barbara; Turski, Andrzej J.

    2011-11-01

    The crucial point of the paper is the relation between equilibrium distributions of plasma species and the type of propagation or diffusive transition of plasma response to a disturbance. The paper contains a unified treatment of disturbance propagation (transport) in the linearized Vlasov electron-positron and fullerene pair plasmas containing charged dust impurities, based on the space-time convolution integral equations. Electron-positron-dust/ion (e-p-d/i) plasmas are rather widespread in nature. Space-time responses of multi-component linearized Vlasov plasmas on the basis of multiple integral equations are invoked. An initial-value problem for Vlasov-Poisson/Ampère equations is reduced to the one multiple integral equation and the solution is expressed in terms of forcing function and its space-time convolution with the resolvent kernel. The forcing function is responsible for the initial disturbance and the resolvent is responsible for the equilibrium velocity distributions of plasma species. By use of resolvent equations, time-reversibility, space-reflexivity and the other symmetries are revealed. The symmetries carry on physical properties of Vlasov pair plasmas, e.g., conservation laws. Properly choosing equilibrium distributions for dusty pair plasmas, we can reduce the resolvent equation to: (i) the undamped dispersive wave equations, (ii) and diffusive transport equations of oscillations.

  2. Examining the efficiency and interdependence of US credit and stock markets through MF-DFA and MF-DXA approaches

    NASA Astrophysics Data System (ADS)

    Shahzad, Syed Jawad Hussain; Nor, Safwan Mohd; Mensi, Walid; Kumar, Ronald Ravinesh

    2017-04-01

    This study examines the power law properties of 11 US credit and stock markets at the industry level. We use multifractal detrended fluctuation analysis (MF-DFA) and multifractal detrended cross-correlation analysis (MF-DXA) to first investigate the relative efficiency of credit and stock markets and then evaluate the mutual interdependence between CDS-equity market pairs. The scaling exponents of the MF-DFA approach suggest that CDS markets are relatively more inefficient than their equity counterparts. However, Banks and Financial credit markets are relatively more efficient. Basic Materials (both CDS and equity indices) is the most inefficient sector of the US economy. The cross-correlation exponents obtained through MF-DXA also suggest that the relationship of the CDS and equity sectors within and across markets is multifractal for all pairs. Within the CDS market, Basic Materials is the most dependent sector, whereas equity market sectors can be divided into two distinct groups based on interdependence. The pair-wise dependence between Basic Materials sector CDSs and the equity index is also the highest. The degree of cross-correlation shows that the sectoral pairs of CDS and equity markets belong to a persistent cross-correlated series within selected time intervals.

  3. Envisaging quantum transport phenomenon in a muddled base pair of DNA

    NASA Astrophysics Data System (ADS)

    Vohra, Rajan; Sawhney, Ravinder Singh

    2018-05-01

    The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.

  4. Higher order structural effects stabilizing the reverse Watson–Crick Guanine-Cytosine base pair in functional RNAs

    PubMed Central

    Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi

    2014-01-01

    The G:C reverse Watson–Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. PMID:24121683

  5. Asynchronous Replication and Autosome-Pair Non-Equivalence in Human Embryonic Stem Cells

    PubMed Central

    Dutta, Devkanya; Ensminger, Alexander W.; Zucker, Jacob P.; Chess, Andrew

    2009-01-01

    A number of mammalian genes exhibit the unusual properties of random monoallelic expression and random asynchronous replication. Such exceptional genes include genes subject to X inactivation and autosomal genes including odorant receptors, immunoglobulins, interleukins, pheromone receptors, and p120 catenin. In differentiated cells, random asynchronous replication of interspersed autosomal genes is coordinated at the whole chromosome level, indicative of chromosome-pair non-equivalence. Here we have investigated the replication pattern of the random asynchronously replicating genes in undifferentiated human embryonic stem cells, using fluorescence in situ hybridization based assay. We show that allele-specific replication of X-linked genes and random monoallelic autosomal genes occur in human embryonic stem cells. The direction of replication is coordinated at the whole chromosome level and can cross the centromere, indicating the existence of autosome-pair non-equivalence in human embryonic stem cells. These results suggest that epigenetic mechanism(s) that randomly distinguish between two parental alleles are emerging in the cells of the inner cell mass, the source of human embryonic stem cells. PMID:19325893

  6. Pair-correlation function of a metastable helium Bose-Einstein condensate

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zin, Pawel; Trippenbach, Marek; Gajda, Mariusz

    2004-02-01

    The pair-correlation function is one of the basic quantities to characterize the coherence properties of a Bose-Einstein condensate. We calculate this function in the experimentally important case of a zero temperature Bose-Einstein condensate in a metastable triplet helium state using the variational method with a pair-excitation ansatz. We compare our result with a pair-correlation function obtained for the hard-sphere potential with the same scattering length. Both functions are practically indistinguishable for distances greater than the scattering length. At smaller distances, due to interatomic interactions, the helium condensate shows strong correlations.

  7. Molecular switching behavior in isosteric DNA base pairs.

    PubMed

    Jissy, A K; Konar, Sukanya; Datta, Ayan

    2013-04-15

    The structures and proton-coupled behavior of adenine-thymine (A-T) and a modified base pair containing a thymine isostere, adenine-difluorotoluene (A-F), are studied in different solvents by dispersion-corrected density functional theory. The stability of the canonical Watson-Crick base pair and the mismatched pair in various solvents with low and high dielectric constants is analyzed. It is demonstrated that A-F base pairing is favored in solvents with low dielectric constant. The stabilization and conformational changes induced by protonation are also analyzed for the natural as well as the mismatched base pair. DNA sequences capable of changing their sequence conformation on protonation are used in the construction of pH-based molecular switches. An acidic medium has a profound influence in stabilizing the isostere base pair. Such a large gain in stability on protonation leads to an interesting pH-controlled molecular switch, which can be incorporated in a natural DNA tract. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. The effects of temperature gradient and growth rate on the morphology and fatigue properties of MAR-M246(Hf)

    NASA Technical Reports Server (NTRS)

    Schmidt, D. D.; Alter, W. S.; Hamilton, W. D.; Parr, R. A.

    1989-01-01

    MAR-M246(Hf) is a nickel based superalloy used in the turbopump blades of the Space Shuttle main engines. The effects are considered of temperature gradient (G) and growth rate (R) on the microstructure and fatigue properties of this superalloy. The primary dendrite arm spacings were found to be inversely proportional to both temperature gradient and growth rate. Carbide and gamma - gamma prime morphology trends were related to G/R ratios. Weibull analysis of fatigue results shows the characteristic life to be larger by a factor of 10 for the low gradient/fast rate pairing of G and R, while the reliability (beta) was lower.

  9. Variety of Behavior of Equity Returns in Financial Markets

    NASA Astrophysics Data System (ADS)

    Bonanno, Giovanni; Lillo, Fabrizio; Mantegna, Rosario N.

    2001-03-01

    The price dynamics of a set of equities traded in an efficient market is pretty complex. It consists of almost not redundant time series which have (i) long-range correlated volatility and (ii) cross-correlation between each pair of equities. We perform a study of the statistical properties of an ensemble of equities returns which is fruitful to elucidate the nature and role of time and ensemble correlation. Specifically, we investigate a statistical ensemble of daily returns of n equities traded in United States financial markets. For each trading day of our database, we study the ensemble return distribution. We find that a typical ensemble return distribution exists in most of the trading days [1] with the exception of crash and rally days and of the days following to these extreme events [2]. We analyze each ensemble return distribution by extracting its first two central moments. We call the second moment of the ensemble return distribution the variety of the market. We choose this term because high variety implies a variated behavior of the equities returns in the considered day. We observe that the mean return and the variety are fluctuating in time and are stochastic processes themselves. The variety is a long-range correlated stochastic process. Customary time-averaged statistical properties of time series of stock returns are also considered. In general, time-averaged and portfolio-averaged returns have different statistical properties [1]. We infer from these differences information about the relative strength of correlation between equities and between different trading days. We also compare our empirical results with those predicted by the single-index model and we conclude that this simple model is unable to explain the statistical properties of the second moment of the ensemble return distribution. Correlation between pairs of equities are continuously present in the dynamics of a stock portfolio. Hence, it is relevant to investigate pair correlation in a efficient and original way. We propose to investigate these correlations at a daily and intra daily time horizon with a method based on concepts of random frustrated systems. Specifically, a hierarchical organization of the investigated equities is obtained by determining a metric distance between stocks and by investigating the properties of the subdominant ultrametric associated with it [3]. The high-frequency cross-correlation existing between pairs of equities are investigated in a set of 100 stocks traded in US equity markets. The decrease of the cross-correlation between the equity returns observed for diminishing time horizons progressively changes the nature of the hierarchical structure associated to each different time horizon [4]. The nature of the correlation present between pairs of time series of equity returns collected in a portfolio has a strong influence on the variety of the market. We finally discuss the relation between pair correlation and variety of an ensemble return distribution. References [1] Fabrizio Lillo and Rosario N. Mantegna, Variety and volatility in financial markets, Phys. Rev. E 62, 6126-6134 (2000). [2] Fabrizio Lillo and Rosario N. Mantegna, Symmetry alteration of ensemble return distribution in crash and rally days of financial market, Eur. Phys. J. B 15, 603-606 (2000). [3] Rosario N. Mantegna, Hierarchical structure in financial markets, Eur. Phys. J. B 11, 193-197 (1999). [4] Giovanni Bonanno, Fabrizio Lillo, and Rosario N. Mantegna, High-frequency cross-correlation in a set of stocks, Quantitative Finance (in press).

  10. 1,8-Naphthyridine-2,7-diamine: a potential universal reader of Watson-Crick base pairs for DNA sequencing by electron tunneling.

    PubMed

    Liang, Feng; Lindsay, Stuart; Zhang, Peiming

    2012-11-21

    With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.

  11. 1,8-Naphthyridine-2,7-diamine: A Potential Universal Reader of the Watson-Crick Base Pairs for DNA Sequencing by Electron Tunneling

    PubMed Central

    Liang, Feng; Lindsay, Stuart; Zhang, Peiming

    2013-01-01

    With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read the DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A:T and G:C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs. PMID:23038027

  12. A computational study on choline benzoate and choline salicylate ionic liquids in the pure state and after CO2 adsorption.

    PubMed

    Aparicio, Santiago; Atilhan, Mert

    2012-08-02

    Choline-based ionic liquids show very adequate environmental, toxicological, and economical profiles for their application in many different technological areas. We report in this work a computational study on the properties of choline benzoate and choline salicylate ionic liquids, as representatives of this family of compounds, in the pure state and after CO(2) adsorption. Quantum chemistry calculations using the density functional theory approach for ionic pairs and ions, CO(2) pairs, were carried out, and the results analyzed using natural bond orbital and atoms in a molecule approaches. Classical molecular dynamics simulations of ionic liquids were done as a function of pressure, temperature, and CO(2) concentration. Microscopic structuring and intermolecular forces are analyzed together with the dynamic behavior of the studied fluids.

  13. The role of linguistic experience on the perception of phonation

    NASA Astrophysics Data System (ADS)

    Esposito, Christina

    2005-09-01

    This study investigates the role linguistic experience has on the perception of phonation and the acoustic properties that correlate with this perception. Listeners from three languages (Gujarati, which contrasts breathy versus modal vowels, Italian, which has no breathiness, and English, which has allophonic breathiness) participated in two tasks. In the Visual Sort task, breathy and modal vowels from a variety of languages (e.g., Chong, Mon, etc.) were presented as icons on a computer screen. Subjects sorted the icons (the stimuli) into two groups based on perceived similarity of the talker's voices. In the multidimensional scaling task, listeners heard pairs of Mazatec vowels, and moved an on-screen slider to indicate the perceived similarity of the vowels in each pair. Results will show that judgments were more uniform across subjects who had breathy categories present in their native language(s), and varied across subjects who lack a breathy category. The perceived similarity among the stimuli will correlate with a measurable acoustic property (H1-H2, H1-H2, H1-A3, H1-A1 or H1-A2, the average of H1-H2 compared to A1, and A2-A3). It is hypothesized that H1-H2 will be the most salient acoustic property for Gujarati listeners because this correlates with their production of breathy vowels.

  14. Nanotubes, nanorods and nanowires having piezoelectric and/or pyroelectric properties and devices manufactured therefrom

    DOEpatents

    Russell, Thomas P [Amherst, MA; Lutkenhaus, Jodie [Wethersfield, CT

    2012-05-15

    Disclosed herein is a device comprising a pair of electrodes; and a nanotube, a nanorod and/or a nanowire; the nanotube, nanorod and/or nanowire comprising a piezoelectric and/or pyroelectric polymeric composition; the pair of electrodes being in electrical communication with opposing surfaces of the nanotube, nanorod and/or a nanowire; the pair of electrodes being perpendicular to a longitudinal axis of the nanotube, nanorod and/or a nanowire.

  15. Synthesis and photocatalytic CO2 reduction performance of Cu2O/Coal-based carbon nanoparticle composites

    NASA Astrophysics Data System (ADS)

    Dedong, Zhang; Maimaiti, Halidan; Awati, Abuduheiremu; Yisilamu, Gunisakezi; Fengchang, Sun; Ming, Wei

    2018-05-01

    The photocatalytic reduction of CO2 into hydrocarbons provides a promising approach to overcome the challenges of environmental crisis and energy shortage. Here we fabricated a cuprous oxide (Cu2O) based composite photocatalyst consisting of Cu2O/carbon nanoparticles (CNPs). To prepare the CNPs, coal samples from Wucaiwan, Xinjiang, China, were first treated with HNO3, followed by hydrogen peroxide (H2O2) oxidation to strip nanocrystalline carbon from coal. After linking with oxygen-containing group such as hydroxyl, coal-based CNPs with sp2 carbon structure and multilayer graphene lattice structure were synthesized. Subsequently, the CNPs were loaded onto the surface of Cu2O nanoparticles prepared by in-situ reduction of copper chloride (CuCl2·2H2O). The physical properties and chemical structure of the Cu2O/CNPs as well as photocatalytic activity of CO2/H2O reduction into CH3OH were measured. The results demonstrate that the Cu2O/CNPs are composed of spherical particles with diameter of 50 nm and mesoporous structure, which are suitable for CO2 adsorption. Under illumination of visible light, electron-hole pairs are generated in Cu2O. Thanks to the CNPs, the fast recombination of electron-hole pairs is suppressed. The energy gradient formed on the surface of Cu2O/CNPs facilitates the efficient separation of electron-hole pairs for CO2 reduction and H2O oxidation, leading to enhanced photocatalytic activity.

  16. Kinetic selection vs. free energy of DNA base pairing in control of polymerase fidelity.

    PubMed

    Oertell, Keriann; Harcourt, Emily M; Mohsen, Michael G; Petruska, John; Kool, Eric T; Goodman, Myron F

    2016-04-19

    What is the free energy source enabling high-fidelity DNA polymerases (pols) to favor incorporation of correct over incorrect base pairs by 10(3)- to 10(4)-fold, corresponding to free energy differences of ΔΔGinc∼ 5.5-7 kcal/mol? Standard ΔΔG° values (∼0.3 kcal/mol) calculated from melting temperature measurements comparing matched vs. mismatched base pairs at duplex DNA termini are far too low to explain pol accuracy. Earlier analyses suggested that pol active-site steric constraints can amplify DNA free energy differences at the transition state (kinetic selection). A recent paper [Olson et al. (2013)J Am Chem Soc135:1205-1208] used Vent pol to catalyze incorporations in the presence of inorganic pyrophosphate intended to equilibrate forward (polymerization) and backward (pyrophosphorolysis) reactions. A steady-state leveling off of incorporation profiles at long reaction times was interpreted as reaching equilibrium between polymerization and pyrophosphorolysis, yielding apparent ΔG° = -RTlnKeq, indicating ΔΔG° of 3.5-7 kcal/mol, sufficient to account for pol accuracy without need of kinetic selection. Here we perform experiments to measure and account for pyrophosphorolysis explicitly. We show that forward and reverse reactions attain steady states far from equilibrium for wrong incorporations such as G opposite T. Therefore,[Formula: see text]values obtained from such steady-state evaluations ofKeqare not dependent on DNA properties alone, but depend largely on constraints imposed on right and wrong substrates in the polymerase active site.

  17. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

    PubMed

    Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

    2013-06-17

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Study of left-handed materials

    NASA Astrophysics Data System (ADS)

    Zhou, Jiangfeng

    Left handed materials (LHMs) are artificial materials that have negative electrical permittivity, negative magnetic permeability, and negative index of refraction across a common frequency band. They possess electromagnetic (EM) properties not found in nature. LHMs have attracted tremendous attention because of their potential applications to build the perfect lens and cloaking devices. In the past few years there has been ample proof for the existence of LHMs in the microwave frequency range. Recently, researchers are trying hard to push the operating frequency of LHMs into terahertz and the optical regime. In this thesis, we start with the theoretical prediction of left handed materials made by Veselago 40 years ago, introducing the unique electromagnetic properties of the left handed materials. After discussing the realization of LHMs by the split ring resonators (SRRs) and wire designs, we briefly review the development of LHMs from microwave frequency to the optical regime. We discuss the chiral metamaterial, which provides an alternative approach to realize negative refractive index. In Chapter 2, we discuss the electromagnetic properties of the SRRs and the breakdown of linear scaling properties of SRRs at infrared and optical frequencies. By discussing the current modes, and the electric and magnetic moments, we study three resonance modes of SRR with respect to different polarizations of EM waves. Through numerical simulations, we find the breakdown of linear scaling, due to the free electron kinetic energy for frequencies above 100 THz. This result is important. It proves that researchers cannot push metamaterials into the optical regime by just scaling down the geometrical size of metamaterial designs used at low frequency. Due to the breakdown of the linear scaling property, a much smaller structure size of LHMs design is required in the optical regime, so new designs with simpler topology are needed. In Chapter 3, we discuss a short wire pair design, which has a distinct advantage over conventional SRRs. We systemically study the electromagnetic properties of the short wire pair design. We determine the criteria overlaps the electric and magnetic resonances of short wire pairs. Using an H-shaped short wire pairs design, we demonstrate negative refractive index experimentally. In Chapter 4, we introduce a LHM design using short wire pairs with long wires, which avoid the difficulty of overlapping the electric and magnetic resonances. We also discussed the relationship between three important LHM designs suitable for the optical regime: double gap SRRs, the short wire pairs, and the fishnet structure. Compared to LHMs at microwave frequencies, the current designs at optical frequencies suffer from high losses which limit their potential applications in the area requiring low losses, such as the perfect lens. In Chapter 5, we investigate the role of losses of the short wire pairs and the fishnet structures. We find the losses can be reduced substantially by increasing the effective inductance to capacitance ratio, L/C, especially at THz frequencies and in the optical regime.

  19. The Spectral and Environment Properties of z ∼ 2.0–2.5 Quasar Pairs

    NASA Astrophysics Data System (ADS)

    Lusso, Elisabeta; Fumagalli, Michele; Rafelski, Marc; Neeleman, Marcel; Prochaska, Jason X.; Hennawi, Joseph F.; O’Meara, John M.; Theuns, Tom

    2018-06-01

    We present the first results from our survey of intervening and proximate Lyman limit systems (LLSs) at z ∼ 2.0–2.5 using the Wide Field Camera 3 on board the Hubble Space Telescope. The quasars in our sample are projected pairs with proper transverse separations R ⊥ ≤ 150 kpc and line-of-sight velocity separations ≲11,000 km s‑1. We construct a stacked ultraviolet (rest-frame wavelengths 700–2000 Å) spectrum of pairs corrected for the intervening Lyman forest and Lyman continuum absorption. The observed spectral composite presents a moderate flux excess for the most prominent broad emission lines, a ∼30% decrease in flux at λ = 800–900 Å compared to a stack of brighter quasars not in pairs at similar redshifts, and lower values of the mean free path of the H I ionizing radiation for pairs ({λ }mfp}912 = 140.7 ± 20.2 {h}70-1 Mpc) compared to single quasars ({λ }mfp}912 = 213.8 ± 28 {h}70-1 Mpc) at the average redshift z ≃ 2.44. From the modeling of LLS absorption in these pairs, we find a higher (∼20%) incidence of proximate LLSs with log {N}{{H}{{I}}} ≥ 17.2 at δv < 5000 km s‑1 compared to single quasars (∼6%). These two rates are different at the 5σ level. Moreover, we find that optically thick absorbers are equally shared between foreground and background quasars. Based on these pieces of evidence, we conclude that there is a moderate excess of gas-absorbing Lyman continuum photons in our closely projected quasar pairs compared to single quasars. We argue that this gas arises mostly within large-scale structures or partially neutral regions inside the dark matter halos where these close pairs reside.

  20. The Effects of Dominance on Leadership and Energetic Gain: A Dynamic Game between Pairs of Social Foragers

    PubMed Central

    Rands, Sean A.

    2011-01-01

    Although social behaviour can bring many benefits to an individual, there are also costs that may be incurred whenever the members of a social group interact. The formation of dominance hierarchies could offer a means of reducing some of the costs of social interaction, but individuals within the hierarchy may end up paying differing costs dependent upon their position within the hierarchy. These differing interaction costs may therefore influence the behaviour of the group, as subordinate individuals may experience very different benefits and costs to dominants when the group is conducting a given behaviour. Here, a state-dependent dynamic game is described which considers a pair of social foragers where there is a set dominance relationship within the pair. The model considers the case where the subordinate member of the pair pays an interference cost when it and the dominant individual conduct specific pairs of behaviours together. The model demonstrates that if the subordinate individual pays these energetic costs when it interacts with the dominant individual, this has effects upon the behaviour of both subordinate and the dominant individuals. Including interaction costs increases the amount of foraging behaviour both individuals conduct, with the behaviour of the pair being driven by the subordinate individual. The subordinate will tend to be the lighter individual for longer periods of time when interaction costs are imposed. This supports earlier suggestions that lighter individuals should act as the decision-maker within the pair, giving leadership-like behaviours that are based upon energetic state. Pre-existing properties of individuals such as their dominance will be less important for determining which individual makes the decisions for the pair. This suggests that, even with strict behavioural hierarchies, identifying which individual is the dominant one is not sufficient for identifying which one is the leader. PMID:22028645

  1. Statistical deprojection of galaxy pairs

    NASA Astrophysics Data System (ADS)

    Nottale, Laurent; Chamaraux, Pierre

    2018-06-01

    Aims: The purpose of the present paper is to provide methods of statistical analysis of the physical properties of galaxy pairs. We perform this study to apply it later to catalogs of isolated pairs of galaxies, especially two new catalogs we recently constructed that contain ≈1000 and ≈13 000 pairs, respectively. We are particularly interested by the dynamics of those pairs, including the determination of their masses. Methods: We could not compute the dynamical parameters directly since the necessary data are incomplete. Indeed, we only have at our disposal one component of the intervelocity between the members, namely along the line of sight, and two components of their interdistance, i.e., the projection on the sky-plane. Moreover, we know only one point of each galaxy orbit. Hence we need statistical methods to find the probability distribution of 3D interdistances and 3D intervelocities from their projections; we designed those methods under the term deprojection. Results: We proceed in two steps to determine and use the deprojection methods. First we derive the probability distributions expected for the various relevant projected quantities, namely intervelocity vz, interdistance rp, their ratio, and the product rp v_z^2, which is involved in mass determination. In a second step, we propose various methods of deprojection of those parameters based on the previous analysis. We start from a histogram of the projected data and we apply inversion formulae to obtain the deprojected distributions; lastly, we test the methods by numerical simulations, which also allow us to determine the uncertainties involved.

