High-efficient extraction of principal medicinal components from fresh Phellodendron bark (cortex phellodendri).

PubMed

Xu, Keqin; He, Gongxiu; Qin, Jieming; Cheng, Xuexiang; He, Hanjie; Zhang, Dangquan; Peng, Wanxi

2018-05-01

There are three key medicinal components (phellodendrine, berberine and palmatine) in the extracts of Phellodendron bark, as one of the fundamental herbs of traditional Chinese medicine. Different extraction methods and solvent combinations were investigated to obtain the optimal technologies for high-efficient extraction of these medicinal components. The results showed that combined solvents have higher extracting effect of phellodendrine, berberine and palmatine than single solvent, and the effect of ultrasonic extraction is distinctly better than those of distillation and soxhlet extraction. The hydrochloric acid/methanol-ultrasonic extraction has the best effect for three medicinal components of fresh Phellodendron bark, providing an extraction yield of 103.12 mg/g berberine, 24.41 mg/g phellodendrine, 1.25 mg/g palmatine.

Recent advances in herbal medicines treating Parkinson's disease.

PubMed

Li, Xu-Zhao; Zhang, Shuai-Nan; Liu, Shu-Min; Lu, Fang

2013-01-01

Herbal medicines have attracted considerable attention in recent years, which are used to treat Parkinson's disease (PD) in China based on traditional Chinese medicine or modern pharmacological theories. We summarized and analyzed the anti-Parkinsonian activities of herbal medicines and herbal formulations investigated in PD models and provide future references for basic and clinical investigations. All the herbal medicines and herbal formulations were tested on PD models in vitro and in vivo. The relevant compounds and herbal extracts with anti-Parkinsonian activities were included and analyzed according to their genera or pharmacological activities. A total of 38 herbal medicines and 11 herbal formulations were analyzed. The relevant compounds, herbal extracts and formulations were reported to be effective on PD models by modulating multiple key events or signaling pathways implicated in the pathogenesis of PD. The plant species of these herbal medicines belong to 24 genera and 18 families, such as Acanthopanax, Alpinia and Astragalus, etc. These herbal medicines can be an alternative and valuable source for anti-Parkinsonian drug discovery. The plant species in these genera and families may be the most promising candidates for further investigation and deserve further consideration in clinical trials. Active components in some of the herbal extracts and the compatibility law of herbal formulations remain to be further investigated. Copyright © 2012 Elsevier B.V. All rights reserved.

The Use and the Prescription Pattern of Traditional Chinese Medicine Among Urolithiasis Patients in Taiwan: A Population-Based Study.

PubMed

Lin, Po-Hung; Lin, Shun-Ku; Hsu, Ren-Jun; Cheng, Kuan-Chen; Liu, Jui-Ming

2016-01-01

To investigate the pattern of Traditional Chinese Medicine (TCM) usage for urolithiasis patients in Taiwan and to determine the most common Chinese herbal products used for urolithiasis. Retrospective review of urolithiasis patients treated with TCM treatment. One million randomly selected samples in the Taiwanese National Health Insurance Research Database between 1997 and 2008. Eighty-two thousand five hundred and fifty-one newly diagnosed urolithiasis patients. The correlation between TCM treatment, demographic factors, or medical conditions. A total of 62.6% of urolithiasis patients use TCM treatment. A younger age, female gender, polypharmacy, multiple comorbidities, and stone in the lower urinary tract result in a greater tendency to use TCM, after adjusting for demographic factors. Jia-Wei-Xiao-Yao-San Extract Powder and Ji-Sheng-Shen-Qi-Wan Extract Powder are the most frequently prescribed Chinese medicine formulae. This is the first study to examine the use of and the prescription pattern for TCM in urolithiasis patients using a random, national population-based sample. More than 62% of urolithiasis patients use TCM, and patients with polypharmacy, multiple comorbidities, and stone in the ureter are more likely to use TCM. The most frequently prescribed Chinese medicine formulae were Jia-Wei-Xiao-Yao-San Extract Powder and Ji-Sheng-Shen-Qi-Wan Extract Powder, which were reported to retard the progression of renal failure and alleviate flank pain or tenderness.

Determination of rutin and quercetin in Chinese herbal medicine by ionic liquid-based pressurized liquid extraction-liquid chromatography-chemiluminescence detection.

PubMed

Wu, Hongwei; Chen, Meilan; Fan, Yunchang; Elsebaei, Fawzi; Zhu, Yan

2012-01-15

A novel ionic liquid-based pressurized liquid extraction (IL-PLE) procedure coupled with high performance liquid chromatography (HPLC) tandem chemiluminescence (CL) detection capable of quantifying trace amounts of rutin and quercetin in four Chinese medicine plants including Flos sophorae Immaturus, Crateagus pinnatifida Bunge, Hypericum japonicum Thunb and Folium Mori was described in this paper. To avoid environmental pollution and toxicity to the operators, ionic liquids (ILs), 1-alkyl-3-methylimidazolium chloride ([C(n)mim][Cl]) aqueous solutions were used in the PLE procedure as extractants replacing traditional organic solvents. In addition, chemiluminescence detection was utilized for its minimal interference from endogenous components of complex matrix. Parameters affecting extraction and analysis were carefully optimized. Compared with the conventional ultrasonic-assisted extraction (UAE) and heat-reflux extraction (HRE), the optimized method achieved the highest extraction efficiency in the shortest extraction time with the least solvent consumption. The applicability of the proposed method to real sample was confirmed. Under the optimized conditions, good reproducibility of extraction performance was obtained and good linearity was observed with correlation coefficients (r) between 0.9997 and 0.9999. The detection limits of rutin and quercetin (LOD, S/N=3) were 1.1×10(-2)mg/L and 3.8×10(-3)mg/L, respectively. The average recoveries of rutin and quercetin for real samples were 93.7-105% with relative standard deviation (RSD) lower than 5.7%. To the best of our knowledge, this paper is the first contribution to utilize a combination of IL-PLE with chemiluminescence detection. And the experimental results indicated that the proposed method shows a promising prospect in extraction and determination of rutin and quercetin in medicinal plants. Copyright © 2011 Elsevier B.V. All rights reserved.

Antimicrobial Activity, Phenolic Content, and Cytotoxicity of Medicinal Plant Extracts Used for Treating Dermatological Diseases and Wound Healing in KwaZulu-Natal, South Africa

PubMed Central

Ghuman, Shanaz; Ncube, Bhekumthetho; Finnie, Jeffrey F.; McGaw, Lyndy J.; Coopoosamy, Roger M.; Van Staden, Johannes

2016-01-01

Medicinal plants used for wound healing and skin diseases are the key to unlocking the doors to combating problematic skin diseases as resistance of pathogens to pharmaceuticals and allopathic management continues to increase. The study aimed at investigating the antimicrobial efficacies, phenolic content, and cytotoxicity effects of 11 medicinal plant extracts commonly used for treating skin conditions and wound healing in traditional medicine within KwaZulu-Natal. Eleven plant species were separated into different plant parts (bulbs, roots, leaves) and extracted with different solvents. The extracts were assessed for antimicrobial activity against six Gram-positive and seven Gram-negative bacterial strains and four fungi commonly associated with skin conditions using disc diffusion and microdilution techniques. The aqueous methanolic extracts were screened for phenolic content while cytotoxicity tests were performed on all extracts using the brine shrimp lethality and tetrazolium–based colorimetric (MTT) assays. Extracts from Aloe ferox, A. arborescens, and Hypericum aethiopicum were the most active against almost all of the tested bacterial and fungal strains. All plant species exhibited some degree of antimicrobial activity. Total phenolic levels, flavonoids and tannins were also higher for A. ferox, followed by A. arborescens and H. aethiopicum, respectively. The cytotoxicity results of all plant extracts were in the range of 90–100% survival after 24 h in the brine shrimp assay. Extracts considered lethal would demonstrate >50% shrimp death. The MTT cytotoxicity test yielded LC50 values of >1 mg/mL on all extracts indicating that they are not cytotoxic. The observed antimicrobial efficacy demonstrated by some plant species and the general lack of cytotoxic effects on all the tested extracts presents some promising and beneficial aspects of these medicinal plant extracts in the treatment of skin diseases and wound healing. The two Aloe species and H. aethiopicum were among the best extracts that exhibited consistently good antimicrobial activity and warrants further investigations and possible isolation of bioactive principles. PMID:27746731

[Study of extracting Peucedanum praeruptorum planted area in Ningguo of Anhui province based on multi-source and multi-phase image].

PubMed

Shi, Ting-Ting; Zhang, Xiao-Bo; Zhang, Ke; Guo, Lan-Ping; Huang, Lu-Qi

2017-11-01

The herbs used as the material for traditional Chinese medicine are always planted in the mountainous area where the natural environment is suitable. As the mountain terrain is complex and the distribution of planting plots is scattered, the traditional survey method is difficult to obtain accurate planting area. It is of great significance to provide decision support for the conservation and utilization of traditional Chinese medicine resources by studying the method of extraction of Chinese herbal medicine planting area based on remote sensing and realizing the dynamic monitoring and reserve estimation of Chinese herbal medicines. In this paper, taking the Peucedanum praeruptorum planted area in Ningguo prefecture of Anhui province as an example, the multispectral remote sensing images that include Landsat-8 with a 30 m resolution and China-made GF-1 with a 16 m resolution were used as data source. Since the spectral characteristics of P. praeruptorum in the two periods are different from those of other crops, the changes of the images at two stages in the same year could be used to extract the P. praeruptorum planted area intercropped in cultivated land. Then the texture and spectral characteristics of young pecan trees were used to extract the P. praeruptorum planted area intercropped in woodland. The results showed that the extracted area of planted P. praeruptorum with the original imagery of 30 m spatial resolution and 16 m spatial resolution was 25 635.43,24 585.43 mu, respectively. Copyright© by the Chinese Pharmaceutical Association.

Antimalarial evaluation of selected medicinal plant extracts used in Iranian traditional medicine

PubMed Central

Haddad, Mohammad Hossein Feiz; Mahbodfar, Hamidreza; Zamani, Zahra; Ramazani, Ali

2017-01-01

Objective(s): In an attempt to discover new natural active extracts against malaria parasites, the present study evaluated the antiplasmodial properties of selected plants based on Iranian traditional medicine. Materials and Methods: Ten plant species found in Iran were selected and collected based on the available literature about the Iranian traditional medicine. The methanolic extracts of these plants were investigated for in vitro antimalarial properties against chloroquine-sensitive (3D7) and multi-drug resistant (K1) strains of Plasmodium falciparum. Their in vivo activity against Plasmodium berghei infection in mice was also determined. Cytotoxicity tests were carried out using the Raji cells line using the MTT assay. The extracts were phytochemically screened for their active constituents. Results: According to the IC50 and selectivity index (SI) values, of the 10 selected plant species, Citrullus colocynthis, Physalis alkekengi, and Solanum nigrum displayed potent in vitro antimalarial activity against both 3D7 and K1 strains with no toxicity (IC50= 2.01-18.67 µg/ml and SI=3.55 to 19.25). Comparisons between treated and untreated control mice showed that the mentioned plant species reduced parasitemia by 65.08%, 57.97%, and 60.68%, respectively. The existence of antiplasmodial compounds was detected in these plant extracts. Conclusion: This was the first study to highlight the in vitro and in vivo antiplasmodial effects of C. colocynthis, P. alkekengi, and S. nigrum in Iran. Future studies can use these findings to design further biological tests to identify the active constituents of the mentioned plant species and clarify their mechanism of action. PMID:28804611

In vitro anti-mycobacterial activity of nine medicinal plants used by ethnic groups in Sonora, Mexico.

PubMed

Robles-Zepeda, Ramón Enrique; Coronado-Aceves, Enrique Wenceslao; Velázquez-Contreras, Carlos Arturo; Ruiz-Bustos, Eduardo; Navarro-Navarro, Moisés; Garibay-Escobar, Adriana

2013-11-25

Sonoran ethnic groups (Yaquis, Mayos, Seris, Guarijíos, Pimas, Kikapúes and Pápagos) use mainly herbal based preparations as their first line of medicinal treatment. Among the plants used are those with anti-tuberculosis properties; however, no formal research is available. Organic extracts were obtained from nine medicinal plants traditionally used by Sonoran ethnic groups to treat different kinds of diseases; three of them are mainly used to treat tuberculosis. All of the extracts were tested against Mycobacterium tuberculosis H37Rv using the Alamar Blue redox bioassay. Methanolic extracts from Ambrosia confertiflora, Ambrosia ambrosioides and Guaiacum coulteri showed minimal inhibitory concentration (MIC) values of 200, 790 and 1000 μg/mL, respectively, whereas no effect was observed with the rest of the methanolic extracts at the concentrations tested. Chloroform, dichloromethane, and ethyl acetate extracts from Ambrosia confertiflora showed a MIC of 90, 120 and 160 μg/mL, respectively. A. confertiflora and A. ambrosioides showed the best anti-mycobacterial activity in vitro. The activity of Guaiacum coulteri is consistent with the traditional use by Sonoran ethnic groups as anti-tuberculosis agent.For these reasons, it is important to investigate a broader spectrum of medicinal plants in order to find compounds active against Mycobacterium tuberculosis.

Standardization of Cassia spectabilis with respect to authenticity, assay and chemical constituent analysis.

PubMed

Torey, Angeline; Sasidharan, Sreenivasan; Yeng, Chen; Latha, Lachimanan Yoga

2010-05-10

Quality control standardizations of the various medicinal plants used in traditional medicine is becoming more important today in view of the commercialization of formulations based on these plants. An attempt at standardization of Cassia spectabilis leaf has been carried out with respect to authenticity, assay and chemical constituent analysis. The authentication involved many parameters, including gross morphology, microscopy of the leaves and functional group analysis by Fourier Transform Infrared (FTIR) spectroscopy. The assay part of standardization involved determination of the minimum inhibitory concentration (MIC) of the extract which could help assess the chemical effects and establish curative values. The MIC of the C. spectabilis leaf extracts was investigated using the Broth Dilution Method. The extracts showed a MIC value of 6.25 mg/mL, independent of the extraction time. The chemical constituent aspect of standardization involves quantification of the main chemical components in C. spectabilis. The GCMS method used for quantification of 2,4-(1H,3H)-pyrimidinedione in the extract was rapid, accurate, precise, linear (R(2) = 0.8685), rugged and robust. Hence this method was suitable for quantification of this component in C. spectabilis. The standardization of C. spectabilis is needed to facilitate marketing of medicinal plants, with a view to promoting the export of valuable Malaysian Traditional Medicinal plants such as C. spectabilis.

27 CFR 17.181 - Exportation of medicinal preparations and flavoring extracts.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Exportation of medicinal... USED IN MANUFACTURING NONBEVERAGE PRODUCTS Miscellaneous Provisions § 17.181 Exportation of medicinal preparations and flavoring extracts. Medicinal preparations and flavoring extracts, approved for drawback under...

[Advancements of computer chemistry in separation of Chinese medicine].

PubMed

Li, Lingjuan; Hong, Hong; Xu, Xuesong; Guo, Liwei

2011-12-01

Separating technique of Chinese medicine is not only a key technique in the field of Chinese medicine' s research and development, but also a significant step in the modernization of Chinese medicinal preparation. Computer chemistry can build model and look for the regulations from Chinese medicine system which is full of complicated data. This paper analyzed the applicability, key technology, basic mode and common algorithm of computer chemistry applied in the separation of Chinese medicine, introduced the mathematic mode and the setting methods of Extraction kinetics, investigated several problems which based on traditional Chinese medicine membrane procession, and forecasted the application prospect.

Studies on detection and analysis of proteases in leaf extract of medicinally important plants.

PubMed

Chinnadurai, Gandhi Shree; Krishnan, Sivakumar; Perumal, Palani

2018-02-01

The whole plant or the extracts obtained from them have long been used as medicine to treat various human diseases and disorders. Notably, those plants endowed with protease activity have been traditionally used as the agents for treating tumors, digestion disorders, swelling, blood coagulation, fibrinolysis and also for immune-modulation. Proteases occupy a pivotal position in enzyme based industries. Plant proteases have been increasingly exploited for pharmaceutical, food, leather and textile processing industries. Earlier investigations have focused on the occurrence of proteases in medicinally unimportant plants. Therefore it has been aimed to study the occurrence of proteolytic enzymes from medicinally important plants establish any correlation exists between protease activity and medicinal use of individual plants. Crude extract were obtained from the leaves of 80 different medicinal plants. Tris-HCl buffer was used as the extraction buffer and the supernatants obtained were used for determination of total protein and protease activity using spectrophotometric methods. Qualitative screening for the presence of protease was carried out with agar diffusion method by incorporating the substrate. SDS-PAGE was used to analyse the isoforms of protease and for determination of relative molecular mass. Relatively higher protease activities were observed in the extracts of leaves of Pongamia pinnata (Fabaceae), Wrightia tinctoria (Apocyanaceae) Acalypha indica (Euphorbiaceae), Adhatoda vasica (Acanthaceae) and Curcuma longa (Zingiberaceae). No correlation was found between the total protein content and protease activity in individual plant species. SDS-PAGE analysis indicated the presence of multiple forms of protease of higher molecular weight range in several plant species. We found a strong correlation between the protease activity and medicinal application of the plant CONCLUSION: The present study has unequivocally revealed that the leaves of medicinal plants could serve as excellent sources of proteases which could be exploited for various industrial, food and pharmaceutical applications. Copyright © 2018 Elsevier GmbH. All rights reserved.

Cree antidiabetic plant extracts display mechanism-based inactivation of CYP3A4.

PubMed

Tam, Teresa W; Liu, Rui; Arnason, John T; Krantis, Anthony; Staines, William A; Haddad, Pierre S; Foster, Brian C

2011-01-01

Seventeen Cree antidiabetic medicinal plants were studied to determine their potential to inhibit cytochrome P450 3A4 (CYP3A4) through mechanism-based inactivation (MBI). The ethanolic extracts of the medicinal plants were studied for their inhibition of CYP3A4 using the substrates testosterone and dibenzylfluorescein (DBF) in high pressure liquid chromatography (HPLC) and microtiter fluorometric assays, respectively. Using testosterone as a substrate, extracts of Alnus incana, Sarracenia purpurea, and Lycopodium clavatum were identified as potent CYP3A4 MBIs, while those from Abies balsamea, Picea mariana, Pinus banksiana, Rhododendron tomentosum, Kalmia angustifolia, and Picea glauca were identified as less potent inactivators. Not unexpectedly, the other substrate, DBF, showed a different profile of inhibition. Only A. balsamea was identified as a CYP3A4 MBI using DBF. Abies balsamea displayed both NADPH- and time-dependence of CYP3A4 inhibition using both substrates. Overall, several of the medicinal plants may markedly deplete CYP3A4 through MBI and, consequently, decrease the metabolism of CYP3A4 substrates including numerous medications used by diabetics.

Online solid-phase extraction with high-performance liquid chromatography and mass spectrometry for the determination of five tannins in traditional Chinese medicine injections.

PubMed

Sun, Meng; Lin, Yuanyuan; Zhang, Jie; Zheng, Shaohua; Wang, Sicen

2016-03-01

A rapid analytical method based on online solid-phase extraction with high-performance liquid chromatography and mass spectrometry has been established and applied to the determination of tannin compounds that may cause adverse effects in traditional Chinese medicine injections. Different solid-phase extraction sorbents have been compared and the elution buffer was optimized. The performance of the method was verified by evaluation of recovery (≥40%), repeatability (RSD ≤ 6%), linearity (r(2) ≥ 0.993), and limit of quantification (≤0.35 μg/mL). Five tannin compounds, gallic acid, cianidanol, gallocatechin gallate, ellagic acid, and penta-O-galloylglucose, were identified with concentrations ranging from 3.1-37.4 μg/mL in the analyzed traditional Chinese medicine injections. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Bibliometric investigation on preventive medicine in North Korea: a coauthor and keyword network analysis.

PubMed

Jung, Minsoo

2013-01-01

This study examined the 2 preventive medicine journals in North Korea by using coauthor and keyword network analysis on the basis of medical informatics and bibliometrics. Used were the Journal of Chosun Medicine (JCM) and the Journal of Preventive Medicine (JPM) (from the first volume of 1997 to the fourth volume of 2006) as data. Extracted were 1734 coauthors from 1104 articles and 1567 coauthors from 1172 articles, respectively. Huge single components were extracted in the coauthor analysis, which indicated a tendency toward structuralization. However, the 2 journals differed in that JPM showed a relative tendency toward specialization, whereas JCM showed one toward generalization. Seventeen and 33 keywords were extracted from each journal in the keyword analysis; JCM mainly concerned pathological research, whereas JPM mainly concerned virus and basic medicine studies that were based on infection and immunity. In contrast to South Korea, North Korea has developed Juche medicine, which came from self-reliance ideology and gratuitous medical service. According to the present study, their ideology was embodied by the discovery of bacteria, study on immune system, and emphasis on pathology, on the basis of experimental epidemiology. However, insufficient research has been conducted thus far on population health and its related determinants.

Inhibition of chemiluminescence and chemotactic activity of phagocytes in vitro by the extracts of selected medicinal plants.

PubMed

Jantan, Ibrahim; Harun, Nurul Hikmah; Septama, Abdi Wira; Murad, Shahnaz; Mesaik, M A

2011-04-01

The methanol extracts of 20 selected medicinal plants were investigated for their effects on the respiratory burst of human whole blood, isolated human polymorphonuclear leukocytes (PMNs) and isolated mice macrophages using a luminol/lucigenin-based chemiluminescence assay. We also tested the effect of the extracts on chemotactic migration of PMNs using the Boyden chamber technique. The extracts of Curcuma domestica L., Phyllanthus amarus Schum & Thonn and C. xanthorrhiza Roxb. were the samples producing the strongest oxidative burst of PMNs with luminol-based chemiluminescence, with IC(50) values ranging from 0.5 to 0.7 μg/ml. For macrophage cells, the extracts which showed strong suppressive activity for luminol-based chemiluminescence were C. xanthorrhiza and Garcinia mangostana L. Among the extracts studied, C. mangga Valton & Vazsjip, Piper nigrum L. and Labisia pumila var. alata showed strong inhibitory activity on lucigenin-amplified oxidative burst of PMNs, with IC(50) values ranging from 0.9 to 1.5 μg/ml. The extracts of Zingiber officinale Rosc., Alpinia galangal (L.) Willd and Averrhoa bilimbi Linn showed strong inhibition on the chemotaxic migration of cells, with IC(50) values comparable to that of ibuprofen (1.5 μg/ml). The results suggest that some of these plants were able to modulate the innate immune response of phagocytes at different steps, emphasizing their potential as a source of new immunomodulatory agents.

[Application of regular expression in extracting key information from Chinese medicine literatures about re-evaluation of post-marketing surveillance].

PubMed

Wang, Zhifei; Xie, Yanming; Wang, Yongyan

2011-10-01

Computerizing extracting information from Chinese medicine literature seems more convenient than hand searching, which could simplify searching process and improve the accuracy. However, many computerized auto-extracting methods are increasingly used, regular expression is so special that could be efficient for extracting useful information in research. This article focused on regular expression applying in extracting information from Chinese medicine literature. Two practical examples were reported in this article about regular expression to extract "case number (non-terminology)" and "efficacy rate (subgroups for related information identification)", which explored how to extract information in Chinese medicine literature by means of some special research method.

