Molecular implementation of molecular shift register memories

NASA Technical Reports Server (NTRS)

Beratan, David N. (Inventor); Onuchic, Jose N. (Inventor)

1991-01-01

An electronic shift register memory (20) at the molecular level is described. The memory elements are based on a chain of electron transfer molecules (22) and the information is shifted by photoinduced (26) electron transfer reactions. Thus, multi-step sequences of charge transfer reactions are used to move charge with high efficiency down a molecular chain. The device integrates compositions of the invention onto a VLSI substrate (36), providing an example of a molecular electronic device which may be fabricated. Three energy level schemes, molecular implementation of these schemes, optical excitation strategies, charge amplification strategies, and error correction strategies are described.

An Energy-Efficient Game-Theory-Based Spectrum Decision Scheme for Cognitive Radio Sensor Networks

PubMed Central

Salim, Shelly; Moh, Sangman

2016-01-01

A cognitive radio sensor network (CRSN) is a wireless sensor network in which sensor nodes are equipped with cognitive radio. In this paper, we propose an energy-efficient game-theory-based spectrum decision (EGSD) scheme for CRSNs to prolong the network lifetime. Note that energy efficiency is the most important design consideration in CRSNs because it determines the network lifetime. The central part of the EGSD scheme consists of two spectrum selection algorithms: random selection and game-theory-based selection. The EGSD scheme also includes a clustering algorithm, spectrum characterization with a Markov chain, and cluster member coordination. Our performance study shows that EGSD outperforms the existing popular framework in terms of network lifetime and coordination overhead. PMID:27376290

An Energy-Efficient Game-Theory-Based Spectrum Decision Scheme for Cognitive Radio Sensor Networks.

PubMed

Salim, Shelly; Moh, Sangman

2016-06-30

A cognitive radio sensor network (CRSN) is a wireless sensor network in which sensor nodes are equipped with cognitive radio. In this paper, we propose an energy-efficient game-theory-based spectrum decision (EGSD) scheme for CRSNs to prolong the network lifetime. Note that energy efficiency is the most important design consideration in CRSNs because it determines the network lifetime. The central part of the EGSD scheme consists of two spectrum selection algorithms: random selection and game-theory-based selection. The EGSD scheme also includes a clustering algorithm, spectrum characterization with a Markov chain, and cluster member coordination. Our performance study shows that EGSD outperforms the existing popular framework in terms of network lifetime and coordination overhead.

An Identity Based Key Exchange Protocol in Cloud Computing

NASA Astrophysics Data System (ADS)

Molli, Venkateswara Rao; Tiwary, Omkar Nath

2012-10-01

Workflow systems often use delegation to enhance the flexibility of authorization; delegation transfers privileges among users across different administrative domains and facilitates information sharing. We present an independently verifiable delegation mechanism, where a delegation credential can be verified without the participation of domain administrators. This protocol, called role-based cascaded delegation (RBCD), supports simple and efficient cross-domain delegation of authority. RBCD enables a role member to create delegations based on the dynamic needs of collaboration; in the meantime, a delegation chain canbe verified by anyone without the participation of role administrators. We also propose the Measurable Risk Adaptive decentralized Role-based Delegation framework to address this problem. Describe an efficient realization of RBCD by using aggregate signatures, where the authentication information for an arbitrarily long role-based delegation chain is captured by one short signature of constant size. RBCD enables a role member to create delegations based on the need of collaboration; in the meantime anyone can verify a delegation chain without the participation of role administrators. The protocol is general and can be realized by any signature scheme. We have described a specific realization with a hierarchical certificate-based encryption scheme that gives delegation compact credentials.

Performance analyses and improvements for the IEEE 802.15.4 CSMA/CA scheme with heterogeneous buffered conditions.

PubMed

Zhu, Jianping; Tao, Zhengsu; Lv, Chunfeng

2012-01-01

Studies of the IEEE 802.15.4 Carrier Sense Multiple Access with Collision Avoidance (CSMA/CA) scheme have been received considerable attention recently, with most of these studies focusing on homogeneous or saturated traffic. Two novel transmission schemes-OSTS/BSTS (One Service a Time Scheme/Bulk Service a Time Scheme)-are proposed in this paper to improve the behaviors of time-critical buffered networks with heterogeneous unsaturated traffic. First, we propose a model which contains two modified semi-Markov chains and a macro-Markov chain combined with the theory of M/G/1/K queues to evaluate the characteristics of these two improved CSMA/CA schemes, in which traffic arrivals and accessing packets are bestowed with non-preemptive priority over each other, instead of prioritization. Then, throughput, packet delay and energy consumption of unsaturated, unacknowledged IEEE 802.15.4 beacon-enabled networks are predicted based on the overall point of view which takes the dependent interactions of different types of nodes into account. Moreover, performance comparisons of these two schemes with other non-priority schemes are also proposed. Analysis and simulation results show that delay and fairness of our schemes are superior to those of other schemes, while throughput and energy efficiency are superior to others in more heterogeneous situations. Comprehensive simulations demonstrate that the analysis results of these models match well with the simulation results.

Complex absorbing potential based Lorentzian fitting scheme and time dependent quantum transport.

PubMed

Xie, Hang; Kwok, Yanho; Jiang, Feng; Zheng, Xiao; Chen, GuanHua

2014-10-28

Based on the complex absorbing potential (CAP) method, a Lorentzian expansion scheme is developed to express the self-energy. The CAP-based Lorentzian expansion of self-energy is employed to solve efficiently the Liouville-von Neumann equation of one-electron density matrix. The resulting method is applicable for both tight-binding and first-principles models and is used to simulate the transient currents through graphene nanoribbons and a benzene molecule sandwiched between two carbon-atom chains.

Performance Analyses and Improvements for the IEEE 802.15.4 CSMA/CA Scheme with Heterogeneous Buffered Conditions

PubMed Central

Zhu, Jianping; Tao, Zhengsu; Lv, Chunfeng

2012-01-01

Studies of the IEEE 802.15.4 Carrier Sense Multiple Access with Collision Avoidance (CSMA/CA) scheme have been received considerable attention recently, with most of these studies focusing on homogeneous or saturated traffic. Two novel transmission schemes—OSTS/BSTS (One Service a Time Scheme/Bulk Service a Time Scheme)—are proposed in this paper to improve the behaviors of time-critical buffered networks with heterogeneous unsaturated traffic. First, we propose a model which contains two modified semi-Markov chains and a macro-Markov chain combined with the theory of M/G/1/K queues to evaluate the characteristics of these two improved CSMA/CA schemes, in which traffic arrivals and accessing packets are bestowed with non-preemptive priority over each other, instead of prioritization. Then, throughput, packet delay and energy consumption of unsaturated, unacknowledged IEEE 802.15.4 beacon-enabled networks are predicted based on the overall point of view which takes the dependent interactions of different types of nodes into account. Moreover, performance comparisons of these two schemes with other non-priority schemes are also proposed. Analysis and simulation results show that delay and fairness of our schemes are superior to those of other schemes, while throughput and energy efficiency are superior to others in more heterogeneous situations. Comprehensive simulations demonstrate that the analysis results of these models match well with the simulation results. PMID:22666076

A new ChainMail approach for real-time soft tissue simulation.

PubMed

Zhang, Jinao; Zhong, Yongmin; Smith, Julian; Gu, Chengfan

2016-07-03

This paper presents a new ChainMail method for real-time soft tissue simulation. This method enables the use of different material properties for chain elements to accommodate various materials. Based on the ChainMail bounding region, a new time-saving scheme is developed to improve computational efficiency for isotropic materials. The proposed method also conserves volume and strain energy. Experimental results demonstrate that the proposed ChainMail method can not only accommodate isotropic, anisotropic and heterogeneous materials but also model incompressibility and relaxation behaviors of soft tissues. Further, the proposed method can achieve real-time computational performance.

The Blood Stocks Management Scheme, a partnership venture between the National Blood Service of England and North Wales and participating hospitals for maximizing blood supply chain management.

PubMed

Chapman, J F; Cook, R

2002-10-01

The Blood Stocks Management Scheme (BSMS) has been established as a joint venture between the National Blood Service (NBS) in England and North Wales and participating hospitals to monitor the blood supply chain. Stock and wastage data are submitted to a web-based data-management system, facilitating continuous and complete red cell data collection and 'real time' data extraction. The data-management system enables peer review of performance in respect of stock holding levels and red cell wastage. The BSMS has developed an innovative web-based data-management system that enables data collection and benchmarking of practice, which should drive changes in stock management practice, therefore optimizing the use of donated blood.

Modeling and Analysis of Hybrid Cellular/WLAN Systems with Integrated Service-Based Vertical Handoff Schemes

NASA Astrophysics Data System (ADS)

Xia, Weiwei; Shen, Lianfeng

We propose two vertical handoff schemes for cellular network and wireless local area network (WLAN) integration: integrated service-based handoff (ISH) and integrated service-based handoff with queue capabilities (ISHQ). Compared with existing handoff schemes in integrated cellular/WLAN networks, the proposed schemes consider a more comprehensive set of system characteristics such as different features of voice and data services, dynamic information about the admitted calls, user mobility and vertical handoffs in two directions. The code division multiple access (CDMA) cellular network and IEEE 802.11e WLAN are taken into account in the proposed schemes. We model the integrated networks by using multi-dimensional Markov chains and the major performance measures are derived for voice and data services. The important system parameters such as thresholds to prioritize handoff voice calls and queue sizes are optimized. Numerical results demonstrate that the proposed ISHQ scheme can maximize the utilization of overall bandwidth resources with the best quality of service (QoS) provisioning for voice and data services.

75 FR 5372 - Proposed Collection: Comment Request

Federal Register 2010, 2011, 2012, 2013, 2014

2010-02-02

...: Special Bond of Indemnity by Purchaser of United States Bonds/Notes Involved in a Chain Letter Scheme. OMB... for refund of the purchase price of savings bonds purchased in a chain letter scheme. Current Actions...

75 FR 28321 - Submission for OMB Review; Comment Request

Federal Register 2010, 2011, 2012, 2013, 2014

2010-05-20

... Involved in a Chain Letter Scheme. Form: PD F 2966. Abstract: Used by the purchaser of savings bonds in a chain letter scheme to request refund purchase price of the bonds. Respondents: Individuals or...

Quantum spin transistor with a Heisenberg spin chain

PubMed Central

Marchukov, O. V.; Volosniev, A. G.; Valiente, M.; Petrosyan, D.; Zinner, N. T.

2016-01-01

Spin chains are paradigmatic systems for the studies of quantum phases and phase transitions, and for quantum information applications, including quantum computation and short-distance quantum communication. Here we propose and analyse a scheme for conditional state transfer in a Heisenberg XXZ spin chain which realizes a quantum spin transistor. In our scheme, the absence or presence of a control spin excitation in the central gate part of the spin chain results in either perfect transfer of an arbitrary state of a target spin between the weakly coupled input and output ports, or its complete blockade at the input port. We also discuss a possible proof-of-concept realization of the corresponding spin chain with a one-dimensional ensemble of cold atoms with strong contact interactions. Our scheme is generally applicable to various implementations of tunable spin chains, and it paves the way for the realization of integrated quantum logic elements. PMID:27721438

Quantum spin transistor with a Heisenberg spin chain.

PubMed

Marchukov, O V; Volosniev, A G; Valiente, M; Petrosyan, D; Zinner, N T

2016-10-10

Spin chains are paradigmatic systems for the studies of quantum phases and phase transitions, and for quantum information applications, including quantum computation and short-distance quantum communication. Here we propose and analyse a scheme for conditional state transfer in a Heisenberg XXZ spin chain which realizes a quantum spin transistor. In our scheme, the absence or presence of a control spin excitation in the central gate part of the spin chain results in either perfect transfer of an arbitrary state of a target spin between the weakly coupled input and output ports, or its complete blockade at the input port. We also discuss a possible proof-of-concept realization of the corresponding spin chain with a one-dimensional ensemble of cold atoms with strong contact interactions. Our scheme is generally applicable to various implementations of tunable spin chains, and it paves the way for the realization of integrated quantum logic elements.

Novel and Efficient Synthesis of the Promising Drug Candidate Discodermolide

DTIC Science & Technology

2010-02-01

stereotriad building blocks for discodermolide and related polyketide antibiotics could be obtained from variations on a short, scalable scheme that did...chains required for the chemical synthesis of the nonaromatic polyketides is usually based on the iterative lengthening of an acyclic substituted chain...burden estimate or any other aspect of this collection of information, including suggestions for reducing this burden to Department of Defense

Large scale shell model study of the evolution of mixed-symmetry states in chains of nuclei around 132Sn

NASA Astrophysics Data System (ADS)

Lo Iudice, N.; Bianco, D.; Andreozzi, F.; Porrino, A.; Knapp, F.

2012-10-01

Large scale shell model calculations based on a new diagonalization algorithm are performed in order to investigate the mixed symmetry states in chains of nuclei in the proximity of N=82. The resulting spectra and transitions are in agreement with the experiments and consistent with the scheme provided by the interacting boson model.

78 FR 41995 - Submission for OMB Review; Comment Request

Federal Register 2010, 2011, 2012, 2013, 2014

2013-07-12

... of United States Savings Bonds/Notes Involved in a Chain Letter Scheme. Form: PD F 2966. Abstract... purchased in a chain letter scheme and used to identify the securities involved and to issue a refund of the...

Universal scheme for finite-probability perfect transfer of arbitrary multispin states through spin chains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Man, Zhong-Xiao, E-mail: zxman@mail.qfnu.edu.cn; An, Nguyen Ba, E-mail: nban@iop.vast.ac.vn; Xia, Yun-Jie, E-mail: yjxia@mail.qfnu.edu.cn

In combination with the theories of open system and quantum recovering measurement, we propose a quantum state transfer scheme using spin chains by performing two sequential operations: a projective measurement on the spins of ‘environment’ followed by suitably designed quantum recovering measurements on the spins of interest. The scheme allows perfect transfer of arbitrary multispin states through multiple parallel spin chains with finite probability. Our scheme is universal in the sense that it is state-independent and applicable to any model possessing spin–spin interactions. We also present possible methods to implement the required measurements taking into account the current experimental technologies.more » As applications, we consider two typical models for which the probabilities of perfect state transfer are found to be reasonably high at optimally chosen moments during the time evolution. - Highlights: • Scheme that can achieve perfect quantum state transfer is devised. • The scheme is state-independent and applicable to any spin-interaction models. • The scheme allows perfect transfer of arbitrary multispin states. • Applications to two typical models are considered in detail.« less

Evolutional Optimization on Material Ordering and Inventory Control of Supply Chain through Incentive Scheme

NASA Astrophysics Data System (ADS)

Prasertwattana, Kanit; Shimizu, Yoshiaki; Chiadamrong, Navee

This paper studied the material ordering and inventory control of supply chain systems. The effect of controlling policies is analyzed under three different configurations of the supply chain systems, and the formulated problem has been solved by using an evolutional optimization method known as Differential Evolution (DE). The numerical results show that the coordinating policy with the incentive scheme outperforms the other policies and can improve the performance of the overall system as well as all members under the concept of supply chain management.

An open Markov chain scheme model for a credit consumption portfolio fed by ARIMA and SARMA processes

NASA Astrophysics Data System (ADS)

Esquível, Manuel L.; Fernandes, José Moniz; Guerreiro, Gracinda R.

2016-06-01

We introduce a schematic formalism for the time evolution of a random population entering some set of classes and such that each member of the population evolves among these classes according to a scheme based on a Markov chain model. We consider that the flow of incoming members is modeled by a time series and we detail the time series structure of the elements in each of the classes. We present a practical application to data from a credit portfolio of a Cape Verdian bank; after modeling the entering population in two different ways - namely as an ARIMA process and as a deterministic sigmoid type trend plus a SARMA process for the residues - we simulate the behavior of the population and compare the results. We get that the second method is more accurate in describing the behavior of the populations when compared to the observed values in a direct simulation of the Markov chain.

On fast carry select adders

NASA Technical Reports Server (NTRS)

Shamanna, M.; Whitaker, S.

1992-01-01

This paper presents an architecture for a high-speed carry select adder with very long bit lengths utilizing a conflict-free bypass scheme. The proposed scheme has almost half the number of transistors and is faster than a conventional carry select adder. A comparative study is also made between the proposed adder and a Manchester carry chain adder which shows that the proposed scheme has the same transistor count, without suffering any performance degradation, compared to the Manchester carry chain adder.

Chaos based video encryption using maps and Ikeda time delay system

NASA Astrophysics Data System (ADS)

Valli, D.; Ganesan, K.

2017-12-01

Chaos based cryptosystems are an efficient method to deal with improved speed and highly secured multimedia encryption because of its elegant features, such as randomness, mixing, ergodicity, sensitivity to initial conditions and control parameters. In this paper, two chaos based cryptosystems are proposed: one is the higher-dimensional 12D chaotic map and the other is based on the Ikeda delay differential equation (DDE) suitable for designing a real-time secure symmetric video encryption scheme. These encryption schemes employ a substitution box (S-box) to diffuse the relationship between pixels of plain video and cipher video along with the diffusion of current input pixel with the previous cipher pixel, called cipher block chaining (CBC). The proposed method enhances the robustness against statistical, differential and chosen/known plain text attacks. Detailed analysis is carried out in this paper to demonstrate the security and uniqueness of the proposed scheme.

Novel scheme to compute chemical potentials of chain molecules on a lattice

NASA Astrophysics Data System (ADS)

Mooij, G. C. A. M.; Frenkel, D.

We present a novel method that allows efficient computation of the total number of allowed conformations of a chain molecule in a dense phase. Using this method, it is possible to estimate the chemical potential of such a chain molecule. We have tested the present method in simulations of a two-dimensional monolayer of chain molecules on a lattice (Whittington-Chapman model) and compared it with existing schemes to compute the chemical potential. We find that the present approach is two to three orders of magnitude faster than the most efficient of the existing methods.

Pathways to increase consumer trust in meat as a safe and wholesome food.

PubMed

Gellynck, Xavier; Verbeke, Wim; Vermeire, Bert

2006-09-01

This paper focuses on the effect of information about meat safety and wholesomeness on consumer trust based on several studies with data collected in Belgium. The research is grounded in the observation that despite the abundant rise of information through labelling, traceability systems and quality assurance schemes, the effect on consumer trust in meat as a safe and wholesome product is only limited. The overload and complexity of information on food products results in misunderstanding and misinterpretation. Functional traceability attributes such as organisational efficiency and chain monitoring are considered to be highly important but not as a basis for market segmentation. However, process traceability attributes such as origin and production method are of interest for particular market segments as a response to meat quality concerns. Quality assurance schemes and associated labels have a poor impact on consumers' perception. It is argued that the high interest of retailers in such schemes is driven by procurement management efficiency rather than safety or overall quality. Future research could concentrate on the distribution of costs and benefits associated with meat quality initiatives among the chain participants.

Smart management of sample dilution using an artificial neural network to achieve streamlined processes and saving resources: the automated nephelometric testing of serum free light chain as case study.

PubMed

Ialongo, Cristiano; Pieri, Massimo; Bernardini, Sergio

2017-02-01

Saving resources is a paramount issue for the modern laboratory, and new trainable as well as smart technologies can be used to allow the automated instrumentation to manage samples more efficiently in order to achieve streamlined processes. In this regard the serum free light chain (sFLC) testing represents an interesting challenge, as it usually causes using a number of assays before achieving an acceptable result within the analytical range. An artificial neural network based on the multi-layer perceptron (MLP-ANN) was used to infer the starting dilution status of sFLC samples based on the information available through the laboratory information system (LIS). After the learning phase, the MLP-ANN simulation was applied to the nephelometric testing routinely performed in our laboratory on a BN ProSpec® System analyzer (Siemens Helathcare) using the N Latex FLC kit. The MLP-ANN reduced the serum kappa free light chain (κ-FLC) and serum lambda free light chain (λ-FLC) wasted tests by 69.4% and 70.8% with respect to the naïve stepwise dilution scheme used by the automated analyzer, and by 64.9% and 66.9% compared to a "rational" dilution scheme based on a 4-step dilution. Although it was restricted to follow-up samples, the MLP-ANN showed good predictive performance, which alongside the possibility to implement it in any automated system, made it a suitable solution for achieving streamlined laboratory processes and saving resources.

Scoring in genetically modified organism proficiency tests based on log-transformed results.

PubMed

Thompson, Michael; Ellison, Stephen L R; Owen, Linda; Mathieson, Kenneth; Powell, Joanne; Key, Pauline; Wood, Roger; Damant, Andrew P

2006-01-01

The study considers data from 2 UK-based proficiency schemes and includes data from a total of 29 rounds and 43 test materials over a period of 3 years. The results from the 2 schemes are similar and reinforce each other. The amplification process used in quantitative polymerase chain reaction determinations predicts a mixture of normal, binomial, and lognormal distributions dominated by the latter 2. As predicted, the study results consistently follow a positively skewed distribution. Log-transformation prior to calculating z-scores is effective in establishing near-symmetric distributions that are sufficiently close to normal to justify interpretation on the basis of the normal distribution.

A security and privacy preserving e-prescription system based on smart cards.

PubMed

Hsu, Chien-Lung; Lu, Chung-Fu

2012-12-01

In 2002, Ateniese and Medeiros proposed an e-prescription system, in which the patient can store e-prescription and related information using smart card. Latter, Yang et al. proposed a novel smart-card based e-prescription system based on Ateniese and Medeiros's system in 2004. Yang et al. considered the privacy issues of prescription data and adopted the concept of a group signature to provide patient's privacy protection. To make the e-prescription system more realistic, they further applied a proxy signature to allow a patient to delegate his signing capability to other people. This paper proposed a novel security and privacy preserving e-prescription system model based on smart cards. A new role, chemist, is included in the system model for settling the medicine dispute. We further presented a concrete identity-based (ID-based) group signature scheme and an ID-based proxy signature scheme to realize the proposed model. Main property of an ID-based system is that public key is simple user's identity and can be verified without extra public key certificates. Our ID-based group signature scheme can allow doctors to sign e-prescription anonymously. In a case of a medical dispute, identities of the doctors can be identified. The proposed ID-based proxy signature scheme can improve signing delegation and allows a delegation chain. The proposed e-prescription system based on our proposed two cryptographic schemes is more practical and efficient than Yang et al.'s system in terms of security, communication overheads, computational costs, practical considerations.

The value of supply chain coordination under moral hazard: A case study of the consumer product supply chain.

PubMed

Lee, Yumi; Song, Sang Hwa; Cheong, Taesu

2018-01-01

In this paper, we examine a real-world case related to the consumer product supply chain to analyze the value of supply chain coordination under the condition of moral hazard. Because of the characteristics of a buyback contract scheme employed in the supply chain, the supplier company's sales department encourages retailers to order more inventory to meet their sales target, whereas retailers pay less attention to their inventory level and leftovers at the end of the season. This condition induces moral hazard problems in the operation of the supply chain, as suppliers suffer from huge returns of leftover inventory. This, in turn, is related to the obsolescence of returned inventory, even with penalty terms in the contract for the return of any leftovers. In this study, we show under the current buyback-based supply chain operation, the inventory levels of both the supplier and retailers exceed customer demand and develop vendor-managed inventory (VMI) system with base stock policy to remove any mismatch of supply and demand. A comparison of both systems shows that through the proper coordination of supply chain operations, both suppliers and retailers can gain additional benefits while providing proper services to end customers.

Self-consistent field theory and numerical scheme for calculating the phase diagram of wormlike diblock copolymers

NASA Astrophysics Data System (ADS)

Jiang, Ying; Chen, Jeff Z. Y.

2013-10-01

This paper concerns establishing a theoretical basis and numerical scheme for studying the phase behavior of AB diblock copolymers made of wormlike chains. The general idea of a self-consistent field theory is the combination of the mean-field approach together with a statistical weight that describes the configurational properties of a polymer chain. In recent years, this approach has been extensively used for structural prediction of block copolymers, based on the Gaussian-model description of a polymer chain. The wormlike-chain model has played an important role in the description of polymer systems, covering the semiflexible-to-rod crossover of the polymer properties and the highly stretching regime, which the Gaussian-chain model has difficulties to describe. Although the idea of developing a self-consistent field theory for wormlike chains could be traced back to early development in polymer physics, the solution of such a theory has been limited due to technical difficulties. In particular, a challenge has been to develop a numerical algorithm enabling the calculation of the phase diagram containing three-dimensional structures for wormlike AB diblock copolymers. This paper describes a computational algorithm that combines a number of numerical tricks, which can be used for such a calculation. A phase diagram covering major parameter areas was constructed for the wormlike-chain system and reported by us, where the ratio between the total length and the persistence length of a constituent polymer is suggested as another tuning parameter for the microphase-separated structures; all detailed technical issues are carefully addressed in the current paper.

Cost-effective handoff scheme based on mobility-aware dual pointer forwarding in proxy mobile IPv6 networks.

PubMed

Son, Seungsik; Jeong, Jongpil

2014-01-01

In this paper, a mobility-aware Dual Pointer Forwarding scheme (mDPF) is applied in Proxy Mobile IPv6 (PMIPv6) networks. The movement of a Mobile Node (MN) is classified as intra-domain and inter-domain handoff. When the MN moves, this scheme can reduce the high signaling overhead for intra-handoff/inter-handoff, because the Local Mobility Anchor (LMA) and Mobile Access Gateway (MAG) are connected by pointer chains. In other words, a handoff is aware of low mobility between the previously attached MAG (pMAG) and newly attached MAG (nMAG), and another handoff between the previously attached LMA (pLMA) and newly attached LMA (nLMA) is aware of high mobility. Based on these mobility-aware binding updates, the overhead of the packet delivery can be reduced. Also, we analyse the binding update cost and packet delivery cost for route optimization, based on the mathematical analytic model. Analytical results show that our mDPF outperforms the PMIPv6 and the other pointer forwarding schemes, in terms of reducing the total cost of signaling.

Mathematical model of the loan portfolio dynamics in the form of Markov chain considering the process of new customers attraction

NASA Astrophysics Data System (ADS)

Bozhalkina, Yana

2017-12-01

Mathematical model of the loan portfolio structure change in the form of Markov chain is explored. This model considers in one scheme both the process of customers attraction, their selection based on the credit score, and loans repayment. The model describes the structure and volume of the loan portfolio dynamics, which allows to make medium-term forecasts of profitability and risk. Within the model corrective actions of bank management in order to increase lending volumes or to reduce the risk are formalized.

Alternative industrial carbon emissions benchmark based on input-output analysis

NASA Astrophysics Data System (ADS)

Han, Mengyao; Ji, Xi

2016-12-01

Some problems exist in the current carbon emissions benchmark setting systems. The primary consideration for industrial carbon emissions standards highly relate to direct carbon emissions (power-related emissions) and only a portion of indirect emissions are considered in the current carbon emissions accounting processes. This practice is insufficient and may cause double counting to some extent due to mixed emission sources. To better integrate and quantify direct and indirect carbon emissions, an embodied industrial carbon emissions benchmark setting method is proposed to guide the establishment of carbon emissions benchmarks based on input-output analysis. This method attempts to link direct carbon emissions with inter-industrial economic exchanges and systematically quantifies carbon emissions embodied in total product delivery chains. The purpose of this study is to design a practical new set of embodied intensity-based benchmarks for both direct and indirect carbon emissions. Beijing, at the first level of carbon emissions trading pilot schemes in China, plays a significant role in the establishment of these schemes and is chosen as an example in this study. The newly proposed method tends to relate emissions directly to each responsibility in a practical way through the measurement of complex production and supply chains and reduce carbon emissions from their original sources. This method is expected to be developed under uncertain internal and external contexts and is further expected to be generalized to guide the establishment of industrial benchmarks for carbon emissions trading schemes in China and other countries.

Learning-based position control of a closed-kinematic chain robot end-effector

NASA Technical Reports Server (NTRS)

Nguyen, Charles C.; Zhou, Zhen-Lei

1990-01-01

A trajectory control scheme whose design is based on learning theory, for a six-degree-of-freedom (DOF) robot end-effector built to study robotic assembly of NASA hardwares in space is presented. The control scheme consists of two control systems: the feedback control system and the learning control system. The feedback control system is designed using the concept of linearization about a selected operating point, and the method of pole placement so that the closed-loop linearized system is stabilized. The learning control scheme consisting of PD-type learning controllers, provides additional inputs to improve the end-effector performance after each trial. Experimental studies performed on a 2 DOF end-effector built at CUA, for three tracking cases show that actual trajectories approach desired trajectories as the number of trials increases. The tracking errors are substantially reduced after only five trials.

Joint-space adaptive control of a 6 DOF end-effector with closed-kinematic chain mechanism

NASA Technical Reports Server (NTRS)

Nguyen, Charles C.; Zhou, Zhen-Lei

1989-01-01

The development is presented for a joint-space adaptive scheme that controls the joint position of a six-degree-of-freedom (DOF) robot end-effector performing fine and precise motion within a very limited workspace. The end-effector was built to study autonomous assembly of NASA hardware in space. The design of the adaptive controller is based on the concept of model reference adaptive control (MRAC) and Lyapunov direct method. In the development, it is assumed that the end-effector performs slowly varying motion. Computer simulation is performed to investigate the performance of the developed control scheme on position control of the end-effector. Simulation results manifest that the adaptive control scheme provides excellent tracking of several test paths.

The value of supply chain coordination under moral hazard: A case study of the consumer product supply chain

PubMed Central

Lee, Yumi; Song, Sang Hwa

2018-01-01

In this paper, we examine a real-world case related to the consumer product supply chain to analyze the value of supply chain coordination under the condition of moral hazard. Because of the characteristics of a buyback contract scheme employed in the supply chain, the supplier company’s sales department encourages retailers to order more inventory to meet their sales target, whereas retailers pay less attention to their inventory level and leftovers at the end of the season. This condition induces moral hazard problems in the operation of the supply chain, as suppliers suffer from huge returns of leftover inventory. This, in turn, is related to the obsolescence of returned inventory, even with penalty terms in the contract for the return of any leftovers. In this study, we show under the current buyback-based supply chain operation, the inventory levels of both the supplier and retailers exceed customer demand and develop vendor-managed inventory (VMI) system with base stock policy to remove any mismatch of supply and demand. A comparison of both systems shows that through the proper coordination of supply chain operations, both suppliers and retailers can gain additional benefits while providing proper services to end customers. PMID:29547625

Local sensory control of a dexterous end effector

NASA Technical Reports Server (NTRS)

Pinto, Victor H.; Everett, Louis J.; Driels, Morris

1990-01-01

A numerical scheme was developed to solve the inverse kinematics for a user-defined manipulator. The scheme was based on a nonlinear least-squares technique which determines the joint variables by minimizing the difference between the target end effector pose and the actual end effector pose. The scheme was adapted to a dexterous hand in which the joints are either prismatic or revolute and the fingers are considered open kinematic chains. Feasible solutions were obtained using a three-fingered dexterous hand. An algorithm to estimate the position and orientation of a pre-grasped object was also developed. The algorithm was based on triangulation using an ideal sensor and a spherical object model. By choosing the object to be a sphere, only the position of the object frame was important. Based on these simplifications, a minimum of three sensors are needed to find the position of a sphere. A two dimensional example to determine the position of a circle coordinate frame using a two-fingered dexterous hand was presented.

Improved genetic algorithm for the protein folding problem by use of a Cartesian combination operator.

PubMed Central

Rabow, A. A.; Scheraga, H. A.

1996-01-01

We have devised a Cartesian combination operator and coding scheme for improving the performance of genetic algorithms applied to the protein folding problem. The genetic coding consists of the C alpha Cartesian coordinates of the protein chain. The recombination of the genes of the parents is accomplished by: (1) a rigid superposition of one parent chain on the other, to make the relation of Cartesian coordinates meaningful, then, (2) the chains of the children are formed through a linear combination of the coordinates of their parents. The children produced with this Cartesian combination operator scheme have similar topology and retain the long-range contacts of their parents. The new scheme is significantly more efficient than the standard genetic algorithm methods for locating low-energy conformations of proteins. The considerable superiority of genetic algorithms over Monte Carlo optimization methods is also demonstrated. We have also devised a new dynamic programming lattice fitting procedure for use with the Cartesian combination operator method. The procedure finds excellent fits of real-space chains to the lattice while satisfying bond-length, bond-angle, and overlap constraints. PMID:8880904

Concept of combinatorial de novo design of drug-like molecules by particle swarm optimization.

PubMed

Hartenfeller, Markus; Proschak, Ewgenij; Schüller, Andreas; Schneider, Gisbert

2008-07-01

We present a fast stochastic optimization algorithm for fragment-based molecular de novo design (COLIBREE, Combinatorial Library Breeding). The search strategy is based on a discrete version of particle swarm optimization. Molecules are represented by a scaffold, which remains constant during optimization, and variable linkers and side chains. Different linkers represent virtual chemical reactions. Side-chain building blocks were obtained from pseudo-retrosynthetic dissection of large compound databases. Here, ligand-based design was performed using chemically advanced template search (CATS) topological pharmacophore similarity to reference ligands as fitness function. A weighting scheme was included for particle swarm optimization-based molecular design, which permits the use of many reference ligands and allows for positive and negative design to be performed simultaneously. In a case study, the approach was applied to the de novo design of potential peroxisome proliferator-activated receptor subtype-selective agonists. The results demonstrate the ability of the technique to cope with large combinatorial chemistry spaces and its applicability to focused library design. The technique was able to perform exploitation of a known scheme and at the same time explorative search for novel ligands within the framework of a given molecular core structure. It thereby represents a practical solution for compound screening in the early hit and lead finding phase of a drug discovery project.

Extracting entangled qubits from Majorana fermions in quantum dot chains through the measurement of parity

PubMed Central

Dai, Li; Kuo, Watson; Chung, Ming-Chiang

2015-01-01

We propose a scheme for extracting entangled charge qubits from quantum-dot chains that support zero-energy edge modes. The edge mode is composed of Majorana fermions localized at the ends of each chain. The qubit, logically encoded in double quantum dots, can be manipulated through tunneling and pairing interactions between them. The detailed form of the entangled state depends on both the parity measurement (an even or odd number) of the boundary-site electrons in each chain and the teleportation between the chains. The parity measurement is realized through the dispersive coupling of coherent-state microwave photons to the boundary sites, while the teleportation is performed via Bell measurements. Our scheme illustrates localizable entanglement in a fermionic system, which serves feasibly as a quantum repeater under realistic experimental conditions, as it allows for finite temperature effect and is robust against disorders, decoherence and quasi-particle poisoning. PMID:26062033

Quantum communication through an unmodulated spin chain.

PubMed

Bose, Sougato

2003-11-14

We propose a scheme for using an unmodulated and unmeasured spin chain as a channel for short distance quantum communications. The state to be transmitted is placed on one spin of the chain and received later on a distant spin with some fidelity. We first obtain simple expressions for the fidelity of quantum state transfer and the amount of entanglement sharable between any two sites of an arbitrary Heisenberg ferromagnet using our scheme. We then apply this to the realizable case of an open ended chain with nearest neighbor interactions. The fidelity of quantum state transfer is obtained as an inverse discrete cosine transform and as a Bessel function series. We find that in a reasonable time, a qubit can be directly transmitted with better than classical fidelity across the full length of chains of up to 80 spins. Moreover, our channel allows distillable entanglement to be shared over arbitrary distances.

Blending Determinism with Evolutionary Computing: Applications to the Calculation of the Molecular Electronic Structure of Polythiophene.

PubMed

Sarkar, Kanchan; Sharma, Rahul; Bhattacharyya, S P

2010-03-09

A density matrix based soft-computing solution to the quantum mechanical problem of computing the molecular electronic structure of fairly long polythiophene (PT) chains is proposed. The soft-computing solution is based on a "random mutation hill climbing" scheme which is modified by blending it with a deterministic method based on a trial single-particle density matrix [P((0))(R)] for the guessed structural parameters (R), which is allowed to evolve under a unitary transformation generated by the Hamiltonian H(R). The Hamiltonian itself changes as the geometrical parameters (R) defining the polythiophene chain undergo mutation. The scale (λ) of the transformation is optimized by making the energy [E(λ)] stationary with respect to λ. The robustness and the performance levels of variants of the algorithm are analyzed and compared with those of other derivative free methods. The method is further tested successfully with optimization of the geometry of bipolaron-doped long PT chains.

Probability distributions for Markov chain based quantum walks

NASA Astrophysics Data System (ADS)

Balu, Radhakrishnan; Liu, Chaobin; Venegas-Andraca, Salvador E.

2018-01-01

We analyze the probability distributions of the quantum walks induced from Markov chains by Szegedy (2004). The first part of this paper is devoted to the quantum walks induced from finite state Markov chains. It is shown that the probability distribution on the states of the underlying Markov chain is always convergent in the Cesaro sense. In particular, we deduce that the limiting distribution is uniform if the transition matrix is symmetric. In the case of a non-symmetric Markov chain, we exemplify that the limiting distribution of the quantum walk is not necessarily identical with the stationary distribution of the underlying irreducible Markov chain. The Szegedy scheme can be extended to infinite state Markov chains (random walks). In the second part, we formulate the quantum walk induced from a lazy random walk on the line. We then obtain the weak limit of the quantum walk. It is noted that the current quantum walk appears to spread faster than its counterpart-quantum walk on the line driven by the Grover coin discussed in literature. The paper closes with an outlook on possible future directions.

Packaging waste prevention in the distribution of fruit and vegetables: An assessment based on the life cycle perspective.

PubMed

Tua, Camilla; Nessi, Simone; Rigamonti, Lucia; Dolci, Giovanni; Grosso, Mario

2017-04-01

In recent years, alternative food supply chains based on short distance production and delivery have been promoted as being more environmentally friendly than those applied by the traditional retailing system. An example is the supply of seasonal and possibly locally grown fruit and vegetables directly to customers inside a returnable crate (the so-called 'box scheme'). In addition to other claimed environmental and economic advantages, the box scheme is often listed among the packaging waste prevention measures. To check whether such a claim is soundly based, a life cycle assessment was carried out to verify the real environmental effectiveness of the box scheme in comparison to the Italian traditional distribution. The study focused on two reference products, carrots and apples, which are available in the crate all year round. An experience of a box scheme carried out in Italy was compared with some traditional scenarios where the product is distributed loose or packaged at the large-scale retail trade. The packaging waste generation, 13 impact indicators on environment and human health and energy consumptions were calculated. Results show that the analysed experience of the box scheme, as currently managed, cannot be considered a packaging waste prevention measure when compared with the traditional distribution of fruit and vegetables. The weaknesses of the alternative system were identified and some recommendations were given to improve its environmental performance.

Study on the supply chain of an enterprise based on axiomatic design

NASA Astrophysics Data System (ADS)

Fan, Shu-hai; Lin, Chao-qun; Ji, Chun; Zhou, Ce; Chen, Peng

2018-06-01

This paper first expounds the basic theoretical knowledge of axiomatic design, and then designs and improves the enterprise supply chain through two design axioms (axiom of independence and information axiom). In the axiomatic design of the axiom of independence, the user needs to determine the needs and problems to be solved, to determine the top total goals, the total goal decomposition, and to determine their own design equations. In the application of information axiom, the concept of cloud is used to quantify the amount of information, and the two schemes are evaluated and compared. Finally, through axiomatic design, we can get the best solution for the improvement of supply chain design. Axiomatic design is a generic, systematic and sophisticated approach to design that addresses the needs of different customers. Using this method to improve the level of supply chain management is creative. As a mature method, it will make the process efficient and convenient.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bertholon, François; Harant, Olivier; Bourlon, Bertrand

This article introduces a joined Bayesian estimation of gas samples issued from a gas chromatography column (GC) coupled with a NEMS sensor based on Giddings Eyring microscopic molecular stochastic model. The posterior distribution is sampled using a Monte Carlo Markov Chain and Gibbs sampling. Parameters are estimated using the posterior mean. This estimation scheme is finally applied on simulated and real datasets using this molecular stochastic forward model.

Test of the ``radical-like polymerization'' scheme in molecular dynamics on the behavior of polymers under shock loading

NASA Astrophysics Data System (ADS)

Lemarchand, Claire; Bousquet, David; Schnell, Benoît; Pineau, Nicolas

2017-06-01

The behavior of polymer melts under shock loading is a question attracting more and more attention because of applications such as polymer-bonded explosives, light-weight armor and civilian protective equipment, like sports and car equipment. Molecular dynamics (MD) simulations are a very good tool to characterize the microscopic response of the polymer to a shock wave. To do so, the initial configuration of the polymer melt needs to be realistic. The ``radical-like polymerization'' scheme is a method to obtain near equilibrium configurations of a melt of long polymer chains. It consists in adding one neighboring monomer at a time to each growing chain. Between each polymerization step an MD run is performed to relax the new configuration. We test how details of our implementation of the ``radical-like polymerization'' scheme can impact or not Hugoniot curves and changes of chain configuration under shock. We compare our results to other simulation and experimental results on reference polymers.

Optimization of Location-Routing Problem for Cold Chain Logistics Considering Carbon Footprint.

PubMed

Wang, Songyi; Tao, Fengming; Shi, Yuhe

2018-01-06

In order to solve the optimization problem of logistics distribution system for fresh food, this paper provides a low-carbon and environmental protection point of view, based on the characteristics of perishable products, and combines with the overall optimization idea of cold chain logistics distribution network, where the green and low-carbon location-routing problem (LRP) model in cold chain logistics is developed with the minimum total costs as the objective function, which includes carbon emission costs. A hybrid genetic algorithm with heuristic rules is designed to solve the model, and an example is used to verify the effectiveness of the algorithm. Furthermore, the simulation results obtained by a practical numerical example show the applicability of the model while provide green and environmentally friendly location-distribution schemes for the cold chain logistics enterprise. Finally, carbon tax policies are introduced to analyze the impact of carbon tax on the total costs and carbon emissions, which proves that carbon tax policy can effectively reduce carbon dioxide emissions in cold chain logistics network.

Surface-induced effects in fluctuation-based measurements of single-polymer elasticity: A direct probe of the radius of gyration

NASA Astrophysics Data System (ADS)

Innes-Gold, Sarah N.; Morgan, Ian L.; Saleh, Omar A.

2018-03-01

Single-molecule measurements of polymer elasticity are powerful, direct probes of both biomolecular structure and principles of polymer physics. Recent work has revealed low-force regimes in which biopolymer elasticity is understood through blob-based scaling models. However, the small tensions required to observe these regimes have the potential to create measurement biases, particularly due to the increased interactions of the polymer chain with tethering surfaces. Here, we examine one experimentally observed bias, in which fluctuation-based estimates of elasticity report an unexpectedly low chain compliance. We show that the effect is in good agreement with predictions based on quantifying the exclusion effect of the surface through an image-method calculation of available polymer configurations. The analysis indicates that the effect occurs at an external tension inversely proportional to the polymer's zero-tension radius of gyration. We exploit this to demonstrate a self-consistent scheme for estimating the radius of gyration of the tethered polymer. This is shown in measurements of both hyaluronic acid and poly(ethylene glycol) chains.

Fuzzy Markov random fields versus chains for multispectral image segmentation.

PubMed

Salzenstein, Fabien; Collet, Christophe

2006-11-01

This paper deals with a comparison of recent statistical models based on fuzzy Markov random fields and chains for multispectral image segmentation. The fuzzy scheme takes into account discrete and continuous classes which model the imprecision of the hidden data. In this framework, we assume the dependence between bands and we express the general model for the covariance matrix. A fuzzy Markov chain model is developed in an unsupervised way. This method is compared with the fuzzy Markovian field model previously proposed by one of the authors. The segmentation task is processed with Bayesian tools, such as the well-known MPM (Mode of Posterior Marginals) criterion. Our goal is to compare the robustness and rapidity for both methods (fuzzy Markov fields versus fuzzy Markov chains). Indeed, such fuzzy-based procedures seem to be a good answer, e.g., for astronomical observations when the patterns present diffuse structures. Moreover, these approaches allow us to process missing data in one or several spectral bands which correspond to specific situations in astronomy. To validate both models, we perform and compare the segmentation on synthetic images and raw multispectral astronomical data.

A parallel algorithm for step- and chain-growth polymerization in molecular dynamics.

PubMed

de Buyl, Pierre; Nies, Erik

2015-04-07

Classical Molecular Dynamics (MD) simulations provide insight into the properties of many soft-matter systems. In some situations, it is interesting to model the creation of chemical bonds, a process that is not part of the MD framework. In this context, we propose a parallel algorithm for step- and chain-growth polymerization that is based on a generic reaction scheme, works at a given intrinsic rate and produces continuous trajectories. We present an implementation in the ESPResSo++ simulation software and compare it with the corresponding feature in LAMMPS. For chain growth, our results are compared to the existing simulation literature. For step growth, a rate equation is proposed for the evolution of the crosslinker population that compares well to the simulations for low crosslinker functionality or for short times.

A parallel algorithm for step- and chain-growth polymerization in molecular dynamics

NASA Astrophysics Data System (ADS)

de Buyl, Pierre; Nies, Erik

2015-04-01

Classical Molecular Dynamics (MD) simulations provide insight into the properties of many soft-matter systems. In some situations, it is interesting to model the creation of chemical bonds, a process that is not part of the MD framework. In this context, we propose a parallel algorithm for step- and chain-growth polymerization that is based on a generic reaction scheme, works at a given intrinsic rate and produces continuous trajectories. We present an implementation in the ESPResSo++ simulation software and compare it with the corresponding feature in LAMMPS. For chain growth, our results are compared to the existing simulation literature. For step growth, a rate equation is proposed for the evolution of the crosslinker population that compares well to the simulations for low crosslinker functionality or for short times.

A supply chain contract with flexibility as a risk-sharing mechanism for demand forecasting

NASA Astrophysics Data System (ADS)

Kim, Whan-Seon

2013-06-01

Demand forecasting is one of the main causes of the bullwhip effect in a supply chain. As a countermeasure for demand uncertainty as well as a risk-sharing mechanism for demand forecasting in a supply chain, this article studies a bilateral contract with order quantity flexibility. Under the contract, the buyer places orders in advance for the predetermined horizons and makes minimum purchase commitments. The supplier, in return, provides the buyer with the flexibility to adjust the order quantities later, according to the most updated demand information. To conduct comparative simulations, four-echelon supply chain models, that employ the contracts and different forecasting techniques under dynamic market demands, are developed. The simulation outcomes show that demand fluctuation can be effectively absorbed by the contract scheme, which enables better inventory management and customer service. Furthermore, it has been verified that the contract scheme under study plays a role as an effective coordination mechanism in a decentralised supply chain.

Model-free learning on robot kinematic chains using a nested multi-agent topology

NASA Astrophysics Data System (ADS)

Karigiannis, John N.; Tzafestas, Costas S.

2016-11-01

This paper proposes a model-free learning scheme for the developmental acquisition of robot kinematic control and dexterous manipulation skills. The approach is based on a nested-hierarchical multi-agent architecture that intuitively encapsulates the topology of robot kinematic chains, where the activity of each independent degree-of-freedom (DOF) is finally mapped onto a distinct agent. Each one of those agents progressively evolves a local kinematic control strategy in a game-theoretic sense, that is, based on a partial (local) view of the whole system topology, which is incrementally updated through a recursive communication process according to the nested-hierarchical topology. Learning is thus approached not through demonstration and training but through an autonomous self-exploration process. A fuzzy reinforcement learning scheme is employed within each agent to enable efficient exploration in a continuous state-action domain. This paper constitutes in fact a proof of concept, demonstrating that global dexterous manipulation skills can indeed evolve through such a distributed iterative learning of local agent sensorimotor mappings. The main motivation behind the development of such an incremental multi-agent topology is to enhance system modularity, to facilitate extensibility to more complex problem domains and to improve robustness with respect to structural variations including unpredictable internal failures. These attributes of the proposed system are assessed in this paper through numerical experiments in different robot manipulation task scenarios, involving both single and multi-robot kinematic chains. The generalisation capacity of the learning scheme is experimentally assessed and robustness properties of the multi-agent system are also evaluated with respect to unpredictable variations in the kinematic topology. Furthermore, these numerical experiments demonstrate the scalability properties of the proposed nested-hierarchical architecture, where new agents can be recursively added in the hierarchy to encapsulate individual active DOFs. The results presented in this paper demonstrate the feasibility of such a distributed multi-agent control framework, showing that the solutions which emerge are plausible and near-optimal. Numerical efficiency and computational cost issues are also discussed.

Optimal Discrete Spatial Compression for Beamspace Massive MIMO Signals

NASA Astrophysics Data System (ADS)

Jiang, Zhiyuan; Zhou, Sheng; Niu, Zhisheng

2018-05-01

Deploying massive number of antennas at the base station side can boost the cellular system performance dramatically. Meanwhile, it however involves significant additional radio-frequency (RF) front-end complexity, hardware cost and power consumption. To address this issue, the beamspace-multiple-input-multiple-output (beamspace-MIMO) based approach is considered as a promising solution. In this paper, we first show that the traditional beamspace-MIMO suffers from spatial power leakage and imperfect channel statistics estimation. A beam combination module is hence proposed, which consists of a small number (compared with the number of antenna elements) of low-resolution (possibly one-bit) digital (discrete) phase shifters after the beamspace transformation to further compress the beamspace signal dimensionality, such that the number of RF chains can be reduced beyond beamspace transformation and beam selection. The optimum discrete beam combination weights for the uplink are obtained based on the branch-and-bound (BB) approach. The key to the BB-based solution is to solve the embodied sub-problem, whose solution is derived in a closed-form. Based on the solution, a sequential greedy beam combination scheme with linear-complexity (w.r.t. the number of beams in the beamspace) is proposed. Link-level simulation results based on realistic channel models and long-term-evolution (LTE) parameters are presented which show that the proposed schemes can reduce the number of RF chains by up to $25\\%$ with a one-bit digital phase-shifter-network.

Markov-chain model of classified atomistic transition states for discrete kinetic Monte Carlo simulations.

PubMed

Numazawa, Satoshi; Smith, Roger

2011-10-01

Classical harmonic transition state theory is considered and applied in discrete lattice cells with hierarchical transition levels. The scheme is then used to determine transitions that can be applied in a lattice-based kinetic Monte Carlo (KMC) atomistic simulation model. The model results in an effective reduction of KMC simulation steps by utilizing a classification scheme of transition levels for thermally activated atomistic diffusion processes. Thermally activated atomistic movements are considered as local transition events constrained in potential energy wells over certain local time periods. These processes are represented by Markov chains of multidimensional Boolean valued functions in three-dimensional lattice space. The events inhibited by the barriers under a certain level are regarded as thermal fluctuations of the canonical ensemble and accepted freely. Consequently, the fluctuating system evolution process is implemented as a Markov chain of equivalence class objects. It is shown that the process can be characterized by the acceptance of metastable local transitions. The method is applied to a problem of Au and Ag cluster growth on a rippled surface. The simulation predicts the existence of a morphology-dependent transition time limit from a local metastable to stable state for subsequent cluster growth by accretion. Excellent agreement with observed experimental results is obtained.

The design and analysis of mooring system

NASA Astrophysics Data System (ADS)

Li, Yixuan

2017-05-01

In this paper, the force status and a design method of single chain mooring system for shallow sea observation network are studied. With treating the link of a chain, steel drum and steel pipe as a rigid body, the recurrence model is established by using Newton's first law and the law of Moment equilibrium theorem. Via the simplified calculation of dichotomy searching, we determine the design parameters of mooring system, such as anchor model, anchor chain length, heavy ball quality under different water flow and wind conditions. We apply MATLAB to simulate the internal steady state of the system in the fixed scheme, water depth of buoy and swimming area to meet the decision-making needs, providing an idea for the actual scheme design of mooring system.

An Optimised System for Generating Multi-Resolution Dtms Using NASA Mro Datasets

NASA Astrophysics Data System (ADS)

Tao, Y.; Muller, J.-P.; Sidiropoulos, P.; Veitch-Michaelis, J.; Yershov, V.

2016-06-01

Within the EU FP-7 iMars project, a fully automated multi-resolution DTM processing chain, called Co-registration ASP-Gotcha Optimised (CASP-GO) has been developed, based on the open source NASA Ames Stereo Pipeline (ASP). CASP-GO includes tiepoint based multi-resolution image co-registration and an adaptive least squares correlation-based sub-pixel refinement method called Gotcha. The implemented system guarantees global geo-referencing compliance with respect to HRSC (and thence to MOLA), provides refined stereo matching completeness and accuracy based on the ASP normalised cross-correlation. We summarise issues discovered from experimenting with the use of the open-source ASP DTM processing chain and introduce our new working solutions. These issues include global co-registration accuracy, de-noising, dealing with failure in matching, matching confidence estimation, outlier definition and rejection scheme, various DTM artefacts, uncertainty estimation, and quality-efficiency trade-offs.

Market behavior and performance of different strategy evaluation schemes.

PubMed

Baek, Yongjoo; Lee, Sang Hoon; Jeong, Hawoong

2010-08-01

Strategy evaluation schemes are a crucial factor in any agent-based market model, as they determine the agents' strategy preferences and consequently their behavioral pattern. This study investigates how the strategy evaluation schemes adopted by agents affect their performance in conjunction with the market circumstances. We observe the performance of three strategy evaluation schemes, the history-dependent wealth game, the trend-opposing minority game, and the trend-following majority game, in a stock market where the price is exogenously determined. The price is either directly adopted from the real stock market indices or generated with a Markov chain of order ≤2 . Each scheme's success is quantified by average wealth accumulated by the traders equipped with the scheme. The wealth game, as it learns from the history, shows relatively good performance unless the market is highly unpredictable. The majority game is successful in a trendy market dominated by long periods of sustained price increase or decrease. On the other hand, the minority game is suitable for a market with persistent zigzag price patterns. We also discuss the consequence of implementing finite memory in the scoring processes of strategies. Our findings suggest under which market circumstances each evaluation scheme is appropriate for modeling the behavior of real market traders.

Local-feature analysis for automated coarse-graining of bulk-polymer molecular dynamics simulations.

PubMed

Xue, Y; Ludovice, P J; Grover, M A

2012-12-01

A method for automated coarse-graining of bulk polymers is presented, using the data-mining tool of local feature analysis. Most existing methods for polymer coarse-graining define superatoms based on their covalent bonding topology along the polymer backbone, but here superatoms are defined based only on their correlated motions, as observed in molecular dynamics simulations. Correlated atomic motions are identified in the simulation data using local feature analysis, between atoms in the same or in different polymer chains. Groups of highly correlated atoms constitute the superatoms in the coarse-graining scheme, and the positions of their seed coordinates are then projected forward in time. Based on only the seed positions, local feature analysis enables the full reconstruction of all atomic positions. This reconstruction suggests an iterative scheme to reduce the computation of the simulations to initialize another short molecular dynamic simulation, identify new superatoms, and again project forward in time.

An ellipsoid-chain model for conjugated polymer solutions

NASA Astrophysics Data System (ADS)

Lee, Cheng K.; Hua, Chi C.; Chen, Show A.

2012-02-01

We propose an ellipsoid-chain model which may be routinely parameterized to capture large-scale properties of semiflexible, amphiphilic conjugated polymers in various solvent media. The model naturally utilizes the defect locations as pivotal centers connecting adjacent ellipsoids (each currently representing ten monomer units), and a variant umbrella-sampling scheme is employed to construct the potentials of mean force (PMF) for specific solvent media using atomistic dynamics data and simplex optimization. The performances, both efficacy and efficiency, of the model are thoroughly evaluated by comparing the simulation results on long, single-chain (i.e., 300-mer) structures with those from two existing, finer-grained models for a standard conjugated polymer (i.e., poly(2-methoxy-5-(2'-ethylhexyloxy)-1,4-phenylenevinylene) or MEH-PPV) in two distinct solvents (i.e., chloroform or toluene) as well as a hybrid, binary-solvent medium (i.e., chloroform/toluene = 1:1 in number density). The coarse-grained Monte Carlo (CGMC) simulation of the ellipsoid-chain model is shown to be the most efficient—about 300 times faster than the coarse-grained molecular dynamics (CGMD) simulation of the finest CG model that employs explicit solvents—in capturing elementary single-chain structures for both single-solvent media, and is a few times faster than the coarse-grained Langevin dynamics (CGLD) simulation of another implicit-solvent polymer model with a slightly greater coarse-graining level than in the CGMD simulation. For the binary-solvent system considered, however, both of the two implicit-solvent schemes (i.e., CGMC and CGLD) fail to capture the effects of conspicuous concentration fluctuations near the polymer-solvent interface, arising from a pronounced coupling between the solvent molecules and different parts of the polymer. Essential physical implications are elaborated on the success as well as the failure of the two implicit-solvent CG schemes under varying solvent conditions. Within the ellipsoid-chain model, the impact of synthesized defects on local segmental ordering as well as bulk chain conformation is also scrutinized, and essential consequences in practical applications discussed. In future perspectives, we remark on strategy that takes advantage of the coordination among various CG models and simulation schemes to warrant computational efficiency and accuracy, with the anticipated capability of simulating larger-scale, many-chain aggregate systems.

Power Terminal Communication Access Network Monitoring System Scheme Based on Design Patterns

NASA Astrophysics Data System (ADS)

Yan, Shengchao; Wu, Desheng; Zhu, Jiang

2018-01-01

In order to realize patterns design for terminal communication monitoring system, this paper introduces manager-workers, tasks-workers design patterns, based on common design patterns such as factory method, chain of responsibility, facade. Using these patterns, the communication monitoring system which combines module-groups like networking communication, business data processing and the peripheral support has been designed successfully. Using these patterns makes this system have great flexibility and scalability and improves the degree of systematic pattern design structure.

Time-dependent density functional theory for open systems with a positivity-preserving decomposition scheme for environment spectral functions

NASA Astrophysics Data System (ADS)

Wang, RuLin; Zheng, Xiao; Kwok, YanHo; Xie, Hang; Chen, GuanHua; Yam, ChiYung

2015-04-01

Understanding electronic dynamics on material surfaces is fundamentally important for applications including nanoelectronics, inhomogeneous catalysis, and photovoltaics. Practical approaches based on time-dependent density functional theory for open systems have been developed to characterize the dissipative dynamics of electrons in bulk materials. The accuracy and reliability of such approaches depend critically on how the electronic structure and memory effects of surrounding material environment are accounted for. In this work, we develop a novel squared-Lorentzian decomposition scheme, which preserves the positive semi-definiteness of the environment spectral matrix. The resulting electronic dynamics is guaranteed to be both accurate and convergent even in the long-time limit. The long-time stability of electronic dynamics simulation is thus greatly improved within the current decomposition scheme. The validity and usefulness of our new approach are exemplified via two prototypical model systems: quasi-one-dimensional atomic chains and two-dimensional bilayer graphene.

Expert systems for automated maintenance of a Mars oxygen production system

NASA Astrophysics Data System (ADS)

Huang, Jen-Kuang; Ho, Ming-Tsang; Ash, Robert L.

1992-08-01

Application of expert system concepts to a breadboard Mars oxygen processor unit have been studied and tested. The research was directed toward developing the methodology required to enable autonomous operation and control of these simple chemical processors at Mars. Failure detection and isolation was the key area of concern, and schemes using forward chaining, backward chaining, knowledge-based expert systems, and rule-based expert systems were examined. Tests and simulations were conducted that investigated self-health checkout, emergency shutdown, and fault detection, in addition to normal control activities. A dynamic system model was developed using the Bond-Graph technique. The dynamic model agreed well with tests involving sudden reductions in throughput. However, nonlinear effects were observed during tests that incorporated step function increases in flow variables. Computer simulations and experiments have demonstrated the feasibility of expert systems utilizing rule-based diagnosis and decision-making algorithms.

Optimization of Location–Routing Problem for Cold Chain Logistics Considering Carbon Footprint

PubMed Central

Wang, Songyi; Tao, Fengming; Shi, Yuhe

2018-01-01

In order to solve the optimization problem of logistics distribution system for fresh food, this paper provides a low-carbon and environmental protection point of view, based on the characteristics of perishable products, and combines with the overall optimization idea of cold chain logistics distribution network, where the green and low-carbon location–routing problem (LRP) model in cold chain logistics is developed with the minimum total costs as the objective function, which includes carbon emission costs. A hybrid genetic algorithm with heuristic rules is designed to solve the model, and an example is used to verify the effectiveness of the algorithm. Furthermore, the simulation results obtained by a practical numerical example show the applicability of the model while provide green and environmentally friendly location-distribution schemes for the cold chain logistics enterprise. Finally, carbon tax policies are introduced to analyze the impact of carbon tax on the total costs and carbon emissions, which proves that carbon tax policy can effectively reduce carbon dioxide emissions in cold chain logistics network. PMID:29316639

Market behavior and performance of different strategy evaluation schemes

NASA Astrophysics Data System (ADS)

Baek, Yongjoo; Lee, Sang Hoon; Jeong, Hawoong

2010-08-01

Strategy evaluation schemes are a crucial factor in any agent-based market model, as they determine the agents’ strategy preferences and consequently their behavioral pattern. This study investigates how the strategy evaluation schemes adopted by agents affect their performance in conjunction with the market circumstances. We observe the performance of three strategy evaluation schemes, the history-dependent wealth game, the trend-opposing minority game, and the trend-following majority game, in a stock market where the price is exogenously determined. The price is either directly adopted from the real stock market indices or generated with a Markov chain of order ≤2 . Each scheme’s success is quantified by average wealth accumulated by the traders equipped with the scheme. The wealth game, as it learns from the history, shows relatively good performance unless the market is highly unpredictable. The majority game is successful in a trendy market dominated by long periods of sustained price increase or decrease. On the other hand, the minority game is suitable for a market with persistent zigzag price patterns. We also discuss the consequence of implementing finite memory in the scoring processes of strategies. Our findings suggest under which market circumstances each evaluation scheme is appropriate for modeling the behavior of real market traders.

Model-based Clustering of Categorical Time Series with Multinomial Logit Classification

NASA Astrophysics Data System (ADS)

Frühwirth-Schnatter, Sylvia; Pamminger, Christoph; Winter-Ebmer, Rudolf; Weber, Andrea

2010-09-01

A common problem in many areas of applied statistics is to identify groups of similar time series in a panel of time series. However, distance-based clustering methods cannot easily be extended to time series data, where an appropriate distance-measure is rather difficult to define, particularly for discrete-valued time series. Markov chain clustering, proposed by Pamminger and Frühwirth-Schnatter [6], is an approach for clustering discrete-valued time series obtained by observing a categorical variable with several states. This model-based clustering method is based on finite mixtures of first-order time-homogeneous Markov chain models. In order to further explain group membership we present an extension to the approach of Pamminger and Frühwirth-Schnatter [6] by formulating a probabilistic model for the latent group indicators within the Bayesian classification rule by using a multinomial logit model. The parameters are estimated for a fixed number of clusters within a Bayesian framework using an Markov chain Monte Carlo (MCMC) sampling scheme representing a (full) Gibbs-type sampler which involves only draws from standard distributions. Finally, an application to a panel of Austrian wage mobility data is presented which leads to an interesting segmentation of the Austrian labour market.

On the Multilevel Solution Algorithm for Markov Chains

NASA Technical Reports Server (NTRS)

Horton, Graham

1997-01-01

We discuss the recently introduced multilevel algorithm for the steady-state solution of Markov chains. The method is based on an aggregation principle which is well established in the literature and features a multiplicative coarse-level correction. Recursive application of the aggregation principle, which uses an operator-dependent coarsening, yields a multi-level method which has been shown experimentally to give results significantly faster than the typical methods currently in use. When cast as a multigrid-like method, the algorithm is seen to be a Galerkin-Full Approximation Scheme with a solution-dependent prolongation operator. Special properties of this prolongation lead to the cancellation of the computationally intensive terms of the coarse-level equations.

Voltage dependency of transmission probability of aperiodic DNA molecule

NASA Astrophysics Data System (ADS)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Markov chain Monte Carlo estimation of quantum states

NASA Astrophysics Data System (ADS)

Diguglielmo, James; Messenger, Chris; Fiurášek, Jaromír; Hage, Boris; Samblowski, Aiko; Schmidt, Tabea; Schnabel, Roman

2009-03-01

We apply a Bayesian data analysis scheme known as the Markov chain Monte Carlo to the tomographic reconstruction of quantum states. This method yields a vector, known as the Markov chain, which contains the full statistical information concerning all reconstruction parameters including their statistical correlations with no a priori assumptions as to the form of the distribution from which it has been obtained. From this vector we can derive, e.g., the marginal distributions and uncertainties of all model parameters, and also of other quantities such as the purity of the reconstructed state. We demonstrate the utility of this scheme by reconstructing the Wigner function of phase-diffused squeezed states. These states possess non-Gaussian statistics and therefore represent a nontrivial case of tomographic reconstruction. We compare our results to those obtained through pure maximum-likelihood and Fisher information approaches.

Nuclear Data Sheets for A = 161

DOE Office of Scientific and Technical Information (OSTI.GOV)

Reich C. W.; Reich C.W.

2011-10-01

The experimental results from the various reaction and radioactive decay studies leading to nuclides in the A = 161 mass chain have been reviewed. Nuclides ranging from Sm (Z = 62) through Os (Z = 76) are included, with Os being a new entry based on a recently reported study. These data are summarized and presented, together with adopted level schemes and properties. This work supersedes the previous evaluation (2000Re14) of the data on these nuclides.