  2. SparseMaps—A systematic infrastructure for reduced-scaling electronic structure methods. III. Linear-scaling multireference domain-based pair natural orbital N-electron valence perturbation theory

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Guo, Yang; Sivalingam, Kantharuban; Neese, Frank, E-mail: Frank.Neese@cec.mpg.de

    2016-03-07

    Multi-reference (MR) electronic structure methods, such as MR configuration interaction or MR perturbation theory, can provide reliable energies and properties for many molecular phenomena like bond breaking, excited states, transition states or magnetic properties of transition metal complexes and clusters. However, owing to their inherent complexity, most MR methods are still too computationally expensive for large systems. Therefore the development of more computationally attractive MR approaches is necessary to enable routine application for large-scale chemical systems. Among the state-of-the-art MR methods, second-order N-electron valence state perturbation theory (NEVPT2) is an efficient, size-consistent, and intruder-state-free method. However, there are still twomore » important bottlenecks in practical applications of NEVPT2 to large systems: (a) the high computational cost of NEVPT2 for large molecules, even with moderate active spaces and (b) the prohibitive cost for treating large active spaces. In this work, we address problem (a) by developing a linear scaling “partially contracted” NEVPT2 method. This development uses the idea of domain-based local pair natural orbitals (DLPNOs) to form a highly efficient algorithm. As shown previously in the framework of single-reference methods, the DLPNO concept leads to an enormous reduction in computational effort while at the same time providing high accuracy (approaching 99.9% of the correlation energy), robustness, and black-box character. In the DLPNO approach, the virtual space is spanned by pair natural orbitals that are expanded in terms of projected atomic orbitals in large orbital domains, while the inactive space is spanned by localized orbitals. The active orbitals are left untouched. Our implementation features a highly efficient “electron pair prescreening” that skips the negligible inactive pairs. The surviving pairs are treated using the partially contracted NEVPT2 formalism. A detailed comparison between the partial and strong contraction schemes is made, with conclusions that discourage the strong contraction scheme as a basis for local correlation methods due to its non-invariance with respect to rotations in the inactive and external subspaces. A minimal set of conservatively chosen truncation thresholds controls the accuracy of the method. With the default thresholds, about 99.9% of the canonical partially contracted NEVPT2 correlation energy is recovered while the crossover of the computational cost with the already very efficient canonical method occurs reasonably early; in linear chain type compounds at a chain length of around 80 atoms. Calculations are reported for systems with more than 300 atoms and 5400 basis functions.« less

  3. Affective Beliefs Influence the Experience of Eating Meat

    PubMed Central

    Anderson, Eric C.; Barrett, Lisa Feldman

    2016-01-01

    People believe they experience the world objectively, but research continually demonstrates that beliefs influence perception. Emerging research indicates that beliefs influence the experience of eating. In three studies, we test whether beliefs about how animals are raised can influence the experience of eating meat. Samples of meat were paired with descriptions of animals raised on factory farms or raised on humane farms. Importantly, the meat samples in both conditions were identical. However, participants experienced the samples differently: meat paired with factory farm descriptions looked, smelled, and tasted less pleasant. Even basic properties of flavor were influenced: factory farmed samples tasted more salty and greasy. Finally, actual behavior was influenced: participants consumed less when samples were paired with factory farm descriptions. These findings demonstrate that the experience of eating is not determined solely by physical properties of stimuli—beliefs also shape experience. PMID:27556643

  4. Resolving dual binding conformations of cellulosome cohesin-dockerin complexes using single-molecule force spectroscopy.

    PubMed

    Jobst, Markus A; Milles, Lukas F; Schoeler, Constantin; Ott, Wolfgang; Fried, Daniel B; Bayer, Edward A; Gaub, Hermann E; Nash, Michael A

    2015-10-31

    Receptor-ligand pairs are ordinarily thought to interact through a lock and key mechanism, where a unique molecular conformation is formed upon binding. Contrary to this paradigm, cellulosomal cohesin-dockerin (Coh-Doc) pairs are believed to interact through redundant dual binding modes consisting of two distinct conformations. Here, we combined site-directed mutagenesis and single-molecule force spectroscopy (SMFS) to study the unbinding of Coh:Doc complexes under force. We designed Doc mutations to knock out each binding mode, and compared their single-molecule unfolding patterns as they were dissociated from Coh using an atomic force microscope (AFM) cantilever. Although average bulk measurements were unable to resolve the differences in Doc binding modes due to the similarity of the interactions, with a single-molecule method we were able to discriminate the two modes based on distinct differences in their mechanical properties. We conclude that under native conditions wild-type Doc from Clostridium thermocellum exocellulase Cel48S populates both binding modes with similar probabilities. Given the vast number of Doc domains with predicted dual binding modes across multiple bacterial species, our approach opens up new possibilities for understanding assembly and catalytic properties of a broad range of multi-enzyme complexes.

  5. Supramolecular nano-sniffers for ultrasensitive detection of formaldehyde.

    PubMed

    Akshath, Uchangi Satyaprasad; Bhatt, Praveena

    2018-02-15

    Supramolecular nanoparticle hybrids for biosensing of analytes have been a major focus due to their tunable optical and surface properties. Quantum dots-Gold nanoparticle (QDs-GNP) based FRET probes involving turn on/off principles have gained immense interest due to their specificity and sensitivity. Recent focus is on applying these supramolecular hybrids for enzyme operated biosensors that can specifically turn-on fluorescence induced by co-factor or product formed from enzymatic reaction. The present study focuses on locking and unlocking the interaction between QD-GNP pair leading to differential fluorescent properties. Cationic GNPs efficiently quenched the anionic QD fluorescence by forming nanoparticle hybrid. Quenching interaction between QD-GNP pair was unlocked by NADH leading to QD fluorescence turn-on. This phenomenon was applied for the successful detection of formaldehyde using NAD + dependent formaldehyde dehydrogenase. The proposed nano-sniffer could successfully detect formaldehyde from 0.001 to 100000ng/mL (R 2 = 0.9339) by the turn off-turn on principle. It could also detect formaldehyde in fruit juice and wine samples indicating its stability and sensitivity in real samples. The proposed nanoprobe can have wide applications in developing enzyme biosensors in future. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Comparison of clinical knowledge bases for summarization of electronic health records.

    PubMed

    McCoy, Allison B; Sittig, Dean F; Wright, Adam

    2013-01-01

    Automated summarization tools that create condition-specific displays may improve clinician efficiency. These tools require new kinds of knowledge that is difficult to obtain. We compared five problem-medication pair knowledge bases generated using four previously described knowledge base development approaches. The number of pairs in the resulting mapped knowledge bases varied widely due to differing mapping techniques from the source terminologies, ranging from 2,873 to 63,977,738 pairs. The number of overlapping pairs across knowledge bases was low, with one knowledge base having half of the pairs overlapping with another knowledge base, and most having less than a third overlapping. Further research is necessary to better evaluate the knowledge bases independently in additional settings, and to identify methods to integrate the knowledge bases.

  7. Image Understanding. Proceedings of a Workshop (11th) Held at College Park, Maryland, April 30, 1980

    DTIC Science & Technology

    1980-04-30

    space nearest connected pairs. The new change in disparity is evaluated, and tested to see whether it lies in the |^ - ff, i? + o\\ inter - val. When no...property values such as gray level and " busyness ". Figure 3a shows a house picture containing five principal types of regions—sky, grass, bushes...pixe1 based on those of its neighbors; see Figure 3c Similar Improvement is obtained when the busyness values are Iteratively smoothed, e.g. by

  8. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Okutsu, N.; Shimamura, K.; Shimizu, E.

    To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH{sub 2} group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH{sub 2} group of G-Cmore » base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes.« less

  9. Analysis of dependent scattering mechanism in hard-sphere Yukawa random media

    NASA Astrophysics Data System (ADS)

    Wang, B. X.; Zhao, C. Y.

    2018-06-01

    The structural correlations in the microscopic structures of random media can induce the dependent scattering mechanism and thus influence the optical scattering properties. Based on our recent theory on the dependent scattering mechanism in random media composed of discrete dipolar scatterers [B. X. Wang and C. Y. Zhao, Phys. Rev. A 97, 023836 (2018)], in this paper, we study the hard-sphere Yukawa random media, in order to further elucidate the role of structural correlations in the dependent scattering mechanism and hence optical scattering properties. Here, we consider charged colloidal suspensions, whose effective pair interaction between colloids is described by a screened Coulomb (Yukawa) potential. By means of adding salt ions, the pair interaction between the charged particles can be flexibly tailored and therefore the structural correlations are modified. It is shown that this strategy can affect the optical properties significantly. For colloidal TiO2 suspensions, the modification of electric and magnetic dipole excitations induced by the structural correlations can substantially influence the optical scattering properties, in addition to the far-field interference effect described by the structure factor. However, this modification is only slightly altered by different salt concentrations and is mainly because of the packing-density-dependent screening effect. On the other hand, for low refractive index colloidal polystyrene suspensions, the dependent scattering mechanism mainly involves the far-field interference effect, and the effective exciting field amplitude for the electric dipole almost remains unchanged under different structural correlations. The present study has profound implications for understanding the role of structural correlations in the dependent scattering mechanism.

  10. Spin-1 Heisenberg ferromagnet using pair approximation method

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mert, Murat; Mert, Gülistan; Kılıç, Ahmet

    2016-06-08

    Thermodynamic properties for Heisenberg ferromagnet with spin-1 on the simple cubic lattice have been calculated using pair approximation method. We introduce the single-ion anisotropy and the next-nearest-neighbor exchange interaction. We found that for negative single-ion anisotropy parameter, the internal energy is positive and heat capacity has two peaks.

  11. Recognition of Watson-Crick base pairs: constraints and limits due to geometric selection and tautomerism

    PubMed Central

    Yusupov, Marat; Yusupova, Gulnara

    2014-01-01

    The natural bases of nucleic acids have a strong preference for one tautomer form, guaranteeing fidelity in their hydrogen bonding potential. However, base pairs observed in recent crystal structures of polymerases and ribosomes are best explained by an alternative base tautomer, leading to the formation of base pairs with Watson-Crick-like geometries. These observations set limits to geometric selection in molecular recognition of complementary Watson-Crick pairs for fidelity in replication and translation processes. PMID:24765524

  12. Electrical Conductivity through a Single Atomic Step Measured with the Proximity-Induced Superconducting Pair Correlation

    DOE PAGES

    Kim, Howon; Lin, Shi -Zeng; Graf, Matthias J.; ...

    2016-09-08

    Local disordered nanostructures in an atomically thick metallic layer on a semiconducting substrate play significant and decisive roles in transport properties of two-dimensional (2D) conductive systems. We measured the electrical conductivity through a step of monoatomic height in a truly microscopic manner by using as a signal the superconducting pair correlation induced by the proximity effect. The transport property across a step of a one-monolayer Pb surface metallic phase, formed on a Si(111) substrate, was evaluated by inducing the pair correlation around the local defect and measuring its response, i.e., the reduced density of states at the Fermi energy usingmore » scanning tunneling microscopy. We found that the step resistance has a significant contribution to the total resistance on a nominally flat surface. Our study also revealed that steps in the 2D metallic layer terminate the propagation of the pair correlation. Furthermore, superconductivity is enhanced between the first surface step and the superconductor–normal-metal interface by reflectionless tunneling when the step is located within a coherence length.« less

  13. Electrical Conductivity through a Single Atomic Step Measured with the Proximity-Induced Superconducting Pair Correlation.

    PubMed

    Kim, Howon; Lin, Shi-Zeng; Graf, Matthias J; Miyata, Yoshinori; Nagai, Yuki; Kato, Takeo; Hasegawa, Yukio

    2016-09-09

    Local disordered nanostructures in an atomically thick metallic layer on a semiconducting substrate play significant and decisive roles in transport properties of two-dimensional (2D) conductive systems. We measured the electrical conductivity through a step of monoatomic height in a truly microscopic manner by using as a signal the superconducting pair correlation induced by the proximity effect. The transport property across a step of a one-monolayer Pb surface metallic phase, formed on a Si(111) substrate, was evaluated by inducing the pair correlation around the local defect and measuring its response, i.e., the reduced density of states at the Fermi energy using scanning tunneling microscopy. We found that the step resistance has a significant contribution to the total resistance on a nominally flat surface. Our study also revealed that steps in the 2D metallic layer terminate the propagation of the pair correlation. Superconductivity is enhanced between the first surface step and the superconductor-normal-metal interface by reflectionless tunneling when the step is located within a coherence length.

  14. Energy-tunable sources of entangled photons: a viable concept for solid-state-based quantum relays.

    PubMed

    Trotta, Rinaldo; Martín-Sánchez, Javier; Daruka, Istvan; Ortix, Carmine; Rastelli, Armando

    2015-04-17

    We propose a new method of generating triggered entangled photon pairs with wavelength on demand. The method uses a microstructured semiconductor-piezoelectric device capable of dynamically reshaping the electronic properties of self-assembled quantum dots (QDs) via anisotropic strain engineering. Theoretical models based on k·p theory in combination with finite-element calculations show that the energy of the polarization-entangled photons emitted by QDs can be tuned in a range larger than 100 meV without affecting the degree of entanglement of the quantum source. These results pave the way towards the deterministic implementation of QD entanglement resources in all-electrically-controlled solid-state-based quantum relays.

  15. Energy-Tunable Sources of Entangled Photons: A Viable Concept for Solid-State-Based Quantum Relays

    NASA Astrophysics Data System (ADS)

    Trotta, Rinaldo; Martín-Sánchez, Javier; Daruka, Istvan; Ortix, Carmine; Rastelli, Armando

    2015-04-01

    We propose a new method of generating triggered entangled photon pairs with wavelength on demand. The method uses a microstructured semiconductor-piezoelectric device capable of dynamically reshaping the electronic properties of self-assembled quantum dots (QDs) via anisotropic strain engineering. Theoretical models based on k .p theory in combination with finite-element calculations show that the energy of the polarization-entangled photons emitted by QDs can be tuned in a range larger than 100 meV without affecting the degree of entanglement of the quantum source. These results pave the way towards the deterministic implementation of QD entanglement resources in all-electrically-controlled solid-state-based quantum relays.

  16. Preliminary Assessment of Detection Efficiency for the Geostationary Lightning Mapper Using Intercomparisons with Ground-Based Systems

    NASA Technical Reports Server (NTRS)

    Bateman, Monte; Mach, Douglas; Blakeslee, Richard J.; Koshak, William

    2018-01-01

    As part of the calibration/validation (cal/val) effort for the Geostationary Lightning Mapper (GLM) on GOES-16, we need to assess instrument performance (detection efficiency and accuracy). One major effort is to calculate the detection efficiency of GLM by comparing to multiple ground-based systems. These comparisons will be done pair-wise between GLM and each other source. A complication in this process is that the ground-based systems sense different properties of the lightning signal than does GLM (e.g., RF vs. optical). Also, each system has a different time and space resolution and accuracy. Preliminary results indicate that GLM is performing at or above its specification.

  17. Impact of native plants on bird and butterfly biodiversity in suburban landscapes.

    PubMed

    Burghardt, Karin T; Tallamy, Douglas W; Gregory Shriver, W

    2009-02-01

    Managed landscapes in which non-native ornamental plants are favored over native vegetation now dominate the United States, particularly east of the Mississippi River. We measured how landscaping with native plants affects the avian and lepidopteran communities on 6 pairs of suburban properties in southeastern Pennsylvania. One property in each pair was landscaped entirely with native plants and the other exhibited a more conventional suburban mixture of plants--a native canopy with non-native groundcover and shrubs. Vegetation sampling confirmed that total plant cover and plant diversity did not differ between treatments, but non-native plant cover was greater on the conventional sites and native plant cover was greater on the native sites. Several avian (abundance, species richness, biomass, and breeding-bird abundance) and larval lepidopteran (abundance and species richness) community parameters were measured from June 2006 to August 2006. Native properties supported significantly more caterpillars and caterpillar species and significantly greater bird abundance, diversity, species richness, biomass, and breeding pairs of native species. Of particular importance is that bird species of regional conservation concern were 8 times more abundant and significantly more diverse on native properties. In our study area, native landscaping positively influenced the avian and lepidopteran carrying capacity of suburbia and provided a mechanism for reducing biodiversity losses in human-dominated landscapes.

  18. Mathematical modeling of the malignancy of cancer using graph evolution.

    PubMed

    Gunduz-Demir, Cigdem

    2007-10-01

    We report a novel computational method based on graph evolution process to model the malignancy of brain cancer called glioma. In this work, we analyze the phases that a graph passes through during its evolution and demonstrate strong relation between the malignancy of cancer and the phase of its graph. From the photomicrographs of tissues, which are diagnosed as normal, low-grade cancerous and high-grade cancerous, we construct cell-graphs based on the locations of cells; we probabilistically generate an edge between every pair of cells depending on the Euclidean distance between them. For a cell-graph, we extract connectivity information including the properties of its connected components in order to analyze the phase of the cell-graph. Working with brain tissue samples surgically removed from 12 patients, we demonstrate that cell-graphs generated for different tissue types evolve differently and that they exhibit different phase properties, which distinguish a tissue type from another.

  19. Strategy to overcome recombination limited photocurrent generation in CsPbX3 nanocrystal arrays

    NASA Astrophysics Data System (ADS)

    Mir, Wasim J.; Livache, Clément; Goubet, Nicolas; Martinez, Bertille; Jagtap, Amardeep; Chu, Audrey; Coutard, Nathan; Cruguel, Hervé; Barisien, Thierry; Ithurria, Sandrine; Nag, Angshuman; Dubertret, Benoit; Ouerghi, Abdelkarim; Silly, Mathieu G.; Lhuillier, Emmanuel

    2018-03-01

    We discuss the transport properties of CsPbBrxI3-x perovskite nanocrystal arrays as a model ensemble system of caesium lead halide-based perovskite nanocrystal arrays. While this material is very promising for the design of light emitting diodes, laser, and solar cells, very little work has been devoted to the basic understanding of their (photo)conductive properties in an ensemble system. By combining DC and time-resolved photocurrent measurements, we demonstrate fast photodetection with time response below 2 ns. The photocurrent generation in perovskite nanocrystal-based arrays is limited by fast bimolecular recombination of the material, which limits the lifetime of the photogenerated electron-hole pairs. We propose to use nanotrench electrodes as a strategy to ensure that the device size fits within the obtained diffusion length of the material in order to boost the transport efficiency and thus observe an enhancement of the photoresponse by a factor of 1000.

  20. Painlevé equations, topological type property and reconstruction by the topological recursion

    NASA Astrophysics Data System (ADS)

    Iwaki, K.; Marchal, O.; Saenz, A.

    2018-01-01

    In this article we prove that Lax pairs associated with ħ-dependent six Painlevé equations satisfy the topological type property proposed by Bergère, Borot and Eynard for any generic choice of the monodromy parameters. Consequently we show that one can reconstruct the formal ħ-expansion of the isomonodromic τ-function and of the determinantal formulas by applying the so-called topological recursion to the spectral curve attached to the Lax pair in all six Painlevé cases. Finally we illustrate the former results with the explicit computations of the first orders of the six τ-functions.

  1. Optimal Electrode Selection for Electrical Resistance Tomography in Carbon Fiber Reinforced Polymer Composites

    PubMed Central

    Escalona Galvis, Luis Waldo; Diaz-Montiel, Paulina; Venkataraman, Satchi

    2017-01-01

    Electrical Resistance Tomography (ERT) offers a non-destructive evaluation (NDE) technique that takes advantage of the inherent electrical properties in carbon fiber reinforced polymer (CFRP) composites for internal damage characterization. This paper investigates a method of optimum selection of sensing configurations for delamination detection in thick cross-ply laminates using ERT. Reduction in the number of sensing locations and measurements is necessary to minimize hardware and computational effort. The present work explores the use of an effective independence (EI) measure originally proposed for sensor location optimization in experimental vibration modal analysis. The EI measure is used for selecting the minimum set of resistance measurements among all possible combinations resulting from selecting sensing electrode pairs. Singular Value Decomposition (SVD) is applied to obtain a spectral representation of the resistance measurements in the laminate for subsequent EI based reduction to take place. The electrical potential field in a CFRP laminate is calculated using finite element analysis (FEA) applied on models for two different laminate layouts considering a set of specified delamination sizes and locations with two different sensing arrangements. The effectiveness of the EI measure in eliminating redundant electrode pairs is demonstrated by performing inverse identification of damage using the full set and the reduced set of resistance measurements. This investigation shows that the EI measure is effective for optimally selecting the electrode pairs needed for resistance measurements in ERT based damage detection. PMID:28772485

  2. Optimal Electrode Selection for Electrical Resistance Tomography in Carbon Fiber Reinforced Polymer Composites.

    PubMed

    Escalona Galvis, Luis Waldo; Diaz-Montiel, Paulina; Venkataraman, Satchi

    2017-02-04

    Electrical Resistance Tomography (ERT) offers a non-destructive evaluation (NDE) technique that takes advantage of the inherent electrical properties in carbon fiber reinforced polymer (CFRP) composites for internal damage characterization. This paper investigates a method of optimum selection of sensing configurations for delamination detection in thick cross-ply laminates using ERT. Reduction in the number of sensing locations and measurements is necessary to minimize hardware and computational effort. The present work explores the use of an effective independence (EI) measure originally proposed for sensor location optimization in experimental vibration modal analysis. The EI measure is used for selecting the minimum set of resistance measurements among all possible combinations resulting from selecting sensing electrode pairs. Singular Value Decomposition (SVD) is applied to obtain a spectral representation of the resistance measurements in the laminate for subsequent EI based reduction to take place. The electrical potential field in a CFRP laminate is calculated using finite element analysis (FEA) applied on models for two different laminate layouts considering a set of specified delamination sizes and locations with two different sensing arrangements. The effectiveness of the EI measure in eliminating redundant electrode pairs is demonstrated by performing inverse identification of damage using the full set and the reduced set of resistance measurements. This investigation shows that the EI measure is effective for optimally selecting the electrode pairs needed for resistance measurements in ERT based damage detection.