[Monitoring method of extraction process for Schisandrae Chinensis Fructus based on near infrared spectroscopy and multivariate statistical process control].

PubMed

Xu, Min; Zhang, Lei; Yue, Hong-Shui; Pang, Hong-Wei; Ye, Zheng-Liang; Ding, Li

2017-10-01

To establish an on-line monitoring method for extraction process of Schisandrae Chinensis Fructus, the formula medicinal material of Yiqi Fumai lyophilized injection by combining near infrared spectroscopy with multi-variable data analysis technology. The multivariate statistical process control (MSPC) model was established based on 5 normal batches in production and 2 test batches were monitored by PC scores, DModX and Hotelling T2 control charts. The results showed that MSPC model had a good monitoring ability for the extraction process. The application of the MSPC model to actual production process could effectively achieve on-line monitoring for extraction process of Schisandrae Chinensis Fructus, and can reflect the change of material properties in the production process in real time. This established process monitoring method could provide reference for the application of process analysis technology in the process quality control of traditional Chinese medicine injections. Copyright© by the Chinese Pharmaceutical Association.

19 CFR 191.101 - Drawback allowance.

Code of Federal Regulations, 2010 CFR

2010-04-01

... TREASURY (CONTINUED) DRAWBACK Internal Revenue Tax on Flavoring Extracts and Medicinal or Toilet... revenue tax upon the exportation of flavoring extracts and medicinal or toilet preparations (including... tax on flavoring extracts or medicinal or toilet preparations (including perfumery) manufactured or...

The merit of medicinal mushrooms from a pharmaceutical point of view.

PubMed

Lindequist, Ulrike

2013-01-01

Whereas pharmaceuticals prepared by extraction of medicinal plants constitute an important part of evidence-based medicine also in the Western Hemisphere, medicinal mushrooms are mainly used as dietary supplements without declaration of a medical indication. Scientific investigations and case studies from Asian medicine show that fungi have very promising pharmacological potential. This article provides an overview of the principles of authorization and market access of herbal drugs in Europe, with special reference to Germany. The current status regarding mushrooms is reported, with an aim toward supporting the development of legalized pharmaceutical preparations of medicinal mushrooms in Europe.

In vitro anti-mycobacterial activity of nine medicinal plants used by ethnic groups in Sonora, Mexico

PubMed Central

2013-01-01

Background Sonoran ethnic groups (Yaquis, Mayos, Seris, Guarijíos, Pimas, Kikapúes and Pápagos) use mainly herbal based preparations as their first line of medicinal treatment. Among the plants used are those with anti-tuberculosis properties; however, no formal research is available. Methods Organic extracts were obtained from nine medicinal plants traditionally used by Sonoran ethnic groups to treat different kinds of diseases; three of them are mainly used to treat tuberculosis. All of the extracts were tested against Mycobacterium tuberculosis H37Rv using the Alamar Blue redox bioassay. Results Methanolic extracts from Ambrosia confertiflora, Ambrosia ambrosioides and Guaiacum coulteri showed minimal inhibitory concentration (MIC) values of 200, 790 and 1000 μg/mL, respectively, whereas no effect was observed with the rest of the methanolic extracts at the concentrations tested. Chloroform, dichloromethane, and ethyl acetate extracts from Ambrosia confertiflora showed a MIC of 90, 120 and 160 μg/mL, respectively. Conclusions A. confertiflora and A. ambrosioides showed the best anti-mycobacterial activity in vitro. The activity of Guaiacum coulteri is consistent with the traditional use by Sonoran ethnic groups as anti-tuberculosis agent. For these reasons, it is important to investigate a broader spectrum of medicinal plants in order to find compounds active against Mycobacterium tuberculosis. PMID:24267469

Antimicrobial and anti-Quorum Sensing activities of selected medicinal plants of Ethiopia: Implication for development of potent antimicrobial agents.

PubMed

Bacha, Ketema; Tariku, Yinebeb; Gebreyesus, Fisseha; Zerihun, Shibru; Mohammed, Ali; Weiland-Bräuer, Nancy; Schmitz, Ruth A; Mulat, Mulugeta

2016-07-11

Traditional medicinal plants have been used as an alternative medicine in many parts of the world, including Ethiopia. There are many documented scientific reports on antimicrobial activities of the same. To our knowledge, however, there is no report on the anti-Quorum Sensing (Quorum Quenching, QQ) potential of traditional Ethiopian medicinal plants. As many of the opportunistic pathogenic bacteria depend on Quorum Sensing (QS) systems to coordinate their virulence expression, interference with QS could be a novel approach to control bacterial infections. Thus, the aim of this study was to evaluate selected medicinal plants from Ethiopia for their antimicrobial activities against bacterial and fungal pathogens; and to assess the interference of these plant extracts with QS of bacteria. Antimicrobial activities of plant extracts (oil, resins and crude extracts) were evaluated following standard agar diffusion technique. The minimum inhibitory concentrations (MIC) of potent extracts were determined using 96 well micro-titer plates and optical densities were measured using an ELISA Microplate reader. Interference with Quorum Sensing activities of extracts was determined using the recently established E. coli based reporter strain AI1-QQ.1 and signaling molecule N-(ß-ketocaproyl)-L-homoserine lactone (3-oxo-C6-HSL). Petroleum ether extract of seed of Nigella sativa exhibited the highest activity against both the laboratory isolated Bacillus cereus [inhibition zone (IZ), 44 ± 0.31 mm] and B. cereus ATCC 10987 (IZ, 40 ± 2.33 mm). Similarly, oil extract from mature ripe fruit husk of Aframomum corrorima and mature unripe fruit of A. corrorima revealed promising activities against Candida albicans ATCC 90028 (IZ, 35 ± 1.52 mm) and Staphylococcus aureus DSM 346 (IZ, 25 ± 1.32 mm), respectively. Antimicrobial activities of oil extract from husk of A. corrorima and petroleum ether extract of seed of N. sativa were significantly higher than that of the control antibiotic [Gentamycin sulfate, (IZ, 25-30 mm)]. The lowest MIC value (12.5 mg/mL) was recorded for oil from husk of A. corrorima against Pseudomonas aeruginosa. Of the total eighteen extracts evaluated, two of the extracts [Methanol extract of root of Albiza schimperiana (ASRM) and petroleum ether extract of seed of Justica schimperiana (JSSP)] interfered with cell-cell communication most likely by interacting with the signaling molecules. Traditional medicinal plants from Ethiopia are potential source of alternative medicine for the local community and scientific research in search for alternative drugs to halt challenges associated with the emerging antimicrobial resistance. Furthermore, the Quorum Quenching activities observed in two of the plant extracts calls for more comprehensive evaluation of medicinal plants for the control of many bacterial processes and phenotypic behaviors such as pathogenicity, swarming, and biofilm formation. Being the first assessment of its kind on the potential application of Ethiopian traditional medicinal plants for interference in microbial cell-cell communication (anti-Quorum Sensing activities), the detailed chemistry of the active compounds and possible mechanism(s) of actions of the bio-molecules responsible for the observed interference were not addressed in the current study. Thus, further evaluation for the nature of those active compounds (bio-molecules) and detailed mechanism(s) of their interaction with microbial processes are recommended.

Automated labeling of bibliographic data extracted from biomedical online journals

NASA Astrophysics Data System (ADS)

Kim, Jongwoo; Le, Daniel X.; Thoma, George R.

2003-01-01

A prototype system has been designed to automate the extraction of bibliographic data (e.g., article title, authors, abstract, affiliation and others) from online biomedical journals to populate the National Library of Medicine"s MEDLINE database. This paper describes a key module in this system: the labeling module that employs statistics and fuzzy rule-based algorithms to identify segmented zones in an article"s HTML pages as specific bibliographic data. Results from experiments conducted with 1,149 medical articles from forty-seven journal issues are presented.

The Discovery of a Potential Antimicrobial Agent: the Novel Compound Natural Medicinal Plant Fermentation Extracts against Candida albicans

NASA Astrophysics Data System (ADS)

Song, Mingzhu; Wang, Xirui; Mao, Canquan; Yao, Wei

2018-01-01

Natural medicinal plants and their extracts are important sources of antimicrobial drug development. In this study, we reported an ancient formula of Chinese folk medicine, the compound natural medicinal plant fermentation extracts (CNMPFE) for its antimicrobial effects. The effects and mechanisms of CNMPFE on C. albicans were studied by cell damage experiments including antimicrobial kinetics, fungal growth curve, alkaline phosphatase (AKP) activity, ultraviolet absorption, electric conductivity and the evaluation of cellular ultra microstructure. The results showed that the minimal inhibitory concentration and minimum fungicidal concentration of CNMPFE against C. albicans were 75% (vol/vol) and 80% (vol/vol) respectively. The inhibition of CNMPFE for C. albicans was dose and time dependent, based on increasing of the AKP activities and the ultraviolet absorptions and the electric conductivities of the fungal solutions, it may exert its antifungal properties by disrupting the structure of cell wall and the cell membrane integrity and their permeability, subsequently resulting in cell death. Taken together, these findings suggest that CNMPFE may be a promising drug candidate for the treatment of fungal infections skin diseases.

Quantitative genotoxicity assays for analysis of medicinal plants: A systematic review.

PubMed

Sponchiado, Graziela; Adam, Mônica Lucia; Silva, Caroline Dadalt; Soley, Bruna Silva; de Mello-Sampayo, Cristina; Cabrini, Daniela Almeida; Correr, Cassyano Januário; Otuki, Michel Fleith

2016-02-03

Medicinal plants are known to contain numerous biologically active compounds, and although they have proven pharmacological properties, they can cause harm, including DNA damage. Review the literature to evaluate the genotoxicity risk of medicinal plants, explore the genotoxicity assays most used and compare these to the current legal requirements. A quantitative systematic review of the literature, using the keywords "medicinal plants", "genotoxicity" and "mutagenicity", was undertakenQ to identify the types of assays most used to assess genotoxicity, and to evaluate the genotoxicity potential of medicinal plant extracts. The database searches retrieved 2289 records, 458 of which met the inclusion criteria. Evaluation of the selected articles showed a total of 24 different assays used for an assessment of medicinal plant extract genotoxicity. More than a quarter of those studies (28.4%) reported positive results for genotoxicity. This review demonstrates that a range of genotoxicity assay methods are used to evaluate the genotoxicity potential of medicinal plant extracts. The most used methods are those recommended by regulatory agencies. However, based on the current findings, in order to conduct a thorough study concerning the possible genotoxic effects of a medicinal plant, we indicate that it is important always to include bacterial and mammalian tests, with at least one in vivo assay. Also, these tests should be capable of detecting outcomes that include mutation induction, clastogenic and aneugenic effects, and structural chromosome abnormalities. In addition, the considerable rate of positive results detected in this analysis further supports the relevance of assessing the genotoxicity potential of medicinal plants. Copyright © 2016. Published by Elsevier Ireland Ltd.

[Establishment of industry promotion technology system in Chinese medicine secondary exploitation based on "component structure theory"].

PubMed

Cheng, Xu-Dong; Feng, Liang; Zhang, Ming-Hua; Gu, Jun-Fei; Jia, Xiao-Bin

2014-10-01

The purpose of the secondary exploitation of Chinese medicine is to improve the quality of Chinese medicine products, enhance core competitiveness, for better use in clinical practice, and more effectively solve the patient suffering. Herbs, extraction, separation, refreshing, preparation and quality control are all involved in the industry promotion of Chinese medicine secondary exploitation of industrial production. The Chinese medicine quality improvement and industry promotion could be realized with the whole process of process optimization, quality control, overall processes improvement. Based on the "component structure theory", "multi-dimensional structure & process dynamic quality control system" and systematic and holistic character of Chinese medicine, impacts of whole process were discussed. Technology systems of Chinese medicine industry promotion was built to provide theoretical basis for improving the quality and efficacy of the secondary development of traditional Chinese medicine products.

Deep Convolutional Neural Networks for Classifying Body Constitution Based on Face Image.

PubMed

Huan, Er-Yang; Wen, Gui-Hua; Zhang, Shi-Jun; Li, Dan-Yang; Hu, Yang; Chang, Tian-Yuan; Wang, Qing; Huang, Bing-Lin

2017-01-01

Body constitution classification is the basis and core content of traditional Chinese medicine constitution research. It is to extract the relevant laws from the complex constitution phenomenon and finally build the constitution classification system. Traditional identification methods have the disadvantages of inefficiency and low accuracy, for instance, questionnaires. This paper proposed a body constitution recognition algorithm based on deep convolutional neural network, which can classify individual constitution types according to face images. The proposed model first uses the convolutional neural network to extract the features of face image and then combines the extracted features with the color features. Finally, the fusion features are input to the Softmax classifier to get the classification result. Different comparison experiments show that the algorithm proposed in this paper can achieve the accuracy of 65.29% about the constitution classification. And its performance was accepted by Chinese medicine practitioners.

Pancreatic lipase and α-amylase inhibitory activities of plants used in Traditional Chinese Medicine (TCM).

PubMed

2016-07-07

To find new, plant based drugs for the treatment of obesity and/or diabetes mellitus type 2 through the inhibition of essential digestive enzymes, in vitro tests were carried out on selected plants or fungi with weight-reducing, blood glucose-reducing or related potential, used in Traditional Chinese Medicine (TCM). Aqueous and methanolic extracts of 32 Chinese herbal medicines were assayed for their in vitro inhibitory activity against pancreatic lipase (PL) and α-amylase (PA). PL activity was measured by using an enzymatic in vitro assay based on the hydrolysis kinetics of an oleate ester of 4-methylumbelliferone. For the determination of α-amylase activity an enzyme assay based on the hydrolytic cleavage of a modified starch derivative was used. Our findings have shown that the methanolic extract of Lycopus lucidus Turcz. var. hirtus Regel (Lamiaceae) was a very effective PL inhibitor (IC50: 88.3±4.1 μg/mL). A high anti-amylase activity showed the methanolic extract of Trichosanthes kirilowii Maxim. (Curcurbitaceae, IC50: 248.8±67.3 μg/mL). This work provides a priority list of interesting plants for further study with respect to the treatment of obesity and associated metabolic diseases.

Old plants newly discovered: Cassia sieberiana D.C. and Cassia abbreviata Oliv. Oliv. root extracts inhibit in vitro HIV-1c replication in peripheral blood mononuclear cells (PBMCs) by different modes of action.

PubMed

Leteane, Melvin M; Ngwenya, Barbara N; Muzila, Mbaki; Namushe, Amos; Mwinga, John; Musonda, Rosemary; Moyo, Sikhulile; Mengestu, Yehualashete B; Abegaz, Berhanu M; Andrae-Marobela, Kerstin

2012-05-07

Despite advances in anti-retroviral therapy which has transformed HIV/AIDS from a fatal to a manageable chronic disease, increasing viral drug resistance, side effects and uneven access to anti-retroviral drugs remain considerable therapeutic challenges. Partly as a consequence of these shortcomings and partly based on the fact that HIV/AIDS gives rise to opportunistic infections whose symptoms have been managed in Africa in an HIV/AIDS-independent context by traditional healers for centuries, many HIV/AIDS patients use herbal medicines. The aim of this study was to screen selected medicinal plants from Botswana, used by traditional healers to treat/manage HIV/AIDS, for inhibitory activities on HIV replication. Based on an ethnomedical survey, ethanolic tannin-containing and tannin-free extracts from 10 medicinal plants were tested for inhibitory properties against a clone of HIV-1c (MJ(4)) measuring cytopathic effect protection and levels of viral p24 antigen in infected PBMCs. Cassia sieberiana D.C., Cassia abbreviata Oliv. Oliv. and Plumbago zeylanica L. extracts showed significant inhibition of HIV-1c (MJ(4)) replication. The inhibitory activity of the Plumbago zeylanica extract could be attributed to its tannin content. Anti-HIV activity of Cassia sieberiana root and bark extracts, and Cassia abbreviata root extracts occurred in a concentration-dependent manner with an effective concentration (EC(50)) of 65.1μg/ml, 85.3μg/ml and 102.8μg/ml, respectively. Experiments to elucidate possible mechanism(s) of action revealed that Cassia sieberiana root and bark extracts blocked HIV replication at its binding- (EC(50)=70.2μg/ml and 90.8μg/ml, respectively) and entry stage (EC(50)=88.9μg/ml and 100.5μg/ml, respectively) while Cassia abbreviata extracts did not. We report here for the first time a direct inhibitory effect on HIV-1c replication of extracts from two extremely popular medicinal plants, Cassia sieberiana and Cassia abbreviata. Considering the traditional uses of both Cassia species, our findings strongly suggest pilot clinical observational studies involving traditional healers to further evaluate the therapeutic potential of the Cassia extracts. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

In vitro antiplasmodial and cytotoxic properties of some medicinal plants from western Burkina Faso.

PubMed

Sanon, Souleymane; Gansane, Adama; Ouattara, Lamoussa P; Traore, Abdoulaye; Ouedraogo, Issa N; Tiono, Alfred; Taramelli, Donatella; Basilico, Nicoletta; Sirima, Sodiomon B

2013-01-01

Resistance of malaria parasites to existing drugs complicates treatment, but an antimalarial vaccine that could protect against this disease is not yet available. It is therefore necessary to find new effective and affordable medicines. Medicinal plants could be a potential source of antimalarial agents. Some medicinal plants from Burkina Faso were evaluated for their antiplasmodial and cytotoxic properties in vitro . Crude dichloromethane, methanol, water-methanol, aqueous and alkaloids extracts were prepared for 12 parts of 10 plants. Chloroquine-resistant malaria strain K1 was used for the in vitro sensibility assay. The Plasmodium lactacte dehydrogenase technique was used to determine the 50% inhibitory concentration of parasites activity (IC 50 ). The cytotoxic effects were determined with HepG2 cells, using the tetrazolium-based colorimetric technique, and the selectivity index (SI) was calculated. Sixty crude extracts were prepared. Seven extracts from Terminalia avicenoides showed IC 50 < 5 µg/mL. The IC 50 of dichloromethane, methanol, aqueous and alkaloids extracts ranged between 1.6 µg/mL and 4.5 µg/mL. Three crude extracts from Combretum collinum and three from Ficus capraefolia had an IC 50 ranging between 0.2 µg/mL and 2.5 µg/mL. Crude extracts from these three plants had no cytotoxic effect, with SI > 1. The other plants have mostly moderate or no antimalarial effects. Some extracts from Cordia myxa , Ficus capraefolia and Opilia celtidifolia showed cytotoxicity, with an SI ranging between 0.4 and 0.9. Our study showed a good antiplasmodial in vitro activity of Terminalia avicenoides, Combretum collinum and Ficus capraefolia . These three plants may contain antiplasmodial molecules that could be isolated by bio-guided phytochemical studies.

In vitro antiplasmodial and cytotoxic properties of some medicinal plants from western Burkina Faso

PubMed Central

Gansane, Adama; Ouattara, Lamoussa P.; Traore, Abdoulaye; Ouedraogo, Issa N.; Tiono, Alfred; Taramelli, Donatella; Basilico, Nicoletta; Sirima, Sodiomon B.

2013-01-01

Background Resistance of malaria parasites to existing drugs complicates treatment, but an antimalarial vaccine that could protect against this disease is not yet available. It is therefore necessary to find new effective and affordable medicines. Medicinal plants could be a potential source of antimalarial agents. Some medicinal plants from Burkina Faso were evaluated for their antiplasmodial and cytotoxic properties in vitro. Methods Crude dichloromethane, methanol, water-methanol, aqueous and alkaloids extracts were prepared for 12 parts of 10 plants. Chloroquine-resistant malaria strain K1 was used for the in vitro sensibility assay. The Plasmodium lactacte dehydrogenase technique was used to determine the 50% inhibitory concentration of parasites activity (IC50). The cytotoxic effects were determined with HepG2 cells, using the tetrazolium-based colorimetric technique, and the selectivity index (SI) was calculated. Results Sixty crude extracts were prepared. Seven extracts from Terminalia avicenoides showed IC50 < 5 µg/mL. The IC50 of dichloromethane, methanol, aqueous and alkaloids extracts ranged between 1.6 µg/mL and 4.5 µg/mL. Three crude extracts from Combretum collinum and three from Ficus capraefolia had an IC50 ranging between 0.2 µg/mL and 2.5 µg/mL. Crude extracts from these three plants had no cytotoxic effect, with SI > 1. The other plants have mostly moderate or no antimalarial effects. Some extracts from Cordia myxa, Ficus capraefolia and Opilia celtidifolia showed cytotoxicity, with an SI ranging between 0.4 and 0.9. Conclusion Our study showed a good antiplasmodial in vitro activity of Terminalia avicenoides, Combretum collinum and Ficus capraefolia. These three plants may contain antiplasmodial molecules that could be isolated by bio-guided phytochemical studies. PMID:29043169

Q-marker based strategy for CMC research of Chinese medicine: A case study of Panax Notoginseng saponins.

PubMed

Zhong, Yi; Zhu, Jieqiang; Yang, Zhenzhong; Shao, Qing; Fan, Xiaohui; Cheng, Yiyu

2018-01-31

To ensure pharmaceutical quality, chemistry, manufacturing and control (CMC) research is essential. However, due to the inherent complexity of Chinese medicine (CM), CMC study of CM remains a great challenge for academia, industry, and regulatory agencies. Recently, quality-marker (Q-marker) was proposed to establish quality standards or quality analysis approaches of Chinese medicine, which sheds a light on Chinese medicine's CMC study. Here manufacture processes of Panax Notoginseng Saponins (PNS) is taken as a case study and the present work is to establish a Q-marker based research strategy for CMC of Chinese medicine. The Q-markers of Panax Notoginseng Saponins (PNS) is selected and established by integrating chemical profile with pharmacological activities. Then, the key processes of PNS manufacturing are identified by material flow analysis. Furthermore, modeling algorithms are employed to explore the relationship between Q-markers and critical process parameters (CPPs) of the key processes. At last, CPPs of the key processes are optimized in order to improving the process efficiency. Among the 97 identified compounds, Notoginsenoside R 1 , ginsenoside Rg 1 , Re, Rb 1 and Rd are selected as the Q-markers of PNS. Our analysis on PNS manufacturing show the extraction process and column chromatography process are the key processes. With the CPPs of each process as the inputs and Q-markers' contents as the outputs, two process prediction models are built separately for the extraction process and column chromatography process of Panax notoginseng, which both possess good prediction ability. Based on the efficiency models of extraction process and column chromatography process we constructed, the optimal CPPs of both processes are calculated. Our results show that the Q-markers derived from CMC research strategy can be applied to analyze the manufacturing processes of Chinese medicine to assure product's quality and promote key processes' efficiency simultaneously. Copyright © 2018 Elsevier GmbH. All rights reserved.