Filetype Identification Using Long, Summarized N-Grams

DTIC Science & Technology

2011-03-01

compressed or encrypted data . If the algorithm used to compress or encrypt the data can be determined, then it is frequently possible to uncom- press...fragments. His implementation utilized the bzip2 library to compress the file fragments. The bzip2 library is based off the Lempel - Ziv -Markov chain... algorithm that uses a dictionary compression scheme to remove repeating data patterns within a set of data . The removed patterns are listed within the

Atomic-Oxygen Effects on POSS Polyimides in Low Earth Orbit

DTIC Science & Technology

2012-01-11

one. Figure 2. Reaction scheme for the synthesis of the N-[(hepta-isobutylPOSS) propyl ]-3,5- diaminobenzamide monomer used to prepare side-chain (SC...atomic oxygen. Earlier results from laboratory- and space-based studies are given, as well as new information on the synthesis and in-space...methods.39,40 Polyimide synthesis and processing was pioneered by workers at Dupont in the 1950’s, with Kapton being the first commercially

An integrated control scheme for space robot after capturing non-cooperative target

NASA Astrophysics Data System (ADS)

Wang, Mingming; Luo, Jianjun; Yuan, Jianping; Walter, Ulrich

2018-06-01

How to identify the mass properties and eliminate the unknown angular momentum of space robotic system after capturing a non-cooperative target is of great challenge. This paper focuses on designing an integrated control framework which includes detumbling strategy, coordination control and parameter identification. Firstly, inverted and forward chain approaches are synthesized for space robot to obtain dynamic equation in operational space. Secondly, a detumbling strategy is introduced using elementary functions with normalized time, while the imposed end-effector constraints are considered. Next, a coordination control scheme for stabilizing both base and end-effector based on impedance control is implemented with the target's parameter uncertainty. With the measurements of the forces and torques exerted on the target, its mass properties are estimated during the detumbling process accordingly. Simulation results are presented using a 7 degree-of-freedom kinematically redundant space manipulator, which verifies the performance and effectiveness of the proposed method.

Engineering single-polymer micelle shape using nonuniform spontaneous surface curvature

NASA Astrophysics Data System (ADS)

Moths, Brian; Witten, T. A.

2018-03-01

Conventional micelles, composed of simple amphiphiles, exhibit only a few standard morphologies, each characterized by its mean surface curvature set by the amphiphiles. Here we demonstrate a rational design scheme to construct micelles of more general shape from polymeric amphiphiles. We replace the many amphiphiles of a conventional micelle by a single flexible, linear, block copolymer chain containing two incompatible species arranged in multiple alternating segments. With suitable segment lengths, the chain exhibits a condensed spherical configuration in solution, similar to conventional micelles. Our design scheme posits that further shapes are attained by altering the segment lengths. As a first study of the power of this scheme, we demonstrate the capacity to produce long-lived micelles of horseshoe form using conventional bead-spring simulations in two dimensions. Modest changes in the segment lengths produce smooth changes in the micelle's shape and stability.

ALARA: The next link in a chain of activation codes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wilson, P.P.H.; Henderson, D.L.

1996-12-31

The Adaptive Laplace and Analytic Radioactivity Analysis [ALARA] code has been developed as the next link in the chain of DKR radioactivity codes. Its methods address the criticisms of DKR while retaining its best features. While DKR ignored loops in the transmutation/decay scheme to preserve the exactness of the mathematical solution, ALARA incorporates new computational approaches without jeopardizing the most important features of DKR`s physical modelling and mathematical methods. The physical model uses `straightened-loop, linear chains` to achieve the same accuracy in the loop solutions as is demanded in the rest of the scheme. In cases where a chain hasmore » no loops, the exact DKR solution is used. Otherwise, ALARA adaptively chooses between a direct Laplace inversion technique and a Laplace expansion inversion technique to optimize the accuracy and speed of the solution. All of these methods result in matrix solutions which allow the fastest and most accurate solution of exact pulsing histories. Since the entire history is solved for each chain as it is created, ALARA achieves the optimum combination of high accuracy, high speed and low memory usage. 8 refs., 2 figs.« less

Multiframe video coding for improved performance over wireless channels.

PubMed

Budagavi, M; Gibson, J D

2001-01-01

We propose and evaluate a multi-frame extension to block motion compensation (BMC) coding of videoconferencing-type video signals for wireless channels. The multi-frame BMC (MF-BMC) coder makes use of the redundancy that exists across multiple frames in typical videoconferencing sequences to achieve additional compression over that obtained by using the single frame BMC (SF-BMC) approach, such as in the base-level H.263 codec. The MF-BMC approach also has an inherent ability of overcoming some transmission errors and is thus more robust when compared to the SF-BMC approach. We model the error propagation process in MF-BMC coding as a multiple Markov chain and use Markov chain analysis to infer that the use of multiple frames in motion compensation increases robustness. The Markov chain analysis is also used to devise a simple scheme which randomizes the selection of the frame (amongst the multiple previous frames) used in BMC to achieve additional robustness. The MF-BMC coders proposed are a multi-frame extension of the base level H.263 coder and are found to be more robust than the base level H.263 coder when subjected to simulated errors commonly encountered on wireless channels.

The Present and Future of Whole Genome Sequencing (WGS) and Whole Metagenome Sequencing (WMS) for Surveillance of Antimicrobial Resistant Microorganisms and Antimicrobial Resistance Genes across the Food Chain

PubMed Central

Oniciuc, Elena A.; Likotrafiti, Eleni; Alvarez-Molina, Adrián; Alvarez-Ordóñez, Avelino

2018-01-01

Antimicrobial resistance (AMR) surveillance is a critical step within risk assessment schemes, as it is the basis for informing global strategies, monitoring the effectiveness of public health interventions, and detecting new trends and emerging threats linked to food. Surveillance of AMR is currently based on the isolation of indicator microorganisms and the phenotypic characterization of clinical, environmental and food strains isolated. However, this approach provides very limited information on the mechanisms driving AMR or on the presence or spread of AMR genes throughout the food chain. Whole-genome sequencing (WGS) of bacterial pathogens has shown potential for epidemiological surveillance, outbreak detection, and infection control. In addition, whole metagenome sequencing (WMS) allows for the culture-independent analysis of complex microbial communities, providing useful information on AMR genes occurrence. Both technologies can assist the tracking of AMR genes and mobile genetic elements, providing the necessary information for the implementation of quantitative risk assessments and allowing for the identification of hotspots and routes of transmission of AMR across the food chain. This review article summarizes the information currently available on the use of WGS and WMS for surveillance of AMR in foodborne pathogenic bacteria and food-related samples and discusses future needs that will have to be considered for the routine implementation of these next-generation sequencing methodologies with this aim. In particular, methodological constraints that impede the use at a global scale of these high-throughput sequencing (HTS) technologies are identified, and the standardization of methods and protocols is suggested as a measure to upgrade HTS-based AMR surveillance schemes. PMID:29789467

A binding energy study of the Atomic Mass Evaluation 2012 and an updated beta-decay study of neutron-rich 74Cu

NASA Astrophysics Data System (ADS)

Tracy, James L., Jr.

A study of ground state binding energy values listed in the Atomic Mass Evaluation 2012 (AME2012) using an interpretive approach, as opposed to the exploratory methods of previous models, is presented. This model is based on a postulate requiring all protons to pair with available neutrons to form bound alpha clusters as the ground state for an N = Z core upon which excess neutrons are added. For each core, the trend of the binding energy as a function of excess neutrons in the isotopic chain can be fit with a three-term quadratic function. The quadratic parameter reveals a smooth decaying exponential function. By re-envisioning the determination of mass excess, the constant-term fit parameters, representing N = Z nuclei, reveal a near-symmetry around Z = 50. The linear fit parameters exhibit trends which are linear functions of core size. A neutron drip-line prediction is compared against current models. By considering the possibility of an alpha-cluster core, a new ground-state structure grouping scheme is presented; nucleon-nucleon pairing is shown to have a greater role in level filling. This model, referred to as the Alpha-Deuteron-Neutron Model, yields promising first results when considering root-mean-square variances from the AME2012. The beta-decay of the neutron-rich isotope 74Cu has been studied using three high-purity Germanium clover detectors at the Holifield Radioactive Ion Beam Facility at Oak Ridge National Laboratory. A high-resolution mass separator greatly improved the purity of the 74Cu beam by removing isobaric contaminants, thus allowing decay through its isobar chain to the stable 74Ge at the center of the LeRIBSS detector array without any decay chain member dominating. Using coincidence gating techniques, 121 gamma-rays associated with 74Cu were isolated from the collective singles spectrum. Eighty-seven of these were placed in an expanded level scheme, and updated beta-feeding level intensities and log( ft) values are presented based on multiple newly-placed excited states up to 6.8 MeV. The progression of simulated Total Absorption gamma-ray Spectroscopy (TAGS) based on known levels and beta feeding values from previous measurements to this evaluation are presented and demonstrate the need for a TAGS measurement of this isotope to gain a more complete understanding of its decay scheme.

Optical solitons and modulation instability analysis of an integrable model of (2+1)-Dimensional Heisenberg ferromagnetic spin chain equation

NASA Astrophysics Data System (ADS)

Inc, Mustafa; Aliyu, Aliyu Isa; Yusuf, Abdullahi; Baleanu, Dumitru

2017-12-01

This paper addresses the nonlinear Schrödinger type equation (NLSE) in (2+1)-dimensions which describes the nonlinear spin dynamics of Heisenberg ferromagnetic spin chains (HFSC) with anisotropic and bilinear interactions in the semiclassical limit. Two integration schemes are employed to study the equation. These are the complex envelope function ansatz and the generalized tanh methods. Dark, dark-bright or combined optical and singular soliton solutions of the equation are derived. Furthermore, the modulational instability (MI) is studied based on the standard linear-stability analysis and the MI gain is got. Numerical simulation of the obtained results are analyzed with interesting figures showing the physical meaning of the solutions.

Tripartite counterfactual entanglement distribution.

PubMed

Chen, Yuanyuan; Gu, Xuemei; Jiang, Dong; Xie, Ling; Chen, Lijun

2015-08-10

We propose two counterfactual schemes for tripartite entanglement distribution without any physical particles travelling through the quantum channel. One scheme arranges three participators to connect with the absorption object by using switch. Using the "chained" quantum Zeno effect, three participators can accomplish the task of entanglement distribution with unique counterfactual interference probability. Another scheme uses Michelson-type interferometer to swap two entanglement pairs such that the photons of three participators are entangled. Moreover, the distance of entanglement distribution is doubled as two distant absorption objects are used. We also discuss the implementation issues to show that the proposed schemes can be realized with current technology.

Bayesian parameter inference for stochastic biochemical network models using particle Markov chain Monte Carlo

PubMed Central

Golightly, Andrew; Wilkinson, Darren J.

2011-01-01

Computational systems biology is concerned with the development of detailed mechanistic models of biological processes. Such models are often stochastic and analytically intractable, containing uncertain parameters that must be estimated from time course data. In this article, we consider the task of inferring the parameters of a stochastic kinetic model defined as a Markov (jump) process. Inference for the parameters of complex nonlinear multivariate stochastic process models is a challenging problem, but we find here that algorithms based on particle Markov chain Monte Carlo turn out to be a very effective computationally intensive approach to the problem. Approximations to the inferential model based on stochastic differential equations (SDEs) are considered, as well as improvements to the inference scheme that exploit the SDE structure. We apply the methodology to a Lotka–Volterra system and a prokaryotic auto-regulatory network. PMID:23226583

Selected spectroscopic results on element 115 decay chains

DOE PAGES

Rudolph, D.; Forsberg, U.; Golubev, P.; ...

2014-08-24

We observed thirty correlated α-decay chains in an experiment studying the fusion-evaporation reaction 48Ca + 243Am at the GSI Helmholtzzentrum fur Schwerionenforschung. The decay characteristics of the majority of these 30 chains are consistent with previous observations and interpretations of such chains to originate from isotopes of element Z = 115. High-resolution α-photon coincidence spectroscopy in conjunction with comprehensive Monte-Carlo simulations allow to propose excitation schemes of atomic nuclei of the heaviest elements, thereby probing nuclear structure models near the 'Island of Stability' with unprecedented experimental precision.

Electrostatic Estimation of Intercalant Jump-Diffusion Barriers Using Finite-Size Ion Models.

PubMed

Zimmermann, Nils E R; Hannah, Daniel C; Rong, Ziqin; Liu, Miao; Ceder, Gerbrand; Haranczyk, Maciej; Persson, Kristin A

2018-02-01

We report on a scheme for estimating intercalant jump-diffusion barriers that are typically obtained from demanding density functional theory-nudged elastic band calculations. The key idea is to relax a chain of states in the field of the electrostatic potential that is averaged over a spherical volume using different finite-size ion models. For magnesium migrating in typical intercalation materials such as transition-metal oxides, we find that the optimal model is a relatively large shell. This data-driven result parallels typical assumptions made in models based on Onsager's reaction field theory to quantitatively estimate electrostatic solvent effects. Because of its efficiency, our potential of electrostatics-finite ion size (PfEFIS) barrier estimation scheme will enable rapid identification of materials with good ionic mobility.

Colour analysis and verification of CCTV images under different lighting conditions

NASA Astrophysics Data System (ADS)

Smith, R. A.; MacLennan-Brown, K.; Tighe, J. F.; Cohen, N.; Triantaphillidou, S.; MacDonald, L. W.

2008-01-01

Colour information is not faithfully maintained by a CCTV imaging chain. Since colour can play an important role in identifying objects it is beneficial to be able to account accurately for changes to colour introduced by components in the chain. With this information it will be possible for law enforcement agencies and others to work back along the imaging chain to extract accurate colour information from CCTV recordings. A typical CCTV system has an imaging chain that may consist of scene, camera, compression, recording media and display. The response of each of these stages to colour scene information was characterised by measuring its response to a known input. The main variables that affect colour within a scene are illumination and the colour, orientation and texture of objects. The effects of illumination on the appearance of colour of a variety of test targets were tested using laboratory-based lighting, street lighting, car headlights and artificial daylight. A range of typical cameras used in CCTV applications, common compression schemes and representative displays were also characterised.

Study of the Characteristics of Elementary Processes in a Chain Hydrogen Burning Reaction in Oxygen

NASA Astrophysics Data System (ADS)

Bychkov, M. E.; Petrushevich, Yu. V.; Starostin, A. N.

2017-12-01

The characteristics of possible chain explosive hydrogen burning reactions in an oxidizing medium are calculated on the potential energy surface. Specifically, reactions H2 + O2 → H2O + O, H2 + O2 → HO2 + H, and H2 + O2 → OH + OH are considered. Special attention is devoted to the production of a pair of fast highly reactive OH radicals. Because of the high activation threshold, this reaction is often excluded from the known kinetic scheme of hydrogen burning. However, a spread in estimates of kinetic characteristics and a disagreement between theoretical predictions with experimental results suggest that the kinetic scheme should be refined.

Production of Diesel Engine Turbocharger Turbine from Low Cost Titanium Powder

DOE Office of Scientific and Technical Information (OSTI.GOV)

Muth, T. R.; Mayer, R.

2012-05-04

Turbochargers in commercial turbo-diesel engines are multi-material systems where usually the compressor rotor is made of aluminum or titanium based material and the turbine rotor is made of either a nickel based superalloy or titanium, designed to operate under the harsh exhaust gas conditions. The use of cast titanium in the turbine section has been used by Cummins Turbo Technologies since 1997. Having the benefit of a lower mass than the superalloy based turbines; higher turbine speeds in a more compact design can be achieved with titanium. In an effort to improve the cost model, and develop an industrial supplymore » of titanium componentry that is more stable than the traditional aerospace based supply chain, the Contractor has developed component manufacturing schemes that use economical Armstrong titanium and titanium alloy powders and MgR-HDH powders. Those manufacturing schemes can be applied to compressor and turbine rotor components for diesel engine applications with the potential of providing a reliable supply of titanium componentry with a cost and performance advantage over cast titanium.« less

Excess entropy scaling for the segmental and global dynamics of polyethylene melts.

PubMed

Voyiatzis, Evangelos; Müller-Plathe, Florian; Böhm, Michael C

2014-11-28

The range of validity of the Rosenfeld and Dzugutov excess entropy scaling laws is analyzed for unentangled linear polyethylene chains. We consider two segmental dynamical quantities, i.e. the bond and the torsional relaxation times, and two global ones, i.e. the chain diffusion coefficient and the viscosity. The excess entropy is approximated by either a series expansion of the entropy in terms of the pair correlation function or by an equation of state for polymers developed in the context of the self associating fluid theory. For the whole range of temperatures and chain lengths considered, the two estimates of the excess entropy are linearly correlated. The scaled bond and torsional relaxation times fall into a master curve irrespective of the chain length and the employed scaling scheme. Both quantities depend non-linearly on the excess entropy. For a fixed chain length, the reduced diffusion coefficient and viscosity scale linearly with the excess entropy. An empirical reduction to a chain length-independent master curve is accessible for both dynamic quantities. The Dzugutov scheme predicts an increased value of the scaled diffusion coefficient with increasing chain length which contrasts physical expectations. The origin of this trend can be traced back to the density dependence of the scaling factors. This finding has not been observed previously for Lennard-Jones chain systems (Macromolecules, 2013, 46, 8710-8723). Thus, it limits the applicability of the Dzugutov approach to polymers. In connection with diffusion coefficients and viscosities, the Rosenfeld scaling law appears to be of higher quality than the Dzugutov approach. An empirical excess entropy scaling is also proposed which leads to a chain length-independent correlation. It is expected to be valid for polymers in the Rouse regime.

Magnetism in (Semi)Conducting Macrocycles of pi conjugated Polymers

DTIC Science & Technology

2016-12-09

wise and avoiding a break in the continuity of the macrocycle. As a first criterion we tested the continuity of the electron orbitals over the...magnesium chloride) and post polymerization functionalization by a Sonogashira coupling reaction is required (scheme 2). Scheme 2: Synthetic...Sonogashira post - polymerization chain end functionalization and B isotopic model of the different population present in the final batch

Transition probabilities of health states for workers in Malaysia using a Markov chain model

NASA Astrophysics Data System (ADS)

Samsuddin, Shamshimah; Ismail, Noriszura

2017-04-01

The aim of our study is to estimate the transition probabilities of health states for workers in Malaysia who contribute to the Employment Injury Scheme under the Social Security Organization Malaysia using the Markov chain model. Our study uses four states of health (active, temporary disability, permanent disability and death) based on the data collected from the longitudinal studies of workers in Malaysia for 5 years. The transition probabilities vary by health state, age and gender. The results show that men employees are more likely to have higher transition probabilities to any health state compared to women employees. The transition probabilities can be used to predict the future health of workers in terms of a function of current age, gender and health state.

The 'Real Welfare' scheme: benchmarking welfare outcomes for commercially farmed pigs.

PubMed

Pandolfi, F; Stoddart, K; Wainwright, N; Kyriazakis, I; Edwards, S A

2017-10-01

Animal welfare standards have been incorporated in EU legislation and in farm assurance schemes, based on scientific information and aiming to safeguard the welfare of the species concerned. Recently, emphasis has shifted from resource-based measures of welfare to animal-based measures, which are considered to assess more accurately the welfare status. The data used in this analysis were collected from April 2013 to May 2016 through the 'Real Welfare' scheme in order to assess on-farm pig welfare, as required for those finishing pigs under the UK Red Tractor Assurance scheme. The assessment involved five main measures (percentage of pigs requiring hospitalization, percentage of lame pigs, percentage of pigs with severe tail lesions, percentage of pigs with severe body marks and enrichment use ratio) and optional secondary measures (percentage of pigs with mild tail lesions, percentage of pigs with dirty tails, percentage of pigs with mild body marks, percentage of pigs with dirty bodies), with associated information about the environment and the enrichment in the farms. For the complete database, a sample of pens was assessed from 1928 farm units. Repeated measures were taken in the same farm unit over time, giving 112 240 records at pen level. These concerned a total of 13 480 289 pigs present on the farm during the assessments, with 5 463 348 pigs directly assessed using the 'Real Welfare' protocol. The three most common enrichment types were straw, chain and plastic objects. The main substrate was straw which was present in 67.9% of the farms. Compared with 2013, a significant increase of pens with undocked-tail pigs, substrates and objects was observed over time (P0.3). The results from the first 3 years of the scheme demonstrate a reduction of the prevalence of animal-based measures of welfare problems and highlight the value of this initiative.

How old is this bird? The age distribution under some phase sampling schemes.

PubMed

Hautphenne, Sophie; Massaro, Melanie; Taylor, Peter

2017-12-01

In this paper, we use a finite-state continuous-time Markov chain with one absorbing state to model an individual's lifetime. Under this model, the time of death follows a phase-type distribution, and the transient states of the Markov chain are known as phases. We then attempt to provide an answer to the simple question "What is the conditional age distribution of the individual, given its current phase"? We show that the answer depends on how we interpret the question, and in particular, on the phase observation scheme under consideration. We then apply our results to the computation of the age pyramid for the endangered Chatham Island black robin Petroica traversi during the monitoring period 2007-2014.

A fiber orientation-adapted integration scheme for computing the hyperelastic Tucker average for short fiber reinforced composites

NASA Astrophysics Data System (ADS)

Goldberg, Niels; Ospald, Felix; Schneider, Matti

2017-10-01

In this article we introduce a fiber orientation-adapted integration scheme for Tucker's orientation averaging procedure applied to non-linear material laws, based on angular central Gaussian fiber orientation distributions. This method is stable w.r.t. fiber orientations degenerating into planar states and enables the construction of orthotropic hyperelastic energies for truly orthotropic fiber orientation states. We establish a reference scenario for fitting the Tucker average of a transversely isotropic hyperelastic energy, corresponding to a uni-directional fiber orientation, to microstructural simulations, obtained by FFT-based computational homogenization of neo-Hookean constituents. We carefully discuss ideas for accelerating the identification process, leading to a tremendous speed-up compared to a naive approach. The resulting hyperelastic material map turns out to be surprisingly accurate, simple to integrate in commercial finite element codes and fast in its execution. We demonstrate the capabilities of the extracted model by a finite element analysis of a fiber reinforced chain link.

Thermodynamics of quantum information scrambling

NASA Astrophysics Data System (ADS)

Campisi, Michele; Goold, John

2017-06-01

Scrambling of quantum information can conveniently be quantified by so-called out-of-time-order correlators (OTOCs), i.e., correlators of the type <[Wτ,V ] †[Wτ,V ] > , whose measurements present a formidable experimental challenge. Here we report on a method for the measurement of OTOCs based on the so-called two-point measurement scheme developed in the field of nonequilibrium quantum thermodynamics. The scheme is of broader applicability than methods employed in current experiments and provides a clear-cut interpretation of quantum information scrambling in terms of nonequilibrium fluctuations of thermodynamic quantities, such as work and heat. Furthermore, we provide a numerical example on a spin chain which highlights the utility of our thermodynamic approach when understanding the differences between integrable and ergodic behaviors. We also discuss how the method can be used to extend the reach of current experiments.

Imaging atoms from resonance fluorescence spectrum beyond the diffraction limit

NASA Astrophysics Data System (ADS)

Liao, Zeyang; Al-Amri, Mohammad; Zubairy, M. Suhail

2014-03-01

We calculate the resonance fluorescence spectrum of a linear chain of two-level atoms driven by a gradient coherent laser field. The result shows that we can determine the positions of atoms from the spectrum even when the atoms locate within subwavelength range and the dipole-dipole interaction is significant. This far-field resonance fluorescence localization microscopy method does not require point-by-point scanning and it may be more time-efficient. We also give a possible scheme to extract the position information in an extended region without requiring more peak power of laser. We also briefly discuss how to do a 2D imaging based on our scheme. This work is supported by grants from the King Abdulaziz City for Science and Technology (KACST) and the Qatar National Research Fund (QNRF) under the NPRP project.

2 + 1 Toda chain. I. Inverse scattering method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lipovskii, V.D.; Shirokov, A.V.

A formal scheme of the inverse scattering method is constructed for the2 + 1 Toda chain in the class of rapidly decreasing Cauchy data. Application of the inverse scattering method to the two-dimensional infinite Toda chain was made difficult by the circumstance that this system is a (2 + 1)-dimensional object, i.e., possesses time and two spatial variables, the role of one of these being played by the chain site number. Because of this, our information about the 2 + 1 Toda chain was limited to a rich set of particular solutions of soliton type obtained in the cycle ofmore » studies by the Darboux transformation method.« less

Applying different independent component analysis algorithms and support vector regression for IT chain store sales forecasting.

PubMed

Dai, Wensheng; Wu, Jui-Yu; Lu, Chi-Jie

2014-01-01

Sales forecasting is one of the most important issues in managing information technology (IT) chain store sales since an IT chain store has many branches. Integrating feature extraction method and prediction tool, such as support vector regression (SVR), is a useful method for constructing an effective sales forecasting scheme. Independent component analysis (ICA) is a novel feature extraction technique and has been widely applied to deal with various forecasting problems. But, up to now, only the basic ICA method (i.e., temporal ICA model) was applied to sale forecasting problem. In this paper, we utilize three different ICA methods including spatial ICA (sICA), temporal ICA (tICA), and spatiotemporal ICA (stICA) to extract features from the sales data and compare their performance in sales forecasting of IT chain store. Experimental results from a real sales data show that the sales forecasting scheme by integrating stICA and SVR outperforms the comparison models in terms of forecasting error. The stICA is a promising tool for extracting effective features from branch sales data and the extracted features can improve the prediction performance of SVR for sales forecasting.

Applying Different Independent Component Analysis Algorithms and Support Vector Regression for IT Chain Store Sales Forecasting

PubMed Central

Dai, Wensheng

2014-01-01

Sales forecasting is one of the most important issues in managing information technology (IT) chain store sales since an IT chain store has many branches. Integrating feature extraction method and prediction tool, such as support vector regression (SVR), is a useful method for constructing an effective sales forecasting scheme. Independent component analysis (ICA) is a novel feature extraction technique and has been widely applied to deal with various forecasting problems. But, up to now, only the basic ICA method (i.e., temporal ICA model) was applied to sale forecasting problem. In this paper, we utilize three different ICA methods including spatial ICA (sICA), temporal ICA (tICA), and spatiotemporal ICA (stICA) to extract features from the sales data and compare their performance in sales forecasting of IT chain store. Experimental results from a real sales data show that the sales forecasting scheme by integrating stICA and SVR outperforms the comparison models in terms of forecasting error. The stICA is a promising tool for extracting effective features from branch sales data and the extracted features can improve the prediction performance of SVR for sales forecasting. PMID:25165740

Field characteristics of an alvarez-type linac structure having chain-like electrode array

DOE Office of Scientific and Technical Information (OSTI.GOV)

Odera, M.; Goto, A.; Hemmi, M.

1985-10-01

A chain-like electrode configuration in an Alvarez-type linac cavity was studied by models. The structure has been devised to get a moderate shunt impedance together with simplicity of operation, in ion velocity region of more than a few percent of that of light by incorporating focusing scheme by high frequency quadrupolar fields into an TM-010 accelerating field of an Alvarez linac. It has a chain-like electrode array instead of drift tubes containing quadrupole lenses for ordinary linacs. The chain-like electrode structure generates along its central axis, high frequency acceleration and focusing fields alternately, separating the acceleration and focusing functions inmore » space. The separation discriminates this structure from spatially uniform acceleration and focusing scheme of the RFQs devised by Kapchinsky and Teplyakov. It gives beam acceleration effects different from those by conventional linacs and reveals possibility of getting a high acceleration efficiency. Resonant frequency spectrum was found relatively simple by measurements on high frequency models. Separation of unwanted modes from the TM-010 acceleration mode is large; a few 10 MHz, at least. Tilt of the acceleration field is not very sensitive to pertubation in gap capacitance for the TM-010 mode.« less

An Ensemble-Based Smoother with Retrospectively Updated Weights for Highly Nonlinear Systems

NASA Technical Reports Server (NTRS)

Chin, T. M.; Turmon, M. J.; Jewell, J. B.; Ghil, M.

2006-01-01

Monte Carlo computational methods have been introduced into data assimilation for nonlinear systems in order to alleviate the computational burden of updating and propagating the full probability distribution. By propagating an ensemble of representative states, algorithms like the ensemble Kalman filter (EnKF) and the resampled particle filter (RPF) rely on the existing modeling infrastructure to approximate the distribution based on the evolution of this ensemble. This work presents an ensemble-based smoother that is applicable to the Monte Carlo filtering schemes like EnKF and RPF. At the minor cost of retrospectively updating a set of weights for ensemble members, this smoother has demonstrated superior capabilities in state tracking for two highly nonlinear problems: the double-well potential and trivariate Lorenz systems. The algorithm does not require retrospective adaptation of the ensemble members themselves, and it is thus suited to a streaming operational mode. The accuracy of the proposed backward-update scheme in estimating non-Gaussian distributions is evaluated by comparison to the more accurate estimates provided by a Markov chain Monte Carlo algorithm.

Quantitative chemical imaging with background-free multiplex coherent anti-Stokes Raman scattering by dual-soliton Stokes pulses

PubMed Central

Chen, Kun; Wu, Tao; Wei, Haoyun; Zhou, Tian; Li, Yan

2016-01-01

Coherent anti-Stokes Raman microscopy (CARS) is a quantitative, chemically specific, and label-free optical imaging technique for studying inhomogeneous systems. However, the complicating influence of the nonresonant response on the CARS signal severely limits its sensitivity and specificity and especially limits the extent to which CARS microscopy has been used as a fully quantitative imaging technique. On the basis of spectral focusing mechanism, we establish a dual-soliton Stokes based CARS microspectroscopy and microscopy scheme capable of quantifying the spatial information of densities and chemical composition within inhomogeneous samples, using a single fiber laser. Dual-soliton Stokes scheme not only removes the nonresonant background but also allows robust acquisition of multiple characteristic vibrational frequencies. This all-fiber based laser source can cover the entire fingerprint (800-2200 cm−1) region with a spectral resolution of 15 cm−1. We demonstrate that quantitative degree determination of lipid-chain unsaturation in the fatty acids mixture can be achieved by the characterization of C = C stretching and CH2 deformation vibrations. For microscopy purposes, we show that the spatially inhomogeneous distribution of lipid droplets can be further quantitatively visualized using this quantified degree of lipid unsaturation in the acyl chain for contrast in the hyperspectral CARS images. The combination of compact excitation source and background-free capability to facilitate extraction of quantitative composition information with multiplex spectral peaks will enable wider applications of quantitative chemical imaging in studying biological and material systems. PMID:27867704

Stochastic parameterization of shallow cumulus convection estimated from high-resolution model data

NASA Astrophysics Data System (ADS)

Dorrestijn, Jesse; Crommelin, Daan T.; Siebesma, A. Pier.; Jonker, Harm J. J.

2013-02-01

In this paper, we report on the development of a methodology for stochastic parameterization of convective transport by shallow cumulus convection in weather and climate models. We construct a parameterization based on Large-Eddy Simulation (LES) data. These simulations resolve the turbulent fluxes of heat and moisture and are based on a typical case of non-precipitating shallow cumulus convection above sea in the trade-wind region. Using clustering, we determine a finite number of turbulent flux pairs for heat and moisture that are representative for the pairs of flux profiles observed in these simulations. In the stochastic parameterization scheme proposed here, the convection scheme jumps randomly between these pre-computed pairs of turbulent flux profiles. The transition probabilities are estimated from the LES data, and they are conditioned on the resolved-scale state in the model column. Hence, the stochastic parameterization is formulated as a data-inferred conditional Markov chain (CMC), where each state of the Markov chain corresponds to a pair of turbulent heat and moisture fluxes. The CMC parameterization is designed to emulate, in a statistical sense, the convective behaviour observed in the LES data. The CMC is tested in single-column model (SCM) experiments. The SCM is able to reproduce the ensemble spread of the temperature and humidity that was observed in the LES data. Furthermore, there is a good similarity between time series of the fractions of the discretized fluxes produced by SCM and observed in LES.

Architectures for reasoning in parallel

NASA Technical Reports Server (NTRS)

Hall, Lawrence O.

1989-01-01

The research conducted has dealt with rule-based expert systems. The algorithms that may lead to effective parallelization of them were investigated. Both the forward and backward chained control paradigms were investigated in the course of this work. The best computer architecture for the developed and investigated algorithms has been researched. Two experimental vehicles were developed to facilitate this research. They are Backpac, a parallel backward chained rule-based reasoning system and Datapac, a parallel forward chained rule-based reasoning system. Both systems have been written in Multilisp, a version of Lisp which contains the parallel construct, future. Applying the future function to a function causes the function to become a task parallel to the spawning task. Additionally, Backpac and Datapac have been run on several disparate parallel processors. The machines are an Encore Multimax with 10 processors, the Concert Multiprocessor with 64 processors, and a 32 processor BBN GP1000. Both the Concert and the GP1000 are switch-based machines. The Multimax has all its processors hung off a common bus. All are shared memory machines, but have different schemes for sharing the memory and different locales for the shared memory. The main results of the investigations come from experiments on the 10 processor Encore and the Concert with partitions of 32 or less processors. Additionally, experiments have been run with a stripped down version of EMYCIN.

Canonical-ensemble extended Lagrangian Born-Oppenheimer molecular dynamics for the linear scaling density functional theory.

PubMed

Hirakawa, Teruo; Suzuki, Teppei; Bowler, David R; Miyazaki, Tsuyoshi

2017-10-11

We discuss the development and implementation of a constant temperature (NVT) molecular dynamics scheme that combines the Nosé-Hoover chain thermostat with the extended Lagrangian Born-Oppenheimer molecular dynamics (BOMD) scheme, using a linear scaling density functional theory (DFT) approach. An integration scheme for this canonical-ensemble extended Lagrangian BOMD is developed and discussed in the context of the Liouville operator formulation. Linear scaling DFT canonical-ensemble extended Lagrangian BOMD simulations are tested on bulk silicon and silicon carbide systems to evaluate our integration scheme. The results show that the conserved quantity remains stable with no systematic drift even in the presence of the thermostat.

Error Suppression for Hamiltonian-Based Quantum Computation Using Subsystem Codes

NASA Astrophysics Data System (ADS)

Marvian, Milad; Lidar, Daniel A.

2017-01-01

We present general conditions for quantum error suppression for Hamiltonian-based quantum computation using subsystem codes. This involves encoding the Hamiltonian performing the computation using an error detecting subsystem code and the addition of a penalty term that commutes with the encoded Hamiltonian. The scheme is general and includes the stabilizer formalism of both subspace and subsystem codes as special cases. We derive performance bounds and show that complete error suppression results in the large penalty limit. To illustrate the power of subsystem-based error suppression, we introduce fully two-local constructions for protection against local errors of the swap gate of adiabatic gate teleportation and the Ising chain in a transverse field.

Error Suppression for Hamiltonian-Based Quantum Computation Using Subsystem Codes.

PubMed

Marvian, Milad; Lidar, Daniel A

2017-01-20

We present general conditions for quantum error suppression for Hamiltonian-based quantum computation using subsystem codes. This involves encoding the Hamiltonian performing the computation using an error detecting subsystem code and the addition of a penalty term that commutes with the encoded Hamiltonian. The scheme is general and includes the stabilizer formalism of both subspace and subsystem codes as special cases. We derive performance bounds and show that complete error suppression results in the large penalty limit. To illustrate the power of subsystem-based error suppression, we introduce fully two-local constructions for protection against local errors of the swap gate of adiabatic gate teleportation and the Ising chain in a transverse field.

Microbiological assessment along the fish production chain of the Norwegian pelagic fisheries sector--Results from a spot sampling programme.

PubMed

Svanevik, Cecilie Smith; Roiha, Irja Sunde; Levsen, Arne; Lunestad, Bjørn Tore

2015-10-01

Microbes play an important role in the degradation of fish products, thus better knowledge of the microbiological conditions throughout the fish production chain may help to optimise product quality and resource utilisation. This paper presents the results of a ten-year spot sampling programme (2005-2014) of the commercially most important pelagic fish species harvested in Norway. Fish-, surface-, and storage water samples were collected from fishing vessels and processing factories. Totally 1,181 samples were assessed with respect to microbiological quality, hygiene and food safety. We introduce a quality and safety assessment scheme for fresh pelagic fish recommending limits for heterotrophic plate counts (HPC), thermos tolerant coliforms, enterococci and Listeria monocytogenes. According to the scheme, in 25 of 41 samplings, sub-optimal conditions were found with respect to quality, whereas in 21 and 9 samplings, samples were not in compliance concerning hygiene and food safety, respectively. The present study has revealed that the quality of pelagic fish can be optimised by improving the hygiene conditions at some critical points at an early phase of the production chain. Thus, the proposed assessment scheme may provide a useful tool for the industry to optimise quality and maintain consumer safety of pelagic fishery products. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

Dynamic modeling and optimal joint torque coordination of advanced robotic systems

NASA Astrophysics Data System (ADS)

Kang, Hee-Jun

The development is documented of an efficient dynamic modeling algorithm and the subsequent optimal joint input load coordination of advanced robotic systems for industrial application. A closed-form dynamic modeling algorithm for the general closed-chain robotic linkage systems is presented. The algorithm is based on the transfer of system dependence from a set of open chain Lagrangian coordinates to any desired system generalized coordinate set of the closed-chain. Three different techniques for evaluation of the kinematic closed chain constraints allow the representation of the dynamic modeling parameters in terms of system generalized coordinates and have no restriction with regard to kinematic redundancy. The total computational requirement of the closed-chain system model is largely dependent on the computation required for the dynamic model of an open kinematic chain. In order to improve computational efficiency, modification of an existing open-chain KIC based dynamic formulation is made by the introduction of the generalized augmented body concept. This algorithm allows a 44 pct. computational saving over the current optimized one (O(N4), 5995 when N = 6). As means of resolving redundancies in advanced robotic systems, local joint torque optimization is applied for effectively using actuator power while avoiding joint torque limits. The stability problem in local joint torque optimization schemes is eliminated by using fictitious dissipating forces which act in the necessary null space. The performance index representing the global torque norm is shown to be satisfactory. In addition, the resulting joint motion trajectory becomes conservative, after a transient stage, for repetitive cyclic end-effector trajectories. The effectiveness of the null space damping method is shown. The modular robot, which is built of well defined structural modules from a finite-size inventory and is controlled by one general computer system, is another class of evolving, highly versatile, advanced robotic systems. Therefore, finally, a module based dynamic modeling algorithm is presented for the dynamic coordination of such reconfigurable modular robotic systems. A user interactive module based manipulator analysis program (MBMAP) has been coded in C language running on 4D/70 Silicon Graphics.

Statistical mechanics of Fermi-Pasta-Ulam chains with the canonical ensemble

NASA Astrophysics Data System (ADS)

Demirel, Melik C.; Sayar, Mehmet; Atılgan, Ali R.

1997-03-01

Low-energy vibrations of a Fermi-Pasta-Ulam-Β (FPU-Β) chain with 16 repeat units are analyzed with the aid of numerical experiments and the statistical mechanics equations of the canonical ensemble. Constant temperature numerical integrations are performed by employing the cubic coupling scheme of Kusnezov et al. [Ann. Phys. 204, 155 (1990)]. Very good agreement is obtained between numerical results and theoretical predictions for the probability distributions of the generalized coordinates and momenta both of the chain and of the thermal bath. It is also shown that the average energy of the chain scales linearly with the bath temperature.

Automatic comic page image understanding based on edge segment analysis

NASA Astrophysics Data System (ADS)

Liu, Dong; Wang, Yongtao; Tang, Zhi; Li, Luyuan; Gao, Liangcai

2013-12-01

Comic page image understanding aims to analyse the layout of the comic page images by detecting the storyboards and identifying the reading order automatically. It is the key technique to produce the digital comic documents suitable for reading on mobile devices. In this paper, we propose a novel comic page image understanding method based on edge segment analysis. First, we propose an efficient edge point chaining method to extract Canny edge segments (i.e., contiguous chains of Canny edge points) from the input comic page image; second, we propose a top-down scheme to detect line segments within each obtained edge segment; third, we develop a novel method to detect the storyboards by selecting the border lines and further identify the reading order of these storyboards. The proposed method is performed on a data set consisting of 2000 comic page images from ten printed comic series. The experimental results demonstrate that the proposed method achieves satisfactory results on different comics and outperforms the existing methods.

A practical molecular identification of nonfermenting Gram-negative bacteria from cystic fibrosis.

PubMed

Capizzani, Carolina Paulino da Costa; Caçador, Natália Candido; Marques, Elizabeth Andrade; Levy, Carlos Emílio; Tonani, Ludmilla; Torres, Lidia Alice Gomes Monteiro Marin; Darini, Ana Lúcia da Costa

Identification of nonfermenting Gram-negative bacteria (NFGNB) of cystic fibrosis patients is hard and misidentification could affect clinical outcome. This study aimed to propose a scheme using polymerase chain reaction to identify NFGNB. This scheme leads to reliable identification within 3 days in an economically viable manner when compared to other methods. Copyright © 2018 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Degradable Polymers and Block Copolymers from Electron-deficient Carbonyl Compounds (STIR) (7.3 Polymer Chemistry - Synthesis: Architecture and Composition)

DTIC Science & Technology

2015-04-23

polymerization results Illustrations: Scheme 1. Polymerization of aldehydes and depolymerization of polyacetals. Scheme 2. Optimized methods for...oligomers) to the pure aldehyde monomer requires several distillations and transfer of the monomer at reflux directly to the polymerization vessel. Low...the controlled organocatalytic chain polymerization of ethyl glyoxylate and other reactive aldehydes , which will enable the preparation of

Environmental assessment of the entire pork value chain in Catalonia - A strategy to work towards Circular Economy.

PubMed

Noya, Isabel; Aldea, Xavier; González-García, Sara; M Gasol, Carles; Moreira, María Teresa; Amores, Maria José; Marín, Desirée; Boschmonart-Rives, Jesús

2017-07-01

Pork industry in Catalonia plays a foremost and representative role in the Spanish pork sector. Beyond the economic benefits, conventional practices in the pork industry also imply a number of environmental impacts that need to be dealt with. In this context, the environmental performance of traditional linear pork chain in Catalonia was evaluated through a LCA approach. The outcomes of the analysis showed that both fodder production and transport activities were identified as the critical stages of the system. Accordingly, alternative schemes based on circular economy principles were proposed and potential environmental credits were estimated. Within this framework, comparative results highlighted the advantages of moving towards a closing loop production system, where resource efficiency and waste valorisation were prioritised over final disposal options. Copyright © 2017 Elsevier B.V. All rights reserved.

Nuclear Data Sheets for A = 222

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singh, S.; Tuli, J.; Jain,A.K.

The ENSDF evaluation for A=222 mass chain (1996El01) has been updated on the basis of the experimental results, since September 1995 (literature cutoff date in 1996El01), from various reaction and decay studies for all nuclides in A=222 mass chain (Z=84 to 92). A new nuclide ({sup 222}Po) has since been observed. In addition, new measurements have been reported in Rn, Th and Ra nuclides. The results obtained from various theoretical studies are given as comments. The updated level and decay schemes, and experimental decay and reaction data on which they are based, are summarized and presented for all the nuclidesmore » with mass number A=222. The adopted values of level energies, level spins and parities are given, and {gamma}-ray energies, intensities, as well as other nuclear properties are presented.« less

Automatic spin-chain learning to explore the quantum speed limit

NASA Astrophysics Data System (ADS)

Zhang, Xiao-Ming; Cui, Zi-Wei; Wang, Xin; Yung, Man-Hong

2018-05-01

One of the ambitious goals of artificial intelligence is to build a machine that outperforms human intelligence, even if limited knowledge and data are provided. Reinforcement learning (RL) provides one such possibility to reach this goal. In this work, we consider a specific task from quantum physics, i.e., quantum state transfer in a one-dimensional spin chain. The mission for the machine is to find transfer schemes with the fastest speeds while maintaining high transfer fidelities. The first scenario we consider is when the Hamiltonian is time independent. We update the coupling strength by minimizing a loss function dependent on both the fidelity and the speed. Compared with a scheme proven to be at the quantum speed limit for the perfect state transfer, the scheme provided by RL is faster while maintaining the infidelity below 5 ×10-4 . In the second scenario where a time-dependent external field is introduced, we convert the state transfer process into a Markov decision process that can be understood by the machine. We solve it with the deep Q-learning algorithm. After training, the machine successfully finds transfer schemes with high fidelities and speeds, which are faster than previously known ones. These results show that reinforcement learning can be a powerful tool for quantum control problems.

Spin Order and Phase Transitions in Chains of Polariton Condensates.

PubMed

Ohadi, H; Ramsay, A J; Sigurdsson, H; Del Valle-Inclan Redondo, Y; Tsintzos, S I; Hatzopoulos, Z; Liew, T C H; Shelykh, I A; Rubo, Y G; Savvidis, P G; Baumberg, J J

2017-08-11

We demonstrate that multiply coupled spinor polariton condensates can be optically tuned through a sequence of spin-ordered phases by changing the coupling strength between nearest neighbors. For closed four-condensate chains these phases span from ferromagnetic (FM) to antiferromagnetic (AFM), separated by an unexpected crossover phase. This crossover phase is composed of alternating FM-AFM bonds. For larger eight-condensate chains, we show the critical role of spatial inhomogeneities and demonstrate a scheme to overcome them and prepare any desired spin state. Our observations thus demonstrate a fully controllable nonequilibrium spin lattice.

Robust symmetry-protected metrology with the Haldane phase

NASA Astrophysics Data System (ADS)

Bartlett, Stephen D.; Brennen, Gavin K.; Miyake, Akimasa

2018-01-01

We propose a metrology scheme that is made robust to a wide range of noise processes by using the passive, error-preventing properties of symmetry-protected topological phases. The so-called fractionalized edge mode of an antiferromagnetic Heisenberg spin-1 chain in a rotationally- symmetric Haldane phase can be used to measure the direction of an unknown electric field, by exploiting the way in which the field direction reduces the symmetry of the chain. Specifically, the direction (and when supplementing with a known background field, also the strength) of the field is registered in the holonomy under an adiabatic sensing protocol, and the degenerate fractionalized edge mode is protected through this process by the remaining reduced symmetry. We illustrate the scheme with respect to a potential realization by Rydberg dressed atoms.

Density matrix renormalization group for a highly degenerate quantum system: Sliding environment block approach

NASA Astrophysics Data System (ADS)

Schmitteckert, Peter

2018-04-01

We present an infinite lattice density matrix renormalization group sweeping procedure which can be used as a replacement for the standard infinite lattice blocking schemes. Although the scheme is generally applicable to any system, its main advantages are the correct representation of commensurability issues and the treatment of degenerate systems. As an example we apply the method to a spin chain featuring a highly degenerate ground-state space where the new sweeping scheme provides an increase in performance as well as accuracy by many orders of magnitude compared to a recently published work.

MOSES: A Matlab-based open-source stochastic epidemic simulator.

PubMed

Varol, Huseyin Atakan

2016-08-01

This paper presents an open-source stochastic epidemic simulator. Discrete Time Markov Chain based simulator is implemented in Matlab. The simulator capable of simulating SEQIJR (susceptible, exposed, quarantined, infected, isolated and recovered) model can be reduced to simpler models by setting some of the parameters (transition probabilities) to zero. Similarly, it can be extended to more complicated models by editing the source code. It is designed to be used for testing different control algorithms to contain epidemics. The simulator is also designed to be compatible with a network based epidemic simulator and can be used in the network based scheme for the simulation of a node. Simulations show the capability of reproducing different epidemic model behaviors successfully in a computationally efficient manner.

Electron-phonon interaction in quantum transport through quantum dots and molecular systems

NASA Astrophysics Data System (ADS)

Ojeda, J. H.; Duque, C. A.; Laroze, D.

2016-12-01

The quantum transport and effects of decoherence properties are studied in quantum dots systems and finite homogeneous chains of aromatic molecules connected to two semi-infinite leads. We study these systems based on the tight-binding approach through Green's function technique within a real space renormalization and polaron transformation schemes. In particular, we calculate the transmission probability following the Landauer-Büttiker formalism, the I - V characteristics and the noise power of current fluctuations taken into account the decoherence. Our results may explain the inelastic effects through nanoscopic systems.

Exploring excited eigenstates of many-body systems using the functional renormalization group

NASA Astrophysics Data System (ADS)

Klöckner, Christian; Kennes, Dante Marvin; Karrasch, Christoph

2018-05-01

We introduce approximate, functional renormalization group based schemes to obtain correlation functions in pure excited eigenstates of large fermionic many-body systems at arbitrary energies. The algorithms are thoroughly benchmarked and their strengths and shortcomings are documented using a one-dimensional interacting tight-binding chain as a prototypical testbed. We study two "toy applications" from the world of Luttinger liquid physics: the survival of power laws in lowly excited states as well as the spectral function of high-energy "block" excitations, which feature several single-particle Fermi edges.

End-to-End QoS for Differentiated Services and ATM Internetworking

NASA Technical Reports Server (NTRS)

Su, Hongjun; Atiquzzaman, Mohammed

2001-01-01

The Internet was initially design for non real-time data communications and hence does not provide any Quality of Service (QoS). The next generation Internet will be characterized by high speed and QoS guarantee. The aim of this paper is to develop a prioritized early packet discard (PEPD) scheme for ATM switches to provide service differentiation and QoS guarantee to end applications running over next generation Internet. The proposed PEPD scheme differs from previous schemes by taking into account the priority of packets generated from different application. We develop a Markov chain model for the proposed scheme and verify the model with simulation. Numerical results show that the results from the model and computer simulation are in close agreement. Our PEPD scheme provides service differentiation to the end-to-end applications.

Analyzing the Effectiveness of the Self-organized Public-Key Management System on MANETs under the Lack of Cooperation and the Impersonation Attacks

NASA Astrophysics Data System (ADS)

da Silva, Eduardo; Dos Santos, Aldri Luiz; Lima, Michele N.; Albini, Luiz Carlos Pessoa

Among the key management schemes for MANETs, the Self-Organized Public-Key Management System (PGP-Like) is the main chaining-based key management scheme. It is fully self-organized and does not require any certificate authority. Two kinds of misbehavior attacks are considered to be great threats to PGP-Like: lack of cooperation and impersonation attacks. This work quantifies the impact of such attacks on the PGP-Like. Simulation results show that PGP-Like was able to maintain its effectiveness when submitted to the lack of cooperation attack, contradicting previously theoretical results. It correctly works even in the presence of more than 60% of misbehaving nodes, although the convergence time is affected with only 20% of misbehaving nodes. On the other hand, PGP-Like is completely vulnerable to the impersonation attack. Its functionality is affected with just 5% of misbehaving nodes, confirming previously theoretical results.

Mixed-Timescale Per-Group Hybrid Precoding for Multiuser Massive MIMO Systems

NASA Astrophysics Data System (ADS)

Teng, Yinglei; Wei, Min; Liu, An; Lau, Vincent; Zhang, Yong

2018-05-01

Considering the expensive radio frequency (RF) chain, huge training overhead and feedback burden issues in massive MIMO, in this letter, we propose a mixed-timescale per-group hybrid precoding (MPHP) scheme under an adaptive partially-connected RF precoding structure (PRPS), where the RF precoder is implemented using an adaptive connection network (ACN) and M analog phase shifters (APSs), where M is the number of antennas at the base station (BS). Exploiting the mixed-time stage channel state information (CSI) structure, the joint-design of ACN and APSs is formulated as a statistical signal-to-leakage-and-noise ratio (SSLNR) maximization problem, and a heuristic group RF precoding (GRFP) algorithm is proposed to provide a near-optimal solution. Simulation results show that the proposed design advances at better energy efficiency (EE) and lower hardware cost, CSI signaling overhead and computational complexity than the conventional hybrid precoding (HP) schemes.

A robot arm simulation with a shared memory multiprocessor machine

NASA Technical Reports Server (NTRS)

Kim, Sung-Soo; Chuang, Li-Ping

1989-01-01

A parallel processing scheme for a single chain robot arm is presented for high speed computation on a shared memory multiprocessor. A recursive formulation that is derived from a virtual work form of the d'Alembert equations of motion is utilized for robot arm dynamics. A joint drive system that consists of a motor rotor and gears is included in the arm dynamics model, in order to take into account gyroscopic effects due to the spinning of the rotor. The fine grain parallelism of mechanical and control subsystem models is exploited, based on independent computation associated with bodies, joint drive systems, and controllers. Efficiency and effectiveness of the parallel scheme are demonstrated through simulations of a telerobotic manipulator arm. Two different mechanical subsystem models, i.e., with and without gyroscopic effects, are compared, to show the trade-off between efficiency and accuracy.

Diversity Analysis of Dairy and Nondairy Lactococcus lactis Isolates, Using a Novel Multilocus Sequence Analysis Scheme and (GTG)5-PCR Fingerprinting▿

PubMed Central

Rademaker, Jan L. W.; Herbet, Hélène; Starrenburg, Marjo J. C.; Naser, Sabri M.; Gevers, Dirk; Kelly, William J.; Hugenholtz, Jeroen; Swings, Jean; van Hylckama Vlieg, Johan E. T.

2007-01-01

The diversity of a collection of 102 lactococcus isolates including 91 Lactococcus lactis isolates of dairy and nondairy origin was explored using partial small subunit rRNA gene sequence analysis and limited phenotypic analyses. A subset of 89 strains of L. lactis subsp. cremoris and L. lactis subsp. lactis isolates was further analyzed by (GTG)5-PCR fingerprinting and a novel multilocus sequence analysis (MLSA) scheme. Two major genomic lineages within L. lactis were found. The L. lactis subsp. cremoris type-strain-like genotype lineage included both L. lactis subsp. cremoris and L. lactis subsp. lactis isolates. The other major lineage, with a L. lactis subsp. lactis type-strain-like genotype, comprised L. lactis subsp. lactis isolates only. A novel third genomic lineage represented two L. lactis subsp. lactis isolates of nondairy origin. The genomic lineages deviate from the subspecific classification of L. lactis that is based on a few phenotypic traits only. MLSA of six partial genes (atpA, encoding ATP synthase alpha subunit; pheS, encoding phenylalanine tRNA synthetase; rpoA, encoding RNA polymerase alpha chain; bcaT, encoding branched chain amino acid aminotransferase; pepN, encoding aminopeptidase N; and pepX, encoding X-prolyl dipeptidyl peptidase) revealed 363 polymorphic sites (total length, 1,970 bases) among 89 L. lactis subsp. cremoris and L. lactis subsp. lactis isolates with unique sequence types for most isolates. This allowed high-resolution cluster analysis in which dairy isolates form subclusters of limited diversity within the genomic lineages. The pheS DNA sequence analysis yielded two genetic groups dissimilar to the other genotyping analysis-based lineages, indicating a disparate acquisition route for this gene. PMID:17890345

Diversity analysis of dairy and nondairy Lactococcus lactis isolates, using a novel multilocus sequence analysis scheme and (GTG)5-PCR fingerprinting.

PubMed

Rademaker, Jan L W; Herbet, Hélène; Starrenburg, Marjo J C; Naser, Sabri M; Gevers, Dirk; Kelly, William J; Hugenholtz, Jeroen; Swings, Jean; van Hylckama Vlieg, Johan E T

2007-11-01

The diversity of a collection of 102 lactococcus isolates including 91 Lactococcus lactis isolates of dairy and nondairy origin was explored using partial small subunit rRNA gene sequence analysis and limited phenotypic analyses. A subset of 89 strains of L. lactis subsp. cremoris and L. lactis subsp. lactis isolates was further analyzed by (GTG)(5)-PCR fingerprinting and a novel multilocus sequence analysis (MLSA) scheme. Two major genomic lineages within L. lactis were found. The L. lactis subsp. cremoris type-strain-like genotype lineage included both L. lactis subsp. cremoris and L. lactis subsp. lactis isolates. The other major lineage, with a L. lactis subsp. lactis type-strain-like genotype, comprised L. lactis subsp. lactis isolates only. A novel third genomic lineage represented two L. lactis subsp. lactis isolates of nondairy origin. The genomic lineages deviate from the subspecific classification of L. lactis that is based on a few phenotypic traits only. MLSA of six partial genes (atpA, encoding ATP synthase alpha subunit; pheS, encoding phenylalanine tRNA synthetase; rpoA, encoding RNA polymerase alpha chain; bcaT, encoding branched chain amino acid aminotransferase; pepN, encoding aminopeptidase N; and pepX, encoding X-prolyl dipeptidyl peptidase) revealed 363 polymorphic sites (total length, 1,970 bases) among 89 L. lactis subsp. cremoris and L. lactis subsp. lactis isolates with unique sequence types for most isolates. This allowed high-resolution cluster analysis in which dairy isolates form subclusters of limited diversity within the genomic lineages. The pheS DNA sequence analysis yielded two genetic groups dissimilar to the other genotyping analysis-based lineages, indicating a disparate acquisition route for this gene.

An open-chain imaginary-time path-integral sampling approach to the calculation of approximate symmetrized quantum time correlation functions.

PubMed

Cendagorta, Joseph R; Bačić, Zlatko; Tuckerman, Mark E

2018-03-14

We introduce a scheme for approximating quantum time correlation functions numerically within the Feynman path integral formulation. Starting with the symmetrized version of the correlation function expressed as a discretized path integral, we introduce a change of integration variables often used in the derivation of trajectory-based semiclassical methods. In particular, we transform to sum and difference variables between forward and backward complex-time propagation paths. Once the transformation is performed, the potential energy is expanded in powers of the difference variables, which allows us to perform the integrals over these variables analytically. The manner in which this procedure is carried out results in an open-chain path integral (in the remaining sum variables) with a modified potential that is evaluated using imaginary-time path-integral sampling rather than requiring the generation of a large ensemble of trajectories. Consequently, any number of path integral sampling schemes can be employed to compute the remaining path integral, including Monte Carlo, path-integral molecular dynamics, or enhanced path-integral molecular dynamics. We believe that this approach constitutes a different perspective in semiclassical-type approximations to quantum time correlation functions. Importantly, we argue that our approximation can be systematically improved within a cumulant expansion formalism. We test this approximation on a set of one-dimensional problems that are commonly used to benchmark approximate quantum dynamical schemes. We show that the method is at least as accurate as the popular ring-polymer molecular dynamics technique and linearized semiclassical initial value representation for correlation functions of linear operators in most of these examples and improves the accuracy of correlation functions of nonlinear operators.

An open-chain imaginary-time path-integral sampling approach to the calculation of approximate symmetrized quantum time correlation functions

NASA Astrophysics Data System (ADS)

Cendagorta, Joseph R.; Bačić, Zlatko; Tuckerman, Mark E.

2018-03-01

We introduce a scheme for approximating quantum time correlation functions numerically within the Feynman path integral formulation. Starting with the symmetrized version of the correlation function expressed as a discretized path integral, we introduce a change of integration variables often used in the derivation of trajectory-based semiclassical methods. In particular, we transform to sum and difference variables between forward and backward complex-time propagation paths. Once the transformation is performed, the potential energy is expanded in powers of the difference variables, which allows us to perform the integrals over these variables analytically. The manner in which this procedure is carried out results in an open-chain path integral (in the remaining sum variables) with a modified potential that is evaluated using imaginary-time path-integral sampling rather than requiring the generation of a large ensemble of trajectories. Consequently, any number of path integral sampling schemes can be employed to compute the remaining path integral, including Monte Carlo, path-integral molecular dynamics, or enhanced path-integral molecular dynamics. We believe that this approach constitutes a different perspective in semiclassical-type approximations to quantum time correlation functions. Importantly, we argue that our approximation can be systematically improved within a cumulant expansion formalism. We test this approximation on a set of one-dimensional problems that are commonly used to benchmark approximate quantum dynamical schemes. We show that the method is at least as accurate as the popular ring-polymer molecular dynamics technique and linearized semiclassical initial value representation for correlation functions of linear operators in most of these examples and improves the accuracy of correlation functions of nonlinear operators.

Quantum gates controlled by spin chain soliton excitations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cuccoli, Alessandro, E-mail: cuccoli@fi.infn.it; Istituto Nazionale di Fisica Nucleare, Sezione di Firenze, I-50019 Sesto Fiorentino; Nuzzi, Davide

2014-05-07

Propagation of soliton-like excitations along spin chains has been proposed as a possible way for transmitting both classical and quantum information between two distant parties with negligible dispersion and dissipation. In this work, a somewhat different use of solitons is considered. Solitons propagating along a spin chain realize an effective magnetic field, well localized in space and time, which can be exploited as a means to manipulate the state of an external spin (i.e., a qubit) that is weakly coupled to the chain. We have investigated different couplings between the qubit and the chain, as well as different soliton shapes,more » according to a Heisenberg chain model. It is found that symmetry properties strongly affect the effectiveness of the proposed scheme, and the most suitable setups for implementing single qubit quantum gates are singled out.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gates, J. M.; Gregorich, K. E.; Gothe, O. R.

In this study, forty-six decay chains, assigned to the decay of 288115, were produced using the 243Am ( 48Ca, 3n) 288115 reaction at the Lawrence Berkeley National Laboratory 88-in. cyclotron. The resulting series of α decays were studied using α-photon and α-x-ray spectroscopies. Multiple α-photon coincidences were observed in the element 115 decay chain members, particularly in the third- and fourth-generation decays (presumed to be 280Rg and 276Mt, respectively). Upon combining these data with those from 22 288115 decay chains observed in a similar experiment, updated level schemes in 276Mt and 272Bh (populated by the α decay of 280Rg andmore » 276Mt, respectively) are proposed. Additionally, photons were observed in the energy range expected for K x rays coincident with the α decay of both 280Rg and 276Mt. However, Compton scattering of higher-energy γ rays and discrete transitions are present in the K x-ray region preventing a definitive Z identification to be made based on observation of characteristic K x-ray energies.« less

Fast analysis of radionuclide decay chain migration

NASA Astrophysics Data System (ADS)

Chen, J. S.; Liang, C. P.; Liu, C. W.; Li, L.

2014-12-01

A novel tool for rapidly predicting the long-term plume behavior of an arbitrary length radionuclide decay chain is presented in this study. This fast tool is achieved based on generalized analytical solutions in compact format derived for a set of two-dimensional advection-dispersion equations coupled with sequential first-order decay reactions in groundwater system. The performance of the developed tool is evaluated by a numerical model using a Laplace transform finite difference scheme. The results of performance evaluation indicate that the developed model is robust and accurate. The developed model is then used to fast understand the transport behavior of a four-member radionuclide decay chain. Results show that the plume extents and concentration levels of any target radionuclide are very sensitive to longitudinal, transverse dispersion, decay rate constant and retardation factor. The developed model are useful tools for rapidly assessing the ecological and environmental impact of the accidental radionuclide releases such as the Fukushima nuclear disaster where multiple radionuclides leaked through the reactor, subsequently contaminating the local groundwater and ocean seawater in the vicinity of the nuclear plant.

The role of higher-order terms in perturbation approaches to the monomer and\\xA0bonding contributions in a SAFT-type equation of state for square-well chain\\xA0fluids

NASA Astrophysics Data System (ADS)

Solana, J. R.; Akhouri, B. P.

2018-07-01

A perturbation theory for square-well chain fluids is developed within the scheme of the (generalised) Wertheim thermodynamic perturbation theory. The theory is based on the Pavlyukhin parametrisations [Y. T. Pavlyukhin, J. Struct. Chem. 53, 476 (2012)] of their simulation data for the first four perturbation terms in the high temperature expansion of the Helmholtz free energy of square-well monomer fluids combined with a second-order perturbation theory for the contact value of the radial distribution function of the square-well monomer fluid that enters into bonding contribution. To obtain the latter perturbation terms, we have performed computer simulations in the hard-sphere reference system. The importance of the perturbation terms beyond the second-order one for the monomer fluid and of the approximations of different orders in the bonding contribution for the chain fluids in the predicted equation of state, excess energy and liquid-vapour coexistence densities is analysed.

Hearing and Mortality Outcomes following Temporal Bone Fractures.

PubMed

Honeybrook, Adam; Patki, Aniruddha; Chapurin, Nikita; Woodard, Charles

2017-12-01

The aim of this article is to determine hearing and mortality outcomes following temporal bone fractures. Retrospective chart review was performed of 152 patients diagnosed with a temporal bone fracture presenting to the emergency room at a tertiary care referral center over a 10-year period. Utilizing Patients' previously obtained temporal bone computed tomographic scans and audiograms, fractures were classified based on several classification schemes. Correlations between fracture patterns, mortality, and hearing outcomes were analyzed using χ 2 tests. Ossicular chain disruption was seen in 11.8% of patients, and otic capsule violation was seen in 5.9%; 22.7% of patients presented for audiologic follow-up. Seventeen patients with conductive hearing loss had air-bone gaps of 26 ± 7.5 dB (500 Hz), 27 ± 6.8 dB (1,000 Hz), 18 ± 6.2 dB (2,000 Hz), and 32 ± 7.7 dB (4,000 Hz). Two cases of profound sensorineural hearing loss were associated with otic capsule violation. No fracture classification scheme was predictive of hearing loss, although longitudinal fractures were statistically associated with ossicular chain disruption ( p  < 0.01). Temporal bone fractures in patients older than 60 years carried a relative risk of death of 3.15 compared with those younger than 60 years. The average magnitude of conductive hearing loss resulting from temporal bone fracture ranged from 18 to 32 dB in this cohort. Classification of fracture type was not predictive of hearing loss, despite the statistical association between ossicular chain disruption and longitudinal fractures. This finding may be due to the low follow-up rates of this patient population. Physicians should make a concerted effort to ensure that audiological monitoring is executed to prevent and manage long-term hearing impairment.