  3. A novel in situ device based on a bionic piezoelectric actuator to study tensile and fatigue properties of bulk materials.

    PubMed

    Wang, Shupeng; Zhang, Zhihui; Ren, Luquan; Zhao, Hongwei; Liang, Yunhong; Zhu, Bing

    2014-06-01

    In this work, a miniaturized device based on a bionic piezoelectric actuator was developed to investigate the static tensile and dynamic fatigue properties of bulk materials. The device mainly consists of a bionic stepping piezoelectric actuator based on wedge block clamping, a pair of grippers, and a set of precise signal test system. Tensile and fatigue examinations share a set of driving system and a set of signal test system. In situ tensile and fatigue examinations under scanning electron microscope or metallographic microscope could be carried out due to the miniaturized dimensions of the device. The structure and working principle of the device were discussed and the effects of output difference between two piezoelectric stacks on the device were theoretically analyzed. The tensile and fatigue examinations on ordinary copper were carried out using this device and its feasibility was verified through the comparison tests with a commercial tensile examination instrument.

  4. A novel in situ device based on a bionic piezoelectric actuator to study tensile and fatigue properties of bulk materials

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Shupeng; Zhang, Zhihui, E-mail: zhzh@jlu.edu.cn; Ren, Luquan

    2014-06-15

    In this work, a miniaturized device based on a bionic piezoelectric actuator was developed to investigate the static tensile and dynamic fatigue properties of bulk materials. The device mainly consists of a bionic stepping piezoelectric actuator based on wedge block clamping, a pair of grippers, and a set of precise signal test system. Tensile and fatigue examinations share a set of driving system and a set of signal test system. In situ tensile and fatigue examinations under scanning electron microscope or metallographic microscope could be carried out due to the miniaturized dimensions of the device. The structure and working principlemore » of the device were discussed and the effects of output difference between two piezoelectric stacks on the device were theoretically analyzed. The tensile and fatigue examinations on ordinary copper were carried out using this device and its feasibility was verified through the comparison tests with a commercial tensile examination instrument.« less

  5. First principles view on chemical compound space: Gaining rigorous atomistic control of molecular properties

    DOE PAGES

    von Lilienfeld, O. Anatole

    2013-02-26

    A well-defined notion of chemical compound space (CCS) is essential for gaining rigorous control of properties through variation of elemental composition and atomic configurations. Here, we give an introduction to an atomistic first principles perspective on CCS. First, CCS is discussed in terms of variational nuclear charges in the context of conceptual density functional and molecular grand-canonical ensemble theory. Thereafter, we revisit the notion of compound pairs, related to each other via “alchemical” interpolations involving fractional nuclear charges in the electronic Hamiltonian. We address Taylor expansions in CCS, property nonlinearity, improved predictions using reference compound pairs, and the ounce-of-gold prizemore » challenge to linearize CCS. Finally, we turn to machine learning of analytical structure property relationships in CCS. Here, these relationships correspond to inferred, rather than derived through variational principle, solutions of the electronic Schrödinger equation.« less

  6. Structure based alignment and clustering of proteins (STRALCP)

    DOEpatents

    Zemla, Adam T.; Zhou, Carol E.; Smith, Jason R.; Lam, Marisa W.

    2013-06-18

    Disclosed are computational methods of clustering a set of protein structures based on local and pair-wise global similarity values. Pair-wise local and global similarity values are generated based on pair-wise structural alignments for each protein in the set of protein structures. Initially, the protein structures are clustered based on pair-wise local similarity values. The protein structures are then clustered based on pair-wise global similarity values. For each given cluster both a representative structure and spans of conserved residues are identified. The representative protein structure is used to assign newly-solved protein structures to a group. The spans are used to characterize conservation and assign a "structural footprint" to the cluster.

  7. Sequence dependency of canonical base pair opening in the DNA double helix

    PubMed Central

    Villa, Alessandra

    2017-01-01

    The flipping-out of a DNA base from the double helical structure is a key step of many cellular processes, such as DNA replication, modification and repair. Base pair opening is the first step of base flipping and the exact mechanism is still not well understood. We investigate sequence effects on base pair opening using extensive classical molecular dynamics simulations targeting the opening of 11 different canonical base pairs in two DNA sequences. Two popular biomolecular force fields are applied. To enhance sampling and calculate free energies, we bias the simulation along a simple distance coordinate using a newly developed adaptive sampling algorithm. The simulation is guided back and forth along the coordinate, allowing for multiple opening pathways. We compare the calculated free energies with those from an NMR study and check assumptions of the model used for interpreting the NMR data. Our results further show that the neighboring sequence is an important factor for the opening free energy, but also indicates that other sequence effects may play a role. All base pairs are observed to have a propensity for opening toward the major groove. The preferred opening base is cytosine for GC base pairs, while for AT there is sequence dependent competition between the two bases. For AT opening, we identify two non-canonical base pair interactions contributing to a local minimum in the free energy profile. For both AT and CG we observe long-lived interactions with water and with sodium ions at specific sites on the open base pair. PMID:28369121

  8. 3D reconstruction of the porous microstructure of Al2O3-coatings based on sequentially revealed surface data

    NASA Astrophysics Data System (ADS)

    Loftfield, Nina; Kästner, Markus; Reithmeier, Eduard

    2018-06-01

    Local and global liquid transport properties correlate strongly with the morphology of porous materials. Therefore, by characterizing the porous network information is indirectly gained on the materials properties. Properties like the open-porosity are easily accessible with techniques like mercury porosimetry. However, the 3D image reconstruction, destructive or non-destructive, holds advantages like an accurate spatially resolved representation of the investigated material. Common 3D data acquisition is done by x-ray microtomography or a combination of focused ion beam based milling and scanning electron microscopy. In this work a reconstruction approach similar to the latter one is implemented. The porous network is reconstructed based on an alternating process of milling the surface by fly cutting and measuring the surface data with a confocal laser scanning microscope. This has the benefit of reconstructing the pore network on the basis of surface height data, measuring the structure boundaries directly. The stack of milled surface height data needs to be registered and the pore structure to be segmented. The segmented pore structure is connected throughout each height layer and afterwards meshed. The investigated materials are porous surface coatings of aluminum oxide for the usage in tribological pairings.

  9. Computational and experimental characterization of a pyrrolidinium-based ionic liquid for electrolyte applications

    NASA Astrophysics Data System (ADS)

    Torabifard, Hedieh; Reed, Luke; Berry, Matthew T.; Hein, Jason E.; Menke, Erik; Cisneros, G. Andrés

    2017-10-01

    The development of Li-ion batteries for energy storage has received significant attention. The synthesis and characterization of electrolytes in these batteries are an important component of this development. Ionic liquids (ILs) have been proposed as possible electrolytes in these devices. Thus, the accurate determination of thermophysical properties for these solvents becomes important for determining their applicability as electrolytes. In this contribution, we present the synthesis and experimental/computational characterization of thermodynamic and transport properties of a pyrrolidinium based ionic liquid as a first step to investigate the possible applicability of this class of ILs for Li-ion batteries. A quantum mechanical-based force field with many-body polarizable interactions has been developed for the simulation of spirocyclic pyrrolidinium, [sPyr+], with BF4- and Li+. Molecular dynamics calculations employing intra-molecular polarization predicted larger heat of vaporization and self-diffusion coefficients and smaller densities in comparison with the model without intra-molecular polarization, indicating that the inclusion of this term can significantly effect the inter-ionic interactions. The calculated properties are in good agreement with available experimental data for similar IL pairs and isothermal titration calorimetry data for [sPyr+][BF4-].

  10. Unifying mechanical and thermodynamic descriptions across the thioredoxin protein family.

    PubMed

    Mottonen, James M; Xu, Minli; Jacobs, Donald J; Livesay, Dennis R

    2009-05-15

    We compare various predicted mechanical and thermodynamic properties of nine oxidized thioredoxins (TRX) using a Distance Constraint Model (DCM). The DCM is based on a nonadditive free energy decomposition scheme, where entropic contributions are determined from rigidity and flexibility of structure based on distance constraints. We perform averages over an ensemble of constraint topologies to calculate several thermodynamic and mechanical response functions that together yield quantitative stability/flexibility relationships (QSFR). Applied to the TRX protein family, QSFR metrics display a rich variety of similarities and differences. In particular, backbone flexibility is well conserved across the family, whereas cooperativity correlation describing mechanical and thermodynamic couplings between the residue pairs exhibit distinctive features that readily standout. The diversity in predicted QSFR metrics that describe cooperativity correlation between pairs of residues is largely explained by a global flexibility order parameter describing the amount of intrinsic flexibility within the protein. A free energy landscape is calculated as a function of the flexibility order parameter, and key values are determined where the native-state, transition-state, and unfolded-state are located. Another key value identifies a mechanical transition where the global nature of the protein changes from flexible to rigid. The key values of the flexibility order parameter help characterize how mechanical and thermodynamic response is linked. Variation in QSFR metrics and key characteristics of global flexibility are related to the native state X-ray crystal structure primarily through the hydrogen bond network. Furthermore, comparison of three TRX redox pairs reveals differences in thermodynamic response (i.e., relative melting point) and mechanical properties (i.e., backbone flexibility and cooperativity correlation) that are consistent with experimental data on thermal stabilities and NMR dynamical profiles. The results taken together demonstrate that small-scale structural variations are amplified into discernible global differences by propagating mechanical couplings through the H-bond network.

  11. Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs.

    PubMed

    McCoy, A B; Wright, A; Krousel-Wood, M; Thomas, E J; McCoy, J A; Sittig, D F

    2015-01-01

    Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes.

  12. Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs

    PubMed Central

    Wright, A.; Krousel-Wood, M.; Thomas, E. J.; McCoy, J. A.; Sittig, D. F.

    2015-01-01

    Summary Background Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. Objective We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. Methods We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. Results The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. Conclusions We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes. PMID:26171079

  13. Modified equations, rational solutions, and the Painleve property for the Kadomtsev--Petviashvili and Hirota--Satsuma equations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Weiss, J.

    1985-09-01

    We propose a method for finding the Lax pairs and rational solutions of integrable partial differential equations. That is, when an equation possesses the Painleve property, a Baecklund transformation is defined in terms of an expansion about the singular manifold. This Baecklund transformation obtains (1) a type of modified equation that is formulated in terms of Schwarzian derivatives and (2) a Miura transformation from the modified to the original equation. By linearizing the (Ricati-type) Miura transformation the Lax pair is found. On the other hand, consideration of the (distinct) Baecklund transformations of the modified equations provides a method for themore » iterative construction of rational solutions. This also obtains the Lax pairs for the modified equations. In this paper we apply this method to the Kadomtsev--Petviashvili equation and the Hirota--Satsuma equations.« less

  14. Generalized quantum interference of correlated photon pairs.

    PubMed

    Kim, Heonoh; Lee, Sang Min; Moon, Han Seb

    2015-05-07

    Superposition and indistinguishablility between probability amplitudes have played an essential role in observing quantum interference effects of correlated photons. The Hong-Ou-Mandel interference and interferences of the path-entangled photon number state are of special interest in the field of quantum information technologies. However, a fully generalized two-photon quantum interferometric scheme accounting for the Hong-Ou-Mandel scheme and path-entangled photon number states has not yet been proposed. Here we report the experimental demonstrations of the generalized two-photon interferometry with both the interferometric properties of the Hong-Ou-Mandel effect and the fully unfolded version of the path-entangled photon number state using photon-pair sources, which are independently generated by spontaneous parametric down-conversion. Our experimental scheme explains two-photon interference fringes revealing single- and two-photon coherence properties in a single interferometer setup. Using the proposed interferometric measurement, it is possible to directly estimate the joint spectral intensity of a photon pair source.

  15. Hydrophobic environment is a key factor for the stability of thermophilic proteins.

    PubMed

    Gromiha, M Michael; Pathak, Manish C; Saraboji, Kadhirvel; Ortlund, Eric A; Gaucher, Eric A

    2013-04-01

    The stability of thermophilic proteins has been viewed from different perspectives and there is yet no unified principle to understand this stability. It would be valuable to reveal the most important interactions for designing thermostable proteins for such applications as industrial protein engineering. In this work, we have systematically analyzed the importance of various interactions by computing different parameters such as surrounding hydrophobicity, inter-residue interactions, ion-pairs and hydrogen bonds. The importance of each interaction has been determined by its predicted relative contribution in thermophiles versus the same contribution in mesophilic homologues based on a dataset of 373 protein families. We predict that hydrophobic environment is the major factor for the stability of thermophilic proteins and found that 80% of thermophilic proteins analyzed showed higher hydrophobicity than their mesophilic counterparts. Ion pairs, hydrogen bonds, and interaction energy are also important and favored in 68%, 50%, and 62% of thermophilic proteins, respectively. Interestingly, thermophilic proteins with decreased hydrophobic environments display a greater number of hydrogen bonds and/or ion pairs. The systematic elimination of mesophilic proteins based on surrounding hydrophobicity, interaction energy, and ion pairs/hydrogen bonds, led to correctly identifying 95% of the thermophilic proteins in our analyses. Our analysis was also applied to another, more refined set of 102 thermophilic-mesophilic pairs, which again identified hydrophobicity as a dominant property in 71% of the thermophilic proteins. Further, the notion of surrounding hydrophobicity, which characterizes the hydrophobic behavior of residues in a protein environment, has been applied to the three-dimensional structures of elongation factor-Tu proteins and we found that the thermophilic proteins are enriched with a hydrophobic environment. The results obtained in this work highlight the importance of hydrophobicity as the dominating characteristic in the stability of thermophilic proteins, and we anticipate this will be useful in our attempts to engineering thermostable proteins. Copyright © 2013 Wiley Periodicals, Inc.

  16. Structural and Magnetic Properties of M(mnt)(2) Salts (M = Ni, Pt, Cu) with a Ferrocene-Based Cation, [FcCH(2)N(CH(3))(3)](+). Interplay between M.M and M.S Intermolecular Interactions.

    PubMed

    Pullen, Anthony E.; Faulmann, Christophe; Pokhodnya, Konstantin I.; Cassoux, Patrick; Tokumoto, Madoka

    1998-12-28

    A series of metal bis-mnt complexes (mnt = 1,2-dithiolatomaleonitrile) with the trimethylammonium methylferrocene cation have been synthesized and characterized using X-ray diffraction, magnetic susceptibility, and differential scanning calorimetry measurements. The complexes have the formulas (FcCH(2)NMe(3))[Ni(mnt)(2)] (2), (FcCH(2)NMe(3))[Pt(mnt)(2)] (3), and (FcCH(2)NMe(3))(2)[Cu(mnt)(2)] (4) (where Fc = ferrocene). At 300 K, the crystal structures of 1:1 complexes 2 and 3 are very similar. They consist of pairs of [M(mnt)(2)](-) in a slipped configuration packed in stacks. Each [M(mnt)(2)](-) stack is separated from adjacent stacks by two columns of cations. Within the pairs, the [M(mnt)(2)](-) anions interact via short M.S contacts, while there are no short contacts between the pairs. Complex 4, which has a 2:1 stoichiometry, exhibits a markedly different packing arrangement of the anionic units. Due to the special position of the Cu atom in the asymmetric unit cell, [Cu(mnt)(2)](2)(-) dianions are completely isolated from each other. The magnetic susceptibility behavior of the nickel complex is consistent with the presence of magnetically isolated, antiferromagnetically (AF) coupled [Ni(mnt)(2)](-) pairs with the AF exchange parameter, J = -840 cm(-)(1). The platinum complex undergoes an endothermic structural phase transition (T(p)) at 247 K. Below T(p) its structure is characterized by the formation of magnetically isolated [Pt(mnt)(2)](2)(2)(-) dimers in an eclipsed configuration with short Pt.Pt and S.S contacts between monomers. In the magnetic properties, the structural changes reveal themselves as an abrupt susceptibility drop implying a substantial increase of the AF exchange parameter. A mechanism of the phase transition in the platinum compound is proposed. For compound 4, paramagnetic behavior is observed.

  17. Ramifications of codoping SrI2:Eu with isovalent and aliovalent impurities

    NASA Astrophysics Data System (ADS)

    Feng, Qingguo; Biswas, Koushik

    2016-12-01

    Eu2+ doped SrI2 is an important scintillator having applications in the field of radiation detection. Codoping techniques are often useful to improve the electronic response of such insulators. Using first-principles based approach, we report on the properties of SrI2:Eu and the influence of codoping with aliovalent (Na, Cs) and isovalent (Mg, Ca, Ba, and Sn) impurities. These codopants do not preferably bind with Eu and are expected to remain as isolated impurities in the SrI2 host. As isolated defects they display amphoteric behavior having, in most cases, significant ionization energies of the donor and acceptor levels. Furthermore, the acceptor states of Na, Cs, and Mg can bind with I-vacancy forming charge compensated donor-acceptor pairs. Such pairs may also bind additional holes or electrons similar to the isolated defects. Lack of deep-to-shallow behavior upon codoping and its ramifications will be discussed.

  18. Properties of promoters cloned randomly from the Saccharomyces cerevisiae genome.

    PubMed Central

    Santangelo, G M; Tornow, J; McLaughlin, C S; Moldave, K

    1988-01-01

    Promoters were isolated at random from the genome of Saccharomyces cerevisiae by using a plasmid that contains a divergently arrayed pair of promoterless reporter genes. A comprehensive library was constructed by inserting random (DNase I-generated) fragments into the intergenic region upstream from the reporter genes. Simple in vivo assays for either reporter gene product (alcohol dehydrogenase or beta-galactosidase) allowed the rapid identification of promoters from among these random fragments. Poly(dA-dT) homopolymer tracts were present in three of five randomly cloned promoters. With two exceptions, each RNA start site detected was 40 to 100 base pairs downstream from a TATA element. All of the randomly cloned promoters were capable of activating reporter gene transcription bidirectionally. Interestingly, one of the promoter fragments originated in a region of the S. cerevisiae rDNA spacer; regulated divergent transcription (presumably by RNA polymerase II) initiated in the same region. Images PMID:2847031

  19. Magnetic Field Effects in Hybrid Perovskite Devices

    NASA Astrophysics Data System (ADS)

    Zhang, C.; Sun, D.; Sheng, C.-X.; Zhai, Y.; Mielczarek, K.; Zakhidov, A.; Vardeny, Z. V.

    2015-03-01

    Solar cells based on the organic-inorganic perovskites (CH3NH3PbX3, X =halogen) have reached a remarkable power conversion efficiency approaching 20%, which calls for research studies of the photophysics behind this high device performance. We measured significant magneto-photocurrent (MPC) response in CH3NH3PbI3-xClx photovoltaic cells, in the form of Lorentzian up to field B = 1T. We attribute the MPC(B) response to spin mixing of loosely-bound photogenerated e-h pairs having different g-factor (dubbed `` Δg mechanism''). We verified this mechanism by measuring Δg directly, using the field induced circularly polarized photoluminescence emission at low temperature, along with the photocarriers' lifetime measured by picosecond pump-probe spectroscopy. We conclude that MPC of spin 1/2 e-h pairs provides a promising method for investigating the spin-related properties of photoexcitations in the novel hybrid perovskites.

  20. Applied Meteorology Unit (AMU) Quarterly Report First Quarter FY-14

    NASA Technical Reports Server (NTRS)

    Bauman, William Henry; Crawford, Winifred C.; Shafer, Jaclyn A.; Watson, Leela R.; Huddleston, Lisa L.; Decker, Ryan K.

    2014-01-01

    NASA's LSP and other programs at Vandenberg Air Force Base (VAFB) use wind forecasts issued by the 30th Operational Support Squadron (30 OSS) to determine if they need to limit activities or protect property such as a launch vehicle due to the occurrence of warning level winds at VAFB in California. The 30 OSS tasked the AMU to provide a wind forecasting capability to improve wind warning forecasts and enhance the safety of their customers' operations. This would allow 30 OSS forecasters to evaluate pressure gradient thresholds between pairs of regional observing stations to help determine the onset and duration of warning category winds. Development of such a tool will require that solid relationships exist between wind speed and the pressure gradient of one or more station pairs. As part of this task, the AMU will also create a statistical climatology of meteorological observations from the VAFB wind towers.

  1. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

    PubMed

    Kondo, Jiro; Westhof, Eric

    2011-10-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  2. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes

    PubMed Central

    Kondo, Jiro; Westhof, Eric

    2011-01-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

  3. Applicability of effective pair potentials for active Brownian particles.

    PubMed

    Rein, Markus; Speck, Thomas

    2016-09-01

    We have performed a case study investigating a recently proposed scheme to obtain an effective pair potential for active Brownian particles (Farage et al., Phys. Rev. E 91, 042310 (2015)). Applying this scheme to the Lennard-Jones potential, numerical simulations of active Brownian particles are compared to simulations of passive Brownian particles interacting by the effective pair potential. Analyzing the static pair correlations, our results indicate a limited range of activity parameters (speed and orientational correlation time) for which we obtain quantitative, or even qualitative, agreement. Moreover, we find a qualitatively different behavior for the virial pressure even for small propulsion speeds. Combining these findings we conclude that beyond linear response active particles exhibit genuine non-equilibrium properties that cannot be captured by effective pair interaction alone.

  4. Personal Injury and Property Damage in the Moral Judgments of Children

    ERIC Educational Resources Information Center

    Elkind, David; Dabek, Ruth F.

    1977-01-01

    A total of 72 elementary school students responded to six moral judgment story pairs which corresponded to all the possible combinations of intentionality (intentional/unintentional) and type of damage (personal injury/property damage). (Author/JMB)

  5. Closing loop base pairs in RNA loop-loop complexes: structural behavior, interaction energy and solvation analysis through molecular dynamics simulations.

    PubMed

    Golebiowski, Jérôme; Antonczak, Serge; Fernandez-Carmona, Juan; Condom, Roger; Cabrol-Bass, Daniel

    2004-12-01

    Nanosecond molecular dynamics using the Ewald summation method have been performed to elucidate the structural and energetic role of the closing base pair in loop-loop RNA duplexes neutralized by Mg2+ counterions in aqueous phases. Mismatches GA, CU and Watson-Crick GC base pairs have been considered for closing the loop of an RNA in complementary interaction with HIV-1 TAR. The simulations reveal that the mismatch GA base, mediated by a water molecule, leads to a complex that presents the best compromise between flexibility and energetic contributions. The mismatch CU base pair, in spite of the presence of an inserted water molecule, is too short to achieve a tight interaction at the closing-loop junction and seems to force TAR to reorganize upon binding. An energetic analysis has allowed us to quantify the strength of the interactions of the closing and the loop-loop pairs throughout the simulations. Although the water-mediated GA closing base pair presents an interaction energy similar to that found on fully geometry-optimized structure, the water-mediated CU closing base pair energy interaction reaches less than half the optimal value.