Is traditional Chinese medicine recommended in Western medicine clinical practice guidelines in China? A systematic analysis

PubMed Central

Ren, Jun; Li, Xun; Sun, Jin; Han, Mei; Yang, Guo-Yan; Li, Wen-Yuan; Robinson, Nicola; Lewith, George; Liu, Jian-Ping

2015-01-01

Background Evidence-based medicine promotes and relies on the use of evidence in developing clinical practice guidelines (CPGs). The Chinese healthcare system includes both traditional Chinese medicine (TCM) and Western medicine, which are expected to be equally reflected in Chinese CPGs. Objective To evaluate the inclusion of TCM-related information in Western medicine CPGs developed in China and the adoption of high level evidence. Methods All CPGs were identified from the China Guideline Clearinghouse (CGC), which is the main Chinese organisation maintaining the guidelines issued by the Ministry of Health of China, the Chinese Medical Association and the Chinese Medical Doctors’ Association. TCM-related contents were extracted from all the CPGs identified. Extracted information comprised the institution issuing the guideline, date of issue, disease, recommendations relating to TCM, evidence level of the recommended content and references supporting the recommendations. Results A total of 604 CPGs were identified, only a small number of which (74/604; 12%) recommended TCM therapy and only five guidelines (7%) had applied evidence grading. The 74 CPGs involved 13 disease systems according to the International Classification of Diseases 10th edition. TCM was mainly recommended in the treatment part of the guidelines (73/74, 99%), and more than half of the recommendations (43/74, 58%) were related to Chinese herbal medicine (single herbs or herbal treatment based on syndrome differentiation). Conclusions Few Chinese Western medicine CPGs recommend TCM therapies and very few provide evidence grading for the TCM recommendation. We suggest that future guideline development should be based on systematic searches for evidence to support CPG recommendations and involve a multidisciplinary approach including TCM expertise. PMID:26041487

Is traditional Chinese medicine recommended in Western medicine clinical practice guidelines in China? A systematic analysis.

PubMed

Ren, Jun; Li, Xun; Sun, Jin; Han, Mei; Yang, Guo-Yan; Li, Wen-Yuan; Robinson, Nicola; Lewith, George; Liu, Jian-Ping

2015-06-03

Evidence-based medicine promotes and relies on the use of evidence in developing clinical practice guidelines (CPGs). The Chinese healthcare system includes both traditional Chinese medicine (TCM) and Western medicine, which are expected to be equally reflected in Chinese CPGs. To evaluate the inclusion of TCM-related information in Western medicine CPGs developed in China and the adoption of high level evidence. All CPGs were identified from the China Guideline Clearinghouse (CGC), which is the main Chinese organisation maintaining the guidelines issued by the Ministry of Health of China, the Chinese Medical Association and the Chinese Medical Doctors' Association.TCM-related contents were extracted from all the CPGs identified. Extracted information comprised the institution issuing the guideline, date of issue, disease, recommendations relating to TCM, evidence level of the recommended content and references supporting the recommendations. A total of 604 CPGs were identified, only a small number of which (74/604; 12%) recommended TCM therapy and only five guidelines (7%) had applied evidence grading. The 74 CPGs involved 13 disease systems according to the International Classification of Diseases 10th edition. TCM was mainly recommended in the treatment part of the guidelines (73/74, 99%), and more than half of the recommendations (43/74, 58%) were related to Chinese herbal medicine (single herbs or herbal treatment based on syndrome differentiation). Few Chinese Western medicine CPGs recommend TCM therapies and very few provide evidence grading for the TCM recommendation. We suggest that future guideline development should be based on systematic searches for evidence to support CPG recommendations and involve a multidisciplinary approach including TCM expertise. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

Medicinal cannabis: Principal cannabinoids concentration and their stability evaluated by a high performance liquid chromatography coupled to diode array and quadrupole time of flight mass spectrometry method.

PubMed

Citti, Cinzia; Ciccarella, Giuseppe; Braghiroli, Daniela; Parenti, Carlo; Vandelli, Maria Angela; Cannazza, Giuseppe

2016-09-05

In the last few years, there has been a boost in the use of cannabis-based extracts for medicinal purposes, although their preparation procedure has not been standardized but rather decided by the individual pharmacists. The present work describes the development of a simple and rapid high performance liquid chromatography method with UV detection (HPLC-UV) for the qualitative and quantitative determination of the principal cannabinoids (CBD-A, CBD, CBN, THC and THC-A) that could be applied to all cannabis-based medicinal extracts (CMEs) and easily performed by a pharmacist. In order to evaluate the identity and purity of the analytes, a high-resolution mass spectrometry (HPLC-ESI-QTOF) analysis was also carried out. Full method validation has been performed in terms of specificity, selectivity, linearity, recovery, dilution integrity and thermal stability. Moreover, the influence of the solvent (ethyl alcohol and olive oil) was evaluated on cannabinoids degradation rate. An alternative extraction method has then been proposed in order to preserve cannabis monoterpene component in final CMEs. Copyright © 2016 Elsevier B.V. All rights reserved.

Antibacterial and anti-inflammatory effects of Jeju medicinal plants against acne-inducing bacteria.

PubMed

Kim, Sang-Suk; Kim, Ji-Young; Lee, Nam Ho; Hyun, Chang-Gu

2008-04-01

Propionibacterium acnes and Staphylococcus epidermidis are pus-forming bacteria that trigger inflammation in acne. The present study was conducted to evaluate the antimicrobial activities of Jeju medicinal plants against these etiologic agents of acne vulgaris. Ethanol extracts of Jeju plants were tested for antimicrobial activities by disc diffusion and broth dilution methods. The results from the disc diffusion assays revealed that four medicinal plants, Mollugo pentaphylla, Angelica anomala, Matteuccia orientalis, and Orixa japonica inhibited the growth of both pathogens. Among these, A. anomala had strong inhibitory effects. Its MIC values were 15.6 microg/ml and 125 microg/ml against P. acnes and S. epidermidis, respectively. The cytotoxic effects of the four extracts were determined by colorimetric MTT assays using two animal cell lines: human dermal fibroblasts and HaCaT cells. Although the M. orientalis root extract had moderate cytotoxicity in HaCaT cells at 200 microg/ml, most extracts exhibited low cytotoxicity at 200 microg/ml in both cell lines. In addition, the extracts reduced the P. acnes-induced secretion of interleukin-8 and tumor necrosis factor-alpha (TNF-alpha) in THP-1 cells, an indication of their anti-inflammatory effects. Based on these results, we suggest that M. pentaphylla, A. anomala, M. orientalis, and O. japonica are attractive acne-mitigating candidates for topical application.

Lingzhi or Reishi Medicinal Mushroom, Ganoderma lucidum (Agaricomycetes), Inhibits Candida Biofilms: A Metabolomic Approach.

PubMed

Bhardwaj, Anuja; Gupta, Payal; Kumar, Navin; Mishra, Jigni; Kumar, Ajai; Rakhee, Rajput; Misra, Kshipra

2017-01-01

This article presents a comparative gas chromatography (GC)-mass spectrometry (MS)-based metabolomic analysis of mycelia and fruiting bodies of the medicinal mushroom Ganoderma lucidum. Three aqueous extracts-mycelia, fruiting bodies, and a mixture of them-and their sequential fractions (methanolic and ethyl acetate), prepared using an accelerated solvent extractor, were characterized by GC-MS to determine volatile organic compounds and by high-performance thin-layer chromatography to quantify ascorbic acid, a potent antioxidant. In addition, these extracts and fractions were assessed against Candida albicans and C. glabrata biofilms via the XTT reduction assay, and their antioxidant potential was evaluated. Application of chemometrics (hierarchical cluster analysis and principal component analysis) to GC data revealed variability in volatile organic compound profiles among G. lucidum extracts and fractions. The mycelial aqueous extract demonstrated higher anti-Candida activity and ascorbic acid content among all the extracts and fractions. Thus, this study illustrates the preventive effect of G. lucidum against C. albicans and C. glabrata biofilms along with its nutritional value.

In Vitro Evaluations of Cytotoxicity of Eight Antidiabetic Medicinal Plants and Their Effect on GLUT4 Translocation

PubMed Central

Kadan, Sleman; Saad, Bashar; Sasson, Yoel; Zaid, Hilal

2013-01-01

Despite the enormous achievements in conventional medicine, herbal-based medicines are still a common practice for the treatment of diabetes. Trigonella foenum-graecum, Atriplex halimus, Olea europaea, Urtica dioica, Allium sativum, Allium cepa, Nigella sativa, and Cinnamomum cassia are strongly recommended in the Greco-Arab and Islamic medicine for the treatment and prevention of diabetes. Cytotoxicity (MTT and LDH assays) of the plant extracts was assessed using cells from the liver hepatocellular carcinoma cell line (HepG2) and cells from the rat L6 muscle cell line. The effects of the plant extracts (50% ethanol in water) on glucose transporter-4 (GLUT4) translocation to the plasma membrane was tested in an ELISA test on L6-GLUT4myc cells. Results obtained indicate that Cinnamomon cassia is cytotoxic at concentrations higher than 100 μg/mL, whereas all other tested extracts exhibited cytotoxic effects at concentrations higher than 500 μg/mL. Exposing L6-GLUT4myc muscle cell to extracts from Trigonella foenum-graecum, Urtica dioica, Atriplex halimus, and Cinnamomum verum led to a significant gain in GLUT4 on their plasma membranes at noncytotoxic concentrations as measured with MTT assay and the LDH leakage assay. These findings indicate that the observed anti-diabetic properties of these plants are mediated, at least partially, through regulating GLUT4 translocation. PMID:23606883

An ethnobotanical survey of medicinal plants of Laos toward the discovery of bioactive compounds as potential candidates for pharmaceutical development

PubMed Central

Soejarto, D.D.; Gyllenhaal, C.; Kadushin, M.R.; Southavong, B.; Sydara, K.; Bouamanivong, S.; Xaiveu, M.; Zhang, H.-J.; Franzblau, S.G.; Tan, Ghee T.; Pezzuto, J.M.; Riley, M.C.; Elkington, B.G.; Waller, D.P.

2012-01-01

Context An ethnobotany-based approach in the selection of raw plant materials to study was implemented. Objective To acquire raw plant materials using ethnobotanical field interviews as starting point to discover new bioactive compounds from medicinal plants of the Lao People’s Democratic Republic. Methods Using semi-structured field interviews with healers in the Lao PDR, plant samples were collected, extracted, and bio-assayed to detect bioactivity against cancer, HIV/AIDS, TB, malaria. Plant species demonstrating activity were recollected and the extracts subjected to a bioassay-guided isolation protocol to isolate and identify the active compounds. Results Field interviews with 118 healers in 15 of 17 provinces of Lao PDR yielded 753 collections (573 species) with 955 plant samples. Of these 955, 50 extracts demonstrated activity in the anticancer, 10 in the anti-HIV, 30 in the anti-TB, and 52 in the antimalarial assay. Recollection of actives followed by bioassay-guided isolation processes yielded a series of new and known in vitro-active anticancer and antimalarial compounds from 5 species. Discussion Laos has a rich biodiversity, harboring an estimated 8000–11,000 species of plants. In a country highly dependent on traditional medicine for its primary health care, this rich plant diversity serves as a major source of their medication. Conclusions Ethnobotanical survey has demonstrated the richness of plant-based traditional medicine of Lao PDR, taxonomically and therapeutically. Biological assays of extracts of half of the 955 samples followed by in-depth studies of a number of actives have yielded a series of new bioactive compounds against the diseases of cancer and malaria. PMID:22136442

Query-oriented evidence extraction to support evidence-based medicine practice.

PubMed

Sarker, Abeed; Mollá, Diego; Paris, Cecile

2016-02-01

Evidence-based medicine practice requires medical practitioners to rely on the best available evidence, in addition to their expertise, when making clinical decisions. The medical domain boasts a large amount of published medical research data, indexed in various medical databases such as MEDLINE. As the size of this data grows, practitioners increasingly face the problem of information overload, and past research has established the time-associated obstacles faced by evidence-based medicine practitioners. In this paper, we focus on the problem of automatic text summarisation to help practitioners quickly find query-focused information from relevant documents. We utilise an annotated corpus that is specialised for the task of evidence-based summarisation of text. In contrast to past summarisation approaches, which mostly rely on surface level features to identify salient pieces of texts that form the summaries, our approach focuses on the use of corpus-based statistics, and domain-specific lexical knowledge for the identification of summary contents. We also apply a target-sentence-specific summarisation technique that reduces the problem of underfitting that persists in generic summarisation models. In automatic evaluations run over a large number of annotated summaries, our extractive summarisation technique statistically outperforms various baseline and benchmark summarisation models with a percentile rank of 96.8%. A manual evaluation shows that our extractive summarisation approach is capable of selecting content with high recall and precision, and may thus be used to generate bottom-line answers to practitioners' queries. Our research shows that the incorporation of specialised data and domain-specific knowledge can significantly improve text summarisation performance in the medical domain. Due to the vast amounts of medical text available, and the high growth of this form of data, we suspect that such summarisation techniques will address the time-related obstacles associated with evidence-based medicine. Copyright © 2015 Elsevier Inc. All rights reserved.

Tristania Sumatrana Effect On Female Mus Musculus Fertility

NASA Astrophysics Data System (ADS)

Syamsurizal, S.

2018-04-01

The use of traditional medicinal plants are generally based on empirical experience, therefore it is necessary scientific approach in order to bring traditional medicine into medical practice and the formal health services. Tristania sumatrana Miq. is one of the traditional medicinal plants are often used as a contraceptive for women in West Sumatra Tristania sumatrana Miq. extract can prolong the estrous cycle in mice to eleven days. This study aimed to influence Tristania sumatrana Miq. extract treatment on fertility of female mice. Experiments conducted a randomized block design 5x2. Five dose groups: control with no treatment, placebo, treatment with doses of 600, 900 and 1200 mg/kgbw and the old two treatment groups: 10 and 20 days. Fertility parameters studied were ovarian weight follicle Graaf number, the corpus luteum and fetal life. The research proves of Tristania sumatrana Miq. extract treatment causes a decrease very significantly the ovarian weight (treatment of 900 mg/kgbw for 10 days), follicles Graaf number (900 mg/kgbw for 20 days), the corpus luteum (600 mg/kgbw for 10 days) and live fetuses (900 mg/kgbw for 10 days). Tristania sumatrana Miq. extract treatment can lead to decreased fertility of female mice.

Effects of crude aqueous medicinal plant extracts on growth and invasion of breast cancer cells.

PubMed

Van Slambrouck, Severine; Daniels, Amber L; Hooten, Carla J; Brock, Steven L; Jenkins, Aaron R; Ogasawara, Marcia A; Baker, Joann M; Adkins, Glen; Elias, Eerik M; Agustin, Vincent J; Constantine, Sarah R; Pullin, Michael J; Shors, Scott T; Kornienko, Alexander; Steelant, Wim F A

2007-06-01

Plants used in folklore medicine continue to be an important source of discovery and development of novel therapeutic agents. In the present study, we determined the effects of crude aqueous extracts of a panel of medicinal plants on the growth and invasion of cancer cells. Our results showed that extracts of L. tridentata (Creosote Bush) and J. communis L. (Juniper Berry) significantly decreased the growth of MCF-7/AZ breast cancer cells. The latter as well as A. californica (Yerba Mansa) inhibited invasion into the collagen type I gel layer. Furthermore, the phosphorylation levels of extracellular signal-regulated kinase 1 and 2 (ERK1/2) decreased when the cells were exposed to aqueous extracts of L. tridentata, J. communis L. and A. californica. This study provides original scientific data on the anticancer activity of selected aqueous medicinal plant extracts used in traditional medicine.

Ethnomedicinal and phytochemical review of Pakistani medicinal plants used as antibacterial agents against Escherichia coli

PubMed Central

2014-01-01

Medicinal plants have always been part of human culture and have the potential to cure different diseases caused by microorganisms. In Pakistan, biologists are mainly focusing on plants’ antimicrobial activities against Escherichia coli due to its increasing resistance to antibiotics. In total, extracts from 34 ethnomedicinally valuable Pakistani plants were reported for in-vitro anti-E. coli activities. Mostly methanolic extracts of medicinal plants were used in different studies, which have shown comparatively higher inhibitory activities against E. coli than n-hexane and aqueous extracts. It has been found that increasing concentration (mg/ml) of methanolic extract can significantly increase (p < 0.01) anti-E. coli activities. Not all medicinal plants are extracted in solvents others than above, which should also be tested against E. coli. Moreover, medicinal plant species must be fully explored phytochemically, which may lead to the development of new drugs. PMID:25135359

Assessment of genotoxicity of herbal medicinal products: application of the "bracketing and matrixing" concept using the example of Valerianae radix (valerian root).

PubMed

Kelber, Olaf; Wegener, Tankred; Steinhoff, Barbara; Staiger, Christiane; Wiesner, Jacqueline; Knöss, Werner; Kraft, Karin

2014-01-01

An assessment of genotoxicity is a precondition for marketing authorization respectively registration of herbal medicinal products (HMPs), as well as for inclusion into the 'Community list of herbal substances, preparations and combinations thereof for use in traditional herbal medicinal products' established by the European Commission in accordance with Directive 2001/83/EC as amended, and based on proposals from the Committee on Herbal Medicinal Products (HMPC). In the 'Guideline on the assessment of genotoxicity of herbal substances/preparations' (EMEA/HMPC/107079/2007) HMPC has described a stepwise approach for genotoxicity testing, according to which the Ames test is a sufficient base for the assessment of genotoxicity in case of an unequivocally negative result. For reducing efforts for testing of individual herbal substances/preparations, HMPC has also developed the 'guideline on selection of test materials for genotoxicity testing for traditional herbal medicinal products/herbal medicinal products' (EMEA/HMPC/67644/2009) with the aim to allow testing of a standard range of test materials which could be considered representative of the commonly used preparations from a specific herbal drug according to a 'bracketing/matrixing' approach. The purpose of this paper is to provide data on the practical application of this bracketing and matrixing concept using the example of Valerianae radix, with the intention of facilitating its inclusion in the "Community list". Five extraction solvents, representing the extremes of the polarity range and including also mid-range extraction solvents, were used, covering the entire spectrum of phytochemical constituents of Valerianae radix, thereby including polar and non-polar constituents. Extracts were tested in the Ames test according to all relevant guidelines. Results were unequivocally negative for all extracts. A review of the literature showed that this result is in accordance with the available data, thus demonstrating the lack of a genotoxic potential. In conclusion the two guidelines on genotoxicity provide a practically applicable concept. Valerianae radix has no genotoxic potential, supporting its use in HMPs and its inclusion in the Community list. Copyright © 2014 The Authors. Published by Elsevier GmbH.. All rights reserved.

Verification of Ganoderma (lingzhi) commercial products by Fourier Transform infrared spectroscopy and two-dimensional IR correlation spectroscopy

NASA Astrophysics Data System (ADS)

Choong, Yew-Keong; Sun, Su-Qin; Zhou, Qun; Lan, Jin; Lee, Han-Lim; Chen, Xiang-Dong

2014-07-01

Ganoderma commercial products are typically based on two sources, raw material (powder form and/or spores) and extract (water and/or solvent). This study compared three types of Ganoderma commercial products using 1 Dimensional Fourier Transform infrared and second derivative spectroscopy. The analyzed spectra of Ganoderma raw material products were compared with spectra of cultivated Ganoderma raw material powder from different mushroom farms in Malaysia. The Ganoderma extract product was also compared with three types of cultivated Ganoderma extracts. Other medicinal Ganoderma contents in commercial extract product that included glucan and triterpenoid were analyzed by using FTIR and 2DIR. The results showed that water extract of cultivated Ganoderma possessed comparable spectra with that of Ganoderma product water extract. By comparing the content of Ganoderma commercial products using FTIR and 2DIR, product content profiles could be detected. In addition, the geographical origin of the Ganoderma products could be verified by comparing their spectra with Ganoderma products from known areas. This study demonstrated the possibility of developing verification tool to validate the purity of commercial medicinal herbal and mushroom products.

Medical use of cannabis and cannabinoids containing products - Regulations in Europe and North America.

PubMed

Abuhasira, Ran; Shbiro, Liat; Landschaft, Yuval

2018-03-01

In 1937, the United States of America criminalized the use of cannabis and as a result its use decreased rapidly. In recent decades, there is a growing interest in the wide range of medical uses of cannabis and its constituents; however, the laws and regulations are substantially different between countries. Laws differentiate between raw herbal cannabis, cannabis extracts, and cannabinoid-based medicines. Both the European Medicines Agency (EMA) and the United States Food and Drug Administration (FDA) do not approve the use of herbal cannabis or its extracts. The FDA approved several cannabinoid-based medicines, so did 23 European countries and Canada. However, only four of the reviewed countries have fully authorized the medical use of herbal cannabis - Canada, Germany, Israel and the Netherlands, together with more than 50% of the states in the United States. Most of the regulators allow the physicians to decide what specific indications they will prescribe cannabis for, but some regulators dictate only specific indications. The aim of this article is to review the current (as of November 2017) regulations of medical cannabis use in Europe and North America. Copyright © 2018 European Federation of Internal Medicine. Published by Elsevier B.V. All rights reserved.

Screening of antiviral activities in medicinal plants extracts against dengue virus using dengue NS2B-NS3 protease assay.

PubMed

Rothan, H A; Zulqarnain, M; Ammar, Y A; Tan, E C; Rahman, N A; Yusof, R

2014-06-01

Dengue virus infects millions of people worldwide and there is no vaccine or anti-dengue therapeutic available. Screening large numbers of medicinal plants for anti-dengue activities is an alternative strategy in order to find the potent therapeutic compounds. Therefore, this study was designed to identify anti-dengue activities in nineteen medicinal plant extracts that are used in traditional medicine. Local medicinal plants Vernonia cinerea, Hemigraphis reptans, Hedyotis auricularia, Laurentia longiflora, Tridax procumbers and Senna angustifolia were used in this study. The highest inhibitory activates against dengue NS2B-NS3pro was observed in ethanolic extract of S. angustifolia leaves, methanolic extract of V. cinerea leaves and ethanol extract of T. procumbens stems. These findings were further verified by in vitro viral inhibition assay. Methanolic extract of V. cinerea leaves, ethanol extract of T. procumbens stems and at less extent ethanolic extract of S. angustifolia leaves were able to maintain the normal morphology of DENV2-infected Vero cells without causing much cytopathic effects (CPE). The percentage of viral inhibition of V. cinerea and T. procumbens extracts were significantly higher than S. angustifolia extract as measured by plaque formation assay and RT-qPCR. In conclusion, The outcome of this study showed that the methanolic extract of V. cinerea leaves and ethanol extract of T. procumbens stems possessed high inhibitory activates against dengue virus that worth more investigation.

Inhibition of urease by extracts derived from 15 Chinese medicinal herbs.