Scenario of solid waste reuse in Khulna city of Bangladesh

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bari, Quazi H., E-mail: qhbari@yahoo.com; Mahbub Hassan, K.; Haque, R.

2012-12-15

The reuse and recycling of waste materials are now sincerely considered to be an integral part of solid waste management in many parts of the world. In this context, a vast number of options ranging from small scale decentralized to larger scale centralized plants have been adopted. This study aimed at investigating the waste reuse schemes in Khulna city located in the southern part of Bangladesh and ranked third largest city in the country. The shops for reusable material (SRM) were mostly situated around railway, waterway, and truck station markets which provided easy transportation to further locations. For the reusesmore » of waste materials and products, a chain system was found to collect reusable wastes under a total number of 310 identified SRM with 859 persons directly or indirectly involved in the scheme. This was a decentralized waste management system with self sufficient (autonomous) management. According to mass balance, about 38.52 tons d{sup -1} solid wastes were reused in Khulna city area, accounting for 7.65% of the total generated wastes. This study revealed that apparently a silent, systematic, smooth, and clean reuse chain has been established in Khulna city area under private initiatives, whose sustainability was confirmed over the years in the country without any official or formal funds. However, proper adjustment between the higher and lower chain in the materials flow path, as well as personal hygiene training for the workers, would further improve the achievements of the established reuse scheme.« less

Scenario of solid waste reuse in Khulna city of Bangladesh.

PubMed

Bari, Quazi H; Mahbub Hassan, K; Haque, R

2012-12-01

The reuse and recycling of waste materials are now sincerely considered to be an integral part of solid waste management in many parts of the world. In this context, a vast number of options ranging from small scale decentralized to larger scale centralized plants have been adopted. This study aimed at investigating the waste reuse schemes in Khulna city located in the southern part of Bangladesh and ranked third largest city in the country. The shops for reusable material (SRM) were mostly situated around railway, waterway, and truck station markets which provided easy transportation to further locations. For the reuses of waste materials and products, a chain system was found to collect reusable wastes under a total number of 310 identified SRM with 859 persons directly or indirectly involved in the scheme. This was a decentralized waste management system with self sufficient (autonomous) management. According to mass balance, about 38.52 tons d(-1) solid wastes were reused in Khulna city area, accounting for 7.65% of the total generated wastes. This study revealed that apparently a silent, systematic, smooth, and clean reuse chain has been established in Khulna city area under private initiatives, whose sustainability was confirmed over the years in the country without any official or formal funds. However, proper adjustment between the higher and lower chain in the materials flow path, as well as personal hygiene training for the workers, would further improve the achievements of the established reuse scheme. Copyright © 2012 Elsevier Ltd. All rights reserved.

Synthesis of nonionic-anionic colloidal systems based on alkaline and ammonium β-nonylphenol polyethyleneoxy (n = 3-20) propionates/dodecylbenzenesulfonates with prospects for food hygiene

PubMed Central

2012-01-01

Background The main objective of this work was to obtain a binary system of surface-active components (nonionic soap – alkaline and/or ammonium dodecylbenzenesulfonate) with potential competences in food hygiene, by accessing a scheme of classical reactions (cyanoethylation, total acid hydrolysis and stoichiometric neutralization with inorganic alkaline and/or organic ammonium bases) adapted to heterogeneously polyethoxylated nonylphenols (n = 3-20). In the processing system mentioned, dodecylbenzenesulfonic acid, initially the acid catalyst for the exhaustive hydrolysis of β-nonylphenolpolyethyleneoxy (n = 3-20) propionitriles, becomes together with the nonionic soap formed the second surface-active component of the binary system. Results In the reaction scheme adopted the influence of the main operating (duration, temperature, molar ratio of reagents) and structural parameters (degree of oligomerization of the polyoxyethylene chain) on the processing yields for the synthetic steps was followed. The favorable role of the polyoxyethylene chain size is remarked, through its specific conformation and its alkaline cations sequestration competences on the yields of cyanoethylation, but also the beneficial influence of phase-transfer catalysts in the total acid hydrolysis step. The chemical stability of dodecylbenzenesulfonic acid (DBSH) at the temperature and strongly acidic pH of the reaction environment is confirmed. The controlled change of the amount of DBSH in the final binary system will later confer it potential colloidal competences in food hygiene receipts. Conclusions The preliminary synthetic tests performed confirmed the prospect of obtaining a broad range of useful colloidal competences in various food hygiene scenarios. PMID:22958389

Magneto-structural correlation in a series of bimetallic alternating chain complexes of [CrIIIL(CN)4]n[MnIII(salpn)]n.nsolvents (L=2,2'-bipy or 9,10-phen, salpn=substituted salicyldehyde, solvents=water and methanol).

PubMed

Pan, Feng; Wang, Zhe-Ming; Gao, Song

2007-11-26

Five chain compounds based on the building block of [Cr(L)(CN)4]- (L=2,2'-bipy, 1-4; L=9,10-phen, 5) and [Mn(salpn)]+ (salpn=substituted salicyldehyde-type Schiff base in Scheme 1) have been prepared and characterized structurally and magnetically. The four compounds (1-4) consisting of [Cr(bipy)(CN)4]- units possess straight bimetallic chains as the [Cr(bpy)(CN)4]- unit links the two neighbor [Mn(salpn)]+ units with the two trans-cyanide ligands, while in 5 the chain is zigzag because the [Cr(phen)(CN)4]- unit connects the [Mn(salpn)]+ units with its two cis-cyanide ligands. The bond angles of Mn-N-C-Cr are adjusted by different coligands of salpn and bipy/phen. The chains are stacking via mainly the aromatic pi-pi-type interactions. All compounds show 3D antiferromagnetic ordering with Néel temperatures ranging from 3.7 to 8.1 K, and they are metamagnets displaying antiferromagnetic to ferrimagnetic transition at critical fields of 4.0-13.1 kOe at 1.9 K. This is due to weak interchain antiferromagnetic interactions between the ferrimagnetic bimetallic chains in the materials. The intrachain couplings (J, in cm(-1)) in the materials, between cyanide-bridged CrIII and MnIII ions, from -1.84 to -5.35 cm(-1), follow a linear relationship (J=-33+0.18alpha) to the Mn-N-C angles (alpha, in deg). In addition, the weak interchain antiferromagnetic interactions and critical fields for antiferromagnetic-ferrimagnetic transition are closely related to some of their structural factors, which were studied very superficially only referring to the separations of nearest chains in each material.

Structural synthesis of linkages for quadruped bio-robot legs

NASA Astrophysics Data System (ADS)

Antonescu, O.; Robu, C.; Antonescu, P.

2016-08-01

The paper presents a few kinematic schemes of planar mechanisms with bars (linkages) used as part of the quadruped robot legs. The Dunshee linkage having only four elements as crank-rocker mechanism is analyzed. Further, the Klann linkage, which is accomplished by amplifying the crank-rocker mechanism with a dyadic kinematic chain, is also presented. More than that, the Jansen linkage, which is obtained by extending and amplifying the crank-rocker mechanism with two dyadic kinematic chains, is also analyzed. At the end of the paper, the authors present a novel linkage application consisting of a quadric kinematic chain.

Construct the stable vendor managed inventory partnership through a profit-sharing approach

NASA Astrophysics Data System (ADS)

Li, S.; Yu, Z.; Dong, M.

2015-01-01

In real life, the vendor managed inventory (VMI) model is not always a stable supply chain partnership. This paper proposes a cooperative game based profit-sharing method to stabilize the VMI partnership. Specifically, in a B2C setting, we consider a VMI program including a manufacturer and multiple online retailers. The manufacturer provides the finished product at the equal wholesale price to multiple online retailers. The online retailers face the same customer demand information. We offer the model to compute the increased profits generated by information sharing for total possible VMI coalitions. Using the solution concept of Shapley value, the profit-sharing scheme is produced to fairly divide the total increased profits among the VMI members. We find that under a fair allocation scheme, the higher inventory cost of one VMI member increases the surplus of the other members. Furthermore, the manufacturer is glad to increase the size of VMI coalition, whereas, the retailers are delighted to limit the size of the alliance. Finally, the manufacturer can select the appropriate retailer to boost its surplus, which has no effect on the surplus of the other retailers. The numerical examples indicate that the grand coalition is stable under the proposed allocation scheme.

Structural and parameteric uncertainty quantification in cloud microphysics parameterization schemes

NASA Astrophysics Data System (ADS)

van Lier-Walqui, M.; Morrison, H.; Kumjian, M. R.; Prat, O. P.; Martinkus, C.

2017-12-01

Atmospheric model parameterization schemes employ approximations to represent the effects of unresolved processes. These approximations are a source of error in forecasts, caused in part by considerable uncertainty about the optimal value of parameters within each scheme -- parameteric uncertainty. Furthermore, there is uncertainty regarding the best choice of the overarching structure of the parameterization scheme -- structrual uncertainty. Parameter estimation can constrain the first, but may struggle with the second because structural choices are typically discrete. We address this problem in the context of cloud microphysics parameterization schemes by creating a flexible framework wherein structural and parametric uncertainties can be simultaneously constrained. Our scheme makes no assuptions about drop size distribution shape or the functional form of parametrized process rate terms. Instead, these uncertainties are constrained by observations using a Markov Chain Monte Carlo sampler within a Bayesian inference framework. Our scheme, the Bayesian Observationally-constrained Statistical-physical Scheme (BOSS), has flexibility to predict various sets of prognostic drop size distribution moments as well as varying complexity of process rate formulations. We compare idealized probabilistic forecasts from versions of BOSS with varying levels of structural complexity. This work has applications in ensemble forecasts with model physics uncertainty, data assimilation, and cloud microphysics process studies.

A Hybrid Secure Scheme for Wireless Sensor Networks against Timing Attacks Using Continuous-Time Markov Chain and Queueing Model.

PubMed

Meng, Tianhui; Li, Xiaofan; Zhang, Sha; Zhao, Yubin

2016-09-28

Wireless sensor networks (WSNs) have recently gained popularity for a wide spectrum of applications. Monitoring tasks can be performed in various environments. This may be beneficial in many scenarios, but it certainly exhibits new challenges in terms of security due to increased data transmission over the wireless channel with potentially unknown threats. Among possible security issues are timing attacks, which are not prevented by traditional cryptographic security. Moreover, the limited energy and memory resources prohibit the use of complex security mechanisms in such systems. Therefore, balancing between security and the associated energy consumption becomes a crucial challenge. This paper proposes a secure scheme for WSNs while maintaining the requirement of the security-performance tradeoff. In order to proceed to a quantitative treatment of this problem, a hybrid continuous-time Markov chain (CTMC) and queueing model are put forward, and the tradeoff analysis of the security and performance attributes is carried out. By extending and transforming this model, the mean time to security attributes failure is evaluated. Through tradeoff analysis, we show that our scheme can enhance the security of WSNs, and the optimal rekeying rate of the performance and security tradeoff can be obtained.

A Hybrid Secure Scheme for Wireless Sensor Networks against Timing Attacks Using Continuous-Time Markov Chain and Queueing Model

PubMed Central

Meng, Tianhui; Li, Xiaofan; Zhang, Sha; Zhao, Yubin

2016-01-01

Wireless sensor networks (WSNs) have recently gained popularity for a wide spectrum of applications. Monitoring tasks can be performed in various environments. This may be beneficial in many scenarios, but it certainly exhibits new challenges in terms of security due to increased data transmission over the wireless channel with potentially unknown threats. Among possible security issues are timing attacks, which are not prevented by traditional cryptographic security. Moreover, the limited energy and memory resources prohibit the use of complex security mechanisms in such systems. Therefore, balancing between security and the associated energy consumption becomes a crucial challenge. This paper proposes a secure scheme for WSNs while maintaining the requirement of the security-performance tradeoff. In order to proceed to a quantitative treatment of this problem, a hybrid continuous-time Markov chain (CTMC) and queueing model are put forward, and the tradeoff analysis of the security and performance attributes is carried out. By extending and transforming this model, the mean time to security attributes failure is evaluated. Through tradeoff analysis, we show that our scheme can enhance the security of WSNs, and the optimal rekeying rate of the performance and security tradeoff can be obtained. PMID:27690042

sdg boson model in the SU(3) scheme

NASA Astrophysics Data System (ADS)

Akiyama, Yoshimi

1985-02-01

Basic properties of the interacting boson model with s-, d- and g-bosons are investigated in rotational nuclei. An SU(3)-seniority scheme is found for the classification of physically important states according to a group reduction chain U(15) ⊃ SU(3). The capability of describing rotational bands increases enormously in comparison with the ordinary sd interacting boson model. The sdg boson model is shown to be able to describe the so-called anharmonicity effect recently observed in the 168Er nucleus.

Automatic Detection of Frontal Face Midline by Chain-coded Merlin-Farber Hough Trasform

NASA Astrophysics Data System (ADS)

Okamoto, Daichi; Ohyama, Wataru; Wakabayashi, Tetsushi; Kimura, Fumitaka

We propose a novel approach for detection of the facial midline (facial symmetry axis) from a frontal face image. The facial midline has several applications, for instance reducing computational cost required for facial feature extraction (FFE) and postoperative assessment for cosmetic or dental surgery. The proposed method detects the facial midline of a frontal face from an edge image as the symmetry axis using the Merlin-Faber Hough transformation. And a new performance improvement scheme for midline detection by MFHT is present. The main concept of the proposed scheme is suppression of redundant vote on the Hough parameter space by introducing chain code representation for the binary edge image. Experimental results on the image dataset containing 2409 images from FERET database indicate that the proposed algorithm can improve the accuracy of midline detection from 89.9% to 95.1 % for face images with different scales and rotation.

Nuclear Data Evaluation for Mass Chain A=217:Odd-Proton Nuclei

PubMed Central

Nafee, Sherif S.; Shaheen, Salem A.; Al-Ramady, Amir M.

2016-01-01

Thallium (Tl81217), Bismuth (Bi83217), Astatine (At85217), Francium (Fr87217), Actinium (Ac89217) and Protactinium (Pa91217) are of odd-proton numbers among the mass chain A = 217. In the present work, the half-lives and gamma transitions for the six nuclei have been studied and adopted based on the recently published interactions or unevaluated nuclear data sets XUNDL. The Q (α) has been updated based on the recent published work of the Atomic Mass Evaluation AME2012 as well. Moreover, the total conversion electrons as well as the K-Shell to L-Shell, L-Shell to M-Shell and L-Shell to N-Shell Conversion Electron Ratios have been calculated using BrIcc code v2.3. An updated skeleton decay scheme for each of the above nuclei has been presented here. The decay hindrance factors (HF) calculated using the ALPHAD program, which is available from Brookhaven National Laboratory’s website, have been calculated for the α- decay data sets for 221Fr-, 221Ac- and 221Pa- α-decays. PMID:26761207

Bayesian calibration of terrestrial ecosystem models: A study of advanced Markov chain Monte Carlo methods

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu, Dan; Ricciuto, Daniel; Walker, Anthony

Calibration of terrestrial ecosystem models is important but challenging. Bayesian inference implemented by Markov chain Monte Carlo (MCMC) sampling provides a comprehensive framework to estimate model parameters and associated uncertainties using their posterior distributions. The effectiveness and efficiency of the method strongly depend on the MCMC algorithm used. In this study, a Differential Evolution Adaptive Metropolis (DREAM) algorithm was used to estimate posterior distributions of 21 parameters for the data assimilation linked ecosystem carbon (DALEC) model using 14 years of daily net ecosystem exchange data collected at the Harvard Forest Environmental Measurement Site eddy-flux tower. The DREAM is a multi-chainmore » method and uses differential evolution technique for chain movement, allowing it to be efficiently applied to high-dimensional problems, and can reliably estimate heavy-tailed and multimodal distributions that are difficult for single-chain schemes using a Gaussian proposal distribution. The results were evaluated against the popular Adaptive Metropolis (AM) scheme. DREAM indicated that two parameters controlling autumn phenology have multiple modes in their posterior distributions while AM only identified one mode. The calibration of DREAM resulted in a better model fit and predictive performance compared to the AM. DREAM provides means for a good exploration of the posterior distributions of model parameters. Lastly, it reduces the risk of false convergence to a local optimum and potentially improves the predictive performance of the calibrated model.« less

Bayesian calibration of terrestrial ecosystem models: A study of advanced Markov chain Monte Carlo methods

DOE PAGES

Lu, Dan; Ricciuto, Daniel; Walker, Anthony; ...

2017-02-22

Calibration of terrestrial ecosystem models is important but challenging. Bayesian inference implemented by Markov chain Monte Carlo (MCMC) sampling provides a comprehensive framework to estimate model parameters and associated uncertainties using their posterior distributions. The effectiveness and efficiency of the method strongly depend on the MCMC algorithm used. In this study, a Differential Evolution Adaptive Metropolis (DREAM) algorithm was used to estimate posterior distributions of 21 parameters for the data assimilation linked ecosystem carbon (DALEC) model using 14 years of daily net ecosystem exchange data collected at the Harvard Forest Environmental Measurement Site eddy-flux tower. The DREAM is a multi-chainmore » method and uses differential evolution technique for chain movement, allowing it to be efficiently applied to high-dimensional problems, and can reliably estimate heavy-tailed and multimodal distributions that are difficult for single-chain schemes using a Gaussian proposal distribution. The results were evaluated against the popular Adaptive Metropolis (AM) scheme. DREAM indicated that two parameters controlling autumn phenology have multiple modes in their posterior distributions while AM only identified one mode. The calibration of DREAM resulted in a better model fit and predictive performance compared to the AM. DREAM provides means for a good exploration of the posterior distributions of model parameters. Lastly, it reduces the risk of false convergence to a local optimum and potentially improves the predictive performance of the calibrated model.« less

A pilot study to assess feasibility of value based pricing in Cyprus through pharmacoeconomic modelling and assessment of its operational framework: sorafenib for second line renal cell cancer.

PubMed

Petrou, Panagiotis; Talias, Michael A

2014-01-01

The continuing increase of pharmaceutical expenditure calls for new approaches to pricing and reimbursement of pharmaceuticals. Value based pricing of pharmaceuticals is emerging as a useful tool and possess theoretical attributes to help health system cope with rising pharmaceutical expenditure. To assess the feasibility of introducing a value-based pricing scheme of pharmaceuticals in Cyprus and explore the integrative framework. A probabilistic Markov chain Monte Carlo model was created to simulate progression of advanced renal cell cancer for comparison of sorafenib to standard best supportive care. Literature review was performed and efficacy data were transferred from a published landmark trial, while official pricelists and clinical guidelines from Cyprus Ministry of Health were utilised for cost calculation. Based on proposed willingness to pay threshold the maximum price of sorafenib for the indication of second line renal cell cancer was assessed. Sorafenib value based price was found to be significantly lower compared to its current reference price. Feasibility of Value Based Pricing is documented and pharmacoeconomic modelling can lead to robust results. Integration of value and affordability in the price are its main advantages which have to be weighed against lack of documentation for several theoretical parameters that influence outcome. Smaller countries such as Cyprus may experience adversities in establishing and sustaining essential structures for this scheme.

VPipe: Virtual Pipelining for Scheduling of DAG Stream Query Plans

NASA Astrophysics Data System (ADS)

Wang, Song; Gupta, Chetan; Mehta, Abhay

There are data streams all around us that can be harnessed for tremendous business and personal advantage. For an enterprise-level stream processing system such as CHAOS [1] (Continuous, Heterogeneous Analytic Over Streams), handling of complex query plans with resource constraints is challenging. While several scheduling strategies exist for stream processing, efficient scheduling of complex DAG query plans is still largely unsolved. In this paper, we propose a novel execution scheme for scheduling complex directed acyclic graph (DAG) query plans with meta-data enriched stream tuples. Our solution, called Virtual Pipelined Chain (or VPipe Chain for short), effectively extends the "Chain" pipelining scheduling approach to complex DAG query plans.

Dynamic SVL and body bias for low leakage power and high performance in CMOS digital circuits

NASA Astrophysics Data System (ADS)

Deshmukh, Jyoti; Khare, Kavita

2012-12-01

In this article, a new complementary metal oxide semiconductor design scheme called dynamic self-controllable voltage level (DSVL) is proposed. In the proposed scheme, leakage power is controlled by dynamically disconnecting supply to inactive blocks and adjusting body bias to further limit leakage and to maintain performance. Leakage power measurements at 1.8 V, 75°C demonstrate power reduction by 59.4% in case of 1 bit full adder and by 43.0% in case of a chain of four inverters using SVL circuit as a power switch. Furthermore, we achieve leakage power reduction by 94.7% in case of 1 bit full adder and by 91.8% in case of a chain of four inverters using dynamic body bias. The forward body bias of 0.45 V applied in active mode improves the maximum operating frequency by 16% in case of 1 bit full adder and 5.55% in case of a chain of inverters. Analysis shows that additional benefits of using the DSVL and body bias include high performance, low leakage power consumption in sleep mode, single threshold implementation and state retention even in standby mode.

A Scheme for the Integrated Assessment of Mitigation Options

NASA Astrophysics Data System (ADS)

Held, H.; Edenhofer, O.

2003-04-01

After some consensus has been achieved that the global mean temperature will have increased by 1.4 to 5.8^oC at the end of this century in case of continued ``business as usual'' greenhouse gas emissions, society has to decide if or which mitigation measures should be taken. A new integrated assessment project on this very issue will be started at PIK in spring 2003. The assessment will cover economic aspects as well as potential side effects of various measures. In the economic module, the effects of investment decisions on technological innovation will be explicitly taken into account. Special emphasize will be put on the issue of uncertainty. Hereby we distinguish the uncertainty related to the Integrated Assessment modules, including the economic module, from the fact that no over-complex system can be fully captured by a model. Therefore, a scheme for the assessment of the ``residual'', the non-modelled part of the system, needs to be worked out. The scheme must be truly interdisciplinary, i.e. must be applicable to at least the natural science and the economic aspects. A scheme based on meta-principles like minimum persistence, ubiquity, or irreversibility of potential measures appears to be a promising candidate. An implementation of ubiquity as at present successfully operated in environmental chemistry may serve as a guideline [1]. Here, the best-known mechanism within a complex impact chain of potentially harmful chemicals, their transport, is captured by a reaction-diffusion mechanism [2]. begin{thebibliography}{0} bibitem{s} M. Scheringer, Persistence and spatial range as endpoints of an exposure-based assessment of organic chemicals. Environ. Sci. Technol. 30: 1652-1659 (1996). bibitem{h} H. Held, Robustness of spatial ranges of environmental chemicals with respect to model dimension, accepted for publication in Stoch. Environ. Res. Risk Assessment.

Skill (or lack thereof) of data-model fusion techniques to provide an early warning signal for an approaching tipping point.

PubMed

Singh, Riddhi; Quinn, Julianne D; Reed, Patrick M; Keller, Klaus

2018-01-01

Many coupled human-natural systems have the potential to exhibit a highly nonlinear threshold response to external forcings resulting in fast transitions to undesirable states (such as eutrophication in a lake). Often, there are considerable uncertainties that make identifying the threshold challenging. Thus, rapid learning is critical for guiding management actions to avoid abrupt transitions. Here, we adopt the shallow lake problem as a test case to compare the performance of four common data assimilation schemes to predict an approaching transition. In order to demonstrate the complex interactions between management strategies and the ability of the data assimilation schemes to predict eutrophication, we also analyze our results across two different management strategies governing phosphorus emissions into the shallow lake. The compared data assimilation schemes are: ensemble Kalman filtering (EnKF), particle filtering (PF), pre-calibration (PC), and Markov Chain Monte Carlo (MCMC) estimation. While differing in their core assumptions, each data assimilation scheme is based on Bayes' theorem and updates prior beliefs about a system based on new information. For large computational investments, EnKF, PF and MCMC show similar skill in capturing the observed phosphorus in the lake (measured as expected root mean squared prediction error). EnKF, followed by PF, displays the highest learning rates at low computational cost, thus providing a more reliable signal of an impending transition. MCMC approaches the true probability of eutrophication only after a strong signal of an impending transition emerges from the observations. Overall, we find that learning rates are greatest near regions of abrupt transitions, posing a challenge to early learning and preemptive management of systems with such abrupt transitions.

Skill (or lack thereof) of data-model fusion techniques to provide an early warning signal for an approaching tipping point

PubMed Central

Quinn, Julianne D.; Reed, Patrick M.; Keller, Klaus

2018-01-01

Many coupled human-natural systems have the potential to exhibit a highly nonlinear threshold response to external forcings resulting in fast transitions to undesirable states (such as eutrophication in a lake). Often, there are considerable uncertainties that make identifying the threshold challenging. Thus, rapid learning is critical for guiding management actions to avoid abrupt transitions. Here, we adopt the shallow lake problem as a test case to compare the performance of four common data assimilation schemes to predict an approaching transition. In order to demonstrate the complex interactions between management strategies and the ability of the data assimilation schemes to predict eutrophication, we also analyze our results across two different management strategies governing phosphorus emissions into the shallow lake. The compared data assimilation schemes are: ensemble Kalman filtering (EnKF), particle filtering (PF), pre-calibration (PC), and Markov Chain Monte Carlo (MCMC) estimation. While differing in their core assumptions, each data assimilation scheme is based on Bayes’ theorem and updates prior beliefs about a system based on new information. For large computational investments, EnKF, PF and MCMC show similar skill in capturing the observed phosphorus in the lake (measured as expected root mean squared prediction error). EnKF, followed by PF, displays the highest learning rates at low computational cost, thus providing a more reliable signal of an impending transition. MCMC approaches the true probability of eutrophication only after a strong signal of an impending transition emerges from the observations. Overall, we find that learning rates are greatest near regions of abrupt transitions, posing a challenge to early learning and preemptive management of systems with such abrupt transitions. PMID:29389938

Evaluating the improvements of the BOLAM meteorological model operational at ISPRA: A case study approach - preliminary results

NASA Astrophysics Data System (ADS)

Mariani, S.; Casaioli, M.; Lastoria, B.; Accadia, C.; Flavoni, S.

2009-04-01

The Institute for Environmental Protection and Research - ISPRA (former Agency for Environmental Protection and Technical Services - APAT) runs operationally since 2000 an integrated meteo-marine forecasting chain, named the Hydro-Meteo-Marine Forecasting System (Sistema Idro-Meteo-Mare - SIMM), formed by a cascade of four numerical models, telescoping from the Mediterranean basin to the Venice Lagoon, and initialized by means of analyses and forecasts from the European Centre for Medium-Range Weather Forecasts (ECMWF). The operational integrated system consists of a meteorological model, the parallel verision of BOlogna Limited Area Model (BOLAM), coupled over the Mediterranean sea with a WAve Model (WAM), a high-resolution shallow-water model of the Adriatic and Ionian Sea, namely the Princeton Ocean Model (POM), and a finite-element version of the same model (VL-FEM) on the Venice Lagoon, aimed to forecast the acqua alta events. Recently, the physically based, fully distributed, rainfall-runoff TOPographic Kinematic APproximation and Integration (TOPKAPI) model has been integrated into the system, coupled to BOLAM, over two river basins, located in the central and northeastern part of Italy, respectively. However, at the present time, this latter part of the forecasting chain is not operational and it is used in a research configuration. BOLAM was originally implemented in 2000 onto the Quadrics parallel supercomputer (and for this reason referred to as QBOLAM, as well) and only at the end of 2006 it was ported (together with the other operational marine models of the forecasting chain) onto the Silicon Graphics Inc. (SGI) Altix 8-processor machine. In particular, due to the Quadrics implementation, the Kuo scheme was formerly implemented into QBOLAM for the cumulus convection parameterization. On the contrary, when porting SIMM onto the Altix Linux cluster, it was achievable to implement into QBOLAM the more advanced convection parameterization by Kain and Fritsch. A fully updated serial version of the BOLAM code has been recently acquired. Code improvements include a more precise advection scheme (Weighted Average Flux); explicit advection of five hydrometeors, and state-of-the-art parameterization schemes for radiation, convection, boundary layer turbulence and soil processes (also with possible choice among different available schemes). The operational implementation of the new code into the SIMM model chain, which requires the development of a parallel version, will be achieved during 2009. In view of this goal, the comparative verification of the different model versions' skill represents a fundamental task. On this purpose, it has been decided to evaluate the performance improvement of the new BOLAM code (in the available serial version, hereinafter BOLAM 2007) with respect to the version with the Kain-Fritsch scheme (hereinafter KF version) and to the older one employing the Kuo scheme (hereinafter Kuo version). In the present work, verification of precipitation forecasts from the three BOLAM versions is carried on in a case study approach. The intense rainfall episode occurred on 10th - 17th December 2008 over Italy has been considered. This event produced indeed severe damages in Rome and its surrounding areas. Objective and subjective verification methods have been employed in order to evaluate model performance against an observational dataset including rain gauge observations and satellite imagery. Subjective comparison of observed and forecast precipitation fields is suitable to give an overall description of the forecast quality. Spatial errors (e.g., shifting and pattern errors) and rainfall volume error can be assessed quantitatively by means of object-oriented methods. By comparing satellite images with model forecast fields, it is possible to investigate the differences between the evolution of the observed weather system and the predicted ones, and its sensitivity to the improvements in the model code. Finally, the error in forecasting the cyclone evolution can be tentatively related with the precipitation forecast error.

Fast-NPS-A Markov Chain Monte Carlo-based analysis tool to obtain structural information from single-molecule FRET measurements

NASA Astrophysics Data System (ADS)

Eilert, Tobias; Beckers, Maximilian; Drechsler, Florian; Michaelis, Jens

2017-10-01

The analysis tool and software package Fast-NPS can be used to analyse smFRET data to obtain quantitative structural information about macromolecules in their natural environment. In the algorithm a Bayesian model gives rise to a multivariate probability distribution describing the uncertainty of the structure determination. Since Fast-NPS aims to be an easy-to-use general-purpose analysis tool for a large variety of smFRET networks, we established an MCMC based sampling engine that approximates the target distribution and requires no parameter specification by the user at all. For an efficient local exploration we automatically adapt the multivariate proposal kernel according to the shape of the target distribution. In order to handle multimodality, the sampler is equipped with a parallel tempering scheme that is fully adaptive with respect to temperature spacing and number of chains. Since the molecular surrounding of a dye molecule affects its spatial mobility and thus the smFRET efficiency, we introduce dye models which can be selected for every dye molecule individually. These models allow the user to represent the smFRET network in great detail leading to an increased localisation precision. Finally, a tool to validate the chosen model combination is provided. Programme Files doi:http://dx.doi.org/10.17632/7ztzj63r68.1 Licencing provisions: Apache-2.0 Programming language: GUI in MATLAB (The MathWorks) and the core sampling engine in C++ Nature of problem: Sampling of highly diverse multivariate probability distributions in order to solve for macromolecular structures from smFRET data. Solution method: MCMC algorithm with fully adaptive proposal kernel and parallel tempering scheme.

Integration of environmental aspects in modelling and optimisation of water supply chains.

PubMed

Koleva, Mariya N; Calderón, Andrés J; Zhang, Di; Styan, Craig A; Papageorgiou, Lazaros G

2018-04-26

Climate change becomes increasingly more relevant in the context of water systems planning. Tools are necessary to provide the most economic investment option considering the reliability of the infrastructure from technical and environmental perspectives. Accordingly, in this work, an optimisation approach, formulated as a spatially-explicit multi-period Mixed Integer Linear Programming (MILP) model, is proposed for the design of water supply chains at regional and national scales. The optimisation framework encompasses decisions such as installation of new purification plants, capacity expansion, and raw water trading schemes. The objective is to minimise the total cost incurring from capital and operating expenditures. Assessment of available resources for withdrawal is performed based on hydrological balances, governmental rules and sustainable limits. In the light of the increasing importance of reliability of water supply, a second objective, seeking to maximise the reliability of the supply chains, is introduced. The epsilon-constraint method is used as a solution procedure for the multi-objective formulation. Nash bargaining approach is applied to investigate the fair trade-offs between the two objectives and find the Pareto optimality. The models' capability is addressed through a case study based on Australia. The impact of variability in key input parameters is tackled through the implementation of a rigorous global sensitivity analysis (GSA). The findings suggest that variations in water demand can be more disruptive for the water supply chain than scenarios in which rainfalls are reduced. The frameworks can facilitate governmental multi-aspect decision making processes for the adequate and strategic investments of regional water supply infrastructure. Copyright © 2018. Published by Elsevier B.V.

Universality of bridge functions and its relation to variational perturbation theory and additivity of equations of state

NASA Astrophysics Data System (ADS)

Rosenfeld, Yaakov

1984-05-01

Featuring the modified hypernetted-chain (MHNC) scheme as a variational fitting procedure, we demonstrate that the accuracy of the variational perturbation theory (VPT) and of the method based on additivity of equations of state is determined by the excess entropy dependence of the bridge-function parameters [i.e., η(s) when the Percus-Yevick hard-sphere bridge functions are employed]. It is found that η(s) is nearly universal for all soft (i.e., "physical") potentials while it is distinctly different for the hard spheres, providing a graphical display of the "jump" in pair-potential space (with respect to accuracy of VPT) from "hard" to "soft" behavior. The universality of η(s) provides a local criterion for the MHNC scheme that should be useful for inverting structure-factor data in order to obtain the potential. An alternative local MHNC criterion due to Lado is rederived and extended, and it is also analyzed in light of the plot of η(s).

Amino acid adsorption on anatase (101) surface at vacuum and aqueous solution: a density functional study.

PubMed

Liu, Liuxie; Li, Kai; Chen, Xiao; Liang, Xiaoqin; Zheng, Yan; Li, Laicai

2018-03-29

The adsorption of 20 amino acids (AAs) on the (101) surface of anatase titanium dioxide (TiO 2 ) has been investigated under the scheme of density functional theory. Through the analysis of adsorption geometries, amino group and side chains of AAs have been identified as the major side to adsorb on TiO 2 , while the carboxyl group prefers to stay outside to avoid the repulsion between negatively charged oxygen from TiO 2 and AAs. On the surface, two-coordinated oxygen is the major site to stabilize AAs through O-H interactions. The above conclusion does not change when it is in the aqueous solution based on the calculations with AAs surrounded by explicit water molecules. The above knowledge is helpful in predicting how AAs and even peptides adsorb on inorganic materials. Graphical abstract The adsorption of 20 amino acids (AAs) on the (101) surface of anatase titanium dioxide (TiO 2 ) has been investigated under the scheme of density functional theory.

The effect of governance mechanisms on food safety in the supply chain: Evidence from the Lebanese dairy sector.

PubMed

Abebe, Gumataw K; Chalak, Ali; Abiad, Mohamad G

2017-07-01

Food safety is a key public health issue worldwide. This study aims to characterise existing governance mechanisms - governance structures (GSs) and food safety management systems (FSMSs) - and analyse the alignment thereof in detecting food safety hazards, based on empirical evidence from Lebanon. Firm-to-firm and public baseline are the dominant FSMSs applied in a large-scale, while chain-wide FSMSs are observed only in a small-scale. Most transactions involving farmers are relational and market-based in contrast to (large-scale) processors, which opt for hierarchical GSs. Large-scale processors use a combination of FSMSs and GSs to minimise food safety hazards albeit potential increase in coordination costs; this is an important feature of modern food supply chains. The econometric analysis reveals contract period, on-farm inspection and experience having significant effects in minimising food safety hazards. However, the potential to implement farm-level FSMS is influenced by formality of the contract, herd size, trading partner choice, and experience. Public baseline FSMSs appear effective in controlling food safety hazards; however, this may not be viable due to the scarcity of public resources. We suggest public policies to focus on long-lasting governance mechanisms by introducing incentive schemes and farm-level FSMSs by providing loans and education to farmers. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

Development of structural schemes of parallel structure manipulators using screw calculus

NASA Astrophysics Data System (ADS)

Rashoyan, G. V.; Shalyukhin, K. A.; Gaponenko, EV

2018-03-01

The paper considers the approach to the structural analysis and synthesis of parallel structure robots based on the mathematical apparatus of groups of screws and on a concept of reciprocity of screws. The results are depicted of synthesis of parallel structure robots with different numbers of degrees of freedom, corresponding to the different groups of screws. Power screws are applied with this aim, based on the principle of static-kinematic analogy; the power screws are similar to the orts of axes of not driven kinematic pairs of a corresponding connecting chain. Accordingly, kinematic screws of the outlet chain of a robot are simultaneously determined which are reciprocal to power screws of kinematic sub-chains. Solution of certain synthesis problems is illustrated with practical applications. Closed groups of screws can have eight types. The three-membered groups of screws are of greatest significance, as well as four-membered screw groups [1] and six-membered screw groups. Three-membered screw groups correspond to progressively guiding mechanisms, to spherical mechanisms, and to planar mechanisms. The four-membered group corresponds to the motion of the SCARA robot. The six-membered group includes all possible motions. From the works of A.P. Kotelnikov, F.M. Dimentberg, it is known that closed fifth-order screw groups do not exist. The article presents examples of the mechanisms corresponding to the given groups.

On Substrate for Atomic Chain Electronics

NASA Technical Reports Server (NTRS)

Yamada, Toshishige; Bauschlicher, Charles W., Jr.; Partridge, Harry; Saini, Subhash (Technical Monitor)

1998-01-01

A substrate for future atomic chain electronics, where adatoms are placed at designated positions and form atomically precise device components, is studied theoretically. The substrate has to serve as a two-dimensional template for adatom mounting with a reasonable confinement barrier and also provide electronic isolation, preventing unwanted coupling between independent adatom structures. However, the two requirements conflict. For excellent electronic isolation, we may seek adatom confinement via van der Waals interaction without chemical bonding to the substrate atoms, but the confinement turns out to be very weak and hence unsatisfactory. An alternative chemical bonding scheme with excellent structural strength is examined, but even fundamental adatom chain properties such as whether chains are semiconducting or metallic are strongly influenced by the nature of the chemical bonding, and electronic isolation is not always achieved. Conditions for obtaining semiconducting chains with well-localized surface-modes, leading to good isolation, are clarified and discussed.

Measurement-device-independent quantum key distribution with multiple crystal heralded source with post-selection

NASA Astrophysics Data System (ADS)

Chen, Dong; Shang-Hong, Zhao; MengYi, Deng

2018-03-01

The multiple crystal heralded source with post-selection (MHPS), originally introduced to improve the single-photon character of the heralded source, has specific applications for quantum information protocols. In this paper, by combining decoy-state measurement-device-independent quantum key distribution (MDI-QKD) with spontaneous parametric downconversion process, we present a modified MDI-QKD scheme with MHPS where two architectures are proposed corresponding to symmetric scheme and asymmetric scheme. The symmetric scheme, which linked by photon switches in a log-tree structure, is adopted to overcome the limitation of the current low efficiency of m-to-1 optical switches. The asymmetric scheme, which shows a chained structure, is used to cope with the scalability issue with increase in the number of crystals suffered in symmetric scheme. The numerical simulations show that our modified scheme has apparent advances both in transmission distance and key generation rate compared to the original MDI-QKD with weak coherent source and traditional heralded source with post-selection. Furthermore, the recent advances in integrated photonics suggest that if built into a single chip, the MHPS might be a practical alternative source in quantum key distribution tasks requiring single photons to work.

Soft x-ray plasma-based seeded multistage amplification chain.

PubMed

Oliva, Eduardo; Fajardo, Marta; Li, Lu; Sebban, Stephane; Ros, David; Zeitoun, Philippe

2012-10-15

To date, plasma-based soft x-ray lasers have demonstrated experimentally 1 μJ, 1 ps (1 MW) pulses. This Letter reports extensive study using time-dependant Maxwell-Bloch code of seeding millimeter scale plasmas that store more than 100 mJ in population inversion. Direct seeding of these plasmas has to overcome very strong amplified spontaneous emission (ASE) as well as prevent wake-field amplification. Below 100 nJ injected energy, seed produces pulses with picosecond duration. To overcome this limitation, a new scheme has been studied, taking advantage of a plasma preamplifier that dramatically increases the seed energy prior to entering the main plasma amplifier leading to ASE and wake-free, fully coherent 21.6 μJ, 80 fs pulses (0.27 GW).

Photon transport in a dissipative chain of nonlinear cavities

NASA Astrophysics Data System (ADS)

Biella, Alberto; Mazza, Leonardo; Carusotto, Iacopo; Rossini, Davide; Fazio, Rosario

2015-05-01

By means of numerical simulations and the input-output formalism, we study photon transport through a chain of coupled nonlinear optical cavities subject to uniform dissipation. Photons are injected from one end of the chain by means of a coherent source. The propagation through the array of cavities is sensitive to the interplay between the photon hopping strength and the local nonlinearity in each cavity. We characterize photon transport by studying the populations and the photon correlations as a function of the cavity position. When complemented with input-output theory, these quantities provide direct information about photon transmission through the system. The position of single-photon and multiphoton resonances directly reflects the structure of the many-body energy levels. This shows how a study of transport along a coupled cavity array can provide rich information about the strongly correlated (many-body) states of light even in presence of dissipation. The numerical algorithm we use, based on the time-evolving block decimation scheme adapted to mixed states, allows us to simulate large arrays (up to 60 cavities). The scaling of photon transmission with the number of cavities does depend on the structure of the many-body photon states inside the array.

Decay spectroscopy of element 115 daughters: Rg 280 → Mt 276 and Mt 276 → Bh 272

DOE PAGES

Gates, J. M.; Gregorich, K. E.; Gothe, O. R.; ...

2015-08-03

In this study, forty-six decay chains, assigned to the decay of 288115, were produced using the 243Am ( 48Ca, 3n) 288115 reaction at the Lawrence Berkeley National Laboratory 88-in. cyclotron. The resulting series of α decays were studied using α-photon and α-x-ray spectroscopies. Multiple α-photon coincidences were observed in the element 115 decay chain members, particularly in the third- and fourth-generation decays (presumed to be 280Rg and 276Mt, respectively). Upon combining these data with those from 22 288115 decay chains observed in a similar experiment, updated level schemes in 276Mt and 272Bh (populated by the α decay of 280Rg andmore » 276Mt, respectively) are proposed. Additionally, photons were observed in the energy range expected for K x rays coincident with the α decay of both 280Rg and 276Mt. However, Compton scattering of higher-energy γ rays and discrete transitions are present in the K x-ray region preventing a definitive Z identification to be made based on observation of characteristic K x-ray energies.« less

Production planning and backup sourcing strategy of a buyer-dominant supply chain with random yield and demand

NASA Astrophysics Data System (ADS)

Chen, Kebing; Xiao, Tiaojun

2015-11-01

This paper studies the backup sourcing strategy of the buyer and the production planning of the supplier in presence of both random yield and random demand. Since the production is susceptible to the randomness of yield beyond the control of the supplier, the buyer may access to a backup sourcing option for the finished items. We analyse the value of backup sourcing for both the decentralised and centralised channels. Backup sourcing strategy of the buyer may lower the supply chain's performance. We show that the order quantity of the buyer does not change the stocking factor of the supplier's input. Meanwhile, compared with the centralised operation, the decentralised operation is more dependent on the backup sourcing to reduce supply shortage of the contracting supplier. From the channel's perspective, an incentive scheme is developed to facilitate the coordination of both the buyer and the contracting supplier, we show that the proposed option contract can allow the supply chain members to share the respective risks involved in the production and selling processes. Finally, we also provide qualitative insights based on numerical examples of the centralised and decentralised solutions.

Towards integrated care for chronic conditions: Dutch policy developments to overcome the (financial) barriers.

PubMed

Tsiachristas, Apostolos; Hipple-Walters, Bethany; Lemmens, Karin M M; Nieboer, Anna P; Rutten-van Mölken, Maureen P M H

2011-07-01

Chronic non-communicable diseases are a major threat to population health and have a major economic impact on health care systems. Worldwide, integrated chronic care delivery systems have been developed to tackle this challenge. In the Netherlands, the recently introduced integrated payment system--the chain-DTC--is seen as the cornerstone of a policy stimulating the development of a well-functioning integrated chronic care system. The purpose of this paper is to describe the recent attempts in the Netherlands to stimulate the delivery of integrated chronic care, focusing specifically on the new integrated payment scheme and the barriers to introducing this scheme. We also highlight possible threats and identify necessary conditions to the success of the system. This paper is based on a combination of methods and sources including literature, government documents, personal communications and site visits to disease management programs (DMPs). The most important conditions for the success of the new payment system are: complete care protocols describing both general (e.g. smoking cessation, physical activity) and disease-specific chronic care modules, coverage of all components of a DMP by basic health care insurance, adequate information systems that facilitate communication between caregivers, explicit links between the quality and the price of a DMP, expansion of the amount of specialized care included in the chain-DTC, inclusion of a multi-morbidity factor in the risk equalization formula of insurers, and thorough economic evaluation of DMPs. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

Optimal Base Station Density of Dense Network: From the Viewpoint of Interference and Load.

PubMed

Feng, Jianyuan; Feng, Zhiyong

2017-09-11

Network densification is attracting increasing attention recently due to its ability to improve network capacity by spatial reuse and relieve congestion by offloading. However, excessive densification and aggressive offloading can also cause the degradation of network performance due to problems of interference and load. In this paper, with consideration of load issues, we study the optimal base station density that maximizes the throughput of the network. The expected link rate and the utilization ratio of the contention-based channel are derived as the functions of base station density using the Poisson Point Process (PPP) and Markov Chain. They reveal the rules of deployment. Based on these results, we obtain the throughput of the network and indicate the optimal deployment density under different network conditions. Extensive simulations are conducted to validate our analysis and show the substantial performance gain obtained by the proposed deployment scheme. These results can provide guidance for the network densification.

How tension propagates for a driven semi-flexible chain while translocating through a nano-pore

NASA Astrophysics Data System (ADS)

Adhikari, Ramesh; Bhattacharya, Aniket

2013-03-01

Driven translocation of a stiff chain through a nano-pore is studied using Langevin dynamics in two dimension (2D). We observe that for a given chain length N the mean first passage time (MFPT) < τ > increases for a stiffer chain and the translocation exponent α (< τ > ~Nα) satisfies the inequality 2 ν < α < 1 + ν , where ν is the equilibrium Flory exponent for a given chain stiffness. We calculate the residence time of the individual monomers and observe that the peak position of the residence time W (m) as a function of the monomer index m shifts at a lower m-value with increasing chain stiffness κb. Finally, we provide qualitative physical explanation for dependence of various quantities on chain stiffness κb by using ideas from Sakaue's tension propagation(TP) theory [Phys. Rev. E 76, 021803 (2007)] and its recent implementation into a Brownian dynamics tension propagation (BDTP) scheme for a finite chain by Ikonen et al. [J. Chem. Phys. 137, 085101 (2012); Phys. Rev. E 85, 051803 (2012)]for a semi-flexible chain. Partially supported by UCF Office of Research and Commercialization & College of Science SEED grant.

An accurate density functional theory based estimation of pK(a) values of polar residues combined with experimental data: from amino acids to minimal proteins.

PubMed

Matsui, Toru; Baba, Takeshi; Kamiya, Katsumasa; Shigeta, Yasuteru

2012-03-28

We report a scheme for estimating the acid dissociation constant (pK(a)) based on quantum-chemical calculations combined with a polarizable continuum model, where a parameter is determined for small reference molecules. We calculated the pK(a) values of variously sized molecules ranging from an amino acid to a protein consisting of 300 atoms. This scheme enabled us to derive a semiquantitative pK(a) value of specific chemical groups and discuss the influence of the surroundings on the pK(a) values. As applications, we have derived the pK(a) value of the side chain of an amino acid and almost reproduced the experimental value. By using our computing schemes, we showed the influence of hydrogen bonds on the pK(a) values in the case of tripeptides, which decreases the pK(a) value by 3.0 units for serine in comparison with those of the corresponding monopeptides. Finally, with some assumptions, we derived the pK(a) values of tyrosines and serines in chignolin and a tryptophan cage. We obtained quite different pK(a) values of adjacent serines in the tryptophan cage; the pK(a) value of the OH group of Ser13 exposed to bulk water is 14.69, whereas that of Ser14 not exposed to bulk water is 20.80 because of the internal hydrogen bonds.

Compressive sampling of polynomial chaos expansions: Convergence analysis and sampling strategies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hampton, Jerrad; Doostan, Alireza, E-mail: alireza.doostan@colorado.edu

2015-01-01

Sampling orthogonal polynomial bases via Monte Carlo is of interest for uncertainty quantification of models with random inputs, using Polynomial Chaos (PC) expansions. It is known that bounding a probabilistic parameter, referred to as coherence, yields a bound on the number of samples necessary to identify coefficients in a sparse PC expansion via solution to an ℓ{sub 1}-minimization problem. Utilizing results for orthogonal polynomials, we bound the coherence parameter for polynomials of Hermite and Legendre type under their respective natural sampling distribution. In both polynomial bases we identify an importance sampling distribution which yields a bound with weaker dependence onmore » the order of the approximation. For more general orthonormal bases, we propose the coherence-optimal sampling: a Markov Chain Monte Carlo sampling, which directly uses the basis functions under consideration to achieve a statistical optimality among all sampling schemes with identical support. We demonstrate these different sampling strategies numerically in both high-order and high-dimensional, manufactured PC expansions. In addition, the quality of each sampling method is compared in the identification of solutions to two differential equations, one with a high-dimensional random input and the other with a high-order PC expansion. In both cases, the coherence-optimal sampling scheme leads to similar or considerably improved accuracy.« less

Poly(dimethylsiloxane)-Polyurethane Elastomers: Synthesis and Properties of Segmented Copolymers and Related Zwitterionomers.

DTIC Science & Technology

1984-11-01

8217-niethylenediphenylene diisocyanate (MDI) which was chain extended with either 1,4-butanediol (BD) or N -me thyl diethanol ami ne . - g.. ( MDEA ). The MDEA -extended...and then vacuum distilled. Tetrahydrofuran %S 9 4 (Aldrich) was dehydrated over calcium hydride. N -methyldiethanolamne ( MDEA ) (Aldrich) at 97 percent...2CM 2- N -CM2CH OH or MOCH 2CM 2CM2CM2OH MDEA B -EL-MTPS-( -MDI-BD--K-DI-+- TI x or nI X Schem~e 1. Synthetic sche-me for polysiloxa-e-pclyurethane

[The study of medical supplies automation replenishment algorithm in hospital on medical supplies supplying chain].

PubMed

Sheng, Xi

2012-07-01

The thesis aims to study the automation replenishment algorithm in hospital on medical supplies supplying chain. The mathematical model and algorithm of medical supplies automation replenishment are designed through referring to practical data form hospital on the basis of applying inventory theory, greedy algorithm and partition algorithm. The automation replenishment algorithm is proved to realize automatic calculation of the medical supplies distribution amount and optimize medical supplies distribution scheme. A conclusion could be arrived that the model and algorithm of inventory theory, if applied in medical supplies circulation field, could provide theoretical and technological support for realizing medical supplies automation replenishment of hospital on medical supplies supplying chain.

Graph state generation with noisy mirror-inverting spin chains

NASA Astrophysics Data System (ADS)

Clark, Stephen R.; Klein, Alexander; Bruderer, Martin; Jaksch, Dieter

2007-06-01

We investigate the influence of noise on a graph state generation scheme which exploits a mirror inverting spin chain. Within this scheme the spin chain is used repeatedly as an entanglement bus (EB) to create multi-partite entanglement. The noise model we consider comprises of each spin of this EB being exposed to independent local noise which degrades the capabilities of the EB. Here we concentrate on quantifying its performance as a single-qubit channel and as a mediator of a two-qubit entangling gate, since these are basic operations necessary for graph state generation using the EB. In particular, for the single-qubit case we numerically calculate the average channel fidelity and whether the channel becomes entanglement breaking, i.e. expunges any entanglement the transferred qubit may have with other external qubits. We find that neither local decay nor dephasing noise cause entanglement breaking. This is in contrast to local thermal and depolarizing noise where we determine a critical length and critical noise coupling, respectively, at which entanglement breaking occurs. The critical noise coupling for local depolarizing noise is found to exhibit a power-law dependence on the chain length. For two-qubits we similarly compute the average gate fidelity and whether the ability for this gate to create entanglement is maintained. The concatenation of these noisy gates for the construction of a five-qubit linear cluster state and a Greenberger Horne Zeilinger state indicates that the level of noise that can be tolerated for graph state generation is tightly constrained.

Modeling global scene factors in attention

NASA Astrophysics Data System (ADS)

Torralba, Antonio

2003-07-01

Models of visual attention have focused predominantly on bottom-up approaches that ignored structured contextual and scene information. I propose a model of contextual cueing for attention guidance based on the global scene configuration. It is shown that the statistics of low-level features across the whole image can be used to prime the presence or absence of objects in the scene and to predict their location, scale, and appearance before exploring the image. In this scheme, visual context information can become available early in the visual processing chain, which allows modulation of the saliency of image regions and provides an efficient shortcut for object detection and recognition. 2003 Optical Society of America

A Security Analysis of the 802.11s Wireless Mesh Network Routing Protocol and Its Secure Routing Protocols

PubMed Central

Tan, Whye Kit; Lee, Sang-Gon; Lam, Jun Huy; Yoo, Seong-Moo

2013-01-01

Wireless mesh networks (WMNs) can act as a scalable backbone by connecting separate sensor networks and even by connecting WMNs to a wired network. The Hybrid Wireless Mesh Protocol (HWMP) is the default routing protocol for the 802.11s WMN. The routing protocol is one of the most important parts of the network, and it requires protection, especially in the wireless environment. The existing security protocols, such as the Broadcast Integrity Protocol (BIP), Counter with cipher block chaining message authentication code protocol (CCMP), Secure Hybrid Wireless Mesh Protocol (SHWMP), Identity Based Cryptography HWMP (IBC-HWMP), Elliptic Curve Digital Signature Algorithm HWMP (ECDSA-HWMP), and Watchdog-HWMP aim to protect the HWMP frames. In this paper, we have analyzed the vulnerabilities of the HWMP and developed security requirements to protect these identified vulnerabilities. We applied the security requirements to analyze the existing secure schemes for HWMP. The results of our analysis indicate that none of these protocols is able to satisfy all of the security requirements. We also present a quantitative complexity comparison among the protocols and an example of a security scheme for HWMP to demonstrate how the result of our research can be utilized. Our research results thus provide a tool for designing secure schemes for the HWMP. PMID:24002231

A security analysis of the 802.11s wireless mesh network routing protocol and its secure routing protocols.

PubMed

Tan, Whye Kit; Lee, Sang-Gon; Lam, Jun Huy; Yoo, Seong-Moo

2013-09-02

Wireless mesh networks (WMNs) can act as a scalable backbone by connecting separate sensor networks and even by connecting WMNs to a wired network. The Hybrid Wireless Mesh Protocol (HWMP) is the default routing protocol for the 802.11s WMN. The routing protocol is one of the most important parts of the network, and it requires protection, especially in the wireless environment. The existing security protocols, such as the Broadcast Integrity Protocol (BIP), Counter with cipher block chaining message authentication code protocol (CCMP), Secure Hybrid Wireless Mesh Protocol (SHWMP), Identity Based Cryptography HWMP (IBC-HWMP), Elliptic Curve Digital Signature Algorithm HWMP (ECDSA-HWMP), and Watchdog-HWMP aim to protect the HWMP frames. In this paper, we have analyzed the vulnerabilities of the HWMP and developed security requirements to protect these identified vulnerabilities. We applied the security requirements to analyze the existing secure schemes for HWMP. The results of our analysis indicate that none of these protocols is able to satisfy all of the security requirements. We also present a quantitative complexity comparison among the protocols and an example of a security scheme for HWMP to demonstrate how the result of our research can be utilized. Our research results thus provide a tool for designing secure schemes for the HWMP.

Ecosystem service information to benefit sustainability standards for commodity supply chains.

PubMed

Chaplin-Kramer, Rebecca; Jonell, Malin; Guerry, Anne; Lambin, Eric F; Morgan, Alexis J; Pennington, Derric; Smith, Nathan; Franch, Jane Atkins; Polasky, Stephen

2015-10-01

The growing base of information about ecosystem services generated by ecologists, economists, and other scientists could improve the implementation, monitoring, and evaluation of commodity-sourcing standards being adopted by corporations to mitigate risk in their supply chains and achieve sustainability goals. This review examines various ways that information about ecosystem services could facilitate compliance with and auditing of commodity-sourcing standards. We also identify gaps in the current state of knowledge on the ecological effectiveness of sustainability standards and demonstrate how ecosystem-service information could complement existing monitoring efforts to build credible evidence. This paper is a call to the ecosystem-service scientists to engage in this decision context and tailor the information they are generating to the needs of the standards community, which we argue would offer greater efficiency of standards implementation for producers and enhanced effectiveness for standard scheme owners and corporations, and should thus lead to more sustainable outcomes for people and nature. © 2015 New York Academy of Sciences.

Optimal rotated staggered-grid finite-difference schemes for elastic wave modeling in TTI media

NASA Astrophysics Data System (ADS)

Yang, Lei; Yan, Hongyong; Liu, Hong

2015-11-01

The rotated staggered-grid finite-difference (RSFD) is an effective approach for numerical modeling to study the wavefield characteristics in tilted transversely isotropic (TTI) media. But it surfaces from serious numerical dispersion, which directly affects the modeling accuracy. In this paper, we propose two different optimal RSFD schemes based on the sampling approximation (SA) method and the least-squares (LS) method respectively to overcome this problem. We first briefly introduce the RSFD theory, based on which we respectively derive the SA-based RSFD scheme and the LS-based RSFD scheme. Then different forms of analysis are used to compare the SA-based RSFD scheme and the LS-based RSFD scheme with the conventional RSFD scheme, which is based on the Taylor-series expansion (TE) method. The contrast in numerical accuracy analysis verifies the greater accuracy of the two proposed optimal schemes, and indicates that these schemes can effectively widen the wavenumber range with great accuracy compared with the TE-based RSFD scheme. Further comparisons between these two optimal schemes show that at small wavenumbers, the SA-based RSFD scheme performs better, while at large wavenumbers, the LS-based RSFD scheme leads to a smaller error. Finally, the modeling results demonstrate that for the same operator length, the SA-based RSFD scheme and the LS-based RSFD scheme can achieve greater accuracy than the TE-based RSFD scheme, while for the same accuracy, the optimal schemes can adopt shorter difference operators to save computing time.

Sythesis of MCMC and Belief Propagation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ahn, Sungsoo; Chertkov, Michael; Shin, Jinwoo

Markov Chain Monte Carlo (MCMC) and Belief Propagation (BP) are the most popular algorithms for computational inference in Graphical Models (GM). In principle, MCMC is an exact probabilistic method which, however, often suffers from exponentially slow mixing. In contrast, BP is a deterministic method, which is typically fast, empirically very successful, however in general lacking control of accuracy over loopy graphs. In this paper, we introduce MCMC algorithms correcting the approximation error of BP, i.e., we provide a way to compensate for BP errors via a consecutive BP-aware MCMC. Our framework is based on the Loop Calculus (LC) approach whichmore » allows to express the BP error as a sum of weighted generalized loops. Although the full series is computationally intractable, it is known that a truncated series, summing up all 2-regular loops, is computable in polynomial-time for planar pair-wise binary GMs and it also provides a highly accurate approximation empirically. Motivated by this, we first propose a polynomial-time approximation MCMC scheme for the truncated series of general (non-planar) pair-wise binary models. Our main idea here is to use the Worm algorithm, known to provide fast mixing in other (related) problems, and then design an appropriate rejection scheme to sample 2-regular loops. Furthermore, we also design an efficient rejection-free MCMC scheme for approximating the full series. The main novelty underlying our design is in utilizing the concept of cycle basis, which provides an efficient decomposition of the generalized loops. In essence, the proposed MCMC schemes run on transformed GM built upon the non-trivial BP solution, and our experiments show that this synthesis of BP and MCMC outperforms both direct MCMC and bare BP schemes.« less

Governance of agro-pesticide through private environmental and social standards in the global cut flower chain from Ethiopia.

PubMed

Mengistie, Belay T; Mol, Arthur P J; Oosterveer, Peter

2017-11-01

The international cut flower industry is strongly criticized because of its environmental impacts and unsafe working conditions. Increasing certification of cut flowers is used to improve the growers' environmental and social performance. But what is the impact of this private governance instrument on regulating the use of pesticides? This paper assesses the potential of private certification on governing the environmental and social problems from pesticide use along the global cut flower supply chain. We use detailed farm-level data to analyse the environmental and social impacts of flower certification in Ethiopia by comparing different national and international certification schemes. Our analysis does not show significant differences between these different private standards for most environmental and health and safety variables. The Ethiopian cut flower industry remains far from improving its sustainability performance through private certification. However, certification schemes may enable farmers to have access to international markets and keep up their reputation.

Optimized pulse shaping for trapped ion quantum computing

NASA Astrophysics Data System (ADS)

Manning, T.; Debnath, Shantanu; Choi, Taeyoung; Figgatt, Caroline; Monroe, Chris

2013-05-01

We perform entangling phase gates between pairs of qubits in a chain of trapped atomic ytterbium ions. Beat notes between frequency comb lines of a pulsed laser coherently drive Raman transitions that couple the hyperfine qubits to multiple collective transverse modes of motion. By optimizing the phase and amplitude of segmented laser pulses, we demonstrate a five-segment scheme to entangle two qubits with high fidelity over a range of detunings. We compare this special case of full control of spin-motion entanglement to a traditional single-segment gate. We extend this scheme to selectively entangle pairs of qubits in larger chains using individual optical addressing, where we couple to all the motional modes. We show how these robust gates can achieve high fidelities for practical gate times in an approach that scales realistically to much larger numbers of qubits. This work is supported by grants from the U.S. Army Research Office with funding from the DARPA OLE program, IARPA, and the MURI program; and the NSF Physics Frontier Center at JQI.

A pilot study to assess feasibility of value based pricing in Cyprus through pharmacoeconomic modelling and assessment of its operational framework: sorafenib for second line renal cell cancer

PubMed Central

2014-01-01

Background The continuing increase of pharmaceutical expenditure calls for new approaches to pricing and reimbursement of pharmaceuticals. Value based pricing of pharmaceuticals is emerging as a useful tool and possess theoretical attributes to help health system cope with rising pharmaceutical expenditure. Aim To assess the feasibility of introducing a value-based pricing scheme of pharmaceuticals in Cyprus and explore the integrative framework. Methods A probabilistic Markov chain Monte Carlo model was created to simulate progression of advanced renal cell cancer for comparison of sorafenib to standard best supportive care. Literature review was performed and efficacy data were transferred from a published landmark trial, while official pricelists and clinical guidelines from Cyprus Ministry of Health were utilised for cost calculation. Based on proposed willingness to pay threshold the maximum price of sorafenib for the indication of second line renal cell cancer was assessed. Results Sorafenib value based price was found to be significantly lower compared to its current reference price. Conclusion Feasibility of Value Based Pricing is documented and pharmacoeconomic modelling can lead to robust results. Integration of value and affordability in the price are its main advantages which have to be weighed against lack of documentation for several theoretical parameters that influence outcome. Smaller countries such as Cyprus may experience adversities in establishing and sustaining essential structures for this scheme. PMID:24910539

Kondo necklace model in approximants of Fibonacci chains

NASA Astrophysics Data System (ADS)

Reyes, Daniel; Tarazona, H.; Cuba-Supanta, G.; Landauro, C. V.; Espinoza, R.; Quispe-Marcatoma, J.

2017-11-01

The low energy behavior of the one dimensional Kondo necklace model with structural aperiodicity is studied using a representation for the localized and conduction electron spins, in terms of local Kondo singlet and triplet operators at zero temperature. A decoupling scheme on the double time Green's functions is used to find the dispersion relation for the excitations of the system. We determine the dependence between the structural aperiodicity modulation and the spin gap in a Fibonacci approximant chain at zero temperature and in the paramagnetic side of the phase diagram.

Cost analysis of an electricity supply chain using modification of price based dynamic economic dispatch in wheeling transaction scheme

NASA Astrophysics Data System (ADS)

Wahyuda; Santosa, Budi; Rusdiansyah, Ahmad

2018-04-01

Deregulation of the electricity market requires coordination between parties to synchronize the optimization on the production side (power station) and the transport side (transmission). Electricity supply chain presented in this article is designed to facilitate the coordination between the parties. Generally, the production side is optimized with price based dynamic economic dispatch (PBDED) model, while the transmission side is optimized with Multi-echelon distribution model. Both sides optimization are done separately. This article proposes a joint model of PBDED and multi-echelon distribution for the combined optimization of production and transmission. This combined optimization is important because changes in electricity demand on the customer side will cause changes to the production side that automatically also alter the transmission path. The transmission will cause two cost components. First, the cost of losses. Second, the cost of using the transmission network (wheeling transaction). Costs due to losses are calculated based on ohmic losses, while the cost of using transmission lines using the MW - mile method. As a result, this method is able to provide best allocation analysis for electrical transactions, as well as emission levels in power generation and cost analysis. As for the calculation of transmission costs, the Reverse MW-mile method produces a cheaper cost than the Absolute MW-mile method

Analysis of Food Safety and Security Challenges in Emerging African Food Producing Areas through a One Health Lens: The Dairy Chains in Mali.