  6. Mesoscopic modeling of DNA denaturation rates: Sequence dependence and experimental comparison

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dahlen, Oda, E-mail: oda.dahlen@ntnu.no; Erp, Titus S. van, E-mail: titus.van.erp@ntnu.no

    Using rare event simulation techniques, we calculated DNA denaturation rate constants for a range of sequences and temperatures for the Peyrard-Bishop-Dauxois (PBD) model with two different parameter sets. We studied a larger variety of sequences compared to previous studies that only consider DNA homopolymers and DNA sequences containing an equal amount of weak AT- and strong GC-base pairs. Our results show that, contrary to previous findings, an even distribution of the strong GC-base pairs does not always result in the fastest possible denaturation. In addition, we applied an adaptation of the PBD model to study hairpin denaturation for which experimentalmore » data are available. This is the first quantitative study in which dynamical results from the mesoscopic PBD model have been compared with experiments. Our results show that present parameterized models, although giving good results regarding thermodynamic properties, overestimate denaturation rates by orders of magnitude. We believe that our dynamical approach is, therefore, an important tool for verifying DNA models and for developing next generation models that have higher predictive power than present ones.« less

  7. Lax Integrability and the Peakon Problem for the Modified Camassa-Holm Equation

    NASA Astrophysics Data System (ADS)

    Chang, Xiangke; Szmigielski, Jacek

    2018-02-01

    Peakons are special weak solutions of a class of nonlinear partial differential equations modelling non-linear phenomena such as the breakdown of regularity and the onset of shocks. We show that the natural concept of weak solutions in the case of the modified Camassa-Holm equation studied in this paper is dictated by the distributional compatibility of its Lax pair and, as a result, it differs from the one proposed and used in the literature based on the concept of weak solutions used for equations of the Burgers type. Subsequently, we give a complete construction of peakon solutions satisfying the modified Camassa-Holm equation in the sense of distributions; our approach is based on solving certain inverse boundary value problem, the solution of which hinges on a combination of classical techniques of analysis involving Stieltjes' continued fractions and multi-point Padé approximations. We propose sufficient conditions needed to ensure the global existence of peakon solutions and analyze the large time asymptotic behaviour whose special features include a formation of pairs of peakons that share asymptotic speeds, as well as Toda-like sorting property.

  8. Autocorrelation descriptor improvements for QSAR: 2DA_Sign and 3DA_Sign

    NASA Astrophysics Data System (ADS)

    Sliwoski, Gregory; Mendenhall, Jeffrey; Meiler, Jens

    2016-03-01

    Quantitative structure-activity relationship (QSAR) is a branch of computer aided drug discovery that relates chemical structures to biological activity. Two well established and related QSAR descriptors are two- and three-dimensional autocorrelation (2DA and 3DA). These descriptors encode the relative position of atoms or atom properties by calculating the separation between atom pairs in terms of number of bonds (2DA) or Euclidean distance (3DA). The sums of all values computed for a given small molecule are collected in a histogram. Atom properties can be added with a coefficient that is the product of atom properties for each pair. This procedure can lead to information loss when signed atom properties are considered such as partial charge. For example, the product of two positive charges is indistinguishable from the product of two equivalent negative charges. In this paper, we present variations of 2DA and 3DA called 2DA_Sign and 3DA_Sign that avoid information loss by splitting unique sign pairs into individual histograms. We evaluate these variations with models trained on nine datasets spanning a range of drug target classes. Both 2DA_Sign and 3DA_Sign significantly increase model performance across all datasets when compared with traditional 2DA and 3DA. Lastly, we find that limiting 3DA_Sign to maximum atom pair distances of 6 Å instead of 12 Å further increases model performance, suggesting that conformational flexibility may hinder performance with longer 3DA descriptors. Consistent with this finding, limiting the number of bonds in 2DA_Sign from 11 to 5 fails to improve performance.

  9. Performance of Language-Coordinated Collective Systems: A Study of Wine Recognition and Description

    PubMed Central

    Zubek, Julian; Denkiewicz, Michał; Dębska, Agnieszka; Radkowska, Alicja; Komorowska-Mach, Joanna; Litwin, Piotr; Stępień, Magdalena; Kucińska, Adrianna; Sitarska, Ewa; Komorowska, Krystyna; Fusaroli, Riccardo; Tylén, Kristian; Rączaszek-Leonardi, Joanna

    2016-01-01

    Most of our perceptions of and engagements with the world are shaped by our immersion in social interactions, cultural traditions, tools and linguistic categories. In this study we experimentally investigate the impact of two types of language-based coordination on the recognition and description of complex sensory stimuli: that of red wine. Participants were asked to taste, remember and successively recognize samples of wines within a larger set in a two-by-two experimental design: (1) either individually or in pairs, and (2) with or without the support of a sommelier card—a cultural linguistic tool designed for wine description. Both effectiveness of recognition and the kinds of errors in the four conditions were analyzed. While our experimental manipulations did not impact recognition accuracy, bias-variance decomposition of error revealed non-trivial differences in how participants solved the task. Pairs generally displayed reduced bias and increased variance compared to individuals, however the variance dropped significantly when they used the sommelier card. The effect of sommelier card reducing the variance was observed only in pairs, individuals did not seem to benefit from the cultural linguistic tool. Analysis of descriptions generated with the aid of sommelier cards shows that pairs were more coherent and discriminative than individuals. The findings are discussed in terms of global properties and dynamics of collective systems when constrained by different types of cultural practices. PMID:27729875

  10. Architecture of Kepler's multi-transiting systems. II. New investigations with twice as many candidates

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fabrycky, Daniel C.; Lissauer, Jack J.; Rowe, Jason F.

    We report on the orbital architectures of Kepler systems having multiple-planet candidates identified in the analysis of data from the first six quarters of Kepler data and reported by Batalha et al. (2013). These data show 899 transiting planet candidates in 365 multiple-planet systems and provide a powerful means to study the statistical properties of planetary systems. Using a generic mass-radius relationship, we find that only two pairs of planets in these candidate systems (out of 761 pairs total) appear to be on Hill-unstable orbits, indicating ∼96% of the candidate planetary systems are correctly interpreted as true systems. We findmore » that planet pairs show little statistical preference to be near mean-motion resonances. We identify an asymmetry in the distribution of period ratios near first-order resonances (e.g., 2:1, 3:2), with an excess of planet pairs lying wide of resonance and relatively few lying narrow of resonance. Finally, based upon the transit duration ratios of adjacent planets in each system, we find that the interior planet tends to have a smaller transit impact parameter than the exterior planet does. This finding suggests that the mode of the mutual inclinations of planetary orbital planes is in the range 1.°0-2.°2, for the packed systems of small planets probed by these observations.« less

  11. Evaluation of an Enhanced Stimulus-Stimulus Pairing Procedure to Increase Early Vocalizations of Children with Autism

    ERIC Educational Resources Information Center

    Esch, Barbara E.; Carr, James E.; Grow, Laura L.

    2009-01-01

    Evidence to support stimulus-stimulus pairing (SSP) in speech acquisition is less than robust, calling into question the ability of SSP to reliably establish automatically reinforcing properties of speech and limiting the procedure's clinical utility for increasing vocalizations. We evaluated the effects of a modified SSP procedure on…

  12. Two-dimensional IR spectroscopy of the anti-HIV agent KP1212 reveals protonated and neutral tautomers that influence pH-dependent mutagenicity

    PubMed Central

    Peng, Chunte Sam; Fedeles, Bogdan I.; Singh, Vipender; Li, Deyu; Amariuta, Tiffany; Essigmann, John M.; Tokmakoff, Andrei

    2015-01-01

    Antiviral drugs designed to accelerate viral mutation rates can drive a viral population to extinction in a process called lethal mutagenesis. One such molecule is 5,6-dihydro-5-aza-2′-deoxycytidine (KP1212), a selective mutagen that induces A-to-G and G-to-A mutations in the genome of replicating HIV. The mutagenic property of KP1212 was hypothesized to originate from its amino–imino tautomerism, which would explain its ability to base pair with either G or A. To test the multiple tautomer hypothesis, we used 2D IR spectroscopy, which offers subpicosecond time resolution and structural sensitivity to distinguish among rapidly interconverting tautomers. We identified several KP1212 tautomers and found that >60% of neutral KP1212 is present in the enol–imino form. The abundant proportion of this traditionally rare tautomer offers a compelling structure-based mechanism for pairing with adenine. Additionally, the pKa of KP1212 was measured to be 7.0, meaning a substantial population of KP1212 is protonated at physiological pH. Furthermore, the mutagenicity of KP1212 was found to increase dramatically at pH <7, suggesting a significant biological role for the protonated KP1212 molecules. Overall, our data reveal that the bimodal mutagenic properties of KP1212 result from its unique shape shifting ability that utilizes both tautomerization and protonation. PMID:25733867

  13. An InGaN/GaN Superlattice to Enhance the Performance of Green LEDs: Exploring the Role of V-Pits.

    PubMed

    Liu, Mengling; Zhao, Jie; Zhou, Shengjun; Gao, Yilin; Hu, Jinfeng; Liu, Xingtong; Ding, Xinghuo

    2018-06-21

    Despite the fact that an InGaN/GaN superlattice (SL) is useful for enhancing the performance of a GaN-based light-emitting diode (LED), its role in improving the efficiency of green LEDs remains an open question. Here, we investigate the influence of a V-pits-embedded InGaN/GaN SL on optical and electrical properties of GaN-based green LEDs. We recorded a sequence of light emission properties of InGaN/GaN multiple quantum wells (MQWs) grown on a 0- and 24-pair InGaN/GaN SL by using scanning electron microscopy (SEM) in combination with a room temperature cathodoluminescence (CL) measurement, which demonstrated the presence of a potential barrier formed by the V-pits around threading dislocations (TDs). We find that an increase in V-pit diameter would lead to the increase of V-pit potential barrier height. Our experimental data suggest that a V-pits-embedded, 24-pair InGaN/GaN SL can effectively suppress the lateral diffusion of carriers into non-recombination centers. As a result, the external quantum efficiency (EQE) of green LEDs is improved by 29.6% at an injection current of 20 mA after implementing the V-pits-embedded InGaN/GaN SL layer. In addition, a lower reverse leakage current was achieved with larger V-pits.

  14. Assessment of amsacrine binding with DNA using UV-visible, circular dichroism and Raman spectroscopic techniques.

    PubMed

    Jangir, Deepak Kumar; Dey, Sanjay Kumar; Kundu, Suman; Mehrotra, Ranjana

    2012-09-03

    Proper understanding of the mechanism of binding of drugs to their targets in cell is a fundamental requirement to develop new drug therapy regimen. Amsacrine is a rationally designed anticancer drug, used to treat leukemia and lymphoma. Binding with cellular DNA is a crucial step in its mechanism of cytotoxicity. Despite numerous studies, DNA binding properties of amsacrine are poorly understood. Its reversible binding with DNA does not permit X-ray crystallography or NMR spectroscopic evaluation of amsacrine-DNA complexes. In the present work, interaction of amsacrine with calf thymus DNA is investigated at physiological conditions. UV-visible, FT-Raman and circular dichroism spectroscopic techniques were employed to determine the binding mode, binding constant, sequence specificity and conformational effects of amsacrine binding to native calf thymus DNA. Our results illustrate that amsacrine interacts with DNA by and large through intercalation between base pairs. Binding constant of the amsacrine-DNA complex was found to be K=1.2±0.1×10(4) M(-1) which is indicative of moderate type of binding of amsacrine to DNA. Raman spectroscopic results suggest that amsacrine has a binding preference of intercalation between AT base pairs of DNA. Minor groove binding is also observed in amsacrine-DNA complexes. These results are in good agreement with in silico investigation of amsacrine binding to DNA and thus provide detailed insight into DNA binding properties of amsacrine, which could ultimately, renders its cytotoxic efficacy. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. Structural investigations and the effect of strain on lead based double perovskites

    NASA Astrophysics Data System (ADS)

    Abbett, Brian; Fennie, Craig J.

    2014-03-01

    The A2 BB' O6 double perovskite structure, in which the B and B' ions are ordered (typically in a rocksalt configuration), provides a versatile platform to realize new properties such as multiferroicity. In particular, compounds with a lone-pair cation on the A-site, such as A=Pb2+, and magnetic B=Co, Mn, and diamagnetic B'= Te, Mo, W, Re, cations have been investigated experimentally, but as of yet none have been found to display ferroelectricity, although several are known to be antiferroelectric. Here we present a first-principles study of the structural and dielectric properties of this family of compounds. We resolve any conflicting reports in the literature as to the ground state structure of compounds and predict the ground state structure when no structural data is available. Additionally, we investigate the effect of epitaxial strain on the structural and magnetic properties.

  16. A novel quantitative electrochemical method to monitor DNA double-strand breaks caused by a DNA cleavage agent at a DNA sensor.

    PubMed

    Banasiak, Anna; Cassidy, John; Colleran, John

    2018-06-01

    To date, DNA cleavage, caused by cleavage agents, has been monitored mainly by gel and capillary electrophoresis. However, these techniques are time-consuming, non-quantitative and require gel stains. In this work, a novel, simple and, importantly, a quantitative method for monitoring the DNA nuclease activity of potential anti-cancer drugs, at a DNA electrochemical sensor, is presented. The DNA sensors were prepared using thiol-modified oligonucleotides that self-assembled to create a DNA monolayer at gold electrode surfaces. The quantification of DNA double-strand breaks is based on calculating the DNA surface coverage, before and after exposure to a DNA cleavage agent. The nuclease properties of a model DNA cleavage agent, copper bis-phenanthroline ([Cu II (phen) 2 ] 2+ ), that can cleave DNA in a Fenton-type reaction, were quantified electrochemically. The DNA surface coverage decreased on average by 21% after subjecting the DNA sensor to a nuclease assay containing [Cu II (phen) 2 ] 2+ , a reductant and an oxidant. This percentage indicates that 6 base pairs were cleaved in the nuclease assay from the immobilised 30 base pair strands. The DNA cleavage can be also induced electrochemically in the absence of a chemical reductant. [Cu II (phen) 2 ] 2+ intercalates between DNA base pairs and, on application of a suitable potential, can be reduced to [Cu I (phen) 2 ] + , with dissolved oxygen acting as the required oxidant. This reduction process is facilitated through DNA strands via long-range electron transfer, resulting in DNA cleavage of 23%. The control measurements for both chemically and electrochemically induced cleavage revealed that DNA strand breaks did not occur under experimental conditions in the absence of [Cu II (phen) 2 ] 2+ . Copyright © 2018 Elsevier B.V. All rights reserved.

  17. Genetic and DNA sequence analysis of the kanamycin resistance transposon Tn903.

    PubMed Central

    Grindley, N D; Joyce, C M

    1980-01-01

    The kanamycin resistance transposon Tn903 consists of a unique region of about 1000 base pairs bounded by a pair of 1050-base-pair inverted repeat sequences. Each repeat contains two Pvu II endonuclease cleavage sites separated by 520 base pairs. We have constructed derivatives of Tn903 in which this 520-base-pair fragment is deleted from one or both repeats. Those derivatives that lack both 520-base-pair fragments cannot transpose, whereas those that lack just one remain transposition proficient. One such transposable derivative, Tn903 delta I, has been selected for further study. We have determined the sequence of the intact inverted repeat. The 18 base pairs at each end are identical and inverted relative to one another, a structure characteristic of insertion sequences. Additional experiments indicate that a single inverted repeat from Tn903 can, in fact, transpose; we propose that this element be called IS903. To correlate the DNA sequence with genetic activities, we have created mutations by inserting a 10-base-pair DNA fragment at several sites within the intact repeat of Tn903 delta 1, and we have examined the effect of such insertions on transposability. The results suggest that IS903 encodes a 307-amino-acid polypeptide (a "transposase") that is absolutely required for transposition of IS903 or Tn903. Images PMID:6261245

  18. Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

    PubMed

    Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

    2018-03-26

    DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Heading-vector navigation based on head-direction cells and path integration.

    PubMed

    Kubie, John L; Fenton, André A

    2009-05-01

    Insect navigation is guided by heading vectors that are computed by path integration. Mammalian navigation models, on the other hand, are typically based on map-like place representations provided by hippocampal place cells. Such models compute optimal routes as a continuous series of locations that connect the current location to a goal. We propose a "heading-vector" model in which head-direction cells or their derivatives serve both as key elements in constructing the optimal route and as the straight-line guidance during route execution. The model is based on a memory structure termed the "shortcut matrix," which is constructed during the initial exploration of an environment when a set of shortcut vectors between sequential pairs of visited waypoint locations is stored. A mechanism is proposed for calculating and storing these vectors that relies on a hypothesized cell type termed an "accumulating head-direction cell." Following exploration, shortcut vectors connecting all pairs of waypoint locations are computed by vector arithmetic and stored in the shortcut matrix. On re-entry, when local view or place representations query the shortcut matrix with a current waypoint and goal, a shortcut trajectory is retrieved. Since the trajectory direction is in head-direction compass coordinates, navigation is accomplished by tracking the firing of head-direction cells that are tuned to the heading angle. Section 1 of the manuscript describes the properties of accumulating head-direction cells. It then shows how accumulating head-direction cells can store local vectors and perform vector arithmetic to perform path-integration-based homing. Section 2 describes the construction and use of the shortcut matrix for computing direct paths between any pair of locations that have been registered in the shortcut matrix. In the discussion, we analyze the advantages of heading-based navigation over map-based navigation. Finally, we survey behavioral evidence that nonhippocampal, heading-based navigation is used in small mammals and humans. Copyright 2008 Wiley-Liss, Inc.

  20. Time-resolved fluorescent properties of 8-vinyl-deoxyadenosine and 2-amino-deoxyribosylpurine exhibit different sensitivity to their opposite base in duplexes.

    PubMed

    Kenfack, Cyril A; Piémont, Etienne; Ben Gaied, Nouha; Burger, Alain; Mély, Yves

    2008-08-14

    8-Vinyl-deoxyadenosine (8VA) has been recently introduced as a fluorescent analogue of adenosine that is less perturbing and less quenched than the well-established 2-amino-deoxyribosylpurine (2AP) probe when inserted in oligonucleotides. To further validate 8VA as a fluorescent substitute of A, we compared the ability of 8VA and 2AP in sequences of the type d(CGT TTT XNX TTT TGC) (with N=8VA or 2AP and X=T and C) to discriminate the nature of the opposite base (Y) in duplexes. For both probes, systematic variations in the amplitudes of the short- and long-lived lifetimes of the fluorescence intensity decays as well as in the amplitude of the fast rotational correlation time of the fluorescence anisotropy decays were observed as a function of the nature of Y. From these parameters, we inferred a stability order 8VA-T > 8VA-G > 8VA-A > 8VA-C, similar to the stability order with the native A base, but different from the stability order with 2AP. Using a combination of molecular mechanics and ab initio calculations, we found that the time-resolved parameters of 8VA, but not the 2AP ones, correlate well with the geometry and the strength of the A-Y base-pairing interaction. This may be rationalized by the smaller structural and electronic perturbations induced by the vinyl group in position 8 as compared to the amino group at position 2. As a consequence, substitution of A by 8VA in a base pair was found to only minimally modify the structure and interaction energy of the base pair. Thus, 8VA can be used as a fluorescent substitute of the natural A, to straightforwardly discriminate the nature of the opposite base. This may find interesting applications notably in the elucidation of the mechanisms and dynamics of the DNA mismatch repair system.

  1. Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

    PubMed

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-08

    The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

  2. Comparable Stability of Hoogsteen and Watson–Crick Base Pairs in Ionic Liquid Choline Dihydrogen Phosphate

    PubMed Central

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-01

    The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194

  3. m1A and m1G Potently Disrupt A-RNA Structure Due to the Intrinsic Instability of Hoogsteen Base Pairs

    PubMed Central

    Zhou, Huiqing; Kimsey, Isaac J.; Nikolova, Evgenia N.; Sathyamoorthy, Bharathwaj; Grazioli, Gianmarc; McSally, James; Bai, Tianyu; Wunderlich, Christoph H.; Kreutz, Christoph; Andricioaei, Ioan; Al-Hashimi, Hashim M.

    2016-01-01

    The B-DNA double helix can dynamically accommodate G–C and A–T base pairs in either Watson-Crick or Hoogsteen configurations. Here, we show that G–C+ and A–U Hoogsteen base pairs are strongly disfavored in A-RNA. As a result, N1-methyl adenosine and N1-methyl guanosine, which occur in DNA as a form of alkylation damage, and in RNA as a posttranscriptional modification, have dramatically different consequences. They create G–C+ and A–U Hoogsteen base pairs in duplex DNA that maintain the structural integrity of the double helix, but block base pairing all together and induce local duplex melting in RNA, providing a mechanism for potently disrupting RNA structure through posttranscriptional modifications. The markedly different propensities to form Hoogsteen base pairs in B-DNA and A-RNA may help meet the opposing requirements of maintaining genome stability on one hand, and dynamically modulating the structure of the epitranscriptome on the other. PMID:27478929

  4. Residual sweeping errors in turbulent particle pair diffusion in a Lagrangian diffusion model.

    PubMed

    Malik, Nadeem A

    2017-01-01

    Thomson, D. J. & Devenish, B. J. [J. Fluid Mech. 526, 277 (2005)] and others have suggested that sweeping effects make Lagrangian properties in Kinematic Simulations (KS), Fung et al [Fung J. C. H., Hunt J. C. R., Malik N. A. & Perkins R. J. J. Fluid Mech. 236, 281 (1992)], unreliable. However, such a conclusion can only be drawn under the assumption of locality. The major aim here is to quantify the sweeping errors in KS without assuming locality. Through a novel analysis based upon analysing pairs of particle trajectories in a frame of reference moving with the large energy containing scales of motion it is shown that the normalized integrated error [Formula: see text] in the turbulent pair diffusivity (K) due to the sweeping effect decreases with increasing pair separation (σl), such that [Formula: see text] as σl/η → ∞; and [Formula: see text] as σl/η → 0. η is the Kolmogorov turbulence microscale. There is an intermediate range of separations 1 < σl/η < ∞ in which the error [Formula: see text] remains negligible. Simulations using KS shows that in the swept frame of reference, this intermediate range is large covering almost the entire inertial subrange simulated, 1 < σl/η < 105, implying that the deviation from locality observed in KS cannot be atributed to sweeping errors. This is important for pair diffusion theory and modeling. PACS numbers: 47.27.E?, 47.27.Gs, 47.27.jv, 47.27.Ak, 47.27.tb, 47.27.eb, 47.11.-j.