PubMed

Shi, Da-Hua; Liu, Yu-Wei; Liu, Wei-Wei; Gu, Zhi-Feng

2011-07-01

Helicobacter pylori is a major causative factor in gastritis-like disorders, and urease plays a key role in Helicobacter pylori colonizing and persisting in the mucous layer of the human stomach. In China, a variety of Chinese medicinal herbs have been prescribed to attenuate or eradicate gastritis-like disorders. However, little is known about the urease inhibition of Chinese medicinal herbs. The present study was conducted to investigate the urease inhibition activities of the ethanol and water extracts of 15 Chinese medicinal herbs. The ethanol and water extracts derived from 15 medicinal herbs, traditionally used for the treatment of gastritis-like disorders in China, were tested for urease-inhibition activity using the phenol red method. Screened at 10 µg/mL, 14 ethanol extracts and 10 water extracts showed urease inhibition. The ethanol extracts of Magnolia officinalis Rehd. et Wils. (Magnoliaceae) and Cassia obtusifolia L. (Leguminosae) possessed inhibition rates higher than 50% with IC₅₀ values of 6.5 and 12.3 µg/mL, respectively. After fractionating successively, the petroleum ether fraction of the ethanol extracts of Magnolia officinalis showed the best activity with 90.8% urease inhibition at a concentration of 10 µg/mL. The bioautography of the petroleum ether fraction indicated the existence of the urease inhibitors in the herb. The present results indicated that some Chinese medicinal herbs might treat gastritis-like disorders via the inhibition of Helicobacter pylori urease and the further possibility for discovering useful novel urease inhibitors from the Chinese medicinal herbs.

A Domain Independent Framework for Extracting Linked Semantic Data from Tables

DTIC Science & Technology

2012-01-01

Evidence - based medicine , the essential role of systematic reviews, and the need for automated text mining tools. In: Proc. 1st ACM Int. Health... based medicine : what it is and what it isn’t. Bmj 312(7023), 71 (1996) 23. Sahoo, S.S., Halb, W., Hellmann, S., Idehen, K., Thibodeau Jr, T., Auer, S., Se...Journal of Artificial Intelligence Research 11(1), 95–130 (1999) 22. Sackett, D., Rosenberg, W., Gray, J., Haynes, R., Richardson, W.: Evidence

Anti-inflammatory, anticholinesterase, antioxidant and phytochemical properties of medicinal plants used for pain-related ailments in South Africa.

PubMed

Fawole, O A; Amoo, S O; Ndhlala, A R; Light, M E; Finnie, J F; Van Staden, J

2010-02-03

Extracts of seven South African medicinal plants used traditionally for the treatment of pain-related ailments were evaluated. The study was aimed at evaluating medicinal and therapeutic potentials of the investigated traditional medicinal plants. Plant extracts were evaluated for anti-inflammatory activity and other pharmacological properties such as anticholinesterase and antioxidant activities. Phytochemical analysis of total phenolic contents, condensed tannins, gallotannins and flavonoids in the aqueous methanol extracts of the medicinal plants were also carried out. The evaluation of anti-inflammatory activity of 50% methanol (50% MeOH), petroleum ether (PE), dichloromethane (DCM) and ethanol (EtOH) plant extracts was done against cyclooxygenase-1 and -2 (COX-1 and COX-2) enzymes. 50% MeOH, PE, DCM and EtOH extracts were tested for acetylcholinesterase (AChE) inhibition, while 50% MeOH extracts were tested for 2,2-diphenyl-1-picryl hydrazyl (DPPH) radical scavenging activity and ferric-reducing power in the antioxidant assays. Total phenolic compounds, condensed tannins, gallotannins and flavonoids were quantitatively determined using spectrophotometric methods. At the screening assay concentration (0.25 microg/microl), 13 extracts showed good COX-1 inhibitory activity (>50%), while good activity was observed in 15 extracts against COX-2 enzyme. All the extracts of Crinum moorei (bulbs) showed good inhibition against both COX-1 and COX-2 enzymes. Though not significantly different (P=0.05), the highest COX-1 percentage inhibition (100%) was shown by Aloe ferox leaf PE and Colocasia antiquorum tuber DCM extracts, while Colocasia antiquorum tuber PE extract exhibited the highest (92.7%) percentage inhibition against COX-2. Crinum moorei bulb DCM extract showed the lowest EC(50) value (2.9 microg/ml) in the AChE assay. In addition, good to moderate bioactivities were observed in some extracts of Aloe ferox (leaves), Crinum moorei (bulbs) and Pycnostachys reticulata (leaves) in all the assays. The presence and/or amounts of phenolic compounds varied with plant species. The results obtained in this study validate the use of the investigated medicinal plants in South African traditional medicine for pain-related ailments. Copyright 2009 Elsevier Ireland Ltd. All rights reserved.

Immunomodulatory properties of medicinal mushrooms: differential effects of water and ethanol extracts on NK cell-mediated cytotoxicity.

PubMed

Lu, Chia-Chen; Hsu, Ya-Jing; Chang, Chih-Jung; Lin, Chuan-Sheng; Martel, Jan; Ojcius, David M; Ko, Yun-Fei; Lai, Hsin-Chih; Young, John D

2016-10-01

Medicinal mushrooms have been used for centuries in Asian countries owing to their beneficial effects on health and longevity. Previous studies have reported that a single medicinal mushroom may produce both stimulatory and inhibitory effects on immune cells, depending on conditions, but the factors responsible for this apparent dichotomy remain obscure. We show here that water and ethanol extracts of cultured mycelium from various species (Agaricus blazei Murrill, Antrodia cinnamomea, Ganoderma lucidum and Hirsutella sinensis) produce opposite effects on NK cells. Water extracts enhance NK cell cytotoxic activity against cancer cells, whereas ethanol extracts inhibit cytotoxicity. Water extracts stimulate the expression and production of cytolytic proteins (perforin and granulysin) and NKG2D/NCR cell surface receptors, and activate intracellular signaling kinases (ERK, JNK and p38). In contrast, ethanol extracts inhibit expression of cytolytic and cell surface receptors. Our results suggest that the mode of extraction of medicinal mushrooms may determine the nature of the immunomodulatory effects produced on immune cells, presumably owing to the differential solubility of stimulatory and inhibitory mediators. These findings have important implications for the preparation of medicinal mushrooms to prevent and treat human diseases. © The Author(s) 2016.

Exploring optimal supplement strategy of medicinal herbs and tea extracts for bioelectricity generation in microbial fuel cells.

PubMed

Chen, Bor-Yann; Liao, Jia-Hui; Hsu, An-Wei; Tsai, Po-Wei; Hsueh, Chung-Chuan

2018-05-01

This first-attempt study used extracts of appropriate antioxidant abundant Camellia and non-Camellia tea and medicinal herbs as model ESs to stably intensify bioelectricity generation performance in microbial fuel cells (MFCs). As electron shuttles (ESs) could stimulate electron transport phenomena by significant reduction of electron transfer resistance, the efficiency of power generation for energy extraction in microbial fuel cells (MFCs) could be appreciably augmented. Using environmentally friendly natural bioresource as green bioresource of ESs is the most promising to sustainable practicability. As comparison of power-density profiles indicated, supplement of Camellia tea extracts would be the most appropriate, then followed non-Camellia Chrysanthemum tea and medicinal herbs. Antioxidant activities, total phenolic contents and power stimulating activities were all electrochemically associated. In particular, the extract of unfermented Camellia tea (i.e., green tea) was the most promising ESs to augment bioenergy extraction compared to other refreshing medicinal herb extracts. Copyright © 2018 Elsevier Ltd. All rights reserved.

19 CFR 191.102 - Procedure.

Code of Federal Regulations, 2010 CFR

2010-04-01

... (CONTINUED) DRAWBACK Internal Revenue Tax on Flavoring Extracts and Medicinal or Toilet Preparations... medicinal or toilet preparations on which drawback is claimed shall record the products manufactured, the... than 5 percent. If the percentage of alcohol contained in a medicinal preparation, flavoring extract or...

[Optimization theory and practical application of membrane science technology based on resource of traditional Chinese medicine residue].

PubMed

Zhu, Hua-Xu; Duan, Jin-Ao; Guo, Li-Wei; Li, Bo; Lu, Jin; Tang, Yu-Ping; Pan, Lin-Mei

2014-05-01

Resource of traditional Chinese medicine residue is an inevitable choice to form new industries characterized of modem, environmental protection and intensive in the Chinese medicine industry. Based on the analysis of source and the main chemical composition of the herb residue, and for the advantages of membrane science and technology used in the pharmaceutical industry, especially membrane separation technology used in improvement technical reserves of traditional extraction and separation process in the pharmaceutical industry, it is proposed that membrane science and technology is one of the most important choices in technological design of traditional Chinese medicine resource industrialization. Traditional Chinese medicine residue is a very complex material system in composition and character, and scientific and effective "separation" process is the key areas of technology to re-use it. Integrated process can improve the productivity of the target product, enhance the purity of the product in the separation process, and solve many tasks which conventional separation is difficult to achieve. As integrated separation technology has the advantages of simplified process and reduced consumption, which are in line with the trend of the modern pharmaceutical industry, the membrane separation technology can provide a broad platform for integrated process, and membrane separation technology with its integrated technology have broad application prospects in achieving resource and industrialization process of traditional Chinese medicine residue. We discuss the principles, methods and applications practice of effective component resources in herb residue using membrane separation and integrated technology, describe the extraction, separation, concentration and purification application of membrane technology in traditional Chinese medicine residue, and systematically discourse suitability and feasibility of membrane technology in the process of traditional Chinese medicine resource industrialization in this paper.

Neuroprotective effects of phytocannabinoid-based medicines in experimental models of Huntington's disease.

PubMed

Sagredo, Onintza; Pazos, M Ruth; Satta, Valentina; Ramos, José A; Pertwee, Roger G; Fernández-Ruiz, Javier

2011-09-01

We studied whether combinations of botanical extracts enriched in either Δ(9)-tetrahydrocannabinol (Δ(9)-THC) or cannabidiol (CBD), which are the main constituents of the cannabis-based medicine Sativex, provide neuroprotection in rat models of Huntington's disease (HD). We used rats intoxicated with 3-nitropropionate (3NP) that were given combinations of Δ(9)-THC- and CBD-enriched botanical extracts. The issue was also studied in malonate-lesioned rats. The administration of Δ(9)-THC- and CBD-enriched botanical extracts combined in a ratio of 1:1 as in Sativex attenuated 3NP-induced GABA deficiency, loss of Nissl-stained neurons, down-regulation of CB(1) receptor and IGF-1 expression, and up-regulation of calpain expression, whereas it completely reversed the reduction in superoxide dismutase-1 expression. Similar responses were generally found with other combinations of Δ(9)-THC- and CBD-enriched botanical extracts, suggesting that these effects are probably related to the antioxidant and CB(1) and CB(2) receptor-independent properties of both phytocannabinoids. In fact, selective antagonists for both receptor types, i.e., SR141716 and AM630, respectively, were unable to prevent the positive effects on calpain expression caused in 3NP-intoxicated rats by the 1:1 combination of Δ(9)-THC and CBD. Finally, this combination also reversed the up-regulation of proinflammatory markers such as inducible nitric oxide synthase observed in malonate-lesioned rats. In conclusion, this study provides preclinical evidence in support of a beneficial effect of the cannabis-based medicine Sativex as a neuroprotective agent capable of delaying disease progression in HD, a disorder that is currently poorly managed in the clinic, prompting an urgent need for clinical trials with agents showing positive results in preclinical studies. Copyright © 2011 Wiley-Liss, Inc.

Antioxidative and antimutagenic activities of healthy herbal drinks from Chinese medicinal herbs.

PubMed

Chen, Wenlung; Weng, Yih-Ming; Tseng, Chin-Yin

2003-01-01

Twenty-nine Chinese medicinal herbs and three healthy herbal drinks made of those herbs in a food processing pilot plant were tested for their antioxidative, free radical scavenging, mutagenic and antimutagenic activities. Water extracts of herbs (with few exceptions) and herbal drinks showed free radical scavenging activity. All water extracts of herbs and herbal drinks showed no mutagenicity toward Salmonella typhimurium tester strains TA98 and TA100 used in the Ames mutagenic tests. In the antimutagenic tests, the mutagenic activity of 4-nitroquinoline N-oxide (NQNO) toward S. typhimurium TA98 was markedly inhibited by water extracts of herbs and herbal drinks. Based on the results, it is suggested that the herbal drinks manufactured in pilot-plant scale are safe and can be served as health-promoting drinks for the public.

Towards evidence-based medicine in specific grass pollen immunotherapy.

PubMed

Calderon, M; Mösges, R; Hellmich, M; Demoly, P

2010-04-01

When initiating grass pollen immunotherapy for seasonal allergic rhinoconjunctivitis, specialist physicians in many European countries must choose between modalities of differing pharmaceutical and regulatory status. We applied an evidence-based medicine (EBM) approach to commercially available subcutaneous and sublingual Gramineae grass pollen immunotherapies (SCIT and SLIT) by evaluating study design, populations, pollen seasons, treatment doses and durations, efficacy, quality of life, safety and compliance. After searching MEDLINE, Embase and the Cochrane Library up until January 2009, we identified 33 randomized, double-blind, placebo-controlled trials (including seven paediatric trials) with a total of 440 specific immunotherapy (SIT)-treated subjects in seven trials (0 paediatric) for SCIT with natural pollen extracts, 168 in three trials (0 paediatric) for SCIT with allergoids, 906 in 16 trials (five paediatric) for natural extract SLIT drops, 41 in two trials (one paediatric) for allergoid SLIT tablets and 1605 in five trials (two paediatric) for natural extract SLIT tablets. Trial design and quality varied significantly within and between SIT modalities. The multinational, rigorous trials of natural extract SLIT tablets correspond to a high level of evidence in adult and paediatric populations. The limited amount of published data on allergoids prevented us from judging the level of evidence for this modality.

Net analyte signal standard addition method for simultaneous determination of sulphadiazine and trimethoprim in bovine milk and veterinary medicines.

PubMed

Hajian, Reza; Mousavi, Esmat; Shams, Nafiseh

2013-06-01

Net analyte signal standard addition method has been used for the simultaneous determination of sulphadiazine and trimethoprim by spectrophotometry in some bovine milk and veterinary medicines. The method combines the advantages of standard addition method with the net analyte signal concept which enables the extraction of information concerning a certain analyte from spectra of multi-component mixtures. This method has some advantages such as the use of a full spectrum realisation, therefore it does not require calibration and prediction step and only a few measurements require for the determination. Cloud point extraction based on the phenomenon of solubilisation used for extraction of sulphadiazine and trimethoprim in bovine milk. It is based on the induction of micellar organised media by using Triton X-100 as an extraction solvent. At the optimum conditions, the norm of NAS vectors increased linearly with concentrations in the range of 1.0-150.0 μmolL(-1) for both sulphadiazine and trimethoprim. The limits of detection (LOD) for sulphadiazine and trimethoprim were 0.86 and 0.92 μmolL(-1), respectively. Copyright © 2012 Elsevier Ltd. All rights reserved.

Vasorelaxant effects of aqueous leaf extract of Tridax procumbens on aortic smooth muscle isolated from the rat.

PubMed

Salahdeen, Hussein M; Murtala, Babatunde A

2012-01-01

Tridax procumbens is commonly used in traditional medicine in southern part of Nigeria for the treatment of hypertension. However, the mechanism of its antihypertensive properties remains unclear. Attempts were made to investigate the properties of direct actions of aqueous extract of the leaves of T. procumbens on mechanical responses of smooth muscles in aortic ring preparations isolated from the rat. Endothelium-intact aortic rings, isolated from the normotensive rats, had been pre-contracted with noradrenaline, and cumulative addition of the aqueous extract (0.15-1.05 mg/mL) to the bathing fluid induced a concentration-dependent relaxation. Aqueous extract of T. procumbens also attenuated the contractile responses to KCl and shifted the concentration-response curve to the right. The contractile responses to serotonin were also attenuated and the concentration-response curve was shifted to the right in the presence of the extract. The results of this study indicated that aqueous leaf extract of T. procumbens possesses vasodilatory effects on the aortic smooth muscles isolated from the rat. Based on these results, a possible mechanism involved in the relaxing actions of the extract on vascular smooth muscle was discussed. The results of this study may provide a scientific basis for the use of this extract to the treatment of hypertension in Nigerian traditional medicine.

Total flavonoid content and antioxidant activity in leaves and stems extract of cultivated and wild tabat barito (Ficus deltoidea Jack)

NASA Astrophysics Data System (ADS)

Manurung, Hetty; Kustiawan, Wawan; Kusuma, Irawan W.; Marjenah

2017-02-01

Tabat barito (Ficus deltoidea Jack) is a name given by Dayak Tribe who lived in Borneo-Kalimantan and it is belongs to the moraceae. Almost all of the parts of F. deltoidea plant is widely used as a medicinal property. The total flavonoid content (TFC) and antioxidant activity from cultivated and wild F. deltoidea leaves and stems extract were assessed. Total flavonoid content was estimated by using Aluminium chloride colorimetric method and expressed as catechin equivalents (mg CE g-1 extract) and the antioxidant activity by the DPPH (2,2-diphenyl-1-picryl hydrazyl) method. The content of total flavonoid of leaves and stems (430.77 and 371.80 µg CE mg-1 extract) of cultivated F. deltoidea were higher than in the wild leaves and stems (114.82 and 66.67 µg CE mg-1 extract). The IC50 of leaves extract of cultivated and wild F. deltoidea, based on the DPPH assay, has a strong antioxidant activity (34.19 and 39.31 µg mL-1 extract) as compared to stems extract. These results showed that the cultivated F. deltoidea are suitable source for medicinal properties and the leaves could be exploited as source of natural antioxidants.

[Application of ultrasound counter currentextraction in patent of traditional Chinese medicine].

PubMed

Miao, Yan-ni; Wu, Bin; Yue, Xue-lian

2015-07-01

The patent information of ultrasound countercurrent extraction used in traditional Chinese medicine was analyzed in this paper by the samples from Derwent World Patent Database (DWPI) and the Chinese Patent Abstracts Database (CNABS). The application of ultrasound countercurrent was discussed with the patent applicant,the amount of the annual distribution, and the pharmaceutical raw materials and other aspects. While the technical parameters published in the patent was deeply analyzed, such as material crushing, extraction solvent, extraction time and temperature, extraction equipment and ultrasonic frequency. Thought above research, various technical parameters of ultrasound countercurrent extraction used in traditional Chinese was summarize. The analysis conclusion of the paper can be used in discovering the technical advantages, optimizing extraction conditions, and providing a reference to extraction technological innovation of traditional Chinese medicine.

An extract based on the medicinal mushroom Agaricus blazei Murill stimulates monocyte-derived dendritic cells to cytokine and chemokine production in vitro.

PubMed

Førland, D T; Johnson, E; Tryggestad, A M A; Lyberg, T; Hetland, G

2010-03-01

The edible mushroom Agaricus blazei Murill (AbM), which has been used in traditional medicine against a range of diseases and possess immunomodulating properties, probably due to its high content of beta-glucans. Others and we have demonstrated stimulatory effects of extracts of this mushroom on different immune cells. Dendritic cells are major directors of immune function. We wanted to examine the effect of AbM stimulation on signal substance release from monocyte-derived dendritic cells (MDDC). After 6d incubation with IL-4 and GM-CSF, the cells were true MDDC. Then the cells were further incubated with up to 10% of the AbM-based extract, AndoSan, LPS (0.5 microg/ml) or PBS control. We found that the AbM extract promoted dose-dependent increased levels of IL-8, G-CSF, TNFalpha, IL-1beta, IL-6 and MIP-1beta, in that order. The synthesis of IL-2, IL-8 and IFNgamma were similar for the AbM extract and LPS. However, AndoSan induced a 10- to 2-fold higher production than did LPS of G-CSF, TNFalpha and IL-1beta, respectively. AbM did not induce increased synthesis of Th2 or anti-inflammatory cytokines or the Th1 cytokine IL-12. We conclude that stimulation of MDDC with an AbM-based extract resulted in increased production of proinflammatory, chemotactic and some Th1-type cytokines in vitro. 2009. Published by Elsevier Ltd.

Phytochemical Screening and Acute Toxicity of Aqueous Extract of Leaves of Conocarpus erectus Linnaeus in Swiss Albino Mice.

PubMed

Nascimento, Dayane K D; Souza, Ivone A DE; Oliveira, Antônio F M DE; Barbosa, Mariana O; Santana, Marllon A N; Pereira, Daniel F; Lira, Eduardo C; Vieira, Jeymesson R C

2016-09-01

Mangroves represent areas of high biological productivity and it is a region rich in bioactive substances used in medicine production. Conocarpus erectus (Combretaceae) known as button mangrove is one of the species found in mangroves and it is used in folk medicine in the treatment of anemia, catarrh, conjunctivitis, diabetes, diarrhea, fever, gonorrhea, headache, hemorrhage, orchitis, rash, bumps and syphilis. The present study aimed to investigate the acute toxicity of aqueous extract of leaves of C. erectus in Swiss albino mice. The plant material was collected in Vila Velha mangroves, located in Itamaracá (PE). The material was subjected to a phytochemical screening where extractive protocols to identify majority molecules present in leaves were used. The evaluation of acute toxicity of aqueous extract of C. erectus followed the model of Acute Toxicity Class based on OECD 423 Guideline, 2001. The majority molecules were identified: flavonoids, tannins and saponins. The LD50 was estimated at 2,000 mg/kg bw. Therefore, the aqueous extract showed low acute toxicity classified in category 5.

Evaluation of Selected Culinary-Medicinal Mushrooms for Antioxidant and ACE Inhibitory Activities

PubMed Central

Abdullah, Noorlidah; Ismail, Siti Marjiana; Aminudin, Norhaniza; Shuib, Adawiyah Suriza; Lau, Beng Fye

2012-01-01

Considering the importance of diet in prevention of oxidative stress-related diseases including hypertension, this study was undertaken to evaluate the in vitro antioxidant and ACE inhibitory activities of selected culinary-medicinal mushrooms extracted by boiling in water for 30 min. Antioxidant capacity was measured using the following assays: DPPH free radical scavenging activity, β-carotene bleaching, inhibition of lipid peroxidation, reducing power ability, and cupric ion reducing antioxidant capacity (CUPRAC). Antioxidant potential of each mushroom species was calculated based on the average percentages relative to quercetin and summarized as Antioxidant Index (AI). Ganoderma lucidum (30.1%), Schizophyllum commune (27.6%), and Hericium erinaceus (17.7%) showed relatively high AI. Total phenolics in these mushrooms varied between 6.19 to 63.51 mg GAE/g extract. In the ACE inhibitory assay, G. lucidum was shown to be the most potent species (IC50 = 50 μg/mL). Based on our findings, culinary-medicinal mushrooms can be considered as potential source of dietary antioxidant and ACE inhibitory agents. PMID:21716693

Antibacterial and antifungal activities of some Mexican medicinal plants.

PubMed

Ruiz-Bustos, E; Velazquez, C; Garibay-Escobar, A; García, Z; Plascencia-Jatomea, M; Cortez-Rocha, M O; Hernandez-Martínez, J; Robles-Zepeda, R E

2009-12-01

In Mexico about 4,000 plant species have some medicinal use. The aim of this work was to evaluate the antimicrobial activity of six Mexican medicinal plants against fungi and Gram-positive and Gram-negative bacteria. Methanolic extracts were prepared from the Mexican medicinal plants Amphypteringium adstrigens, Castella tortuosa, Coutarea latiflora, Ibervillea sonorae, Jatropha cuneata, and Selaginella lepidophylla. The antibacterial and antifungal activities of the plants were determined by the broth microdilution method and the radial growth inhibition assay, respectively. All Mexican plants tested showed antimicrobial activity. Among the six plant extracts analyzed, J. cuneata showed the highest growth-inhibitory activity against fungi, Gram-positive and Gram-negative bacteria (J. cuneata > A. adstrigens > C. latiflora > C. tortuosa > I. sonorae approximately S. lepidophylla). Shigella flexneri and Staphylococcus aureus were the most susceptible bacteria to plant extracts. Complete inhibition of S. flexneri growth was observed with J. cuneata methanolic extract at 90 microg/mL. This plant extract also showed the strongest antifungal activity against Fusarium verticillioides and Aspergillus niger. Our data suggest that the medicinal plants tested have important antimicrobial properties. This is the first report describing the antimicrobial activities of several of the Mexican medicinal plants used in this study.