PubMed

Cheng, Rachel; Mantovani, Alberto; Frazzoli, Chiara

2017-01-01

Challenges posed by changes in livestock production in emerging food producing areas and demographic development and climate change require new approaches and responsibilities in the management of food chains. The increasingly recognized role of primary food producers requires the support of the scientific community to instruct effective approaches based on scientific data, tools, and expertise. Mali is an emerging food producing area, and this review covers (i) the dairy farming scenario and its environment, (ii) the role of dairy production in food security, including the greatly different animal rearing systems in the Sahel and tropical regions, (iii) risk management pillars as modern infrastructures, effective farmer organizations, and institutional systems to guarantee animal health and safety of products, and (iv) feasible interventions based on good practices and risk assessment at the farm level (e.g., sustainable use of fertilizers, feeds, veterinary drugs, and pesticides) to protect consumers from food safety hazards. Social innovation based on the empowerment of the primary food producers emerges as crucial for sustainable and safe food production. Sustainable policies should be supported by the mobilization of stakeholders of One Health, which is a science-based approach to linking human health and nutrition with the health and management of food producing animals and environmental safety. In the context of the complex, multifaceted scenario of Mali dairy production, this article presents how a cost-effective animal health and food safety scheme could be established in the dairy production chain. Because milk is a major commodity in this country, benefits could be derived in food security, public health, the resilience of the farming system, animal husbandry, and international trade.

Machine learning-based coreference resolution of concepts in clinical documents

PubMed Central

Ware, Henry; Mullett, Charles J; El-Rawas, Oussama

2012-01-01

Objective Coreference resolution of concepts, although a very active area in the natural language processing community, has not yet been widely applied to clinical documents. Accordingly, the 2011 i2b2 competition focusing on this area is a timely and useful challenge. The objective of this research was to collate coreferent chains of concepts from a corpus of clinical documents. These concepts are in the categories of person, problems, treatments, and tests. Design A machine learning approach based on graphical models was employed to cluster coreferent concepts. Features selected were divided into domain independent and domain specific sets. Training was done with the i2b2 provided training set of 489 documents with 6949 chains. Testing was done on 322 documents. Results The learning engine, using the un-weighted average of three different measurement schemes, resulted in an F measure of 0.8423 where no domain specific features were included and 0.8483 where the feature set included both domain independent and domain specific features. Conclusion Our machine learning approach is a promising solution for recognizing coreferent concepts, which in turn is useful for practical applications such as the assembly of problem and medication lists from clinical documents. PMID:22582205

Elucidation of molecular kinetic schemes from macroscopic traces using system identification

PubMed Central

González-Maeso, Javier; Sealfon, Stuart C.; Galocha-Iragüen, Belén; Brezina, Vladimir

2017-01-01

Overall cellular responses to biologically-relevant stimuli are mediated by networks of simpler lower-level processes. Although information about some of these processes can now be obtained by visualizing and recording events at the molecular level, this is still possible only in especially favorable cases. Therefore the development of methods to extract the dynamics and relationships between the different lower-level (microscopic) processes from the overall (macroscopic) response remains a crucial challenge in the understanding of many aspects of physiology. Here we have devised a hybrid computational-analytical method to accomplish this task, the SYStems-based MOLecular kinetic scheme Extractor (SYSMOLE). SYSMOLE utilizes system-identification input-output analysis to obtain a transfer function between the stimulus and the overall cellular response in the Laplace-transformed domain. It then derives a Markov-chain state molecular kinetic scheme uniquely associated with the transfer function by means of a classification procedure and an analytical step that imposes general biological constraints. We first tested SYSMOLE with synthetic data and evaluated its performance in terms of its rate of convergence to the correct molecular kinetic scheme and its robustness to noise. We then examined its performance on real experimental traces by analyzing macroscopic calcium-current traces elicited by membrane depolarization. SYSMOLE derived the correct, previously known molecular kinetic scheme describing the activation and inactivation of the underlying calcium channels and correctly identified the accepted mechanism of action of nifedipine, a calcium-channel blocker clinically used in patients with cardiovascular disease. Finally, we applied SYSMOLE to study the pharmacology of a new class of glutamate antipsychotic drugs and their crosstalk mechanism through a heteromeric complex of G protein-coupled receptors. Our results indicate that our methodology can be successfully applied to accurately derive molecular kinetic schemes from experimental macroscopic traces, and we anticipate that it may be useful in the study of a wide variety of biological systems. PMID:28192423

ProCure21+ should speed scheme starts.

PubMed

Baillie, Jonathan

2010-11-01

This October saw the launch of the new ProCure21+ National Framework under which, the Department of Health (DH) team behind the new scheme claims, the NHS can potentially save a further pound 200 million of public money on top of the substantial sums saved under predecessor, ProCure21, via faster, more streamlined procurement, design, planning, and construction, of publicly-funded healthcare schemes. HEJ editor Jonathan Baillie discussed, with the DH's senior responsible officer (SRO) and P21+ team leader Peter Sellars, the background to the new Framework's introduction, the success of its forerunner, and the additional benefits that ProCure21 + (which is backed by organisations incuding HM Treasury, the National Audit Office, and the Office of Government Commerce) should bring to the entire healthcare building supply chain.

Two-Carbon Homologation of Ketones to 3-Methyl Unsaturated Aldehydes

USDA-ARS?s Scientific Manuscript database

The usual scheme of two-carbon homologation of ketones to 3-methyl unsaturated aldehydes by Horner-Wadsworth-Emmons condensations with phosphonate esters, such as triethyl-2-phosphonoacetate, involves three steps. The phosphonate condensation step results in extension of the carbon chain by two carb...

Linear and nonlinear dynamics of isospectral granular chains

NASA Astrophysics Data System (ADS)

Chaunsali, R.; Xu, H.; Yang, J.; Kevrekidis, P. G.

2017-04-01

We study the dynamics of isospectral granular chains that are highly tunable due to the nonlinear Hertz contact law interaction between the granular particles. The system dynamics can thus be tuned easily from being linear to strongly nonlinear by adjusting the initial compression applied to the chain. In particular, we introduce both discrete and continuous spectral transformation schemes to generate a family of granular chains that are isospectral in their linear limit. Inspired by the principle of supersymmetry in quantum systems, we also introduce a methodology to add or remove certain eigenfrequencies, and we demonstrate numerically that the corresponding physical system can be constructed in the setting of one-dimensional granular crystals. In the linear regime, we highlight the similarities in the elastic wave transmission characteristics of such isospectral systems, and emphasize that the presented mathematical framework allows one to suitably tailor the wave transmission through a general class of granular chains, both ordered and disordered. Moreover, we show how the dynamic response of these structures deviates from its linear limit as we introduce Hertzian nonlinearity in the chain and how nonlinearity breaks the notion of linear isospectrality.

Non-Hermitian engineering of single mode two dimensional laser arrays

PubMed Central

Teimourpour, Mohammad H.; Ge, Li; Christodoulides, Demetrios N.; El-Ganainy, Ramy

2016-01-01

A new scheme for building two dimensional laser arrays that operate in the single supermode regime is proposed. This is done by introducing an optical coupling between the laser array and lossy pseudo-isospectral chains of photonic resonators. The spectrum of this discrete reservoir is tailored to suppress all the supermodes of the main array except the fundamental one. This spectral engineering is facilitated by employing the Householder transformation in conjunction with discrete supersymmetry. The proposed scheme is general and can in principle be used in different platforms such as VCSEL arrays and photonic crystal laser arrays. PMID:27698355

Radical chemistry of artemisinin

NASA Astrophysics Data System (ADS)

Denisov, Evgenii T.; Solodova, S. L.; Denisova, Taisa G.

2010-12-01

The review summarizes physicochemical characteristics of the natural sesquiterpene peroxide artemisinin. The kinetic schemes of transformations of artemisinin radicals under anaerobic conditions are presented and analyzed. The sequence of radical reactions of artemisinin in the presence of oxygen is considered in detail. Special emphasis is given to the intramolecular chain oxidation resulting in the transformation of artemisinin into polyatomic hydroperoxide. The kinetic characteristics of elementary reaction steps involving alkyl, alkoxyl, and peroxyl radicals generated from artemisinin are discussed. The results of testing of artemisinin and its derivatives for the antimalarial activity and the scheme of the biochemical synthesis of artemisinin in nature are considered.

Cationic lipids: molecular structure/ transfection activity relationships and interactions with biomembranes.

PubMed

Koynova, Rumiana; Tenchov, Boris

2010-01-01

Abstract Synthetic cationic lipids, which form complexes (lipoplexes) with polyanionic DNA, are presently the most widely used constituents of nonviral gene carriers. A large number of cationic amphiphiles have been synthesized and tested in transfection studies. However, due to the complexity of the transfection pathway, no general schemes have emerged for correlating the cationic lipid chemistry with their transfection efficacy and the approaches for optimizing their molecular structures are still largely empirical. Here we summarize data on the relationships between transfection activity and cationic lipid molecular structure and demonstrate that the transfection activity depends in a systematic way on the lipid hydrocarbon chain structure. A number of examples, including a large series of cationic phosphatidylcholine derivatives, show that optimum transfection is displayed by lipids with chain length of approximately 14 carbon atoms and that the transfection efficiency strongly increases with increase of chain unsaturation, specifically upon replacement of saturated with monounsaturated chains.

Ancient numerical daemons of conceptual hydrological modeling: 2. Impact of time stepping schemes on model analysis and prediction

NASA Astrophysics Data System (ADS)

Kavetski, Dmitri; Clark, Martyn P.

2010-10-01

Despite the widespread use of conceptual hydrological models in environmental research and operations, they remain frequently implemented using numerically unreliable methods. This paper considers the impact of the time stepping scheme on model analysis (sensitivity analysis, parameter optimization, and Markov chain Monte Carlo-based uncertainty estimation) and prediction. It builds on the companion paper (Clark and Kavetski, 2010), which focused on numerical accuracy, fidelity, and computational efficiency. Empirical and theoretical analysis of eight distinct time stepping schemes for six different hydrological models in 13 diverse basins demonstrates several critical conclusions. (1) Unreliable time stepping schemes, in particular, fixed-step explicit methods, suffer from troublesome numerical artifacts that severely deform the objective function of the model. These deformations are not rare isolated instances but can arise in any model structure, in any catchment, and under common hydroclimatic conditions. (2) Sensitivity analysis can be severely contaminated by numerical errors, often to the extent that it becomes dominated by the sensitivity of truncation errors rather than the model equations. (3) Robust time stepping schemes generally produce "better behaved" objective functions, free of spurious local optima, and with sufficient numerical continuity to permit parameter optimization using efficient quasi Newton methods. When implemented within a multistart framework, modern Newton-type optimizers are robust even when started far from the optima and provide valuable diagnostic insights not directly available from evolutionary global optimizers. (4) Unreliable time stepping schemes lead to inconsistent and biased inferences of the model parameters and internal states. (5) Even when interactions between hydrological parameters and numerical errors provide "the right result for the wrong reason" and the calibrated model performance appears adequate, unreliable time stepping schemes make the model unnecessarily fragile in predictive mode, undermining validation assessments and operational use. Erroneous or misleading conclusions of model analysis and prediction arising from numerical artifacts in hydrological models are intolerable, especially given that robust numerics are accepted as mainstream in other areas of science and engineering. We hope that the vivid empirical findings will encourage the conceptual hydrological community to close its Pandora's box of numerical problems, paving the way for more meaningful model application and interpretation.

Analogue of cosmological particle creation in an ion trap.

PubMed

Schützhold, Ralf; Uhlmann, Michael; Petersen, Lutz; Schmitz, Hector; Friedenauer, Axel; Schätz, Tobias

2007-11-16

We study phonons in a dynamical chain of ions confined by a trap with a time-dependent (axial) potential strength and demonstrate that they behave in the same way as quantum fields in an expanding or contracting Universe. Based on this analogy, we present a scheme for the detection of the analogue of cosmological particle creation which should be feasible with present day technology. In order to test the quantum nature of the particle creation mechanism and to distinguish it from classical effects such as heating, we propose to measure the two-phonon amplitude via the 2nd red sideband transition and to compare it with the one-phonon amplitude (1st red sideband).

Stormwater quality modelling in combined sewers: calibration and uncertainty analysis.

PubMed

Kanso, A; Chebbo, G; Tassin, B

2005-01-01

Estimating the level of uncertainty in urban stormwater quality models is vital for their utilization. This paper presents the results of application of a Monte Carlo Markov Chain method based on the Bayesian theory for the calibration and uncertainty analysis of a storm water quality model commonly used in available software. The tested model uses a hydrologic/hydrodynamic scheme to estimate the accumulation, the erosion and the transport of pollutants on surfaces and in sewers. It was calibrated for four different initial conditions of in-sewer deposits. Calibration results showed large variability in the model's responses in function of the initial conditions. They demonstrated that the model's predictive capacity is very low.

8-O-Azeloyl-14-benzoylaconine: a new alkaloid from the roots of Aconitum karacolicum Rapcs and its antiproliferative activities.

PubMed

Chodoeva, Ainura; Bosc, Jean-Jacques; Guillon, Jean; Decendit, Alain; Petraud, Michel; Absalon, Christelle; Vitry, Christiane; Jarry, Christian; Robert, Jacques

2005-12-01

A new alkaloid of Aconitum karacolicum Rapcs, from the Ranunculaceae family, collected in Kirghizstan, was isolated from the roots of this plant, using a purification scheme based upon its in vitro antiproliferative properties against three human tumour cell lines in culture. Structural identification was performed using high resolution MS-MS mass spectrometry and (1)H, (13)C, 2D NOESY NMR spectroscopy analysis. This compound consists of a 14-benzoylaconine moiety substituted on C-8 by an azeloyl chain. It presents in vitro cytotoxicity with an IC(50) of about 10-20 microM, which warrants further investigation on its possible interest in cancer chemotherapy.

Grey Language Hesitant Fuzzy Group Decision Making Method Based on Kernel and Grey Scale

PubMed Central

Diao, Yuzhu; Hu, Aqin

2018-01-01

Based on grey language multi-attribute group decision making, a kernel and grey scale scoring function is put forward according to the definition of grey language and the meaning of the kernel and grey scale. The function introduces grey scale into the decision-making method to avoid information distortion. This method is applied to the grey language hesitant fuzzy group decision making, and the grey correlation degree is used to sort the schemes. The effectiveness and practicability of the decision-making method are further verified by the industry chain sustainable development ability evaluation example of a circular economy. Moreover, its simplicity and feasibility are verified by comparing it with the traditional grey language decision-making method and the grey language hesitant fuzzy weighted arithmetic averaging (GLHWAA) operator integration method after determining the index weight based on the grey correlation. PMID:29498699

Grey Language Hesitant Fuzzy Group Decision Making Method Based on Kernel and Grey Scale.

PubMed

Li, Qingsheng; Diao, Yuzhu; Gong, Zaiwu; Hu, Aqin

2018-03-02

Based on grey language multi-attribute group decision making, a kernel and grey scale scoring function is put forward according to the definition of grey language and the meaning of the kernel and grey scale. The function introduces grey scale into the decision-making method to avoid information distortion. This method is applied to the grey language hesitant fuzzy group decision making, and the grey correlation degree is used to sort the schemes. The effectiveness and practicability of the decision-making method are further verified by the industry chain sustainable development ability evaluation example of a circular economy. Moreover, its simplicity and feasibility are verified by comparing it with the traditional grey language decision-making method and the grey language hesitant fuzzy weighted arithmetic averaging (GLHWAA) operator integration method after determining the index weight based on the grey correlation.

Bidirectional chaos communication between two outer semiconductor lasers coupled mutually with a central semiconductor laser.

PubMed

Li, Ping; Wu, Jia-Gui; Wu, Zheng-Mao; Lin, Xiao-Dong; Deng, Dao; Liu, Yu-Ran; Xia, Guang-Qiong

2011-11-21

Based on a linear chain composed of a central semiconductor laser and two outer semiconductor lasers, chaos synchronization and bidirectional communication between two outer lasers have been investigated under the case that the central laser and the two outer lasers are coupled mutually, whereas there exists no coupling between the two outer lasers. The simulation results show that high-quality and stable isochronal synchronization between the two outer lasers can be achieved, while the cross-correlation coefficients between the two outer lasers and the central laser are very low under proper operation condition. Based on the high performance chaos synchronization between the two outer lasers, message bidirectional transmissions of bit rates up to 20 Gbit/s can be realized through adopting a novel decoding scheme which is different from that based on chaos pass filtering effect. Furthermore, the security of bidirectional communication is also analyzed. © 2011 Optical Society of America

Atmospheric parameterization schemes for satellite cloud property retrieval during FIRE IFO 2

NASA Technical Reports Server (NTRS)

Titlow, James; Baum, Bryan A.

1993-01-01

Satellite cloud retrieval algorithms generally require atmospheric temperature and humidity profiles to determine such cloud properties as pressure and height. For instance, the CO2 slicing technique called the ratio method requires the calculation of theoretical upwelling radiances both at the surface and a prescribed number (40) of atmospheric levels. This technique has been applied to data from, for example, the High Resolution Infrared Radiometer Sounder (HIRS/2, henceforth HIRS) flown aboard the NOAA series of polar orbiting satellites and the High Resolution Interferometer Sounder (HIS). In this particular study, four NOAA-11 HIRS channels in the 15-micron region are used. The ratio method may be applied to various channel combinations to estimate cloud top heights using channels in the 15-mu m region. Presently, the multispectral, multiresolution (MSMR) scheme uses 4 HIRS channel combination estimates for mid- to high-level cloud pressure retrieval and Advanced Very High Resolution Radiometer (AVHRR) data for low-level (is greater than 700 mb) cloud level retrieval. In order to determine theoretical upwelling radiances, atmospheric temperature and water vapor profiles must be provided as well as profiles of other radiatively important gas absorber constituents such as CO2, O3, and CH4. The assumed temperature and humidity profiles have a large effect on transmittance and radiance profiles, which in turn are used with HIRS data to calculate cloud pressure, and thus cloud height and temperature. For large spatial scale satellite data analysis, atmospheric parameterization schemes for cloud retrieval algorithms are usually based on a gridded product such as that provided by the European Center for Medium Range Weather Forecasting (ECMWF) or the National Meteorological Center (NMC). These global, gridded products prescribe temperature and humidity profiles for a limited number of pressure levels (up to 14) in a vertical atmospheric column. The FIRE IFO 2 experiment provides an opportunity to investigate current atmospheric profile parameterization schemes, compare satellite cloud height results using both gridded products (ECMWF) and high vertical resolution sonde data from the National Weather Service (NWS) and Cross Chain Loran Atmospheric Sounding System (CLASS), and suggest modifications in atmospheric parameterization schemes based on these results.

A scoring scheme for evaluating magnetofossil identifications

NASA Astrophysics Data System (ADS)

Kopp, R. E.; Kirschvink, J. L.

2007-12-01

In many Quaternary lacustrine and marine settings, fossil magnetotactic bacteria are a major contributor to sedimentary magnetization [1]. Magnetite particles produced by magnetotactic bacteria have traits, shaped by natural selection, that increase the efficiency with which the bacteria utilize iron and also facilitate the recognition of the particles' biological origin. In particular, magnetotactic bacteria generally produce particles with characteristic shapes and narrow size and shape distributions that lie within the single domain stability field. The particles have effective positive magnetic anisotropy, produced by alignment in chains and frequently by particle elongation. In addition, the crystals are often nearly stochiometric and have few crystallographic defects. Yet, despite these distinctive traits, there are few identified magnetofossils that predate the Quaternary, and many putative identifications are highly controversial. We propose a six-criteria scoring scheme for evaluating identifications based on the quality of the geological, magnetic, and electron microscopic evidence. Our criteria are: (1) whether the geological context is well-constrained stratigraphically, and whether paleomagnetic evidence suggests a primary magnetization; (2) whether magnetic or microscopic evidence support the presence of significant single-domain magnetite; (3) whether magnetic or ferromagnetic resonance evidence indicates narrow size and shape distributions, and whether microscopic evidence reveals single-domain particles with truncated edges, elongate single-domain particles, and/or narrow size and shape distributions; (4) whether ferromagnetic resonance, low-temperature magnetic, or electron microscopic evidence reveals the presence of chains; (5) whether low-temperature magnetometry, energy dispersive X-ray spectroscopy, or other techniques demonstrate the near-stochiometry of the particles; and (6) whether high-resolution TEM indicates the near- absence of crystallographic defects. We use criterion 1 to set the threshold for determining whether a magnetofossil identification is robust. Criteria 3 and 4 are assigned numerical scores that range from 0 to 4, while criteria 2, 5, and 6 are evaluated based on presence or absence. Based on this scheme, the oldest robust magnetofossils yet found come from the Cretaceous chalk beds of southern England [2], though Lower Cambrian limestones of the Pestrotsvet Formation, Siberia Platform, only marginally fail to meet our robust criteria [3]. Although magnetofossils have also been reported from Proterozoic, Archean, and Martian rocks, none of these identifications are robust. References: [1] R. E. Kopp and J. L. Kirschvink (2007). Earth Sci. Rev. doi:10.1016/j.earscirev.2007.08.001. [2] P. Montgomery et al. (1998). Earth Planet. Sci. Lett. 156: 209-224. [3] S. B. R. Chang et al. (1987). Phys. Earth Planet. Int. 46: 289-303.

The effect of atmospheric diabatic heating on low-frequency oscillations

NASA Astrophysics Data System (ADS)

Yen, Ming-Cheng

A diagnostic scheme is devised to illustrate a chain relationship between diabatic heating and planetary-scale divergent and rotational circulations. The scheme consists of the velocity-potential maintenance equation, which relates diabatic heating and velocity potential, and the streamfunction budget equation, which depicts the streamfunction tendency caused by the imbalance between streamfunction tendencies induced by vorticity advection and source. The proposed scheme is employed to examine the effect of tropical diabatic heating on the annual variation of subtropical jet streams. It was found that annual variations of both tropical diabatic heating and planetary-scale divergent circulation exhibit an annual in-phase seesaw oscillation between the winter and summer hemispheres. The annual variation of subtropical jet streams is caused by the adjustment of atmospheric rotational flow through planetary-scale divergent circulation in response to the annual cycle of tropical diabatic heating.

Adaptive Packet Combining Scheme in Three State Channel Model

NASA Astrophysics Data System (ADS)

Saring, Yang; Bulo, Yaka; Bhunia, Chandan Tilak

2018-01-01

The two popular techniques of packet combining based error correction schemes are: Packet Combining (PC) scheme and Aggressive Packet Combining (APC) scheme. PC scheme and APC scheme have their own merits and demerits; PC scheme has better throughput than APC scheme, but suffers from higher packet error rate than APC scheme. The wireless channel state changes all the time. Because of this random and time varying nature of wireless channel, individual application of SR ARQ scheme, PC scheme and APC scheme can't give desired levels of throughput. Better throughput can be achieved if appropriate transmission scheme is used based on the condition of channel. Based on this approach, adaptive packet combining scheme has been proposed to achieve better throughput. The proposed scheme adapts to the channel condition to carry out transmission using PC scheme, APC scheme and SR ARQ scheme to achieve better throughput. Experimentally, it was observed that the error correction capability and throughput of the proposed scheme was significantly better than that of SR ARQ scheme, PC scheme and APC scheme.

Control of parallel manipulators using force feedback

NASA Technical Reports Server (NTRS)

Nanua, Prabjot

1994-01-01

Two control schemes are compared for parallel robotic mechanisms actuated by hydraulic cylinders. One scheme, the 'rate based scheme', uses the position and rate information only for feedback. The second scheme, the 'force based scheme' feeds back the force information also. The force control scheme is shown to improve the response over the rate control one. It is a simple constant gain control scheme better suited to parallel mechanisms. The force control scheme can be easily modified for the dynamic forces on the end effector. This paper presents the results of a computer simulation of both the rate and force control schemes. The gains in the force based scheme can be individually adjusted in all three directions, whereas the adjustment in just one direction of the rate based scheme directly affects the other two directions.

Tracking Control of Mobile Robots Localized via Chained Fusion of Discrete and Continuous Epipolar Geometry, IMU and Odometry.

PubMed

Tick, David; Satici, Aykut C; Shen, Jinglin; Gans, Nicholas

2013-08-01

This paper presents a novel navigation and control system for autonomous mobile robots that includes path planning, localization, and control. A unique vision-based pose and velocity estimation scheme utilizing both the continuous and discrete forms of the Euclidean homography matrix is fused with inertial and optical encoder measurements to estimate the pose, orientation, and velocity of the robot and ensure accurate localization and control signals. A depth estimation system is integrated in order to overcome the loss of scale inherent in vision-based estimation. A path following control system is introduced that is capable of guiding the robot along a designated curve. Stability analysis is provided for the control system and experimental results are presented that prove the combined localization and control system performs with high accuracy.

Flexible polyelectrolyte chain in a strong electrolyte solution: Insight into equilibrium properties and force-extension behavior from mesoscale simulation

NASA Astrophysics Data System (ADS)

Malekzadeh Moghani, Mahdy; Khomami, Bamin

2016-01-01

Macromolecules with ionizable groups are ubiquitous in biological and synthetic systems. Due to the complex interaction between chain and electrostatic decorrelation lengths, both equilibrium properties and micro-mechanical response of dilute solutions of polyelectrolytes (PEs) are more complex than their neutral counterparts. In this work, the bead-rod micromechanical description of a chain is used to perform hi-fidelity Brownian dynamics simulation of dilute PE solutions to ascertain the self-similar equilibrium behavior of PE chains with various linear charge densities, scaling of the Kuhn step length (lE) with salt concentration cs and the force-extension behavior of the PE chain. In accord with earlier theoretical predictions, our results indicate that for a chain with n Kuhn segments, lE ˜ cs-0.5 as linear charge density approaches 1/n. Moreover, the constant force ensemble simulation results accurately predict the initial non-linear force-extension region of PE chain recently measured via single chain experiments. Finally, inspired by Cohen's extraction of Warner's force law from the inverse Langevin force law, a novel numerical scheme is developed to extract a new elastic force law for real chains from our discrete set of force-extension data similar to Padè expansion, which accurately depicts the initial non-linear region where the total Kuhn length is less than the thermal screening length.

Flexible polyelectrolyte chain in a strong electrolyte solution: Insight into equilibrium properties and force-extension behavior from mesoscale simulation.

PubMed

Malekzadeh Moghani, Mahdy; Khomami, Bamin

2016-01-14

Macromolecules with ionizable groups are ubiquitous in biological and synthetic systems. Due to the complex interaction between chain and electrostatic decorrelation lengths, both equilibrium properties and micro-mechanical response of dilute solutions of polyelectrolytes (PEs) are more complex than their neutral counterparts. In this work, the bead-rod micromechanical description of a chain is used to perform hi-fidelity Brownian dynamics simulation of dilute PE solutions to ascertain the self-similar equilibrium behavior of PE chains with various linear charge densities, scaling of the Kuhn step length (lE) with salt concentration cs and the force-extension behavior of the PE chain. In accord with earlier theoretical predictions, our results indicate that for a chain with n Kuhn segments, lE ∼ cs (-0.5) as linear charge density approaches 1/n. Moreover, the constant force ensemble simulation results accurately predict the initial non-linear force-extension region of PE chain recently measured via single chain experiments. Finally, inspired by Cohen's extraction of Warner's force law from the inverse Langevin force law, a novel numerical scheme is developed to extract a new elastic force law for real chains from our discrete set of force-extension data similar to Padè expansion, which accurately depicts the initial non-linear region where the total Kuhn length is less than the thermal screening length.

Combined Molecular Algorithms for the Generation, Equilibration and Topological Analysis of Entangled Polymers: Methodology and Performance

PubMed Central

Karayiannis, Nikos Ch.; Kröger, Martin

2009-01-01

We review the methodology, algorithmic implementation and performance characteristics of a hierarchical modeling scheme for the generation, equilibration and topological analysis of polymer systems at various levels of molecular description: from atomistic polyethylene samples to random packings of freely-jointed chains of tangent hard spheres of uniform size. Our analysis focuses on hitherto less discussed algorithmic details of the implementation of both, the Monte Carlo (MC) procedure for the system generation and equilibration, and a postprocessing step, where we identify the underlying topological structure of the simulated systems in the form of primitive paths. In order to demonstrate our arguments, we study how molecular length and packing density (volume fraction) affect the performance of the MC scheme built around chain-connectivity altering moves. In parallel, we quantify the effect of finite system size, of polydispersity, and of the definition of the number of entanglements (and related entanglement molecular weight) on the results about the primitive path network. Along these lines we approve main concepts which had been previously proposed in the literature. PMID:20087477

Processing uncertain RFID data in traceability supply chains.

PubMed

Xie, Dong; Xiao, Jie; Guo, Guangjun; Jiang, Tong

2014-01-01

Radio Frequency Identification (RFID) is widely used to track and trace objects in traceability supply chains. However, massive uncertain data produced by RFID readers are not effective and efficient to be used in RFID application systems. Following the analysis of key features of RFID objects, this paper proposes a new framework for effectively and efficiently processing uncertain RFID data, and supporting a variety of queries for tracking and tracing RFID objects. We adjust different smoothing windows according to different rates of uncertain data, employ different strategies to process uncertain readings, and distinguish ghost, missing, and incomplete data according to their apparent positions. We propose a comprehensive data model which is suitable for different application scenarios. In addition, a path coding scheme is proposed to significantly compress massive data by aggregating the path sequence, the position, and the time intervals. The scheme is suitable for cyclic or long paths. Moreover, we further propose a processing algorithm for group and independent objects. Experimental evaluations show that our approach is effective and efficient in terms of the compression and traceability queries.

Processing Uncertain RFID Data in Traceability Supply Chains

PubMed Central

Xie, Dong; Xiao, Jie

2014-01-01

Radio Frequency Identification (RFID) is widely used to track and trace objects in traceability supply chains. However, massive uncertain data produced by RFID readers are not effective and efficient to be used in RFID application systems. Following the analysis of key features of RFID objects, this paper proposes a new framework for effectively and efficiently processing uncertain RFID data, and supporting a variety of queries for tracking and tracing RFID objects. We adjust different smoothing windows according to different rates of uncertain data, employ different strategies to process uncertain readings, and distinguish ghost, missing, and incomplete data according to their apparent positions. We propose a comprehensive data model which is suitable for different application scenarios. In addition, a path coding scheme is proposed to significantly compress massive data by aggregating the path sequence, the position, and the time intervals. The scheme is suitable for cyclic or long paths. Moreover, we further propose a processing algorithm for group and independent objects. Experimental evaluations show that our approach is effective and efficient in terms of the compression and traceability queries. PMID:24737978

Design of a vehicle based system to prevent ozone loss

NASA Technical Reports Server (NTRS)

Lynn, Sean R.; Bunker, Deborah; Hesbach, Thomas D., Jr.; Howerton, Everett B.; Hreinsson, G.; Mistr, E. Kirk; Palmer, Matthew E.; Rogers, Claiborne; Tischler, Dayna S.; Wrona, Daniel J.

1993-01-01

Reduced quantities of ozone in the atmosphere allow greater levels of ultraviolet light (UV) radiation to reach the earth's surface. This is known to cause skin cancer and mutations. Chlorine liberated from Chlorofluorocarbons (CFC's) and natural sources initiate the destruction of stratospheric ozone through a free radical chain reaction. The project goals are to understand the processes which contribute to stratospheric ozone loss, examine ways to prevent ozone loss, and design a vehicle-based system to carry out the prevention scheme. The 1992/1993 design objectives were to accomplish the first two goals and define the requirements for an implementation vehicle to be designed in detail starting next year. Many different ozone intervention schemes have been proposed though few have been researched and none have been tested. A scheme proposed by R.J. Cicerone, Scott Elliot and R.P.Turco late in 1991 was selected because of its research support and economic feasibility. This scheme uses hydrocarbon injected into the Antarctic ozone hole to form stable compounds with free chlorine, thus reducing ozone depletion. Because most polar ozone depletion takes place during a 3-4 week period each year, the hydrocarbon must be injected during this time window. A study of the hydrocarbon injection requirements determined that 100 aircraft traveling Mach 2.4 at a maximum altitude of 66,000 ft. would provide the most economic approach to preventing ozone loss. Each aircraft would require an 8,000 nm. range and be able to carry 35,000 lbs. of propane. The propane would be stored in a three-tank high pressure system. Missions would be based from airport regions located in South America and Australia. To best provide the requirements of mission analysis, an aircraft with L/D(sub cruise) = 10.5, SFC = 0.65 (the faculty advisor suggested that this number is too low) and a 250,000 lb TOGW was selected as a baseline. Modularity and multi-role functionality were selected to be key design features. Modularity provides ease of turnaround for the down-time critical mission. Multi-role functionality allows the aircraft to be used beyond its design mission, perhaps as an High Speed Civil Transport (HSCT) or for high altitude research.

Grid-free density functional calculations on periodic systems.

PubMed

Varga, Stefan

2007-09-21

Density fitting scheme is applied to the exchange part of the Kohn-Sham potential matrix in a grid-free local density approximation for infinite systems with translational periodicity. It is shown that within this approach the computational demands for the exchange part scale in the same way as for the Coulomb part. The efficiency of the scheme is demonstrated on a model infinite polymer chain. For simplicity, the implementation with Dirac-Slater Xalpha exchange functional is presented only. Several choices of auxiliary basis set expansion coefficients were tested with both Coulomb and overlap metric. Their effectiveness is discussed also in terms of robustness and norm preservation.

Grid-free density functional calculations on periodic systems

NASA Astrophysics Data System (ADS)

Varga, Štefan

2007-09-01

Density fitting scheme is applied to the exchange part of the Kohn-Sham potential matrix in a grid-free local density approximation for infinite systems with translational periodicity. It is shown that within this approach the computational demands for the exchange part scale in the same way as for the Coulomb part. The efficiency of the scheme is demonstrated on a model infinite polymer chain. For simplicity, the implementation with Dirac-Slater Xα exchange functional is presented only. Several choices of auxiliary basis set expansion coefficients were tested with both Coulomb and overlap metric. Their effectiveness is discussed also in terms of robustness and norm preservation.

Numerical methods for multi-scale modeling of non-Newtonian flows

NASA Astrophysics Data System (ADS)

Symeonidis, Vasileios

This work presents numerical methods for the simulation of Non-Newtonian fluids in the continuum as well as the mesoscopic level. The former is achieved with Direct Numerical Simulation (DNS) spectral h/p methods, while the latter employs the Dissipative Particle Dynamics (DPD) technique. Physical results are also presented as a motivation for a clear understanding of the underlying numerical approaches. The macroscopic simulations employ two non-Newtonian models, namely the Reiner-Ravlin (RR) and the viscoelastic FENE-P model. (1) A spectral viscosity method defined by two parameters ε, M is used to stabilize the FENE-P conformation tensor c. Convergence studies are presented for different combinations of these parameters. Two boundary conditions for the tensor c are also investigated. (2) Agreement is achieved with other works for Stokes flow of a two-dimensional cylinder in a channel. Comparison of the axial normal stress and drag coefficient on the cylinder is presented. Further, similar results from unsteady two- and three-dimensional turbulent flows past a flat plate in a channel are shown. (3) The RR problem is formulated for nearly incompressible flows, with the introduction of a mathematically equivalent tensor formulation. A spectral viscosity method and polynomial over-integration are studied. Convergence studies, including a three-dimensional channel flow with a parallel slot, investigate numerical problems arising from elemental boundaries and sharp corners. (4) The round hole pressure problem is presented for Newtonian and RR fluids in geometries with different hole sizes. Comparison with experimental data is made for the Newtonian case. The flaw in the experimental assumptions of undisturbed pressure opposite the hole is revealed, while good agreement with the data is shown. The Higashitani-Pritchard kinematical theory for RR, fluids is recovered for round holes and an approximate formula for the RR Stokes hole pressure is presented. The mesoscopic simulations assume bead-spring representations of polymer chains and investigate different integrating schemes of the DPD equations and different intra-polymer force combinations. (1) A novel family of time-staggered integrators is presented, taking advantage of the time-scale disparity between polymer-solvent and solvent-solvent interactions. Convergence tests for relaxation parameters for the velocity-Verlet and Lowe's schemes are presented. (2) Wormlike chains simulating lambda- DNA molecules subject to constant shear are studied, and direct comparison with Brownian Dynamics and experimental results is made. The effect of the number of beads per chain is examined through the extension autocorrelation function. (3) The Schmidt number (Sc) for each numerical scheme is investigated and the dependence on the scheme's parameters is shown. Re-visiting the wormlike chain problem under shear, we recover a better agreement with the experimental data through proper adjustment of Sc.

An accurate density functional theory for the vapor-liquid interface of associating chain molecules based on the statistical associating fluid theory for potentials of variable range

NASA Astrophysics Data System (ADS)

Gloor, Guy J.; Jackson, George; Blas, Felipe J.; del Río, Elvira Martín; de Miguel, Enrique

2004-12-01

A Helmholtz free energy density functional is developed to describe the vapor-liquid interface of associating chain molecules. The functional is based on the statistical associating fluid theory with attractive potentials of variable range (SAFT-VR) for the homogenous fluid [A. Gil-Villegas, A. Galindo, P. J. Whitehead, S. J. Mills, G. Jackson, and A. N. Burgess, J. Chem. Phys. 106, 4168 (1997)]. A standard perturbative density functional theory (DFT) is constructed by partitioning the free energy density into a reference term (which incorporates all of the short-range interactions, and is treated locally) and an attractive perturbation (which incorporates the long-range dispersion interactions). In our previous work [F. J. Blas, E. Martín del Río, E. de Miguel, and G. Jackson, Mol. Phys. 99, 1851 (2001); G. J. Gloor, F. J. Blas, E. Martín del Río, E. de Miguel, and G. Jackson, Fluid Phase Equil. 194, 521 (2002)] we used a mean-field version of the theory (SAFT-HS) in which the pair correlations were neglected in the attractive term. This provides only a qualitative description of the vapor-liquid interface, due to the inadequate mean-field treatment of the vapor-liquid equilibria. Two different approaches are used to include the correlations in the attractive term: in the first, the free energy of the homogeneous fluid is partitioned such that the effect of correlations are incorporated in the local reference term; in the second, a density averaged correlation function is incorporated into the perturbative term in a similar way to that proposed by Toxvaerd [S. Toxvaerd, J. Chem. Phys. 64, 2863 (1976)]. The latter is found to provide the most accurate description of the vapor-liquid surface tension on comparison with new simulation data for a square-well fluid of variable range. The SAFT-VR DFT is used to examine the effect of molecular chain length and association on the surface tension. Different association schemes (dimerization, straight and branched chain formation, and network structures) are examined separately. The surface tension of the associating fluid is found to be bounded between the nonassociating and fully associated limits (both of which correspond to equivalent nonassociating systems). The temperature dependence of the surface tension is found to depend strongly on the balance between the strength and range of the association, and on the particular association scheme. In the case of a system with a strong but very localized association interaction, the surface tension exhibits the characteristic "s shaped" behavior with temperature observed in fluids such as water and alkanols. The various types of curves observed in real substances can be reproduced by the theory. It is very gratifying that a DFT based on SAFT-VR free energy can provide an accurate quantitative description of the surface tension of both the model and experimental systems.

Planetary Crater Detection and Registration Using Marked Point Processes, Multiple Birth and Death Algorithms, and Region-Based Analysis

NASA Technical Reports Server (NTRS)

Solarna, David; Moser, Gabriele; Le Moigne-Stewart, Jacqueline; Serpico, Sebastiano B.

2017-01-01

Because of the large variety of sensors and spacecraft collecting data, planetary science needs to integrate various multi-sensor and multi-temporal images. These multiple data represent a precious asset, as they allow the study of targets spectral responses and of changes in the surface structure; because of their variety, they also require accurate and robust registration. A new crater detection algorithm, used to extract features that will be integrated in an image registration framework, is presented. A marked point process-based method has been developed to model the spatial distribution of elliptical objects (i.e. the craters) and a birth-death Markov chain Monte Carlo method, coupled with a region-based scheme aiming at computational efficiency, is used to find the optimal configuration fitting the image. The extracted features are exploited, together with a newly defined fitness function based on a modified Hausdorff distance, by an image registration algorithm whose architecture has been designed to minimize the computational time.

Schemes for efficient transmission of encoded video streams on high-speed networks

NASA Astrophysics Data System (ADS)

Ramanathan, Srinivas; Vin, Harrick M.; Rangan, P. Venkat

1994-04-01

In this paper, we argue that significant performance benefits can accrue if integrated networks implement application-specific mechanisms that account for the diversities in media compression schemes. Towards this end, we propose a simple, yet effective, strategy called Frame Induced Packet Discarding (FIPD), in which, upon detection of loss of a threshold number (determined by an application's video encoding scheme) of packets belonging to a video frame, the network attempts to discard all the remaining packets of that frame. In order to analytically quantify the performance of FIPD so as to obtain fractional frame losses that can be guaranteed to video channels, we develop a finite state, discrete time markov chain model of the FIPD strategy. The fractional frame loss thus computed can serve as the criterion for admission control at the network. Performance evaluations demonstrate the utility of the FIPD strategy.

Instability dynamics and breather formation in a horizontally shaken pendulum chain.

PubMed

Xu, Y; Alexander, T J; Sidhu, H; Kevrekidis, P G

2014-10-01

Inspired by the experimental results of Cuevas et al. [Phys. Rev. Lett. 102, 224101 (2009)], we consider theoretically the behavior of a chain of planar rigid pendulums suspended in a uniform gravitational field and subjected to a horizontal periodic driving force applied to the pendulum pivots. We characterize the motion of a single pendulum, finding bistability near the fundamental resonance and near the period-3 subharmonic resonance. We examine the development of modulational instability in a driven pendulum chain and find both a critical chain length and a critical frequency for the appearance of the instability. We study the breather solutions and show their connection to the single-pendulum dynamics and extend our analysis to consider multifrequency breathers connected to the period-3 periodic solution, showing also the possibility of stability in these breather states. Finally we examine the problem of breather generation and demonstrate a robust scheme for generation of on-site and off-site breathers.

Free Energy Perturbation Hamiltonian Replica-Exchange Molecular Dynamics (FEP/H-REMD) for Absolute Ligand Binding Free Energy Calculations.

PubMed

Jiang, Wei; Roux, Benoît

2010-07-01

Free Energy Perturbation with Replica Exchange Molecular Dynamics (FEP/REMD) offers a powerful strategy to improve the convergence of free energy computations. In particular, it has been shown previously that a FEP/REMD scheme allowing random moves within an extended replica ensemble of thermodynamic coupling parameters "lambda" can improve the statistical convergence in calculations of absolute binding free energy of ligands to proteins [J. Chem. Theory Comput. 2009, 5, 2583]. In the present study, FEP/REMD is extended and combined with an accelerated MD simulations method based on Hamiltonian replica-exchange MD (H-REMD) to overcome the additional problems arising from the existence of kinetically trapped conformations within the protein receptor. In the combined strategy, each system with a given thermodynamic coupling factor lambda in the extended ensemble is further coupled with a set of replicas evolving on a biased energy surface with boosting potentials used to accelerate the inter-conversion among different rotameric states of the side chains in the neighborhood of the binding site. Exchanges are allowed to occur alternatively along the axes corresponding to the thermodynamic coupling parameter lambda and the boosting potential, in an extended dual array of coupled lambda- and H-REMD simulations. The method is implemented on the basis of new extensions to the REPDSTR module of the biomolecular simulation program CHARMM. As an illustrative example, the absolute binding free energy of p-xylene to the nonpolar cavity of the L99A mutant of T4 lysozyme was calculated. The tests demonstrate that the dual lambda-REMD and H-REMD simulation scheme greatly accelerates the configurational sampling of the rotameric states of the side chains around the binding pocket, thereby improving the convergence of the FEP computations.

Genetic algorithms with memory- and elitism-based immigrants in dynamic environments.

PubMed

Yang, Shengxiang

2008-01-01

In recent years the genetic algorithm community has shown a growing interest in studying dynamic optimization problems. Several approaches have been devised. The random immigrants and memory schemes are two major ones. The random immigrants scheme addresses dynamic environments by maintaining the population diversity while the memory scheme aims to adapt genetic algorithms quickly to new environments by reusing historical information. This paper investigates a hybrid memory and random immigrants scheme, called memory-based immigrants, and a hybrid elitism and random immigrants scheme, called elitism-based immigrants, for genetic algorithms in dynamic environments. In these schemes, the best individual from memory or the elite from the previous generation is retrieved as the base to create immigrants into the population by mutation. This way, not only can diversity be maintained but it is done more efficiently to adapt genetic algorithms to the current environment. Based on a series of systematically constructed dynamic problems, experiments are carried out to compare genetic algorithms with the memory-based and elitism-based immigrants schemes against genetic algorithms with traditional memory and random immigrants schemes and a hybrid memory and multi-population scheme. The sensitivity analysis regarding some key parameters is also carried out. Experimental results show that the memory-based and elitism-based immigrants schemes efficiently improve the performance of genetic algorithms in dynamic environments.

String order parameters for one-dimensional Floquet symmetry protected topological phases

NASA Astrophysics Data System (ADS)

Kumar, Ajesh; Dumitrescu, Philipp T.; Potter, Andrew C.

2018-06-01

Floquet symmetry protected topological (FSPT) phases are nonequilibrium topological phases enabled by time-periodic driving. FSPT phases of one-dimensional (1D) chains of bosons, spins, or qubits host dynamically protected edge states that can store quantum information without decoherence, making them promising for use as quantum memories. While FSPT order cannot be detected by any local measurement, here we construct nonlocal string order parameters that directly measure general 1D FSPT order. We propose a superconducting-qubit array based realization of the simplest Ising FSPT phase, which can be implemented with existing quantum computing hardware. We devise an interferometric scheme to directly measure the nonlocal string order using only simple one- and two-qubit operations and single-qubit measurements.

Predicting Flory-Huggins χ from Simulations

NASA Astrophysics Data System (ADS)

Zhang, Wenlin; Gomez, Enrique D.; Milner, Scott T.

2017-07-01

We introduce a method, based on a novel thermodynamic integration scheme, to extract the Flory-Huggins χ parameter as small as 10-3k T for polymer blends from molecular dynamics (MD) simulations. We obtain χ for the archetypical coarse-grained model of nonpolar polymer blends: flexible bead-spring chains with different Lennard-Jones interactions between A and B monomers. Using these χ values and a lattice version of self-consistent field theory (SCFT), we predict the shape of planar interfaces for phase-separated binary blends. Our SCFT results agree with MD simulations, validating both the predicted χ values and our thermodynamic integration method. Combined with atomistic simulations, our method can be applied to predict χ for new polymers from their chemical structures.

Bethe-Boltzmann hydrodynamics and spin transport in the XXZ chain

NASA Astrophysics Data System (ADS)

Bulchandani, Vir B.; Vasseur, Romain; Karrasch, Christoph; Moore, Joel E.

2018-01-01

Quantum integrable systems, such as the interacting Bose gas in one dimension and the XXZ quantum spin chain, have an extensive number of local conserved quantities that endow them with exotic thermalization and transport properties. We discuss recently introduced hydrodynamic approaches for such integrable systems from the viewpoint of kinetic theory and extend the previous works by proposing a numerical scheme to solve the hydrodynamic equations for finite times and arbitrary locally equilibrated initial conditions. We then discuss how such methods can be applied to describe nonequilibrium steady states involving ballistic heat and spin currents. In particular, we show that the spin Drude weight in the XXZ chain, previously accessible only by rigorous techniques of limited scope or controversial thermodynamic Bethe ansatz arguments, may be evaluated from hydrodynamics in very good agreement with density-matrix renormalization group calculations.

A study of topologies and protocols for fiber optic local area network

NASA Technical Reports Server (NTRS)

Yeh, C.; Gerla, M.; Rodrigues, P.

1985-01-01

The emergence of new applications requiring high data traffic necessitates the development of high speed local area networks. Optical fiber is selected as the transmission medium due to its inherent advantages over other possible media and the dual optical bus architecture is shown to be the most suitable topology. Asynchronous access protocols, including token, random, hybrid random/token, and virtual token schemes, are developed and analyzed. Exact expressions for insertion delay and utilization at light and heavy load are derived, and intermediate load behavior is investigated by simulation. A new tokenless adaptive scheme whose control depends only on the detection of activity on the channel is shown to outperform round-robin schemes under uneven loads and multipacket traffic and to perform optimally at light load. An approximate solution to the queueing delay for an oscillating polling scheme under chaining is obtained and results are compared with simulation. Solutions to the problem of building systems with a large number of stations are presented, including maximization of the number of optical couplers, and the use of passive star/bus topologies, bridges and gateways.

A new approach for embedding causal sets into Minkowski space

NASA Astrophysics Data System (ADS)

Liu, He; Reid, David D.

2018-06-01

This paper reports on recent work toward an approach for embedding causal sets into two-dimensional Minkowski space. The main new feature of the present scheme is its use of the spacelike distance measure to construct an ordering of causal set elements within anti-chains of a causal set as an aid to the embedding procedure.

Extended producer responsibility: The impact of organizational dimensions on WEEE collection from households.

PubMed

Corsini, Filippo; Rizzi, Francesco; Frey, Marco

2017-01-01

Extended Producer Responsibility (EPR) has been the backbone of product life cycle management in Europe since the 2000s. Unfortunately, EPR implementation has multiple impacts on the supply chain and, thus, its consequences are not always easily manageable. Although several studies have explored various examples within the EU, the determinants of the effectiveness of EPR management are still not fully understood. This research seeks to bridge this gap by making use of quantitative analyses to investigate how key issues related to: WEEE Directive transposition and organizational settings adopted by each Member State, influenced the results achieved in those Member States in terms of collection from households. In details, a latent class analysis (LCA) has been used to analyse different EPR management strategies based on the policy set, the supply chain structure, and the performance of the household collection of electronic waste. Results highlight the strong connection between allocation of responsibility and organizational model adopted in Member States and performance related to small households equipment's. Conclusions shows the need for stronger coordination of EPR and waste policies in order to achieve adequate levels of Waste Electrical and Electronic Equipment (WEEE) collection, the need of a clear delineation of the responsibilities of each subject of the supply chain and also the importance of "clearing houses" in moderating the impacts of short-sighted competition between collective schemes. Copyright © 2016 Elsevier Ltd. All rights reserved.

Economic order quantity (EOQ) by game theory approach in probabilistic supply chain system under service level constraint for items with imperfect quality

NASA Astrophysics Data System (ADS)

Setiawan, R.

2018-03-01

In this paper, Economic Order Quantity (EOQ) of probabilistic two-level supply – chain system for items with imperfect quality has been analyzed under service level constraint. A firm applies an active service level constraint to avoid unpredictable shortage terms in the objective function. Mathematical analysis of optimal result is delivered using two equilibrium scheme concept in game theory approach. Stackelberg’s equilibrium for cooperative strategy and Stackelberg’s Equilibrium for noncooperative strategy. This is a new approach to game theory result in inventory system whether service level constraint is applied by a firm in his moves.

Comparison of the co-gasification of sewage sludge and food wastes and cost-benefit analysis of gasification- and incineration-based waste treatment schemes.

PubMed

You, Siming; Wang, Wei; Dai, Yanjun; Tong, Yen Wah; Wang, Chi-Hwa

2016-10-01

The compositions of food wastes and their co-gasification producer gas were compared with the existing data of sewage sludge. Results showed that food wastes are more favorable than sewage sludge for co-gasification based on residue generation and energy output. Two decentralized gasification-based schemes were proposed to dispose of the sewage sludge and food wastes in Singapore. Monte Carlo simulation-based cost-benefit analysis was conducted to compare the proposed schemes with the existing incineration-based scheme. It was found that the gasification-based schemes are financially superior to the incineration-based scheme based on the data of net present value (NPV), benefit-cost ratio (BCR), and internal rate of return (IRR). Sensitivity analysis was conducted to suggest effective measures to improve the economics of the schemes. Copyright © 2016 Elsevier Ltd. All rights reserved.

The “Electrostatic-Switch” Mechanism: Monte Carlo Study of MARCKS-Membrane Interaction

PubMed Central

Tzlil, Shelly; Murray, Diana; Ben-Shaul, Avinoam

2008-01-01

The binding of the myristoylated alanine-rich C kinase substrate (MARCKS) to mixed, fluid, phospholipid membranes is modeled with a recently developed Monte Carlo simulation scheme. The central domain of MARCKS is both basic (ζ = +13) and hydrophobic (five Phe residues), and is flanked with two long chains, one ending with the myristoylated N-terminus. This natively unfolded protein is modeled as a flexible chain of “beads” representing the amino acid residues. The membranes contain neutral (ζ = 0), monovalent (ζ = −1), and tetravalent (ζ = −4) lipids, all of which are laterally mobile. MARCKS-membrane interaction is modeled by Debye-Hückel electrostatic potentials and semiempirical hydrophobic energies. In agreement with experiment, we find that membrane binding is mediated by electrostatic attraction of the basic domain to acidic lipids and membrane penetration of its hydrophobic moieties. The binding is opposed by configurational entropy losses and electrostatic membrane repulsion of the two long chains, and by lipid demixing upon adsorption. The simulations provide a physical model for how membrane-adsorbed MARCKS attracts several PIP2 lipids (ζ = −4) to its vicinity, and how phosphorylation of the central domain (ζ = +13 to ζ = +7) triggers an “electrostatic switch”, which weakens both the membrane interaction and PIP2 sequestration. This scheme captures the essence of “discreteness of charge” at membrane surfaces and can examine the formation of membrane-mediated multicomponent macromolecular complexes that function in many cellular processes. PMID:18502797

PMD compensation in multilevel coded-modulation schemes with coherent detection using BLAST algorithm and iterative polarization cancellation.

PubMed

Djordjevic, Ivan B; Xu, Lei; Wang, Ting

2008-09-15

We present two PMD compensation schemes suitable for use in multilevel (M>or=2) block-coded modulation schemes with coherent detection. The first scheme is based on a BLAST-type polarization-interference cancellation scheme, and the second scheme is based on iterative polarization cancellation. Both schemes use the LDPC codes as channel codes. The proposed PMD compensations schemes are evaluated by employing coded-OFDM and coherent detection. When used in combination with girth-10 LDPC codes those schemes outperform polarization-time coding based OFDM by 1 dB at BER of 10(-9), and provide two times higher spectral efficiency. The proposed schemes perform comparable and are able to compensate even 1200 ps of differential group delay with negligible penalty.

The Jarzynski identity derived from general Hamiltonian or non-Hamiltonian dynamics reproducing NVT or NPT ensembles

NASA Astrophysics Data System (ADS)

Cuendet, Michel A.

2006-10-01

The Jarzynski identity (JI) relates nonequilibrium work averages to thermodynamic free energy differences. It was shown in a recent contribution [M. A. Cuendet, Phys. Rev. Lett. 96, 120602 (2006)] that the JI can, in particular, be derived directly from the Nosé-Hoover thermostated dynamics. This statistical mechanical derivation is particularly relevant in the framework of molecular dynamics simulation, because it is based solely on the equations of motion considered and is free of any additional assumptions on system size or bath coupling. Here, this result is generalized to a variety of dynamics, along two directions. On the one hand, specific improved thermostating schemes used in practical applications are treated. These include Nosé-Hoover chains, higher moment thermostats, as well as an isothermal-isobaric scheme yielding the JI in the NPT ensemble. On the other hand, the theoretical generality of the new derivation is explored. Generic dynamics with arbitrary coupling terms and an arbitrary number of thermostating variables, both non-Hamiltonian and Hamiltonian, are shown to imply the JI. In particular, a nonautonomous formulation of the generalized Nosé-Poincaré thermostat is proposed. Finally, general conditions required for the JI derivation are briefly discussed.

Report on Pairing-based Cryptography.

PubMed

Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

2015-01-01

This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.

Report on Pairing-based Cryptography

PubMed Central

Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

2015-01-01

This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST’s position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed. PMID:26958435

Bayesian seismic tomography by parallel interacting Markov chains

NASA Astrophysics Data System (ADS)

Gesret, Alexandrine; Bottero, Alexis; Romary, Thomas; Noble, Mark; Desassis, Nicolas

2014-05-01

The velocity field estimated by first arrival traveltime tomography is commonly used as a starting point for further seismological, mineralogical, tectonic or similar analysis. In order to interpret quantitatively the results, the tomography uncertainty values as well as their spatial distribution are required. The estimated velocity model is obtained through inverse modeling by minimizing an objective function that compares observed and computed traveltimes. This step is often performed by gradient-based optimization algorithms. The major drawback of such local optimization schemes, beyond the possibility of being trapped in a local minimum, is that they do not account for the multiple possible solutions of the inverse problem. They are therefore unable to assess the uncertainties linked to the solution. Within a Bayesian (probabilistic) framework, solving the tomography inverse problem aims at estimating the posterior probability density function of velocity model using a global sampling algorithm. Markov chains Monte-Carlo (MCMC) methods are known to produce samples of virtually any distribution. In such a Bayesian inversion, the total number of simulations we can afford is highly related to the computational cost of the forward model. Although fast algorithms have been recently developed for computing first arrival traveltimes of seismic waves, the complete browsing of the posterior distribution of velocity model is hardly performed, especially when it is high dimensional and/or multimodal. In the latter case, the chain may even stay stuck in one of the modes. In order to improve the mixing properties of classical single MCMC, we propose to make interact several Markov chains at different temperatures. This method can make efficient use of large CPU clusters, without increasing the global computational cost with respect to classical MCMC and is therefore particularly suited for Bayesian inversion. The exchanges between the chains allow a precise sampling of the high probability zones of the model space while avoiding the chains to end stuck in a probability maximum. This approach supplies thus a robust way to analyze the tomography imaging uncertainties. The interacting MCMC approach is illustrated on two synthetic examples of tomography of calibration shots such as encountered in induced microseismic studies. On the second application, a wavelet based model parameterization is presented that allows to significantly reduce the dimension of the problem, making thus the algorithm efficient even for a complex velocity model.

Nonequilibrium generalised Langevin equation for the calculation of heat transport properties in model 1D atomic chains coupled to two 3D thermal baths.

PubMed

Ness, H; Stella, L; Lorenz, C D; Kantorovich, L

2017-04-28

We use a generalised Langevin equation scheme to study the thermal transport of low dimensional systems. In this approach, the central classical region is connected to two realistic thermal baths kept at two different temperatures [H. Ness et al., Phys. Rev. B 93, 174303 (2016)]. We consider model Al systems, i.e., one-dimensional atomic chains connected to three-dimensional baths. The thermal transport properties are studied as a function of the chain length N and the temperature difference ΔT between the baths. We calculate the transport properties both in the linear response regime and in the non-linear regime. Two different laws are obtained for the linear conductance versus the length of the chains. For large temperatures (T≳500 K) and temperature differences (ΔT≳500 K), the chains, with N>18 atoms, present a diffusive transport regime with the presence of a temperature gradient across the system. For lower temperatures (T≲500 K) and temperature differences (ΔT≲400 K), a regime similar to the ballistic regime is observed. Such a ballistic-like regime is also obtained for shorter chains (N≤15). Our detailed analysis suggests that the behaviour at higher temperatures and temperature differences is mainly due to anharmonic effects within the long chains.

Nuclear Data Sheets for A=159

DOE Office of Scientific and Technical Information (OSTI.GOV)

Reich C. W.; Reich,C.W.

2012-01-01

The experimental results from the various reaction and radioactive decay studies leading to nuclides in the A = 159 mass chain have been reviewed. Nuclides ranging from Pm (Z = 61) through Os (Z = 74) are included. These data are summarized and presented, together with adopted level schemes and properties. This work supersedes the previous evaluation of the data on these nuclides (2003He11).

Solving inverse problem for Markov chain model of customer lifetime value using flower pollination algorithm

NASA Astrophysics Data System (ADS)

Al-Ma'shumah, Fathimah; Permana, Dony; Sidarto, Kuntjoro Adji

2015-12-01

Customer Lifetime Value is an important and useful concept in marketing. One of its benefits is to help a company for budgeting marketing expenditure for customer acquisition and customer retention. Many mathematical models have been introduced to calculate CLV considering the customer retention/migration classification scheme. A fairly new class of these models which will be described in this paper uses Markov Chain Models (MCM). This class of models has the major advantage for its flexibility to be modified to several different cases/classification schemes. In this model, the probabilities of customer retention and acquisition play an important role. From Pfeifer and Carraway, 2000, the final formula of CLV obtained from MCM usually contains nonlinear form of the transition probability matrix. This nonlinearity makes the inverse problem of CLV difficult to solve. This paper aims to solve this inverse problem, yielding the approximate transition probabilities for the customers, by applying metaheuristic optimization algorithm developed by Yang, 2013, Flower Pollination Algorithm. The major interpretation of obtaining the transition probabilities are to set goals for marketing teams in keeping the relative frequencies of customer acquisition and customer retention.

A secure smart-card based authentication and key agreement scheme for telecare medicine information systems.

PubMed

Lee, Tian-Fu; Liu, Chuan-Ming

2013-06-01

A smart-card based authentication scheme for telecare medicine information systems enables patients, doctors, nurses, health visitors and the medicine information systems to establish a secure communication platform through public networks. Zhu recently presented an improved authentication scheme in order to solve the weakness of the authentication scheme of Wei et al., where the off-line password guessing attacks cannot be resisted. This investigation indicates that the improved scheme of Zhu has some faults such that the authentication scheme cannot execute correctly and is vulnerable to the attack of parallel sessions. Additionally, an enhanced authentication scheme based on the scheme of Zhu is proposed. The enhanced scheme not only avoids the weakness in the original scheme, but also provides users' anonymity and authenticated key agreements for secure data communications.

Cryptanalysis and Improvement of a Biometric-Based Multi-Server Authentication and Key Agreement Scheme.

PubMed

Wang, Chengqi; Zhang, Xiao; Zheng, Zhiming

2016-01-01

With the security requirements of networks, biometrics authenticated schemes which are applied in the multi-server environment come to be more crucial and widely deployed. In this paper, we propose a novel biometric-based multi-server authentication and key agreement scheme which is based on the cryptanalysis of Mishra et al.'s scheme. The informal and formal security analysis of our scheme are given, which demonstrate that our scheme satisfies the desirable security requirements. The presented scheme provides a variety of significant functionalities, in which some features are not considered in the most of existing authentication schemes, such as, user revocation or re-registration and biometric information protection. Compared with several related schemes, our scheme has more secure properties and lower computation cost. It is obviously more appropriate for practical applications in the remote distributed networks.

ID-based encryption scheme with revocation

NASA Astrophysics Data System (ADS)

Othman, Hafizul Azrie; Ismail, Eddie Shahril

2017-04-01

In 2015, Meshram proposed an efficient ID-based cryptographic encryption based on the difficulty of solving discrete logarithm and integer-factoring problems. The scheme was pairing free and claimed to be secure against adaptive chosen plaintext attacks (CPA). Later, Tan et al. proved that the scheme was insecure by presenting a method to recover the secret master key and to obtain prime factorization of modulo n. In this paper, we propose a new pairing-free ID-based encryption scheme with revocation based on Meshram's ID-based encryption scheme, which is also secure against Tan et al.'s attacks.

A secure biometrics-based authentication scheme for telecare medicine information systems.

PubMed

Yan, Xiaopeng; Li, Weiheng; Li, Ping; Wang, Jiantao; Hao, Xinhong; Gong, Peng

2013-10-01

The telecare medicine information system (TMIS) allows patients and doctors to access medical services or medical information at remote sites. Therefore, it could bring us very big convenient. To safeguard patients' privacy, authentication schemes for the TMIS attracted wide attention. Recently, Tan proposed an efficient biometrics-based authentication scheme for the TMIS and claimed their scheme could withstand various attacks. However, in this paper, we point out that Tan's scheme is vulnerable to the Denial-of-Service attack. To enhance security, we also propose an improved scheme based on Tan's work. Security and performance analysis shows our scheme not only could overcome weakness in Tan's scheme but also has better performance.

Connection adaption for control of networked mobile chaotic agents.

PubMed

Zhou, Jie; Zou, Yong; Guan, Shuguang; Liu, Zonghua; Xiao, Gaoxi; Boccaletti, S

2017-11-22

In this paper, we propose a strategy for the control of mobile chaotic oscillators by adaptively rewiring connections between nearby agents with local information. In contrast to the dominant adaptive control schemes where coupling strength is adjusted continuously according to the states of the oscillators, our method does not request adaption of coupling strength. As the resulting interaction structure generated by this proposed strategy is strongly related to unidirectional chains, by investigating synchronization property of unidirectional chains, we reveal that there exists a certain coupling range in which the agents could be controlled regardless of the length of the chain. This feature enables the adaptive strategy to control the mobile oscillators regardless of their moving speed. Compared with existing adaptive control strategies for networked mobile agents, our proposed strategy is simpler for implementation where the resulting interaction networks are kept unweighted at all time.