  5. The Electrostatic Instability for Realistic Pair Distributions in Blazar/EBL Cascades

    NASA Astrophysics Data System (ADS)

    Vafin, S.; Rafighi, I.; Pohl, M.; Niemiec, J.

    2018-04-01

    This work revisits the electrostatic instability for blazar-induced pair beams propagating through the intergalactic medium (IGM) using linear analysis and PIC simulations. We study the impact of the realistic distribution function of pairs resulting from the interaction of high-energy gamma-rays with the extragalactic background light. We present analytical and numerical calculations of the linear growth rate of the instability for the arbitrary orientation of wave vectors. Our results explicitly demonstrate that the finite angular spread of the beam dramatically affects the growth rate of the waves, leading to the fastest growth for wave vectors quasi-parallel to the beam direction and a growth rate at oblique directions that is only a factor of 2–4 smaller compared to the maximum. To study the nonlinear beam relaxation, we performed PIC simulations that take into account a realistic wide-energy distribution of beam particles. The parameters of the simulated beam-plasma system provide an adequate physical picture that can be extrapolated to realistic blazar-induced pairs. In our simulations, the beam looses only 1% of its energy, and we analytically estimate that the beam would lose its total energy over about 100 simulation times. An analytical scaling is then used to extrapolate the parameters of realistic blazar-induced pair beams. We find that they can dissipate their energy slightly faster by the electrostatic instability than through inverse-Compton scattering. The uncertainties arising from, e.g., details of the primary gamma-ray spectrum are too large to make firm statements for individual blazars, and an analysis based on their specific properties is required.

  6. Spatial Segregation and Aggregation of Ectomycorrhizal and Root-Endophytic Fungi in the Seedlings of Two Quercus Species

    PubMed Central

    Yamamoto, Satoshi; Sato, Hirotoshi; Tanabe, Akifumi S.; Hidaka, Amane; Kadowaki, Kohmei; Toju, Hirokazu

    2014-01-01

    Diverse clades of mycorrhizal and endophytic fungi are potentially involved in competitive or facilitative interactions within host-plant roots. We investigated the potential consequences of these ecological interactions on the assembly process of root-associated fungi by examining the co-occurrence of pairs of fungi in host-plant individuals. Based on massively-parallel pyrosequencing, we analyzed the root-associated fungal community composition for each of the 249 Quercus serrata and 188 Quercus glauca seedlings sampled in a warm-temperate secondary forest in Japan. Pairs of fungi that co-occurred more or less often than expected by chance were identified based on randomization tests. The pyrosequencing analysis revealed that not only ectomycorrhizal fungi but also endophytic fungi were common in the root-associated fungal community. Intriguingly, specific pairs of these ectomycorrhizal and endophytic fungi showed spatially aggregated patterns, suggesting the existence of facilitative interactions between fungi in different functional groups. Due to the large number of fungal pairs examined, many of the observed aggregated/segregated patterns with very low P values (e.g., < 0.005) turned non-significant after the application of a multiple comparison method. However, our overall results imply that the community structures of ectomycorrhizal and endophytic fungi could influence each other through interspecific competitive/facilitative interactions in root. To test the potential of host-plants' control of fungus–fungus ecological interactions in roots, we further examined whether the aggregated/segregated patterns could vary depending on the identity of host plant species. Potentially due to the physiological properties shared between the congeneric host plant species, the sign of hosts' control was not detected in the present study. The pyrosequencing-based randomization analyses shown in this study provide a platform of the high-throughput investigation of fungus–fungus interactions in plant root systems. PMID:24801150

  7. Fluorescence of size-expanded DNA bases: reporting on DNA sequence and structure with an unnatural genetic set.

    PubMed

    Krueger, Andrew T; Kool, Eric T

    2008-03-26

    We recently described the synthesis and helix assembly properties of expanded DNA (xDNA), which contains base pairs 2.4 A larger than natural DNA pairs. This designed genetic set is under study with the goals of mimicking the functions of the natural DNA-based genetic system and of developing useful research tools. Here, we study the fluorescence properties of the four expanded bases of xDNA (xA, xC, xG, xT) and evaluate how their emission varies with changes in oligomer length, composition, and hybridization. Experiments were carried out with short oligomers of xDNA nucleosides conjugated to a DNA oligonucleotide, and we investigated the effects of hybridizing these fluorescent oligomers to short complementary DNAs with varied bases opposite the xDNA bases. As monomer nucleosides, the xDNA bases absorb light in two bands: one at approximately 260 nm (similar to DNA) and one at longer wavelength ( approximately 330 nm). All are efficient violet-blue fluorophores with emission maxima at approximately 380-410 nm and quantum yields (Phifl) of 0.30-0.52. Short homo-oligomers of the xDNA bases (length 1-4 monomers) showed moderate self-quenching except xC, which showed enhancement of Phifl with increasing length. Interestingly, multimers of xA emitted at longer wavelengths (520 nm) as an apparent excimer. Hybridization of an oligonucleotide to the DNA adjacent to the xDNA bases (with the xDNA portion overhanging) resulted in no change in fluorescence. However, addition of one, two, or more DNA bases in these duplexes opposite the xDNA portion resulted in a number of significant fluorescence responses, including wavelength shifts, enhancements, or quenching. The strongest responses were the enhancement of (xG)n emission by hybridization of one or more adenines opposite them, and the quenching of (xT)n and (xC)n emission by guanines opposite. The data suggest multiple ways in which the xDNA bases, both alone and in oligomers, may be useful as tools in biophysical analysis and biotechnological applications.

  8. Interplay between proton-neutron pairing and deformation in self-conjugated medium mass nuclei

    NASA Astrophysics Data System (ADS)

    Gambacurta, Danilo; Lacroix, Denis

    2016-05-01

    We employ a model combining self-consistent mean-field and shell model techniques to study the competition between particle-like and proton-neutron pairing correlations in fp-shell even-even self-conjugate nuclei. Deformation effects are realistically and microscopically described. The resulting approach can give a precise description of pairing correlations and eventually treat the coexistence of different condensate formed of pairs with different total spin/ isospin. The standard BCS calculations are systematically compared with approaches including correlation effects beyond the independent quasi-particle picture. The competition between proton-neutron correlations in the isoscalar and isovector channels is also analyzed, as well as their dependence on the deformation properties.

  9. Evolutionary games combining two or three pair coordinations on a square lattice

    NASA Astrophysics Data System (ADS)

    Király, Balázs; Szabó, György

    2017-10-01

    We study multiagent logit-rule-driven evolutionary games on a square lattice whose pair interactions are composed of a maximal number of nonoverlapping elementary coordination games describing Ising-type interactions between just two of the available strategies. Using Monte Carlo simulations we investigate the macroscopic noise-level-dependent behavior of the two- and three-pair games and the critical properties of the continuous phase transtitions these systems exhibit. The four-strategy game is shown to be equivalent to a system that consists of two independent and identical Ising models.

  10. Evolutionary games combining two or three pair coordinations on a square lattice.

    PubMed

    Király, Balázs; Szabó, György

    2017-10-01

    We study multiagent logit-rule-driven evolutionary games on a square lattice whose pair interactions are composed of a maximal number of nonoverlapping elementary coordination games describing Ising-type interactions between just two of the available strategies. Using Monte Carlo simulations we investigate the macroscopic noise-level-dependent behavior of the two- and three-pair games and the critical properties of the continuous phase transtitions these systems exhibit. The four-strategy game is shown to be equivalent to a system that consists of two independent and identical Ising models.

  11. A Model for the Vortex Pair Associated with a Jet in a Cross Flow

    NASA Technical Reports Server (NTRS)

    Sellers, William L.

    1975-01-01

    A model is presented for the contrarotating vortex pair that is formed by a round, turbulent, subsonic jet directed normally into a uniform, subsonic cross flow. The model consists of a set of algebraic equations that describe the properties of the vortex pair as a function of their location in the jet plume. The parameters of the model are physical characteristics of the vortices such as the vortex strength, spacing, and core size. These parameters are determined by velocity measurements at selective points in the jet plume.

  12. Superconductivity in the Penson-Kolb Model on a Triangular Lattice

    NASA Astrophysics Data System (ADS)

    Ptok, A.; Mierzejewski, M.

    2008-07-01

    We investigate properties of the two-dimensional Penson-Kolb model with repulsive pair hopping interaction. In the case of a bipartite square lattice this interaction may lead to the η-type pairing, when the phase of superconducting order parameter changes from one lattice site to the neighboring one. We show that this interaction may be responsible for the onset of superconductivity also for a triangular lattice. We discuss the spatial dependence of the superconducting order parameter and demonstrate that the total momentum of the paired electrons is determined by the lattice geometry.

  13. Proton conduction in electrolyte made of manganese dioxide for hydrogen gas sensor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Koyanaka, Hideki; Ueda, Yoshikatsu; Takeuchi, K

    2012-01-01

    We propose a network model of oxygen-pairs to store and conduct protons on the surface of manganese dioxide with a weak covalent bond like protons stored in pressured ice. The atomic distances of oxygen-pairs were estimated between 2.57 and 2.60 angstroms in crystal structures of ramsdellite-type and lambda-type manganese dioxides by using protonated samples and inelastic neutron scattering measurements. Good properties for a hydrogen gas sensor using electrolytes made of manganese dioxides that contain such oxygen-pairs were confirmed experimentally.

  14. Entanglement between total intensity and polarization for pairs of coherent states

    NASA Astrophysics Data System (ADS)

    Sanchidrián-Vaca, Carlos; Luis, Alfredo

    2018-04-01

    We examine entanglement between number and polarization, or number and relative phase, in pair coherent states and two-mode squeezed vacuum via linear entropy and covariance criteria. We consider the embedding of the two-mode Hilbert space in a larger space to get a well-defined factorization of the number-phase variables. This can be regarded as a kind of protoentanglement that can be extracted and converted into real particle entanglement via feasible experimental procedures. In particular this reveals interesting entanglement properties of pairs of coherent states.

  15. The limits of the nuclear landscape explored by the relativistic continuum Hartree-Bogoliubov theory

    NASA Astrophysics Data System (ADS)

    Xia, X. W.; Lim, Y.; Zhao, P. W.; Liang, H. Z.; Qu, X. Y.; Chen, Y.; Liu, H.; Zhang, L. F.; Zhang, S. Q.; Kim, Y.; Meng, J.

    2018-05-01

    The ground-state properties of nuclei with 8 ⩽ Z ⩽ 120 from the proton drip line to the neutron drip line have been investigated using the spherical relativistic continuum Hartree-Bogoliubov (RCHB) theory with the relativistic density functional PC-PK1. With the effects of the continuum included, there are totally 9035 nuclei predicted to be bound, which largely extends the existing nuclear landscapes predicted with other methods. The calculated binding energies, separation energies, neutron and proton Fermi surfaces, root-mean-square (rms) radii of neutron, proton, matter, and charge distributions, ground-state spins and parities are tabulated. The extension of the nuclear landscape obtained with RCHB is discussed in detail, in particular for the neutron-rich side, in comparison with the relativistic mean field calculations without pairing correlations and also other predicted landscapes. It is found that the coupling between the bound states and the continuum due to the pairing correlations plays an essential role in extending the nuclear landscape. The systematics of the separation energies, radii, densities, potentials and pairing energies of the RCHB calculations are also discussed. In addition, the α-decay energies and proton emitters based on the RCHB calculations are investigated.

  16. Modeling and experimental validation of angular radiance and distance-dependent radiance in a turbid medium

    NASA Astrophysics Data System (ADS)

    Liu, Lingling; Li, Chenxi; Zhao, Huijuan; Yi, Xi; Gao, Feng; Meng, Wei; Lu, Yiming

    2014-03-01

    Radiance is sensitive to the variations of tissue optical parameters, such as absorption coefficient μa, scattering coefficient μs, and anisotropy factor g. Therefore, similar to fluence, radiance can be used for tissue characterization. Compared with fluence, radiance has the advantage of offering the direction information of light intensity. Taking such advantage, the optical parameters can be determined by rotating the detector through 360 deg with only a single optode pair. Instead of the translation mode used in the fluence-based technologies, the Rotation mode has less invasiveness in the clinical diagnosis. This paper explores a new method to obtain the optical properties by measuring the distribution of light intensity in liquid phantom with only a single optode pair and the detector rotation through 360 deg. The angular radiance and distance-dependent radiance are verified by comparing experimental measurement data with Monte Carlo (MC) simulation for the short source-detector separations and diffusion approximation for the large source-detector separations. Detecting angular radiance with only a single optode pair under a certain source-detection separation will present a way for prostate diagnose and light dose calculation during the photon dynamic therapy (PDT).

  17. Local free energies for the coarse-graining of adsorption phenomena: The interacting pair approximation

    NASA Astrophysics Data System (ADS)

    Pazzona, Federico G.; Pireddu, Giovanni; Gabrieli, Andrea; Pintus, Alberto M.; Demontis, Pierfranco

    2018-05-01

    We investigate the coarse-graining of host-guest systems under the perspective of the local distribution of pore occupancies, along with the physical meaning and actual computability of the coarse-interaction terms. We show that the widely accepted approach, in which the contributions to the free energy given by the molecules located in two neighboring pores are estimated through Monte Carlo simulations where the two pores are kept separated from the rest of the system, leads to inaccurate results at high sorbate densities. In the coarse-graining strategy that we propose, which is based on the Bethe-Peierls approximation, density-independent interaction terms are instead computed according to local effective potentials that take into account the correlations between the pore pair and its surroundings by means of mean-field correction terms without the need for simulating the pore pair separately. Use of the interaction parameters obtained this way allows the coarse-grained system to reproduce more closely the equilibrium properties of the original one. Results are shown for lattice-gases where the local free energy can be computed exactly and for a system of Lennard-Jones particles under the effect of a static confining field.

  18. [Origin of lifting and lowering theory and its herb pair study].

    PubMed

    Guo, Zhao-Juan; Yuan, Yi-Ping; Kong, Li-Ting; Jia, Xiao-Yu; Wang, Ning-Ning; Dai, Ying; Zhai, Hua-Qiang

    2017-08-01

    Lifting and lowering theory is one of the important basis for guiding clinical medication. Through the study of ancient books and literature, we learned that lifting and lowering theory was originated in Huangdi Neijing, practiced more in the Shanghan Zabing Lun, established in Yixue Qiyuan, and developed in Compendium of Materia Medica and now. However, lifting and lowering theory is now mostly stagnated in the theoretical stage, with few experimental research. In the clinical study, the guiding role of lifting and lowering theory to prescriptions?mainly includes opposite?role?of lift and lower medicine property, mutual promotion of lift and lower medicine property, main role of lift medicine property and main role of lower medicine property. Under the guidance of lifting and lowering theory, the herb pair compatibility include herb combination of lift medicine property, herb combination of lift and lower medicine property and herb combination of lower medicine property. Modern biological technology was used in this study to carry out experimental research on the lifting and lowering theory, revealing the scientific connotation of it, which will help to promote clinical rational drug use. Copyright© by the Chinese Pharmaceutical Association.

  19. The evolving energy budget of accretionary wedges

    NASA Astrophysics Data System (ADS)

    McBeck, Jessica; Cooke, Michele; Maillot, Bertrand; Souloumiac, Pauline

    2017-04-01

    The energy budget of evolving accretionary systems reveals how deformational processes partition energy as faults slip, topography uplifts, and layer-parallel shortening produces distributed off-fault deformation. The energy budget provides a quantitative framework for evaluating the energetic contribution or consumption of diverse deformation mechanisms. We investigate energy partitioning in evolving accretionary prisms by synthesizing data from physical sand accretion experiments and numerical accretion simulations. We incorporate incremental strain fields and cumulative force measurements from two suites of experiments to design numerical simulations that represent accretionary wedges with stronger and weaker detachment faults. One suite of the physical experiments includes a basal glass bead layer and the other does not. Two physical experiments within each suite implement different boundary conditions (stable base versus moving base configuration). Synthesizing observations from the differing base configurations reduces the influence of sidewall friction because the force vector produced by sidewall friction points in opposite directions depending on whether the base is fixed or moving. With the numerical simulations, we calculate the energy budget at two stages of accretion: at the maximum force preceding the development of the first thrust pair, and at the minimum force following the development of the pair. To identify the appropriate combination of material and fault properties to apply in the simulations, we systematically vary the Young's modulus and the fault static and dynamic friction coefficients in numerical accretion simulations, and identify the set of parameters that minimizes the misfit between the normal force measured on the physical backwall and the numerically simulated force. Following this derivation of the appropriate material and fault properties, we calculate the components of the work budget in the numerical simulations and in the simulated increments of the physical experiments. The work budget components of the physical experiments are determined from backwall force measurements and incremental velocity fields calculated via digital image correlation. Comparison of the energy budget preceding and following the development of the first thrust pair quantifies the tradeoff of work done in distributed deformation and work expended in frictional slip due to the development of the first backthrust and forethrust. In both the numerical and physical experiments, after the pair develops internal work decreases at the expense of frictional work, which increases. Despite the increase in frictional work, the total external work of the system decreases, revealing that accretion faulting leads to gains in efficiency. Comparison of the energy budget of the accretion experiments and simulations with the strong and weak detachments indicate that when the detachment is strong, the total energy consumed in frictional sliding and internal deformation is larger than when the detachment is relatively weak.

  20. Base Pair Opening in a Deoxynucleotide Duplex Containing a cis-syn Thymine Cyclobutane Dimer Lesion

    PubMed Central

    Wenke, Belinda B.; Huiting, Leah N.; Frankel, Elisa B.; Lane, Benjamin F.; Núñez, Megan E.

    2014-01-01

    The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair Kop. In the normal duplex Kop decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a Kop of 8×10−7. In contrast, base pair opening at the 5’T of the thymine dimer is facile. The 5’T of the dimer has the largest equilibrium constant (Kop =3×10−4) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3’T of the dimer is much more stable than by the 5’T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5’ side more than on the 3’ side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions. PMID:24328089

  1. Planar Poincare chart - A planar graphic representation of the state of light polarization

    NASA Technical Reports Server (NTRS)

    Tedjojuwono, Ken K.; Hunter, William W., Jr.; Ocheltree, Stewart L.

    1989-01-01

    The planar Poincare chart, which represents the complete planar equivalence of the Poincare sphere, is proposed. The four sets of basic lines are drawn on two separate charts for the generalization and convenience of reading the scale. The chart indicates the rotation of the principal axes of linear birefringent material. The relationships between parameters of the two charts are given as 2xi-2phi (orientation angle of the major axis-ellipticity angle) pair and 2alpha-delta (angle of amplitude ratio-phase difference angle) pair. The results are useful for designing and analyzing polarization properties of optical components with birefringent properties.

  2. Electronic structure and pair potential energy analysis of 4-n-methoxy-4′-cyanobiphenyl: A nematic liquid crystal

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sharma, Dipendra, E-mail: d-11sharma@rediffmail.com; Tiwari, S. N., E-mail: sntiwari123@rediffmail.com; Dwivedi, M. K., E-mail: dwivedi-ji@gmail.com

    2016-05-06

    Electronic structure properties of 4-n-methoxy-4′-cyanobiphenyl, a pure nematic liquid crystal have been examined using an ab‒initio, HF/6‒31G(d,p) technique with GAMESS program. Conformational and charge distribution analysis have been carried out. MEP, HOMO and LUMO surfaces have been scanned. Ionization potential, electron affinity, electronegativity, global hardness and softness of the liquid crystal molecule have been calculated. Further, stacking, side by side and end to end interactions between a molecular pair have been evaluated. Results have been used to elucidate the physico-chemical and liquid crystalline properties of the system.

  3. Effect of Sb content on the physical properties of Ge-Se-Te chalcogenide glasses

    NASA Astrophysics Data System (ADS)

    Vashist, Priyanka; Anjali, Patial, Balbir Singh; Thakur, Nagesh

    2018-05-01

    In the present study, the bulk as-(Se80Te20)94-xGe6Sbx (x = 0, 1, 2, 4, 6, 8) glasses were synthesized using melt quenching technique. The physical properties viz coordination number, lone pair of electrons, number of constraints, glass transition temperature, mean bond energy, cohesive energy, electro-negativity and average heat of atomization of the investigated composition are reported and discussed. It is inferred that on increasing Sb content; average coordination number, average number of constraints, mean bond energy, cohesive energy and glass transition temperature increases but lone pair of electrons, average heat of atomization and deviation of stoichiometry decreases.

  4. The development of adaptive memory: Young children show enhanced retention of animacy-related information.

    PubMed

    Aslan, Alp; John, Thomas

    2016-12-01

    Previous developmental work has indicated that animacy is a foundational ontogenetic category that is given priority already early in life. Here, we investigated whether such priority is also present in children's episodic memory, examining whether young children show enhanced retention of animacy-related information. Kindergartners and younger and older elementary school children were presented with fictitious (non)words (e.g., BULA, LAFE) paired with properties characteristic of humans (e.g., "likes music"), (nonhuman) animals (e.g., "builds nests"), and inanimate things (e.g., "has four edges") and were asked to rate the animacy status of each nonword. After a retention interval, a surprise recognition test for the nonwords was administered. We found enhanced recognition of nonwords paired with human and animal properties compared with (the same) nonwords paired with inanimate properties. The size of this animacy advantage was comparable across age groups, suggesting developmental invariance of the advantage over the age range examined (i.e., 4-11years). The results support a functional-evolutionary view on memory, suggesting that already young children's memory is "tuned" to process and retain animacy. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Theory of superconductivity with non-Hermitian and parity-time reversal symmetric Cooper pairing symmetry

    NASA Astrophysics Data System (ADS)

    Ghatak, Ananya; Das, Tanmoy

    2018-01-01

    Recently developed parity (P ) and time-reversal (T ) symmetric non-Hermitian systems govern a rich variety of new and characteristically distinct physical properties, which may or may not have a direct analog in their Hermitian counterparts. We study here a non-Hermitian, PT -symmetric superconducting Hamiltonian that possesses a real quasiparticle spectrum in the PT -unbroken region of the Brillouin zone. Within a single-band mean-field theory, we find that real quasiparticle energies are possible when the superconducting order parameter itself is either Hermitian or anti-Hermitian. Within the corresponding Bardeen-Cooper-Schrieffer (BCS) theory, we find that several properties are characteristically distinct and novel in the non-Hermitian pairing case than its Hermitian counterpart. One of our significant findings is that while a Hermitian superconductor gives a second-order phase transition, the non-Hermitian one produces a robust first-order phase transition. The corresponding thermodynamic properties and the Meissner effect are also modified accordingly. Finally, we discuss how such a PT -symmetric pairing can emerge from an antisymmetric potential, such as the Dzyloshinskii-Moriya interaction, but with an external bath, or complex potential, among others.