Antimicrobial and antioxidant activities of Cortex Magnoliae Officinalis and some other medicinal plants commonly used in South-East Asia

PubMed Central

Chan, Lai Wah; Cheah, Emily LC; Saw, Constance LL; Weng, Wanyu; Heng, Paul WS

2008-01-01

Background Eight medicinal plants were tested for their antimicrobial and antioxidant activities. Different extraction methods were also tested for their effects on the bioactivities of the medicinal plants. Methods Eight plants, namely Herba Polygonis Hydropiperis (Laliaocao), Folium Murraya Koenigii (Jialiye), Rhizoma Arachis Hypogea (Huashenggen), Herba Houttuyniae (Yuxingcao), Epipremnum pinnatum (Pashulong), Rhizoma Typhonium Flagelliforme (Laoshuyu), Cortex Magnoliae Officinalis (Houpo) and Rhizoma Imperatae (Baimaogen) were investigated for their potential antimicrobial and antioxidant properties. Results Extracts of Cortex Magnoliae Officinalis had the strongest activities against M. Smegmatis, C. albicans, B. subtilis and S. aureus. Boiled extracts of Cortex Magnoliae Officinalis, Folium Murraya Koenigii, Herba Polygonis Hydropiperis and Herba Houttuyniae demonstrated greater antioxidant activities than other tested medicinal plants. Conclusion Among the eight tested medicinal plants, Cortex Magnoliae Officinalis showed the highest antimicrobial and antioxidant activities. Different methods of extraction yield different spectra of bioactivities. PMID:19038060

Bioactivity of indigenous medicinal plants against the cotton whitefly, Bemisia tabaci

PubMed Central

Hammad, E. Abou-Fakhr; Zeaiter, A.; Saliba, N.; Talhouk, S.

2014-01-01

Abstract Forty-one methanol extracts of 28 indigenous medicinal plant species were tested for their insecticidal bioactivity against cotton whitefly, Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae), adults and second nymphal instars under controlled conditions. This study is within a bioprospection context, in the form of utilizing local plant species as an alternative in sustainable agriculture development. Eighteen and nine plant extracts caused a significant decrease in number of live adult and nymphal whiteflies, respectively, compared to the control. This is the first report for the potential effect on survival of insects for 22 out of 28 tested medicinal plant species. Whole plant extracts of Ranunculus myosuroudes Boiss. and Kotschy (Ranunculaceae), Achillea damascena L. (Asteraceae), and Anthemis hebronica Boiss. and Kotschy (Asteraceae) and leaf extracts of Verbascum leptostychum DC. (Scrophulariaceae) and Heliotropium rotundifolium Boiss. (Borangiaceae) caused both repellent and toxic effects against the adult and second nymphal instars, respectively. Extracts of leaves and stems of Anthemis scariosa Boiss. (Asteraceae) and Calendula palestina Pers. (Asteraceae) were found to be more bioactive against the adult and nymphal instars, respectively, than extracts of other plant parts, such as flowers. Thus, the bioactive extracts of these medicinal plants have the potential to lower whitefly populations in a comprehensive pest management program in local communities, pending cultivation of these medicinal plant species. PMID:25204756

Medicinal chemistry and pharmacology of genus Tripterygium (Celastraceae)

PubMed Central

Brinker, Anita M.; Ma, Jun; Lipsky, Peter E.; Raskin, Ilya

2013-01-01

Plants in the genus Tripterygium, such as Tripterygium wilfordii Hook. f., have a long history of use in traditional Chinese medicine. In recent years there has been considerable interest in the use of Tripterygium extracts and of the main bioactive constituent, the diterpene triepoxide triptolide (1), to treat a variety of autoimmune and inflammation-related conditions. The main mode of action of the Tripterygium extracts and triptolide (1) is the inhibition of expression of proinflammatory genes such as those for interleukin-2 (IL-2), inducible nitric oxide synthase (iNOS), tumor necrosis factor-α (TNF-α), cyclooxygenase-2 (COX-2) and interferon-gamma (IFN-γ). The efficacy and safety of certain types of Tripterygium extracts were confirmed in human clinical trials in the US and abroad. Over 300 compounds have been identified in the genus Tripterygium, and many of these have been evaluated for biological activity. The overall activity of the extract is based on the interaction between its components. Therefore, the safety and efficacy of the extract cannot be fully mimicked by any individual constituent. This review discusses the biochemical composition and biological and pharmacological activities of Tripterygium extracts, and their main bioactive components. PMID:17250858

Medicinal chemistry and pharmacology of genus Tripterygium (Celastraceae).

PubMed

Brinker, Anita M; Ma, Jun; Lipsky, Peter E; Raskin, Ilya

2007-03-01

Plants in the genus Tripterygium, such as Tripterygium wilfordii Hook.f., have a long history of use in traditional Chinese medicine. In recent years there has been considerable interest in the use of Tripterygium extracts and of the main bioactive constituent, the diterpene triepoxide triptolide (1), to treat a variety of autoimmune and inflammation-related conditions. The main mode of action of the Tripterygium extracts and triptolide (1) is the inhibition of expression of proinflammatory genes such as those for interleukin-2 (IL-2), inducible nitric oxide synthase (iNOS), tumor necrosis factor-alpha (TNF-alpha), cyclooxygenase-2 (COX-2) and interferon-gamma (IFN-gamma). The efficacy and safety of certain types of Tripterygium extracts were confirmed in human clinical trials in the US and abroad. Over 300 compounds have been identified in the genus Tripterygium, and many of these have been evaluated for biological activity. The overall activity of the extract is based on the interaction between its components. Therefore, the safety and efficacy of the extract cannot be fully mimicked by any individual constituent. This review discusses the biochemical composition and biological and pharmacological activities of Tripterygium extracts, and their main bioactive components.

Anti-inflammatory and analgesic activities of Tunisian Citrullus colocynthis Schrad. immature fruit and seed organic extracts.

PubMed

Marzouk, B; Marzouk, Z; Fenina, N; Bouraoui, A; Aouni, M

2011-06-01

Inflammations and immune-related diseases including rheumatoid arthritis are widespread in the entire globe. The treatment of these illnesses is mainly based on the use of synthetic and biotechnological drugs, in recent years. Tunisian traditional medicine is a potential source of new remedies namely Citrullus colocynthis Schrad. (Cucurbitaceae): endemic in southern Tunisia and used in folk medicine to treat many inflammation disorders. Our goal was to assess the in vivo analgesic and anti-inflammatory activities of Tunisian Citrullus colocynthis immature fruit and seed organic extracts (petroleum ether, chloroform, ethyl acetate, acetone and finely methanol extract). Yields of prepared organic extracts are gravimetrically determined. For the analgesic and anti-inflammatory activities, we have used respectively, the acetic acid writhing test in mice and the carrageenan-induced paw edema assay in rats. All extracts displayed an important analgesic and anti-inflammatory activities at different doses without inducing any side effects. This study has demonstrated the analgesic and anti-inflammatory activities of Citrullus colocynthis immature fruit and seed extracts. Experiment results provide scientific insight into the ancient practice of utilizing Citrullus colocynthis Schrad. as analgesic and as anti-inflammatory agents.

Association Rule Based Feature Extraction for Character Recognition

NASA Astrophysics Data System (ADS)

Dua, Sumeet; Singh, Harpreet

Association rules that represent isomorphisms among data have gained importance in exploratory data analysis because they can find inherent, implicit, and interesting relationships among data. They are also commonly used in data mining to extract the conditions among attribute values that occur together frequently in a dataset [1]. These rules have wide range of applications, namely in the financial and retail sectors of marketing, sales, and medicine.

Whither systems medicine?

PubMed Central

Apweiler, Rolf; Beissbarth, Tim; Berthold, Michael R; Blüthgen, Nils; Burmeister, Yvonne; Dammann, Olaf; Deutsch, Andreas; Feuerhake, Friedrich; Franke, Andre; Hasenauer, Jan; Hoffmann, Steve; Höfer, Thomas; Jansen, Peter LM; Kaderali, Lars; Klingmüller, Ursula; Koch, Ina; Kohlbacher, Oliver; Kuepfer, Lars; Lammert, Frank; Maier, Dieter; Pfeifer, Nico; Radde, Nicole; Rehm, Markus; Roeder, Ingo; Saez-Rodriguez, Julio; Sax, Ulrich; Schmeck, Bernd; Schuppert, Andreas; Seilheimer, Bernd; Theis, Fabian J; Vera, Julio; Wolkenhauer, Olaf

2018-01-01

New technologies to generate, store and retrieve medical and research data are inducing a rapid change in clinical and translational research and health care. Systems medicine is the interdisciplinary approach wherein physicians and clinical investigators team up with experts from biology, biostatistics, informatics, mathematics and computational modeling to develop methods to use new and stored data to the benefit of the patient. We here provide a critical assessment of the opportunities and challenges arising out of systems approaches in medicine and from this provide a definition of what systems medicine entails. Based on our analysis of current developments in medicine and healthcare and associated research needs, we emphasize the role of systems medicine as a multilevel and multidisciplinary methodological framework for informed data acquisition and interdisciplinary data analysis to extract previously inaccessible knowledge for the benefit of patients. PMID:29497170

Extraction of GBH Film Medicine and Influence on Quality Evaluation of The Film

NASA Astrophysics Data System (ADS)

Ji, Y. B.; Lu, L.; Ru, X.; Guo, S. Z.; Qiao, A. N.; Wang, S. W.

2017-12-01

To know the extraction effects of GBH film medicine and the influence on film quality evaluation. Ultrasonic extraction and reflux extraction were used to extract the two methods with the traditional water decocting method to contrast. They were used to determining the content of total flavonoids. The same method was used to separate the root of the main medicinal herbs and the decoction of the water decoction of the other drug powder. They were used to determine the content of total flavonoids. The effect of extraction method on the preparation of membrane was investigated. The membrane preparation, evaluation and flexibility, respectively, film-forming property, smoothness and disintegration time are used to evaluating separately the effect of extraction method. The results showed that the extraction effect of 70% ethanol concentration of total flavonoids. The best extraction method had no effect on the film quality initial evaluation. This experiment provides a method for membrane extraction agent, has a certain practical significance.

Alternative medicine safety: Agaricus blazei and propolis.

PubMed

Sorimachi, Kenji; Nakamoto, Takaaki

2011-08-01

All medicines pose a potential health risk, be they Eastern or Western medicines. Newly developed Western drugs must undergo rigorous testing to ensure their efficacy and safety, while with Eastern drugs, safety has generally been established because of their long histories of safe usage as traditional medicines. The regulation of Western medicines is much stronger than that of Eastern medicines, partly as pure chemicals are used and their effects and side effects are more likely to be acute. Eastern medicines consist of multiple components, generally extracted from a single or several plants or other natural sources, and their effects are not so acute, with delayed onset of side effects. However, the chronic usage of many Eastern medicines may result in the gradual accumulation of toxic compounds in the body. For example, Agaricus blazei extracts have been used as alternative medicines for cancer, but contain the known carcinogen agaritine (this carcinogen is also present in Agaricus bisporus). To ensure the safety of this alternative medicine, agaritine should be removed or its content reduced if the extract is to be taken chronically. Clearly, the safety of not only pure medicines, but also alternative medicines and daily foods, should be carefully controlled.

Artificial intelligence in cardiology.

PubMed

Bonderman, Diana

2017-12-01

Decision-making is complex in modern medicine and should ideally be based on available data, structured knowledge and proper interpretation in the context of an individual patient. Automated algorithms, also termed artificial intelligence that are able to extract meaningful patterns from data collections and build decisions upon identified patterns may be useful assistants in clinical decision-making processes. In this article, artificial intelligence-based studies in clinical cardiology are reviewed. The text also touches on the ethical issues and speculates on the future roles of automated algorithms versus clinicians in cardiology and medicine in general.

Management of Breast Milk Oversupply in Traditional Persian Medicine.

PubMed

Kabiri, Marya; Kamalinejad, Mohammad; Sohrabvand, Farnaz; Bioos, Soodabeh; Babaeian, Mohammad

2017-10-01

Comprehensive explanation about milk oversupply is not available in the current literature because few studies have been done on this topic. In traditional Persian medicine, milk oversupply and its management have been described. The aim of this study was to investigate milk oversupply from the perspective of medieval Persian practitioners. In this study, some main medical resources of traditional Persian medicine such as Al-Havi and the Canon of Medicine were studied to extract valuable information about milk oversupply. Etiology of milk overproduction according to traditional Persian medicine is based on humors theory and cannot be easily compared with current medical concepts. Diet modifications and natural remedies have been applied for managing this condition but the majority of traditional Persian medicine interventions for reducing milk oversupply have not been scientifically investigated in modern medicine. The knowledge of milk oversupply in traditional Persian medicine may be helpful to conduct further related studies.

Management of Breast Milk Oversupply in Traditional Persian Medicine

PubMed Central

Kabiri, Marya; Kamalinejad, Mohammad; Sohrabvand, Farnaz; Bioos, Soodabeh

2017-01-01

Comprehensive explanation about milk oversupply is not available in the current literature because few studies have been done on this topic. In traditional Persian medicine, milk oversupply and its management have been described. The aim of this study was to investigate milk oversupply from the perspective of medieval Persian practitioners. In this study, some main medical resources of traditional Persian medicine such as Al-Havi and the Canon of Medicine were studied to extract valuable information about milk oversupply. Etiology of milk overproduction according to traditional Persian medicine is based on humors theory and cannot be easily compared with current medical concepts. Diet modifications and natural remedies have been applied for managing this condition but the majority of traditional Persian medicine interventions for reducing milk oversupply have not been scientifically investigated in modern medicine. The knowledge of milk oversupply in traditional Persian medicine may be helpful to conduct further related studies. PMID:28817945

Standardized Cannabis sativa extract attenuates tau and stathmin gene expression in the melanoma cell line.

PubMed

Vaseghi, Golnaz; Taki, Mohamad Javad; Javanmard, Shaghayegh Haghjooy

2017-10-01

Metastasis is the main cause of death in patients with melanoma. Cannabis-based medicines are effective adjunctive drugs in cancer patients. Tau and Stathmin proteins are the key proteins in cancer metastasis. Here we have investigated the effect of a standardized Cannabis sativa extract on cell migration and Tau and Stathmin gene expression in the melanoma cell line. In the treatment group, melanoma (B1617) was treated 48 hr with various concentrations of standardized C. sativa extract. Cells with no treatment were considered as the control group, then study was followed by Quantitative RT-Real Time PCR assay. Relative gene expression was calculated by the ΔΔct method. Migration assay was used to evaluate cancer metastasis. Tau and stathmin gene expression was significantly decreased compared to the control group. Cell migration was also significantly reduced compared to controls. C. sativa decreased tau and stathmin gene expression and cancer metastasis. The results may have some clinical relevance for the use of cannabis-based medicines in patients with metastatic melanoma.

Survey on medicinal plants traditionally used in Senegal for the treatment of tuberculosis (TB) and assessment of their antimycobacterial activity.

PubMed

Diop, ElHadji Assane; Queiroz, Emerson Ferreira; Kicka, Sébastien; Rudaz, Serge; Diop, Tahir; Soldati, Thierry; Wolfender, Jean-Luc

2018-04-24

In West Africa, populations are used to taking traditional medicine as a first aid against common health problems. In this aspect, many plants are claimed to be effective in the treatment of Tuberculosis (TB), which according to the World Health Organization (WHO) remains one of the world's deadliest communicable diseases. The main aim of this study was to identify plants used to treat TB-symptoms by the population of Senegal and to evaluate their possible concomitant use with clinically approved TB-drugs. This approach allowed the selection of plants effectively used in traditional medicine. In order to verify if the usage of some of these plants can be rationalized, the activity of their traditional preparations was assessed with both an intracellular and extracellular antimycobacterial host-pathogen assays. An ethnopharmacological survey conducted on 117 TB-patients and 30 healers in Senegal from March to May 2014. The questionnaires were focused on the use of medicinal plants to treat common TB -symptoms (cough longer than 2 weeks, fever, night sweats, weight loss and bloody sputum). Local plant names, utilized organs (herbal drugs) and traditional formulations of the plants were recorded. Extracts were prepared by mimicking the traditional decoction in boiling water and screened for their antimycobacterial activity using Mycobacterium marinum, as a validated TB surrogate, and an Acanthamoeba castellanii - M. marinum whole-cell based host-pathogen assay, to detect anti-infective activities. By the end of the survey, nearly 30 plants were cited and the 12 most cited herbal drugs were collected and their usage documented by extensive literature search. Extracts of the chosen herbs were screened with the described assays; with a main focus on traditional formulas (mainly herbal decoctions). Two of the water extracts from Combretum aculeatum and Guiera senegalensis showed significant antimycobacterial activities when compared to the positive control drug (rifampin). These extracts showed no observable toxicity against amoeba host cells (Acanthamoeba castellanii). This study demonstrates that most of the patients do not concomitantly use plants and TB drugs (~90% of informants) but, instead, most are treated with medicinal plants before they are admitted to a hospital (41%). Interestingly, among the aqueous extracts assayed, two extracts (Combretum aculeatum (Combretaceae) and Guiera senegalensis (Combretaceae)) collected within this survey demonstrate antimycobacterial activities on the validated whole-cell based host-pathogen assay. Both extracts showed significant activities against intracellular and extracellular - M. marinum growth presenting IC 50 lower than 0.5mg/ml compared to the reference drug Rifampin (IC 50 of 0.4 and 7µg/ml). No toxicity was observed for amoebae cells at concentration until 0.8mg/ml. Copyright © 2017 Elsevier B.V. All rights reserved.

[Study on balance group in steady-state extraction process of Chinese medicine and experimental verification to Houttuynia cordata].

PubMed

Liu, Wenlong; Zhang, Xili; He, Fuyuan; Zhang, Ping; Wang, Haiqin; Wu, Dezhi; Chen, Zuohong

2011-11-01

To establish and experimental verification the mathematical model of the balance groups that is the steady-state of traditional Chinese medicine in extraction. Using the entropy and genetic principles of statistics, and taking the coefficient of variation of GC fingerprint which is the naphtha of the Houttuynia cordata between strains in the same GAP place as a pivot to establish and verify the mathematical model was established of the balance groups that is the steady-state of traditional Chinese medicine in extraction. A mathematical model that is suitable for the balance groups of the steady-state of traditional Chinese medicine and preparation in extraction, and the balance groups which is 29 683 strains (approximately 118.7 kg) were gained with the same origin of H. cordata as the model drug. Under the GAP of quality control model, controlling the stability of the quality through further using the Hardy-Weinberg balance groups of the H. cordata between strains, the new theory and experiment foundation is established for the steady-state of traditional Chinese medicine in extraction and quality control.

Prospective bacterial quorum sensing inhibitors from Indian medicinal plant extracts.

PubMed

Tiwary, B K; Ghosh, R; Moktan, S; Ranjan, V K; Dey, P; Choudhury, D; Dutta, S; Deb, D; Das, A P; Chakraborty, R

2017-07-01

As virulence of many pathogenic bacteria is regulated by the phenomenon of quorum sensing (QS), the present study aimed to find the QS-inhibiting (QS-I) property (if any) in 61 Indian medicinal plants. The presence of QS-I compound in the leaf extract was evaluated by its ability to inhibit production of pigment in Chromobacterium violaceum MTCC 2656 (violacein) and Pseudomonas aeruginosa MTCC 2297 (pyocyanin) or swarming of P. aeruginosa MTCC 2297. Extracts of three plants, Astilbe rivularis, Fragaria nubicola and Osbeckia nepalensis, have shown a dose-dependent inhibition of violacein production with no negative effect on bacterial growth. Inhibition of pyocyanin pigment production and swarming motility in P. aeruginosa MTCC 2297 was also shown. Based on the results obtained by gas chromatography-mass spectroscopy (GC-MS) and thin-layer chromatography-direct bioautography (TLC-DB), it was concluded that triterpenes and flavonoid compounds found in the three plant extracts could have QS-I activity. A novel alternative prospect to prevent bacterial infections without inhibiting the growth is to apply chemicals that inhibit quorum sensing mechanism of the pathogens. Antiquorum property of 61 medicinal plants was evaluated by the ability of their leaf extract(s) to inhibit production of pigment (violacein in Chromobacterium violaceum MTCC 2656, pyocyanin in Pseudomonas aeruginosa MTCC 2297) or swarming in P. aeruginosa MTCC 2297. The most prospective plants (for the development of quorum sensing inhibitor), showing inhibition of violacein production without affecting bacterial growth, were Astilbe rivularis, Fragaria nubicola and Osbeckia nepalensis. © 2017 The Society for Applied Microbiology.

Differentiated Evaluation of Extract-Specific Evidence on Cimicifuga racemosa's Efficacy and Safety for Climacteric Complaints

PubMed Central

Beer, A.-M.; Neff, A.

2013-01-01

Past reviews on Cimicifuga racemosa (CR) without differentiation between extracts, quality, and indication altogether led to inconsistent data. Therefore, for the first time, we meet the requirements of the system's logic of evidence-based phytotherapy by taking into consideration extracts, pharmaceutical quality (reflected in a regulatory status as medicinal product), and indication. A literature search for clinical studies examining CR's efficacy and safety for menopausal complaints was conducted. The results were sorted by type of extract, regulatory status, and indication. Accordingly, Oxford Levels of Evidence (LOE) and Grades of Recommendation (GR) were determined. CR extracts demonstrated a good to very good safety in general, on estrogen-sensitive organs and the liver. However, only registered CR medicinal products were able to prove their efficacy. Best evidence was provided by the isopropanolic CR extract (iCR): the multitude of studies including more than 11,000 patients demonstrated consistent confirmatory evidence of LOE 1b (LOE 1a for safety) leading to GR A. The studies on the ethanolic extract BNO 1055 including more than 500 patients showed exploratory evidence of LOE 2b resulting in GR B. A positive benefit-risk profile is stated and limited to Cimicifuga racemosa products holding a marketing authorisation for treating climacteric complaints. PMID:24062793

Differentiated Evaluation of Extract-Specific Evidence on Cimicifuga racemosa's Efficacy and Safety for Climacteric Complaints.