Linking payment to health outcomes: a taxonomy and examination of performance-based reimbursement schemes between healthcare payers and manufacturers.

PubMed

Carlson, Josh J; Sullivan, Sean D; Garrison, Louis P; Neumann, Peter J; Veenstra, David L

2010-08-01

To identify, categorize and examine performance-based health outcomes reimbursement schemes for medical technology. We performed a review of performance-based health outcomes reimbursement schemes over the past 10 years (7/98-010/09) using publicly available databases, web and grey literature searches, and input from healthcare reimbursement experts. We developed a taxonomy of scheme types by inductively organizing the schemes identified according to the timing, execution, and health outcomes measured in the schemes. Our search yielded 34 coverage with evidence development schemes, 10 conditional treatment continuation schemes, and 14 performance-linked reimbursement schemes. The majority of schemes are in Europe and Australia, with an increasing number in Canada and the U.S. These schemes have the potential to alter the reimbursement and pricing landscape for medical technology, but significant challenges, including high transaction costs and insufficient information systems, may limit their long-term impact. Future studies regarding experiences and outcomes of implemented schemes are necessary. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

An alternative view of protein fold space.

PubMed

Shindyalov, I N; Bourne, P E

2000-02-15

Comparing and subsequently classifying protein structures information has received significant attention concurrent with the increase in the number of experimentally derived 3-dimensional structures. Classification schemes have focused on biological function found within protein domains and on structure classification based on topology. Here an alternative view is presented that groups substructures. Substructures are long (50-150 residue) highly repetitive near-contiguous pieces of polypeptide chain that occur frequently in a set of proteins from the PDB defined as structurally non-redundant over the complete polypeptide chain. The substructure classification is based on a previously reported Combinatorial Extension (CE) algorithm that provides a significantly different set of structure alignments than those previously described, having, for example, only a 40% overlap with FSSP. Qualitatively the algorithm provides longer contiguous aligned segments at the price of a slightly higher root-mean-square deviation (rmsd). Clustering these alignments gives a discreet and highly repetitive set of substructures not detectable by sequence similarity alone. In some cases different substructures represent all or different parts of well known folds indicative of the Russian doll effect--the continuity of protein fold space. In other cases they fall into different structure and functional classifications. It is too early to determine whether these newly classified substructures represent new insights into the evolution of a structural framework important to many proteins. What is apparent from on-going work is that these substructures have the potential to be useful probes in finding remote sequence homology and in structure prediction studies. The characteristics of the complete all-by-all comparison of the polypeptide chains present in the PDB and details of the filtering procedure by pair-wise structure alignment that led to the emergent substructure gallery are discussed. Substructure classification, alignments, and tools to analyze them are available at http://cl.sdsc.edu/ce.html.

Active learning of constitutive relation from mesoscopic dynamics for macroscopic modeling of non-Newtonian flows

NASA Astrophysics Data System (ADS)

Zhao, Lifei; Li, Zhen; Caswell, Bruce; Ouyang, Jie; Karniadakis, George Em

2018-06-01

We simulate complex fluids by means of an on-the-fly coupling of the bulk rheology to the underlying microstructure dynamics. In particular, a continuum model of polymeric fluids is constructed without a pre-specified constitutive relation, but instead it is actively learned from mesoscopic simulations where the dynamics of polymer chains is explicitly computed. To couple the bulk rheology of polymeric fluids and the microscale dynamics of polymer chains, the continuum approach (based on the finite volume method) provides the transient flow field as inputs for the (mesoscopic) dissipative particle dynamics (DPD), and in turn DPD returns an effective constitutive relation to close the continuum equations. In this multiscale modeling procedure, we employ an active learning strategy based on Gaussian process regression (GPR) to minimize the number of expensive DPD simulations, where adaptively selected DPD simulations are performed only as necessary. Numerical experiments are carried out for flow past a circular cylinder of a non-Newtonian fluid, modeled at the mesoscopic level by bead-spring chains. The results show that only five DPD simulations are required to achieve an effective closure of the continuum equations at Reynolds number Re = 10. Furthermore, when Re is increased to 100, only one additional DPD simulation is required for constructing an extended GPR-informed model closure. Compared to traditional message-passing multiscale approaches, applying an active learning scheme to multiscale modeling of non-Newtonian fluids can significantly increase the computational efficiency. Although the method demonstrated here obtains only a local viscosity from the polymer dynamics, it can be extended to other multiscale models of complex fluids whose macro-rheology is unknown.

Understanding security failures of two authentication and key agreement schemes for telecare medicine information systems.

PubMed

Mishra, Dheerendra

2015-03-01

Smart card based authentication and key agreement schemes for telecare medicine information systems (TMIS) enable doctors, nurses, patients and health visitors to use smart cards for secure login to medical information systems. In recent years, several authentication and key agreement schemes have been proposed to present secure and efficient solution for TMIS. Most of the existing authentication schemes for TMIS have either higher computation overhead or are vulnerable to attacks. To reduce the computational overhead and enhance the security, Lee recently proposed an authentication and key agreement scheme using chaotic maps for TMIS. Xu et al. also proposed a password based authentication and key agreement scheme for TMIS using elliptic curve cryptography. Both the schemes provide better efficiency from the conventional public key cryptography based schemes. These schemes are important as they present an efficient solution for TMIS. We analyze the security of both Lee's scheme and Xu et al.'s schemes. Unfortunately, we identify that both the schemes are vulnerable to denial of service attack. To understand the security failures of these cryptographic schemes which are the key of patching existing schemes and designing future schemes, we demonstrate the security loopholes of Lee's scheme and Xu et al.'s scheme in this paper.

Robust and efficient biometrics based password authentication scheme for telecare medicine information systems using extended chaotic maps.

PubMed

Lu, Yanrong; Li, Lixiang; Peng, Haipeng; Xie, Dong; Yang, Yixian

2015-06-01

The Telecare Medicine Information Systems (TMISs) provide an efficient communicating platform supporting the patients access health-care delivery services via internet or mobile networks. Authentication becomes an essential need when a remote patient logins into the telecare server. Recently, many extended chaotic maps based authentication schemes using smart cards for TMISs have been proposed. Li et al. proposed a secure smart cards based authentication scheme for TMISs using extended chaotic maps based on Lee's and Jiang et al.'s scheme. In this study, we show that Li et al.'s scheme has still some weaknesses such as violation the session key security, vulnerability to user impersonation attack and lack of local verification. To conquer these flaws, we propose a chaotic maps and smart cards based password authentication scheme by applying biometrics technique and hash function operations. Through the informal and formal security analyses, we demonstrate that our scheme is resilient possible known attacks including the attacks found in Li et al.'s scheme. As compared with the previous authentication schemes, the proposed scheme is more secure and efficient and hence more practical for telemedical environments.

Bubble-free on-chip continuous-flow polymerase chain reaction: concept and application.

PubMed

Wu, Wenming; Kang, Kyung-Tae; Lee, Nae Yoon

2011-06-07

Bubble formation inside a microscale channel is a significant problem in general microfluidic experiments. The problem becomes especially crucial when performing a polymerase chain reaction (PCR) on a chip which is subject to repetitive temperature changes. In this paper, we propose a bubble-free sample injection scheme applicable for continuous-flow PCR inside a glass/PDMS hybrid microfluidic chip, and attempt to provide a theoretical basis concerning bubble formation and elimination. Highly viscous paraffin oil plugs are employed in both the anterior and posterior ends of a sample plug, completely encapsulating the sample and eliminating possible nucleation sites for bubbles. In this way, internal channel pressure is increased, and vaporization of the sample is prevented, suppressing bubble formation. Use of an oil plug in the posterior end of the sample plug aids in maintaining a stable flow of a sample at a constant rate inside a heated microchannel throughout the entire reaction, as compared to using an air plug. By adopting the proposed sample injection scheme, we demonstrate various practical applications. On-chip continuous-flow PCR is performed employing genomic DNA extracted from a clinical single hair root sample, and its D1S80 locus is successfully amplified. Also, chip reusability is assessed using a plasmid vector. A single chip is used up to 10 times repeatedly without being destroyed, maintaining almost equal intensities of the resulting amplicons after each run, ensuring the reliability and reproducibility of the proposed sample injection scheme. In addition, the use of a commercially-available and highly cost-effective hot plate as a potential candidate for the heating source is investigated.

Enhanced smartcard-based password-authenticated key agreement using extended chaotic maps.

PubMed

Lee, Tian-Fu; Hsiao, Chia-Hung; Hwang, Shi-Han; Lin, Tsung-Hung

2017-01-01

A smartcard based password-authenticated key agreement scheme enables a legal user to log in to a remote authentication server and access remote services through public networks using a weak password and a smart card. Lin recently presented an improved chaotic maps-based password-authenticated key agreement scheme that used smartcards to eliminate the weaknesses of the scheme of Guo and Chang, which does not provide strong user anonymity and violates session key security. However, the improved scheme of Lin does not exhibit the freshness property and the validity of messages so it still fails to withstand denial-of-service and privileged-insider attacks. Additionally, a single malicious participant can predetermine the session key such that the improved scheme does not exhibit the contributory property of key agreements. This investigation discusses these weaknesses and proposes an enhanced smartcard-based password-authenticated key agreement scheme that utilizes extended chaotic maps. The session security of this enhanced scheme is based on the extended chaotic map-based Diffie-Hellman problem, and is proven in the real-or-random and the sequence of games models. Moreover, the enhanced scheme ensures the freshness of communicating messages by appending timestamps, and thereby avoids the weaknesses in previous schemes.

Enhanced smartcard-based password-authenticated key agreement using extended chaotic maps

PubMed Central

Lee, Tian-Fu; Hsiao, Chia-Hung; Hwang, Shi-Han

2017-01-01

A smartcard based password-authenticated key agreement scheme enables a legal user to log in to a remote authentication server and access remote services through public networks using a weak password and a smart card. Lin recently presented an improved chaotic maps-based password-authenticated key agreement scheme that used smartcards to eliminate the weaknesses of the scheme of Guo and Chang, which does not provide strong user anonymity and violates session key security. However, the improved scheme of Lin does not exhibit the freshness property and the validity of messages so it still fails to withstand denial-of-service and privileged-insider attacks. Additionally, a single malicious participant can predetermine the session key such that the improved scheme does not exhibit the contributory property of key agreements. This investigation discusses these weaknesses and proposes an enhanced smartcard-based password-authenticated key agreement scheme that utilizes extended chaotic maps. The session security of this enhanced scheme is based on the extended chaotic map-based Diffie-Hellman problem, and is proven in the real-or-random and the sequence of games models. Moreover, the enhanced scheme ensures the freshness of communicating messages by appending timestamps, and thereby avoids the weaknesses in previous schemes. PMID:28759615

Cryptanalysis and Improvement of a Biometric-Based Multi-Server Authentication and Key Agreement Scheme

PubMed Central

Wang, Chengqi; Zhang, Xiao; Zheng, Zhiming

2016-01-01

With the security requirements of networks, biometrics authenticated schemes which are applied in the multi-server environment come to be more crucial and widely deployed. In this paper, we propose a novel biometric-based multi-server authentication and key agreement scheme which is based on the cryptanalysis of Mishra et al.’s scheme. The informal and formal security analysis of our scheme are given, which demonstrate that our scheme satisfies the desirable security requirements. The presented scheme provides a variety of significant functionalities, in which some features are not considered in the most of existing authentication schemes, such as, user revocation or re-registration and biometric information protection. Compared with several related schemes, our scheme has more secure properties and lower computation cost. It is obviously more appropriate for practical applications in the remote distributed networks. PMID:26866606

Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting

USGS Publications Warehouse

Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.

2011-01-01

Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

Single amino acid mutation in alpha-helical peptide affect second harmonic generation hyperpolarizability

NASA Astrophysics Data System (ADS)

Wei, Jing; Wang, Jin-Yun; Zhang, Min-Yi; Chai, Guo-Liang; Lin, Chen-Sheng; Cheng, Wen-Dan

2013-01-01

We investigate the effect of side chain on the first-order hyperpolarizability in α-helical polyalanine peptide with the 10th alanine mutation (Acetyl(ala)9X(ala)7NH2). Structures of various substituted peptides are optimized by ONIOM (DFT: AM1) scheme, and then linear and nonlinear optical properties are calculated by SOS//CIS/6-31G∗ method. The polarizability and first-order hyperpolarizability increase obviously only when 'X' represents phenylalanine, tyrosine and tryptophan. We also discuss the origin of nonlinear optical response and determine what caused the increase of first-order hyperpolarizability. Our results strongly suggest that side chains containing benzene, phenol and indole have important contributions to first-order hyperpolarizability.

Multiple mobility edges in a 1D Aubry chain with Hubbard interaction in presence of electric field: Controlled electron transport

NASA Astrophysics Data System (ADS)

Saha, Srilekha; Maiti, Santanu K.; Karmakar, S. N.

2016-09-01

Electronic behavior of a 1D Aubry chain with Hubbard interaction is critically analyzed in presence of electric field. Multiple energy bands are generated as a result of Hubbard correlation and Aubry potential, and, within these bands localized states are developed under the application of electric field. Within a tight-binding framework we compute electronic transmission probability and average density of states using Green's function approach where the interaction parameter is treated under Hartree-Fock mean field scheme. From our analysis we find that selective transmission can be obtained by tuning injecting electron energy, and thus, the present model can be utilized as a controlled switching device.

High-efficiency interaction-free measurement with an unbalanced Mach–Zehnder interferometer

NASA Astrophysics Data System (ADS)

Chao, Liu; Jinhong, Liu; Junxiang, Zhang; Shiyao, Zhu

2018-06-01

The presence of an object can be detected without the absorption of photons in an interaction-free measurement (IFM) system based on the Zeno effect in chained Mach–Zehnder interferometers (MZIs). In this paper, we propose a scheme with an unbalanced MZI to perform the transmission of two frequency components of input light simultaneously. The two components are separated at two output ports of the MZI, achieving a high probability of asserting the absence of the object. The two final outputs of the MZI can also be extended to perform special information processing via IFM. As a result, this proposal contributes to the improvement of efficiency in interaction-free measurements with a very small number of interferometers for potential practical implementations of quantum information technology.

The dangerous new synthetic drug α-PVP as the hydrated chloride salt α-pyrrolidinopentiophenone hydrochloride 0.786-hydrate.

PubMed

Wood, Matthew R; Bernal, Ivan; Lalancette, Roger A

2016-01-01

α-Pyrrolidinovalerophenone (α-PVP), a dangerous designer drug, is now being marketed around the world as a harmless `bath salt', when in reality it is a powerful β-ketone phenethylamine stimulant. A sample of the free base from a recent law-enforcement seizure was crystallized as the HCl salt [systematic name: 1-(1-oxo-1-phenylpentan-2-yl)pyrrolidin-1-ium chloride 0.786-hydrate], C15H22NO(+)·Cl(-)·0.786H2O. In the crystal structure, the propyl chain is nearly perpendicular to both the phenyl ring and the carbonyl group. The hydrogen-bonding scheme involves the quaternary N atom, the Cl(-) anion and the partially occupied (0.786) water molecule, forming centrosymmetric dimers.

Bayesian reconstruction of projection reconstruction NMR (PR-NMR).

PubMed

Yoon, Ji Won

2014-11-01

Projection reconstruction nuclear magnetic resonance (PR-NMR) is a technique for generating multidimensional NMR spectra. A small number of projections from lower-dimensional NMR spectra are used to reconstruct the multidimensional NMR spectra. In our previous work, it was shown that multidimensional NMR spectra are efficiently reconstructed using peak-by-peak based reversible jump Markov chain Monte Carlo (RJMCMC) algorithm. We propose an extended and generalized RJMCMC algorithm replacing a simple linear model with a linear mixed model to reconstruct close NMR spectra into true spectra. This statistical method generates samples in a Bayesian scheme. Our proposed algorithm is tested on a set of six projections derived from the three-dimensional 700 MHz HNCO spectrum of a protein HasA. Copyright © 2014 Elsevier Ltd. All rights reserved.

An efficient and provable secure revocable identity-based encryption scheme.

PubMed

Wang, Changji; Li, Yuan; Xia, Xiaonan; Zheng, Kangjia

2014-01-01

Revocation functionality is necessary and crucial to identity-based cryptosystems. Revocable identity-based encryption (RIBE) has attracted a lot of attention in recent years, many RIBE schemes have been proposed in the literature but shown to be either insecure or inefficient. In this paper, we propose a new scalable RIBE scheme with decryption key exposure resilience by combining Lewko and Waters' identity-based encryption scheme and complete subtree method, and prove our RIBE scheme to be semantically secure using dual system encryption methodology. Compared to existing scalable and semantically secure RIBE schemes, our proposed RIBE scheme is more efficient in term of ciphertext size, public parameters size and decryption cost at price of a little looser security reduction. To the best of our knowledge, this is the first construction of scalable and semantically secure RIBE scheme with constant size public system parameters.

Efficiently Multi-User Searchable Encryption Scheme with Attribute Revocation and Grant for Cloud Storage

PubMed Central

Wang, Shangping; Zhang, Xiaoxue; Zhang, Yaling

2016-01-01

Cipher-policy attribute-based encryption (CP-ABE) focus on the problem of access control, and keyword-based searchable encryption scheme focus on the problem of finding the files that the user interested in the cloud storage quickly. To design a searchable and attribute-based encryption scheme is a new challenge. In this paper, we propose an efficiently multi-user searchable attribute-based encryption scheme with attribute revocation and grant for cloud storage. In the new scheme the attribute revocation and grant processes of users are delegated to proxy server. Our scheme supports multi attribute are revoked and granted simultaneously. Moreover, the keyword searchable function is achieved in our proposed scheme. The security of our proposed scheme is reduced to the bilinear Diffie-Hellman (BDH) assumption. Furthermore, the scheme is proven to be secure under the security model of indistinguishability against selective ciphertext-policy and chosen plaintext attack (IND-sCP-CPA). And our scheme is also of semantic security under indistinguishability against chosen keyword attack (IND-CKA) in the random oracle model. PMID:27898703

Efficiently Multi-User Searchable Encryption Scheme with Attribute Revocation and Grant for Cloud Storage.

PubMed

Wang, Shangping; Zhang, Xiaoxue; Zhang, Yaling

2016-01-01

Cipher-policy attribute-based encryption (CP-ABE) focus on the problem of access control, and keyword-based searchable encryption scheme focus on the problem of finding the files that the user interested in the cloud storage quickly. To design a searchable and attribute-based encryption scheme is a new challenge. In this paper, we propose an efficiently multi-user searchable attribute-based encryption scheme with attribute revocation and grant for cloud storage. In the new scheme the attribute revocation and grant processes of users are delegated to proxy server. Our scheme supports multi attribute are revoked and granted simultaneously. Moreover, the keyword searchable function is achieved in our proposed scheme. The security of our proposed scheme is reduced to the bilinear Diffie-Hellman (BDH) assumption. Furthermore, the scheme is proven to be secure under the security model of indistinguishability against selective ciphertext-policy and chosen plaintext attack (IND-sCP-CPA). And our scheme is also of semantic security under indistinguishability against chosen keyword attack (IND-CKA) in the random oracle model.

Uncertainty based modeling of rainfall-runoff: Combined differential evolution adaptive Metropolis (DREAM) and K-means clustering

NASA Astrophysics Data System (ADS)

Zahmatkesh, Zahra; Karamouz, Mohammad; Nazif, Sara

2015-09-01

Simulation of rainfall-runoff process in urban areas is of great importance considering the consequences and damages of extreme runoff events and floods. The first issue in flood hazard analysis is rainfall simulation. Large scale climate signals have been proved to be effective in rainfall simulation and prediction. In this study, an integrated scheme is developed for rainfall-runoff modeling considering different sources of uncertainty. This scheme includes three main steps of rainfall forecasting, rainfall-runoff simulation and future runoff prediction. In the first step, data driven models are developed and used to forecast rainfall using large scale climate signals as rainfall predictors. Due to high effect of different sources of uncertainty on the output of hydrologic models, in the second step uncertainty associated with input data, model parameters and model structure is incorporated in rainfall-runoff modeling and simulation. Three rainfall-runoff simulation models are developed for consideration of model conceptual (structural) uncertainty in real time runoff forecasting. To analyze the uncertainty of the model structure, streamflows generated by alternative rainfall-runoff models are combined, through developing a weighting method based on K-means clustering. Model parameters and input uncertainty are investigated using an adaptive Markov Chain Monte Carlo method. Finally, calibrated rainfall-runoff models are driven using the forecasted rainfall to predict future runoff for the watershed. The proposed scheme is employed in the case study of the Bronx River watershed, New York City. Results of uncertainty analysis of rainfall-runoff modeling reveal that simultaneous estimation of model parameters and input uncertainty significantly changes the probability distribution of the model parameters. It is also observed that by combining the outputs of the hydrological models using the proposed clustering scheme, the accuracy of runoff simulation in the watershed is remarkably improved up to 50% in comparison to the simulations by the individual models. Results indicate that the developed methodology not only provides reliable tools for rainfall and runoff modeling, but also adequate time for incorporating required mitigation measures in dealing with potentially extreme runoff events and flood hazard. Results of this study can be used in identification of the main factors affecting flood hazard analysis.

N -term pairwise-correlation inequalities, steering, and joint measurability

NASA Astrophysics Data System (ADS)

Karthik, H. S.; Devi, A. R. Usha; Tej, J. Prabhu; Rajagopal, A. K.; Sudha, Narayanan, A.

2017-05-01

Chained inequalities involving pairwise correlations of qubit observables in the equatorial plane are constructed based on the positivity of a sequence of moment matrices. When a jointly measurable set of positive-operator-valued measures (POVMs) is employed in the first measurement of every pair of sequential measurements, the chained pairwise correlations do not violate the classical bound imposed by the moment matrix positivity. We find that incompatibility of the set of POVMs employed in first measurements is only necessary, but not sufficient, in general, for the violation of the inequality. On the other hand, there exists a one-to-one equivalence between the degree of incompatibility (which quantifies the joint measurability) of the equatorial qubit POVMs and the optimal violation of a nonlocal steering inequality, proposed by Jones and Wiseman [S. J. Jones and H. M. Wiseman, Phys. Rev. A 84, 012110 (2011), 10.1103/PhysRevA.84.012110]. To this end, we construct a local analog of this steering inequality in a single-qubit system and show that its violation is a mere reflection of measurement incompatibility of equatorial qubit POVMs, employed in first measurements in the sequential unsharp-sharp scheme.

Design and practice of a novel experiment teaching system based on the optoelectric information chain

NASA Astrophysics Data System (ADS)

Luo, Yunhan; Chen, Zhe; Li, Yan; Di, Hongwei; Li, Zhen; Bai, Chunhe; Tang, Jieyuan; Zhang, Jun; Yi, Xiao

2017-08-01

The course of optoelectronic information science is a diverse science and technology with wide range of disciplines, intensive technology, and strong applicability. As a result, the practice teaching in undergraduate education occupies the strategic important position, which is a key link in the process of innovative talents cultivation of photoelectric information, plays a unique and irreplaceable role by any other teaching methods. In order to meet the requirements of national innovative talents of photoelectric information, the complete teaching reform strategy was put forward by combining with the higher education policy and development strategy of teaching and professional characteristics. The goal of the experimental teaching reform is to cultivate innovative talents and to construct the photoelectric information industry chain system of experimental teaching platform and cultivating creative personnel. The key clue is the photoelectric information surrounding photoelectric information, like "generation - modulation - transformation - detection - procession" which will be realized by resource integration and complementary among cross disciplines, and focusing on scientific research support for the teaching and the combination of professional knowledge and practical application. This teaching reform scheme presented in the paper will provide very good demonstration effect in the curriculum reform of other photoelectric information related courses.

A provably-secure ECC-based authentication scheme for wireless sensor networks.

PubMed

Nam, Junghyun; Kim, Moonseong; Paik, Juryon; Lee, Youngsook; Won, Dongho

2014-11-06

A smart-card-based user authentication scheme for wireless sensor networks (in short, a SUA-WSN scheme) is designed to restrict access to the sensor data only to users who are in possession of both a smart card and the corresponding password. While a significant number of SUA-WSN schemes have been suggested in recent years, their intended security properties lack formal definitions and proofs in a widely-accepted model. One consequence is that SUA-WSN schemes insecure against various attacks have proliferated. In this paper, we devise a security model for the analysis of SUA-WSN schemes by extending the widely-accepted model of Bellare, Pointcheval and Rogaway (2000). Our model provides formal definitions of authenticated key exchange and user anonymity while capturing side-channel attacks, as well as other common attacks. We also propose a new SUA-WSN scheme based on elliptic curve cryptography (ECC), and prove its security properties in our extended model. To the best of our knowledge, our proposed scheme is the first SUA-WSN scheme that provably achieves both authenticated key exchange and user anonymity. Our scheme is also computationally competitive with other ECC-based (non-provably secure) schemes.

A Provably-Secure ECC-Based Authentication Scheme for Wireless Sensor Networks

PubMed Central

Nam, Junghyun; Kim, Moonseong; Paik, Juryon; Lee, Youngsook; Won, Dongho

2014-01-01

A smart-card-based user authentication scheme for wireless sensor networks (in short, a SUA-WSN scheme) is designed to restrict access to the sensor data only to users who are in possession of both a smart card and the corresponding password. While a significant number of SUA-WSN schemes have been suggested in recent years, their intended security properties lack formal definitions and proofs in a widely-accepted model. One consequence is that SUA-WSN schemes insecure against various attacks have proliferated. In this paper, we devise a security model for the analysis of SUA-WSN schemes by extending the widely-accepted model of Bellare, Pointcheval and Rogaway (2000). Our model provides formal definitions of authenticated key exchange and user anonymity while capturing side-channel attacks, as well as other common attacks. We also propose a new SUA-WSN scheme based on elliptic curve cryptography (ECC), and prove its security properties in our extended model. To the best of our knowledge, our proposed scheme is the first SUA-WSN scheme that provably achieves both authenticated key exchange and user anonymity. Our scheme is also computationally competitive with other ECC-based (non-provably secure) schemes. PMID:25384009

A soft-hard combination-based cooperative spectrum sensing scheme for cognitive radio networks.

PubMed

Do, Nhu Tri; An, Beongku

2015-02-13

In this paper we propose a soft-hard combination scheme, called SHC scheme, for cooperative spectrum sensing in cognitive radio networks. The SHC scheme deploys a cluster based network in which Likelihood Ratio Test (LRT)-based soft combination is applied at each cluster, and weighted decision fusion rule-based hard combination is utilized at the fusion center. The novelties of the SHC scheme are as follows: the structure of the SHC scheme reduces the complexity of cooperative detection which is an inherent limitation of soft combination schemes. By using the LRT, we can detect primary signals in a low signal-to-noise ratio regime (around an average of -15 dB). In addition, the computational complexity of the LRT is reduced since we derive the closed-form expression of the probability density function of LRT value. The SHC scheme also takes into account the different effects of large scale fading on different users in the wide area network. The simulation results show that the SHC scheme not only provides the better sensing performance compared to the conventional hard combination schemes, but also reduces sensing overhead in terms of reporting time compared to the conventional soft combination scheme using the LRT.

A Novel Passive Tracking Scheme Exploiting Geometric and Intercept Theorems

PubMed Central

Zhou, Biao; Sun, Chao; Ahn, Deockhyeon; Kim, Youngok

2018-01-01

Passive tracking aims to track targets without assistant devices, that is, device-free targets. Passive tracking based on Radio Frequency (RF) Tomography in wireless sensor networks has recently been addressed as an emerging field. The passive tracking scheme using geometric theorems (GTs) is one of the most popular RF Tomography schemes, because the GT-based method can effectively mitigate the demand for a high density of wireless nodes. In the GT-based tracking scheme, the tracking scenario is considered as a two-dimensional geometric topology and then geometric theorems are applied to estimate crossing points (CPs) of the device-free target on line-of-sight links (LOSLs), which reveal the target’s trajectory information in a discrete form. In this paper, we review existing GT-based tracking schemes, and then propose a novel passive tracking scheme by exploiting the Intercept Theorem (IT). To create an IT-based CP estimation scheme available in the noisy non-parallel LOSL situation, we develop the equal-ratio traverse (ERT) method. Finally, we analyze properties of three GT-based tracking algorithms and the performance of these schemes is evaluated experimentally under various trajectories, node densities, and noisy topologies. Analysis of experimental results shows that tracking schemes exploiting geometric theorems can achieve remarkable positioning accuracy even under rather a low density of wireless nodes. Moreover, the proposed IT scheme can provide generally finer tracking accuracy under even lower node density and noisier topologies, in comparison to other schemes. PMID:29562621

Evolution of the biosynthesis of the branched-chain amino acids

NASA Technical Reports Server (NTRS)

Keefe, Anthony D.; Lazcano, Antonio; Miller, Stanley L.

1995-01-01

The origins of the biosynthetic pathways for the branched-chain amino acids cannot be understood in terms of the backwards development of the present acetolactate pathway because it contains unstable intermediates. We propose that the first biosynthesis of the branched-chain amino acids was by the reductive carboxylation of short branched chain fatty acids giving keto acids which were then transaminated. Similar reaction sequences mediated by nonspecific enzymes would produce serine and threomine from the abundant prebiotic compounds glycolic and lactic acids. The aromatic amino acids may also have first been synthesized in this way, e.g. tryptophan from indole acetic acid. The next step would have been the biosynthesis of leucine from alpha-ketoisovalerc acid. The acetolactate pathway developed subsequently. The first version of the Krebs cycle, which was used for amino acid biosynthesis, would have been assembled by making use fo the reductive carboxylation and leucine biosynthesis enzymes, and completed with the development of a single new enzyme, succinate dehydrogenase. This evolutionary scheme suggests that there may be limitations to inferring the origins of metabolism by a simple back extrapolation of current pathways.

Multi-scale modeling of diffusion-controlled reactions in polymers: renormalisation of reactivity parameters.

PubMed

Everaers, Ralf; Rosa, Angelo

2012-01-07

The quantitative description of polymeric systems requires hierarchical modeling schemes, which bridge the gap between the atomic scale, relevant to chemical or biomolecular reactions, and the macromolecular scale, where the longest relaxation modes occur. Here, we use the formalism for diffusion-controlled reactions in polymers developed by Wilemski, Fixman, and Doi to discuss the renormalisation of the reactivity parameters in polymer models with varying spatial resolution. In particular, we show that the adjustments are independent of chain length. As a consequence, it is possible to match reactions times between descriptions with different resolution for relatively short reference chains and to use the coarse-grained model to make quantitative predictions for longer chains. We illustrate our results by a detailed discussion of the classical problem of chain cyclization in the Rouse model, which offers the simplest example of a multi-scale descriptions, if we consider differently discretized Rouse models for the same physical system. Moreover, we are able to explore different combinations of compact and non-compact diffusion in the local and large-scale dynamics by varying the embedding dimension.

Validation of a High-Order Prefactored Compact Scheme on Nonlinear Flows with Complex Geometries

NASA Technical Reports Server (NTRS)

Hixon, Ray; Mankbadi, Reda R.; Povinelli, L. A. (Technical Monitor)

2000-01-01

Three benchmark problems are solved using a sixth-order prefactored compact scheme employing an explicit 10th-order filter with optimized fourth-order Runge-Kutta time stepping. The problems solved are the following: (1) propagation of sound waves through a transonic nozzle; (2) shock-sound interaction; and (3) single airfoil gust response. In the first two problems, the spatial accuracy of the scheme is tested on a stretched grid, and the effectiveness of boundary conditions is shown. The solution stability and accuracy near a shock discontinuity is shown as well. Also, 1-D nonlinear characteristic boundary conditions will be evaluated. In the third problem, a nonlinear Euler solver will be used that solves the equations in generalized curvilinear coordinates using the chain rule transformation. This work, continuing earlier work on flat-plate cascades and Joukowski airfoils, will focus mainly on the effect of the grid and boundary conditions on the accuracy of the solution. The grids were generated using a commercially available grid generator, GridPro/az3000.

Robust Multiple-Range Coherent Quantum State Transfer.

PubMed

Chen, Bing; Peng, Yan-Dong; Li, Yong; Qian, Xiao-Feng

2016-07-01

We propose a multiple-range quantum communication channel to realize coherent two-way quantum state transport with high fidelity. In our scheme, an information carrier (a qubit) and its remote partner are both adiabatically coupled to the same data bus, i.e., an N-site tight-binding chain that has a single defect at the center. At the weak interaction regime, our system is effectively equivalent to a three level system of which a coherent superposition of the two carrier states constitutes a dark state. The adiabatic coupling allows a well controllable information exchange timing via the dark state between the two carriers. Numerical results show that our scheme is robust and efficient under practically inevitable perturbative defects of the data bus as well as environmental dephasing noise.

An Improved Biometrics-Based Remote User Authentication Scheme with User Anonymity

PubMed Central

Kumari, Saru

2013-01-01

The authors review the biometrics-based user authentication scheme proposed by An in 2012. The authors show that there exist loopholes in the scheme which are detrimental for its security. Therefore the authors propose an improved scheme eradicating the flaws of An's scheme. Then a detailed security analysis of the proposed scheme is presented followed by its efficiency comparison. The proposed scheme not only withstands security problems found in An's scheme but also provides some extra features with mere addition of only two hash operations. The proposed scheme allows user to freely change his password and also provides user anonymity with untraceability. PMID:24350272

An improved biometrics-based remote user authentication scheme with user anonymity.

PubMed

Khan, Muhammad Khurram; Kumari, Saru

2013-01-01

The authors review the biometrics-based user authentication scheme proposed by An in 2012. The authors show that there exist loopholes in the scheme which are detrimental for its security. Therefore the authors propose an improved scheme eradicating the flaws of An's scheme. Then a detailed security analysis of the proposed scheme is presented followed by its efficiency comparison. The proposed scheme not only withstands security problems found in An's scheme but also provides some extra features with mere addition of only two hash operations. The proposed scheme allows user to freely change his password and also provides user anonymity with untraceability.

Provably secure identity-based identification and signature schemes from code assumptions

PubMed Central

Zhao, Yiming

2017-01-01

Code-based cryptography is one of few alternatives supposed to be secure in a post-quantum world. Meanwhile, identity-based identification and signature (IBI/IBS) schemes are two of the most fundamental cryptographic primitives, so several code-based IBI/IBS schemes have been proposed. However, with increasingly profound researches on coding theory, the security reduction and efficiency of such schemes have been invalidated and challenged. In this paper, we construct provably secure IBI/IBS schemes from code assumptions against impersonation under active and concurrent attacks through a provably secure code-based signature technique proposed by Preetha, Vasant and Rangan (PVR signature), and a security enhancement Or-proof technique. We also present the parallel-PVR technique to decrease parameter values while maintaining the standard security level. Compared to other code-based IBI/IBS schemes, our schemes achieve not only preferable public parameter size, private key size, communication cost and signature length due to better parameter choices, but also provably secure. PMID:28809940

Provably secure identity-based identification and signature schemes from code assumptions.

PubMed

Song, Bo; Zhao, Yiming

2017-01-01

Code-based cryptography is one of few alternatives supposed to be secure in a post-quantum world. Meanwhile, identity-based identification and signature (IBI/IBS) schemes are two of the most fundamental cryptographic primitives, so several code-based IBI/IBS schemes have been proposed. However, with increasingly profound researches on coding theory, the security reduction and efficiency of such schemes have been invalidated and challenged. In this paper, we construct provably secure IBI/IBS schemes from code assumptions against impersonation under active and concurrent attacks through a provably secure code-based signature technique proposed by Preetha, Vasant and Rangan (PVR signature), and a security enhancement Or-proof technique. We also present the parallel-PVR technique to decrease parameter values while maintaining the standard security level. Compared to other code-based IBI/IBS schemes, our schemes achieve not only preferable public parameter size, private key size, communication cost and signature length due to better parameter choices, but also provably secure.

Unique anthranilic acid chemistry facilitates profiling and characterization of Ser/Thr-linked sugar chains following hydrazinolysis.

PubMed

Anumula, Kalyan Rao

2008-02-01

A novel method for the analysis of Ser/Thr-linked sugar chains was made possible by the virtue of unique anthranilic acid (AA, 2-aminobenzoic acid [2AA]) chemistry for labeling carbohydrates in aqueous salt solutions (K. R. Anumula, Anal. Biochem. 350 (2006) 1-23). The protocol for profiling of Ser/Thr carbohydrates by hydrazinolysis was made simple by eliminating intermediary isolation steps involved in a sample preparation such as desalting and various chromatographic purification schemes. A 6-h hydrazinolysis was carried out at 60 degrees C for O-linked oligosaccharides and at 95 degrees C for total oligosaccharides (N-linked with some O-linked). Following evaporation of hydrazine (<10 min), the oligosaccharides were N-acetylated and derivatized with AA in the same reaction mixture containing salts. Presumably, the glycosyl-hydrazines/hydrazones present in the mixture did not interfere with AA labeling. Because AA is the most fluorescent and highly reactive tag for labeling carbohydrates, the procedures described are suitable for the analysis of a limited amount of samples ( approximately 5 microg) by the current high-resolution high-performance liquid chromatography (HPLC) methods. HPLC conditions developed for the separation of O-linked sugar chains based on size on an amide column were satisfactory for quantitative profiling and characterization. Common O-linked sugar chains found in fetuin, equine chorionic gonadotropin, and glycophorin can be analyzed in less than 50 min. In addition, these fast profiling methods were comparable to profiling by PNGase F (peptide N-glycosidase from Flavobacterium meningosepticum) digestion in terms of time, effort, and simplicity and also were highly reproducible for routine testing. The procedures for the release of sugar chains by hydrazinolysis at the microgram level, labeling with fluorescent tag AA, and profiling by HPLC should be useful in characterization of carbohydrates found in glycoproteins.

A secure and efficient chaotic map-based authenticated key agreement scheme for telecare medicine information systems.

PubMed

Mishra, Dheerendra; Srinivas, Jangirala; Mukhopadhyay, Sourav

2014-10-01

Advancement in network technology provides new ways to utilize telecare medicine information systems (TMIS) for patient care. Although TMIS usually faces various attacks as the services are provided over the public network. Recently, Jiang et al. proposed a chaotic map-based remote user authentication scheme for TMIS. Their scheme has the merits of low cost and session key agreement using Chaos theory. It enhances the security of the system by resisting various attacks. In this paper, we analyze the security of Jiang et al.'s scheme and demonstrate that their scheme is vulnerable to denial of service attack. Moreover, we demonstrate flaws in password change phase of their scheme. Further, our aim is to propose a new chaos map-based anonymous user authentication scheme for TMIS to overcome the weaknesses of Jiang et al.'s scheme, while also retaining the original merits of their scheme. We also show that our scheme is secure against various known attacks including the attacks found in Jiang et al.'s scheme. The proposed scheme is comparable in terms of the communication and computational overheads with Jiang et al.'s scheme and other related existing schemes. Moreover, we demonstrate the validity of the proposed scheme through the BAN (Burrows, Abadi, and Needham) logic.

Nuclear Data Sheets for A = 68

DOE Office of Scientific and Technical Information (OSTI.GOV)

McCutchan, E. A.

2012-07-01

The experimental results from the various reaction and radioactive decay studies leading to nuclides in the A = 68 mass chain have been reviewed. Nuclides ranging from Cr (Z = 24) to Br (Z = 35) are included. For these nuclei, level and decay schemes, as well as tables of nuclear properties, are given. This work supersedes the previous evaluation of the data on these nuclides (2002Bu29).

Managing the Services Supply Chain in the Department of Defense: Opportunities and Challenges

DTIC Science & Technology

2006-04-30

and Russell (1990), Heskett, Sasser and Hart (1990), Lovelock (1992b), Fitzsimmons and Fitzsimmons (2006), and in casebooks including Sasser, Hart...managers of service businesses. Lovelock (1983) proposes five schemes for classifying services that offer insight for marketing and operations...managers in different service businesses. Additional suggestions for managing service business are given by Lovelock (1992a), Schmenner (1986), and Quinn

Research to Assembly Scheme for Satellite Deck Based on Robot Flexibility Control Principle

NASA Astrophysics Data System (ADS)

Guo, Tao; Hu, Ruiqin; Xiao, Zhengyi; Zhao, Jingjing; Fang, Zhikai

2018-03-01

Deck assembly is critical quality control point in final satellite assembly process, and cable extrusion and structure collision problems in assembly process will affect development quality and progress of satellite directly. Aimed at problems existing in deck assembly process, assembly project scheme for satellite deck based on robot flexibility control principle is proposed in this paper. Scheme is introduced firstly; secondly, key technologies on end force perception and flexible docking control in the scheme are studied; then, implementation process of assembly scheme for satellite deck is described in detail; finally, actual application case of assembly scheme is given. Result shows that compared with traditional assembly scheme, assembly scheme for satellite deck based on robot flexibility control principle has obvious advantages in work efficiency, reliability and universality aspects etc.

A keyword searchable attribute-based encryption scheme with attribute update for cloud storage.

PubMed

Wang, Shangping; Ye, Jian; Zhang, Yaling

2018-01-01

Ciphertext-policy attribute-based encryption (CP-ABE) scheme is a new type of data encryption primitive, which is very suitable for data cloud storage for its fine-grained access control. Keyword-based searchable encryption scheme enables users to quickly find interesting data stored in the cloud server without revealing any information of the searched keywords. In this work, we provide a keyword searchable attribute-based encryption scheme with attribute update for cloud storage, which is a combination of attribute-based encryption scheme and keyword searchable encryption scheme. The new scheme supports the user's attribute update, especially in our new scheme when a user's attribute need to be updated, only the user's secret key related with the attribute need to be updated, while other user's secret key and the ciphertexts related with this attribute need not to be updated with the help of the cloud server. In addition, we outsource the operation with high computation cost to cloud server to reduce the user's computational burden. Moreover, our scheme is proven to be semantic security against chosen ciphertext-policy and chosen plaintext attack in the general bilinear group model. And our scheme is also proven to be semantic security against chosen keyword attack under bilinear Diffie-Hellman (BDH) assumption.

A keyword searchable attribute-based encryption scheme with attribute update for cloud storage

PubMed Central

Wang, Shangping; Zhang, Yaling

2018-01-01

Ciphertext-policy attribute-based encryption (CP-ABE) scheme is a new type of data encryption primitive, which is very suitable for data cloud storage for its fine-grained access control. Keyword-based searchable encryption scheme enables users to quickly find interesting data stored in the cloud server without revealing any information of the searched keywords. In this work, we provide a keyword searchable attribute-based encryption scheme with attribute update for cloud storage, which is a combination of attribute-based encryption scheme and keyword searchable encryption scheme. The new scheme supports the user's attribute update, especially in our new scheme when a user's attribute need to be updated, only the user's secret key related with the attribute need to be updated, while other user's secret key and the ciphertexts related with this attribute need not to be updated with the help of the cloud server. In addition, we outsource the operation with high computation cost to cloud server to reduce the user's computational burden. Moreover, our scheme is proven to be semantic security against chosen ciphertext-policy and chosen plaintext attack in the general bilinear group model. And our scheme is also proven to be semantic security against chosen keyword attack under bilinear Diffie-Hellman (BDH) assumption. PMID:29795577

Exponential Arithmetic Based Self-Healing Group Key Distribution Scheme with Backward Secrecy under the Resource-Constrained Wireless Networks

PubMed Central

Guo, Hua; Zheng, Yandong; Zhang, Xiyong; Li, Zhoujun

2016-01-01

In resource-constrained wireless networks, resources such as storage space and communication bandwidth are limited. To guarantee secure communication in resource-constrained wireless networks, group keys should be distributed to users. The self-healing group key distribution (SGKD) scheme is a promising cryptographic tool, which can be used to distribute and update the group key for the secure group communication over unreliable wireless networks. Among all known SGKD schemes, exponential arithmetic based SGKD (E-SGKD) schemes reduce the storage overhead to constant, thus is suitable for the the resource-constrained wireless networks. In this paper, we provide a new mechanism to achieve E-SGKD schemes with backward secrecy. We first propose a basic E-SGKD scheme based on a known polynomial-based SGKD, where it has optimal storage overhead while having no backward secrecy. To obtain the backward secrecy and reduce the communication overhead, we introduce a novel approach for message broadcasting and self-healing. Compared with other E-SGKD schemes, our new E-SGKD scheme has the optimal storage overhead, high communication efficiency and satisfactory security. The simulation results in Zigbee-based networks show that the proposed scheme is suitable for the resource-restrained wireless networks. Finally, we show the application of our proposed scheme. PMID:27136550

High level expression and immunochemical characterization of botulinum neurotoxin type F light chain.

PubMed

Chauhan, Ritika; Chauhan, Vinita; Rao, Mula Kameshwar; Chaudhary, Dilip; Bhagyawant, Sameer; Dhaked, Ram Kumar

2018-06-01

Botulinum neurotoxins (BoNTs) are the most toxic biological substances known. Their potential use as biological warfare agent results in their classification as category A biowarfare agent by Centers for Disease Control and Prevention (CDC), USA. Presently, there are no approved detection system and pharmacological treatments for BoNT intoxication. Although a toxoid vaccine is available for immuno-prophylaxis, vaccines cannot reverse the effect of pre-translocated toxin. Direct handling of the live BoNTs for developing detection and therapeutics may pose fatal danger. This concern was addressed by purifying the recombinant catalytically active light chain of BoNT/F. BoNT/F-LC gene was amplified from the genomic DNA using specifically designed primers and expressed in Escherichia coli. Expression and purification profile were optimized under different conditions for biologically active light chain production. Specific polyclonal antibodies generated against type F illustrates in vivo neutralization in mice and rabbit. These antibodies play key role in conceiving the development of high throughput SPR based detection system which is a highly precise label free technique for protein interaction analysis. The presented work is first of its kind, signifying the production of highly stable and active rBoNT/F-LC and its immunochemical characterization. The study aids in paving the path towards developing a persistent detection system as well as in presenting comprehended scheme for in vitro small molecule therapeutics analysis. Copyright © 2018 Elsevier Inc. All rights reserved.

Efficient hierarchical trans-dimensional Bayesian inversion of magnetotelluric data

NASA Astrophysics Data System (ADS)

Xiang, Enming; Guo, Rongwen; Dosso, Stan E.; Liu, Jianxin; Dong, Hao; Ren, Zhengyong

2018-06-01

This paper develops an efficient hierarchical trans-dimensional (trans-D) Bayesian algorithm to invert magnetotelluric (MT) data for subsurface geoelectrical structure, with unknown geophysical model parameterization (the number of conductivity-layer interfaces) and data-error models parameterized by an auto-regressive (AR) process to account for potential error correlations. The reversible-jump Markov-chain Monte Carlo algorithm, which adds/removes interfaces and AR parameters in birth/death steps, is applied to sample the trans-D posterior probability density for model parameterization, model parameters, error variance and AR parameters, accounting for the uncertainties of model dimension and data-error statistics in the uncertainty estimates of the conductivity profile. To provide efficient sampling over the multiple subspaces of different dimensions, advanced proposal schemes are applied. Parameter perturbations are carried out in principal-component space, defined by eigen-decomposition of the unit-lag model covariance matrix, to minimize the effect of inter-parameter correlations and provide effective perturbation directions and length scales. Parameters of new layers in birth steps are proposed from the prior, instead of focused distributions centred at existing values, to improve birth acceptance rates. Parallel tempering, based on a series of parallel interacting Markov chains with successively relaxed likelihoods, is applied to improve chain mixing over model dimensions. The trans-D inversion is applied in a simulation study to examine the resolution of model structure according to the data information content. The inversion is also applied to a measured MT data set from south-central Australia.

Assessment of the GECKO-A modeling tool using chamber observations for C12 alkanes

NASA Astrophysics Data System (ADS)

Aumont, B.; La, S.; Ouzebidour, F.; Valorso, R.; Mouchel-Vallon, C.; Camredon, M.; Lee-Taylor, J. M.; Hodzic, A.; Madronich, S.; Yee, L. D.; Loza, C. L.; Craven, J. S.; Zhang, X.; Seinfeld, J.

2013-12-01

Secondary Organic Aerosol (SOA) production and ageing is the result of atmospheric oxidation processes leading to the progressive formation of organic species with higher oxidation state and lower volatility. Explicit chemical mechanisms reflect our understanding of these multigenerational oxidation steps. Major uncertainties remain concerning the processes leading to SOA formation and the development, assessment and improvement of such explicit schemes is therefore a key issue. The development of explicit mechanism to describe the oxidation of long chain hydrocarbons is however a challenge. Indeed, explicit oxidation schemes involve a large number of reactions and secondary organic species, far exceeding the size of chemical schemes that can be written manually. The chemical mechanism generator GECKO-A (Generator for Explicit Chemistry and Kinetics of Organics in the Atmosphere) is a computer program designed to overcome this difficulty. GECKO-A generates gas phase oxidation schemes according to a prescribed protocol assigning reaction pathways and kinetics data on the basis of experimental data and structure-activity relationships. In this study, we examine the ability of the generated schemes to explain SOA formation observed in the Caltech Environmental Chambers from various C12 alkane isomers and under high NOx and low NOx conditions. First results show that the model overestimates both the SOA yields and the O/C ratios. Various sensitivity tests are performed to explore processes that might be responsible for these disagreements.

Correlational and thermodynamic properties of finite-temperature electron liquids in the hypernetted-chain approximation.

PubMed

Tanaka, Shigenori

2016-12-07

Correlational and thermodynamic properties of homogeneous electron liquids at finite temperatures are theoretically analyzed in terms of dielectric response formalism with the hypernetted-chain (HNC) approximation and its modified version. The static structure factor and the local-field correction to describe the strong Coulomb-coupling effects beyond the random-phase approximation are self-consistently calculated through solution to integral equations in the paramagnetic (spin unpolarized) and ferromagnetic (spin polarized) states. In the ground state with the normalized temperature θ=0, the present HNC scheme well reproduces the exchange-correlation energies obtained by quantum Monte Carlo (QMC) simulations over the whole fluid phase (the coupling constant r s ≤100), i.e., within 1% and 2% deviations from putative best QMC values in the paramagnetic and ferromagnetic states, respectively. As compared with earlier studies based on the Singwi-Tosi-Land-Sjölander and modified convolution approximations, some improvements on the correlation energies and the correlation functions including the compressibility sum rule are found in the intermediate to strong coupling regimes. When applied to the electron fluids at intermediate Fermi degeneracies (θ≈1), the static structure factors calculated in the HNC scheme show good agreements with the results obtained by the path integral Monte Carlo (PIMC) simulation, while a small negative region in the radial distribution function is observed near the origin, which may be associated with a slight overestimation for the exchange-correlation hole in the HNC approximation. The interaction energies are calculated for various combinations of density and temperature parameters ranging from strong to weak degeneracy and from weak to strong coupling, and the HNC values are then parametrized as functions of r s and θ. The HNC exchange-correlation free energies obtained through the coupling-constant integration show reasonable agreements with earlier results including the PIMC-based fitting over the whole fluid region at finite degeneracies in the paramagnetic state. In contrast, a systematic difference between the HNC and PIMC results is observed in the ferromagnetic state, which suggests a necessity of further studies on the exchange-correlation free energies from both aspects of analytical theory and simulation.

Production and Evaluation of 236gNp and Reference Materials for Naturally Occurring Radioactive Materials

NASA Astrophysics Data System (ADS)

Larijani, Cyrus Kouroush

This thesis is based on the development of a radiochemical separation scheme capable of separating both 236gNp and 236Pu from a uranium target of natural isotopic composition ( 1 g uranium) and 200 MBq of fission decay products. The isobaric distribution of fission residues produced following the bombardment of a natural uranium target with a beam of 25 MeV protons has been evaluated. Decay analysis of thirteen isobarically distinct fission residues were carried out using high-resolution gamma-ray spectrometry at the UK National Physical Laboratory. Stoichiometric abundances were calculated via the determination of absolute activity concentrations associated with the longest-lived members of each isobaric chain. This technique was validated by computational modelling of likely sequential decay processes through an isobaric decay chain. The results were largely in agreement with previously published values for neutron bombardments on natural uranium at energies of 14 MeV. Higher relative yields of products with mass numbers A 110-130 were found, consistent with the increasing yield of these radionuclides as the bombarding energy is increased. Using literature values for the production cross-section for fusion of protons with uranium targets, it is estimated that an upper limit of approximately 250 Bq of activity from the 236Np ground state was produced in this experiment. Using a radiochemical separation scheme, Np and Pu fractions were separated from the produced fission decay products, with analyses of the target-based final reaction products made using Inductively Couple Plasma Mass Spectrometry (ICP-MS) and high-resolution alpha and gamma-ray spectrometry. In a separate research theme, reliable measurement of Naturally Occurring Radioactive Materials is of significance in order to comply with environmental regulations and for radiological protection purposes. The thesis describes the standardisation of three reference materials, namely Sand, Tuff and TiO2 which can serve as quality control materials to achieve traceability, method validation and instrument calibration. The sample preparation, material characterization via gamma, alpha and Inductively Coupled Plasma Mass Spectrometry (ICP-MS) and the assignment of values for both the 4n Thorium and 4n + 2 Uranium decay series are presented.

An improved biometrics-based authentication scheme for telecare medical information systems.

PubMed

Guo, Dianli; Wen, Qiaoyan; Li, Wenmin; Zhang, Hua; Jin, Zhengping

2015-03-01

Telecare medical information system (TMIS) offers healthcare delivery services and patients can acquire their desired medical services conveniently through public networks. The protection of patients' privacy and data confidentiality are significant. Very recently, Mishra et al. proposed a biometrics-based authentication scheme for telecare medical information system. Their scheme can protect user privacy and is believed to resist a range of network attacks. In this paper, we analyze Mishra et al.'s scheme and identify that their scheme is insecure to against known session key attack and impersonation attack. Thereby, we present a modified biometrics-based authentication scheme for TMIS to eliminate the aforementioned faults. Besides, we demonstrate the completeness of the proposed scheme through BAN-logic. Compared to the related schemes, our protocol can provide stronger security and it is more practical.

Parallelised photoacoustic signal acquisition using a Fabry-Perot sensor and a camera-based interrogation scheme

NASA Astrophysics Data System (ADS)

Saeb Gilani, T.; Villringer, C.; Zhang, E.; Gundlach, H.; Buchmann, J.; Schrader, S.; Laufer, J.

2018-02-01

Tomographic photoacoustic (PA) images acquired using a Fabry-Perot (FP) based scanner offer high resolution and image fidelity but can result in long acquisition times due to the need for raster scanning. To reduce the acquisition times, a parallelised camera-based PA signal detection scheme is developed. The scheme is based on using a sCMOScamera and FPI sensors with high homogeneity of optical thickness. PA signals were acquired using the camera-based setup and the signal to noise ratio (SNR) was measured. A comparison of the SNR of PA signal detected using 1) a photodiode in a conventional raster scanning detection scheme and 2) a sCMOS camera in parallelised detection scheme is made. The results show that the parallelised interrogation scheme has the potential to provide high speed PA imaging.

Surface reconstruction and deformation monitoring of stratospheric airship based on laser scanning technology

NASA Astrophysics Data System (ADS)

Guo, Kai; Xie, Yongjie; Ye, Hu; Zhang, Song; Li, Yunfei

2018-04-01

Due to the uncertainty of stratospheric airship's shape and the security problem caused by the uncertainty, surface reconstruction and surface deformation monitoring of airship was conducted based on laser scanning technology and a √3-subdivision scheme based on Shepard interpolation was developed. Then, comparison was conducted between our subdivision scheme and the original √3-subdivision scheme. The result shows our subdivision scheme could reduce the shrinkage of surface and the number of narrow triangles. In addition, our subdivision scheme could keep the sharp features. So, surface reconstruction and surface deformation monitoring of airship could be conducted precisely by our subdivision scheme.

3D early embryogenesis image filtering by nonlinear partial differential equations.

PubMed

Krivá, Z; Mikula, K; Peyriéras, N; Rizzi, B; Sarti, A; Stasová, O

2010-08-01

We present nonlinear diffusion equations, numerical schemes to solve them and their application for filtering 3D images obtained from laser scanning microscopy (LSM) of living zebrafish embryos, with a goal to identify the optimal filtering method and its parameters. In the large scale applications dealing with analysis of 3D+time embryogenesis images, an important objective is a correct detection of the number and position of cell nuclei yielding the spatio-temporal cell lineage tree of embryogenesis. The filtering is the first and necessary step of the image analysis chain and must lead to correct results, removing the noise, sharpening the nuclei edges and correcting the acquisition errors related to spuriously connected subregions. In this paper we study such properties for the regularized Perona-Malik model and for the generalized mean curvature flow equations in the level-set formulation. A comparison with other nonlinear diffusion filters, like tensor anisotropic diffusion and Beltrami flow, is also included. All numerical schemes are based on the same discretization principles, i.e. finite volume method in space and semi-implicit scheme in time, for solving nonlinear partial differential equations. These numerical schemes are unconditionally stable, fast and naturally parallelizable. The filtering results are evaluated and compared first using the Mean Hausdorff distance between a gold standard and different isosurfaces of original and filtered data. Then, the number of isosurface connected components in a region of interest (ROI) detected in original and after the filtering is compared with the corresponding correct number of nuclei in the gold standard. Such analysis proves the robustness and reliability of the edge preserving nonlinear diffusion filtering for this type of data and lead to finding the optimal filtering parameters for the studied models and numerical schemes. Further comparisons consist in ability of splitting the very close objects which are artificially connected due to acquisition error intrinsically linked to physics of LSM. In all studied aspects it turned out that the nonlinear diffusion filter which is called geodesic mean curvature flow (GMCF) has the best performance. Copyright 2010 Elsevier B.V. All rights reserved.

An Identity-Based Anti-Quantum Privacy-Preserving Blind Authentication in Wireless Sensor Networks.

PubMed

Zhu, Hongfei; Tan, Yu-An; Zhu, Liehuang; Wang, Xianmin; Zhang, Quanxin; Li, Yuanzhang

2018-05-22

With the development of wireless sensor networks, IoT devices are crucial for the Smart City; these devices change people's lives such as e-payment and e-voting systems. However, in these two systems, the state-of-art authentication protocols based on traditional number theory cannot defeat a quantum computer attack. In order to protect user privacy and guarantee trustworthy of big data, we propose a new identity-based blind signature scheme based on number theorem research unit lattice, this scheme mainly uses a rejection sampling theorem instead of constructing a trapdoor. Meanwhile, this scheme does not depend on complex public key infrastructure and can resist quantum computer attack. Then we design an e-payment protocol using the proposed scheme. Furthermore, we prove our scheme is secure in the random oracle, and satisfies confidentiality, integrity, and non-repudiation. Finally, we demonstrate that the proposed scheme outperforms the other traditional existing identity-based blind signature schemes in signing speed and verification speed, outperforms the other lattice-based blind signature in signing speed, verification speed, and signing secret key size.

An Identity-Based Anti-Quantum Privacy-Preserving Blind Authentication in Wireless Sensor Networks

PubMed Central

Zhu, Hongfei; Tan, Yu-an; Zhu, Liehuang; Wang, Xianmin; Zhang, Quanxin; Li, Yuanzhang

2018-01-01

With the development of wireless sensor networks, IoT devices are crucial for the Smart City; these devices change people’s lives such as e-payment and e-voting systems. However, in these two systems, the state-of-art authentication protocols based on traditional number theory cannot defeat a quantum computer attack. In order to protect user privacy and guarantee trustworthy of big data, we propose a new identity-based blind signature scheme based on number theorem research unit lattice, this scheme mainly uses a rejection sampling theorem instead of constructing a trapdoor. Meanwhile, this scheme does not depend on complex public key infrastructure and can resist quantum computer attack. Then we design an e-payment protocol using the proposed scheme. Furthermore, we prove our scheme is secure in the random oracle, and satisfies confidentiality, integrity, and non-repudiation. Finally, we demonstrate that the proposed scheme outperforms the other traditional existing identity-based blind signature schemes in signing speed and verification speed, outperforms the other lattice-based blind signature in signing speed, verification speed, and signing secret key size. PMID:29789475

Adaptive Numerical Dissipative Control in High Order Schemes for Multi-D Non-Ideal MHD

NASA Technical Reports Server (NTRS)

Yee, H. C.; Sjoegreen, B.

2004-01-01

The goal is to extend our adaptive numerical dissipation control in high order filter schemes and our new divergence-free methods for ideal MHD to non-ideal MHD that include viscosity and resistivity. The key idea consists of automatic detection of different flow features as distinct sensors to signal the appropriate type and amount of numerical dissipation/filter where needed and leave the rest of the region free of numerical dissipation contamination. These scheme-independent detectors are capable of distinguishing shocks/shears, flame sheets, turbulent fluctuations and spurious high-frequency oscillations. The detection algorithm is based on an artificial compression method (ACM) (for shocks/shears), and redundant multi-resolution wavelets (WAV) (for the above types of flow feature). These filter approaches also provide a natural and efficient way for the minimization of Div(B) numerical error. The filter scheme consists of spatially sixth order or higher non-dissipative spatial difference operators as the base scheme for the inviscid flux derivatives. If necessary, a small amount of high order linear dissipation is used to remove spurious high frequency oscillations. For example, an eighth-order centered linear dissipation (AD8) might be included in conjunction with a spatially sixth-order base scheme. The inviscid difference operator is applied twice for the viscous flux derivatives. After the completion of a full time step of the base scheme step, the solution is adaptively filtered by the product of a 'flow detector' and the 'nonlinear dissipative portion' of a high-resolution shock-capturing scheme. In addition, the scheme independent wavelet flow detector can be used in conjunction with spatially compact, spectral or spectral element type of base schemes. The ACM and wavelet filter schemes using the dissipative portion of a second-order shock-capturing scheme with sixth-order spatial central base scheme for both the inviscid and viscous MHD flux derivatives and a fourth-order Runge-Kutta method are denoted.

Tunable ohmic environment using Josephson junction chains

NASA Astrophysics Data System (ADS)

Rastelli, Gianluca; Pop, Ioan M.

2018-05-01

We propose a scheme to implement a tunable, wide frequency-band dissipative environment using a double chain of Josephson junctions. The two parallel chains consist of identical superconducting quantum interference devices (SQUIDs), with magnetic-flux tunable inductance, coupled to each other at each node via a capacitance much larger than the junction capacitance. Thanks to this capacitive coupling, the system sustains electromagnetic modes with a wide frequency dispersion. The internal quality factor of the modes is maintained as high as possible, and the damping is introduced by a uniform coupling of the modes to a transmission line, itself connected to an amplification and readout circuit. For sufficiently long chains, containing several thousands of junctions, the resulting admittance is a smooth function versus frequency in the microwave domain, and its effective dissipation can be continuously monitored by recording the emitted radiation in the transmission line. We show that by varying in situ the SQUIDs' inductance, the double chain can operate as a tunable ohmic resistor in a frequency band spanning up to 1 GHz, with a resistance that can be swept through values comparable to the resistance quantum Rq=h /(4 e2) ≃6.5 kΩ . We argue that the circuit complexity is within reach using current Josephson junction technology.

Time-dependent quantum transport: An efficient method based on Liouville-von-Neumann equation for single-electron density matrix

NASA Astrophysics Data System (ADS)

Xie, Hang; Jiang, Feng; Tian, Heng; Zheng, Xiao; Kwok, Yanho; Chen, Shuguang; Yam, ChiYung; Yan, YiJing; Chen, Guanhua

2012-07-01

Basing on our hierarchical equations of motion for time-dependent quantum transport [X. Zheng, G. H. Chen, Y. Mo, S. K. Koo, H. Tian, C. Y. Yam, and Y. J. Yan, J. Chem. Phys. 133, 114101 (2010), 10.1063/1.3475566], we develop an efficient and accurate numerical algorithm to solve the Liouville-von-Neumann equation. We solve the real-time evolution of the reduced single-electron density matrix at the tight-binding level. Calculations are carried out to simulate the transient current through a linear chain of atoms, with each represented by a single orbital. The self-energy matrix is expanded in terms of multiple Lorentzian functions, and the Fermi distribution function is evaluated via the Padè spectrum decomposition. This Lorentzian-Padè decomposition scheme is employed to simulate the transient current. With sufficient Lorentzian functions used to fit the self-energy matrices, we show that the lead spectral function and the dynamics response can be treated accurately. Compared to the conventional master equation approaches, our method is much more efficient as the computational time scales cubically with the system size and linearly with the simulation time. As a result, the simulations of the transient currents through systems containing up to one hundred of atoms have been carried out. As density functional theory is also an effective one-particle theory, the Lorentzian-Padè decomposition scheme developed here can be generalized for first-principles simulation of realistic systems.

Probing polariton dynamics in trapped ions with phase-coherent two-dimensional spectroscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gessner, Manuel; Schlawin, Frank; Buchleitner, Andreas

2015-06-07

We devise a phase-coherent three-pulse protocol to probe the polariton dynamics in a trapped-ion quantum simulation. In contrast to conventional nonlinear signals, the presented scheme does not change the number of excitations in the system, allowing for the investigation of the dynamics within an N-excitation manifold. In the particular case of a filling factor one (N excitations in an N-ion chain), the proposed interaction induces coherent transitions between a delocalized phonon superfluid and a localized atomic insulator phase. Numerical simulations of a two-ion chain demonstrate that the resulting two-dimensional spectra allow for the unambiguous identification of the distinct phases, andmore » the two-dimensional line shapes efficiently characterize the relevant decoherence mechanism.« less

Error function attack of chaos synchronization based encryption schemes.