  6. Measurements of top quark properties in top pair production and decay at the LHC using the CMS detector

    DOE PAGES

    Jindariani, Sergo

    2016-05-31

    Measurements are presented of the properties of top quarks in pair production and decay from proton-proton collisions at the LHC. The data were collected at centre-of-mass energies of 7 and 8 TeV by the CMS experiment during the years 2011 and 2012. The top quark-antiquark charge asymmetry is measured using the difference of the absolute rapidities of the reconstructed top and anti-top kinematics, as well as from distributions of the top quark decay products. The measurements are performed in the decay channels of the tt¯ pair into both one and two leptons in the final state. The polarization of topmore » quarks and top pair spin correlations are measured from the angular distributions of top quark decay products. The W-boson helicity fractions and angular asymmetries are extracted and limits on anomalous contributions to the Wtb vertex are determined. The flavor content in top-quark pair events is measured using the fraction of top quarks decaying into a W-boson and a b -quark relative to all top quark decays, R=B(t→Wb)/B(t→Wq) , and the result is used to determine the CKM matrix element Vtb as well as the width of the top quark resonance. Finally, all of the results are found to be in good agreement with standard model predictions.« less

  7. The Wear Behavior of Textured Steel Sliding against Polymers

    PubMed Central

    Wang, Meiling; Zhang, Changtao; Wang, Xiaolei

    2017-01-01

    Artificially fabricated surface textures can significantly improve the friction and wear resistance of a tribological contact. Recently, this surface texturing technique has been applied to polymer materials to improve their tribological performance. However, the wear behavior of textured tribo-pairs made of steel and polymer materials has been less thoroughly investigated and is not well understood; thus, it needs further research. The aim of this study is to investigate the wear properties of tribological contacts made of textured stainless steel against polymer surfaces. Three polymer materials were selected in this study, namely, ultrahigh molecular weight polyethylene (UHMWPE), polyoxymethylene (POM) and (polyetheretherketone) PEEK. Wear tests were operated through a ring-on-plane mode. The results revealed that the texture features and material properties affected the wear rates and friction coefficients of the textured tribo-pairs. In general, PEEK/textured steel achieved the lowest wear rate among the three types of tribo-pairs investigated. Energy dispersive x-ray spectroscopy (EDX) analysis revealed that the elements of C and O on the contacting counterfaces varied with texture features and indicated different wear behavior. Experimental and simulated results showed differences in the stress distribution around the dimple edge, which may influence wear performance. Wear debris with different surface morphologies were found for tribo-pairs with varying texture features. This study has increased the understanding of the wear behavior of tribo-pairs between textured stainless steel and polymer materials. PMID:28772688

  8. Stacking interactions and DNA intercalation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Dr. Shen; Cooper, Valentino R; Thonhauser, Prof. Timo

    2009-01-01

    The relationship between stacking interactions and the intercalation of proflavine and ellipticine within DNA is investigated using a nonempirical van der Waals density functional for the correlation energy. Our results, employing a binary stack model, highlight fundamental, qualitative differences between base-pair base-pair interactions and that of the stacked intercalator base pair system. Most notable result is the paucity of torque which so distinctively defines the Twist of DNA. Surprisingly, this model, when combined with a constraint on the twist of the surrounding base-pair steps to match the observed unwinding of the sugar-phosphate backbone, was sufficient for explaining the experimentally observedmore » proflavine intercalator configuration. Our extensive mapping of the potential energy surface of base-pair intercalator interactions can provide valuable information for future nonempirical studies of DNA intercalation dynamics.« less

  9. Photo-Responsive Soft Ionic Crystals: Ion-Pairing Assemblies of Azobenzene Carboxylates.

    PubMed

    Yamakado, Ryohei; Hara, Mitsuo; Nagano, Shusaku; Seki, Takahiro; Maeda, Hiromitsu

    2017-07-12

    This report delineates the design and synthesis of negatively charged azobenzene derivatives that form photo-responsive ion-pairing assemblies. The azobenzene carboxylates possessing aliphatic chains were prepared as photo-responsive anions that promote the formation of ion-pairing dimension-controlled assemblies, including mesophases, when used in conjunction with a tetrabutylammonium (TBA) cation. The photo-responsive properties of the ion pairs and the precursory carboxylic acids in the bulk state were examined by polarized optical microscopy (POM) and X-ray diffraction (XRD), demonstrating that liquid crystal (LC)-liquid and crystal-liquid phase transitions occurred, depending on the number and lengths of the aliphatic chains of each assembly. An ion pair exhibited photo-induced crystal-crystal phase transitions upon switching between two irradiation wavelengths (365/436 nm). © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. General Model of Photon-Pair Detection with an Image Sensor

    NASA Astrophysics Data System (ADS)

    Defienne, Hugo; Reichert, Matthew; Fleischer, Jason W.

    2018-05-01

    We develop an analytic model that relates intensity correlation measurements performed by an image sensor to the properties of photon pairs illuminating it. Experiments using an effective single-photon counting camera, a linear electron-multiplying charge-coupled device camera, and a standard CCD camera confirm the model. The results open the field of quantum optical sensing using conventional detectors.

  11. A homogeneous sample of binary galaxies: Basic observational properties

    NASA Technical Reports Server (NTRS)

    Karachentsev, I. D.

    1990-01-01

    A survey of optical characteristics for 585 binary systems, satisfying a condition of apparent isolation on the sky, is presented. Influences of various selection effects distorting the average parameters of the sample are noted. The pair components display mutual similarity over all the global properties: luminosity, diameter, morphological type, mass-to-luminosity ratio, angular momentum etc., which is not due only to selection effects. The observed correlations must be caused by common origin of pair members. Some features (nuclear activity, color index) could acquire similarity during synchronous evolution of double galaxies. Despite the observed isolation, the sample of double systems is seriously contaminated by accidental pairs, and also by members of groups and clusters. After removing false pairs estimates of orbital mass-to-luminosity ratio range from 0 to 30 f(solar), with the mean value (7.8 plus or minus 0.7) f(solar). Binary galaxies possess nearly circular orbits with a typical eccentrity e = 0.25, probably resulting from evolutionary selection driven by component mergers under dynamical friction. The double-galaxy population with space abundance 0.12 plus or minus 0.02 and characteristic merger timescale 0.2 H(exp -1) may significantly influence the rate of dynamical evolution of galaxies.

  12. The Dewar photoproduct of thymidylyl(3′→5′)- thymidine (Dewar product) exhibits mutagenic behavior in accordance with the “A rule”

    PubMed Central

    Lee, Joon-Hwa; Bae, Sung-Hun; Choi, Byong-Seok

    2000-01-01

    In contrast to the highly mutagenic pyrimidine(6–4)pyrimidone photoproduct, its Dewar valence isomer (Dewar product) has low mutagenic potential and produces a broad range of mutations [LeClerc, J. E., Borden, A. & Lawrence, C. W. (1991) Proc. Natl. Acad. Sci. USA 88, 9685–9689]. To determine the origin of the mutagenic property of the Dewar product, we used experimental NMR restraints and molecular dynamics to determine the solution structure of a Dewar-lesion DNA decamer duplex. This DNA decamer duplex (DW/GA duplex) contains a mismatched base pair between the 3′ T residue of the Dewar lesion (T6) and an opposed G residue (G15). The 3′ T (T6) of the Dewar lesion formed stable hydrogen bonds with the opposing G15 residue. However, the helical bending and unwinding angles of the DW/GA duplex were much larger than those of a second duplex that contains the Dewar lesion and opposing A15 and A16 residues (DW/AA duplex). The DW/GA duplex showed poorer stacking interactions at the two bases of the Dewar product and at the adjacent A7⋅T14 base pair than did the DW/AA duplex. These structural features imply that no thermal stability or conformational benefit is obtained by incorporating a G instead of an A opposite the 3′ T of the Dewar lesion. These properties may thus facilitate the preferential incorporation of an A in accordance with the A rule during translesion replication and lead to the low frequency of 3′ T→C mutations observed at this site. PMID:10758155

  13. Development and evaluation of a crowdsourcing methodology for knowledge base construction: identifying relationships between clinical problems and medications

    PubMed Central

    Wright, Adam; Laxmisan, Archana; Ottosen, Madelene J; McCoy, Jacob A; Butten, David; Sittig, Dean F

    2012-01-01

    Objective We describe a novel, crowdsourcing method for generating a knowledge base of problem–medication pairs that takes advantage of manually asserted links between medications and problems. Methods Through iterative review, we developed metrics to estimate the appropriateness of manually entered problem–medication links for inclusion in a knowledge base that can be used to infer previously unasserted links between problems and medications. Results Clinicians manually linked 231 223 medications (55.30% of prescribed medications) to problems within the electronic health record, generating 41 203 distinct problem–medication pairs, although not all were accurate. We developed methods to evaluate the accuracy of the pairs, and after limiting the pairs to those meeting an estimated 95% appropriateness threshold, 11 166 pairs remained. The pairs in the knowledge base accounted for 183 127 total links asserted (76.47% of all links). Retrospective application of the knowledge base linked 68 316 medications not previously linked by a clinician to an indicated problem (36.53% of unlinked medications). Expert review of the combined knowledge base, including inferred and manually linked problem–medication pairs, found a sensitivity of 65.8% and a specificity of 97.9%. Conclusion Crowdsourcing is an effective, inexpensive method for generating a knowledge base of problem–medication pairs that is automatically mapped to local terminologies, up-to-date, and reflective of local prescribing practices and trends. PMID:22582202

  14. Using Sphinx to Improve Onion Routing Circuit Construction

    NASA Astrophysics Data System (ADS)

    Kate, Aniket; Goldberg, Ian

    This paper presents compact message formats for onion routing circuit construction using the Sphinx methodology developed for mixes. We significantly compress the circuit construction messages for three onion routing protocols that have emerged as enhancements to the Tor anonymizing network; namely, Tor with predistributed Diffie-Hellman values, pairing-based onion routing, and certificateless onion routing. Our new circuit constructions are also secure in the universal composability framework, a property that was missing from the original constructions. Further, we compare the performance of our schemes with their older counterparts as well as with each other.

  15. Proactive schema based link lifetime estimation and connectivity ratio.

    PubMed

    Bachir, Bouamoud; Ali, Ouacha; Ahmed, Habbani; Mohamed, Elkoutbi

    2014-01-01

    The radio link between a pair of wireless nodes is affected by a set of random factors such as transmission range, node mobility, and environment conditions. The properties of such radio links are continually experienced when nodes status balances between being reachable and being unreachable; thereby on completion of each experience the statistical distribution of link lifetime is updated. This aspect is emphasized in mobile ad hoc network especially when it is deployed in some fields that require intelligent processing of data information such as aerospace domain.

  16. Local Sampling of the Wigner Function at Telecom Wavelength with Loss-Tolerant Detection of Photon Statistics.

    PubMed

    Harder, G; Silberhorn, Ch; Rehacek, J; Hradil, Z; Motka, L; Stoklasa, B; Sánchez-Soto, L L

    2016-04-01

    We report the experimental point-by-point sampling of the Wigner function for nonclassical states created in an ultrafast pulsed type-II parametric down-conversion source. We use a loss-tolerant time-multiplexed detector based on a fiber-optical setup and a pair of photon-number-resolving avalanche photodiodes. By capitalizing on an expedient data-pattern tomography, we assess the properties of the light states with outstanding accuracy. The method allows us to reliably infer the squeezing of genuine two-mode states without any phase reference.

  17. Sediment Grain-Size and Loss-on-Ignition Analyses from 2002 Englebright Lake Coring and Sampling Campaigns

    USGS Publications Warehouse

    Snyder, Noah P.; Allen, James R.; Dare, Carlin; Hampton, Margaret A.; Schneider, Gary; Wooley, Ryan J.; Alpers, Charles N.; Marvin-DiPasquale, Mark C.

    2004-01-01

    This report presents sedimentologic data from three 2002 sampling campaigns conducted in Englebright Lake on the Yuba River in northern California. This work was done to assess the properties of the material deposited in the reservoir between completion of Englebright Dam in 1940 and 2002, as part of the Upper Yuba River Studies Program. Included are the results of grain-size-distribution and loss-on-ignition analyses for 561 samples, as well as an error analysis based on replicate pairs of subsamples.

  18. Highly luminescent and color-tunable salicylate ionic liquids

    DOE PAGES

    Campbell, Paul S.; Yang, Mei; Pitz, Demian; ...

    2014-03-11

    High quantum yields of up to 40.5 % can be achieved in salicylate-bearing ionic liquids. A range of these ionic liquids have been synthesized and their photoluminescent properties studied in detail. The differences noted can be related back to the structure of the ionic liquid cation and possible interionic interactions. It is found that shifts of emission, particularly in the pyridinium-based ionic liquids, can be related to cation–anion pairing interactions. Furthermore, facile and controlled emission color mixing is demonstrated through combining different ILs, with emission colors ranging from blue to yellow.

  19. AB INITIO Molecular Dynamics Simulations on Local Structure and Electronic Properties in Liquid MgxBi1-x Alloys

    NASA Astrophysics Data System (ADS)

    Hao, Qing-Hai; You, Yu-Wei; Kong, Xiang-Shan; Liu, C. S.

    2013-03-01

    The microscopic structure and dynamics of liquid MgxBi1-x(x = 0.5, 0.6, 0.7) alloys together with pure liquid Mg and Bi metals were investigated by means of ab initio molecular dynamics simulations. We present results of structure properties including pair correlation function, structural factor, bond-angle distribution function and bond order parameter, and their composition dependence. The dynamical and electronic properties have also been studied. The structure factor and pair correlation function are in agreement with the available experimental data. The calculated bond-angle distribution function and bond order parameter suggest that the stoichiometric composition Mg3Bi2 exhibits a different local structure order compared with other concentrations, which help us understand the appearance of the minimum electronic conductivity at this composition observed in previous experiments.

  20. [Convergent origin of repeats in genes coding for globular proteins. An analysis of the factors determining the presence of inverted and symmetrical repeats].

    PubMed

    Solov'ev, V V; Kel', A E; Kolchanov, N A

    1989-01-01

    The factors, determining the presence of inverted and symmetrical repeats in genes coding for globular proteins, have been analysed. An interesting property of genetical code has been revealed in the analysis of symmetrical repeats: the pairs of symmetrical codons corresponded to pairs of amino acids with mostly similar physical-chemical parameters. This property may explain the presence of symmetrical repeats and palindromes only in genes coding for beta-structural proteins-polypeptides, where amino acids with similar physical-chemical properties occupy symmetrical positions. A stochastic model of evolution of polynucleotide sequences has been used for analysis of inverted repeats. The modelling demonstrated that only limiting of sequences (uneven frequencies of used codons) is enough for arising of nonrandom inverted repeats in genes.

  1. Ion-Pairing Contribution to the Liposomal Transport of Topotecan as Revealed by Mechanistic Modeling.

    PubMed

    Fugit, Kyle D; Anderson, Bradley D

    2017-04-01

    Actively loaded liposomal formulations of anticancer agents have been widely explored due to their high drug encapsulation efficiencies and prolonged drug retention. Mathematical models to predict and optimize drug loading and release kinetics from these nanoparticle formulations would be useful in their development and may allow researchers to tune release profiles. Such models must account for the driving forces as influenced by the physicochemical properties of the drug and the microenvironment, and the liposomal barrier properties. This study employed mechanistic modeling to describe the active liposomal loading and release kinetics of the anticancer agent topotecan (TPT). The model incorporates ammonia transport resulting in generation of a pH gradient, TPT dimerization, TPT lactone ring-opening and -closing interconversion kinetics, chloride transport, and transport of TPT-chloride ion-pairs to describe the active loading and release kinetics of TPT in the presence of varying chloride concentrations. Model-based predictions of the kinetics of active loading at varying loading concentrations of TPT and release under dynamic dialysis conditions were in reasonable agreement with experiments. These findings identify key attributes to consider in optimizing and predicting loading and release of liposomal TPT that may also be applicable to liposomal formulations of other weakly basic pharmaceuticals. Copyright © 2017 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

  2. Resolving dual binding conformations of cellulosome cohesin-dockerin complexes using single-molecule force spectroscopy

    PubMed Central

    Jobst, Markus A; Milles, Lukas F; Schoeler, Constantin; Ott, Wolfgang; Fried, Daniel B; Bayer, Edward A; Gaub, Hermann E; Nash, Michael A

    2015-01-01

    Receptor-ligand pairs are ordinarily thought to interact through a lock and key mechanism, where a unique molecular conformation is formed upon binding. Contrary to this paradigm, cellulosomal cohesin-dockerin (Coh-Doc) pairs are believed to interact through redundant dual binding modes consisting of two distinct conformations. Here, we combined site-directed mutagenesis and single-molecule force spectroscopy (SMFS) to study the unbinding of Coh:Doc complexes under force. We designed Doc mutations to knock out each binding mode, and compared their single-molecule unfolding patterns as they were dissociated from Coh using an atomic force microscope (AFM) cantilever. Although average bulk measurements were unable to resolve the differences in Doc binding modes due to the similarity of the interactions, with a single-molecule method we were able to discriminate the two modes based on distinct differences in their mechanical properties. We conclude that under native conditions wild-type Doc from Clostridium thermocellum exocellulase Cel48S populates both binding modes with similar probabilities. Given the vast number of Doc domains with predicteddual binding modes across multiple bacterial species, our approach opens up newpossibilities for understanding assembly and catalytic properties of a broadrange of multi-enzyme complexes. DOI: http://dx.doi.org/10.7554/eLife.10319.001 PMID:26519733

  3. A structural determinant in the uracil DNA glycosylase superfamily for the removal of uracil from adenine/uracil base pairs

    PubMed Central

    Lee, Dong-Hoon; Liu, Yinling; Lee, Hyun-Wook; Xia, Bo; Brice, Allyn R.; Park, Sung-Hyun; Balduf, Hunter; Dominy, Brian N.; Cao, Weiguo

    2015-01-01

    The uracil DNA glycosylase superfamily consists of several distinct families. Family 2 mismatch-specific uracil DNA glycosylase (MUG) from Escherichia coli is known to exhibit glycosylase activity on three mismatched base pairs, T/U, G/U and C/U. Family 1 uracil N-glycosylase (UNG) from E. coli is an extremely efficient enzyme that can remove uracil from any uracil-containing base pairs including the A/U base pair. Here, we report the identification of an important structural determinant that underlies the functional difference between MUG and UNG. Substitution of a Lys residue at position 68 with Asn in MUG not only accelerates the removal of uracil from mismatched base pairs but also enables the enzyme to gain catalytic activity on A/U base pairs. Binding and kinetic analysis demonstrate that the MUG-K68N substitution results in enhanced ground state binding and transition state interactions. Molecular modeling reveals that MUG-K68N, UNG-N123 and family 5 Thermus thermophiles UDGb-A111N can form bidentate hydrogen bonds with the N3 and O4 moieties of the uracil base. Genetic analysis indicates the gain of function for A/U base pairs allows the MUG-K68N mutant to remove uracil incorporated into the genome during DNA replication. The implications of this study in the origin of life are discussed. PMID:25550433

  4. Structural features of the DNA hairpin d(ATCCTA-GTTA-TAGGAT): formation of a G-A base pair in the loop.

    PubMed Central

    van Dongen, M J; Mooren, M M; Willems, E F; van der Marel, G A; van Boom, J H; Wijmenga, S S; Hilbers, C W

    1997-01-01

    The three-dimensional structure of the hairpin formed by d(ATCCTA-GTTA-TAGGAT) has been determined by means of two-dimensional NMR studies, distance geometry and molecular dynamics calculations. The first and the last residues of the tetraloop of this hairpin form a sheared G-A base pair on top of the six Watson-Crick base pairs in the stem. The glycosidic torsion angles of the guanine and adenine residues in the G-A base pair reside in the anti and high- anti domain ( approximately -60 degrees ) respectively. Several dihedral angles in the loop adopt non-standard values to accommodate this base pair. The first and second residue in the loop are stacked in a more or less normal helical fashion; the fourth loop residue also stacks upon the stem, while the third residue is directed away from the loop region. The loop structure can be classified as a so-called type-I loop, in which the bases at the 5'-end of the loop stack in a continuous fashion. In this situation, loop stability is unlikely to depend heavily on the nature of the unpaired bases in the loop. Moreover, the present study indicates that the influence of the polarity of a closing A.T pair is much less significant than that of a closing C.G base pair. PMID:9092659

  5. Pairing tone trains with vagus nerve stimulation induces temporal plasticity in auditory cortex.

    PubMed

    Shetake, Jai A; Engineer, Navzer D; Vrana, Will A; Wolf, Jordan T; Kilgard, Michael P

    2012-01-01

    The selectivity of neurons in sensory cortex can be modified by pairing neuromodulator release with sensory stimulation. Repeated pairing of electrical stimulation of the cholinergic nucleus basalis, for example, induces input specific plasticity in primary auditory cortex (A1). Pairing nucleus basalis stimulation (NBS) with a tone increases the number of A1 neurons that respond to the paired tone frequency. Pairing NBS with fast or slow tone trains can respectively increase or decrease the ability of A1 neurons to respond to rapidly presented tones. Pairing vagus nerve stimulation (VNS) with a single tone alters spectral tuning in the same way as NBS-tone pairing without the need for brain surgery. In this study, we tested whether pairing VNS with tone trains can change the temporal response properties of A1 neurons. In naïve rats, A1 neurons respond strongly to tones repeated at rates up to 10 pulses per second (pps). Repeatedly pairing VNS with 15 pps tone trains increased the temporal following capacity of A1 neurons and repeatedly pairing VNS with 5 pps tone trains decreased the temporal following capacity of A1 neurons. Pairing VNS with tone trains did not alter the frequency selectivity or tonotopic organization of auditory cortex neurons. Since VNS is well tolerated by patients, VNS-tone train pairing represents a viable method to direct temporal plasticity in a variety of human conditions associated with temporal processing deficits. Copyright © 2011 Elsevier Inc. All rights reserved.

  6. Dependence of Long Bone Flexural Properties on Bone Mineral Distribution

    NASA Technical Reports Server (NTRS)

    Katz, BethAnn; Cleek, Tammy M.; Whalen, Robert T.; Connolly, James P. (Technical Monitor)

    1995-01-01

    The objective of this study is to assess whether a non-invasive determination of long bone cross-sectional areal properties using bone densitometry accurately estimates true long bone flexural properties. In this study, section properties of two pairs of human female embalmed tibiae were compared using two methods: special analysis of bone densitometry data, and experimental determination of flexural regidities from bone surface strain measurements during controlled loading.