PubMed

Beer, A-M; Neff, A

2013-01-01

Past reviews on Cimicifuga racemosa (CR) without differentiation between extracts, quality, and indication altogether led to inconsistent data. Therefore, for the first time, we meet the requirements of the system's logic of evidence-based phytotherapy by taking into consideration extracts, pharmaceutical quality (reflected in a regulatory status as medicinal product), and indication. A literature search for clinical studies examining CR's efficacy and safety for menopausal complaints was conducted. The results were sorted by type of extract, regulatory status, and indication. Accordingly, Oxford Levels of Evidence (LOE) and Grades of Recommendation (GR) were determined. CR extracts demonstrated a good to very good safety in general, on estrogen-sensitive organs and the liver. However, only registered CR medicinal products were able to prove their efficacy. Best evidence was provided by the isopropanolic CR extract (iCR): the multitude of studies including more than 11,000 patients demonstrated consistent confirmatory evidence of LOE 1b (LOE 1a for safety) leading to GR A. The studies on the ethanolic extract BNO 1055 including more than 500 patients showed exploratory evidence of LOE 2b resulting in GR B. A positive benefit-risk profile is stated and limited to Cimicifuga racemosa products holding a marketing authorisation for treating climacteric complaints.

Determination of the inhibitory effect of green tea extract on glucose-6-phosphate dehydrogenase based on multilayer capillary enzyme microreactor.

PubMed

Camara, Mohamed Amara; Tian, Miaomiao; Liu, Xiaoxia; Liu, Xin; Wang, Yujia; Yang, Jiqing; Yang, Li

2016-08-01

Natural herbal medicines are an important source of enzyme inhibitors for the discovery of new drugs. A number of natural extracts such as green tea have been used in prevention and treatment of diseases due to their low-cost, low toxicity and good performance. The present study reports an online assay of the activity and inhibition of the green tea extract of the Glucose 6-phosphate dehydrogenase (G6PDH) enzyme using multilayer capillary electrophoresis based immobilized enzyme microreactors (CE-IMERs). The multilayer CE-IMERs were produced with layer-by-layer electrostatic assembly, which can easily enhance the enzyme loading capacity of the microreactor. The activity of the G6PDH enzyme was determined and the enzyme inhibition by the inhibitors from green tea extract was investigated using online assay of the multilayer CE-IMERs. The Michaelis constant (Km ) of the enzyme, the IC50 and Ki values of the inhibitors were achieved and found to agree with those obtained using offline assays. The results show a competitive inhibition of green tea extract on the G6PDH enzyme. The present study provides an efficient and easy-to-operate approach for determining G6PDH enzyme reaction and the inhibition of green tea extract, which may be beneficial in research and the development of natural herbal medicines. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

MSL: Facilitating automatic and physical analysis of published scientific literature in PDF format.

PubMed

Ahmed, Zeeshan; Dandekar, Thomas

2015-01-01

Published scientific literature contains millions of figures, including information about the results obtained from different scientific experiments e.g. PCR-ELISA data, microarray analysis, gel electrophoresis, mass spectrometry data, DNA/RNA sequencing, diagnostic imaging (CT/MRI and ultrasound scans), and medicinal imaging like electroencephalography (EEG), magnetoencephalography (MEG), echocardiography  (ECG), positron-emission tomography (PET) images. The importance of biomedical figures has been widely recognized in scientific and medicine communities, as they play a vital role in providing major original data, experimental and computational results in concise form. One major challenge for implementing a system for scientific literature analysis is extracting and analyzing text and figures from published PDF files by physical and logical document analysis. Here we present a product line architecture based bioinformatics tool 'Mining Scientific Literature (MSL)', which supports the extraction of text and images by interpreting all kinds of published PDF files using advanced data mining and image processing techniques. It provides modules for the marginalization of extracted text based on different coordinates and keywords, visualization of extracted figures and extraction of embedded text from all kinds of biological and biomedical figures using applied Optimal Character Recognition (OCR). Moreover, for further analysis and usage, it generates the system's output in different formats including text, PDF, XML and images files. Hence, MSL is an easy to install and use analysis tool to interpret published scientific literature in PDF format.

Selective extraction and determination of chlorogenic acids as combined quality markers in herbal medicines using molecularly imprinted polymers based on a mimic template.

PubMed

Ji, Wenhua; Zhang, Mingming; Yan, Huijiao; Zhao, Hengqiang; Mu, Yan; Guo, Lanping; Wang, Xiao

2017-12-01

We describe a solid-phase extraction adsorbent based on molecularly imprinted polymers (MIPs), prepared with use of a mimic template. The MIPs were used for the selective extraction and determination of three chlorogenic acids as combined quality markers for Lonicera japonica and Lianhua qingwen granules. The morphologies and surface groups of the MIPs were assessed by scanning electron microscopy, Brunauer-Emmett-Teller surface area analysis, and Fourier transform infrared spectroscopy. The adsorption isotherms, kinetics, and selectivity of the MIPs were systematically compared with those of non-molecularly imprinted polymers. The MIPs showed high selectivity toward three structurally similar chlorogenic acids (chlorogenic acid, cryptochlorogenic acid, and neochlorogenic acid). A procedure using molecularly imprinted solid-phase extraction coupled with high-performance liquid chromatography was established for the determination of three chlorogenic acids from Lonicera japonica and Lianhua qingwen granules. The recoveries of the chlorogenic acids ranged from 93.1% to 101.4%. The limits of detection and limits of quantification for the three chlorogenic acids were 0.003 mg g -1 and 0.01 mg g -1 , respectively. The newly developed method is thus a promising technique for the enrichment and determination of chlorogenic acids from herbal medicines. Graphical Abstract Mimic molecularly imprinted polymers for the selective extraction of chlorogenic acids.

Health-Mining: a Disease Management Support Service based on Data Mining and Rule Extraction.

PubMed

Bei, Andrea; De Luca, Stefano; Ruscitti, Giancarlo; Salamon, Diego

2005-01-01

The disease management is the collection of the processes aimed to control the health care and improving the quality at same time reducing the overall cost of the procedures. Our system, Health-Mining, is a Decision Support System with the objective of controlling the adequacy of hospitalization and therapies, determining the effective use of standard guidelines and eventually identifying better ones emerged from the medical practice (Evidence Based Medicine). In realizing the system, we have the aim of creation of a path to admissions- appropriateness criteria construction, valid at an international level. A main goal of the project is rule extraction and the identification of the rules adequate in term of efficacy, quality and cost reduction, especially in the view of fast changing technologies and medicines. We tested Health-Mining in a real test case for an Italian Region, Regione Veneto, on the installation of pacemaker and ICD.

Lynx: a database and knowledge extraction engine for integrative medicine.

PubMed

Sulakhe, Dinanath; Balasubramanian, Sandhya; Xie, Bingqing; Feng, Bo; Taylor, Andrew; Wang, Sheng; Berrocal, Eduardo; Dave, Utpal; Xu, Jinbo; Börnigen, Daniela; Gilliam, T Conrad; Maltsev, Natalia

2014-01-01

We have developed Lynx (http://lynx.ci.uchicago.edu)--a web-based database and a knowledge extraction engine, supporting annotation and analysis of experimental data and generation of weighted hypotheses on molecular mechanisms contributing to human phenotypes and disorders of interest. Its underlying knowledge base (LynxKB) integrates various classes of information from >35 public databases and private collections, as well as manually curated data from our group and collaborators. Lynx provides advanced search capabilities and a variety of algorithms for enrichment analysis and network-based gene prioritization to assist the user in extracting meaningful knowledge from LynxKB and experimental data, whereas its service-oriented architecture provides public access to LynxKB and its analytical tools via user-friendly web services and interfaces.

Csf Based Non-Ground Points Extraction from LIDAR Data

NASA Astrophysics Data System (ADS)

Shen, A.; Zhang, W.; Shi, H.

2017-09-01

Region growing is a classical method of point cloud segmentation. Based on the idea of collecting the pixels with similar properties to form regions, region growing is widely used in many fields such as medicine, forestry and remote sensing. In this algorithm, there are two core problems. One is the selection of seed points, the other is the setting of the growth constraints, in which the selection of the seed points is the foundation. In this paper, we propose a CSF (Cloth Simulation Filtering) based method to extract the non-ground seed points effectively. The experiments have shown that this method can obtain a group of seed spots compared with the traditional methods. It is a new attempt to extract seed points

Traditional Medicine Collection Tracking System (TM-CTS): a database for ethnobotanically driven drug-discovery programs.

PubMed

Harris, Eric S J; Erickson, Sean D; Tolopko, Andrew N; Cao, Shugeng; Craycroft, Jane A; Scholten, Robert; Fu, Yanling; Wang, Wenquan; Liu, Yong; Zhao, Zhongzhen; Clardy, Jon; Shamu, Caroline E; Eisenberg, David M

2011-05-17

Ethnobotanically driven drug-discovery programs include data related to many aspects of the preparation of botanical medicines, from initial plant collection to chemical extraction and fractionation. The Traditional Medicine Collection Tracking System (TM-CTS) was created to organize and store data of this type for an international collaborative project involving the systematic evaluation of commonly used Traditional Chinese Medicinal plants. The system was developed using domain-driven design techniques, and is implemented using Java, Hibernate, PostgreSQL, Business Intelligence and Reporting Tools (BIRT), and Apache Tomcat. The TM-CTS relational database schema contains over 70 data types, comprising over 500 data fields. The system incorporates a number of unique features that are useful in the context of ethnobotanical projects such as support for information about botanical collection, method of processing, quality tests for plants with existing pharmacopoeia standards, chemical extraction and fractionation, and historical uses of the plants. The database also accommodates data provided in multiple languages and integration with a database system built to support high throughput screening based drug discovery efforts. It is accessed via a web-based application that provides extensive, multi-format reporting capabilities. This new database system was designed to support a project evaluating the bioactivity of Chinese medicinal plants. The software used to create the database is open source, freely available, and could potentially be applied to other ethnobotanically driven natural product collection and drug-discovery programs. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

Traditional Medicine Collection Tracking System (TM-CTS): A Database for Ethnobotanically-Driven Drug-Discovery Programs

PubMed Central

Harris, Eric S. J.; Erickson, Sean D.; Tolopko, Andrew N.; Cao, Shugeng; Craycroft, Jane A.; Scholten, Robert; Fu, Yanling; Wang, Wenquan; Liu, Yong; Zhao, Zhongzhen; Clardy, Jon; Shamu, Caroline E.; Eisenberg, David M.

2011-01-01

Aim of the study. Ethnobotanically-driven drug-discovery programs include data related to many aspects of the preparation of botanical medicines, from initial plant collection to chemical extraction and fractionation. The Traditional Medicine-Collection Tracking System (TM-CTS) was created to organize and store data of this type for an international collaborative project involving the systematic evaluation of commonly used Traditional Chinese Medicinal plants. Materials and Methods. The system was developed using domain-driven design techniques, and is implemented using Java, Hibernate, PostgreSQL, Business Intelligence and Reporting Tools (BIRT), and Apache Tomcat. Results. The TM-CTS relational database schema contains over 70 data types, comprising over 500 data fields. The system incorporates a number of unique features that are useful in the context of ethnobotanical projects such as support for information about botanical collection, method of processing, quality tests for plants with existing pharmacopoeia standards, chemical extraction and fractionation, and historical uses of the plants. The database also accommodates data provided in multiple languages and integration with a database system built to support high throughput screening based drug discovery efforts. It is accessed via a web-based application that provides extensive, multi-format reporting capabilities. Conclusions. This new database system was designed to support a project evaluating the bioactivity of Chinese medicinal plants. The software used to create the database is open source, freely available, and could potentially be applied to other ethnobotanically-driven natural product collection and drug-discovery programs. PMID:21420479

Effects of two medicinal plants Psidium guajava L. (Myrtaceae) and Diospyros mespiliformis L. (Ebenaceae) leaf extracts on rat skeletal muscle cells in primary culture.

PubMed

Belemtougri, R G; Constantin, B; Cognard, C; Raymond, G; Sawadogo, L

2006-01-01

Crude decoction, aqueous and ethanolic extracts of two medicinal plants (Psidium guajava and Diospyros mespiliformis), widely used in the central plateau of Burkina Faso to treat many diseases were evaluated for their antagonistic effects on caffeine induced calcium release from sarcoplasmic reticulum of rat skeletal muscle cells. These different extracts showed a decrease of caffeine induced calcium release in a dose dependent manner. Comparison of the results showed that Psidium guajava leaf extracts are more active than extracts of Diospyros mespiliformis and that crude decoctions show better inhibitory activity. The observed results could explain their use as antihypertensive and antidiarrhoeal agents in traditional medicine, by inhibiting intracellular calcium release.

Effects of two medicinal plants Psidium guajava L. (Myrtaceae) and Diospyros mespiliformis L. (Ebenaceae) leaf extracts on rat skeletal muscle cells in primary culture

PubMed Central

Belemtougri, R.G.; Constantin, B.; Cognard, C.; Raymond, G.; Sawadogo, L.

2006-01-01

Crude decoction, aqueous and ethanolic extracts of two medicinal plants (Psidium guajava and Diospyros mespiliformis), widely used in the central plateau of Burkina Faso to treat many diseases were evaluated for their antagonistic effects on caffeine induced calcium release from sarcoplasmic reticulum of rat skeletal muscle cells. These different extracts showed a decrease of caffeine induced calcium release in a dose dependent manner. Comparison of the results showed that Psidium guajava leaf extracts are more active than extracts of Diospyros mespiliformis and that crude decoctions show better inhibitory activity. The observed results could explaine their use as antihypertensive and antidiarrhoeal agents in traditional medicine, by inhibiting intracellular calcium release. PMID:16365927

Antimicrobial thin films based on ayurvedic plants extracts embedded in a bioactive glass matrix

NASA Astrophysics Data System (ADS)

Floroian, L.; Ristoscu, C.; Candiani, G.; Pastori, N.; Moscatelli, M.; Mihailescu, N.; Negut, I.; Badea, M.; Gilca, M.; Chiesa, R.; Mihailescu, I. N.

2017-09-01

Ayurvedic medicine is one of the oldest medical systems. It is an example of a coherent traditional system which has a time-tested and precise algorithm for medicinal plant selection, based on several ethnopharmacophore descriptors which knowledge endows the user to adequately choose the optimal plant for the treatment of certain pathology. This work aims for linking traditional knowledge with biomedical science by using traditional ayurvedic plants extracts with antimicrobial effect in form of thin films for implant protection. We report on the transfer of novel composites from bioactive glass mixed with antimicrobial plants extracts and polymer by matrix-assisted pulsed laser evaporation into uniform thin layers onto stainless steel implant-like surfaces. The comprehensive characterization of the deposited films was performed by complementary analyses: Fourier transformed infrared spectroscopy, glow discharge optical emission spectroscopy, scanning electron microscopy, atomic force microscopy, electrochemical impedance spectroscopy, UV-VIS absorption spectroscopy and antimicrobial tests. The results emphasize upon the multifunctionality of these coatings which allow to halt the leakage of metal and metal oxides into the biological fluids and eventually to inner organs (by polymer use), to speed up the osseointegration (due to the bioactive glass use), to exert antimicrobial effects (by ayurvedic plants extracts use) and to decrease the implant price (by cheaper stainless steel use).

The Dosage Form of Aragh in Treatment, from the Iranian Traditional Medicine Perspective.

PubMed

Adl, Mehdi; Emtiazi, Majid

2016-05-01

The Iranian traditional medicine is one of the branches of complementary medicine and it is based on using the dosage forms of plants. One of the most common forms of pharmaceutical plants is Aragh. Due to ease-of-use, distillate is a more acceptable form among the public. In this article, it is attempted to study the usage forms and effects of Aragh according to the valid traditional medicine resources. This article is a review of Iranian traditional medicine textbooks such as Makhzan-ul-dawiah, Gharabadin Kabir, Cannon of Medicine, and other recent texts on medical plants. According to the traditional medicine, the process of getting Aragh is a kind of distillation, which is performed by using Ghar and Alembic (the equipment that are used in distillation). Distillation is the process of extracting and refining the fluid of a plant. Aragh of the plants is much more effective on the body than the plant itself. Traditional medicine regards Aragh as a new kind of drug (medicine) that is rarely mentioned in older texts (except for golab). However, the modern medicine regards it as a dosage form of essence, which is dissolved in water. The more the essence, the better the distillate gets. According to the traditional medicine sources, since the time of Hakim Aghil Khorasani, Aragh was used more and more every day. About 100 kinds of Araghs are mentioned in ancient texts, which are extracted from simple plants. Considering the distillation process and the way it performs, and by knowing that Aragh is a plant's softest and the most influential entity, it seems that it has a huge effect on Arvah and Ghova, the main parts like heart and brain and nervous parts.

The Dosage Form of Aragh in Treatment, from the Iranian Traditional Medicine Perspective

PubMed Central

Adl, Mehdi; Emtiazi, Majid

2016-01-01

Background: The Iranian traditional medicine is one of the branches of complementary medicine and it is based on using the dosage forms of plants. One of the most common forms of pharmaceutical plants is Aragh. Due to ease-of-use, distillate is a more acceptable form among the public. In this article, it is attempted to study the usage forms and effects of Aragh according to the valid traditional medicine resources. Methods: This article is a review of Iranian traditional medicine textbooks such as Makhzan-ul-dawiah, Gharabadin Kabir, Cannon of Medicine, and other recent texts on medical plants. Results: According to the traditional medicine, the process of getting Aragh is a kind of distillation, which is performed by using Ghar and Alembic (the equipment that are used in distillation). Distillation is the process of extracting and refining the fluid of a plant. Aragh of the plants is much more effective on the body than the plant itself. Traditional medicine regards Aragh as a new kind of drug (medicine) that is rarely mentioned in older texts (except for golab). However, the modern medicine regards it as a dosage form of essence, which is dissolved in water. The more the essence, the better the distillate gets. Conclusion: According to the traditional medicine sources, since the time of Hakim Aghil Khorasani, Aragh was used more and more every day. About 100 kinds of Araghs are mentioned in ancient texts, which are extracted from simple plants. Considering the distillation process and the way it performs, and by knowing that Aragh is a plant’s softest and the most influential entity, it seems that it has a huge effect on Arvah and Ghova, the main parts like heart and brain and nervous parts. PMID:27840528

The Dosage Form of Aragh in Treatment, from the Iranian Traditional Medicine Perspective

PubMed Central

Adl, Mehdi; Emtiazi, Majid

2016-01-01

Background: The Iranian traditional medicine is one of the branches of complementary medicine and it is based on using the dosage forms of plants. One of the most common forms of pharmaceutical plants is Aragh. Due to ease-of-use, distillate is a more acceptable form among the public. In this article, it is attempted to study the usage forms and effects of Aragh according to the valid traditional medicine resources. Methods: This article is a review of Iranian traditional medicine textbooks such as Makhzan-ul-dawiah, Gharabadin Kabir, Cannon of Medicine, and other recent texts on medical plants. Results: According to the traditional medicine, the process of getting Aragh is a kind of distillation, which is performed by using Ghar and Alembic (the equipment that are used in distillation). Distillation is the process of extracting and refining the fluid of a plant. Aragh of the plants is much more effective on the body than the plant itself. Traditional medicine regards Aragh as a new kind of drug (medicine) that is rarely mentioned in older texts (except for golab). However, the modern medicine regards it as a dosage form of essence, which is dissolved in water. The more the essence, the better the distillate gets. Conclusion: According to the traditional medicine sources, since the time of Hakim Aghil Khorasani, Aragh was used more and more every day. About 100 kinds of Araghs are mentioned in ancient texts, which are extracted from simple plants. Considering the distillation process and the way it performs, and by knowing that Aragh is a plant’s softest and the most influential entity, it seems that it has a huge effect on Arvah and Ghova, the main parts like heart and brain and nervous parts. PMID:27516693

Gymnema sylvestre R. Br., an Indian medicinal herb: traditional uses, chemical composition, and biological activity.

PubMed

Di Fabio, Giovanni; Romanucci, Valeria; Di Marino, Cinzia; Pisanti, Antonio; Zarrelli, Armando

2015-01-01

Gymnema sylvestre R. Br. is one of the most important medicinal plants that grows in tropical forests in India and South East Asia. Its active ingredients and extracts of leaves and roots are used in traditional medicine to treat various ailments and they are present in the market for pharmaceutical and parapharmaceutical products. Commercial products based on substances of plant origin that are generally connoted as natural have to be subjected to monitoring and evaluation by health authorities for their potential impacts on public health. The monitoring and evaluation of these products are critical because the boundary between a therapeutic action and a functional or healthy activity has not yet been defined in a clear and unambiguous way. Therefore, these products are considered borderline products, and they require careful and rigorous studies, in order to use them as complement and/or even replacement of synthetic drugs that are characterized by side effects and high economic costs. This review explores the traditional uses, chemical composition and biological activity of G. sylvestre extracts, providing a general framework on the most interesting extracts and what are the necessary studies for a complete definition of the range of activities.

News from Tartary: an ethnopharmacological approach to drug and therapeutic discovery

PubMed Central

Hamza, Nawel; Berke, Benedicte; Umar, Anwar

2016-01-01

Ethnopharmacology aims to identify new therapeutic agents based on their traditional use. It begins by the identification of disease states, and of the traditional therapies for these, most commonly herbals. Herbals of interest are selected from ethnopharmacological surveys, and tested on experimental models of the diseases of interest. Once the activity of the traditional remedy is demonstrated, including dose‐dependence, if possible comparatively to reference medications, the active ingredients can be explored, if possible using bioguided extraction. Identified molecules can then be further developed as medicinal products or pharmaceutical medicines (e.g., artemisine), or the herbal product can be developed as such (e.g. St John's wort). We provide examples of various study programmes, concerning the antiplatelet and antithrombotic effects of Armagnac extracts from Southwest France; antithrombotic and antihypertensive effects of extracts of Ocimum basilicum L; antithrombotic, antihypertensive and antihyperlipidemic effects of Cydonia oblonga; Antiproliferative and antithrombotic effects of Abnorma Savda Munziq of traditional Uyghur medicine; and the antidiabetic and hepatoprotective effects of Centaurium erythraea Rafn, Artemisia herba‐alba Asso and Trigonella foenum‐graecum L., all in collaboration between University of Bordeaux, France, Xinjiang Medical University in Urumqi, China and University Mentouri in Constantine, Algeria. PMID:27297624

[Medical imaging in tumor precision medicine: opportunities and challenges].

PubMed

Xu, Jingjing; Tan, Yanbin; Zhang, Minming

2017-05-25

Tumor precision medicine is an emerging approach for tumor diagnosis, treatment and prevention, which takes account of individual variability of environment, lifestyle and genetic information. Tumor precision medicine is built up on the medical imaging innovations developed during the past decades, including the new hardware, new imaging agents, standardized protocols, image analysis and multimodal imaging fusion technology. Also the development of automated and reproducible analysis algorithm has extracted large amount of information from image-based features. With the continuous development and mining of tumor clinical and imaging databases, the radiogenomics, radiomics and artificial intelligence have been flourishing. Therefore, these new technological advances bring new opportunities and challenges to the application of imaging in tumor precision medicine.