PubMed

Wang, Xingang; Zhan, Meng; Lai, C-H; Gang, Hu

2004-03-01

Different chaos synchronization based encryption schemes are reviewed and compared from the practical point of view. As an efficient cryptanalysis tool for chaos encryption, a proposal based on the error function attack is presented systematically and used to evaluate system security. We define a quantitative measure (quality factor) of the effective applicability of a chaos encryption scheme, which takes into account the security, the encryption speed, and the robustness against channel noise. A comparison is made of several encryption schemes and it is found that a scheme based on one-way coupled chaotic map lattices performs outstandingly well, as judged from quality factor. Copyright 2004 American Institute of Physics.

Security analysis and enhancements of an effective biometric-based remote user authentication scheme using smart cards.

PubMed

An, Younghwa

2012-01-01

Recently, many biometrics-based user authentication schemes using smart cards have been proposed to improve the security weaknesses in user authentication system. In 2011, Das proposed an efficient biometric-based remote user authentication scheme using smart cards that can provide strong authentication and mutual authentication. In this paper, we analyze the security of Das's authentication scheme, and we have shown that Das's authentication scheme is still insecure against the various attacks. Also, we proposed the enhanced scheme to remove these security problems of Das's authentication scheme, even if the secret information stored in the smart card is revealed to an attacker. As a result of security analysis, we can see that the enhanced scheme is secure against the user impersonation attack, the server masquerading attack, the password guessing attack, and the insider attack and provides mutual authentication between the user and the server.

Security Analysis and Enhancements of an Effective Biometric-Based Remote User Authentication Scheme Using Smart Cards

PubMed Central

An, Younghwa

2012-01-01

Recently, many biometrics-based user authentication schemes using smart cards have been proposed to improve the security weaknesses in user authentication system. In 2011, Das proposed an efficient biometric-based remote user authentication scheme using smart cards that can provide strong authentication and mutual authentication. In this paper, we analyze the security of Das's authentication scheme, and we have shown that Das's authentication scheme is still insecure against the various attacks. Also, we proposed the enhanced scheme to remove these security problems of Das's authentication scheme, even if the secret information stored in the smart card is revealed to an attacker. As a result of security analysis, we can see that the enhanced scheme is secure against the user impersonation attack, the server masquerading attack, the password guessing attack, and the insider attack and provides mutual authentication between the user and the server. PMID:22899887

An efficient chaotic maps-based authentication and key agreement scheme using smartcards for telecare medicine information systems.

PubMed

Lee, Tian-Fu

2013-12-01

A smartcard-based authentication and key agreement scheme for telecare medicine information systems enables patients, doctors, nurses and health visitors to use smartcards for secure login to medical information systems. Authorized users can then efficiently access remote services provided by the medicine information systems through public networks. Guo and Chang recently improved the efficiency of a smartcard authentication and key agreement scheme by using chaotic maps. Later, Hao et al. reported that the scheme developed by Guo and Chang had two weaknesses: inability to provide anonymity and inefficient double secrets. Therefore, Hao et al. proposed an authentication scheme for telecare medicine information systems that solved these weaknesses and improved performance. However, a limitation in both schemes is their violation of the contributory property of key agreements. This investigation discusses these weaknesses and proposes a new smartcard-based authentication and key agreement scheme that uses chaotic maps for telecare medicine information systems. Compared to conventional schemes, the proposed scheme provides fewer weaknesses, better security, and more efficiency.

Combinatorial approaches to gene recognition.

PubMed

Roytberg, M A; Astakhova, T V; Gelfand, M S

1997-01-01

Recognition of genes via exon assembly approaches leads naturally to the use of dynamic programming. We consider the general graph-theoretical formulation of the exon assembly problem and analyze in detail some specific variants: multicriterial optimization in the case of non-linear gene-scoring functions; context-dependent schemes for scoring exons and related procedures for exon filtering; and highly specific recognition of arbitrary gene segments, oligonucleotide probes and polymerase chain reaction (PCR) primers.

Managing the Service Supply Chain in the Department of Defense: Opportunities and Challenges

DTIC Science & Technology

2006-12-30

are discussed in textbooks such as Sasser, Olsen and Wyckoff (1978), Murdick, Render and Russell (1990), Heskett, Sasser and Hart (1990), Lovelock ...come up with generalizations that are helpful for managers of service businesses. Lovelock (1983, Summer) proposes five schemes for classifying...business are given by Lovelock (1992), Schmenner (1986, Spring), and Quinn (1992). Chase (1981), as mentioned previously, proposed a theory of the

Nuclear Data Sheets for A=150

DOE Office of Scientific and Technical Information (OSTI.GOV)

Basu, S.K.; Sonzogni, A.A.

The experimental results from the various reaction and decay studies leading to nuclides in the A=150 mass chain have been reviewed. These data are summarized and presented, together with the adopted level schemes and properties, for the nuclides from Cs(Z=55) through Lu(Z=71). This evaluation replaces the previous evaluation by E. der Mateosian and J. K. Tuli (1995De28), which appeared in Nuclear Data Sheets 75, 827 (1995)

Nuclear Data Sheets for A=150

NASA Astrophysics Data System (ADS)

Basu, S. K.; Sonzogni, A. A.

2013-04-01

The experimental results from the various reaction and decay studies leading to nuclides in the A=150 mass chain have been reviewed. These data are summarized and presented, together with the adopted level schemes and properties, for the nuclides from Cs(Z=55) through Lu(Z=71). This evaluation replaces the previous evaluation by E. der Mateosian and J. K. Tuli (1995De28), which appeared in Nuclear Data Sheets 75, 827 (1995).

The Effect of Supply Chain Management Processes on Competitive Advantage and Organizational Performance

DTIC Science & Technology

2012-03-22

what constitutes manufacturing flexibility. Sehti and Sehti (1990) point out that there are no fewer than 50 combined flexibility types and...The eight remaining surveys constitute a low 1% response rate. 53 Demographic information concerning the respondent was collected in the survey...Mexican operations under NAFTA , Transportation Journal, Vol. 34, No.3, pp. 25-34. Feldmann, M., & Müller S. (2003) An incentive scheme for true

Replica exchange and expanded ensemble simulations as Gibbs sampling: simple improvements for enhanced mixing.

PubMed

Chodera, John D; Shirts, Michael R

2011-11-21

The widespread popularity of replica exchange and expanded ensemble algorithms for simulating complex molecular systems in chemistry and biophysics has generated much interest in discovering new ways to enhance the phase space mixing of these protocols in order to improve sampling of uncorrelated configurations. Here, we demonstrate how both of these classes of algorithms can be considered as special cases of Gibbs sampling within a Markov chain Monte Carlo framework. Gibbs sampling is a well-studied scheme in the field of statistical inference in which different random variables are alternately updated from conditional distributions. While the update of the conformational degrees of freedom by Metropolis Monte Carlo or molecular dynamics unavoidably generates correlated samples, we show how judicious updating of the thermodynamic state indices--corresponding to thermodynamic parameters such as temperature or alchemical coupling variables--can substantially increase mixing while still sampling from the desired distributions. We show how state update methods in common use can lead to suboptimal mixing, and present some simple, inexpensive alternatives that can increase mixing of the overall Markov chain, reducing simulation times necessary to obtain estimates of the desired precision. These improved schemes are demonstrated for several common applications, including an alchemical expanded ensemble simulation, parallel tempering, and multidimensional replica exchange umbrella sampling.

Design and implementation of a programming circuit in radiation-hardened FPGA

NASA Astrophysics Data System (ADS)

Lihua, Wu; Xiaowei, Han; Yan, Zhao; Zhongli, Liu; Fang, Yu; Chen, Stanley L.

2011-08-01

We present a novel programming circuit used in our radiation-hardened field programmable gate array (FPGA) chip. This circuit provides the ability to write user-defined configuration data into an FPGA and then read it back. The proposed circuit adopts the direct-access programming point scheme instead of the typical long token shift register chain. It not only saves area but also provides more flexible configuration operations. By configuring the proposed partial configuration control register, our smallest configuration section can be conveniently configured as a single data and a flexible partial configuration can be easily implemented. The hierarchical simulation scheme, optimization of the critical path and the elaborate layout plan make this circuit work well. Also, the radiation hardened by design programming point is introduced. This circuit has been implemented in a static random access memory (SRAM)-based FPGA fabricated by a 0.5 μm partial-depletion silicon-on-insulator CMOS process. The function test results of the fabricated chip indicate that this programming circuit successfully realizes the desired functions in the configuration and read-back. Moreover, the radiation test results indicate that the programming circuit has total dose tolerance of 1 × 105 rad(Si), dose rate survivability of 1.5 × 1011 rad(Si)/s and neutron fluence immunity of 1 × 1014 n/cm2.

A distributed multichannel demand-adaptive P2P VoD system with optimized caching and neighbor-selection

NASA Astrophysics Data System (ADS)

Zhang, Hao; Chen, Minghua; Parekh, Abhay; Ramchandran, Kannan

2011-09-01

We design a distributed multi-channel P2P Video-on-Demand (VoD) system using "plug-and-play" helpers. Helpers are heterogenous "micro-servers" with limited storage, bandwidth and number of users they can serve simultaneously. Our proposed system has the following salient features: (1) it jointly optimizes over helper-user connection topology, video storage distribution and transmission bandwidth allocation; (2) it minimizes server load, and is adaptable to varying supply and demand patterns across multiple video channels irrespective of video popularity; and (3) it is fully distributed and requires little or no maintenance overhead. The combinatorial nature of the problem and the system demand for distributed algorithms makes the problem uniquely challenging. By utilizing Lagrangian decomposition and Markov chain approximation based arguments, we address this challenge by designing two distributed algorithms running in tandem: a primal-dual storage and bandwidth allocation algorithm and a "soft-worst-neighbor-choking" topology-building algorithm. Our scheme provably converges to a near-optimal solution, and is easy to implement in practice. Packet-level simulation results show that the proposed scheme achieves minimum sever load under highly heterogeneous combinations of supply and demand patterns, and is robust to system dynamics of user/helper churn, user/helper asynchrony, and random delays in the network.

Lightweight ECC based RFID authentication integrated with an ID verifier transfer protocol.

PubMed

He, Debiao; Kumar, Neeraj; Chilamkurti, Naveen; Lee, Jong-Hyouk

2014-10-01

The radio frequency identification (RFID) technology has been widely adopted and being deployed as a dominant identification technology in a health care domain such as medical information authentication, patient tracking, blood transfusion medicine, etc. With more and more stringent security and privacy requirements to RFID based authentication schemes, elliptic curve cryptography (ECC) based RFID authentication schemes have been proposed to meet the requirements. However, many recently published ECC based RFID authentication schemes have serious security weaknesses. In this paper, we propose a new ECC based RFID authentication integrated with an ID verifier transfer protocol that overcomes the weaknesses of the existing schemes. A comprehensive security analysis has been conducted to show strong security properties that are provided from the proposed authentication scheme. Moreover, the performance of the proposed authentication scheme is analyzed in terms of computational cost, communicational cost, and storage requirement.

Searchable attribute-based encryption scheme with attribute revocation in cloud storage.

PubMed

Wang, Shangping; Zhao, Duqiao; Zhang, Yaling

2017-01-01

Attribute based encryption (ABE) is a good way to achieve flexible and secure access control to data, and attribute revocation is the extension of the attribute-based encryption, and the keyword search is an indispensable part for cloud storage. The combination of both has an important application in the cloud storage. In this paper, we construct a searchable attribute-based encryption scheme with attribute revocation in cloud storage, the keyword search in our scheme is attribute based with access control, when the search succeeds, the cloud server returns the corresponding cipher text to user and the user can decrypt the cipher text definitely. Besides, our scheme supports multiple keywords search, which makes the scheme more practical. Under the assumption of decisional bilinear Diffie-Hellman exponent (q-BDHE) and decisional Diffie-Hellman (DDH) in the selective security model, we prove that our scheme is secure.

Simple scheme to implement decoy-state reference-frame-independent quantum key distribution

NASA Astrophysics Data System (ADS)

Zhang, Chunmei; Zhu, Jianrong; Wang, Qin

2018-06-01

We propose a simple scheme to implement decoy-state reference-frame-independent quantum key distribution (RFI-QKD), where signal states are prepared in Z, X, and Y bases, decoy states are prepared in X and Y bases, and vacuum states are set to no bases. Different from the original decoy-state RFI-QKD scheme whose decoy states are prepared in Z, X and Y bases, in our scheme decoy states are only prepared in X and Y bases, which avoids the redundancy of decoy states in Z basis, saves the random number consumption, simplifies the encoding device of practical RFI-QKD systems, and makes the most of the finite pulses in a short time. Numerical simulations show that, considering the finite size effect with reasonable number of pulses in practical scenarios, our simple decoy-state RFI-QKD scheme exhibits at least comparable or even better performance than that of the original decoy-state RFI-QKD scheme. Especially, in terms of the resistance to the relative rotation of reference frames, our proposed scheme behaves much better than the original scheme, which has great potential to be adopted in current QKD systems.

Work, Train, Win: Work-Based Learning Design and Management for Productivity Gains. OECD Education Working Papers, No. 135

ERIC Educational Resources Information Center

Kis, Viktoria

2016-01-01

Realising the potential of work-based learning schemes as a driver of productivity requires careful design and support. The length of work-based learning schemes should be adapted to the profile of productivity gains. A scheme that is too long for a given skill set might be unattractive for learners and waste public resources, but a scheme that is…

Cryptanalysis and improvement of Yan et al.'s biometric-based authentication scheme for telecare medicine information systems.

PubMed

Mishra, Dheerendra; Mukhopadhyay, Sourav; Chaturvedi, Ankita; Kumari, Saru; Khan, Muhammad Khurram

2014-06-01

Remote user authentication is desirable for a Telecare Medicine Information System (TMIS) for the safety, security and integrity of transmitted data over the public channel. In 2013, Tan presented a biometric based remote user authentication scheme and claimed that his scheme is secure. Recently, Yan et al. demonstrated some drawbacks in Tan's scheme and proposed an improved scheme to erase the drawbacks of Tan's scheme. We analyze Yan et al.'s scheme and identify that their scheme is vulnerable to off-line password guessing attack, and does not protect anonymity. Moreover, in their scheme, login and password change phases are inefficient to identify the correctness of input where inefficiency in password change phase can cause denial of service attack. Further, we design an improved scheme for TMIS with the aim to eliminate the drawbacks of Yan et al.'s scheme.

An Improvement of Robust and Efficient Biometrics Based Password Authentication Scheme for Telecare Medicine Information Systems Using Extended Chaotic Maps.

PubMed

Moon, Jongho; Choi, Younsung; Kim, Jiye; Won, Dongho

2016-03-01

Recently, numerous extended chaotic map-based password authentication schemes that employ smart card technology were proposed for Telecare Medical Information Systems (TMISs). In 2015, Lu et al. used Li et al.'s scheme as a basis to propose a password authentication scheme for TMISs that is based on biometrics and smart card technology and employs extended chaotic maps. Lu et al. demonstrated that Li et al.'s scheme comprises some weaknesses such as those regarding a violation of the session-key security, a vulnerability to the user impersonation attack, and a lack of local verification. In this paper, however, we show that Lu et al.'s scheme is still insecure with respect to issues such as a violation of the session-key security, and that it is vulnerable to both the outsider attack and the impersonation attack. To overcome these drawbacks, we retain the useful properties of Lu et al.'s scheme to propose a new password authentication scheme that is based on smart card technology and requires the use of chaotic maps. Then, we show that our proposed scheme is more secure and efficient and supports security properties.

A privacy preserving secure and efficient authentication scheme for telecare medical information systems.

PubMed

Mishra, Raghavendra; Barnwal, Amit Kumar

2015-05-01

The Telecare medical information system (TMIS) presents effective healthcare delivery services by employing information and communication technologies. The emerging privacy and security are always a matter of great concern in TMIS. Recently, Chen at al. presented a password based authentication schemes to address the privacy and security. Later on, it is proved insecure against various active and passive attacks. To erase the drawbacks of Chen et al.'s anonymous authentication scheme, several password based authentication schemes have been proposed using public key cryptosystem. However, most of them do not present pre-smart card authentication which leads to inefficient login and password change phases. To present an authentication scheme with pre-smart card authentication, we present an improved anonymous smart card based authentication scheme for TMIS. The proposed scheme protects user anonymity and satisfies all the desirable security attributes. Moreover, the proposed scheme presents efficient login and password change phases where incorrect input can be quickly detected and a user can freely change his password without server assistance. Moreover, we demonstrate the validity of the proposed scheme by utilizing the widely-accepted BAN (Burrows, Abadi, and Needham) logic. The proposed scheme is also comparable in terms of computational overheads with relevant schemes.

Regulatory Issues Associated with Preharvest Food Safety: United States Perspective.

PubMed

Micallef, Shirley A; Buchanan, Robert L

2017-07-01

The preharvest and preslaughter steps of food production constitute a first stage at which food can become contaminated with foodborne and toxigenic pathogens. Contamination at this early stage of food production can lead to amplification as food travels through the production and supply chain, accentuating the crucial need to address hazards and establish science-based metrics that are feasible to implement. This article discusses the preharvest food safety regulatory landscape in the United States, with a specific emphasis on fresh produce crops. Best practices, certification, audit schemes and challenges due to market channels, economies of scales, and grower behavior are considered in relation to the Food Safety Modernization Act. An outlook on the needs to facilitate implementation of the new law, develop educational programs for growers and stakeholders, and continue to better align food safety with environmental goals are presented.

Parametric amplification of 100 fs mid-infrared pulses in ZnGeP₂ driven by a Ho:YAG chirped-pulse amplifier.

PubMed

Kanai, Tsuneto; Malevich, Pavel; Kangaparambil, Sarayoo Sasidharan; Ishida, Kakuta; Mizui, Makoto; Yamanouchi, Kaoru; Hoogland, Heinar; Holzwarth, Ronald; Pugzlys, Audrius; Baltuska, Andrius

2017-02-15

We report on the parametric generation of 100 fs sub-6-cycle 40 μJ pulses with the center wavelength at 5.2 μm using a 1 ps 2.1 μm pump laser and a dispersion management scheme based on bulk material. Our optically synchronized amplifier chain consists of a Ho:YAG chirped-pulse amplifier and white-light-seeded optical parametric amplifiers providing simultaneous passive carrier-envelope phase locking of three ultrashort longwave pulses at the pump, signal, and idler wavelengths corresponding, respectively, to 2.1, 3.5, and 5.2 μm. We also demonstrate bandwidth enhancement and efficient control over nonlinear spectral phase in the regime of cascaded χ² nonlinearity in ZnGeP₂.

Robust Multiple-Range Coherent Quantum State Transfer

PubMed Central

Chen, Bing; Peng, Yan-Dong; Li, Yong; Qian, Xiao-Feng

2016-01-01

We propose a multiple-range quantum communication channel to realize coherent two-way quantum state transport with high fidelity. In our scheme, an information carrier (a qubit) and its remote partner are both adiabatically coupled to the same data bus, i.e., an N-site tight-binding chain that has a single defect at the center. At the weak interaction regime, our system is effectively equivalent to a three level system of which a coherent superposition of the two carrier states constitutes a dark state. The adiabatic coupling allows a well controllable information exchange timing via the dark state between the two carriers. Numerical results show that our scheme is robust and efficient under practically inevitable perturbative defects of the data bus as well as environmental dephasing noise. PMID:27364891

Cloud-based shaft torque estimation for electric vehicle equipped with integrated motor-transmission system

NASA Astrophysics Data System (ADS)

Zhu, Xiaoyuan; Zhang, Hui; Yang, Bo; Zhang, Guichen

2018-01-01

In order to improve oscillation damping control performance as well as gear shift quality of electric vehicle equipped with integrated motor-transmission system, a cloud-based shaft torque estimation scheme is proposed in this paper by using measurable motor and wheel speed signals transmitted by wireless network. It can help reduce computational burden of onboard controllers and also relief network bandwidth requirement of individual vehicle. Considering possible delays during signal wireless transmission, delay-dependent full-order observer design is proposed to estimate the shaft torque in cloud server. With these random delays modeled by using homogenous Markov chain, robust H∞ performance is adopted to minimize the effect of wireless network-induced delays, signal measurement noise as well as system modeling uncertainties on shaft torque estimation error. Observer parameters are derived by solving linear matrix inequalities, and simulation results using acceleration test and tip-in, tip-out test demonstrate the effectiveness of proposed shaft torque observer design.

C-Glycosyl Analogs of Oligosaccharides

NASA Astrophysics Data System (ADS)

Vauzeilles, Boris; Urban, Dominique; Doisneau, Gilles; Beau, Jean-Marie

This chapter covers the synthesis of a large collection of "C-oligosaccharides ", synthetic analogs of naturally occurring oligosaccharides in which a carbon atom replaces the anomeric, interglycosidic oxygen atom. These non-natural constructs are stable to chemical and enzymatic degradation, and are primarily devised to probe carbohydrate-based biological processes. These mainly target carbohydrate-protein interactions such as the modulation of glycoenzyme (glycosylhydrolases and transferases) activities or the design of ligands for lectin Carbohydrate Recognition Domains. The discussion is based on the key carbon-carbon bond assembling steps on carbohydrate templates: ionic (anionic and cationic chemistries, sigmatropic rearrangements) or radical assemblage, and olefin metathesis. Synthetic schemes in which at least one of the monosaccharide units is constructed by total synthesis or by cyclization of acyclic chiral chains are presented separately in a "partial de novo synthesis" section. The review also provides comments, when they are known, on the conformational and binding properties of these synthetic analogs, as well as their biological behavior when tested.

Localisation of an Unknown Number of Land Mines Using a Network of Vapour Detectors

PubMed Central

Chhadé, Hiba Haj; Abdallah, Fahed; Mougharbel, Imad; Gning, Amadou; Julier, Simon; Mihaylova, Lyudmila

2014-01-01

We consider the problem of localising an unknown number of land mines using concentration information provided by a wireless sensor network. A number of vapour sensors/detectors, deployed in the region of interest, are able to detect the concentration of the explosive vapours, emanating from buried land mines. The collected data is communicated to a fusion centre. Using a model for the transport of the explosive chemicals in the air, we determine the unknown number of sources using a Principal Component Analysis (PCA)-based technique. We also formulate the inverse problem of determining the positions and emission rates of the land mines using concentration measurements provided by the wireless sensor network. We present a solution for this problem based on a probabilistic Bayesian technique using a Markov chain Monte Carlo sampling scheme, and we compare it to the least squares optimisation approach. Experiments conducted on simulated data show the effectiveness of the proposed approach. PMID:25384008

Efficient Lookup Table-Based Adaptive Baseband Predistortion Architecture for Memoryless Nonlinearity

NASA Astrophysics Data System (ADS)

Ba, Seydou N.; Waheed, Khurram; Zhou, G. Tong

2010-12-01

Digital predistortion is an effective means to compensate for the nonlinear effects of a memoryless system. In case of a cellular transmitter, a digital baseband predistorter can mitigate the undesirable nonlinear effects along the signal chain, particularly the nonlinear impairments in the radiofrequency (RF) amplifiers. To be practically feasible, the implementation complexity of the predistorter must be minimized so that it becomes a cost-effective solution for the resource-limited wireless handset. This paper proposes optimizations that facilitate the design of a low-cost high-performance adaptive digital baseband predistorter for memoryless systems. A comparative performance analysis of the amplitude and power lookup table (LUT) indexing schemes is presented. An optimized low-complexity amplitude approximation and its hardware synthesis results are also studied. An efficient LUT predistorter training algorithm that combines the fast convergence speed of the normalized least mean squares (NLMSs) with a small hardware footprint is proposed. Results of fixed-point simulations based on the measured nonlinear characteristics of an RF amplifier are presented.

Dynamical Binding Modes Determine Agonistic and Antagonistic Ligand Effects in the Prostate-Specific G-Protein Coupled Receptor (PSGR).

PubMed

Wolf, Steffen; Jovancevic, Nikolina; Gelis, Lian; Pietsch, Sebastian; Hatt, Hanns; Gerwert, Klaus

2017-11-22

We analysed the ligand-based activation mechanism of the prostate-specific G-protein coupled receptor (PSGR), which is an olfactory receptor that mediates cellular growth in prostate cancer cells. Furthermore, it is an olfactory receptor with a known chemically near identic antagonist/agonist pair, α- and β-ionone. Using a combined theoretical and experimental approach, we propose that this receptor is activated by a ligand-induced rearrangement of a protein-internal hydrogen bond network. Surprisingly, this rearrangement is not induced by interaction of the ligand with the network, but by dynamic van der Waals contacts of the ligand with the involved amino acid side chains, altering their conformations and intraprotein connectivity. Ligand recognition in this GPCR is therefore highly stereo selective, but seemingly lacks any ligand recognition via polar contacts. A putative olfactory receptor-based drug design scheme will have to take this unique mode of protein/ligand action into account.

Color encryption scheme based on adapted quantum logistic map

NASA Astrophysics Data System (ADS)

Zaghloul, Alaa; Zhang, Tiejun; Amin, Mohamed; Abd El-Latif, Ahmed A.

2014-04-01

This paper presents a new color image encryption scheme based on quantum chaotic system. In this scheme, a new encryption scheme is accomplished by generating an intermediate chaotic key stream with the help of quantum chaotic logistic map. Then, each pixel is encrypted by the cipher value of the previous pixel and the adapted quantum logistic map. The results show that the proposed scheme has adequate security for the confidentiality of color images.

Mean-field calculations of chain packing and conformational statistics in lipid bilayers: comparison with experiments and molecular dynamics studies.

PubMed Central

Fattal, D R; Ben-Shaul, A

1994-01-01

A molecular, mean-field theory of chain packing statistics in aggregates of amphiphilic molecules is applied to calculate the conformational properties of the lipid chains comprising the hydrophobic cores of dipalmitoyl-phosphatidylcholine (DPPC), dioleoyl-phosphatidylcholine (DOPC), and palmitoyl-oleoyl-phosphatidylcholine (POPC) bilayers in their fluid state. The central quantity in this theory, the probability distribution of chain conformations, is evaluated by minimizing the free energy of the bilayer assuming only that the segment density within the hydrophobic region is uniform (liquidlike). Using this distribution we calculate chain conformational properties such as bond orientational order parameters and spatial distributions of the various chain segments. The lipid chains, both the saturated palmitoyl (-(CH2)14-CH3) and the unsaturated oleoyl (-(CH2)7-CH = CH-(CH2)7-CH3) chains are modeled using rotational isomeric state schemes. All possible chain conformations are enumerated and their statistical weights are determined by the self-consistency equations expressing the condition of uniform density. The hydrophobic core of the DPPC bilayer is treated as composed of single (palmitoyl) chain amphiphiles, i.e., the interactions between chains originating from the same lipid headgroup are assumed to be the same as those between chains belonging to different molecules. Similarly, the DOPC system is treated as a bilayer of oleoyl chains. The POPC bilayer is modeled as an equimolar mixture of palmitoyl and oleoyl chains. Bond orientational order parameter profiles, and segment spatial distributions are calculated for the three systems above, for several values of the bilayer thickness (or, equivalently, average area/headgroup) chosen, where possible, so as to allow for comparisons with available experimental data and/or molecular dynamics simulations. In most cases the agreement between the mean-field calculations, which are relatively easy to perform, and the experimental and simulation data is very good, supporting their use as an efficient tool for analyzing a variety of systems subject to varying conditions (e.g., bilayers of different compositions or thicknesses at different temperatures). PMID:7811955

A Hash Based Remote User Authentication and Authenticated Key Agreement Scheme for the Integrated EPR Information System.

PubMed

Li, Chun-Ta; Weng, Chi-Yao; Lee, Cheng-Chi; Wang, Chun-Cheng

2015-11-01

To protect patient privacy and ensure authorized access to remote medical services, many remote user authentication schemes for the integrated electronic patient record (EPR) information system have been proposed in the literature. In a recent paper, Das proposed a hash based remote user authentication scheme using passwords and smart cards for the integrated EPR information system, and claimed that the proposed scheme could resist various passive and active attacks. However, in this paper, we found that Das's authentication scheme is still vulnerable to modification and user duplication attacks. Thereafter we propose a secure and efficient authentication scheme for the integrated EPR information system based on lightweight hash function and bitwise exclusive-or (XOR) operations. The security proof and performance analysis show our new scheme is well-suited to adoption in remote medical healthcare services.

A Practical and Secure Coercion-Resistant Scheme for Internet Voting

NASA Astrophysics Data System (ADS)

Araújo, Roberto; Foulle, Sébastien; Traoré, Jacques

Juels, Catalano, and Jakobsson (JCJ) proposed at WPES 2005 the first voting scheme that considers real-world threats and that is more realistic for Internet elections. Their scheme, though, has a quadratic work factor and thereby is not efficient for large scale elections. Based on the work of JCJ, Smith proposed an efficient scheme that has a linear work factor. In this paper we first show that Smith's scheme is insecure. Then we present a new coercion-resistant election scheme with a linear work factor that overcomes the flaw of Smith's proposal. Our solution is based on the group signature scheme of Camenisch and Lysyanskaya (Crypto 2004).

Effectiveness and equity of the Tanzania National Voucher Scheme for mosquito nets over 10 years of implementation.

PubMed

Kramer, Karen; Mandike, Renata; Nathan, Rose; Mohamed, Ally; Lynch, Matthew; Brown, Nick; Mnzava, Ally; Rimisho, Wilhelmina; Lengeler, Christian

2017-06-15

The Tanzania National Voucher Scheme (TNVS) was a public private partnership managed by the Ministry of Health that provided pregnant women and infants with highly subsidized (long-lasting) insecticide-treated nets between 2004 and 2014. It was implemented in the context of the National Insecticide Treated Nets (NATNETS) Programme and was the main keep up strategy for vulnerable populations. The programme design was adjusted considerably over time to incorporate new evidence, shifting public health policies, and changing donor priorities. Three TNVS models can be distinguished: (1) the fixed discount; (2) the fixed top-up; (3) the hybrid voucher model. The changes improved equity and effectiveness, but also had a profound effect on how the programme was managed and implemented. The TNVS reached the majority of beneficiaries with vouchers, and significantly increased household ownership and use of LLINs. While two mass distribution campaigns implemented between 2009 and 2011 achieved universal coverage and equity, the TNVS ensured continuous protection of the vulnerable populations before, during and after the campaigns. The TNVS stimulated and maintained a large national retail network which managed the LLIN supply chain. The effectiveness of the TNVS was a function of several interdependent factors, including the supply chain of vouchers through the public health system; the supply chain of nets in the commercial sector; the demand for nets from voucher recipients; management and risk mitigation measures; and the influence of global and donor objectives. The TNVS was a highly innovative and globally influential programme, which stimulated the thinking around effectively and equitably distributing ITNs, and contributed directly to the evolution of global policy. It was a fundamental component of the NATNETS programme which protected a malaria-vulnerable population for over a decade.

FIELD TESTS OF GEOGRAPHICALLY-DEPENDENT VS. THRESHOLD-BASED WATERSHED CLASSIFICATION SCHEMES IN THE GREAT LAKES BASIN

EPA Science Inventory

We compared classification schemes based on watershed storage (wetland + lake area/watershed area) and forest fragmentation with a geographically-based classification scheme for two case studies involving 1) Lake Superior tributaries and 2) watersheds of riverine coastal wetlands...

FIELD TESTS OF GEOGRAPHICALLY-DEPENDENT VS. THRESHOLD-BASED WATERSHED CLASSIFICATION SCHEMED IN THE GREAT LAKES BASIN

EPA Science Inventory

We compared classification schemes based on watershed storage (wetland + lake area/watershed area) and forest fragmentation with a geographically-based classification scheme for two case studies involving 1)Lake Superior tributaries and 2) watersheds of riverine coastal wetlands ...

An optimal implicit staggered-grid finite-difference scheme based on the modified Taylor-series expansion with minimax approximation method for elastic modeling

NASA Astrophysics Data System (ADS)

Yang, Lei; Yan, Hongyong; Liu, Hong

2017-03-01

Implicit staggered-grid finite-difference (ISFD) scheme is competitive for its great accuracy and stability, whereas its coefficients are conventionally determined by the Taylor-series expansion (TE) method, leading to a loss in numerical precision. In this paper, we modify the TE method using the minimax approximation (MA), and propose a new optimal ISFD scheme based on the modified TE (MTE) with MA method. The new ISFD scheme takes the advantage of the TE method that guarantees great accuracy at small wavenumbers, and keeps the property of the MA method that keeps the numerical errors within a limited bound at the same time. Thus, it leads to great accuracy for numerical solution of the wave equations. We derive the optimal ISFD coefficients by applying the new method to the construction of the objective function, and using a Remez algorithm to minimize its maximum. Numerical analysis is made in comparison with the conventional TE-based ISFD scheme, indicating that the MTE-based ISFD scheme with appropriate parameters can widen the wavenumber range with high accuracy, and achieve greater precision than the conventional ISFD scheme. The numerical modeling results also demonstrate that the MTE-based ISFD scheme performs well in elastic wave simulation, and is more efficient than the conventional ISFD scheme for elastic modeling.

A direct Primitive Variable Recovery Scheme for hyperbolic conservative equations: The case of relativistic hydrodynamics.

PubMed

Aguayo-Ortiz, A; Mendoza, S; Olvera, D

2018-01-01

In this article we develop a Primitive Variable Recovery Scheme (PVRS) to solve any system of coupled differential conservative equations. This method obtains directly the primitive variables applying the chain rule to the time term of the conservative equations. With this, a traditional finite volume method for the flux is applied in order avoid violation of both, the entropy and "Rankine-Hugoniot" jump conditions. The time evolution is then computed using a forward finite difference scheme. This numerical technique evades the recovery of the primitive vector by solving an algebraic system of equations as it is often used and so, it generalises standard techniques to solve these kind of coupled systems. The article is presented bearing in mind special relativistic hydrodynamic numerical schemes with an added pedagogical view in the appendix section in order to easily comprehend the PVRS. We present the convergence of the method for standard shock-tube problems of special relativistic hydrodynamics and a graphical visualisation of the errors using the fluctuations of the numerical values with respect to exact analytic solutions. The PVRS circumvents the sometimes arduous computation that arises from standard numerical methods techniques, which obtain the desired primitive vector solution through an algebraic polynomial of the charges.

A direct Primitive Variable Recovery Scheme for hyperbolic conservative equations: The case of relativistic hydrodynamics

PubMed Central

Mendoza, S.; Olvera, D.

2018-01-01

In this article we develop a Primitive Variable Recovery Scheme (PVRS) to solve any system of coupled differential conservative equations. This method obtains directly the primitive variables applying the chain rule to the time term of the conservative equations. With this, a traditional finite volume method for the flux is applied in order avoid violation of both, the entropy and “Rankine-Hugoniot” jump conditions. The time evolution is then computed using a forward finite difference scheme. This numerical technique evades the recovery of the primitive vector by solving an algebraic system of equations as it is often used and so, it generalises standard techniques to solve these kind of coupled systems. The article is presented bearing in mind special relativistic hydrodynamic numerical schemes with an added pedagogical view in the appendix section in order to easily comprehend the PVRS. We present the convergence of the method for standard shock-tube problems of special relativistic hydrodynamics and a graphical visualisation of the errors using the fluctuations of the numerical values with respect to exact analytic solutions. The PVRS circumvents the sometimes arduous computation that arises from standard numerical methods techniques, which obtain the desired primitive vector solution through an algebraic polynomial of the charges. PMID:29659602

An effective and secure key-management scheme for hierarchical access control in E-medicine system.

PubMed

Odelu, Vanga; Das, Ashok Kumar; Goswami, Adrijit

2013-04-01

Recently several hierarchical access control schemes are proposed in the literature to provide security of e-medicine systems. However, most of them are either insecure against 'man-in-the-middle attack' or they require high storage and computational overheads. Wu and Chen proposed a key management method to solve dynamic access control problems in a user hierarchy based on hybrid cryptosystem. Though their scheme improves computational efficiency over Nikooghadam et al.'s approach, it suffers from large storage space for public parameters in public domain and computational inefficiency due to costly elliptic curve point multiplication. Recently, Nikooghadam and Zakerolhosseini showed that Wu-Chen's scheme is vulnerable to man-in-the-middle attack. In order to remedy this security weakness in Wu-Chen's scheme, they proposed a secure scheme which is again based on ECC (elliptic curve cryptography) and efficient one-way hash function. However, their scheme incurs huge computational cost for providing verification of public information in the public domain as their scheme uses ECC digital signature which is costly when compared to symmetric-key cryptosystem. In this paper, we propose an effective access control scheme in user hierarchy which is only based on symmetric-key cryptosystem and efficient one-way hash function. We show that our scheme reduces significantly the storage space for both public and private domains, and computational complexity when compared to Wu-Chen's scheme, Nikooghadam-Zakerolhosseini's scheme, and other related schemes. Through the informal and formal security analysis, we further show that our scheme is secure against different attacks and also man-in-the-middle attack. Moreover, dynamic access control problems in our scheme are also solved efficiently compared to other related schemes, making our scheme is much suitable for practical applications of e-medicine systems.

High-Order Central WENO Schemes for Multi-Dimensional Hamilton-Jacobi Equations

NASA Technical Reports Server (NTRS)

Bryson, Steve; Levy, Doron; Biegel, Bryan (Technical Monitor)

2002-01-01

We present new third- and fifth-order Godunov-type central schemes for approximating solutions of the Hamilton-Jacobi (HJ) equation in an arbitrary number of space dimensions. These are the first central schemes for approximating solutions of the HJ equations with an order of accuracy that is greater than two. In two space dimensions we present two versions for the third-order scheme: one scheme that is based on a genuinely two-dimensional Central WENO reconstruction, and another scheme that is based on a simpler dimension-by-dimension reconstruction. The simpler dimension-by-dimension variant is then extended to a multi-dimensional fifth-order scheme. Our numerical examples in one, two and three space dimensions verify the expected order of accuracy of the schemes.

Proteins analysed as virtual knots

NASA Astrophysics Data System (ADS)

Alexander, Keith; Taylor, Alexander J.; Dennis, Mark R.

2017-02-01

Long, flexible physical filaments are naturally tangled and knotted, from macroscopic string down to long-chain molecules. The existence of knotting in a filament naturally affects its configuration and properties, and may be very stable or disappear rapidly under manipulation and interaction. Knotting has been previously identified in protein backbone chains, for which these mechanical constraints are of fundamental importance to their molecular functionality, despite their being open curves in which the knots are not mathematically well defined; knotting can only be identified by closing the termini of the chain somehow. We introduce a new method for resolving knotting in open curves using virtual knots, which are a wider class of topological objects that do not require a classical closure and so naturally capture the topological ambiguity inherent in open curves. We describe the results of analysing proteins in the Protein Data Bank by this new scheme, recovering and extending previous knotting results, and identifying topological interest in some new cases. The statistics of virtual knots in protein chains are compared with those of open random walks and Hamiltonian subchains on cubic lattices, identifying a regime of open curves in which the virtual knotting description is likely to be important.

Proteins analysed as virtual knots

PubMed Central

Alexander, Keith; Taylor, Alexander J.; Dennis, Mark R.

2017-01-01

Long, flexible physical filaments are naturally tangled and knotted, from macroscopic string down to long-chain molecules. The existence of knotting in a filament naturally affects its configuration and properties, and may be very stable or disappear rapidly under manipulation and interaction. Knotting has been previously identified in protein backbone chains, for which these mechanical constraints are of fundamental importance to their molecular functionality, despite their being open curves in which the knots are not mathematically well defined; knotting can only be identified by closing the termini of the chain somehow. We introduce a new method for resolving knotting in open curves using virtual knots, which are a wider class of topological objects that do not require a classical closure and so naturally capture the topological ambiguity inherent in open curves. We describe the results of analysing proteins in the Protein Data Bank by this new scheme, recovering and extending previous knotting results, and identifying topological interest in some new cases. The statistics of virtual knots in protein chains are compared with those of open random walks and Hamiltonian subchains on cubic lattices, identifying a regime of open curves in which the virtual knotting description is likely to be important. PMID:28205562

Exact quantum numbers of collapsed and non-collapsed two-string solutions in the spin-1/2 Heisenberg spin chain

NASA Astrophysics Data System (ADS)

Deguchi, Tetsuo; Ranjan Giri, Pulak

2016-04-01

Every solution of the Bethe-ansatz equations (BAEs) is characterized by a set of quantum numbers, by which we can evaluate it numerically. However, no general rule is known how to give quantum numbers for the physical solutions of BAE. For the spin-1/2 XXX chain we rigorously derive all the quantum numbers for the complete set of the Bethe-ansatz eigenvectors in the two down-spin sector with any chain length N. Here we obtain them both for real and complex solutions. We also show that all the solutions associated with them are distinct. Consequently, we prove the completeness of the Bethe ansatz and give an exact expression for the number of real solutions which correspond to collapsed bound-state solutions (i.e., two-string solutions) in the sector: 2[(N-1)/2-(N/π ){{tan}}-1(\\sqrt{N-1})] in terms of Gauss’ symbol. Moreover, we prove in the sector the scheme conjectured by Takahashi for solving BAE systematically. We also suggest that by applying the present method we can derive the quantum numbers for the spin-1/2 XXZ chain.

Dynamics of hot random quantum spin chains: from anyons to Heisenberg spins

NASA Astrophysics Data System (ADS)

Parameswaran, Siddharth; Potter, Andrew; Vasseur, Romain

2015-03-01

We argue that the dynamics of the random-bond Heisenberg spin chain are ergodic at infinite temperature, in contrast to the many-body localized behavior seen in its random-field counterpart. First, we show that excited-state real-space renormalization group (RSRG-X) techniques suffer from a fatal breakdown of perturbation theory due to the proliferation of large effective spins that grow without bound. We repair this problem by deforming the SU (2) symmetry of the Heisenberg chain to its `anyonic' version, SU(2)k , where the growth of effective spins is truncated at spin S = k / 2 . This enables us to construct a self-consistent RSRG-X scheme that is particularly simple at infinite temperature. Solving the flow equations, we compute the excited-state entanglement and show that it crosses over from volume-law to logarithmic scaling at a length scale ξk ~eαk3 . This reveals that (a) anyon chains have random-singlet-like excited states for any finite k; and (b) ergodicity is restored in the Heisenberg limit k --> ∞ . We acknowledge support from the Quantum Materials program of LBNL (RV), the Gordon and Betty Moore Foundation (ACP), and UC Irvine startup funds (SAP).

A Quantum Proxy Signature Scheme Based on Genuine Five-qubit Entangled State

NASA Astrophysics Data System (ADS)

Cao, Hai-Jing; Huang, Jun; Yu, Yao-Feng; Jiang, Xiu-Li

2014-09-01

In this paper a very efficient and secure proxy signature scheme is proposed. It is based on controlled quantum teleportation. Genuine five-qubit entangled state functions as quantum channel. The scheme uses the physical characteristics of quantum mechanics to implement delegation, signature and verification. Quantum key distribution and one-time pad are adopted in our scheme, which could guarantee not only the unconditional security of the scheme but also the anonymity of the messages owner.

An improved and effective secure password-based authentication and key agreement scheme using smart cards for the telecare medicine information system.

PubMed

Das, Ashok Kumar; Bruhadeshwar, Bezawada

2013-10-01

Recently Lee and Liu proposed an efficient password based authentication and key agreement scheme using smart card for the telecare medicine information system [J. Med. Syst. (2013) 37:9933]. In this paper, we show that though their scheme is efficient, their scheme still has two security weaknesses such as (1) it has design flaws in authentication phase and (2) it has design flaws in password change phase. In order to withstand these flaws found in Lee-Liu's scheme, we propose an improvement of their scheme. Our improved scheme keeps also the original merits of Lee-Liu's scheme. We show that our scheme is efficient as compared to Lee-Liu's scheme. Further, through the security analysis, we show that our scheme is secure against possible known attacks. In addition, we simulate our scheme for the formal security verification using the widely-accepted AVISPA (Automated Validation of Internet Security Protocols and Applications) tool to show that our scheme is secure against passive and active attacks.

Ab initio optimization principle for the ground states of translationally invariant strongly correlated quantum lattice models.

PubMed

Ran, Shi-Ju

2016-05-01

In this work, a simple and fundamental numeric scheme dubbed as ab initio optimization principle (AOP) is proposed for the ground states of translational invariant strongly correlated quantum lattice models. The idea is to transform a nondeterministic-polynomial-hard ground-state simulation with infinite degrees of freedom into a single optimization problem of a local function with finite number of physical and ancillary degrees of freedom. This work contributes mainly in the following aspects: (1) AOP provides a simple and efficient scheme to simulate the ground state by solving a local optimization problem. Its solution contains two kinds of boundary states, one of which play the role of the entanglement bath that mimics the interactions between a supercell and the infinite environment, and the other gives the ground state in a tensor network (TN) form. (2) In the sense of TN, a novel decomposition named as tensor ring decomposition (TRD) is proposed to implement AOP. Instead of following the contraction-truncation scheme used by many existing TN-based algorithms, TRD solves the contraction of a uniform TN in an opposite way by encoding the contraction in a set of self-consistent equations that automatically reconstruct the whole TN, making the simulation simple and unified; (3) AOP inherits and develops the ideas of different well-established methods, including the density matrix renormalization group (DMRG), infinite time-evolving block decimation (iTEBD), network contractor dynamics, density matrix embedding theory, etc., providing a unified perspective that is previously missing in this fields. (4) AOP as well as TRD give novel implications to existing TN-based algorithms: A modified iTEBD is suggested and the two-dimensional (2D) AOP is argued to be an intrinsic 2D extension of DMRG that is based on infinite projected entangled pair state. This paper is focused on one-dimensional quantum models to present AOP. The benchmark is given on a transverse Ising chain and 2D classical Ising model, showing the remarkable efficiency and accuracy of the AOP.

Improving Biometric-Based Authentication Schemes with Smart Card Revocation/Reissue for Wireless Sensor Networks.

PubMed

Moon, Jongho; Lee, Donghoon; Lee, Youngsook; Won, Dongho

2017-04-25

User authentication in wireless sensor networks is more difficult than in traditional networks owing to sensor network characteristics such as unreliable communication, limited resources, and unattended operation. For these reasons, various authentication schemes have been proposed to provide secure and efficient communication. In 2016, Park et al. proposed a secure biometric-based authentication scheme with smart card revocation/reissue for wireless sensor networks. However, we found that their scheme was still insecure against impersonation attack, and had a problem in the smart card revocation/reissue phase. In this paper, we show how an adversary can impersonate a legitimate user or sensor node, illegal smart card revocation/reissue and prove that Park et al.'s scheme fails to provide revocation/reissue. In addition, we propose an enhanced scheme that provides efficiency, as well as anonymity and security. Finally, we provide security and performance analysis between previous schemes and the proposed scheme, and provide formal analysis based on the random oracle model. The results prove that the proposed scheme can solve the weaknesses of impersonation attack and other security flaws in the security analysis section. Furthermore, performance analysis shows that the computational cost is lower than the previous scheme.

Improving Biometric-Based Authentication Schemes with Smart Card Revocation/Reissue for Wireless Sensor Networks

PubMed Central

Moon, Jongho; Lee, Donghoon; Lee, Youngsook; Won, Dongho

2017-01-01

User authentication in wireless sensor networks is more difficult than in traditional networks owing to sensor network characteristics such as unreliable communication, limited resources, and unattended operation. For these reasons, various authentication schemes have been proposed to provide secure and efficient communication. In 2016, Park et al. proposed a secure biometric-based authentication scheme with smart card revocation/reissue for wireless sensor networks. However, we found that their scheme was still insecure against impersonation attack, and had a problem in the smart card revocation/reissue phase. In this paper, we show how an adversary can impersonate a legitimate user or sensor node, illegal smart card revocation/reissue and prove that Park et al.’s scheme fails to provide revocation/reissue. In addition, we propose an enhanced scheme that provides efficiency, as well as anonymity and security. Finally, we provide security and performance analysis between previous schemes and the proposed scheme, and provide formal analysis based on the random oracle model. The results prove that the proposed scheme can solve the weaknesses of impersonation attack and other security flaws in the security analysis section. Furthermore, performance analysis shows that the computational cost is lower than the previous scheme. PMID:28441331

An improved scheme for Flip-OFDM based on Hartley transform in short-range IM/DD systems.

PubMed

Zhou, Ji; Qiao, Yaojun; Cai, Zhuo; Ji, Yuefeng

2014-08-25

In this paper, an improved Flip-OFDM scheme is proposed for IM/DD optical systems, where the modulation/demodulation processing takes advantage of the fast Hartley transform (FHT) algorithm. We realize the improved scheme in one symbol period while conventional Flip-OFDM scheme based on fast Fourier transform (FFT) in two consecutive symbol periods. So the complexity of many operations in improved scheme is half of that in conventional scheme, such as CP operation, polarity inversion and symbol delay. Compared to FFT with complex input constellation, the complexity of FHT with real input constellation is halved. The transmission experiment over 50-km SSMF has been realized to verify the feasibility of improved scheme. In conclusion, the improved scheme has the same BER performance with conventional scheme, but great superiority on complexity.

Predicting protein subcellular locations using hierarchical ensemble of Bayesian classifiers based on Markov chains.

PubMed

Bulashevska, Alla; Eils, Roland

2006-06-14

The subcellular location of a protein is closely related to its function. It would be worthwhile to develop a method to predict the subcellular location for a given protein when only the amino acid sequence of the protein is known. Although many efforts have been made to predict subcellular location from sequence information only, there is the need for further research to improve the accuracy of prediction. A novel method called HensBC is introduced to predict protein subcellular location. HensBC is a recursive algorithm which constructs a hierarchical ensemble of classifiers. The classifiers used are Bayesian classifiers based on Markov chain models. We tested our method on six various datasets; among them are Gram-negative bacteria dataset, data for discriminating outer membrane proteins and apoptosis proteins dataset. We observed that our method can predict the subcellular location with high accuracy. Another advantage of the proposed method is that it can improve the accuracy of the prediction of some classes with few sequences in training and is therefore useful for datasets with imbalanced distribution of classes. This study introduces an algorithm which uses only the primary sequence of a protein to predict its subcellular location. The proposed recursive scheme represents an interesting methodology for learning and combining classifiers. The method is computationally efficient and competitive with the previously reported approaches in terms of prediction accuracies as empirical results indicate. The code for the software is available upon request.

Local unitary transformation method toward practical electron correlation calculations with scalar relativistic effect in large-scale molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Seino, Junji; Nakai, Hiromi, E-mail: nakai@waseda.jp; Research Institute for Science and Engineering, Waseda University, 3-4-1 Okubo, Shinjuku-ku, Tokyo 169-8555

In order to perform practical electron correlation calculations, the local unitary transformation (LUT) scheme at the spin-free infinite-order Douglas–Kroll–Hess (IODKH) level [J. Seino and H. Nakai, J. Chem. Phys.136, 244102 (2012); J. Seino and H. Nakai, J. Chem. Phys.137, 144101 (2012)], which is based on the locality of relativistic effects, has been combined with the linear-scaling divide-and-conquer (DC)-based Hartree–Fock (HF) and electron correlation methods, such as the second-order Møller–Plesset (MP2) and the coupled cluster theories with single and double excitations (CCSD). Numerical applications in hydrogen halide molecules, (HX){sub n} (X = F, Cl, Br, and I), coinage metal chain systems,more » M{sub n} (M = Cu and Ag), and platinum-terminated polyynediyl chain, trans,trans-((p-CH{sub 3}C{sub 6}H{sub 4}){sub 3}P){sub 2}(C{sub 6}H{sub 5})Pt(C≡C){sub 4}Pt(C{sub 6}H{sub 5})((p-CH{sub 3}C{sub 6}H{sub 4}){sub 3}P){sub 2}, clarified that the present methods, namely DC-HF, MP2, and CCSD with the LUT-IODKH Hamiltonian, reproduce the results obtained using conventional methods with small computational costs. The combination of both LUT and DC techniques could be the first approach that achieves overall quasi-linear-scaling with a small prefactor for relativistic electron correlation calculations.« less

A new interstellar molecule - Tricarbon monoxide

NASA Technical Reports Server (NTRS)

Matthews, H. E.; Irvine, W. M.; Friberg, P.; Brown, R. D.; Godfrey, P. D.

1984-01-01

The C3O molecule, whose pure rotational spectrum has only recently been studied in the laboratory, has been detected in the cold, dark interstellar Taurus Molecular Cloud 1. Since C3O is the first interstelar carbon chain molecule to contain oxygen, its existence places an important new constraint on chemical schemes for cold interstellar clouds. The abundance of C3O can be understood in terms of purely gas-phase ion-molecule chemistry.

Public-key quantum digital signature scheme with one-time pad private-key

NASA Astrophysics Data System (ADS)

Chen, Feng-Lin; Liu, Wan-Fang; Chen, Su-Gen; Wang, Zhi-Hua

2018-01-01

A quantum digital signature scheme is firstly proposed based on public-key quantum cryptosystem. In the scheme, the verification public-key is derived from the signer's identity information (such as e-mail) on the foundation of identity-based encryption, and the signature private-key is generated by one-time pad (OTP) protocol. The public-key and private-key pair belongs to classical bits, but the signature cipher belongs to quantum qubits. After the signer announces the public-key and generates the final quantum signature, each verifier can verify publicly whether the signature is valid or not with the public-key and quantum digital digest. Analysis results show that the proposed scheme satisfies non-repudiation and unforgeability. Information-theoretic security of the scheme is ensured by quantum indistinguishability mechanics and OTP protocol. Based on the public-key cryptosystem, the proposed scheme is easier to be realized compared with other quantum signature schemes under current technical conditions.

Gas-Kinetic Theory Based Flux Splitting Method for Ideal Magnetohydrodynamics

NASA Technical Reports Server (NTRS)

Xu, Kun

1998-01-01

A gas-kinetic solver is developed for the ideal magnetohydrodynamics (MHD) equations. The new scheme is based on the direct splitting of the flux function of the MHD equations with the inclusion of "particle" collisions in the transport process. Consequently, the artificial dissipation in the new scheme is much reduced in comparison with the MHD Flux Vector Splitting Scheme. At the same time, the new scheme is compared with the well-developed Roe-type MHD solver. It is concluded that the kinetic MHD scheme is more robust and efficient than the Roe- type method, and the accuracy is competitive. In this paper the general principle of splitting the macroscopic flux function based on the gas-kinetic theory is presented. The flux construction strategy may shed some light on the possible modification of AUSM- and CUSP-type schemes for the compressible Euler equations, as well as to the development of new schemes for a non-strictly hyperbolic system.

Secure Communications in CIoT Networks with a Wireless Energy Harvesting Untrusted Relay

PubMed Central

Hu, Hequn; Liao, Xuewen

2017-01-01

The Internet of Things (IoT) represents a bright prospect that a variety of common appliances can connect to one another, as well as with the rest of the Internet, to vastly improve our lives. Unique communication and security challenges have been brought out by the limited hardware, low-complexity, and severe energy constraints of IoT devices. In addition, a severe spectrum scarcity problem has also been stimulated by the use of a large number of IoT devices. In this paper, cognitive IoT (CIoT) is considered where an IoT network works as the secondary system using underlay spectrum sharing. A wireless energy harvesting (EH) node is used as a relay to improve the coverage of an IoT device. However, the relay could be a potential eavesdropper to intercept the IoT device’s messages. This paper considers the problem of secure communication between the IoT device (e.g., sensor) and a destination (e.g., controller) via the wireless EH untrusted relay. Since the destination can be equipped with adequate energy supply, secure schemes based on destination-aided jamming are proposed based on power splitting (PS) and time splitting (TS) policies, called intuitive secure schemes based on PS (Int-PS), precoded secure scheme based on PS (Pre-PS), intuitive secure scheme based on TS (Int-TS) and precoded secure scheme based on TS (Pre-TS), respectively. The secure performances of the proposed schemes are evaluated through the metric of probability of successfully secure transmission (PSST), which represents the probability that the interference constraint of the primary user is satisfied and the secrecy rate is positive. PSST is analyzed for the proposed secure schemes, and the closed form expressions of PSST for Pre-PS and Pre-TS are derived and validated through simulation results. Numerical results show that the precoded secure schemes have better PSST than the intuitive secure schemes under similar power consumption. When the secure schemes based on PS and TS polices have similar PSST, the average transmit power consumption of the secure scheme based on TS is lower. The influences of power splitting and time slitting ratios are also discussed through simulations. PMID:28869540

Efficient and Provable Secure Pairing-Free Security-Mediated Identity-Based Identification Schemes

PubMed Central

Chin, Ji-Jian; Tan, Syh-Yuan; Heng, Swee-Huay; Phan, Raphael C.-W.

2014-01-01

Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user's secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI) was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions. PMID:25207333

Efficient and provable secure pairing-free security-mediated identity-based identification schemes.

PubMed

Chin, Ji-Jian; Tan, Syh-Yuan; Heng, Swee-Huay; Phan, Raphael C-W

2014-01-01

Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user's secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI) was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions.

Privacy Protection for Telecare Medicine Information Systems Using a Chaotic Map-Based Three-Factor Authenticated Key Agreement Scheme.

PubMed

Zhang, Liping; Zhu, Shaohui; Tang, Shanyu

2017-03-01

Telecare medicine information systems (TMIS) provide flexible and convenient e-health care. However, the medical records transmitted in TMIS are exposed to unsecured public networks, so TMIS are more vulnerable to various types of security threats and attacks. To provide privacy protection for TMIS, a secure and efficient authenticated key agreement scheme is urgently needed to protect the sensitive medical data. Recently, Mishra et al. proposed a biometrics-based authenticated key agreement scheme for TMIS by using hash function and nonce, they claimed that their scheme could eliminate the security weaknesses of Yan et al.'s scheme and provide dynamic identity protection and user anonymity. In this paper, however, we demonstrate that Mishra et al.'s scheme suffers from replay attacks, man-in-the-middle attacks and fails to provide perfect forward secrecy. To overcome the weaknesses of Mishra et al.'s scheme, we then propose a three-factor authenticated key agreement scheme to enable the patient to enjoy the remote healthcare services via TMIS with privacy protection. The chaotic map-based cryptography is employed in the proposed scheme to achieve a delicate balance of security and performance. Security analysis demonstrates that the proposed scheme resists various attacks and provides several attractive security properties. Performance evaluation shows that the proposed scheme increases efficiency in comparison with other related schemes.

PHACK: An Efficient Scheme for Selective Forwarding Attack Detection in WSNs.

PubMed

Liu, Anfeng; Dong, Mianxiong; Ota, Kaoru; Long, Jun

2015-12-09

In this paper, a Per-Hop Acknowledgement (PHACK)-based scheme is proposed for each packet transmission to detect selective forwarding attacks. In our scheme, the sink and each node along the forwarding path generate an acknowledgement (ACK) message for each received packet to confirm the normal packet transmission. The scheme, in which each ACK is returned to the source node along a different routing path, can significantly increase the resilience against attacks because it prevents an attacker from compromising nodes in the return routing path, which can otherwise interrupt the return of nodes' ACK packets. For this case, the PHACK scheme also has better potential to detect abnormal packet loss and identify suspect nodes as well as better resilience against attacks. Another pivotal issue is the network lifetime of the PHACK scheme, as it generates more acknowledgements than previous ACK-based schemes. We demonstrate that the network lifetime of the PHACK scheme is not lower than that of other ACK-based schemes because the scheme just increases the energy consumption in non-hotspot areas and does not increase the energy consumption in hotspot areas. Moreover, the PHACK scheme greatly simplifies the protocol and is easy to implement. Both theoretical and simulation results are given to demonstrate the effectiveness of the proposed scheme in terms of high detection probability and the ability to identify suspect nodes.

PHACK: An Efficient Scheme for Selective Forwarding Attack Detection in WSNs

PubMed Central

Liu, Anfeng; Dong, Mianxiong; Ota, Kaoru; Long, Jun

2015-01-01

In this paper, a Per-Hop Acknowledgement (PHACK)-based scheme is proposed for each packet transmission to detect selective forwarding attacks. In our scheme, the sink and each node along the forwarding path generate an acknowledgement (ACK) message for each received packet to confirm the normal packet transmission. The scheme, in which each ACK is returned to the source node along a different routing path, can significantly increase the resilience against attacks because it prevents an attacker from compromising nodes in the return routing path, which can otherwise interrupt the return of nodes’ ACK packets. For this case, the PHACK scheme also has better potential to detect abnormal packet loss and identify suspect nodes as well as better resilience against attacks. Another pivotal issue is the network lifetime of the PHACK scheme, as it generates more acknowledgements than previous ACK-based schemes. We demonstrate that the network lifetime of the PHACK scheme is not lower than that of other ACK-based schemes because the scheme just increases the energy consumption in non-hotspot areas and does not increase the energy consumption in hotspot areas. Moreover, the PHACK scheme greatly simplifies the protocol and is easy to implement. Both theoretical and simulation results are given to demonstrate the effectiveness of the proposed scheme in terms of high detection probability and the ability to identify suspect nodes. PMID:26690178

Secure anonymity-preserving password-based user authentication and session key agreement scheme for telecare medicine information systems.

PubMed

Sutrala, Anil Kumar; Das, Ashok Kumar; Odelu, Vanga; Wazid, Mohammad; Kumari, Saru

2016-10-01

Information and communication and technology (ICT) has changed the entire paradigm of society. ICT facilitates people to use medical services over the Internet, thereby reducing the travel cost, hospitalization cost and time to a greater extent. Recent advancements in Telecare Medicine Information System (TMIS) facilitate users/patients to access medical services over the Internet by gaining health monitoring facilities at home. Amin and Biswas recently proposed a RSA-based user authentication and session key agreement protocol usable for TMIS, which is an improvement over Giri et al.'s RSA-based user authentication scheme for TMIS. In this paper, we show that though Amin-Biswas's scheme considerably improves the security drawbacks of Giri et al.'s scheme, their scheme has security weaknesses as it suffers from attacks such as privileged insider attack, user impersonation attack, replay attack and also offline password guessing attack. A new RSA-based user authentication scheme for TMIS is proposed, which overcomes the security pitfalls of Amin-Biswas's scheme and also preserves user anonymity property. The careful formal security analysis using the two widely accepted Burrows-Abadi-Needham (BAN) logic and the random oracle models is done. Moreover, the informal security analysis of the scheme is also done. These security analyses show the robustness of our new scheme against the various known attacks as well as attacks found in Amin-Biswas's scheme. The simulation of the proposed scheme using the widely accepted Automated Validation of Internet Security Protocols and Applications (AVISPA) tool is also done. We present a new user authentication and session key agreement scheme for TMIS, which fixes the mentioned security pitfalls found in Amin-Biswas's scheme, and we also show that the proposed scheme provides better security than other existing schemes through the rigorous security analysis and verification tool. Furthermore, we present the formal security verification of our scheme using the widely accepted AVISPA tool. High security and extra functionality features allow our proposed scheme to be applicable for telecare medicine information systems which is used for e-health care medical applications. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Leukotriene B4 omega-hydroxylase in human polymorphonuclear leukocytes. Suicidal inactivation by acetylenic fatty acids.

PubMed

Shak, S; Reich, N O; Goldstein, I M; Ortiz de Montellano, P R

1985-10-25

Human polymorphonuclear leukocytes (PMN) not only generate and respond to leukotriene B4 (LTB4), but also catabolize this mediator of inflammation rapidly and specifically by omega-oxidation (probably due to the action of a cytochrome P-450 enzyme). To develop pharmacologically useful inhibitors of the LTB4 omega-hydroxylase in human PMN, we devised a general scheme for synthesizing terminal acetylenic fatty acids based on the "acetylenic zipper" reaction. We found that the LTB4 omega-hydroxylase in intact PMN and in PMN sonicates is inactivated in a concentration-dependent fashion by terminal acetylenic analogues of lauric, palmitic, and stearic acids (i.e. 11-dodecynoic, 15-hexadecynoic, and 17-octadecynoic acids). Consistent with a suicidal process, inactivation of the LTB4 omega-hydroxylase requires molecular oxygen and NADPH, is time-dependent, and follows pseudo-first-order kinetics. Inactivation of the omega-hydroxylase by acetylenic fatty acids also is dependent on the terminal acetylenic moiety and the carbon chain length. Saturated fatty acids lacking a terminal acetylenic moiety do not inactivate the omega-hydroxylase. In addition, the two long-chain (C16, C18) acetylenic fatty acids inactivate the omega-hydroxylase at much lower concentrations (less than 5.0 microM) than those required for inactivation by the short-chain (C12) terminal acetylenic fatty acid (100 microM). Potent suicidal inhibitors of the LTB4 omega-hydroxylase in human PMN will help elucidate the roles played by LTB4 and its omega-oxidation products in regulating PMN function and in mediating inflammation.