  7. N(4)C-ethyl-N(4)C cross-linked DNA: synthesis and characterization of duplexes with interstrand cross-links of different orientations.

    PubMed

    Noronha, Anne M; Noll, David M; Wilds, Christopher J; Miller, Paul S

    2002-01-22

    The preparation and physical properties of short DNA duplexes that contain a N(4)C-ethyl-N(4)C interstrand cross-link are described. Duplexes that contain an interstrand cross-link between mismatched C-C residues and duplexes in which the C residues of a -CG- or -GC- step are linked to give "staggered" interstrand cross-links were prepared using a novel N(4)C-ethyl-N(4)C phosphoramidite reagent. Duplexes with the C-C mismatch cross-link have UV thermal transition temperatures that are 25 degrees C higher than the melting temperatures of control duplexes in which the cross-link is replaced with a G-C base pair. It appears that this cross-link stabilizes adjacent base pairs and does not perturb the structure of the helix, a conclusion that is supported by the CD spectrum of this duplex and by molecular models. An even higher level of stabilization, 49 degrees C, is seen with the duplex that contains a -CG- staggered cross-link. Molecular models suggest that this cross-link may induce propeller twisting in the cross-linked base pairs, and the CD spectrum of this duplex exhibits an unusual negative band at 298 nm, although the remainder of the spectrum is similar to that of B-form DNA. Mismatched C-C or -CG- staggered cross-linked duplexes that have complementary overhanging ends can undergo self-ligation catalyzed by T4 DNA ligase. Analysis of the ligated oligomers by nondenaturing polyacrylamide gel electrophoresis shows that the resulting oligomers migrate in a manner similar to that of a mixture of non-cross-linked control oligomers and suggests that these cross-links do not result in significant bending of the helix. However, the orientation of the staggered cross-link can have a significant effect on the structure and stability of the cross-linked duplex. Thus, the thermal stability of the duplex that contains a -GC- staggered cross-link is 10 degrees C lower than the melting temperature of the control, non-cross-linked duplex. Unlike the -CG- staggered cross-link, in which the cross-linked base pairs can still maintain hydrogen bond contacts, molecular models suggest that formation of the -GC- staggered cross-link disrupts hydrogen bonding and may also perturb adjacent base pairs leading to an overall reduction in helix stability. Duplexes with specifically positioned and oriented cross-links can be used as substrates to study DNA repair mechanisms.

  8. Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

    PubMed

    Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

    2009-03-18

    It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

  9. Development of High-Performance Chemical Isotope Labeling LC-MS for Profiling the Carbonyl Submetabolome.

    PubMed

    Zhao, Shuang; Dawe, Margot; Guo, Kevin; Li, Liang

    2017-06-20

    Metabolites containing a carbonyl group represent several important classes of molecules including various forms of ketones and aldehydes such as steroids and sugars. We report a high-performance chemical isotope labeling (CIL) LC-MS method for profiling the carbonyl submetabolome with high coverage and high accuracy and precision of relative quantification. This method is based on the use of dansylhydrazine (DnsHz) labeling of carbonyl metabolites to change their chemical and physical properties to such an extent that the labeled metabolites can be efficiently separated by reversed phase LC and ionized by electrospray ionization MS. In the analysis of six standards representing different carbonyl classes, acetaldehyde could be ionized only after labeling and MS signals were significantly increased for other 5 standards with an enhancement factor ranging from ∼15-fold for androsterone to ∼940-fold for 2-butanone. Differential 12 C- and 13 C-DnsHz labeling was developed for quantifying metabolic differences in comparative samples where individual samples were separately labeled with 12 C-labeling and spiked with a 13 C-labeled pooled sample, followed by LC-MS analysis, peak pair picking, and peak intensity ratio measurement. In the replicate analysis of a 1:1 12 C-/ 13 C-labeled human urine mixture (n = 6), an average of 2030 ± 39 pairs per run were detected with 1737 pairs in common, indicating the possibility of detecting a large number of carbonyl metabolites as well as high reproducibility of peak pair detection. The average RSD of the peak pair ratios was 7.6%, and 95.6% of the pairs had a RSD value of less than 20%, demonstrating high precision for peak ratio measurement. In addition, the ratios of most peak pairs were close to the expected value of 1.0 (e.g., 95.5% of them had ratios of between 0.67 and 1.5), showing the high accuracy of the method. For metabolite identification, a library of DnsHz-labeled standards was constructed, including 78 carbonyl metabolites with each containing MS, retention time (RT), and MS/MS information. This library and an online search program for labeled carbonyl metabolite identification based on MS, RT, and MS/MS matches have been implemented in a freely available Website, www.mycompoundid.org . Using this library, out of the 1737 peak pairs detected in urine, 33 metabolites were positively identified. In addition, 1333 peak pairs could be matched to the metabolome databases with most of them belonging to the carbonyl metabolites. These results show that 12 C-/ 13 C-DnsHz labeling LC-MS is a useful tool for profiling the carbonyl submetabolome of complex samples with high coverage.

  10. Theory of nodal s ±-wave pairing symmetry in the Pu-based 115 superconductor family

    DOE PAGES

    Das, Tanmoy; Zhu, Jian -Xin; Graf, Matthias J.

    2015-02-27

    The spin-fluctuation mechanism of superconductivity usually results in the presence of gapless or nodal quasiparticle states in the excitation spectrum. Nodal quasiparticle states are well established in copper-oxide, and heavy-fermion superconductors, but not in iron-based superconductors. Here, we study the pairing symmetry and mechanism of a new class of plutonium-based high-T c superconductors and predict the presence of a nodal s⁺⁻ wave pairing symmetry in this family. Starting from a density-functional theory (DFT) based electronic structure calculation we predict several three-dimensional (3D) Fermi surfaces in this 115 superconductor family. We identify the dominant Fermi surface “hot-spots” in the inter-band scatteringmore » channel, which are aligned along the wavevector Q = (π, π, π), where degeneracy could induce sign-reversal of the pairing symmetry. Our calculation demonstrates that the s⁺⁻ wave pairing strength is stronger than the previously thought d-wave pairing; and more importantly, this pairing state allows for the existence of nodal quasiparticles. Finally, we predict the shape of the momentum- and energy-dependent magnetic resonance spectrum for the identification of this pairing symmetry.« less

  11. From tunable core-shell nanoparticles to plasmonic drawbridges: Active control of nanoparticle optical properties

    PubMed Central

    Byers, Chad P.; Zhang, Hui; Swearer, Dayne F.; Yorulmaz, Mustafa; Hoener, Benjamin S.; Huang, Da; Hoggard, Anneli; Chang, Wei-Shun; Mulvaney, Paul; Ringe, Emilie; Halas, Naomi J.; Nordlander, Peter; Link, Stephan; Landes, Christy F.

    2015-01-01

    The optical properties of metallic nanoparticles are highly sensitive to interparticle distance, giving rise to dramatic but frequently irreversible color changes. By electrochemical modification of individual nanoparticles and nanoparticle pairs, we induced equally dramatic, yet reversible, changes in their optical properties. We achieved plasmon tuning by oxidation-reduction chemistry of Ag-AgCl shells on the surfaces of both individual and strongly coupled Au nanoparticle pairs, resulting in extreme but reversible changes in scattering line shape. We demonstrated reversible formation of the charge transfer plasmon mode by switching between capacitive and conductive electronic coupling mechanisms. Dynamic single-particle spectroelectrochemistry also gave an insight into the reaction kinetics and evolution of the charge transfer plasmon mode in an electrochemically tunable structure. Our study represents a highly useful approach to the precise tuning of the morphology of narrow interparticle gaps and will be of value for controlling and activating a range of properties such as extreme plasmon modulation, nanoscopic plasmon switching, and subnanometer tunable gap applications. PMID:26665175

  12. A systematic approach to identify therapeutic effects of natural products based on human metabolite information.

    PubMed

    Noh, Kyungrin; Yoo, Sunyong; Lee, Doheon

    2018-06-13

    Natural products have been widely investigated in the drug development field. Their traditional use cases as medicinal agents and their resemblance of our endogenous compounds show the possibility of new drug development. Many researchers have focused on identifying therapeutic effects of natural products, yet the resemblance of natural products and human metabolites has been rarely touched. We propose a novel method which predicts therapeutic effects of natural products based on their similarity with human metabolites. In this study, we compare the structure, target and phenotype similarities between natural products and human metabolites to capture molecular and phenotypic properties of both compounds. With the generated similarity features, we train support vector machine model to identify similar natural product and human metabolite pairs. The known functions of human metabolites are then mapped to the paired natural products to predict their therapeutic effects. With our selected three feature sets, structure, target and phenotype similarities, our trained model successfully paired similar natural products and human metabolites. When applied to the natural product derived drugs, we could successfully identify their indications with high specificity and sensitivity. We further validated the found therapeutic effects of natural products with the literature evidence. These results suggest that our model can match natural products to similar human metabolites and provide possible therapeutic effects of natural products. By utilizing the similar human metabolite information, we expect to find new indications of natural products which could not be covered by previous in silico methods.

  13. Chromatographic and computational assessment of lipophilicity using sum of ranking differences and generalized pair-correlation.

    PubMed

    Andrić, Filip; Héberger, Károly

    2015-02-06

    Lipophilicity (logP) represents one of the most studied and most frequently used fundamental physicochemical properties. At present there are several possibilities for its quantitative expression and many of them stems from chromatographic experiments. Numerous attempts have been made to compare different computational methods, chromatographic methods vs. computational approaches, as well as chromatographic methods and direct shake-flask procedure without definite results or these findings are not accepted generally. In the present work numerous chromatographically derived lipophilicity measures in combination with diverse computational methods were ranked and clustered using the novel variable discrimination and ranking approaches based on the sum of ranking differences and the generalized pair correlation method. Available literature logP data measured on HILIC, and classical reversed-phase combining different classes of compounds have been compared with most frequently used multivariate data analysis techniques (principal component and hierarchical cluster analysis) as well as with the conclusions in the original sources. Chromatographic lipophilicity measures obtained under typical reversed-phase conditions outperform the majority of computationally estimated logPs. Oppositely, in the case of HILIC none of the many proposed chromatographic indices overcomes any of the computationally assessed logPs. Only two of them (logkmin and kmin) may be selected as recommended chromatographic lipophilicity measures. Both ranking approaches, sum of ranking differences and generalized pair correlation method, although based on different backgrounds, provides highly similar variable ordering and grouping leading to the same conclusions. Copyright © 2015. Published by Elsevier B.V.

  14. Beyond BCS pairing in high-density neutron matter

    NASA Astrophysics Data System (ADS)

    Rios, A.; Ding, D.; Dussan, H.; Dickhoff, W. H.; Witte, S. J.; Polls, A.

    2018-01-01

    Pairing gaps in neutron matter need to be computed in a wide range of densities to address open questions in neutron star phenomenology. Traditionally, the Bardeen-Cooper-Schrieffer approach has been used to compute gaps from bare nucleon-nucleon interactions. Here, we incorporate the influence of short- and long-range correlations into pairing properties. Short-range correlations are treated including the appropriate fragmentation of single-particle states, and they suppress the gaps substantially. Long-range correlations dress the pairing interaction via density and spin modes, and provide a relatively small correction. We use three different interactions as a starting point to control for any systematic effects. Results are relevant for neutron-star cooling scenarios, in particular in view of the recent observational data on Cassiopeia A.

  15. Experimental demonstration of wavelength domain rogue-free ONU based on wavelength-pairing for TDM/WDM optical access networks.

    PubMed

    Lee, Jie Hyun; Park, Heuk; Kang, Sae-Kyoung; Lee, Joon Ki; Chung, Hwan Seok

    2015-11-30

    In this study, we propose and experimentally demonstrate a wavelength domain rogue-free ONU based on wavelength-pairing of downstream and upstream signals for time/wavelength division-multiplexed optical access networks. The wavelength-pairing tunable filter is aligned to the upstream wavelength channel by aligning it to one of the downstream wavelength channels. Wavelength-pairing is implemented with a compact and cyclic Si-AWG integrated with a Ge-PD. The pairing filter covered four 100 GHz-spaced wavelength channels. The feasibility of the wavelength domain rogue-free operation is investigated by emulating malfunction of the misaligned laser. The wavelength-pairing tunable filter based on the Si-AWG blocks the upstream signal in the non-assigned wavelength channel before data collision with other ONUs.

  16. Orbital selective pairing and gap structures of iron-based superconductors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kreisel, Andreas; Andersen, Brian M.; Sprau, P. O.

    We discuss the in uence on spin-fluctuation pairing theory of orbital selective strong correlation effects in Fe-based superconductors, particularly Fe chalcogenide systems. We propose that a key ingredient for an improved itinerant pairing theory is orbital selectivity, i.e., incorporating the reduced coherence of quasiparticles occupying specific orbital states. This modifies the usual spin-fluctuation via suppression of pair scattering processes involving those less coherent states and results in orbital selective Cooper pairing of electrons in the remaining states. We show that this paradigm yields remarkably good agreement with the experimentally observed anisotropic gap structures in both bulk and monolayer FeSe, asmore » well as LiFeAs, indicating that orbital selective Cooper pairing plays a key role in the more strongly correlated iron-based superconductors.« less

  17. Orbital selective pairing and gap structures of iron-based superconductors

    DOE PAGES

    Kreisel, Andreas; Andersen, Brian M.; Sprau, P. O.; ...

    2017-05-08

    We discuss the in uence on spin-fluctuation pairing theory of orbital selective strong correlation effects in Fe-based superconductors, particularly Fe chalcogenide systems. We propose that a key ingredient for an improved itinerant pairing theory is orbital selectivity, i.e., incorporating the reduced coherence of quasiparticles occupying specific orbital states. This modifies the usual spin-fluctuation via suppression of pair scattering processes involving those less coherent states and results in orbital selective Cooper pairing of electrons in the remaining states. We show that this paradigm yields remarkably good agreement with the experimentally observed anisotropic gap structures in both bulk and monolayer FeSe, asmore » well as LiFeAs, indicating that orbital selective Cooper pairing plays a key role in the more strongly correlated iron-based superconductors.« less

  18. Acid-induced exchange of the imino proton in G.C pairs.

    PubMed Central

    Nonin, S; Leroy, J L; Gueron, M

    1996-01-01

    Acid-induced catalysis of imino proton exchange in G.C pairs of DNA duplexes is surprisingly fast, being nearly as fast as for the isolated nucleoside, despite base-pair dissociation constants in the range of 10(-5) at neutral or basic pH. It is also observed in terminal G.C pairs of duplexes and in base pairs of drug-DNA complexes. We have measured imino proton exchange in deoxyguanosine and in the duplex (ATATAGATCTATAT) as a function of pH. We show that acid-induced exchange can be assigned to proton transfer from N7-protonated guanosine to cytidine in the open state of the pair. This is faster than transfer from neutral guanosine (the process of intrinsic catalysis previously characterized at neutral ph) due to the lower imino proton pK of the protonated form, 7.2 instead of 9.4. Other interpretations are excluded by a study of exchange catalysis by formiate and cytidine as exchange catalysts. The cross-over pH between the regimes of pH-independent and acid-induced exchange rates is more basic in the case of base pairs than in the mononucleoside, suggestive of an increase by one to two decades in the dissociation constant of the base pair upon N7 protonation of G. Acid-induced catalysis is much weaker in A.T base pairs, as expected in view of the low pK for protonation of thymidine. PMID:8604298

  19. Acid-induced exchange of the imino proton in G.C pairs.

    PubMed

    Nonin, S; Leroy, J L; Gueron, M

    1996-02-15

    Acid-induced catalysis of imino proton exchange in G.C pairs of DNA duplexes is surprisingly fast, being nearly as fast as for the isolated nucleoside, despite base-pair dissociation constants in the range of 10(-5) at neutral or basic pH. It is also observed in terminal G.C pairs of duplexes and in base pairs of drug-DNA complexes. We have measured imino proton exchange in deoxyguanosine and in the duplex (ATATAGATCTATAT) as a function of pH. We show that acid-induced exchange can be assigned to proton transfer from N7-protonated guanosine to cytidine in the open state of the pair. This is faster than transfer from neutral guanosine (the process of intrinsic catalysis previously characterized at neutral ph) due to the lower imino proton pK of the protonated form, 7.2 instead of 9.4. Other interpretations are excluded by a study of exchange catalysis by formiate and cytidine as exchange catalysts. The cross-over pH between the regimes of pH-independent and acid-induced exchange rates is more basic in the case of base pairs than in the mononucleoside, suggestive of an increase by one to two decades in the dissociation constant of the base pair upon N7 protonation of G. Acid-induced catalysis is much weaker in A.T base pairs, as expected in view of the low pK for protonation of thymidine.

  20. Diffraction pattern simulation of cellulose fibrils using distributed and quantized pair distances

    DOE PAGES

    Zhang, Yan; Inouye, Hideyo; Crowley, Michael; ...

    2016-10-14

    Intensity simulation of X-ray scattering from large twisted cellulose molecular fibrils is important in understanding the impact of chemical or physical treatments on structural properties such as twisting or coiling. This paper describes a highly efficient method for the simulation of X-ray diffraction patterns from complex fibrils using atom-type-specific pair-distance quantization. Pair distances are sorted into arrays which are labelled by atom type. Histograms of pair distances in each array are computed and binned and the resulting population distributions are used to represent the whole pair-distance data set. These quantized pair-distance arrays are used with a modified and vectorized Debyemore » formula to simulate diffraction patterns. This approach utilizes fewer pair distances in each iteration, and atomic scattering factors are moved outside the iteration since the arrays are labelled by atom type. As a result, this algorithm significantly reduces the computation time while maintaining the accuracy of diffraction pattern simulation, making possible the simulation of diffraction patterns from large twisted fibrils in a relatively short period of time, as is required for model testing and refinement.« less

  1. Diffraction pattern simulation of cellulose fibrils using distributed and quantized pair distances

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Yan; Inouye, Hideyo; Crowley, Michael

    Intensity simulation of X-ray scattering from large twisted cellulose molecular fibrils is important in understanding the impact of chemical or physical treatments on structural properties such as twisting or coiling. This paper describes a highly efficient method for the simulation of X-ray diffraction patterns from complex fibrils using atom-type-specific pair-distance quantization. Pair distances are sorted into arrays which are labelled by atom type. Histograms of pair distances in each array are computed and binned and the resulting population distributions are used to represent the whole pair-distance data set. These quantized pair-distance arrays are used with a modified and vectorized Debyemore » formula to simulate diffraction patterns. This approach utilizes fewer pair distances in each iteration, and atomic scattering factors are moved outside the iteration since the arrays are labelled by atom type. This algorithm significantly reduces the computation time while maintaining the accuracy of diffraction pattern simulation, making possible the simulation of diffraction patterns from large twisted fibrils in a relatively short period of time, as is required for model testing and refinement.« less

  2. Diffraction pattern simulation of cellulose fibrils using distributed and quantized pair distances

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Yan; Inouye, Hideyo; Crowley, Michael

    Intensity simulation of X-ray scattering from large twisted cellulose molecular fibrils is important in understanding the impact of chemical or physical treatments on structural properties such as twisting or coiling. This paper describes a highly efficient method for the simulation of X-ray diffraction patterns from complex fibrils using atom-type-specific pair-distance quantization. Pair distances are sorted into arrays which are labelled by atom type. Histograms of pair distances in each array are computed and binned and the resulting population distributions are used to represent the whole pair-distance data set. These quantized pair-distance arrays are used with a modified and vectorized Debyemore » formula to simulate diffraction patterns. This approach utilizes fewer pair distances in each iteration, and atomic scattering factors are moved outside the iteration since the arrays are labelled by atom type. As a result, this algorithm significantly reduces the computation time while maintaining the accuracy of diffraction pattern simulation, making possible the simulation of diffraction patterns from large twisted fibrils in a relatively short period of time, as is required for model testing and refinement.« less

  3. The entangled triplet pair state in acene and heteroacene materials

    PubMed Central

    Yong, Chaw Keong; Musser, Andrew J.; Bayliss, Sam L.; Lukman, Steven; Tamura, Hiroyuki; Bubnova, Olga; Hallani, Rawad K.; Meneau, Aurélie; Resel, Roland; Maruyama, Munetaka; Hotta, Shu; Herz, Laura M.; Beljonne, David; Anthony, John E.; Clark, Jenny; Sirringhaus, Henning

    2017-01-01

    Entanglement of states is one of the most surprising and counter-intuitive consequences of quantum mechanics, with potent applications in cryptography and computing. In organic materials, one particularly significant manifestation is the spin-entangled triplet-pair state, which mediates the spin-conserving fission of one spin-0 singlet exciton into two spin-1 triplet excitons. Despite long theoretical and experimental exploration, the nature of the triplet-pair state and inter-triplet interactions have proved elusive. Here we use a range of organic semiconductors that undergo singlet exciton fission to reveal the photophysical properties of entangled triplet-pair states. We find that the triplet pair is bound with respect to free triplets with an energy that is largely material independent (∼30 meV). During its lifetime, the component triplets behave cooperatively as a singlet and emit light through a Herzberg–Teller-type mechanism, resulting in vibronically structured photoluminescence. In photovoltaic blends, charge transfer can occur from the bound triplet pairs with >100% photon-to-charge conversion efficiency. PMID:28699637

  4. A newly developed highly selective Zn2+-AcO- ion-pair sensor through partner preference: equal efficiency under solitary and colonial situation.

    PubMed

    Karar, Monaj; Paul, Suvendu; Biswas, Bhaskar; Majumdar, Tapas; Mallick, Arabinda

    2018-05-10

    Unusual self-sorting of an ion-pair under highly crowded conditions driven by a synthesized intelligent molecule 2-((E)-(3-((E)-2-hydroxy-3-methoxybenzylideneamino)-2-hydroxypropyl imino)methyl)-6-methoxyphenol, hereafter HBP, is described. When a mixture of various metal salts was allowed to react with HBP, only a specific ion-pair ZnII/AcO- in the solution simultaneously reacted, resulting in high-fidelity ion-pair recognition of HBP. This phenomenon was evidenced by significant changes in the absorption spectra and huge enhancement in emission intensity of HBP. The property that one molecule preferring one particular cation-anion pair over others is a rare but interesting phenomenon. Thus, the potential to interact selectively with the targeted ion-pair resulting in the formation of a specific complex recognized HBP as a new class of molecule that might find future applications in real time and on-site monitoring and separation of new molecules.