Changes in total phenol, flavonoid contents and anti-Lactobacillus activity of Callisia fragrans due to extraction solvent

NASA Astrophysics Data System (ADS)

Le, Thom; Cao, Diem Kieu; Pham, Thanh Vy; Huynh, Tan Dat; Ta, Nhat Thuy Anh; Nguyen, Ngoc Thao Linh; Nguyen, Huu Thanh; Le, Hue Huong; Bui, Anh Vo; Truong, Dieu-Hien

2018-04-01

Callisia fragrans is a wonder herb with many medicinal properties such as burn, dental diseases, cancer diseases and arthritis in folk medicine. It is noted that the phytochemical constituents and antimicrobial activity of traditional plants depend on not only the extracting method but also the solvent used for extraction. In this study, the effect of five extraction solvents (i.e., distilled water, 80% methanol, 80% ethanol, 80% ethyl acetate, and 80% chloroform) on yield, total phenolic content (TPC) and total flavonoid content (TFC) of Callisia leaves was determined. Besides, changes in anti-Lactobacillus fermentum activity of C. fragrans freeze-dried extract was also evaluated using disk-diffusion method. The recovery percentage of extractable yield of fresh leaves are ranged from 11.93% w/w for distilled water extract to 16.60% w/w for aqueous ethanol extracts. The yield of 80% aqueous methanol extract (16.27% w/w) is only slightly less than that of the ethanol extract. Significant differences were observed among TPC and TFC obtaining by 80% methanol (0.0522% and 0.0335% w/w, respectively) compared to other solvents (p < 0.05). TPC and TFC of C. fragrans extracts increase in the following order: distilled water < 80% chloroform < 80% ethyl acetate < 80% ethanol < 80% methanol. The results revealed that 80% aqueous methanol Calissia extracts has moderate inhibition (9.0 mm of inhibition zone for 1.5 mg/mL of extracts) of L. fermentum compared to standard antibacterial agent. Based on the study results, it can be concluded that the yield, TPC and TFC of C. frgrans extract varied with the extracting solvent. It also showed that Callisia extracts can prevent dental caries by inhibiting the growth of L. fermentum, towards new insights for treatment of dental caries.

[Risk control of traditional Chinese medicines containing aristolochis acids (AAs) based on influencing factors of content of AAs].

PubMed

Tian, Jing-Zhuo; Liang, Ai-Hua; Liu, Jing; Zhang, Bo-Li

2017-12-01

Aristolochic acids (AAs) widely exist in such plants as Aristolochia and Asarum. The renal toxicity of AAs as well as its carcinogenicity to urinary system have been widely known. In 2003 and 2004, China prohibited the use of Aristolochiae Radix, Aristolochiae Manshuriensis Caulis and Aristolochiae Fangchi Radix, and required administering other AAs-containing medicines in accordance with the regulations for prescription drugs. In this paper, we retrieved literatures on the content determination of AAs in recent 10 years in China. It suggested that the AAs content is lower in Asarum herb, especially in its roots and rhizomes, and most of which do not show detectable amount of AA-I. Some of traditional Chinese medicines show fairly small amount of detectable AA-I. The AAs content in Aristolochia herb (including Fructus Aristolochiae, kaempfer dutchmanspipe root) is relatively high; however, there are fewer literatures for studying the content determination of AAs in Chinese patent medicines. There were many factors affecting AAs content, including the parts used, origins, processing methods, extraction process. It suggested that we should pay attention to the toxicity of Chinese medicines containing AAs and use these decoction pieces and traditional Chinese medicines cautiously. In addition, basic studies for the origins, processing methods and extraction process of Chinese patent medicines containing AAs, as well as supervision and detection of AAs content in traditional Chinese medicinal materials, decoction pieces and Chinese patent medicines shall be strengthened for reducing medication risk and guaranteeing clinical medication safety. Copyright© by the Chinese Pharmaceutical Association.

The Stability of Medicinal Plant microRNAs in the Herb Preparation Process.

PubMed

Xie, Wenyan; Melzig, Matthias F

2018-04-16

Herbal medicine is now globally accepted as a valid alternative system of pharmaceutical therapies. Various studies around the world have been initiated to develop scientific evidence-based herbal therapies. Recently, the therapeutic potential of medicinal plant derived miRNAs has attracted great attraction. MicroRNAs have been indicated as new bioactive ingredients in medicinal plants. However, the stability of miRNAs during the herbal preparation process and their bioavailability in humans remain unclear. Viscum album L. (European mistletoe) has been widely used in folk medicine for the treatment of cancer and cardiovascular diseases. Our previous study has indicated the therapeutic potential of mistletoe miRNAs by using bioinformatics tools. To evaluate the stability of these miRNAs, various mistletoe extracts that mimic the clinical medicinal use as well as traditional folk medicinal use were prepared. The mistletoe miRNAs including miR166a-3p, miR159a, miR831-5p, val-miR218 and val-miR11 were quantified by stem-loop qRT-PCR. As a result, miRNAs were detectable in the majority of the extracts, indicating that consumption of medicinal plant preparations might introduce miRNAs into mammals. The factors that might cause miRNA degradation include ultrasonic treatment, extreme heat, especially RNase treatment, while to be associated with plant molecules (e.g., proteins, exosomes) might be an efficient way to protect miRNAs against degradation. Our study confirmed the stability of plant derived miRNAs during herb preparations, suggesting the possibility of functionally intact medicinal plant miRNAs in mammals.

Extraction of intracellular protein from Chlorella pyrenoidosa using a combination of ethanol soaking, enzyme digest, ultrasonication and homogenization techniques.

PubMed

Zhang, Ruilin; Chen, Jian; Zhang, Xuewu

2018-01-01

Due to the rigid cell wall of Chlorella species, it is still challenging to effectively extract significant amounts of protein. Mass methods were used for the extraction of intracellular protein from microalgae with biological, mechanical and chemical approaches. In this study, based on comparison of different extraction methods, a new protocol was established to maximize extract amounts of protein, which was involved in ethanol soaking, enzyme digest, ultrasonication and homogenization techniques. Under the optimized conditions, 72.4% of protein was extracted from the microalgae Chlorella pyrenoidosa, which should contribute to the research and development of Chlorella protein in functional food and medicine. Copyright © 2017 Elsevier Ltd. All rights reserved.

Insecticidal activity of certain medicinal plants.

PubMed

Pavela, Roman

2004-12-01

The methanol extracts of eight species of medicinal plants were tested for insecticidal activity in third instar larvae of Egyptian cottonworm (Spodoptera littoralis). All extracts showed a certain degree of larval toxicity. The extracts of Ocimum basilicum, Origanum majorana and Salvia officinalis appeared to be highly toxic. The extracts significantly affected the growth indexes [relative growth rate (RGR), efficiency of conversion of ingested food (ECI), efficiency of conversion of digested food (ECD)].

[Advances in studies on multi-stage countercurrent extraction technology in traditional Chinese medicine].

PubMed

Xie, Zhi-Peng; Liu, Xue-Song; Chen, Yong; Cai, Ming; Qu, Hai-Bin; Cheng, Yi-Yu

2007-05-01

Multi-stage countercurrent extraction technology, integrating solvent extraction, repercolation with dynamic and countercurrent extraction, is a novel extraction technology for the traditional Chinese medicine. This solvent-saving, energy-saving and high-extraction-efficiency technology can at the most drive active compounds to diffuse from the herbal materials into the solvent stage by stage by creating concentration differences between the herbal materials and the solvents. This paper reviewed the basic principle, the influence factors and the research progress and trends of the equipments and the application of the multi-stage countercurrent extraction.

Study on Senna alata and its different extracts by Fourier transform infrared spectroscopy and two-dimensional correlation infrared spectroscopy

NASA Astrophysics Data System (ADS)

Adiana, M. A.; Mazura, M. P.

2011-04-01

Senna alata L. commonly known as candle bush belongs to the family of Fabaceae and the plant has been reported to possess anti-inflammatory, analgesic, laxative and antiplatelet-aggregating activity. In order to develop a rapid and effective analysis method for studying integrally the main constituents in the medicinal materials and their extracts, discriminating the extracts from different extraction process, comparing the categories of chemical constituents in the different extracts and monitoring the qualities of medicinal materials, we applied Fourier transform infrared spectroscopy (FT-IR) associated with second derivative infrared spectroscopy and two-dimensional infrared correlation spectroscopy (2D-IR) to study the main constituents of S. alata and its different extracts (extracted by hexane, dichloromethane, ethyl acetate and methanol in turn). The findings indicated that FT-IR and 2D-IR can provide many holistic variation rules of chemical constituents. Use of the macroscopical fingerprint characters of FT-IR and 2D-IR spectrum can identify the main chemical constituents in medicinal materials and their extracts, but also compare the components differences among similar samples. In a conclusion, FT-IR spectroscopy combined with 2D correlation analysis provides a powerful method for the quality control of traditional medicines.

Revisiting the linkage between ethnomedical use and development of new medicines: A novel plant collection strategy towards the discovery of anticancer agents

PubMed Central

Henkin, Joshua M.; Sydara, Kongmany; Xayvue, Mouachanh; Souliya, Onevilay; Kinghorn, A. Douglas; Burdette, Joanna E.; Chen, Wei-Lun; Elkington, Bethany G.; Soejarto, Djaja D.

2017-01-01

The Vietnam-Laos International Cooperative Biodiversity Group (ICBG) based at the University of Illinois at Chicago (UIC) catalyzed a country-wide network of medicinal plant preserves (MPP) and medicinal biodiversity preserves (MBP) now established in ten provinces of the Lao People’s Democratic Republic (Lao PDR), which are relied upon as protected sources of ethnomedicines for local villagers and traditional healers. In collaboration with the Lao PDR’s Institute of Traditional Medicine (ITM), our ongoing P01 Program Project (Ohio State University) examined the anticancer bioprospecting potential for two of the most exhaustively inventoried of these sites: the Bolikhamxay MPP and the Xiengkhouang MBP. Guided by prior voucher specimens sourced from these preserves with an overwhelming emphasis on plants employed in traditional medicine, 201 distinct samples from 96 species were collected along with proper herbarium documentation. Aliquots of these plant samples were extracted in azeotropic ethanol and evaporated to dryness for initial biological evaluation. In six samples from six different species (2.99% of the collected samples, 6.25% of taxa) it was observed that extracts exhibited notable cytotoxicity against HT-29 colon adenocarcinoma cells. The wisdom behind the utilization of HT-29 cells in this preliminary biological screen is discussed. Furthermore, comparison of screening results based on longstanding considerations and ideological underpinnings of ethnobotanical vs. “random” biodiversity-based collection approaches is detailed herein. The results of this interdisciplinary study support the hypothesis that, by privileging the initial sample set in terms of human safety and pharmacological activity, ethnobotanically driven collection for biological screening efforts can produce leads unprecedented by the strict traditional usages of plants. PMID:29152156

A chemical family-based strategy for uncovering hidden bioactive molecules and multicomponent interactions in herbal medicines.

PubMed

Song, Hui-Peng; Wu, Si-Qi; Hao, Haiping; Chen, Jun; Lu, Jun; Xu, Xiaojun; Li, Ping; Yang, Hua

2016-03-30

Two concepts involving natural products were proposed and demonstrated in this paper. (1) Natural product libraries (e.g. herbal extract) are not perfect for bioactivity screening because of the vast complexity of compound compositions, and thus a library reconstruction procedure is necessary before screening. (2) The traditional mode of "screening single compound" could be improved to "screening single compound, drug combination and multicomponent interaction" due to the fact that herbal medicines work by integrative effects of multi-components rather than single effective constituents. Based on the two concepts, we established a novel strategy aiming to make screening easier and deeper. Using thrombin as the model enzyme, we firstly uncovered the minor lead compounds, potential drug combinations and multicomponent interactions in an herbal medicine of Dan-Qi pair, showing a significant advantage over previous methods. This strategy was expected to be a new and promising mode for investigation of herbal medicines.

Effect of Tree Species on Enzyme Secretion by the Shiitake Medicinal Mushroom, Lentinus edodes (Agaricomycetes).

PubMed

Plotnikov, Evgeny V; Glukhova, Lubov B; Sokolyanskaya, Ludmila O; Karnachuk, Olga V; Solioz, Marc

2016-01-01

We compared cold and hot wood extracts of 3 endemic Siberian trees-namely, Prunus padus (bird cherry), Populus tremula (aspen), and Betula sp. (birch)-on biomass production and laccase and peroxidase secretion in submerged cultures by the medicinal mushroom Lentinus edodes. Of the conditions tested, only hot Prunus extracts stimulated biomass production, whereas all extracts stimulated laccase and peroxidase secretion, albeit to different extents. A large, differential stimulation of manganese peroxidase was observed by hot Prunus extracts. The results highlight important differences between tree species in the stimulation of biomass and enzyme production by L. edodes and point to potentially interesting stimulatory factors present in hot Prunus extracts. These findings are of relevance in the use of L. edodes for medicinal or biotechnological applications.

The therapeutic potential of cannabis and cannabinoids.

PubMed

Grotenhermen, Franjo; Müller-Vahl, Kirsten

2012-07-01

Cannabis-based medications have been a topic of intense study since the endogenous cannabinoid system was discovered two decades ago. In 2011, for the first time, a cannabis extract was approved for clinical use in Germany. Selective literature review. Cannabis-based medications exert their effects mainly through the activation of cannabinoid receptors (CB1 and CB2). More than 100 controlled clinical trials of cannabinoids or whole-plant preparations for various indications have been conducted since 1975. The findings of these trials have led to the approval of cannabis-based medicines (dronabinol, nabilone, and a cannabis extract [THC:CBD=1:1]) in several countries. In Germany, a cannabis extract was approved in 2011 for the treatment of moderate to severe refractory spasticity in multiple sclerosis. It is commonly used off label for the treatment of anorexia, nausea, and neuropathic pain. Patients can also apply for government permission to buy medicinal cannabis flowers for self-treatment under medical supervision. The most common side effects of cannabinoids are tiredness and dizziness (in more than 10% of patients), psychological effects, and dry mouth. Tolerance to these side effects nearly always develops within a short time. Withdrawal symptoms are hardly ever a problem in the therapeutic setting. There is now clear evidence that cannabinoids are useful for the treatment of various medical conditions.

Herbal Remedies for Functional Dyspepsia and Traditional Iranian Medicine Perspective

PubMed Central

Babaeian, Mahmoud; Naseri, Mohsen; Kamalinejad, Mohammad; Ghaffari, Farzaneh; Emadi, Fatemeh; Feizi, Awat; Hosseini Yekta, Nafiseh; Adibi, Peyman

2015-01-01

Context: Functional dyspepsia (FD) is a functional gastro-intestinal disorder with high prevalence. Among various treatment options, treatment by complementary and alternative medicines especially herbal remedies also practiced. Traditional Iranian medicine (TIM), a valuable resource of valid applied studies of ancient Iranian scholars, recommends numerous medicinal plants to treat dyspepsia symptoms. In this study, through investigation of TIM references, we aimed to identify medicinal plants for treatment of digestion insufficiency. Evidence Acquisition: In this qualitative study, dyspepsia symptoms including fullness, early satiety, bloating, nausea, and belching were checked under reliable sources of traditional medicine. Then medicinal plants recommended for the treatment of the symptoms were extracted from the books. Likewise, for investigating the pharmacological properties of medicinal plants used for the relieving of dyspepsia symptoms, electronic databases such as PubMed, Scopus, Google Scholar and some Iranian databases like SID and IranMedex were employed. Results: The study yielded 105 plants from 37 families which could treat various dyspepsia symptoms; fifty-seven plants, mainly from Apiaceae, Lamiaceae, Amaryllidaceae and Zingiberaceae had digestive effects. In this research, based on the information in TIM reference texts, we obtained 58 plants effective for bloating, 40 for nausea, 37 for appetite loss and 7 for belching. In human clinical trials conducted on medicinal plants effective for FD symptoms, 7 single plants were used. Conclusions: Finding the medicinal plants effective on digestion insufficiency based on TIM could suggest a better strategy for the relieving of dyspepsia symptoms. Traditional Iranian medicine prescribes medicinal plants based on each patient’s personal characteristics and practices multiple target therapies. PMID:26734483

Herbal Remedies for Functional Dyspepsia and Traditional Iranian Medicine Perspective.

PubMed

Babaeian, Mahmoud; Naseri, Mohsen; Kamalinejad, Mohammad; Ghaffari, Farzaneh; Emadi, Fatemeh; Feizi, Awat; Hosseini Yekta, Nafiseh; Adibi, Peyman

2015-11-01

Functional dyspepsia (FD) is a functional gastro-intestinal disorder with high prevalence. Among various treatment options, treatment by complementary and alternative medicines especially herbal remedies also practiced. Traditional Iranian medicine (TIM), a valuable resource of valid applied studies of ancient Iranian scholars, recommends numerous medicinal plants to treat dyspepsia symptoms. In this study, through investigation of TIM references, we aimed to identify medicinal plants for treatment of digestion insufficiency. In this qualitative study, dyspepsia symptoms including fullness, early satiety, bloating, nausea, and belching were checked under reliable sources of traditional medicine. Then medicinal plants recommended for the treatment of the symptoms were extracted from the books. Likewise, for investigating the pharmacological properties of medicinal plants used for the relieving of dyspepsia symptoms, electronic databases such as PubMed, Scopus, Google Scholar and some Iranian databases like SID and IranMedex were employed. The study yielded 105 plants from 37 families which could treat various dyspepsia symptoms; fifty-seven plants, mainly from Apiaceae, Lamiaceae, Amaryllidaceae and Zingiberaceae had digestive effects. In this research, based on the information in TIM reference texts, we obtained 58 plants effective for bloating, 40 for nausea, 37 for appetite loss and 7 for belching. In human clinical trials conducted on medicinal plants effective for FD symptoms, 7 single plants were used. Finding the medicinal plants effective on digestion insufficiency based on TIM could suggest a better strategy for the relieving of dyspepsia symptoms. Traditional Iranian medicine prescribes medicinal plants based on each patient's personal characteristics and practices multiple target therapies.

Medicinal herbs as a potential strategy to decrease methane production by rumen microbiota: a systematic evaluation with a focus on Perilla frutescens seed extract.

PubMed

Wang, Jiakun; Liu, Mei; Wu, Yuelei; Wang, Liang; Liu, Jianxin; Jiang, Linshu; Yu, Zhongtang

2016-11-01

Mitigation of the methane (CH 4 ) emission from ruminants is needed to decrease the environmental impact of ruminant animal production. Different plant materials and chemicals have been tested, but few are both effective and practical. Medicinal herbs contain biological compounds and antimicrobials that may be effective in lowering the CH 4 production. However, few studies have systematically evaluated medicinal herbs for their effect on CH 4 production or on the rumen microbiota. In this study, extracts from 100 medicinal herbs were assessed for their ability to decrease CH 4 production by rumen microbiota in vitro. The extracts of 12 herbs effectively lowered the CH 4 production, with the extract of Perilla frutescens seeds being the most effective. The major components of P. frutescens seed extract were identified, and the effects of the extract on the fermentation characteristics and populations of rumen methanogens, fungi, protozoa, and select bacteria were also assessed. The decreased CH 4 production induced by the P. frutescens seed extract was accompanied by an increased abundance of Ruminobacter, Selenomonas, Succinivibrio, Shuttleworthis, Pseudobutyrivbrio, Anaerovibrio, and Roseomonas and a decreased abundance of Methanobrevibacter millerae. The abundance of Pedobacter, Anaeroplasma, Paludibacter, Ruminococcus, and unclassified Lachnospiraceae was positively correlated with the CH 4 production, with no effects on volatile fatty acids. This study suggests that medicinal herbs may be used to mitigate the CH 4 emission from ruminants.

Antioxidant, antihypertensive, and antibacterial properties of endophytic Pestalotiopsis species from medicinal plants.

PubMed

Tejesvi, Mysore V; Kini, Kukkundoor R; Prakash, Harishchandra S; Subbiah, Ven; Shetty, Hunthrike S

2008-09-01

Pestalotiopsis species were most dominant endophytic species isolated from four medicinal plants including Terminalia arjuna, Terminalia chebula, Azadirachta indica, and Holarrhena antidysenterica. Thirty Pestalotiopsis species isolated from different parts of the medicinal plants were selected for the study. The antioxidant and antihypertensive properties of Pestalotiopsis isolates were determined by measuring 1,1-diphenyl-2-picrylhydrazyl inhibitory activity, lipid peroxidation, and angiotensin-converting enzyme inhibition activity. Pestalotiopsis isolates of T. arjuna origin exhibited maximum radical scavenging activity compared with the others. The IC50 values of Pestalotiopsis extracts for 1,1-diphenyl-2-picrylhydrazyl scavenging activity ranged from 14 to 27 microg/mL compared with 15 and 6 microg/mL for butylated hydroxytoluene and ascorbic acid, respectively. The DNA damage study was also done for three isolates, TC-315, TA-37, and TA-60; TA-37 gave 80% protection. The IC50 values of Pestalotiopsis extracts for lipid peroxidation ranged between 30 and 35.5 microg/mL, while for the positive control butylated hydroxytoluene, it was 26 microg/mL. Out of 32 fungal extracts screened for antihypertensive assay, five (TA-37, TA-60, TA-102, TA-103, and TC-320) showed >60% inhibition of angiotensin-converting enzyme. The IC50 values for five extracts ranged from 21 to 37 microg/mL and was 20 microg/mL for captopril used as a positive control. The antibacterial activity was measured by the microplate-based turbidity measurement method. Four Pestalotiopsis extracts (TA-04, TA-37, TA-60, and TA-102) showed >75% inhibition against five bacterial strains including Bacillus subtilis, Escherichia coli, Pseudomonas fluorescens, Xanthomonas axonopodis pv. malvacearum, and Staphylococcus aureus. The antioxidant, antibacterial, and antihypertensive activities demonstrated the potential of Pestalotiopsis extracts as therapeutic targets.

Antiplasmodial activity of two medicinal plants against clinical isolates of Plasmodium falciparum and Plasmodium berghei infected mice.

PubMed

Attemene, Serge David Dago; Beourou, Sylvain; Tuo, Karim; Gnondjui, Albert Alloh; Konate, Abibatou; Toure, Andre Offianan; Kati-Coulibaly, Seraphin; Djaman, Joseph Alico

2018-03-01

Malaria is an infectious and deadly parasitic disease, associated with fever, anaemia and other ailments. Unfortunately the upsurge of plasmodium multidrug resistant constrained researchers to look for new effective drugs. Medicinal plants seem to be an unquenchable source of bioactive principles in the treatment of various diseases. The aim of this study was to assess the antiplasmodial activity of two Ivorian medicinal plants. The in vitro activity was evaluated against clinical isolates and Plasmodium falciparum K1 multidrug resistant strain using the fluorescence based SYBR green I assay. The in vivo bioassay was carried out using the classical 4 day suppressive and curative tests on Plasmodium berghei infected mice. Results showed that the in vitro bioassay of both plant extracts were found to exhibit a promising and moderate antiparasitic effects on clinical isolates (5 µg/mL < IC 50  < 15 µg/mL) and Plasmodium falciparum multidrug resistant K1 strain (15 µg/mL < IC 50  < 50 µg/mL). Furthermore, the in vivo antiplasmodial screening of both extracts showed a significant decrease in parasitemia, which was dose-dependent. Body temperature in mice treated with both extracts at experimental doses increased, compared to the negative control group and was dose-dependent. As for mice body weight a significant decrease ( p  < 0.001) was noticed in the negative control group compared to tested groups of animals. The hydroethanolic stem bark extract of Anthocleista djalonensis A Chev and leaves extract of Ziziphus mauritiana Lam exhibited anti-malarial activities. Therefore, the bioactive compounds of both plant extracts need to be investigated.