Rate-loss analysis of an efficient quantum repeater architecture

NASA Astrophysics Data System (ADS)

Guha, Saikat; Krovi, Hari; Fuchs, Christopher A.; Dutton, Zachary; Slater, Joshua A.; Simon, Christoph; Tittel, Wolfgang

2015-08-01

We analyze an entanglement-based quantum key distribution (QKD) architecture that uses a linear chain of quantum repeaters employing photon-pair sources, spectral-multiplexing, linear-optic Bell-state measurements, multimode quantum memories, and classical-only error correction. Assuming perfect sources, we find an exact expression for the secret-key rate, and an analytical description of how errors propagate through the repeater chain, as a function of various loss-and-noise parameters of the devices. We show via an explicit analytical calculation, which separately addresses the effects of the principle nonidealities, that this scheme achieves a secret-key rate that surpasses the Takeoka-Guha-Wilde bound—a recently found fundamental limit to the rate-vs-loss scaling achievable by any QKD protocol over a direct optical link—thereby providing one of the first rigorous proofs of the efficacy of a repeater protocol. We explicitly calculate the end-to-end shared noisy quantum state generated by the repeater chain, which could be useful for analyzing the performance of other non-QKD quantum protocols that require establishing long-distance entanglement. We evaluate that shared state's fidelity and the achievable entanglement-distillation rate, as a function of the number of repeater nodes, total range, and various loss-and-noise parameters of the system. We extend our theoretical analysis to encompass sources with nonzero two-pair-emission probability, using an efficient exact numerical evaluation of the quantum state propagation and measurements. We expect our results to spur formal rate-loss analysis of other repeater protocols and also to provide useful abstractions to seed analyses of quantum networks of complex topologies.

Regolith thermal energy storage for lunar nighttime power

NASA Technical Reports Server (NTRS)

Tillotson, Brian

1992-01-01

A scheme for providing nighttime electric power to a lunar base is described. This scheme stores thermal energy in a pile of regolith. Any such scheme must somehow improve on the poor thermal conductivity of lunar regolith in vacuum. Two previous schemes accomplish this by casting or melting the regolith. The scheme described here wraps the regolith in a gas-tight bag and introduces a light gas to enhance thermal conductivity. This allows the system to be assembled with less energy and equipment than schemes which require melting of regolith. A point design based on the new scheme is presented. Its mass from Earth compares favorably with the mass of a regenerative fuel cell of equal capacity.

A new semiclassical decoupling scheme for electronic transitions in molecular collisions - Application to vibrational-to-electronic energy transfer

NASA Technical Reports Server (NTRS)

Lee, H.-W.; Lam, K. S.; Devries, P. L.; George, T. F.

1980-01-01

A new semiclassical decoupling scheme (the trajectory-based decoupling scheme) is introduced in a computational study of vibrational-to-electronic energy transfer for a simple model system that simulates collinear atom-diatom collisions. The probability of energy transfer (P) is calculated quasiclassically using the new scheme as well as quantum mechanically as a function of the atomic electronic-energy separation (lambda), with overall good agreement between the two sets of results. Classical mechanics with the new decoupling scheme is found to be capable of predicting resonance behavior whereas an earlier decoupling scheme (the coordinate-based decoupling scheme) failed. Interference effects are not exhibited in P vs lambda results.

Modeling and performance analysis of an improved movement-based location management scheme for packet-switched mobile communication systems.

PubMed

Chung, Yun Won; Kwon, Jae Kyun; Park, Suwon

2014-01-01

One of the key technologies to support mobility of mobile station (MS) in mobile communication systems is location management which consists of location update and paging. In this paper, an improved movement-based location management scheme with two movement thresholds is proposed, considering bursty data traffic characteristics of packet-switched (PS) services. The analytical modeling for location update and paging signaling loads of the proposed scheme is developed thoroughly and the performance of the proposed scheme is compared with that of the conventional scheme. We show that the proposed scheme outperforms the conventional scheme in terms of total signaling load with an appropriate selection of movement thresholds.

Producer-retailer integrated EMQ system with machine breakdown, rework failures, and a discontinuous inventory issuing policy.

PubMed

Chiu, Singa Wang; Chen, Shin-Wei; Chiu, Yuan-Shyi Peter; Li, Ting-Wei

2016-01-01

This study develops two extended economic manufacturing quantity (EMQ)-based models with a discontinuous product issuing policy, random machine breakdown, and rework failures. Various real conditions in production processes, end-product delivery, and intra-supply chains such as a producer-retailer integrated scheme are examined. The first model incorporates a discontinuous multi-delivery policy into a prior work (Chiu et al. in Proc Inst Mech Eng B J Eng 223:183-194, 2009) in lieu of their continuous policy. Such an enhanced model can address situations in supply chain environments, where finished products are transported to outside retail stores (or customers). The second model further combines retailer's stock holding costs into the first model. This extended EMQ model is applicable in situations in present-day manufacturing firms where finished products are distributed to company's own retail stores (or regional sales offices) and stocked there for sale. Two aforementioned extended EMQ models are investigated, respectively. Mathematical modeling along with iterative algorithms are employed to derive the optimal production run times that minimize the expected total system costs, including the costs incurred in production units, transportation, and retail stores, for these integrated EMQ systems. Numerical examples are provided to demonstrate the practical application of the research results.

Comparison of wavelet based denoising schemes for gear condition monitoring: An Artificial Neural Network based Approach

NASA Astrophysics Data System (ADS)

Ahmed, Rounaq; Srinivasa Pai, P.; Sriram, N. S.; Bhat, Vasudeva

2018-02-01

Vibration Analysis has been extensively used in recent past for gear fault diagnosis. The vibration signals extracted is usually contaminated with noise and may lead to wrong interpretation of results. The denoising of extracted vibration signals helps the fault diagnosis by giving meaningful results. Wavelet Transform (WT) increases signal to noise ratio (SNR), reduces root mean square error (RMSE) and is effective to denoise the gear vibration signals. The extracted signals have to be denoised by selecting a proper denoising scheme in order to prevent the loss of signal information along with noise. An approach has been made in this work to show the effectiveness of Principal Component Analysis (PCA) to denoise gear vibration signal. In this regard three selected wavelet based denoising schemes namely PCA, Empirical Mode Decomposition (EMD), Neighcoeff Coefficient (NC), has been compared with Adaptive Threshold (AT) an extensively used wavelet based denoising scheme for gear vibration signal. The vibration signals acquired from a customized gear test rig were denoised by above mentioned four denoising schemes. The fault identification capability as well as SNR, Kurtosis and RMSE for the four denoising schemes have been compared. Features extracted from the denoised signals have been used to train and test artificial neural network (ANN) models. The performances of the four denoising schemes have been evaluated based on the performance of the ANN models. The best denoising scheme has been identified, based on the classification accuracy results. PCA is effective in all the regards as a best denoising scheme.

Implementation analysis of RC5 algorithm on Preneel-Govaerts-Vandewalle (PGV) hashing schemes using length extension attack

NASA Astrophysics Data System (ADS)

Siswantyo, Sepha; Susanti, Bety Hayat

2016-02-01

Preneel-Govaerts-Vandewalle (PGV) schemes consist of 64 possible single-block-length schemes that can be used to build a hash function based on block ciphers. For those 64 schemes, Preneel claimed that 4 schemes are secure. In this paper, we apply length extension attack on those 4 secure PGV schemes which use RC5 algorithm in its basic construction to test their collision resistance property. The attack result shows that the collision occurred on those 4 secure PGV schemes. Based on the analysis, we indicate that Feistel structure and data dependent rotation operation in RC5 algorithm, XOR operations on the scheme, along with selection of additional message block value also give impact on the collision to occur.

Limitations of discrete-time quantum walk on a one-dimensional infinite chain

NASA Astrophysics Data System (ADS)

Lin, Jia-Yi; Zhu, Xuanmin; Wu, Shengjun

2018-04-01

How well can we manipulate the state of a particle via a discrete-time quantum walk? We show that the discrete-time quantum walk on a one-dimensional infinite chain with coin operators that are independent of the position can only realize product operators of the form eiξ A ⊗1p, which cannot change the position state of the walker. We present a scheme to construct all possible realizations of all the product operators of the form eiξ A ⊗1p. When the coin operators are dependent on the position, we show that the translation operators on the position can not be realized via a DTQW with coin operators that are either the identity operator 1 or the Pauli operator σx.

Performance verification of the FlashCam prototype camera for the Cherenkov Telescope Array

NASA Astrophysics Data System (ADS)

Werner, F.; Bauer, C.; Bernhard, S.; Capasso, M.; Diebold, S.; Eisenkolb, F.; Eschbach, S.; Florin, D.; Föhr, C.; Funk, S.; Gadola, A.; Garrecht, F.; Hermann, G.; Jung, I.; Kalekin, O.; Kalkuhl, C.; Kasperek, J.; Kihm, T.; Lahmann, R.; Marszalek, A.; Pfeifer, M.; Principe, G.; Pühlhofer, G.; Pürckhauer, S.; Rajda, P. J.; Reimer, O.; Santangelo, A.; Schanz, T.; Schwab, T.; Steiner, S.; Straumann, U.; Tenzer, C.; Vollhardt, A.; Wolf, D.; Zietara, K.; CTA Consortium

2017-12-01

The Cherenkov Telescope Array (CTA) is a future gamma-ray observatory that is planned to significantly improve upon the sensitivity and precision of the current generation of Cherenkov telescopes. The observatory will consist of several dozens of telescopes with different sizes and equipped with different types of cameras. Of these, the FlashCam camera system is the first to implement a fully digital signal processing chain which allows for a traceable, configurable trigger scheme and flexible signal reconstruction. As of autumn 2016, a prototype FlashCam camera for the medium-sized telescopes of CTA nears completion. First results of the ongoing system tests demonstrate that the signal chain and the readout system surpass CTA requirements. The stability of the system is shown using long-term temperature cycling.

Universal aspects of conformations and transverse fluctuations of a two-dimensional semi-flexible chain

NASA Astrophysics Data System (ADS)

Hsu, Hsiao-Ping; Huang, Aiqun; Bhattacharya, Aniket; Binder, Kurt

2015-03-01

In this talk we compare the results obtained from Monte Carlo (MC) and Brownian dynamics (BD) simulation for the universal properties of a semi-flexible chain. Specifically we compare MC results obtained using pruned-enriched Rosenbluth method (PERM) with those obtained from BD simulation. We find that the scaled plot of root-mean-square (RMS) end-to-end distance / 2 Llp and RMS transverse transverse fluctuations √{ } /lp as a function of L /lp (where L and lp are the contour length, and the persistence length respectively) are universal and independent of the definition of the persistence length used in MC and BD schemes. We further investigate to what extent these results agree for a semi-flexible polymer confined in a quasi one dimensional channel.

Many-body delocalization with random vector potentials

NASA Astrophysics Data System (ADS)

Cheng, Chen; Mondaini, Rubem

2016-11-01

We study the ergodic properties of excited states in a model of interacting fermions in quasi-one-dimensional chains subjected to a random vector potential. In the noninteracting limit, we show that arbitrarily small values of this complex off-diagonal disorder trigger localization for the whole spectrum; the divergence of the localization length in the single-particle basis is characterized by a critical exponent ν which depends on the energy density being investigated. When short-range interactions are included, the localization is lost, and the system is ergodic regardless of the magnitude of disorder in finite chains. Our numerical results suggest a delocalization scheme for arbitrary small values of interactions. This finding indicates that the standard scenario of the many-body localization cannot be obtained in a model with random gauge fields.

Enhancing the LVRT Capability of PMSG-Based Wind Turbines Based on R-SFCL

NASA Astrophysics Data System (ADS)

Xu, Lin; Lin, Ruixing; Ding, Lijie; Huang, Chunjun

2018-03-01

A novel low voltage ride-through (LVRT) scheme for PMSG-based wind turbines based on the Resistor Superconducting Fault Current Limiter (R-SFCL) is proposed in this paper. The LVRT scheme is mainly formed by R-SFCL in series between the transformer and the Grid Side Converter (GSC), and basic modelling has been discussed in detail. The proposed LVRT scheme is implemented to interact with PMSG model in PSCAD/EMTDC under three phase short circuit fault condition, which proves that the proposed scheme based on R-SFCL can improve the transient performance and LVRT capability to consolidate grid connection with wind turbines.

A robust anonymous biometric-based authenticated key agreement scheme for multi-server environments

PubMed Central

Huang, Yuanfei; Ma, Fangchao

2017-01-01

In order to improve the security in remote authentication systems, numerous biometric-based authentication schemes using smart cards have been proposed. Recently, Moon et al. presented an authentication scheme to remedy the flaws of Lu et al.’s scheme, and claimed that their improved protocol supports the required security properties. Unfortunately, we found that Moon et al.’s scheme still has weaknesses. In this paper, we show that Moon et al.’s scheme is vulnerable to insider attack, server spoofing attack, user impersonation attack and guessing attack. Furthermore, we propose a robust anonymous multi-server authentication scheme using public key encryption to remove the aforementioned problems. From the subsequent formal and informal security analysis, we demonstrate that our proposed scheme provides strong mutual authentication and satisfies the desirable security requirements. The functional and performance analysis shows that the improved scheme has the best secure functionality and is computational efficient. PMID:29121050

A robust anonymous biometric-based authenticated key agreement scheme for multi-server environments.

PubMed

Guo, Hua; Wang, Pei; Zhang, Xiyong; Huang, Yuanfei; Ma, Fangchao

2017-01-01

In order to improve the security in remote authentication systems, numerous biometric-based authentication schemes using smart cards have been proposed. Recently, Moon et al. presented an authentication scheme to remedy the flaws of Lu et al.'s scheme, and claimed that their improved protocol supports the required security properties. Unfortunately, we found that Moon et al.'s scheme still has weaknesses. In this paper, we show that Moon et al.'s scheme is vulnerable to insider attack, server spoofing attack, user impersonation attack and guessing attack. Furthermore, we propose a robust anonymous multi-server authentication scheme using public key encryption to remove the aforementioned problems. From the subsequent formal and informal security analysis, we demonstrate that our proposed scheme provides strong mutual authentication and satisfies the desirable security requirements. The functional and performance analysis shows that the improved scheme has the best secure functionality and is computational efficient.

An Efficient Quantum Somewhat Homomorphic Symmetric Searchable Encryption

NASA Astrophysics Data System (ADS)

Sun, Xiaoqiang; Wang, Ting; Sun, Zhiwei; Wang, Ping; Yu, Jianping; Xie, Weixin

2017-04-01

In 2009, Gentry first introduced an ideal lattices fully homomorphic encryption (FHE) scheme. Later, based on the approximate greatest common divisor problem, learning with errors problem or learning with errors over rings problem, FHE has developed rapidly, along with the low efficiency and computational security. Combined with quantum mechanics, Liang proposed a symmetric quantum somewhat homomorphic encryption (QSHE) scheme based on quantum one-time pad, which is unconditional security. And it was converted to a quantum fully homomorphic encryption scheme, whose evaluation algorithm is based on the secret key. Compared with Liang's QSHE scheme, we propose a more efficient QSHE scheme for classical input states with perfect security, which is used to encrypt the classical message, and the secret key is not required in the evaluation algorithm. Furthermore, an efficient symmetric searchable encryption (SSE) scheme is constructed based on our QSHE scheme. SSE is important in the cloud storage, which allows users to offload search queries to the untrusted cloud. Then the cloud is responsible for returning encrypted files that match search queries (also encrypted), which protects users' privacy.

Hierarchical self-assembly: Self-organized nanostructures in a nematically ordered matrix of self-assembled polymeric chains

NASA Astrophysics Data System (ADS)

Mubeena, Shaikh; Chatterji, Apratim

2015-03-01

We report many different nanostructures which are formed when model nanoparticles of different sizes (diameter σn) are allowed to aggregate in a background matrix of semiflexible self-assembled polymeric wormlike micellar chains. The different nanostructures are formed by the dynamical arrest of phase-separating mixtures of micellar monomers and nanoparticles. The different morphologies obtained are the result of an interplay of the available free volume, the elastic energy of deformation of polymers, the density (chemical potential) of the nanoparticles in the polymer matrix, and, of course, the ratio of the size of self-assembling nanoparticles and self-avoidance diameter of polymeric chains. We have used a hybrid semi-grand-canonical Monte Carlo simulation scheme to obtain the (nonequilibrium) phase diagram of the self-assembled nanostructures. We observe rodlike structures of nanoparticles which get self-assembled in the gaps between the nematically ordered chains, as well as percolating gel-like network of conjoined nanotubes. We also find a totally unexpected interlocked crystalline phase of nanoparticles and monomers, in which each crystal plane of nanoparticles is separated by planes of perfectly organized polymer chains. We identified the condition which leads to such interlocked crystal structure. We suggest experimental possibilities of how the results presented in this paper could be used to obtain different nanostructures in the laboratory.

A Quantum Multi-proxy Blind Signature Scheme Based on Genuine Four-Qubit Entangled State

NASA Astrophysics Data System (ADS)

Tian, Juan-Hong; Zhang, Jian-Zhong; Li, Yan-Ping

2016-02-01

In this paper, we propose a multi-proxy blind signature scheme based on controlled teleportation. Genuine four-qubit entangled state functions as quantum channel. The scheme uses the physical characteristics of quantum mechanics to implement delegation, signature and verification. The security analysis shows the scheme satisfies the security features of multi-proxy signature, unforgeability, undeniability, blindness and unconditional security.

Photon statistics of shot noise measured using a Josephson parametric amplifier

NASA Astrophysics Data System (ADS)

Simoneau, Jean Olivier; Virally, Stéphane; Lupien, Christian; Reulet, Bertrand

2015-03-01

Quantum measurements are very sensitive to external noise sources. Such measurements require careful amplification chain design so as not to overwhelm the signal with extraneous noise. A quantum-limited amplifier, like the Josephson parametric amplifier (paramp), is thus an ideal candidate for this purpose. We used a paramp to investigate the quantum noise of a tunnel junction. This measurement scheme allowed us to improve upon previous observations of shot noise by an order of magnitude in terms of noise temperature. With this setup, we have measured the second and fourth cumulants of current fluctuations generated by the tunnel junction within a 40 MHz bandwidth around 6 GHz. From theses measurements, we deduce the variance of the photon number fluctuations for various bias schemes of the junction. In particular, we investigate the regime where the junction emits pairs of photons.

A multihop key agreement scheme for wireless ad hoc networks based on channel characteristics.

PubMed

Hao, Zhuo; Zhong, Sheng; Yu, Nenghai

2013-01-01

A number of key agreement schemes based on wireless channel characteristics have been proposed recently. However, previous key agreement schemes require that two nodes which need to agree on a key are within the communication range of each other. Hence, they are not suitable for multihop wireless networks, in which nodes do not always have direct connections with each other. In this paper, we first propose a basic multihop key agreement scheme for wireless ad hoc networks. The proposed basic scheme is resistant to external eavesdroppers. Nevertheless, this basic scheme is not secure when there exist internal eavesdroppers or Man-in-the-Middle (MITM) adversaries. In order to cope with these adversaries, we propose an improved multihop key agreement scheme. We show that the improved scheme is secure against internal eavesdroppers and MITM adversaries in a single path. Both performance analysis and simulation results demonstrate that the improved scheme is efficient. Consequently, the improved key agreement scheme is suitable for multihop wireless ad hoc networks.

A Multihop Key Agreement Scheme for Wireless Ad Hoc Networks Based on Channel Characteristics

PubMed Central

Yu, Nenghai

2013-01-01

A number of key agreement schemes based on wireless channel characteristics have been proposed recently. However, previous key agreement schemes require that two nodes which need to agree on a key are within the communication range of each other. Hence, they are not suitable for multihop wireless networks, in which nodes do not always have direct connections with each other. In this paper, we first propose a basic multihop key agreement scheme for wireless ad hoc networks. The proposed basic scheme is resistant to external eavesdroppers. Nevertheless, this basic scheme is not secure when there exist internal eavesdroppers or Man-in-the-Middle (MITM) adversaries. In order to cope with these adversaries, we propose an improved multihop key agreement scheme. We show that the improved scheme is secure against internal eavesdroppers and MITM adversaries in a single path. Both performance analysis and simulation results demonstrate that the improved scheme is efficient. Consequently, the improved key agreement scheme is suitable for multihop wireless ad hoc networks. PMID:23766725

Comparison of two SVD-based color image compression schemes.

PubMed

Li, Ying; Wei, Musheng; Zhang, Fengxia; Zhao, Jianli

2017-01-01

Color image compression is a commonly used process to represent image data as few bits as possible, which removes redundancy in the data while maintaining an appropriate level of quality for the user. Color image compression algorithms based on quaternion are very common in recent years. In this paper, we propose a color image compression scheme, based on the real SVD, named real compression scheme. First, we form a new real rectangular matrix C according to the red, green and blue components of the original color image and perform the real SVD for C. Then we select several largest singular values and the corresponding vectors in the left and right unitary matrices to compress the color image. We compare the real compression scheme with quaternion compression scheme by performing quaternion SVD using the real structure-preserving algorithm. We compare the two schemes in terms of operation amount, assignment number, operation speed, PSNR and CR. The experimental results show that with the same numbers of selected singular values, the real compression scheme offers higher CR, much less operation time, but a little bit smaller PSNR than the quaternion compression scheme. When these two schemes have the same CR, the real compression scheme shows more prominent advantages both on the operation time and PSNR.

Comparison of two SVD-based color image compression schemes

PubMed Central

Li, Ying; Wei, Musheng; Zhang, Fengxia; Zhao, Jianli

2017-01-01

Color image compression is a commonly used process to represent image data as few bits as possible, which removes redundancy in the data while maintaining an appropriate level of quality for the user. Color image compression algorithms based on quaternion are very common in recent years. In this paper, we propose a color image compression scheme, based on the real SVD, named real compression scheme. First, we form a new real rectangular matrix C according to the red, green and blue components of the original color image and perform the real SVD for C. Then we select several largest singular values and the corresponding vectors in the left and right unitary matrices to compress the color image. We compare the real compression scheme with quaternion compression scheme by performing quaternion SVD using the real structure-preserving algorithm. We compare the two schemes in terms of operation amount, assignment number, operation speed, PSNR and CR. The experimental results show that with the same numbers of selected singular values, the real compression scheme offers higher CR, much less operation time, but a little bit smaller PSNR than the quaternion compression scheme. When these two schemes have the same CR, the real compression scheme shows more prominent advantages both on the operation time and PSNR. PMID:28257451

A Target Coverage Scheduling Scheme Based on Genetic Algorithms in Directional Sensor Networks

PubMed Central

Gil, Joon-Min; Han, Youn-Hee

2011-01-01

As a promising tool for monitoring the physical world, directional sensor networks (DSNs) consisting of a large number of directional sensors are attracting increasing attention. As directional sensors in DSNs have limited battery power and restricted angles of sensing range, maximizing the network lifetime while monitoring all the targets in a given area remains a challenge. A major technique to conserve the energy of directional sensors is to use a node wake-up scheduling protocol by which some sensors remain active to provide sensing services, while the others are inactive to conserve their energy. In this paper, we first address a Maximum Set Covers for DSNs (MSCD) problem, which is known to be NP-complete, and present a greedy algorithm-based target coverage scheduling scheme that can solve this problem by heuristics. This scheme is used as a baseline for comparison. We then propose a target coverage scheduling scheme based on a genetic algorithm that can find the optimal cover sets to extend the network lifetime while monitoring all targets by the evolutionary global search technique. To verify and evaluate these schemes, we conducted simulations and showed that the schemes can contribute to extending the network lifetime. Simulation results indicated that the genetic algorithm-based scheduling scheme had better performance than the greedy algorithm-based scheme in terms of maximizing network lifetime. PMID:22319387

Could the employment-based targeting approach serve Egypt in moving towards a social health insurance model?

PubMed

Shawky, S

2010-06-01

The current health insurance system in Egypt targets the productive population through an employment-based scheme bounded by a cost ceiling and focusing on curative care. Egypt Social Contract Survey data from 2005 were used to evaluate the impact of the employment-based scheme on health system accessibility and financing. Only 22.8% of the population in the productive age range (19-59 years) benefited from any health insurance scheme. The employment-based scheme covered 39.3% of the working population and was skewed towards urban areas, older people, females and the wealthier. It did not increase service utilization, but reduced out-of-pocket expenditure. Egypt should blend all health insurance schemes and adopt an innovative approach to reach universal coverage.

Quantum attack-resistent certificateless multi-receiver signcryption scheme.

PubMed

Li, Huixian; Chen, Xubao; Pang, Liaojun; Shi, Weisong

2013-01-01

The existing certificateless signcryption schemes were designed mainly based on the traditional public key cryptography, in which the security relies on the hard problems, such as factor decomposition and discrete logarithm. However, these problems will be easily solved by the quantum computing. So the existing certificateless signcryption schemes are vulnerable to the quantum attack. Multivariate public key cryptography (MPKC), which can resist the quantum attack, is one of the alternative solutions to guarantee the security of communications in the post-quantum age. Motivated by these concerns, we proposed a new construction of the certificateless multi-receiver signcryption scheme (CLMSC) based on MPKC. The new scheme inherits the security of MPKC, which can withstand the quantum attack. Multivariate quadratic polynomial operations, which have lower computation complexity than bilinear pairing operations, are employed in signcrypting a message for a certain number of receivers in our scheme. Security analysis shows that our scheme is a secure MPKC-based scheme. We proved its security under the hardness of the Multivariate Quadratic (MQ) problem and its unforgeability under the Isomorphism of Polynomials (IP) assumption in the random oracle model. The analysis results show that our scheme also has the security properties of non-repudiation, perfect forward secrecy, perfect backward secrecy and public verifiability. Compared with the existing schemes in terms of computation complexity and ciphertext length, our scheme is more efficient, which makes it suitable for terminals with low computation capacity like smart cards.

A splitting scheme based on the space-time CE/SE method for solving multi-dimensional hydrodynamical models of semiconductor devices

NASA Astrophysics Data System (ADS)

Nisar, Ubaid Ahmed; Ashraf, Waqas; Qamar, Shamsul

2016-08-01

Numerical solutions of the hydrodynamical model of semiconductor devices are presented in one and two-space dimension. The model describes the charge transport in semiconductor devices. Mathematically, the models can be written as a convection-diffusion type system with a right hand side describing the relaxation effects and interaction with a self consistent electric field. The proposed numerical scheme is a splitting scheme based on the conservation element and solution element (CE/SE) method for hyperbolic step, and a semi-implicit scheme for the relaxation step. The numerical results of the suggested scheme are compared with the splitting scheme based on Nessyahu-Tadmor (NT) central scheme for convection step and the same semi-implicit scheme for the relaxation step. The effects of various parameters such as low field mobility, device length, lattice temperature and voltages for one-space dimensional hydrodynamic model are explored to further validate the generic applicability of the CE/SE method for the current model equations. A two dimensional simulation is also performed by CE/SE method for a MESFET device, producing results in good agreement with those obtained by NT-central scheme.

An enhanced biometric-based authentication scheme for telecare medicine information systems using elliptic curve cryptosystem.

PubMed

Lu, Yanrong; Li, Lixiang; Peng, Haipeng; Yang, Yixian

2015-03-01

The telecare medical information systems (TMISs) enable patients to conveniently enjoy telecare services at home. The protection of patient's privacy is a key issue due to the openness of communication environment. Authentication as a typical approach is adopted to guarantee confidential and authorized interaction between the patient and remote server. In order to achieve the goals, numerous remote authentication schemes based on cryptography have been presented. Recently, Arshad et al. (J Med Syst 38(12): 2014) presented a secure and efficient three-factor authenticated key exchange scheme to remedy the weaknesses of Tan et al.'s scheme (J Med Syst 38(3): 2014). In this paper, we found that once a successful off-line password attack that results in an adversary could impersonate any user of the system in Arshad et al.'s scheme. In order to thwart these security attacks, an enhanced biometric and smart card based remote authentication scheme for TMISs is proposed. In addition, the BAN logic is applied to demonstrate the completeness of the enhanced scheme. Security and performance analyses show that our enhanced scheme satisfies more security properties and less computational cost compared with previously proposed schemes.

Cryptanalysis of Chatterjee-Sarkar Hierarchical Identity-Based Encryption Scheme at PKC 06

NASA Astrophysics Data System (ADS)

Park, Jong Hwan; Lee, Dong Hoon

In 2006, Chatterjee and Sarkar proposed a hierarchical identity-based encryption (HIBE) scheme which can support an unbounded number of identity levels. This property is particularly useful in providing forward secrecy by embedding time components within hierarchical identities. In this paper we show that their scheme does not provide the claimed property. Our analysis shows that if the number of identity levels becomes larger than the value of a fixed public parameter, an unintended receiver can reconstruct a new valid ciphertext and decrypt the ciphertext using his or her own private key. The analysis is similarly applied to a multi-receiver identity-based encryption scheme presented as an application of Chatterjee and Sarkar's HIBE scheme.

Algorithms for adaptive stochastic control for a class of linear systems

NASA Technical Reports Server (NTRS)

Toda, M.; Patel, R. V.

1977-01-01

Control of linear, discrete time, stochastic systems with unknown control gain parameters is discussed. Two suboptimal adaptive control schemes are derived: one is based on underestimating future control and the other is based on overestimating future control. Both schemes require little on-line computation and incorporate in their control laws some information on estimation errors. The performance of these laws is studied by Monte Carlo simulations on a computer. Two single input, third order systems are considered, one stable and the other unstable, and the performance of the two adaptive control schemes is compared with that of the scheme based on enforced certainty equivalence and the scheme where the control gain parameters are known.

Efficient Fair Exchange from Identity-Based Signature

NASA Astrophysics Data System (ADS)

Yum, Dae Hyun; Lee, Pil Joong

A fair exchange scheme is a protocol by which two parties Alice and Bob exchange items or services without allowing either party to gain advantages by quitting prematurely or otherwise misbehaving. To this end, modern cryptographic solutions use a semi-trusted arbitrator who involves only in cases where one party attempts to cheat or simply crashes. We call such a fair exchange scheme optimistic. When no registration is required between the signer and the arbitrator, we say that the fair exchange scheme is setup free. To date, the setup-free optimist fair exchange scheme under the standard RSA assumption was only possible from the generic construction of [12], which uses ring signatures. In this paper, we introduce a new setup-free optimistic fair exchange scheme under the standard RSA assumption. Our scheme uses the GQ identity-based signature and is more efficient than [12]. The construction can also be generalized by using various identity-based signature schemes. Our main technique is to allow each user to choose his (or her) own “random” public key in the identitybased signature scheme.

Genetic and economic evaluation of Japanese Black (Wagyu) cattle breeding schemes.

PubMed

Kahi, A K; Hirooka, H

2005-09-01

Deterministic simulation was used to evaluate 10 breeding schemes for genetic gain and profitability and in the context of maximizing returns from investment in Japanese Black cattle breeding. A breeding objective that integrated the cow-calf and feedlot segments was considered. Ten breeding schemes that differed in the records available for use as selection criteria were defined. The schemes ranged from one that used carcass traits currently available to Japanese Black cattle breeders (Scheme 1) to one that also included linear measurements and male and female reproduction traits (Scheme 10). The latter scheme represented the highest level of performance recording. In all breeding schemes, sires were chosen from the proportion selected during the first selection stage (performance testing), modeling a two-stage selection process. The effect on genetic gain and profitability of varying test capacity and number of progeny per sire and of ultrasound scanning of live animals was examined for all breeding schemes. Breeding schemes that selected young bulls during performance testing based on additional individual traits and information on carcass traits from their relatives generated additional genetic gain and profitability. Increasing test capacity resulted in an increase in genetic gain in all schemes. Profitability was optimal in Scheme 2 (a scheme similar to Scheme 1, but selection of young bulls also was based on information on carcass traits from their relatives) to 10 when 900 to 1,000 places were available for performance testing. Similarly, as the number of progeny used in the selection of sires increased, genetic gain first increased sharply and then gradually in all schemes. Profit was optimal across all breeding schemes when sires were selected based on information from 150 to 200 progeny. Additional genetic gain and profitability were generated in each breeding scheme with ultrasound scanning of live animals for carcass traits. Ultrasound scanning of live animals was more important than the addition of any other traits in the selection criteria. These results may be used to provide guidance to Japanese Black cattle breeders.

A secure and robust password-based remote user authentication scheme using smart cards for the integrated EPR information system.

PubMed

Das, Ashok Kumar

2015-03-01

An integrated EPR (Electronic Patient Record) information system of all the patients provides the medical institutions and the academia with most of the patients' information in details for them to make corrective decisions and clinical decisions in order to maintain and analyze patients' health. In such system, the illegal access must be restricted and the information from theft during transmission over the insecure Internet must be prevented. Lee et al. proposed an efficient password-based remote user authentication scheme using smart card for the integrated EPR information system. Their scheme is very efficient due to usage of one-way hash function and bitwise exclusive-or (XOR) operations. However, in this paper, we show that though their scheme is very efficient, their scheme has three security weaknesses such as (1) it has design flaws in password change phase, (2) it fails to protect privileged insider attack and (3) it lacks the formal security verification. We also find that another recently proposed Wen's scheme has the same security drawbacks as in Lee at al.'s scheme. In order to remedy these security weaknesses found in Lee et al.'s scheme and Wen's scheme, we propose a secure and efficient password-based remote user authentication scheme using smart cards for the integrated EPR information system. We show that our scheme is also efficient as compared to Lee et al.'s scheme and Wen's scheme as our scheme only uses one-way hash function and bitwise exclusive-or (XOR) operations. Through the security analysis, we show that our scheme is secure against possible known attacks. Furthermore, we simulate our scheme for the formal security verification using the widely-accepted AVISPA (Automated Validation of Internet Security Protocols and Applications) tool and show that our scheme is secure against passive and active attacks.

Construction of Low Dissipative High Order Well-Balanced Filter Schemes for Non-Equilibrium Flows

NASA Technical Reports Server (NTRS)

Wang, Wei; Yee, H. C.; Sjogreen, Bjorn; Magin, Thierry; Shu, Chi-Wang

2009-01-01

The goal of this paper is to generalize the well-balanced approach for non-equilibrium flow studied by Wang et al. [26] to a class of low dissipative high order shock-capturing filter schemes and to explore more advantages of well-balanced schemes in reacting flows. The class of filter schemes developed by Yee et al. [30], Sjoegreen & Yee [24] and Yee & Sjoegreen [35] consist of two steps, a full time step of spatially high order non-dissipative base scheme and an adaptive nonlinear filter containing shock-capturing dissipation. A good property of the filter scheme is that the base scheme and the filter are stand alone modules in designing. Therefore, the idea of designing a well-balanced filter scheme is straightforward, i.e., choosing a well-balanced base scheme with a well-balanced filter (both with high order). A typical class of these schemes shown in this paper is the high order central difference schemes/predictor-corrector (PC) schemes with a high order well-balanced WENO filter. The new filter scheme with the well-balanced property will gather the features of both filter methods and well-balanced properties: it can preserve certain steady state solutions exactly; it is able to capture small perturbations, e.g., turbulence fluctuations; it adaptively controls numerical dissipation. Thus it shows high accuracy, efficiency and stability in shock/turbulence interactions. Numerical examples containing 1D and 2D smooth problems, 1D stationary contact discontinuity problem and 1D turbulence/shock interactions are included to verify the improved accuracy, in addition to the well-balanced behavior.

A Secure ECC-based RFID Mutual Authentication Protocol to Enhance Patient Medication Safety.

PubMed

Jin, Chunhua; Xu, Chunxiang; Zhang, Xiaojun; Li, Fagen

2016-01-01

Patient medication safety is an important issue in patient medication systems. In order to prevent medication errors, integrating Radio Frequency Identification (RFID) technology into automated patient medication systems is required in hospitals. Based on RFID technology, such systems can provide medical evidence for patients' prescriptions and medicine doses, etc. Due to the mutual authentication between the medication server and the tag, RFID authentication scheme is the best choice for automated patient medication systems. In this paper, we present a RFID mutual authentication scheme based on elliptic curve cryptography (ECC) to enhance patient medication safety. Our scheme can achieve security requirements and overcome various attacks existing in other schemes. In addition, our scheme has better performance in terms of computational cost and communication overhead. Therefore, the proposed scheme is well suitable for patient medication systems.

The influence of sodium lauryl sulfate on the crystal phases of titania by hydrothermal method

NASA Astrophysics Data System (ADS)

Liu, Chaohong; Wang, Xin

2012-11-01

In this paper, we prepared TiO2 nanostructures by a hydrothermal method and investigated the influence of the SO4^{2-} ion and the effect of long alkyl chains of sodium dodecyl sulfate on the crystal phases of TiO2 by experiments and theoretical calculations. The results indicate that the absorption of the H+HSO4 fragment on rutile (110) is more stable than that of the 2H+SO4 fragment and more favorable to the formation of anatase. The absorption and steric effects of sodium dodecyl sulfate on the surfaces of TiO2 grains also have an important influence on the formation of mixed crystals by changing the speed and the way of octahedral TiO6 units combining. Based on the above facts, we revised the original reaction scheme for crystalline titania formation by previous authors.

A Chain of Modeling Tools For Gas and Aqueous Phase Chemstry

NASA Astrophysics Data System (ADS)

Audiffren, N.; Djouad, R.; Sportisse, B.

Atmospheric chemistry is characterized by the use of large set of chemical species and reactions. Handling with the set of data required for the definition of the model is a quite difficult task. We prsent in this short article a preprocessor for diphasic models (gas phase and aqueous phase in cloud droplets) named SPACK. The main interest of SPACK is the automatic generation of lumped species related to fast equilibria. We also developped a linear tangent model using the automatic differentiation tool named ODYSSEE in order to perform a sensitivity analysis of an atmospheric multi- phase mechanism based on RADM2 kinetic scheme.Local sensitivity coefficients are computed for two different scenarii. We focus in this study on the sensitivity of the ozone,NOx,HOx, system with respect to some aqueous phase reactions and we inves- tigate the influence of the reduction in the photolysis rates in the area below the cloud region.

Modeling scintillator and WLS fiber signals for fast Monte Carlo simulations

NASA Astrophysics Data System (ADS)

Sánchez, F. A.; Medina-Tanco, G.

2010-08-01

In this work we present a fast, robust and flexible procedure to simulate electronic signals of scintillator units: plastic scintillator material embedded with a wavelength shifter optical fiber coupled to a photo-multiplier tube which, in turn, is plugged to a front-end electronic board. The simple rationale behind the simulation chain allows to adapt the procedure to a broad range of detectors based on that kind of units. We show that, in order to produce realistic results, the simulation parameters can be properly calibrated against laboratory measurements and used thereafter as input of the simulations. Simulated signals of atmospheric background cosmic ray muons are presented and their main features analyzed and validated using actual measured data. Conversely, for any given practical application, the present simulation scheme can be used to find an adequate combination of photo-multiplier tube and optical fiber at the prototyping stage.

Structural classification of CDR-H3 revisited: a lesson in antibody modeling.

PubMed

Kuroda, Daisuke; Shirai, Hiroki; Kobori, Masato; Nakamura, Haruki

2008-11-15

Among the six complementarity-determining regions (CDRs) in the variable domains of an antibody, the third CDR of the heavy chain (CDR-H3), which lies in the center of the antigen-binding site, plays a particularly important role in antigen recognition. CDR-H3 shows significant variability in its length, sequence, and structure. Although difficult, model building of this segment is the most critical step in antibody modeling. Since our first proposal of the "H3-rules," which classify CDR-H3 structure based on amino acid sequence, the number of experimentally determined antibody structures has increased. Here, we revise these H3-rules and propose an improved classification scheme for CDR-H3 structure modeling. In addition, we determine the common features of CDR-H3 in antibody drugs as well as discuss the concept of "antibody druggability," which can be applied as an indicator of antibody evaluation during drug discovery.

Absolute frequency measurement of a diode laser locked on a hyperfine component of 5S1/2-5D5/2 two-photon transitions of rubidium (lambda equals 778.1 nm, nu equals 385.3 THz)

NASA Astrophysics Data System (ADS)

Zondy, Jean-Jacques; Touahri, D.; Acef, Ouali; Hilico, L.; Abed, M.; Clairon, Andre; Millerioux, Yves P.; Felder, Raymond; de Beauvoir, Beatrice; Nez, Francois; Biraben, Francois; Julien, Lucile

1995-04-01

A frequency chain, derived from the one used to measure the absolute frequency ((nu) $= 473 THz) of the He-Ne/I2 optical standard, is currently being implemented in order to measure the frequency of a diode laser stabilized on the two-photon transition of rubidium vapor. The measurement scheme is based on the comparison of the frequency of this near-IR potential secondary standard to the 13th harmonic frequency of the R(12)-CO2/OsO4 LPTF secondary standard at (nu) equals 29.096 THz. Recent results on the frequency synthesis are reported, enabling the testing of long-term stability of this Rb-locked system with respect to the IR reference standard.

Impact of Pathogen Population Heterogeneity and Stress-Resistant Variants on Food Safety.

PubMed

Abee, T; Koomen, J; Metselaar, K I; Zwietering, M H; den Besten, H M W

2016-01-01

This review elucidates the state-of-the-art knowledge about pathogen population heterogeneity and describes the genotypic and phenotypic analyses of persister subpopulations and stress-resistant variants. The molecular mechanisms underlying the generation of persister phenotypes and genetic variants are identified. Zooming in on Listeria monocytogenes, a comparative whole-genome sequence analysis of wild types and variants that enabled the identification of mutations in variants obtained after a single exposure to lethal food-relevant stresses is described. Genotypic and phenotypic features are compared to those for persistent strains isolated from food processing environments. Inactivation kinetics, models used for fitting, and the concept of kinetic modeling-based schemes for detection of variants are presented. Furthermore, robustness and fitness parameters of L. monocytogenes wild type and variants are used to model their performance in food chains. Finally, the impact of stress-resistant variants and persistence in food processing environments on food safety is discussed.

New isomer in 96Y marking the onset of deformation at N = 57

NASA Astrophysics Data System (ADS)

Iskra, Ł. W.; Fornal, B.; Leoni, S.; Bocchi, G.; Petrovici, A.; Porzio, C.; Blanc, A.; De France, G.; Jentschel, M.; Köster, U.; Mutti, P.; Régis, J.-M.; Simpson, G.; Soldner, T.; Ur, C. A.; Urban, W.; Bazzacco, D.; Benzoni, G.; Bottoni, S.; Bruce, A.; Cieplicka-Oryńczak, N.; Crespi, F. C. L.; Fraile, L. M.; Korten, W.; Kröll, T.; Lalkovski, S.; Márginean, N.; Michelagnoli, C.; Melon, B.; Mengoni, D.; Million, B.; Nannini, A.; Napoli, D.; Podolyák, Zs.; Regan, P. H.; Szpak, B.

2017-01-01

The level scheme of 96Y was significantly extended and a new 201 ns isomer was located at 1655 keV excitation energy, with spin-parity assignment of 5± or 6-. The isomer decays to spherical low-spin structure by transitions with large hindrance and is fed by a short cascade which resembles the beginning of a rotational band. This is in analogy with the feeding and decay pattern of the 4- isomer in 98Y, here confirmed, by lifetime analysis, as a bandhead of a rotational structure with sizable deformation. It is suggested that the new isomer in 96Y arises from a shape change between deformed and spherical configurations, which indicates the appearance of deformation already at N = 57 in the yttrium chain. The experimental findings for 96Y are strengthened by theoretical calculations based on the complex Excited Vampir model.

Development of a PCR/LDR/flow-through hybridization assay using a capillary tube, probe DNA-immobilized magnetic beads and chemiluminescence detection.

PubMed

Hommatsu, Manami; Okahashi, Hisamitsu; Ohta, Keisuke; Tamai, Yusuke; Tsukagoshi, Kazuhiko; Hashimoto, Masahiko

2013-01-01

A polymerase chain reaction (PCR)/ligase detection reaction (LDR)/flow-through hybridization assay using chemiluminescence (CL) detection was developed for analyzing point mutations in gene fragments with high diagnostic value for colorectal cancers. A flow-through hybridization format using a capillary tube, in which probe DNA-immobilized magnetic beads were packed, provided accelerated hybridization kinetics of target DNA (i.e. LDR product) to the probe DNA. Simple fluid manipulations enabled both allele-specific hybridization and the removal of non-specifically bound DNA in the wash step. Furthermore, the use of CL detection greatly simplified the detection scheme, since CL does not require a light source for excitation of the fluorescent dye tags on the LDR products. Preliminary results demonstrated that this analytical system could detect both homozygous and heterozygous mutations, without the expensive instrumentation and cumbersome procedures required by conventional DNA microarray-based methods.

Improving activity recognition using temporal coherence.

PubMed

Ataya, Abbas; Jallon, Pierre; Bianchi, Pascal; Doron, Maeva

2013-01-01

Assessment of daily physical activity using data from wearable sensors has recently become a prominent research area in the biomedical engineering field and a substantial application for pattern recognition. In this paper, we present an accelerometer-based activity recognition scheme on the basis of a hierarchical structured classifier. A first step consists of distinguishing static activities from dynamic ones in order to extract relevant features for each activity type. Next, a separate classifier is applied to detect more specific activities of the same type. On top of our activity recognition system, we introduce a novel approach to take into account the temporal coherence of activities. Inter-activity transition information is modeled by a directed graph Markov chain. Confidence measures in activity classes are then evaluated from conventional classifier's outputs and coupled with the graph to reinforce activity estimation. Accurate results and significant improvement of activity detection are obtained when applying our system for the recognition of 9 activities for 48 subjects.

Optimal clinical trial design based on a dichotomous Markov-chain mixed-effect sleep model.

PubMed

Steven Ernest, C; Nyberg, Joakim; Karlsson, Mats O; Hooker, Andrew C

2014-12-01

D-optimal designs for discrete-type responses have been derived using generalized linear mixed models, simulation based methods and analytical approximations for computing the fisher information matrix (FIM) of non-linear mixed effect models with homogeneous probabilities over time. In this work, D-optimal designs using an analytical approximation of the FIM for a dichotomous, non-homogeneous, Markov-chain phase advanced sleep non-linear mixed effect model was investigated. The non-linear mixed effect model consisted of transition probabilities of dichotomous sleep data estimated as logistic functions using piecewise linear functions. Theoretical linear and nonlinear dose effects were added to the transition probabilities to modify the probability of being in either sleep stage. D-optimal designs were computed by determining an analytical approximation the FIM for each Markov component (one where the previous state was awake and another where the previous state was asleep). Each Markov component FIM was weighted either equally or by the average probability of response being awake or asleep over the night and summed to derive the total FIM (FIM(total)). The reference designs were placebo, 0.1, 1-, 6-, 10- and 20-mg dosing for a 2- to 6-way crossover study in six dosing groups. Optimized design variables were dose and number of subjects in each dose group. The designs were validated using stochastic simulation/re-estimation (SSE). Contrary to expectations, the predicted parameter uncertainty obtained via FIM(total) was larger than the uncertainty in parameter estimates computed by SSE. Nevertheless, the D-optimal designs decreased the uncertainty of parameter estimates relative to the reference designs. Additionally, the improvement for the D-optimal designs were more pronounced using SSE than predicted via FIM(total). Through the use of an approximate analytic solution and weighting schemes, the FIM(total) for a non-homogeneous, dichotomous Markov-chain phase advanced sleep model was computed and provided more efficient trial designs and increased nonlinear mixed-effects modeling parameter precision.

Automatic detection of sweep-meshable volumes

DOEpatents

Tautges,; Timothy J. , White; David, R [Pittsburgh, PA

2006-05-23

A method of and software for automatically determining whether a mesh can be generated by sweeping for a representation of a geometric solid comprising: classifying surface mesh schemes for surfaces of the representation locally using surface vertex types; grouping mappable and submappable surfaces of the representation into chains; computing volume edge types for the representation; recursively traversing surfaces of the representation and grouping the surfaces into source, target, and linking surface lists; and checking traversal direction when traversing onto linking surfaces.

Large scale shell model study of nuclear spectroscopy in nuclei around 132Sn

NASA Astrophysics Data System (ADS)

Lo Iudice, N.; Bianco, D.; Andreozzi, F.; Porrino, A.; Knapp, F.

2012-10-01

The properties of low-lying 2+ states in chains of nuclei in the proximity of the magic number N=82 are investigated within a new shell model approach exploiting an iterative algorithm alternative to Lanczos. The calculation yields levels and transition strengths in overall good agreement with experiments. The comparative analysis of the E2 and M1 transitions supports, in many cases, the scheme provided by the interacting boson model.

Energy-efficient writing scheme for magnetic domain-wall motion memory

NASA Astrophysics Data System (ADS)

Kim, Kab-Jin; Yoshimura, Yoko; Ham, Woo Seung; Ernst, Rick; Hirata, Yuushou; Li, Tian; Kim, Sanghoon; Moriyama, Takahiro; Nakatani, Yoshinobu; Ono, Teruo

2017-04-01

We present an energy-efficient magnetic domain-writing scheme for domain wall (DW) motion-based memory devices. A cross-shaped nanowire is employed to inject a domain into the nanowire through current-induced DW propagation. The energy required for injecting the magnetic domain is more than one order of magnitude lower than that for the conventional field-based writing scheme. The proposed scheme is beneficial for device miniaturization because the threshold current for DW propagation scales with the device size, which cannot be achieved in the conventional field-based technique.

A quantum proxy group signature scheme based on an entangled five-qubit state

NASA Astrophysics Data System (ADS)

Wang, Meiling; Ma, Wenping; Wang, Lili; Yin, Xunru

2015-09-01

A quantum proxy group signature (QPGS) scheme based on controlled teleportation is presented, by using the entangled five-qubit quantum state functions as quantum channel. The scheme uses the physical characteristics of quantum mechanics to implement delegation, signature and verification. The security of the scheme is guaranteed by the entanglement correlations of the entangled five-qubit state, the secret keys based on the quantum key distribution (QKD) and the one-time pad algorithm, all of which have been proven to be unconditionally secure and the signature anonymity.

ICE CONTROL - Towards optimizing wind energy production during icing events

NASA Astrophysics Data System (ADS)

Dorninger, Manfred; Strauss, Lukas; Serafin, Stefano; Beck, Alexander; Wittmann, Christoph; Weidle, Florian; Meier, Florian; Bourgeois, Saskia; Cattin, René; Burchhart, Thomas; Fink, Martin

2017-04-01

Forecasts of wind power production loss caused by icing weather conditions are produced by a chain of physical models. The model chain consists of a numerical weather prediction model, an icing model and a production loss model. Each element of the model chain is affected by significant uncertainty, which can be quantified using targeted observations and a probabilistic forecasting approach. In this contribution, we present preliminary results from the recently launched project ICE CONTROL, an Austrian research initiative on measurements, probabilistic forecasting, and verification of icing on wind turbine blades. ICE CONTROL includes an experimental field phase, consisting of measurement campaigns in a wind park in Rhineland-Palatinate, Germany, in the winters 2016/17 and 2017/18. Instruments deployed during the campaigns consist of a conventional icing detector on the turbine hub and newly devised ice sensors (eologix Sensor System) on the turbine blades, as well as meteorological sensors for wind, temperature, humidity, visibility, and precipitation type and spectra. Liquid water content and spectral characteristics of super-cooled water droplets are measured using a Fog Monitor FM-120. Three cameras document the icing conditions on the instruments and on the blades. Different modelling approaches are used to quantify the components of the model-chain uncertainties. The uncertainty related to the initial conditions of the weather prediction is evaluated using the existing global ensemble prediction system (EPS) of the European Centre for Medium-Range Weather Forecasts (ECMWF). Furthermore, observation system experiments are conducted with the AROME model and its 3D-Var data assimilation to investigate the impact of additional observations (such as Mode-S aircraft data, SCADA data and MSG cloud mask initialization) on the numerical icing forecast. The uncertainty related to model formulation is estimated from multi-physics ensembles based on the Weather Research and Forecasting model (WRF) by perturbing parameters in the physical parameterization schemes. In addition, uncertainties of the icing model and of its adaptations to the rotating turbine blade are addressed. The model forecasts combined with the suite of instruments and their measurements make it possible to conduct a step-wise verification of all the components of the model chain - a novel aspect compared to similar ongoing and completed forecasting projects.

Real-time projections of cholera outbreaks through data assimilation and rainfall forecasting

NASA Astrophysics Data System (ADS)

Pasetto, Damiano; Finger, Flavio; Rinaldo, Andrea; Bertuzzo, Enrico

2017-10-01

Although treatment for cholera is well-known and cheap, outbreaks in epidemic regions still exact high death tolls mostly due to the unpreparedness of health care infrastructures to face unforeseen emergencies. In this context, mathematical models for the prediction of the evolution of an ongoing outbreak are of paramount importance. Here, we test a real-time forecasting framework that readily integrates new information as soon as available and periodically issues an updated forecast. The spread of cholera is modeled by a spatially-explicit scheme that accounts for the dynamics of susceptible, infected and recovered individuals hosted in different local communities connected through hydrologic and human mobility networks. The framework presents two major innovations for cholera modeling: the use of a data assimilation technique, specifically an ensemble Kalman filter, to update both state variables and parameters based on the observations, and the use of rainfall forecasts to force the model. The exercise of simulating the state of the system and the predictive capabilities of the novel tools, set at the initial phase of the 2010 Haitian cholera outbreak using only information that was available at that time, serves as a benchmark. Our results suggest that the assimilation procedure with the sequential update of the parameters outperforms calibration schemes based on Markov chain Monte Carlo. Moreover, in a forecasting mode the model usefully predicts the spatial incidence of cholera at least one month ahead. The performance decreases for longer time horizons yet allowing sufficient time to plan for deployment of medical supplies and staff, and to evaluate alternative strategies of emergency management.

Assessing an ensemble Kalman filter inference of Manning's n coefficient of an idealized tidal inlet against a polynomial chaos-based MCMC

NASA Astrophysics Data System (ADS)

Siripatana, Adil; Mayo, Talea; Sraj, Ihab; Knio, Omar; Dawson, Clint; Le Maitre, Olivier; Hoteit, Ibrahim

2017-08-01

Bayesian estimation/inversion is commonly used to quantify and reduce modeling uncertainties in coastal ocean model, especially in the framework of parameter estimation. Based on Bayes rule, the posterior probability distribution function (pdf) of the estimated quantities is obtained conditioned on available data. It can be computed either directly, using a Markov chain Monte Carlo (MCMC) approach, or by sequentially processing the data following a data assimilation approach, which is heavily exploited in large dimensional state estimation problems. The advantage of data assimilation schemes over MCMC-type methods arises from the ability to algorithmically accommodate a large number of uncertain quantities without significant increase in the computational requirements. However, only approximate estimates are generally obtained by this approach due to the restricted Gaussian prior and noise assumptions that are generally imposed in these methods. This contribution aims at evaluating the effectiveness of utilizing an ensemble Kalman-based data assimilation method for parameter estimation of a coastal ocean model against an MCMC polynomial chaos (PC)-based scheme. We focus on quantifying the uncertainties of a coastal ocean ADvanced CIRCulation (ADCIRC) model with respect to the Manning's n coefficients. Based on a realistic framework of observation system simulation experiments (OSSEs), we apply an ensemble Kalman filter and the MCMC method employing a surrogate of ADCIRC constructed by a non-intrusive PC expansion for evaluating the likelihood, and test both approaches under identical scenarios. We study the sensitivity of the estimated posteriors with respect to the parameters of the inference methods, including ensemble size, inflation factor, and PC order. A full analysis of both methods, in the context of coastal ocean model, suggests that an ensemble Kalman filter with appropriate ensemble size and well-tuned inflation provides reliable mean estimates and uncertainties of Manning's n coefficients compared to the full posterior distributions inferred by MCMC.

A FRACTAL-BASED STOCHASTIC INTERPOLATION SCHEME IN SUBSURFACE HYDROLOGY

EPA Science Inventory

The need for a realistic and rational method for interpolating sparse data sets is widespread. Real porosity and hydraulic conductivity data do not vary smoothly over space, so an interpolation scheme that preserves irregularity is desirable. Such a scheme based on the properties...

CP-ABE Based Privacy-Preserving User Profile Matching in Mobile Social Networks

PubMed Central

Cui, Weirong; Du, Chenglie; Chen, Jinchao

2016-01-01

Privacy-preserving profile matching, a challenging task in mobile social networks, is getting more attention in recent years. In this paper, we propose a novel scheme that is based on ciphertext-policy attribute-based encryption to tackle this problem. In our scheme, a user can submit a preference-profile and search for users with matching-profile in decentralized mobile social networks. In this process, no participant’s profile and the submitted preference-profile is exposed. Meanwhile, a secure communication channel can be established between the pair of successfully matched users. In contrast to existing related schemes which are mainly based on the secure multi-party computation, our scheme can provide verifiability (both the initiator and any unmatched user cannot cheat each other to pretend to be matched), and requires few interactions among users. We provide thorough security analysis and performance evaluation on our scheme, and show its advantages in terms of security, efficiency and usability over state-of-the-art schemes. PMID:27337001

CP-ABE Based Privacy-Preserving User Profile Matching in Mobile Social Networks.

PubMed

Cui, Weirong; Du, Chenglie; Chen, Jinchao

2016-01-01

Privacy-preserving profile matching, a challenging task in mobile social networks, is getting more attention in recent years. In this paper, we propose a novel scheme that is based on ciphertext-policy attribute-based encryption to tackle this problem. In our scheme, a user can submit a preference-profile and search for users with matching-profile in decentralized mobile social networks. In this process, no participant's profile and the submitted preference-profile is exposed. Meanwhile, a secure communication channel can be established between the pair of successfully matched users. In contrast to existing related schemes which are mainly based on the secure multi-party computation, our scheme can provide verifiability (both the initiator and any unmatched user cannot cheat each other to pretend to be matched), and requires few interactions among users. We provide thorough security analysis and performance evaluation on our scheme, and show its advantages in terms of security, efficiency and usability over state-of-the-art schemes.

Effective W-state fusion strategies for electronic and photonic qubits via the quantum-dot-microcavity coupled system.

PubMed

Han, Xue; Hu, Shi; Guo, Qi; Wang, Hong-Fu; Zhu, Ai-Dong; Zhang, Shou

2015-08-05

We propose effective fusion schemes for stationary electronic W state and flying photonic W state, respectively, by using the quantum-dot-microcavity coupled system. The present schemes can fuse a n-qubit W state and a m-qubit W state to a (m + n - 1)-qubit W state, that is, these schemes can be used to not only create large W state with small ones, but also to prepare 3-qubit W states with Bell states. The schemes are based on the optical selection rules and the transmission and reflection rules of the cavity and can be achieved with high probability. We evaluate the effect of experimental imperfections and the feasibility of the schemes, which shows that the present schemes can be realized with high fidelity in both the weak coupling and the strong coupling regimes. These schemes may be meaningful for the large-scale solid-state-based quantum computation and the photon-qubit-based quantum communication.

Revocable identity-based proxy re-signature against signing key exposure.

PubMed

Yang, Xiaodong; Chen, Chunlin; Ma, Tingchun; Wang, Jinli; Wang, Caifen

2018-01-01

Identity-based proxy re-signature (IDPRS) is a novel cryptographic primitive that allows a semi-trusted proxy to convert a signature under one identity into another signature under another identity on the same message by using a re-signature key. Due to this transformation function, IDPRS is very useful in constructing privacy-preserving schemes for various information systems. Key revocation functionality is important in practical IDPRS for managing users dynamically; however, the existing IDPRS schemes do not provide revocation mechanisms that allow the removal of misbehaving or compromised users from the system. In this paper, we first introduce a notion called revocable identity-based proxy re-signature (RIDPRS) to achieve the revocation functionality. We provide a formal definition of RIDPRS as well as its security model. Then, we present a concrete RIDPRS scheme that can resist signing key exposure and prove that the proposed scheme is existentially unforgeable against adaptive chosen identity and message attacks in the standard model. To further improve the performance of signature verification in RIDPRS, we introduce a notion called server-aided revocable identity-based proxy re-signature (SA-RIDPRS). Moreover, we extend the proposed RIDPRS scheme to the SA-RIDPRS scheme and prove that this extended scheme is secure against adaptive chosen message and collusion attacks. The analysis results show that our two schemes remain efficient in terms of computational complexity when implementing user revocation procedures. In particular, in the SA-RIDPRS scheme, the verifier needs to perform only a bilinear pairing and four exponentiation operations to verify the validity of the signature. Compared with other IDPRS schemes in the standard model, our SA-RIDPRS scheme greatly reduces the computation overhead of verification.

Revocable identity-based proxy re-signature against signing key exposure

PubMed Central

Ma, Tingchun; Wang, Jinli; Wang, Caifen

2018-01-01

Identity-based proxy re-signature (IDPRS) is a novel cryptographic primitive that allows a semi-trusted proxy to convert a signature under one identity into another signature under another identity on the same message by using a re-signature key. Due to this transformation function, IDPRS is very useful in constructing privacy-preserving schemes for various information systems. Key revocation functionality is important in practical IDPRS for managing users dynamically; however, the existing IDPRS schemes do not provide revocation mechanisms that allow the removal of misbehaving or compromised users from the system. In this paper, we first introduce a notion called revocable identity-based proxy re-signature (RIDPRS) to achieve the revocation functionality. We provide a formal definition of RIDPRS as well as its security model. Then, we present a concrete RIDPRS scheme that can resist signing key exposure and prove that the proposed scheme is existentially unforgeable against adaptive chosen identity and message attacks in the standard model. To further improve the performance of signature verification in RIDPRS, we introduce a notion called server-aided revocable identity-based proxy re-signature (SA-RIDPRS). Moreover, we extend the proposed RIDPRS scheme to the SA-RIDPRS scheme and prove that this extended scheme is secure against adaptive chosen message and collusion attacks. The analysis results show that our two schemes remain efficient in terms of computational complexity when implementing user revocation procedures. In particular, in the SA-RIDPRS scheme, the verifier needs to perform only a bilinear pairing and four exponentiation operations to verify the validity of the signature. Compared with other IDPRS schemes in the standard model, our SA-RIDPRS scheme greatly reduces the computation overhead of verification. PMID:29579125

An Improved and Secure Biometric Authentication Scheme for Telecare Medicine Information Systems Based on Elliptic Curve Cryptography.

PubMed

Chaudhry, Shehzad Ashraf; Mahmood, Khalid; Naqvi, Husnain; Khan, Muhammad Khurram

2015-11-01

Telecare medicine information system (TMIS) offers the patients convenient and expedite healthcare services remotely anywhere. Patient security and privacy has emerged as key issues during remote access because of underlying open architecture. An authentication scheme can verify patient's as well as TMIS server's legitimacy during remote healthcare services. To achieve security and privacy a number of authentication schemes have been proposed. Very recently Lu et al. (J. Med. Syst. 39(3):1-8, 2015) proposed a biometric based three factor authentication scheme for TMIS to confiscate the vulnerabilities of Arshad et al.'s (J. Med. Syst. 38(12):136, 2014) scheme. Further, they emphasized the robustness of their scheme against several attacks. However, in this paper we establish that Lu et al.'s scheme is vulnerable to numerous attacks including (1) Patient anonymity violation attack, (2) Patient impersonation attack, and (3) TMIS server impersonation attack. Furthermore, their scheme does not provide patient untraceability. We then, propose an improvement of Lu et al.'s scheme. We have analyzed the security of improved scheme using popular automated tool ProVerif. The proposed scheme while retaining the plusses of Lu et al.'s scheme is also robust against known attacks.

Secure Communications in CIoT Networks with a Wireless Energy Harvesting Untrusted Relay.

PubMed

Hu, Hequn; Gao, Zhenzhen; Liao, Xuewen; Leung, Victor C M

2017-09-04

The Internet of Things (IoT) represents a bright prospect that a variety of common appliances can connect to one another, as well as with the rest of the Internet, to vastly improve our lives. Unique communication and security challenges have been brought out by the limited hardware, low-complexity, and severe energy constraints of IoT devices. In addition, a severe spectrum scarcity problem has also been stimulated by the use of a large number of IoT devices. In this paper, cognitive IoT (CIoT) is considered where an IoT network works as the secondary system using underlay spectrum sharing. A wireless energy harvesting (EH) node is used as a relay to improve the coverage of an IoT device. However, the relay could be a potential eavesdropper to intercept the IoT device's messages. This paper considers the problem of secure communication between the IoT device (e.g., sensor) and a destination (e.g., controller) via the wireless EH untrusted relay. Since the destination can be equipped with adequate energy supply, secure schemes based on destination-aided jamming are proposed based on power splitting (PS) and time splitting (TS) policies, called intuitive secure schemes based on PS (Int-PS), precoded secure scheme based on PS (Pre-PS), intuitive secure scheme based on TS (Int-TS) and precoded secure scheme based on TS (Pre-TS), respectively. The secure performances of the proposed schemes are evaluated through the metric of probability of successfully secure transmission ( P S S T ), which represents the probability that the interference constraint of the primary user is satisfied and the secrecy rate is positive. P S S T is analyzed for the proposed secure schemes, and the closed form expressions of P S S T for Pre-PS and Pre-TS are derived and validated through simulation results. Numerical results show that the precoded secure schemes have better P S S T than the intuitive secure schemes under similar power consumption. When the secure schemes based on PS and TS polices have similar P S S T , the average transmit power consumption of the secure scheme based on TS is lower. The influences of power splitting and time slitting ratios are also discussed through simulations.