  5. The entangled triplet pair state in acene and heteroacene materials

    NASA Astrophysics Data System (ADS)

    Yong, Chaw Keong; Musser, Andrew J.; Bayliss, Sam L.; Lukman, Steven; Tamura, Hiroyuki; Bubnova, Olga; Hallani, Rawad K.; Meneau, Aurélie; Resel, Roland; Maruyama, Munetaka; Hotta, Shu; Herz, Laura M.; Beljonne, David; Anthony, John E.; Clark, Jenny; Sirringhaus, Henning

    2017-07-01

    Entanglement of states is one of the most surprising and counter-intuitive consequences of quantum mechanics, with potent applications in cryptography and computing. In organic materials, one particularly significant manifestation is the spin-entangled triplet-pair state, which mediates the spin-conserving fission of one spin-0 singlet exciton into two spin-1 triplet excitons. Despite long theoretical and experimental exploration, the nature of the triplet-pair state and inter-triplet interactions have proved elusive. Here we use a range of organic semiconductors that undergo singlet exciton fission to reveal the photophysical properties of entangled triplet-pair states. We find that the triplet pair is bound with respect to free triplets with an energy that is largely material independent (~30 meV). During its lifetime, the component triplets behave cooperatively as a singlet and emit light through a Herzberg-Teller-type mechanism, resulting in vibronically structured photoluminescence. In photovoltaic blends, charge transfer can occur from the bound triplet pairs with >100% photon-to-charge conversion efficiency.

  6. Thermoluminescence of Antarctic meteorites: A rapid screening technique for terrestrial age estimation, pairing studies and identification of specimens with unusual prefall histories

    NASA Technical Reports Server (NTRS)

    Sutton, S. R.; Walker, R. M.

    1986-01-01

    Thermoluminescence (TL) is a promising technique for rapid screening of the large numbers of Antarctic meteorites, permitting identification of interesting specimens that can then be studied in detail by other, more definite techniques. Specifically, TL permits determination of rough terrestrial age, identification of potential paired groups and location of specimens with unusual pre-fall histories. Meteorites with long terrestrial ages are particularly valuable for studying transport and weathering mechanisms. Pairing studies are possible because TL variations among meteorites are large compared to variations within individual objects, especially for natural TL. Available TL data for several L3 fragments, three of which were paired by other techniques, are presented as an example of the use of TL parameters in pairing studies. Additional TL measurements, specifically a blind test, are recommended to satisfactorily establish the reliability of this pairing property. The TL measurements also identify fragments with unusual pre-fall histories, such an near-Sun orbits.

  7. Direct measurement of nonlinear properties of bipartite quantum states.

    PubMed

    Bovino, Fabio Antonio; Castagnoli, Giuseppe; Ekert, Artur; Horodecki, Paweł; Alves, Carolina Moura; Sergienko, Alexander Vladimir

    2005-12-09

    Nonlinear properties of quantum states, such as entropy or entanglement, quantify important physical resources and are frequently used in quantum-information science. They are usually calculated from a full description of a quantum state, even though they depend only on a small number of parameters that specify the state. Here we extract a nonlocal and a nonlinear quantity, namely, the Renyi entropy, from local measurements on two pairs of polarization-entangled photons. We also introduce a "phase marking" technique which allows the selection of uncorrupted outcomes even with nondeterministic sources of entangled photons. We use our experimental data to demonstrate the violation of entropic inequalities. They are examples of nonlinear entanglement witnesses and their power exceeds all linear tests for quantum entanglement based on all possible Bell-Clauser-Horne-Shimony-Holt inequalities.

  8. RSRM-13 (360Q013) ballistics mass properties flight designation STS-41

    NASA Technical Reports Server (NTRS)

    Laubacher, Brian A.; Richards, M. C.

    1990-01-01

    The propulsion performance and reconstructed mass properties data from Thiokol's RSRM-13 motors which were assigned to the STS-41 launch are presented. The SRM propellant, TP-H1148, is a composite type solid propellant, formulated of polybutadiene acrylic acid acryonitrile terpolymer binder, epoxy curing agent, ammonium perchlorate oxidizer, and aluminum powder fuel. A small amount of burning rate catalyst (iron oxide) was added to achieve the desired propellant burn rate. The propellant evaluation and raw material information are also presented. The presented ballistic performance was based on the Operational Flight Instrumentation. The adjustments made to the raw data on this flight include biasing the data to correct ambient pressure before liftoff. The performance from each motor as well as matched pair performance values were well within the CEI Specification requirements.

  9. Increasing the structural coverage of tuberculosis drug targets.

    PubMed

    Baugh, Loren; Phan, Isabelle; Begley, Darren W; Clifton, Matthew C; Armour, Brianna; Dranow, David M; Taylor, Brandy M; Muruthi, Marvin M; Abendroth, Jan; Fairman, James W; Fox, David; Dieterich, Shellie H; Staker, Bart L; Gardberg, Anna S; Choi, Ryan; Hewitt, Stephen N; Napuli, Alberto J; Myers, Janette; Barrett, Lynn K; Zhang, Yang; Ferrell, Micah; Mundt, Elizabeth; Thompkins, Katie; Tran, Ngoc; Lyons-Abbott, Sally; Abramov, Ariel; Sekar, Aarthi; Serbzhinskiy, Dmitri; Lorimer, Don; Buchko, Garry W; Stacy, Robin; Stewart, Lance J; Edwards, Thomas E; Van Voorhis, Wesley C; Myler, Peter J

    2015-03-01

    High-resolution three-dimensional structures of essential Mycobacterium tuberculosis (Mtb) proteins provide templates for TB drug design, but are available for only a small fraction of the Mtb proteome. Here we evaluate an intra-genus "homolog-rescue" strategy to increase the structural information available for TB drug discovery by using mycobacterial homologs with conserved active sites. Of 179 potential TB drug targets selected for x-ray structure determination, only 16 yielded a crystal structure. By adding 1675 homologs from nine other mycobacterial species to the pipeline, structures representing an additional 52 otherwise intractable targets were solved. To determine whether these homolog structures would be useful surrogates in TB drug design, we compared the active sites of 106 pairs of Mtb and non-TB mycobacterial (NTM) enzyme homologs with experimentally determined structures, using three metrics of active site similarity, including superposition of continuous pharmacophoric property distributions. Pair-wise structural comparisons revealed that 19/22 pairs with >55% overall sequence identity had active site Cα RMSD <1 Å, >85% side chain identity, and ≥80% PSAPF (similarity based on pharmacophoric properties) indicating highly conserved active site shape and chemistry. Applying these results to the 52 NTM structures described above, 41 shared >55% sequence identity with the Mtb target, thus increasing the effective structural coverage of the 179 Mtb targets over three-fold (from 9% to 32%). The utility of these structures in TB drug design can be tested by designing inhibitors using the homolog structure and assaying the cognate Mtb enzyme; a promising test case, Mtb cytidylate kinase, is described. The homolog-rescue strategy evaluated here for TB is also generalizable to drug targets for other diseases. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Decay of the supersonic turbulent wakes from micro-ramps

    NASA Astrophysics Data System (ADS)

    Sun, Z.; Schrijer, F. F. J.; Scarano, F.; van Oudheusden, B. W.

    2014-02-01

    The wakes resulting from micro-ramps immersed in a supersonic turbulent boundary layer at Ma = 2.0 are investigated by means of particle image velocimetry. Two micro-ramps are investigated with height of 60% and 80% of the undisturbed boundary layer, respectively. The measurement domain is placed at the symmetry plane of the ramp and encompasses the range from 10 to 32 ramp heights downstream of the ramp. The decay of the flow field properties is evaluated in terms of time-averaged and root-mean-square (RMS) statistics. In the time-averaged flow field, the recovery from the imparted momentum deficit and the decay of upwash motion are analyzed. The RMS fluctuations of the velocity components exhibit strong anisotropy at the most upstream location and develop into a more isotropic regime downstream. The self-similarity properties of velocity components and fluctuation components along wall-normal direction are followed. The investigation of the unsteady large scale motion is carried out by means of snapshot analysis and by a statistical approach based on the spatial auto-correlation function. The Kelvin-Helmholtz (K-H) instability at the upper shear layer is observed to develop further with the onset of vortex pairing. The average distance between vortices is statistically estimated using the spatial auto-correlation. A marked transition with the wavelength increase is observed across the pairing regime. The K-H instability, initially observed only at the upper shear layer also begins to appear in the lower shear layer as soon as the wake is elevated sufficiently off the wall. The auto-correlation statistics confirm the coherence of counter-rotating vortices from the upper and lower sides, indicating the formation of vortex rings downstream of the pairing region.

  11. Increasing the structural coverage of tuberculosis drug targets

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Baugh, Loren; Phan, Isabelle; Begley, Darren W.

    High-resolution three-dimensional structures of essential Mycobacterium tuberculosis (Mtb) proteins provide templates for TB drug design, but are available for only a small fraction of the Mtb proteome. Here we evaluate an intra-genus “homolog-rescue” strategy to increase the structural information available for TB drug discovery by using mycobacterial homologs with conserved active sites. We found that of 179 potential TB drug targets selected for x-ray structure determination, only 16 yielded a crystal structure. By adding 1675 homologs from nine other mycobacterial species to the pipeline, structures representing an additional 52 otherwise intractable targets were solved. To determine whether these homolog structuresmore » would be useful surrogates in TB drug design, we compared the active sites of 106 pairs of Mtb and non-TB mycobacterial (NTM) enzyme homologs with experimentally determined structures, using three metrics of active site similarity, including superposition of continuous pharmacophoric property distributions. Pair-wise structural comparisons revealed that 19/22 pairs with >55% overall sequence identity had active site Cα RMSD <1 Å, >85% side chain identity, and ≥80% PS APF (similarity based on pharmacophoric properties) indicating highly conserved active site shape and chemistry. Applying these results to the 52 NTM structures described above, 41 shared >55% sequence identity with the Mtb target, thus increasing the effective structural coverage of the 179 Mtb targets over three-fold (from 9% to 32%). The utility of these structures in TB drug design can be tested by designing inhibitors using the homolog structure and assaying the cognate Mtb enzyme; a promising test case, Mtb cytidylate kinase, is described. The homolog-rescue strategy evaluated here for TB is also generalizable to drug targets for other diseases.« less

  12. Increasing the structural coverage of tuberculosis drug targets

    DOE PAGES

    Baugh, Loren; Phan, Isabelle; Begley, Darren W.; ...

    2014-12-19

    High-resolution three-dimensional structures of essential Mycobacterium tuberculosis (Mtb) proteins provide templates for TB drug design, but are available for only a small fraction of the Mtb proteome. Here we evaluate an intra-genus “homolog-rescue” strategy to increase the structural information available for TB drug discovery by using mycobacterial homologs with conserved active sites. We found that of 179 potential TB drug targets selected for x-ray structure determination, only 16 yielded a crystal structure. By adding 1675 homologs from nine other mycobacterial species to the pipeline, structures representing an additional 52 otherwise intractable targets were solved. To determine whether these homolog structuresmore » would be useful surrogates in TB drug design, we compared the active sites of 106 pairs of Mtb and non-TB mycobacterial (NTM) enzyme homologs with experimentally determined structures, using three metrics of active site similarity, including superposition of continuous pharmacophoric property distributions. Pair-wise structural comparisons revealed that 19/22 pairs with >55% overall sequence identity had active site Cα RMSD <1 Å, >85% side chain identity, and ≥80% PS APF (similarity based on pharmacophoric properties) indicating highly conserved active site shape and chemistry. Applying these results to the 52 NTM structures described above, 41 shared >55% sequence identity with the Mtb target, thus increasing the effective structural coverage of the 179 Mtb targets over three-fold (from 9% to 32%). The utility of these structures in TB drug design can be tested by designing inhibitors using the homolog structure and assaying the cognate Mtb enzyme; a promising test case, Mtb cytidylate kinase, is described. The homolog-rescue strategy evaluated here for TB is also generalizable to drug targets for other diseases.« less

  13. Increasing the Structural Coverage of Tuberculosis Drug Targets

    PubMed Central

    Baugh, Loren; Phan, Isabelle; Begley, Darren W.; Clifton, Matthew C.; Armour, Brianna; Dranow, David M.; Taylor, Brandy M.; Muruthi, Marvin M.; Abendroth, Jan; Fairman, James W.; Fox, David; Dieterich, Shellie H.; Staker, Bart L.; Gardberg, Anna S.; Choi, Ryan; Hewitt, Stephen N.; Napuli, Alberto J.; Myers, Janette; Barrett, Lynn K.; Zhang, Yang; Ferrell, Micah; Mundt, Elizabeth; Thompkins, Katie; Tran, Ngoc; Lyons-Abbott, Sally; Abramov, Ariel; Sekar, Aarthi; Serbzhinskiy, Dmitri; Lorimer, Don; Buchko, Garry W.; Stacy, Robin; Stewart, Lance J.; Edwards, Thomas E.; Van Voorhis, Wesley C.; Myler, Peter J.

    2015-01-01

    High-resolution three-dimensional structures of essential Mycobacterium tuberculosis (Mtb) proteins provide templates for TB drug design, but are available for only a small fraction of the Mtb proteome. Here we evaluate an intra-genus “homolog-rescue” strategy to increase the structural information available for TB drug discovery by using mycobacterial homologs with conserved active sites. Of 179 potential TB drug targets selected for x-ray structure determination, only 16 yielded a crystal structure. By adding 1675 homologs from nine other mycobacterial species to the pipeline, structures representing an additional 52 otherwise intractable targets were solved. To determine whether these homolog structures would be useful surrogates in TB drug design, we compared the active sites of 106 pairs of Mtb and non-TB mycobacterial (NTM) enzyme homologs with experimentally determined structures, using three metrics of active site similarity, including superposition of continuous pharmacophoric property distributions. Pair-wise structural comparisons revealed that 19/22 pairs with >55% overall sequence identity had active site Cα RMSD <1Å, >85% side chain identity, and ≥80% PSAPF (similarity based on pharmacophoric properties) indicating highly conserved active site shape and chemistry. Applying these results to the 52 NTM structures described above, 41 shared >55% sequence identity with the Mtb target, thus increasing the effective structural coverage of the 179 Mtb targets over three-fold (from 9% to 32%). The utility of these structures in TB drug design can be tested by designing inhibitors using the homolog structure and assaying the cognate Mtb enzyme; a promising test case, Mtb cytidylate kinase, is described. The homolog-rescue strategy evaluated here for TB is also generalizable to drug targets for other diseases. PMID:25613812

  14. Base pairing among three cis-acting sequences contributes to template switching during hepadnavirus reverse transcription.

    PubMed

    Liu, Ning; Tian, Ru; Loeb, Daniel D

    2003-02-18

    Synthesis of the relaxed-circular (RC) DNA genome of hepadnaviruses requires two template switches during plus-strand DNA synthesis: primer translocation and circularization. Although primer translocation and circularization use different donor and acceptor sequences, and are distinct temporally, they share the common theme of switching from one end of the minus-strand template to the other end. Studies of duck hepatitis B virus have indicated that, in addition to the donor and acceptor sequences, three other cis-acting sequences, named 3E, M, and 5E, are required for the synthesis of RC DNA by contributing to primer translocation and circularization. The mechanism by which 3E, M, and 5E act was not known. We present evidence that these sequences function by base pairing with each other within the minus-strand template. 3E base-pairs with one portion of M (M3) and 5E base-pairs with an adjacent portion of M (M5). We found that disrupting base pairing between 3E and M3 and between 5E and M5 inhibited primer translocation and circularization. More importantly, restoring base pairing with mutant sequences restored the production of RC DNA. These results are consistent with the model that, within duck hepatitis B virus capsids, the ends of the minus-strand template are juxtaposed via base pairing to facilitate the two template switches during plus-strand DNA synthesis.

  15. Loss of G-A base pairs is insufficient for achieving a large opening of U4 snRNA K-turn motif.

    PubMed

    Cojocaru, Vlad; Klement, Reinhard; Jovin, Thomas M

    2005-01-01

    Upon binding to the 15.5K protein, two tandem-sheared G-A base pairs are formed in the internal loop of the kink-turn motif of U4 snRNA (Kt-U4). We have reported that the folding of Kt-U4 is assisted by protein binding. Unstable interactions that contribute to a large opening of the free RNA ('k-e motion') were identified using locally enhanced sampling molecular dynamics simulations, results that agree with experiments. A detailed analysis of the simulations reveals that the k-e motion in Kt-U4 is triggered both by loss of G-A base pairs in the internal loop and backbone flexibility in the stems. Essential dynamics show that the loss of G-A base pairs is correlated along the first mode but anti-correlated along the third mode with the k-e motion. Moreover, when enhanced sampling was confined to the internal loop, the RNA adopted an alternative conformation characterized by a sharper kink, opening of G-A base pairs and modified stacking interactions. Thus, loss of G-A base pairs is insufficient for achieving a large opening of the free RNA. These findings, supported by previously published RNA structure probing experiments, suggest that G-A base pair formation occurs upon protein binding, thereby stabilizing a selective orientation of the stems.

  16. Expanding the universe of categorical syllogisms: a challenge for reasoning researchers.

    PubMed

    Roberts, Maxwell J

    2005-11-01

    Syllogistic reasoning, in which people identify conclusions from quantified premise pairs, remains a benchmark task whose patterns of data must be accounted for by general theories of deductive reasoning. However, psychologists have confined themselves to administering only the 64 premise pairs historically identified by Aristotle. By utilizing all combinations of negations, the present article identifies an expanded set of 576 premise pairs and gives the valid conclusions that they support. Many of these have interesting properties, and the identification of predictions and their verification will be an important next step for all proponents of such theories.

  17. Structural Fluctuation and Thermophysical Properties of Molten II-VI Compounds

    NASA Technical Reports Server (NTRS)

    2003-01-01

    The objectives of the project is to conduct ground-based experimental and theoretical research on the structural fluctuations and thermophysical properties of molten II-VI compounds to enhance the basic understanding of the existing flight experiments in microgravity materials science programs and to study the fundamental heterophase fluctuations phenomena in these melts by: 1) Conducting neutron scattering analysis and measuring quantitatively the relevant thermophysical properties of the II-VI melts such as viscosity, electrical conductivity, thermal diffusivity and density as well as the relaxation characteristics of these properties to advance the understanding of the structural properties and the relaxation phenomena in these melts and 2) Performing theoretical analyses on the melt systems to interpret the experimental results. All the facilities required for the experimental measurements have been procured, installed and tested. A relaxation phenomenon, which shows a slow drift of the measured thermal conductivity toward the equilibrium value after cooling of the sample, was observed for the first time. An apparatus based on the transient torque induced by a rotating magnetic field has been developed to determine the viscosity and electrical conductivity of semiconducting liquids. Viscosity measurements on molten tellurium showed similar relaxation behavior as the measured diffusivity. Neutron scattering experiments were performed on the HgTe and HgZnTe melts and the results on pair distribution showed better resolution than previous reported.

  18. EDITORIAL: The electromagnetic properties of iron-based superconductors The electromagnetic properties of iron-based superconductors

    NASA Astrophysics Data System (ADS)

    Prozorov, Ruslan; Gurevich, Alex; Luke, Graeme

    2010-05-01

    Iron-based superconductors, discovered just a few years ago, are members of a diverse family of pnictides and chalcogenides which may potentially contain hundreds of superconducting compounds. The unconventional, multiband superconductivity in these materials most likely emerges from the quintessential magnetic Fe ions. Along with many similarities to the high-Tc cuprates, the proximity of antiferromagnetism to superconductivity in these semi-metallic materials has attracted much attention. The massive effort aimed at understanding superconductivity in the high-Tc cuprates has stimulated the development of numerous state-of-the-art experimental techniques, improved crystal growth methods and a variety of new theoretical insights. These tools and models were already available and readily applied to the new iron-based superconductors for which lots of high quality new results are being reported literally every day. The current special section represents only a snapshot of these extensive studies performed in the second half of 2009, less than two years after the discovery of 26 K superconductivity in the LaFeAsO compound. The range of various experiments is impressive and this issue is mostly focused on the electromagnetic properties of these iron-based materials. The electromagnetic response is sensitive to the microscopic electronic behavior and therefore can be used to probe the mechanism of superconductivity. On the other hand, it is the electromagnetic response that determines many possible applications of these superconductors, particularly given their extremely high upper critical fields. At this point it is already quite clear that the iron-based superconductors cannot unambiguously fit into any known type of superconductor class and have been placed in one of their own. The metallic ground state of the parent compounds is different from the insulating state of the cuprates and generally exhibits a lower electromagnetic anisotropy. However, similar to the cuprates, a superconducting 'dome' is formed upon doping the parent compounds, which exhibits antiferromagnetic and structural transitions at temperatures well above the superconducting critical temperature. This special section touches on several key aspects of these new iron-based superconductors. These topics include materials synthesis and basic characterization, the role of impurities and pairing symmetry, and mapping of the superconducting phase diagram as a function of chemical doping and pressure. Studies of transport, magnetic and optical properties account for a substantial portion of this special section. Particular attention is devoted to the role of magnetic excitations and the issue of the possible coexistence of magnetism and superconductivity. Attempts to understand the nature of the superconducting pairing are discussed from several angles, including tunneling spectroscopy and the London penetration depth. The vortex state is probed by magnetization, transport and neutron scattering, while the irreversible state is probed by studies of magnetic and transport critical current density.

  19. Single-particle spectral density of the unitary Fermi gas: Novel approach based on the operator product expansion, sum rules and the maximum entropy method

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gubler, Philipp, E-mail: pgubler@riken.jp; RIKEN Nishina Center, Wako, Saitama 351-0198; Yamamoto, Naoki

    2015-05-15

    Making use of the operator product expansion, we derive a general class of sum rules for the imaginary part of the single-particle self-energy of the unitary Fermi gas. The sum rules are analyzed numerically with the help of the maximum entropy method, which allows us to extract the single-particle spectral density as a function of both energy and momentum. These spectral densities contain basic information on the properties of the unitary Fermi gas, such as the dispersion relation and the superfluid pairing gap, for which we obtain reasonable agreement with the available results based on quantum Monte-Carlo simulations.

  20. Causal Entropies – a measure for determining changes in the temporal organization of neural systems

    PubMed Central

    Waddell, Jack; Dzakpasu, Rhonda; Booth, Victoria; Riley, Brett; Reasor, Jonathan; Poe, Gina; Zochowski, Michal

    2009-01-01

    We propose a novel measure to detect temporal ordering in the activity of individual neurons in a local network, which is thought to be a hallmark of activity-dependent synaptic modifications during learning. The measure, called Causal Entropy, is based on the time-adaptive detection of asymmetries in the relative temporal patterning between neuronal pairs. We characterize properties of the measure on both simulated data and experimental multiunit recordings of hippocampal neurons from the awake, behaving rat, and show that the metric can more readily detect those asymmetries than standard cross correlation-based techniques, especially since the temporal sensitivity of causal entropy can detect such changes rapidly and dynamically. PMID:17275095

Top