Data on the synthesis and mechanical characterization of polysiloxane-based urea-elastomers prepared from amino-terminated polydimethylsiloxanes and polydimethyl-methyl-phenyl-siloxane-copolymers.

PubMed

Riehle, Natascha; Götz, Tobias; Kandelbauer, Andreas; Tovar, Günter E M; Lorenz, Günter

2018-06-01

This article contains data on the synthesis and mechanical characterization of polysiloxane-based urea-elastomers (PSUs) and is related to the research article entitled "Influence of PDMS molecular weight on transparency and mechanical properties of soft polysiloxane-urea-elastomers for intraocular lens application" (Riehle et al., 2018) [1]. These elastomers were prepared by a two-step polyaddition using the aliphatic diisocyanate 4,4'-Methylenbis(cyclohexylisocyanate) (H 12 MDI), a siloxane-based chain extender 1,3-Bis(3-aminopropyl)-1,1,3,3-tetramethyldisiloxane (APTMDS) and amino-terminated polydimethylsiloxanes (PDMS) or polydimethyl-methyl-phenyl-siloxane-copolymers (PDMS-Me,Ph), respectively. (More details about the synthesis procedure and the reaction scheme can be found in the related research article (Riehle et al., 2018) [1]). Amino-terminated polydimethylsiloxanes with varying molecular weights and PDMS-Me,Ph-copolymers were prepared prior by a base-catalyzed ring-chain equilibration of a cyclic siloxane and the endblocker APTMDS. This DiB article contains a procedure for the synthesis of the base catalyst tetramethylammonium-3-aminopropyl-dimethylsilanolate and a generic synthesis procedure for the preparation of a PDMS having a targeted number average molecular weight M ¯ n of 3000 g mol -1 . Molecular weights and the amount of methyl-phenyl-siloxane within the polysiloxane-copolymers were determined by 1 H NMR and 29 Si NMR spectroscopy. The corresponding NMR spectra and data are described in this article. Additionally, this DiB article contains processed data on in line and off line FTIR-ATR spectroscopy, which was used to follow the reaction progress of the polyaddition by showing the conversion of the diisocyanate. All relevant IR band assignments of a polydimethylsiloxane-urea spectrum are described in this article. Finally, data on the tensile properties and the mechanical hysteresis-behaviour at 100% elongation of PDMS-based polyurea-elastomers are shown in dependence to the PDMS molecular weight.

Identity-Based Verifiably Encrypted Signatures without Random Oracles

NASA Astrophysics Data System (ADS)

Zhang, Lei; Wu, Qianhong; Qin, Bo

Fair exchange protocol plays an important role in electronic commerce in the case of exchanging digital contracts. Verifiably encrypted signatures provide an optimistic solution to these scenarios with an off-line trusted third party. In this paper, we propose an identity-based verifiably encrypted signature scheme. The scheme is non-interactive to generate verifiably encrypted signatures and the resulting encrypted signature consists of only four group elements. Based on the computational Diffie-Hellman assumption, our scheme is proven secure without using random oracles. To the best of our knowledge, this is the first identity-based verifiably encrypted signature scheme provably secure in the standard model.

A Secure and Privacy-Preserving Navigation Scheme Using Spatial Crowdsourcing in Fog-Based VANETs

PubMed Central

Wang, Lingling; Liu, Guozhu; Sun, Lijun

2017-01-01

Fog-based VANETs (Vehicular ad hoc networks) is a new paradigm of vehicular ad hoc networks with the advantages of both vehicular cloud and fog computing. Real-time navigation schemes based on fog-based VANETs can promote the scheme performance efficiently. In this paper, we propose a secure and privacy-preserving navigation scheme by using vehicular spatial crowdsourcing based on fog-based VANETs. Fog nodes are used to generate and release the crowdsourcing tasks, and cooperatively find the optimal route according to the real-time traffic information collected by vehicles in their coverage areas. Meanwhile, the vehicle performing the crowdsourcing task can get a reasonable reward. The querying vehicle can retrieve the navigation results from each fog node successively when entering its coverage area, and follow the optimal route to the next fog node until it reaches the desired destination. Our scheme fulfills the security and privacy requirements of authentication, confidentiality and conditional privacy preservation. Some cryptographic primitives, including the Elgamal encryption algorithm, AES, randomized anonymous credentials and group signatures, are adopted to achieve this goal. Finally, we analyze the security and the efficiency of the proposed scheme. PMID:28338620

Evaluation of effectiveness of wavelet based denoising schemes using ANN and SVM for bearing condition classification.

PubMed

Vijay, G S; Kumar, H S; Srinivasa Pai, P; Sriram, N S; Rao, Raj B K N

2012-01-01

The wavelet based denoising has proven its ability to denoise the bearing vibration signals by improving the signal-to-noise ratio (SNR) and reducing the root-mean-square error (RMSE). In this paper seven wavelet based denoising schemes have been evaluated based on the performance of the Artificial Neural Network (ANN) and the Support Vector Machine (SVM), for the bearing condition classification. The work consists of two parts, the first part in which a synthetic signal simulating the defective bearing vibration signal with Gaussian noise was subjected to these denoising schemes. The best scheme based on the SNR and the RMSE was identified. In the second part, the vibration signals collected from a customized Rolling Element Bearing (REB) test rig for four bearing conditions were subjected to these denoising schemes. Several time and frequency domain features were extracted from the denoised signals, out of which a few sensitive features were selected using the Fisher's Criterion (FC). Extracted features were used to train and test the ANN and the SVM. The best denoising scheme identified, based on the classification performances of the ANN and the SVM, was found to be the same as the one obtained using the synthetic signal.

A Secure and Privacy-Preserving Navigation Scheme Using Spatial Crowdsourcing in Fog-Based VANETs.

PubMed

Wang, Lingling; Liu, Guozhu; Sun, Lijun

2017-03-24

Fog-based VANETs (Vehicular ad hoc networks) is a new paradigm of vehicular ad hoc networks with the advantages of both vehicular cloud and fog computing. Real-time navigation schemes based on fog-based VANETs can promote the scheme performance efficiently. In this paper, we propose a secure and privacy-preserving navigation scheme by using vehicular spatial crowdsourcing based on fog-based VANETs. Fog nodes are used to generate and release the crowdsourcing tasks, and cooperatively find the optimal route according to the real-time traffic information collected by vehicles in their coverage areas. Meanwhile, the vehicle performing the crowdsourcing task can get a reasonable reward. The querying vehicle can retrieve the navigation results from each fog node successively when entering its coverage area, and follow the optimal route to the next fog node until it reaches the desired destination. Our scheme fulfills the security and privacy requirements of authentication, confidentiality and conditional privacy preservation. Some cryptographic primitives, including the Elgamal encryption algorithm, AES, randomized anonymous credentials and group signatures, are adopted to achieve this goal. Finally, we analyze the security and the efficiency of the proposed scheme.

Bayesian tomography by interacting Markov chains

NASA Astrophysics Data System (ADS)

Romary, T.

2017-12-01

In seismic tomography, we seek to determine the velocity of the undergound from noisy first arrival travel time observations. In most situations, this is an ill posed inverse problem that admits several unperfect solutions. Given an a priori distribution over the parameters of the velocity model, the Bayesian formulation allows to state this problem as a probabilistic one, with a solution under the form of a posterior distribution. The posterior distribution is generally high dimensional and may exhibit multimodality. Moreover, as it is known only up to a constant, the only sensible way to addressthis problem is to try to generate simulations from the posterior. The natural tools to perform these simulations are Monte Carlo Markov chains (MCMC). Classical implementations of MCMC algorithms generally suffer from slow mixing: the generated states are slow to enter the stationary regime, that is to fit the observations, and when one mode of the posterior is eventually identified, it may become difficult to visit others. Using a varying temperature parameter relaxing the constraint on the data may help to enter the stationary regime. Besides, the sequential nature of MCMC makes them ill fitted toparallel implementation. Running a large number of chains in parallel may be suboptimal as the information gathered by each chain is not mutualized. Parallel tempering (PT) can be seen as a first attempt to make parallel chains at different temperatures communicate but only exchange information between current states. In this talk, I will show that PT actually belongs to a general class of interacting Markov chains algorithm. I will also show that this class enables to design interacting schemes that can take advantage of the whole history of the chain, by authorizing exchanges toward already visited states. The algorithms will be illustrated with toy examples and an application to first arrival traveltime tomography.

Community-based health insurance knowledge, concern, preferences, and financial planning for health care among informal sector workers in a health district of Douala, Cameroon

PubMed Central

Noubiap, Jean Jacques N; Joko, Walburga Yvonne A; Obama, Joel Marie N; Bigna, Jean Joel R

2013-01-01

Introduction For the last two decades, promoted by many governments and international number in sub-Saharan Africa. In 2005 in Cameroon, there were only 60 Community-based health insurance (CBHI) schemes nationwide, covering less than 1% of the population. In 2006, the Cameroon government adopted a national strategy aimed at creating at least one CBHI scheme in each health district and covering at least 40% of the population with CBHI schemes by 2015. Unfortunately, there is almost no published data on the awareness and the implementation of CBHI schemes in Cameroon. Methods Structured interviews were conducted in January 2010 with 160 informal sectors workers in the Bonassama health district (BHD) of Douala, aiming at evaluating their knowledge, concern and preferences on CBHI schemes and their financial plan to cover health costs. Results The awareness on the existence of CHBI schemes was poor awareness schemes among these informal workers. Awareness of CBHI schemes was significantly associated with a high level of education (p = 0.0001). Only 4.4% of respondents had health insurance, and specifically 1.2% were involved in a CBHI scheme. However, 128 (86.2%) respondents thought that belonging to a CBHI scheme could facilitate their access to adequate health care, and were thus willing to be involved in CBHI schemes. Our respondents would have preferred CBHI schemes run by missionaries to CBHI schemes run by the government or people of the same ethnic group (p). Conclusion There is a very low participation in CBHI schemes among the informal sector workers of the BHD. This is mainly due to the lack of awareness and limited knowledge on the basic concepts of a CBHI by this target population. Solidarity based community associations to which the vast majority of this target population belong are prime areas for sensitization on CBHI schemes. Hence these associations could possibly federalize to create CBHI schemes. PMID:24498466

Community-based health insurance knowledge, concern, preferences, and financial planning for health care among informal sector workers in a health district of Douala, Cameroon.

PubMed

Noubiap, Jean Jacques N; Joko, Walburga Yvonne A; Obama, Joel Marie N; Bigna, Jean Joel R

2013-01-01

For the last two decades, promoted by many governments and international number in sub-Saharan Africa. In 2005 in Cameroon, there were only 60 Community-based health insurance (CBHI) schemes nationwide, covering less than 1% of the population. In 2006, the Cameroon government adopted a national strategy aimed at creating at least one CBHI scheme in each health district and covering at least 40% of the population with CBHI schemes by 2015. Unfortunately, there is almost no published data on the awareness and the implementation of CBHI schemes in Cameroon. Structured interviews were conducted in January 2010 with 160 informal sectors workers in the Bonassama health district (BHD) of Douala, aiming at evaluating their knowledge, concern and preferences on CBHI schemes and their financial plan to cover health costs. The awareness on the existence of CHBI schemes was poor awareness schemes among these informal workers. Awareness of CBHI schemes was significantly associated with a high level of education (p = 0.0001). Only 4.4% of respondents had health insurance, and specifically 1.2% were involved in a CBHI scheme. However, 128 (86.2%) respondents thought that belonging to a CBHI scheme could facilitate their access to adequate health care, and were thus willing to be involved in CBHI schemes. Our respondents would have preferred CBHI schemes run by missionaries to CBHI schemes run by the government or people of the same ethnic group (p). There is a very low participation in CBHI schemes among the informal sector workers of the BHD. This is mainly due to the lack of awareness and limited knowledge on the basic concepts of a CBHI by this target population. Solidarity based community associations to which the vast majority of this target population belong are prime areas for sensitization on CBHI schemes. Hence these associations could possibly federalize to create CBHI schemes.

A secure and efficient password-based user authentication scheme using smart cards for the integrated EPR information system.

PubMed

Lee, Tian-Fu; Chang, I-Pin; Lin, Tsung-Hung; Wang, Ching-Cheng

2013-06-01

The integrated EPR information system supports convenient and rapid e-medicine services. A secure and efficient authentication scheme for the integrated EPR information system provides safeguarding patients' electronic patient records (EPRs) and helps health care workers and medical personnel to rapidly making correct clinical decisions. Recently, Wu et al. proposed an efficient password-based user authentication scheme using smart cards for the integrated EPR information system, and claimed that the proposed scheme could resist various malicious attacks. However, their scheme is still vulnerable to lost smart card and stolen verifier attacks. This investigation discusses these weaknesses and proposes a secure and efficient authentication scheme for the integrated EPR information system as alternative. Compared with related approaches, the proposed scheme not only retains a lower computational cost and does not require verifier tables for storing users' secrets, but also solves the security problems in previous schemes and withstands possible attacks.

Optical colour image watermarking based on phase-truncated linear canonical transform and image decomposition

NASA Astrophysics Data System (ADS)

Su, Yonggang; Tang, Chen; Li, Biyuan; Lei, Zhenkun

2018-05-01

This paper presents a novel optical colour image watermarking scheme based on phase-truncated linear canonical transform (PT-LCT) and image decomposition (ID). In this proposed scheme, a PT-LCT-based asymmetric cryptography is designed to encode the colour watermark into a noise-like pattern, and an ID-based multilevel embedding method is constructed to embed the encoded colour watermark into a colour host image. The PT-LCT-based asymmetric cryptography, which can be optically implemented by double random phase encoding with a quadratic phase system, can provide a higher security to resist various common cryptographic attacks. And the ID-based multilevel embedding method, which can be digitally implemented by a computer, can make the information of the colour watermark disperse better in the colour host image. The proposed colour image watermarking scheme possesses high security and can achieve a higher robustness while preserving the watermark’s invisibility. The good performance of the proposed scheme has been demonstrated by extensive experiments and comparison with other relevant schemes.

An enhanced biometric authentication scheme for telecare medicine information systems with nonce using chaotic hash function.

PubMed

Das, Ashok Kumar; Goswami, Adrijit

2014-06-01

Recently, Awasthi and Srivastava proposed a novel biometric remote user authentication scheme for the telecare medicine information system (TMIS) with nonce. Their scheme is very efficient as it is based on efficient chaotic one-way hash function and bitwise XOR operations. In this paper, we first analyze Awasthi-Srivastava's scheme and then show that their scheme has several drawbacks: (1) incorrect password change phase, (2) fails to preserve user anonymity property, (3) fails to establish a secret session key beween a legal user and the server, (4) fails to protect strong replay attack, and (5) lacks rigorous formal security analysis. We then a propose a novel and secure biometric-based remote user authentication scheme in order to withstand the security flaw found in Awasthi-Srivastava's scheme and enhance the features required for an idle user authentication scheme. Through the rigorous informal and formal security analysis, we show that our scheme is secure against possible known attacks. In addition, we simulate our scheme for the formal security verification using the widely-accepted AVISPA (Automated Validation of Internet Security Protocols and Applications) tool and show that our scheme is secure against passive and active attacks, including the replay and man-in-the-middle attacks. Our scheme is also efficient as compared to Awasthi-Srivastava's scheme.

An Improvement of Robust Biometrics-Based Authentication and Key Agreement Scheme for Multi-Server Environments Using Smart Cards.

PubMed

Moon, Jongho; Choi, Younsung; Jung, Jaewook; Won, Dongho

2015-01-01

In multi-server environments, user authentication is a very important issue because it provides the authorization that enables users to access their data and services; furthermore, remote user authentication schemes for multi-server environments have solved the problem that has arisen from user's management of different identities and passwords. For this reason, numerous user authentication schemes that are designed for multi-server environments have been proposed over recent years. In 2015, Lu et al. improved upon Mishra et al.'s scheme, claiming that their remote user authentication scheme is more secure and practical; however, we found that Lu et al.'s scheme is still insecure and incorrect. In this paper, we demonstrate that Lu et al.'s scheme is vulnerable to outsider attack and user impersonation attack, and we propose a new biometrics-based scheme for authentication and key agreement that can be used in multi-server environments; then, we show that our proposed scheme is more secure and supports the required security properties.

Differential cytotoxicity of long-chain bases for human oral gingival epithelial keratinocytes, oral fibroblasts, and dendritic cells.

PubMed

Mehalick, Leslie A; Poulsen, Christopher; Fischer, Carol L; Lanzel, Emily A; Bates, Amber M; Walters, Katherine S; Cavanaugh, Joseph E; Guthmiller, Janet M; Johnson, Georgia K; Wertz, Philip W; Brogden, Kim A

2015-12-01

Long-chain bases, found in the oral cavity, have potent antimicrobial activity against oral pathogens. In an article associated with this dataset, Poulson and colleagues determined the cytotoxicities of long-chain bases (sphingosine, dihydrosphingosine, and phytosphingosine) for human oral gingival epithelial (GE) keratinocytes, oral gingival fibroblasts (GF), dendritic cells (DC), and squamous cell carcinoma (SCC) cell lines [1]. Poulson and colleagues found that GE keratinocytes were more resistant to long-chain bases as compared to GF, DC, and SCC cell lines [1]. In this study, we assess the susceptibility of DC to lower concentrations of long chain bases. 0.2-10.0 µM long-chain bases and GML were not cytotoxic to DC; 40.0-80.0 µM long-chain bases, but not GML, were cytotoxic for DC; and 80.0 µM long-chain bases were cytotoxic to DC and induced cellular damage and death in less than 20 mins. Overall, the LD50 of long-chain bases for GE keratinocytes, GF, and DC were considerably higher than their minimal inhibitory concentrations for oral pathogens, a finding important to pursuing their future potential in treating periodontal and oral infections.

Systems-based decomposition schemes for the approximate solution of multi-term fractional differential equations

NASA Astrophysics Data System (ADS)

Ford, Neville J.; Connolly, Joseph A.

2009-07-01

We give a comparison of the efficiency of three alternative decomposition schemes for the approximate solution of multi-term fractional differential equations using the Caputo form of the fractional derivative. The schemes we compare are based on conversion of the original problem into a system of equations. We review alternative approaches and consider how the most appropriate numerical scheme may be chosen to solve a particular equation.

Efficient biometric authenticated key agreements based on extended chaotic maps for telecare medicine information systems.

PubMed

Lou, Der-Chyuan; Lee, Tian-Fu; Lin, Tsung-Hung

2015-05-01

Authenticated key agreements for telecare medicine information systems provide patients, doctors, nurses and health visitors with accessing medical information systems and getting remote services efficiently and conveniently through an open network. In order to have higher security, many authenticated key agreement schemes appended biometric keys to realize identification except for using passwords and smartcards. Due to too many transmissions and computational costs, these authenticated key agreement schemes are inefficient in communication and computation. This investigation develops two secure and efficient authenticated key agreement schemes for telecare medicine information systems by using biometric key and extended chaotic maps. One scheme is synchronization-based, while the other nonce-based. Compared to related approaches, the proposed schemes not only retain the same security properties with previous schemes, but also provide users with privacy protection and have fewer transmissions and lower computational cost.

Phase-Image Encryption Based on 3D-Lorenz Chaotic System and Double Random Phase Encoding

NASA Astrophysics Data System (ADS)

Sharma, Neha; Saini, Indu; Yadav, AK; Singh, Phool

2017-12-01

In this paper, an encryption scheme for phase-images based on 3D-Lorenz chaotic system in Fourier domain under the 4f optical system is presented. The encryption scheme uses a random amplitude mask in the spatial domain and a random phase mask in the frequency domain. Its inputs are phase-images, which are relatively more secure as compared to the intensity images because of non-linearity. The proposed scheme further derives its strength from the use of 3D-Lorenz transform in the frequency domain. Although the experimental setup for optical realization of the proposed scheme has been provided, the results presented here are based on simulations on MATLAB. It has been validated for grayscale images, and is found to be sensitive to the encryption parameters of the Lorenz system. The attacks analysis shows that the key-space is large enough to resist brute-force attack, and the scheme is also resistant to the noise and occlusion attacks. Statistical analysis and the analysis based on correlation distribution of adjacent pixels have been performed to test the efficacy of the encryption scheme. The results have indicated that the proposed encryption scheme possesses a high level of security.

Electron-Transfer/Higher-Energy Collision Dissociation (EThcD)-Enabled Intact Glycopeptide/Glycoproteome Characterization

NASA Astrophysics Data System (ADS)

Yu, Qing; Wang, Bowen; Chen, Zhengwei; Urabe, Go; Glover, Matthew S.; Shi, Xudong; Guo, Lian-Wang; Kent, K. Craig; Li, Lingjun

2017-09-01

Protein glycosylation, one of the most heterogeneous post-translational modifications, can play a major role in cellular signal transduction and disease progression. Traditional mass spectrometry (MS)-based large-scale glycoprotein sequencing studies heavily rely on identifying enzymatically released glycans and their original peptide backbone separately, as there is no efficient fragmentation method to produce unbiased glycan and peptide product ions simultaneously in a single spectrum, and that can be conveniently applied to high throughput glycoproteome characterization, especially for N-glycopeptides, which can have much more branched glycan side chains than relatively less complex O-linked glycans. In this study, a redefined electron-transfer/higher-energy collision dissociation (EThcD) fragmentation scheme is applied to incorporate both glycan and peptide fragments in one single spectrum, enabling complete information to be gathered and great microheterogeneity details to be revealed. Fetuin was first utilized to prove the applicability with 19 glycopeptides and corresponding five glycosylation sites identified. Subsequent experiments tested its utility for human plasma N-glycoproteins. Large-scale studies explored N-glycoproteomics in rat carotid arteries over the course of restenosis progression to investigate the potential role of glycosylation. The integrated fragmentation scheme provides a powerful tool for the analysis of intact N-glycopeptides and N-glycoproteomics. We also anticipate this approach can be readily applied to large-scale O-glycoproteome characterization. [Figure not available: see fulltext.

Enhancement tuning and control for high dynamic range images in multi-scale locally adaptive contrast enhancement algorithms

NASA Astrophysics Data System (ADS)

Cvetkovic, Sascha D.; Schirris, Johan; de With, Peter H. N.

2009-01-01

For real-time imaging in surveillance applications, visibility of details is of primary importance to ensure customer confidence. If we display High Dynamic-Range (HDR) scenes whose contrast spans four or more orders of magnitude on a conventional monitor without additional processing, results are unacceptable. Compression of the dynamic range is therefore a compulsory part of any high-end video processing chain because standard monitors are inherently Low- Dynamic Range (LDR) devices with maximally two orders of display dynamic range. In real-time camera processing, many complex scenes are improved with local contrast enhancements, bringing details to the best possible visibility. In this paper, we show how a multi-scale high-frequency enhancement scheme, in which gain is a non-linear function of the detail energy, can be used for the dynamic range compression of HDR real-time video camera signals. We also show the connection of our enhancement scheme to the processing way of the Human Visual System (HVS). Our algorithm simultaneously controls perceived sharpness, ringing ("halo") artifacts (contrast) and noise, resulting in a good balance between visibility of details and non-disturbance of artifacts. The overall quality enhancement, suitable for both HDR and LDR scenes, is based on a careful selection of the filter types for the multi-band decomposition and a detailed analysis of the signal per frequency band.

Development and assessement of the GECKO-A multiphase modelling tool for the atmospheric oxidation of biogenic organic compounds

NASA Astrophysics Data System (ADS)

Valorso, Richard; Raventos-Duran, Teresa; Aumont, Bernard; Camredon, Marie; Ng, Nga L.; Seinfeld, John H.

2010-05-01

The evaluation of the impacts of secondary organics on pollution episodes, climate and the tropospheric oxidizing capacity requires modelling tools that track the identity and reactivity of organic carbon in the various stages down to the ultimate oxidation products. The fully explicit representation of hydrocarbon oxidation, from the initial compounds to the final product CO2, requires a very large number of chemical reactions and intermediate species, far in excess of the number that can be reasonably written manually. We developed a "self generating approach" to explicitly describe (i) the gas phase oxidation schemes of organic compounds under general tropospheric conditions and (ii) the partitioning of secondary organics between gas and condensed phases. This approach was codified in a computer program, GECKO-A (Generator for Explicit Chemistry and Kinetics of Organics in the Atmosphere). This method allows prediction of multiphase mass budget using first principles. However, due to computational limitations, fully explicit chemical schemes can only be generated for species up to C8. We recently implemented a reduction protocol in GECKO-A to allow the generation of oxidation schemes for long chain organics. This protocol was applied to develop highly detailed oxidation schemes for biogenic compounds. The relevance of the generated schemes was assessed using experiments performed in the Caltech smog chamber for various NOx conditions. The first results show a systematic overestimation of the simulated SOA concentrations by GECKO-A. Several hypotheses were tested to find the origin of the discrepancies beetwen model and measurements.

A scheme of hidden-structure attribute-based encryption with multiple authorities

NASA Astrophysics Data System (ADS)

Ling, J.; Weng, A. X.

2018-05-01

In the most of the CP-ABE schemes with hidden access structure, both all the user attributes and the key generation are managed by only one authority. The key generation efficiency will decrease as the number of user increases, and the data will encounter security issues as the only authority is attacked. We proposed a scheme of hidden-structure attribute-based encryption with multiple authorities, which introduces multiple semi-trusted attribute authorities, avoiding the threat even though one or more authorities are attacked. We also realized user revocation by managing a revocation list. Based on DBDH assumption, we proved that our scheme is of IND-CMA security. The analysis shows that our scheme improves the key generation efficiency.

Quantum Attack-Resistent Certificateless Multi-Receiver Signcryption Scheme

PubMed Central

Li, Huixian; Chen, Xubao; Pang, Liaojun; Shi, Weisong

2013-01-01

The existing certificateless signcryption schemes were designed mainly based on the traditional public key cryptography, in which the security relies on the hard problems, such as factor decomposition and discrete logarithm. However, these problems will be easily solved by the quantum computing. So the existing certificateless signcryption schemes are vulnerable to the quantum attack. Multivariate public key cryptography (MPKC), which can resist the quantum attack, is one of the alternative solutions to guarantee the security of communications in the post-quantum age. Motivated by these concerns, we proposed a new construction of the certificateless multi-receiver signcryption scheme (CLMSC) based on MPKC. The new scheme inherits the security of MPKC, which can withstand the quantum attack. Multivariate quadratic polynomial operations, which have lower computation complexity than bilinear pairing operations, are employed in signcrypting a message for a certain number of receivers in our scheme. Security analysis shows that our scheme is a secure MPKC-based scheme. We proved its security under the hardness of the Multivariate Quadratic (MQ) problem and its unforgeability under the Isomorphism of Polynomials (IP) assumption in the random oracle model. The analysis results show that our scheme also has the security properties of non-repudiation, perfect forward secrecy, perfect backward secrecy and public verifiability. Compared with the existing schemes in terms of computation complexity and ciphertext length, our scheme is more efficient, which makes it suitable for terminals with low computation capacity like smart cards. PMID:23967037

An Efficient User Authentication and User Anonymity Scheme with Provably Security for IoT-Based Medical Care System.

PubMed

Li, Chun-Ta; Wu, Tsu-Yang; Chen, Chin-Ling; Lee, Cheng-Chi; Chen, Chien-Ming

2017-06-23

In recent years, with the increase in degenerative diseases and the aging population in advanced countries, demands for medical care of older or solitary people have increased continually in hospitals and healthcare institutions. Applying wireless sensor networks for the IoT-based telemedicine system enables doctors, caregivers or families to monitor patients' physiological conditions at anytime and anyplace according to the acquired information. However, transmitting physiological data through the Internet concerns the personal privacy of patients. Therefore, before users can access medical care services in IoT-based medical care system, they must be authenticated. Typically, user authentication and data encryption are most critical for securing network communications over a public channel between two or more participants. In 2016, Liu and Chung proposed a bilinear pairing-based password authentication scheme for wireless healthcare sensor networks. They claimed their authentication scheme cannot only secure sensor data transmission, but also resist various well-known security attacks. In this paper, we demonstrate that Liu-Chung's scheme has some security weaknesses, and we further present an improved secure authentication and data encryption scheme for the IoT-based medical care system, which can provide user anonymity and prevent the security threats of replay and password/sensed data disclosure attacks. Moreover, we modify the authentication process to reduce redundancy in protocol design, and the proposed scheme is more efficient in performance compared with previous related schemes. Finally, the proposed scheme is provably secure in the random oracle model under ECDHP.

A Secure Dynamic Identity and Chaotic Maps Based User Authentication and Key Agreement Scheme for e-Healthcare Systems.

PubMed

Li, Chun-Ta; Lee, Cheng-Chi; Weng, Chi-Yao; Chen, Song-Jhih

2016-11-01

Secure user authentication schemes in many e-Healthcare applications try to prevent unauthorized users from intruding the e-Healthcare systems and a remote user and a medical server can establish session keys for securing the subsequent communications. However, many schemes does not mask the users' identity information while constructing a login session between two or more parties, even though personal privacy of users is a significant topic for e-Healthcare systems. In order to preserve personal privacy of users, dynamic identity based authentication schemes are hiding user's real identity during the process of network communications and only the medical server knows login user's identity. In addition, most of the existing dynamic identity based authentication schemes ignore the inputs verification during login condition and this flaw may subject to inefficiency in the case of incorrect inputs in the login phase. Regarding the use of secure authentication mechanisms for e-Healthcare systems, this paper presents a new dynamic identity and chaotic maps based authentication scheme and a secure data protection approach is employed in every session to prevent illegal intrusions. The proposed scheme can not only quickly detect incorrect inputs during the phases of login and password change but also can invalidate the future use of a lost/stolen smart card. Compared the functionality and efficiency with other authentication schemes recently, the proposed scheme satisfies desirable security attributes and maintains acceptable efficiency in terms of the computational overheads for e-Healthcare systems.

A more secure anonymous user authentication scheme for the integrated EPR information system.

PubMed

Wen, Fengtong

2014-05-01

Secure and efficient user mutual authentication is an essential task for integrated electronic patient record (EPR) information system. Recently, several authentication schemes have been proposed to meet this requirement. In a recent paper, Lee et al. proposed an efficient and secure password-based authentication scheme used smart cards for the integrated EPR information system. This scheme is believed to have many abilities to resist a range of network attacks. Especially, they claimed that their scheme could resist lost smart card attack. However, we reanalyze the security of Lee et al.'s scheme, and show that it fails to protect off-line password guessing attack if the secret information stored in the smart card is compromised. This also renders that their scheme is insecure against user impersonation attacks. Then, we propose a new user authentication scheme for integrated EPR information systems based on the quadratic residues. The new scheme not only resists a range of network attacks but also provides user anonymity. We show that our proposed scheme can provide stronger security.

Developing a new case based computer-aided detection scheme and an adaptive cueing method to improve performance in detecting mammographic lesions

PubMed Central

Tan, Maxine; Aghaei, Faranak; Wang, Yunzhi; Zheng, Bin

2017-01-01

The purpose of this study is to evaluate a new method to improve performance of computer-aided detection (CAD) schemes of screening mammograms with two approaches. In the first approach, we developed a new case based CAD scheme using a set of optimally selected global mammographic density, texture, spiculation, and structural similarity features computed from all four full-field digital mammography (FFDM) images of the craniocaudal (CC) and mediolateral oblique (MLO) views by using a modified fast and accurate sequential floating forward selection feature selection algorithm. Selected features were then applied to a “scoring fusion” artificial neural network (ANN) classification scheme to produce a final case based risk score. In the second approach, we combined the case based risk score with the conventional lesion based scores of a conventional lesion based CAD scheme using a new adaptive cueing method that is integrated with the case based risk scores. We evaluated our methods using a ten-fold cross-validation scheme on 924 cases (476 cancer and 448 recalled or negative), whereby each case had all four images from the CC and MLO views. The area under the receiver operating characteristic curve was AUC = 0.793±0.015 and the odds ratio monotonically increased from 1 to 37.21 as CAD-generated case based detection scores increased. Using the new adaptive cueing method, the region based and case based sensitivities of the conventional CAD scheme at a false positive rate of 0.71 per image increased by 2.4% and 0.8%, respectively. The study demonstrated that supplementary information can be derived by computing global mammographic density image features to improve CAD-cueing performance on the suspicious mammographic lesions. PMID:27997380

Genetic progress in multistage dairy cattle breeding schemes using genetic markers.

PubMed

Schrooten, C; Bovenhuis, H; van Arendonk, J A M; Bijma, P

2005-04-01

The aim of this paper was to explore general characteristics of multistage breeding schemes and to evaluate multistage dairy cattle breeding schemes that use information on quantitative trait loci (QTL). Evaluation was either for additional genetic response or for reduction in number of progeny-tested bulls while maintaining the same response. The reduction in response in multistage breeding schemes relative to comparable single-stage breeding schemes (i.e., with the same overall selection intensity and the same amount of information in the final stage of selection) depended on the overall selection intensity, the selection intensity in the various stages of the breeding scheme, and the ratio of the accuracies of selection in the various stages of the breeding scheme. When overall selection intensity was constant, reduction in response increased with increasing selection intensity in the first stage. The decrease in response was highest in schemes with lower overall selection intensity. Reduction in response was limited in schemes with low to average emphasis on first-stage selection, especially if the accuracy of selection in the first stage was relatively high compared with the accuracy in the final stage. Closed nucleus breeding schemes in dairy cattle that use information on QTL were evaluated by deterministic simulation. In the base scheme, the selection index consisted of pedigree information and own performance (dams), or pedigree information and performance of 100 daughters (sires). In alternative breeding schemes, information on a QTL was accounted for by simulating an additional index trait. The fraction of the variance explained by the QTL determined the correlation between the additional index trait and the breeding goal trait. Response in progeny test schemes relative to a base breeding scheme without QTL information ranged from +4.5% (QTL explaining 5% of the additive genetic variance) to +21.2% (QTL explaining 50% of the additive genetic variance). A QTL explaining 5% of the additive genetic variance allowed a 35% reduction in the number of progeny tested bulls, while maintaining genetic response at the level of the base scheme. Genetic progress was up to 31.3% higher for schemes with increased embryo production and selection of embryos based on QTL information. The challenge for breeding organizations is to find the optimum breeding program with regard to additional genetic progress and additional (or reduced) cost.

Proposed new classification scheme for chemical injury to the human eye.

PubMed

Bagley, Daniel M; Casterton, Phillip L; Dressler, William E; Edelhauser, Henry F; Kruszewski, Francis H; McCulley, James P; Nussenblatt, Robert B; Osborne, Rosemarie; Rothenstein, Arthur; Stitzel, Katherine A; Thomas, Karluss; Ward, Sherry L

2006-07-01

Various ocular alkali burn classification schemes have been published and used to grade human chemical eye injuries for the purpose of identifying treatments and forecasting outcomes. The ILSI chemical eye injury classification scheme was developed for the additional purpose of collecting detailed human eye injury data to provide information on the mechanisms associated with chemical eye injuries. This information will have clinical application, as well as use in the development and validation of new methods to assess ocular toxicity. A panel of ophthalmic researchers proposed the new classification scheme based upon current knowledge of the mechanisms of eye injury, and their collective clinical and research experience. Additional ophthalmologists and researchers were surveyed to critique the scheme. The draft scheme was revised, and the proposed scheme represents the best consensus from at least 23 physicians and scientists. The new scheme classifies chemical eye injury into five categories based on clinical signs, symptoms, and expected outcomes. Diagnostic classification is based primarily on two clinical endpoints: (1) the extent (area) of injury at the limbus, and (2) the degree of injury (area and depth) to the cornea. The new classification scheme provides a uniform system for scoring eye injury across chemical classes, and provides enough detail for the clinician to collect data that will be relevant to identifying the mechanisms of ocular injury.

Fidelity Witnesses for Fermionic Quantum Simulations

NASA Astrophysics Data System (ADS)

Gluza, M.; Kliesch, M.; Eisert, J.; Aolita, L.

2018-05-01

The experimental interest and developments in quantum spin-1 /2 chains has increased uninterruptedly over the past decade. In many instances, the target quantum simulation belongs to the broader class of noninteracting fermionic models, constituting an important benchmark. In spite of this class being analytically efficiently tractable, no direct certification tool has yet been reported for it. In fact, in experiments, certification has almost exclusively relied on notions of quantum state tomography scaling very unfavorably with the system size. Here, we develop experimentally friendly fidelity witnesses for all pure fermionic Gaussian target states. Their expectation value yields a tight lower bound to the fidelity and can be measured efficiently. We derive witnesses in full generality in the Majorana-fermion representation and apply them to experimentally relevant spin-1 /2 chains. Among others, we show how to efficiently certify strongly out-of-equilibrium dynamics in critical Ising chains. At the heart of the measurement scheme is a variant of importance sampling specially tailored to overlaps between covariance matrices. The method is shown to be robust against finite experimental-state infidelities.

Carrier transfer in vertically stacked quantum ring-quantum dot chains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mazur, Yu. I., E-mail: ymazur@uark.edu; Dorogan, V. G.; Benamara, M.

2015-04-21

The interplay between structural properties and charge transfer in self-assembled quantum ring (QR) chains grown by molecular beam epitaxy on top of an InGaAs/GaAs quantum dot (QD) superlattice template is analyzed and characterized. The QDs and QRs are vertically stacked and laterally coupled as well as aligned within each layer due to the strain field distributions that governs the ordering. The strong interdot coupling influences the carrier transfer both along as well as between chains in the ring layer and dot template structures. A qualitative contrast between different dynamic models has been developed. By combining temperature and excitation intensity effects,more » the tuning of the photoluminescence gain for either the QR or the QD mode is attained. The information obtained here about relaxation parameters, energy scheme, interlayer and interdot coupling resulting in creation of 1D structures is very important for the usage of such specific QR–QD systems for applied purposes such as lasing, detection, and energy-harvesting technology of future solar panels.« less

A comparison of temporal and location-based sampling strategies for global positioning system-triggered electronic diaries.

PubMed

Törnros, Tobias; Dorn, Helen; Reichert, Markus; Ebner-Priemer, Ulrich; Salize, Hans-Joachim; Tost, Heike; Meyer-Lindenberg, Andreas; Zipf, Alexander

2016-11-21

Self-reporting is a well-established approach within the medical and psychological sciences. In order to avoid recall bias, i.e. past events being remembered inaccurately, the reports can be filled out on a smartphone in real-time and in the natural environment. This is often referred to as ambulatory assessment and the reports are usually triggered at regular time intervals. With this sampling scheme, however, rare events (e.g. a visit to a park or recreation area) are likely to be missed. When addressing the correlation between mood and the environment, it may therefore be beneficial to include participant locations within the ambulatory assessment sampling scheme. Based on the geographical coordinates, the database query system then decides if a self-report should be triggered or not. We simulated four different ambulatory assessment sampling schemes based on movement data (coordinates by minute) from 143 voluntary participants tracked for seven consecutive days. Two location-based sampling schemes incorporating the environmental characteristics (land use and population density) at each participant's location were introduced and compared to a time-based sampling scheme triggering a report on the hour as well as to a sampling scheme incorporating physical activity. We show that location-based sampling schemes trigger a report less often, but we obtain more unique trigger positions and a greater spatial spread in comparison to sampling strategies based on time and distance. Additionally, the location-based methods trigger significantly more often at rarely visited types of land use and less often outside the study region where no underlying environmental data are available.

Surface code quantum communication.

PubMed

Fowler, Austin G; Wang, David S; Hill, Charles D; Ladd, Thaddeus D; Van Meter, Rodney; Hollenberg, Lloyd C L

2010-05-07

Quantum communication typically involves a linear chain of repeater stations, each capable of reliable local quantum computation and connected to their nearest neighbors by unreliable communication links. The communication rate of existing protocols is low as two-way classical communication is used. By using a surface code across the repeater chain and generating Bell pairs between neighboring stations with probability of heralded success greater than 0.65 and fidelity greater than 0.96, we show that two-way communication can be avoided and quantum information can be sent over arbitrary distances with arbitrarily low error at a rate limited only by the local gate speed. This is achieved by using the unreliable Bell pairs to measure nonlocal stabilizers and feeding heralded failure information into post-transmission error correction. Our scheme also applies when the probability of heralded success is arbitrarily low.

Observation uncertainty in reversible Markov chains.

PubMed

Metzner, Philipp; Weber, Marcus; Schütte, Christof

2010-09-01

In many applications one is interested in finding a simplified model which captures the essential dynamical behavior of a real life process. If the essential dynamics can be assumed to be (approximately) memoryless then a reasonable choice for a model is a Markov model whose parameters are estimated by means of Bayesian inference from an observed time series. We propose an efficient Monte Carlo Markov chain framework to assess the uncertainty of the Markov model and related observables. The derived Gibbs sampler allows for sampling distributions of transition matrices subject to reversibility and/or sparsity constraints. The performance of the suggested sampling scheme is demonstrated and discussed for a variety of model examples. The uncertainty analysis of functions of the Markov model under investigation is discussed in application to the identification of conformations of the trialanine molecule via Robust Perron Cluster Analysis (PCCA+) .

Multiparty Quantum Blind Signature Scheme Based on Graph States

NASA Astrophysics Data System (ADS)

Jian-Wu, Liang; Xiao-Shu, Liu; Jin-Jing, Shi; Ying, Guo

2018-05-01

A multiparty quantum blind signature scheme is proposed based on the principle of graph state, in which the unitary operations of graph state particles can be applied to generate the quantum blind signature and achieve verification. Different from the classical blind signature based on the mathematical difficulty, the scheme could guarantee not only the anonymity but also the unconditionally security. The analysis shows that the length of the signature generated in our scheme does not become longer as the number of signers increases, and it is easy to increase or decrease the number of signers.

Triangle based TVD schemes for hyperbolic conservation laws

NASA Technical Reports Server (NTRS)

Durlofsky, Louis J.; Osher, Stanley; Engquist, Bjorn

1990-01-01

A triangle based total variation diminishing (TVD) scheme for the numerical approximation of hyperbolic conservation laws in two space dimensions is constructed. The novelty of the scheme lies in the nature of the preprocessing of the cell averaged data, which is accomplished via a nearest neighbor linear interpolation followed by a slope limiting procedures. Two such limiting procedures are suggested. The resulting method is considerably more simple than other triangle based non-oscillatory approximations which, like this scheme, approximate the flux up to second order accuracy. Numerical results for linear advection and Burgers' equation are presented.

On the security flaws in ID-based password authentication schemes for telecare medical information systems.

PubMed

Mishra, Dheerendra

2015-01-01

Telecare medical information systems (TMIS) enable healthcare delivery services. However, access of these services via public channel raises security and privacy issues. In recent years, several smart card based authentication schemes have been introduced to ensure secure and authorized communication between remote entities over the public channel for the (TMIS). We analyze the security of some of the recently proposed authentication schemes of Lin, Xie et al., Cao and Zhai, and Wu and Xu's for TMIS. Unfortunately, we identify that these schemes failed to satisfy desirable security attributes. In this article we briefly discuss four dynamic ID-based authentication schemes and demonstrate their failure to satisfy desirable security attributes. The study is aimed to demonstrate how inefficient password change phase can lead to denial of server scenario for an authorized user, and how an inefficient login phase causes the communication and computational overhead and decrease the performance of the system. Moreover, we show the vulnerability of Cao and Zhai's scheme to known session specific temporary information attack, vulnerability of Wu and Xu's scheme to off-line password guessing attack, and vulnerability of Xie et al.'s scheme to untraceable on-line password guessing attack.

High-Order Semi-Discrete Central-Upwind Schemes for Multi-Dimensional Hamilton-Jacobi Equations

NASA Technical Reports Server (NTRS)

Bryson, Steve; Levy, Doron; Biegel, Bryan (Technical Monitor)

2002-01-01

We present the first fifth order, semi-discrete central upwind method for approximating solutions of multi-dimensional Hamilton-Jacobi equations. Unlike most of the commonly used high order upwind schemes, our scheme is formulated as a Godunov-type scheme. The scheme is based on the fluxes of Kurganov-Tadmor and Kurganov-Tadmor-Petrova, and is derived for an arbitrary number of space dimensions. A theorem establishing the monotonicity of these fluxes is provided. The spacial discretization is based on a weighted essentially non-oscillatory reconstruction of the derivative. The accuracy and stability properties of our scheme are demonstrated in a variety of examples. A comparison between our method and other fifth-order schemes for Hamilton-Jacobi equations shows that our method exhibits smaller errors without any increase in the complexity of the computations.

A Quantum Proxy Blind Signature Scheme Based on Genuine Five-Qubit Entangled State

NASA Astrophysics Data System (ADS)

Zeng, Chuan; Zhang, Jian-Zhong; Xie, Shu-Cui

2017-06-01

In this paper, a quantum proxy blind signature scheme based on controlled quantum teleportation is proposed. This scheme uses a genuine five-qubit entangled state as quantum channel and adopts the classical Vernam algorithm to blind message. We use the physical characteristics of quantum mechanics to implement delegation, signature and verification. Security analysis shows that our scheme is valid and satisfy the properties of a proxy blind signature, such as blindness, verifiability, unforgeability, undeniability.

An Inherent-Optical-Property-Centered Approach to Correct the Angular Effects in Water-Leaving Radiance

DTIC Science & Technology

2011-07-01

10%. These results demonstrate that the IOP-based BRDF correction scheme (which is composed of the R„ model along with the IOP retrieval...distribution was averaged over 10 min 5. Validation of the lOP-Based BRDF Correction Scheme The IOP-based BRDF correction scheme is applied to both...oceanic and coastal waters were very consistent qualitatively and quantitatively and thus validate the IOP- based BRDF correction system, at least

Experimental demonstration of an OFDM based visible light communication system using inter-block precoding and superimposed pilots

NASA Astrophysics Data System (ADS)

Zhang, Junwei; Hong, Xuezhi; Liu, Jie; Guo, Changjian

2018-04-01

In this work, we investigate and experimentally demonstrate an orthogonal frequency division multiplexing (OFDM) based high speed wavelength-division multiplexed (WDM) visible light communication (VLC) system using an inter-block data precoding and superimposed pilots (DP-SP) based channel estimation (CE) scheme. The residual signal-to-pilot interference (SPI) can be eliminated by using inter-block data precoding, resulting in a significant improvement in estimated accuracy and the overall system performance compared with uncoded SP based CE scheme. We also study the power allocation/overhead problem of the training for DP-SP, uncoded SP and conventional preamble based CE schemes, from which we obtain the optimum signal-to-pilot power ratio (SPR)/overhead percentage for all above cases. Intra-symbol frequency-domain averaging (ISFA) is also adopted to further enhance the accuracy of CE. By using the DP-SP based CE scheme, aggregate data rates of 1.87-Gbit/s and 1.57-Gbit/s are experimentally demonstrated over 0.8-m and 2-m indoor free space transmission, respectively, using a commercially available red, green and blue (RGB) light emitting diode (LED) with WDM. Experimental results show that the DP-SP based CE scheme is comparable to the conventional preamble based CE scheme in term of received Q factor and data rate while entailing a much smaller overhead-size.

A digital memories based user authentication scheme with privacy preservation.

PubMed

Liu, JunLiang; Lyu, Qiuyun; Wang, Qiuhua; Yu, Xiangxiang

2017-01-01

The traditional username/password or PIN based authentication scheme, which still remains the most popular form of authentication, has been proved insecure, unmemorable and vulnerable to guessing, dictionary attack, key-logger, shoulder-surfing and social engineering. Based on this, a large number of new alternative methods have recently been proposed. However, most of them rely on users being able to accurately recall complex and unmemorable information or using extra hardware (such as a USB Key), which makes authentication more difficult and confusing. In this paper, we propose a Digital Memories based user authentication scheme adopting homomorphic encryption and a public key encryption design which can protect users' privacy effectively, prevent tracking and provide multi-level security in an Internet & IoT environment. Also, we prove the superior reliability and security of our scheme compared to other schemes and present a performance analysis and promising evaluation results.

A digital memories based user authentication scheme with privacy preservation

PubMed Central

Liu, JunLiang; Lyu, Qiuyun; Wang, Qiuhua; Yu, Xiangxiang

2017-01-01

The traditional username/password or PIN based authentication scheme, which still remains the most popular form of authentication, has been proved insecure, unmemorable and vulnerable to guessing, dictionary attack, key-logger, shoulder-surfing and social engineering. Based on this, a large number of new alternative methods have recently been proposed. However, most of them rely on users being able to accurately recall complex and unmemorable information or using extra hardware (such as a USB Key), which makes authentication more difficult and confusing. In this paper, we propose a Digital Memories based user authentication scheme adopting homomorphic encryption and a public key encryption design which can protect users’ privacy effectively, prevent tracking and provide multi-level security in an Internet & IoT environment. Also, we prove the superior reliability and security of our scheme compared to other schemes and present a performance analysis and promising evaluation results. PMID:29190659

A Robust and Effective Smart-Card-Based Remote User Authentication Mechanism Using Hash Function

PubMed Central

Odelu, Vanga; Goswami, Adrijit

2014-01-01

In a remote user authentication scheme, a remote server verifies whether a login user is genuine and trustworthy, and also for mutual authentication purpose a login user validates whether the remote server is genuine and trustworthy. Several remote user authentication schemes using the password, the biometrics, and the smart card have been proposed in the literature. However, most schemes proposed in the literature are either computationally expensive or insecure against several known attacks. In this paper, we aim to propose a new robust and effective password-based remote user authentication scheme using smart card. Our scheme is efficient, because our scheme uses only efficient one-way hash function and bitwise XOR operations. Through the rigorous informal and formal security analysis, we show that our scheme is secure against possible known attacks. We perform the simulation for the formal security analysis using the widely accepted AVISPA (Automated Validation Internet Security Protocols and Applications) tool to ensure that our scheme is secure against passive and active attacks. Furthermore, our scheme supports efficiently the password change phase always locally without contacting the remote server and correctly. In addition, our scheme performs significantly better than other existing schemes in terms of communication, computational overheads, security, and features provided by our scheme. PMID:24892078

A robust and effective smart-card-based remote user authentication mechanism using hash function.

PubMed

Das, Ashok Kumar; Odelu, Vanga; Goswami, Adrijit

2014-01-01

In a remote user authentication scheme, a remote server verifies whether a login user is genuine and trustworthy, and also for mutual authentication purpose a login user validates whether the remote server is genuine and trustworthy. Several remote user authentication schemes using the password, the biometrics, and the smart card have been proposed in the literature. However, most schemes proposed in the literature are either computationally expensive or insecure against several known attacks. In this paper, we aim to propose a new robust and effective password-based remote user authentication scheme using smart card. Our scheme is efficient, because our scheme uses only efficient one-way hash function and bitwise XOR operations. Through the rigorous informal and formal security analysis, we show that our scheme is secure against possible known attacks. We perform the simulation for the formal security analysis using the widely accepted AVISPA (Automated Validation Internet Security Protocols and Applications) tool to ensure that our scheme is secure against passive and active attacks. Furthermore, our scheme supports efficiently the password change phase always locally without contacting the remote server and correctly. In addition, our scheme performs significantly better than other existing schemes in terms of communication, computational overheads, security, and features provided by our scheme.

Nuclear Data Sheets for A = 157

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nica, N.; On leave from the National Institute for Physics and Nuclear Engineering “Horia Hulubei”, Bucharest; Under Subcontract No. 100586 with National Nuclear Data Center, Brookhaven National Laboratory, Upton, New York 11973

2016-02-15

The experimental results from the various reaction and decay studies leading to the nuclides {sup 157}Nd, {sup 157}Pm, {sup 157}Sm, {sup 157}Eu, {sup 157}Gd, {sup 157}Tb, {sup 157}Dy, {sup 157}Ho, {sup 157}Er, {sup 157}Tm, {sup 157}Yb, {sup 157}Lu, {sup 157}Hf, {sup 157}Ta, and {sup 157}W in the A = 157 mass chain have been reviewed. These data are summarized and presented, together with adopted level schemes and properties.

Aspects of the inverse problem for the Toda chain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kozlowski, K. K., E-mail: karol.kozlowski@u-bourgogne.fr

We generalize Babelon's approach to equations in dual variables so as to be able to treat new types of operators which we build out of the sub-constituents of the model's monodromy matrix. Further, we also apply Sklyanin's recent monodromy matrix identities so as to obtain equations in dual variables for yet other operators. The schemes discussed in this paper appear to be universal and thus, in principle, applicable to many models solvable through the quantum separation of variables.

Access-in-turn test architecture for low-power test application

NASA Astrophysics Data System (ADS)

Wang, Weizheng; Wang, JinCheng; Wang, Zengyun; Xiang, Lingyun

2017-03-01

This paper presents a novel access-in-turn test architecture (AIT-TA) for testing of very large scale integrated (VLSI) designs. In the proposed scheme, each scan cell in a chain receives test data from shift-in line in turn while pushing its test response to the shift-out line. It solves the power problem of conventional scan architecture to a great extent and suppresses significantly the switching activity during shift and capture operation with acceptable hardware overhead. Thus, it can help to implement the test at much higher operation frequencies resulting shorter test application time. The proposed test approach enhances the architecture of conventional scan flip-flops and backward compatible with existing test pattern generation and simulation techniques. Experimental results obtained for some larger ISCAS'89 and ITC'99 benchmark circuits illustrate effectiveness of the proposed low-power test application scheme.

Closing oil palm yield gaps among Indonesian smallholders through industry schemes, pruning, weeding and improved seeds

PubMed Central

Soliman, T.; Lim, F. K. S.; Lee, J. S. H.

2016-01-01

Oil palm production has led to large losses of valuable habitats for tropical biodiversity. Sparing of land for nature could in theory be attained if oil palm yields increased. The efficiency of oil palm smallholders is below its potential capacity, but the factors determining efficiency are poorly understood. We employed a two-stage data envelopment analysis approach to assess the influence of agronomic, supply chain and management factors on oil palm production efficiency in 190 smallholders in six villages in Indonesia. The results show that, on average, yield increases of 65% were possible and that fertilizer and herbicide use was excessive and inefficient. Adopting industry-supported scheme management practices, use of high-quality seeds and higher pruning and weeding rates were found to improve efficiency. Smallholder oil palm production intensification in Indonesia has the capacity to increase production by 26%, an equivalent of 1.75 million hectares of land. PMID:27853605

Backup agreements with penalty scheme under supply disruptions

NASA Astrophysics Data System (ADS)

Hou, Jing; Zhao, Lindu

2012-05-01

This article considers a supply chain for a single product involving one retailer and two independent suppliers, when the main supplier might fail to supply the products, the backup supplier can always supply the products at a higher price. The retailer could use the backup supplier as a regular provider or a stand-by source by reserving some products at the supplier. A backup agreement with penalty scheme is constructed between the retailer and the backup supplier to mitigate the supply disruptions and the demand uncertainty. The expected profit functions and the optimal decisions of the two players are derived through a sequential optimisation process. Then, the sensitivity of two players' expected profits to various input factors is examined through numerical examples. The impacts of the disruption probability and the demand uncertainty on the backup agreement are also investigated, which could provide guideline for how to use each sourcing method.

Closing oil palm yield gaps among Indonesian smallholders through industry schemes, pruning, weeding and improved seeds.

PubMed

Soliman, T; Lim, F K S; Lee, J S H; Carrasco, L R

2016-08-01

Oil palm production has led to large losses of valuable habitats for tropical biodiversity. Sparing of land for nature could in theory be attained if oil palm yields increased. The efficiency of oil palm smallholders is below its potential capacity, but the factors determining efficiency are poorly understood. We employed a two-stage data envelopment analysis approach to assess the influence of agronomic, supply chain and management factors on oil palm production efficiency in 190 smallholders in six villages in Indonesia. The results show that, on average, yield increases of 65% were possible and that fertilizer and herbicide use was excessive and inefficient. Adopting industry-supported scheme management practices, use of high-quality seeds and higher pruning and weeding rates were found to improve efficiency. Smallholder oil palm production intensification in Indonesia has the capacity to increase production by 26%, an equivalent of 1.75 million hectares of land.

Perception as a closed-loop convergence process.

PubMed

Ahissar, Ehud; Assa, Eldad

2016-05-09

Perception of external objects involves sensory acquisition via the relevant sensory organs. A widely-accepted assumption is that the sensory organ is the first station in a serial chain of processing circuits leading to an internal circuit in which a percept emerges. This open-loop scheme, in which the interaction between the sensory organ and the environment is not affected by its concurrent downstream neuronal processing, is strongly challenged by behavioral and anatomical data. We present here a hypothesis in which the perception of external objects is a closed-loop dynamical process encompassing loops that integrate the organism and its environment and converging towards organism-environment steady-states. We discuss the consistency of closed-loop perception (CLP) with empirical data and show that it can be synthesized in a robotic setup. Testable predictions are proposed for empirical distinction between open and closed loop schemes of perception.

Perception as a closed-loop convergence process

PubMed Central

Ahissar, Ehud; Assa, Eldad

2016-01-01

Perception of external objects involves sensory acquisition via the relevant sensory organs. A widely-accepted assumption is that the sensory organ is the first station in a serial chain of processing circuits leading to an internal circuit in which a percept emerges. This open-loop scheme, in which the interaction between the sensory organ and the environment is not affected by its concurrent downstream neuronal processing, is strongly challenged by behavioral and anatomical data. We present here a hypothesis in which the perception of external objects is a closed-loop dynamical process encompassing loops that integrate the organism and its environment and converging towards organism-environment steady-states. We discuss the consistency of closed-loop perception (CLP) with empirical data and show that it can be synthesized in a robotic setup. Testable predictions are proposed for empirical distinction between open and closed loop schemes of perception. DOI: http://dx.doi.org/10.7554/eLife.12830.001 PMID:27159238

A novel method for trajectory planning of cooperative mobile manipulators.

PubMed

Bolandi, Hossein; Ehyaei, Amir Farhad

2011-01-01

We have designed a two-stage scheme to consider the trajectory planning problem of two mobile manipulators for cooperative transportation of a rigid body in the presence of static obstacles. In the first stage, with regard to the static obstacles, we develop a method that searches the workspace for the shortest possible path between the start and goal configurations, by constructing a graph on a portion of the configuration space that satisfies the collision and closure constraints. The final stage is to calculate a sequence of time-optimal trajectories to go between the consecutive points of the path, with regard to the nonholonomic constraints and the maximum allowed joint accelerations. This approach allows geometric constraints such as joint limits and closed-chain constraints, along with differential constraints such as nonholonomic velocity constraints and acceleration limits, to be incorporated into the planning scheme. The simulation results illustrate the effectiveness of the proposed method.

A Novel Method for Trajectory Planning of Cooperative Mobile Manipulators

PubMed Central

Bolandi, Hossein; Ehyaei, Amir Farhad

2011-01-01

We have designed a two-stage scheme to consider the trajectory planning problem of two mobile manipulators for cooperative transportation of a rigid body in the presence of static obstacles. In the first stage, with regard to the static obstacles, we develop a method that searches the workspace for the shortest possible path between the start and goal configurations, by constructing a graph on a portion of the configuration space that satisfies the collision and closure constraints. The final stage is to calculate a sequence of time-optimal trajectories to go between the consecutive points of the path, with regard to the nonholonomic constraints and the maximum allowed joint accelerations. This approach allows geometric constraints such as joint limits and closed-chain constraints, along with differential constraints such as nonholonomic velocity constraints and acceleration limits, to be incorporated into the planning scheme. The simulation results illustrate the effectiveness of the proposed method. PMID:22606656

A remark on the GNSS single difference model with common clock scheme for attitude determination

NASA Astrophysics Data System (ADS)

Chen, Wantong

2016-09-01

GNSS-based attitude determination technique is an important field of study, in which two schemes can be used to construct the actual system: the common clock scheme and the non-common clock scheme. Compared with the non-common clock scheme, the common clock scheme can strongly improve both the reliability and the accuracy. However, in order to gain these advantages, specific care must be taken in the implementation. The cares are thus discussed, based on the generating technique of carrier phase measurement in GNSS receivers. A qualitative assessment of potential phase bias contributes is also carried out. Possible technical difficulties are pointed out for the development of single-board multi-antenna GNSS attitude systems with a common clock.

Asynchronous error-correcting secure communication scheme based on fractional-order shifting chaotic system

NASA Astrophysics Data System (ADS)

Chao, Luo

2015-11-01

In this paper, a novel digital secure communication scheme is firstly proposed. Different from the usual secure communication schemes based on chaotic synchronization, the proposed scheme employs asynchronous communication which avoids the weakness of synchronous systems and is susceptible to environmental interference. Moreover, as to the transmission errors and data loss in the process of communication, the proposed scheme has the ability to be error-checking and error-correcting in real time. In order to guarantee security, the fractional-order complex chaotic system with the shifting of order is utilized to modulate the transmitted signal, which has high nonlinearity and complexity in both frequency and time domains. The corresponding numerical simulations demonstrate the effectiveness and feasibility of the scheme.

Student Loans Schemes in Mauritius: Experience, Analysis and Scenarios

ERIC Educational Resources Information Center

Mohadeb, Praveen

2006-01-01

This study makes a comprehensive review of the situation of student loans schemes in Mauritius, and makes recommendations, based on best practices, for setting up a national scheme that attempts to avoid weaknesses identified in some of the loans schemes of other countries. It suggests that such a scheme would be cost-effective and beneficial both…

A Hybrid Key Management Scheme for WSNs Based on PPBR and a Tree-Based Path Key Establishment Method

PubMed Central

Zhang, Ying; Liang, Jixing; Zheng, Bingxin; Chen, Wei

2016-01-01

With the development of wireless sensor networks (WSNs), in most application scenarios traditional WSNs with static sink nodes will be gradually replaced by Mobile Sinks (MSs), and the corresponding application requires a secure communication environment. Current key management researches pay less attention to the security of sensor networks with MS. This paper proposes a hybrid key management schemes based on a Polynomial Pool-based key pre-distribution and Basic Random key pre-distribution (PPBR) to be used in WSNs with MS. The scheme takes full advantages of these two kinds of methods to improve the cracking difficulty of the key system. The storage effectiveness and the network resilience can be significantly enhanced as well. The tree-based path key establishment method is introduced to effectively solve the problem of communication link connectivity. Simulation clearly shows that the proposed scheme performs better in terms of network resilience, connectivity and storage effectiveness compared to other widely used schemes. PMID:27070624

TripSense: A Trust-Based Vehicular Platoon Crowdsensing Scheme with Privacy Preservation in VANETs

PubMed Central

Hu, Hao; Lu, Rongxing; Huang, Cheng; Zhang, Zonghua

2016-01-01

In this paper, we propose a trust-based vehicular platoon crowdsensing scheme, named TripSense, in VANET. The proposed TripSense scheme introduces a trust-based system to evaluate vehicles’ sensing abilities and then selects the more capable vehicles in order to improve sensing results accuracy. In addition, the sensing tasks are accomplished by platoon member vehicles and preprocessed by platoon head vehicles before the data are uploaded to server. Hence, it is less time-consuming and more efficient compared with the way where the data are submitted by individual platoon member vehicles. Hence it is more suitable in ephemeral networks like VANET. Moreover, our proposed TripSense scheme integrates unlinkable pseudo-ID techniques to achieve PM vehicle identity privacy, and employs a privacy-preserving sensing vehicle selection scheme without involving the PM vehicle’s trust score to keep its location privacy. Detailed security analysis shows that our proposed TripSense scheme not only achieves desirable privacy requirements but also resists against attacks launched by adversaries. In addition, extensive simulations are conducted to show the correctness and effectiveness of our proposed scheme. PMID:27258287

Differential cytotoxicity of long-chain bases for human oral gingival epithelial keratinocytes, oral fibroblasts, and dendritic cells

PubMed Central

Mehalick, Leslie A.; Poulsen, Christopher; Fischer, Carol L.; Lanzel, Emily A.; Bates, Amber M.; Walters, Katherine S.; Cavanaugh, Joseph E.; Guthmiller, Janet M.; Johnson, Georgia K.; Wertz, Philip W.; Brogden, Kim A.

2015-01-01

Long-chain bases, found in the oral cavity, have potent antimicrobial activity against oral pathogens. In an article associated with this dataset, Poulson and colleagues determined the cytotoxicities of long-chain bases (sphingosine, dihydrosphingosine, and phytosphingosine) for human oral gingival epithelial (GE) keratinocytes, oral gingival fibroblasts (GF), dendritic cells (DC), and squamous cell carcinoma (SCC) cell lines [1]. Poulson and colleagues found that GE keratinocytes were more resistant to long-chain bases as compared to GF, DC, and SCC cell lines [1]. In this study, we assess the susceptibility of DC to lower concentrations of long chain bases. 0.2–10.0 µM long-chain bases and GML were not cytotoxic to DC; 40.0–80.0 µM long-chain bases, but not GML, were cytotoxic for DC; and 80.0 µM long-chain bases were cytotoxic to DC and induced cellular damage and death in less than 20 mins. Overall, the LD50 of long-chain bases for GE keratinocytes, GF, and DC were considerably higher than their minimal inhibitory concentrations for oral pathogens, a finding important to pursuing their future potential in treating periodontal and oral infections. PMID:26550599