Variability of antioxidant and biological activities of Rhus tripartitum related to phenolic compounds

PubMed Central

Ben Miled, Hanène; Saada, Mariem; Jallali, Ines; Ben Barka, Zaineb; Tlili, Mounira; Alimi, Hichem; Sakly, Mohsen; Ben Rhouma, Khémais; Abderrabba, Manef; Abdelmelek, Hafedh; Tebourbi, Olfa; Ksouri, Riadh

2017-01-01

Rhus species are known in traditional medicine for their therapeutic virtue and their extracts showed numerous important properties including antimalarial, antimicrobial, antiviral, and hypoglycemic and anticonvulsant activities. Rhus tripartitum (Ucria) is a medicinal plant widely used in Tunisia folk medicine against chronic diarrhea and gastric ulcer. This study was designed to examine in vitro and ex vivo antioxidant, anti-inflammatory and anticancer activities of four extracts of Rhus tripartitum root cortex with increasing solvent polarity (hexane, dichloromethane, methanol and water). HPLC was used to identify and quantify phenolic compounds in Rhus extract. Water extract showed the highest antioxidant activity using oxygen radical absorbance capacity (ORAC method) with 8.95 ± 0.47 µmol Trolox/mg and a cell based-assay with 0.28 ± 0.12 µmol Trolox/mg as compared to the other fractions. Moreover, methanol extract displayed the strongest anti-cancer activity against human lung carcinoma (A-549) and colon adenocarcinoma cell lines (DLD-1) with an IC50 value of 60.69 ± 2.58 and 39.83 ± 4.56 µg/ml (resazurin test) and 44.52 ± 5.96 and 55.65 ± 6.00 µg/ml (hoechst test), respectively. Besides, the highest anti-inflammatory activity, inhibiting nitric oxide (NO) release, was exhibited by dichloromethane extract with 31.5 % at 160 µg/ml in lipopolysaccharide (LPS)-stimulated RAW 264.7 macrophages. The HPLC analysis showed that catechol and kaempferol were the major phenolics. These data suggest the richness of all fractions of Ucria root on interesting bioactive molecules with different polarity and confirm the known traditional therapeutics virtues of this species for the treatment of dysentery, diarrhea and gastric ulcer. PMID:28694749

Variability of antioxidant and biological activities of Rhus tripartitum related to phenolic compounds.

PubMed

Ben Miled, Hanène; Saada, Mariem; Jallali, Ines; Ben Barka, Zaineb; Tlili, Mounira; Alimi, Hichem; Sakly, Mohsen; Ben Rhouma, Khémais; Abderrabba, Manef; Abdelmelek, Hafedh; Tebourbi, Olfa; Ksouri, Riadh

2017-01-01

Rhus species are known in traditional medicine for their therapeutic virtue and their extracts showed numerous important properties including antimalarial, antimicrobial, antiviral, and hypoglycemic and anticonvulsant activities. Rhus tripartitum (Ucria) is a medicinal plant widely used in Tunisia folk medicine against chronic diarrhea and gastric ulcer. This study was designed to examine in vitro and ex vivo antioxidant, anti-inflammatory and anticancer activities of four extracts of Rhus tripartitum root cortex with increasing solvent polarity (hexane, dichloromethane, methanol and water). HPLC was used to identify and quantify phenolic compounds in Rhus extract. Water extract showed the highest antioxidant activity using oxygen radical absorbance capacity (ORAC method) with 8.95 ± 0.47 µmol Trolox/mg and a cell based-assay with 0.28 ± 0.12 µmol Trolox/mg as compared to the other fractions. Moreover, methanol extract displayed the strongest anti-cancer activity against human lung carcinoma (A-549) and colon adenocarcinoma cell lines (DLD-1) with an IC 50 value of 60.69 ± 2.58 and 39.83 ± 4.56 µg/ml (resazurin test) and 44.52 ± 5.96 and 55.65 ± 6.00 µg/ml (hoechst test), respectively. Besides, the highest anti-inflammatory activity, inhibiting nitric oxide (NO) release, was exhibited by dichloromethane extract with 31.5 % at 160 µg/ml in lipopolysaccharide (LPS)-stimulated RAW 264.7 macrophages. The HPLC analysis showed that catechol and kaempferol were the major phenolics. These data suggest the richness of all fractions of Ucria root on interesting bioactive molecules with different polarity and confirm the known traditional therapeutics virtues of this species for the treatment of dysentery, diarrhea and gastric ulcer.

In vitro immunomodulating properties of selected Sudanese medicinal plants.

PubMed

Koko, W S; Mesaik, M Ahmed; Yousaf, S; Galal, M; Choudhary, M Iqbal

2008-06-19

Ethanolic extracts of 23 medicinal plants, commonly used in Sudanese folk medicines against infectious diseases, were investigated for their immunomodulating activity using luminol/lucigenin-based chemiluminescence assay. Preliminary screenings on whole blood oxidative burst activity showed inhibitory activities of 14 plant extracts, while only one plant, Balanites aegyptiaca fruits exhibited a proinflammatory activity. Further investigation was conducted by monitoring their effects on oxidative burst of isolated polymorphonuclear cells (PMNs) and mononuclear cells (MNCs) by using two different phagocytosis activators (serum opsonizing zymosan-A and PMA). Results obtained showed that the fruits and barks of Acacia nilotica, and leaves and barks of Khaya senegalensis, possess average inhibitory effects in the range of 70.7, 67.1, 69.5 and 67.4% on both types of phagocytes (PMNs and MNCs), respectively, at a 6.25 microg/mL concentration. Moderate inhibitory activity (52.2%) was exerted by the aerial parts of Xanthium brasilicum, while the rest of the plants showed only a weak inhibitory activity. The inhibition of oxidative burst activity was found to be irreversible in most of the extracts, except for Peganum harmala, Tephrosia apollinea, Tinospora bakis, and Vernonia amygdalina. Interestingly, the fruits of Balanites aegyptiaca exhibited a moderate proinflammatory effect (37-40.4% increases in ROS level compared to the control) at 25-100 microg/mL concentration in the case of whole blood along with PMNs phagocyte activity. The Tinospora bakis extract showed proinflammatory response at a low concentration (6.25 microg/mL) during activation with PMA. None of these extracts affected PMNs viability (90-98%) upon 2 h incubation, except of the ethanolic extracts of Acacia nilotica fruits and Balanites aegyptiaca barks.

Identification of pyrogallol as an antiproliferative compound present in extracts from the medicinal plant Emblica officinalis: effects on in vitro cell growth of human tumor cell lines.

PubMed

Khan, Mahmud Tareq Hassan; Lampronti, Ilaria; Martello, Dino; Bianchi, Nicoletta; Jabbar, Shaila; Choudhuri, Mohammad Shahabuddin Kabir; Datta, Bidduyt Kanti; Gambari, Roberto

2002-07-01

In this study we compared the in vitro antiproliferative activity of extracts from medicinal plants toward human tumor cell lines, including human erythromyeloid K562, B-lymphoid Raji, T-lymphoid Jurkat, erythroleukemic HEL cell lines. Extracts from Emblica officinalis were the most active in inhibiting in vitro cell proliferation, after comparison to those from Terminalia arjuna, Aphanamixis polystachya, Oroxylum indicum, Cuscuta reflexa, Aegle marmelos, Saraca asoka, Rumex maritimus, Lagerstroemia speciosa, Red Sandalwood. Emblica officinalis extracts have been studied previously, due to their hepatoprotective, antioxidant, antifungal, antimicrobial and anti-inflammatory medicinal activities. Gas chromatography/mass spectrometry analyses allowed to identify pyrogallol as the common compound present both in unfractionated and n-butanol fraction of Emblica officinalis extracts. Antiproliferative effects of pyrogallol were therefore determined on human tumor cell lines thus identifying pyrogallol as an active component of Emblica officinalis extracts.

Lynx: a database and knowledge extraction engine for integrative medicine

PubMed Central

Sulakhe, Dinanath; Balasubramanian, Sandhya; Xie, Bingqing; Feng, Bo; Taylor, Andrew; Wang, Sheng; Berrocal, Eduardo; Dave, Utpal; Xu, Jinbo; Börnigen, Daniela; Gilliam, T. Conrad; Maltsev, Natalia

2014-01-01

We have developed Lynx (http://lynx.ci.uchicago.edu)—a web-based database and a knowledge extraction engine, supporting annotation and analysis of experimental data and generation of weighted hypotheses on molecular mechanisms contributing to human phenotypes and disorders of interest. Its underlying knowledge base (LynxKB) integrates various classes of information from >35 public databases and private collections, as well as manually curated data from our group and collaborators. Lynx provides advanced search capabilities and a variety of algorithms for enrichment analysis and network-based gene prioritization to assist the user in extracting meaningful knowledge from LynxKB and experimental data, whereas its service-oriented architecture provides public access to LynxKB and its analytical tools via user-friendly web services and interfaces. PMID:24270788

Sustainable medicines and global health care.

PubMed

Cordell, Geoffrey A

2011-07-01

The global population has now exceeded 7 billion, and forests and other resources around the world are being irreversibly depleted for energy, food, shelter, material goods, and drugs to accommodate population needs. For most of the world's population, plants, based on many well-established systems of medicine, in either crude or extract form, represent the foundation of primary health care for the foreseeable future. Contemporary harvesting methods for medicinal plants are severely depleting these critical indigenous resources. However, maintaining and enhancing the availability of quality medicinal agents on a sustainable basis is an unappreciated public health care concept. To accomplish these goals for future health care, and restore the health of the Earth, a profound paradigm shift is necessary: ALL medicinal agents should be regarded as a sustainable commodity, irrespective of their source. Several approaches to enhancing the availability of safe and efficacious plant-based medicinal agents will be presented including integrated strategies to manifest the four pillars (information, botany, chemistry, and biology) for medicinal plant quality control. These integrated initiatives involve information systems, DNA barcoding, metabolomics, biotechnology, nanotechnology, in-field analysis of medicinal plants, and the application of new detection techniques for the development of medicinal plants with enhanced levels of safe and reproducible biological agents. © Georg Thieme Verlag KG Stuttgart · New York.

MiDas: Automatic Extraction of a Common Domain of Discourse in Sleep Medicine for Multi-center Data Integration

PubMed Central

Sahoo, Satya S.; Ogbuji, Chimezie; Luo, Lingyun; Dong, Xiao; Cui, Licong; Redline, Susan S.; Zhang, Guo-Qiang

2011-01-01

Clinical studies often use data dictionaries with controlled sets of terms to facilitate data collection, limited interoperability and sharing at a local site. Multi-center retrospective clinical studies require that these data dictionaries, originating from individual participating centers, be harmonized in preparation for the integration of the corresponding clinical research data. Domain ontologies are often used to facilitate multi-center data integration by modeling terms from data dictionaries in a logic-based language, but interoperability among domain ontologies (using automated techniques) is an unresolved issue. Although many upper-level reference ontologies have been proposed to address this challenge, our experience in integrating multi-center sleep medicine data highlights the need for an upper level ontology that models a common set of terms at multiple-levels of abstraction, which is not covered by the existing upper-level ontologies. We introduce a methodology underpinned by a Minimal Domain of Discourse (MiDas) algorithm to automatically extract a minimal common domain of discourse (upper-domain ontology) from an existing domain ontology. Using the Multi-Modality, Multi-Resource Environment for Physiological and Clinical Research (Physio-MIMI) multi-center project in sleep medicine as a use case, we demonstrate the use of MiDas in extracting a minimal domain of discourse for sleep medicine, from Physio-MIMI’s Sleep Domain Ontology (SDO). We then extend the resulting domain of discourse with terms from the data dictionary of the Sleep Heart and Health Study (SHHS) to validate MiDas. To illustrate the wider applicability of MiDas, we automatically extract the respective domains of discourse from 6 sample domain ontologies from the National Center for Biomedical Ontologies (NCBO) and the OBO Foundry. PMID:22195180

MiDas: automatic extraction of a common domain of discourse in sleep medicine for multi-center data integration.

PubMed

Sahoo, Satya S; Ogbuji, Chimezie; Luo, Lingyun; Dong, Xiao; Cui, Licong; Redline, Susan S; Zhang, Guo-Qiang

2011-01-01

Clinical studies often use data dictionaries with controlled sets of terms to facilitate data collection, limited interoperability and sharing at a local site. Multi-center retrospective clinical studies require that these data dictionaries, originating from individual participating centers, be harmonized in preparation for the integration of the corresponding clinical research data. Domain ontologies are often used to facilitate multi-center data integration by modeling terms from data dictionaries in a logic-based language, but interoperability among domain ontologies (using automated techniques) is an unresolved issue. Although many upper-level reference ontologies have been proposed to address this challenge, our experience in integrating multi-center sleep medicine data highlights the need for an upper level ontology that models a common set of terms at multiple-levels of abstraction, which is not covered by the existing upper-level ontologies. We introduce a methodology underpinned by a Minimal Domain of Discourse (MiDas) algorithm to automatically extract a minimal common domain of discourse (upper-domain ontology) from an existing domain ontology. Using the Multi-Modality, Multi-Resource Environment for Physiological and Clinical Research (Physio-MIMI) multi-center project in sleep medicine as a use case, we demonstrate the use of MiDas in extracting a minimal domain of discourse for sleep medicine, from Physio-MIMI's Sleep Domain Ontology (SDO). We then extend the resulting domain of discourse with terms from the data dictionary of the Sleep Heart and Health Study (SHHS) to validate MiDas. To illustrate the wider applicability of MiDas, we automatically extract the respective domains of discourse from 6 sample domain ontologies from the National Center for Biomedical Ontologies (NCBO) and the OBO Foundry.

MSL: Facilitating automatic and physical analysis of published scientific literature in PDF format

PubMed Central

Ahmed, Zeeshan; Dandekar, Thomas

2018-01-01

Published scientific literature contains millions of figures, including information about the results obtained from different scientific experiments e.g. PCR-ELISA data, microarray analysis, gel electrophoresis, mass spectrometry data, DNA/RNA sequencing, diagnostic imaging (CT/MRI and ultrasound scans), and medicinal imaging like electroencephalography (EEG), magnetoencephalography (MEG), echocardiography  (ECG), positron-emission tomography (PET) images. The importance of biomedical figures has been widely recognized in scientific and medicine communities, as they play a vital role in providing major original data, experimental and computational results in concise form. One major challenge for implementing a system for scientific literature analysis is extracting and analyzing text and figures from published PDF files by physical and logical document analysis. Here we present a product line architecture based bioinformatics tool ‘Mining Scientific Literature (MSL)’, which supports the extraction of text and images by interpreting all kinds of published PDF files using advanced data mining and image processing techniques. It provides modules for the marginalization of extracted text based on different coordinates and keywords, visualization of extracted figures and extraction of embedded text from all kinds of biological and biomedical figures using applied Optimal Character Recognition (OCR). Moreover, for further analysis and usage, it generates the system’s output in different formats including text, PDF, XML and images files. Hence, MSL is an easy to install and use analysis tool to interpret published scientific literature in PDF format. PMID:29721305

Biofilm inhibition activity of traditional medicinal plants from Northwestern Argentina against native pathogen and environmental microorganisms.

PubMed

Romero, Cintia Mariana; Vivacqua, Cristian Germán; Abdulhamid, María Belén; Baigori, Mario Domingo; Slanis, Alberto Carlos; Allori, María Cristina Gaudioso de; Tereschuk, María Laura

2016-01-01

Plants have been commonly used in popular medicine of most cultures for the treatment of disease. The in vitro antimicrobial activity of certain Argentine plants used in traditional medicine has been reported. The aim of this study was to investigate the antimicrobial, anti-biofilm, and anti-cell adherence activities of native plants (Larrea divaricata, Tagetes minuta, Tessaria absinthioides, Lycium chilense, and Schinus fasciculatus) collected in northwestern Argentina. The activities of the five plant species were evaluated in Bacillus strains and clinical strains of coagulase-negative Staphylococcus isolated from northwestern Argentina and identified by 16S rDNA. Lycium chilense and Schinus fasciculatus were the most effective antimicrobial plant extracts (15.62µg/ml and 62.50µg/ml for Staphylococcus sp. Mcr1 and Bacillus sp. Mcn4, respectively). The highest (66%) anti-biofilm activity against Bacillus sp. Mcn4 was observed with T. absinthioides and L. divaricate extracts. The highest (68%) anti-biofilm activity against Staphylococcus sp. Mcr1 was observed with L. chilense extract. T. minuta, T. absinthioides, and L. divaricata showed percentages of anti-biofilm activity of between 55% and 62%. The anti-adherence effects of T. minuta and L. chilense observed in Bacillus sp. Mcn4 reflected a difference of only 22% and 10%, respectively, between anti-adherence and biofilm inhibition. Thus, the inhibition of biofilm could be related to cell adherence. In Staphylococcus sp. Mcr1, all plant extracts produced low anti-adherence percentages. These five species may represent a source of alternative drugs derived from plant extracts, based on ethnobotanical knowledge from northwest Argentina.

Zulu medicinal plants with antibacterial activity.

PubMed

Kelmanson, J E; Jäger, A K; van Staden, J

2000-03-01

Aqueous, methanolic and ethyl acetate extracts of 14 plants used in traditional Zulu medicine for treatment of ailments of an infectious nature were screened for antibacterial activity. Most of the activity detected was against gram-positive bacteria. Tuber bark extracts of Dioscorea sylvatica had activity against gram-negative Escherichia coli and extracts of Dioscorea dregeana, Cheilanthes viridis and Vernonia colorata were active against Pseudomonas aeruginosa. The highest antibacterial activity was found in extracts of C. viridis, D. dregeana, D. silvatica, Melianthus comosus and V. colorata. In general, methanolic extracts exhibited higher activity than aqueous and ethyl acetate extracts.

Rare tradition of the folk medicinal use of Aconitum spp. is kept alive in Solčavsko, Slovenia.

PubMed

Povšnar, Marija; Koželj, Gordana; Kreft, Samo; Lumpert, Mateja

2017-08-08

Aconitum species are poisonous plants that have been used in Western medicine for centuries. In the nineteenth century, these plants were part of official and folk medicine in the Slovenian territory. According to current ethnobotanical studies, folk use of Aconitum species is rarely reported in Europe. The purpose of this study was to research the folk medicinal use of Aconitum species in Solčavsko, Slovenia; to collect recipes for the preparation of Aconitum spp., indications for use, and dosing; and to investigate whether the folk use of aconite was connected to poisoning incidents. In Solčavsko, a remote alpine area in northern Slovenia, we performed semi-structured interviews with 19 informants in Solčavsko, 3 informants in Luče, and two retired physicians who worked in that area. Three samples of homemade ethanolic extracts were obtained from informants, and the concentration of aconitine was measured. In addition, four extracts were prepared according to reported recipes. All 22 informants knew of Aconitum spp. and their therapeutic use, and 5 of them provided a detailed description of the preparation and use of "voukuc", an ethanolic extract made from aconite roots. Seven informants were unable to describe the preparation in detail, since they knew of the extract only from the narration of others or they remembered it from childhood. Most likely, the roots of Aconitum tauricum and Aconitum napellus were used for the preparation of the extract, and the solvent was homemade spirits. Four informants kept the extract at home; two extracts were prepared recently (1998 and 2015). Three extracts were analyzed, and 2 contained aconitine. Informants reported many indications for the use of the extract; it was used internally and, in some cases, externally as well. The extract was also used in animals. The extract was measured in drops, but the number of drops differed among the informants. The informants reported nine poisonings with Aconitum spp., but none of them occurred as a result of medicinal use of the extract. In this study, we determined that folk knowledge of the medicinal use of Aconitum spp. is still present in Solčavsko, but Aconitum preparations are used only infrequently.

Anemone medicinal plants: ethnopharmacology, phytochemistry and biology.

PubMed

Hao, Da-Cheng; Gu, Xiaojie; Xiao, Peigen

2017-03-01

The Ranunculaceae genus Anemone (order Ranunculales), comprising more than 150 species, mostly herbs, has long been used in folk medicine and worldwide ethnomedicine. Various medicinal compounds have been found in Anemone plants, especially triterpenoid saponins, some of which have shown anti-cancer activities. Some Anemone compounds and extracts display immunomodulatory, anti-inflammatory, antioxidant, and antimicrobial activities. More than 50 species have ethnopharmacological uses, which provide clues for modern drug discovery. Anemone compounds exert anticancer and other bioactivities via multiple pathways. However, a comprehensive review of the Anemone medicinal resources is lacking. We here summarize the ethnomedical knowledge and recent progress on the chemical and pharmacological diversity of Anemone medicinal plants, as well as the emerging molecular mechanisms and functions of these medicinal compounds. The phylogenetic relationships of Anemone species were reconstructed based on nuclear ITS and chloroplast markers. The molecular phylogeny is largely congruent with the morphology-based classification. Commonly used medicinal herbs are distributed in each subgenus and section, and chemical and biological studies of more unexplored taxa are warranted. Gene expression profiling and relevant "omics" platforms could reveal differential effects of phytometabolites. Genomics, transcriptomics, proteomics, and metabolomics should be highlighted in deciphering novel therapeutic mechanisms and utilities of Anemone phytometabolites.

Theranostic barcoded nanoparticles for personalized cancer medicine

PubMed Central

Yaari, Zvi; da Silva, Dana; Zinger, Assaf; Goldman, Evgeniya; Kajal, Ashima; Tshuva, Rafi; Barak, Efrat; Dahan, Nitsan; Hershkovitz, Dov; Goldfeder, Mor; Roitman, Janna Shainsky; Schroeder, Avi

2016-01-01

Personalized medicine promises to revolutionize cancer therapy by matching the most effective treatment to the individual patient. Using a nanoparticle-based system, we predict the therapeutic potency of anticancer medicines in a personalized manner. We carry out the diagnostic stage through a multidrug screen performed inside the tumour, extracting drug activity information with single cell sensitivity. By using 100 nm liposomes, loaded with various cancer drugs and corresponding synthetic DNA barcodes, we find a correlation between the cell viability and the drug it was exposed to, according to the matching barcodes. Based on this screen, we devise a treatment protocol for mice bearing triple-negative breast-cancer tumours, and its results confirm the diagnostic prediction. We show that the use of nanotechnology in cancer care is effective for generating personalized treatment protocols. PMID:27830705

Ultrasound-Assisted Extraction of Carnosic Acid and Rosmarinic Acid Using Ionic Liquid Solution from Rosmarinus officinalis

PubMed Central

Zu, Ge; Zhang, Rongrui; Yang, Lei; Ma, Chunhui; Zu, Yuangang; Wang, Wenjie; Zhao, Chunjian

2012-01-01

Ionic liquid based, ultrasound-assisted extraction was successfully applied to the extraction of phenolcarboxylic acids, carnosic acid and rosmarinic acid, from Rosmarinus officinalis. Eight ionic liquids, with different cations and anions, were investigated in this work and [C8mim]Br was selected as the optimal solvent. Ultrasound extraction parameters, including soaking time, solid–liquid ratio, ultrasound power and time, and the number of extraction cycles, were discussed by single factor experiments and the main influence factors were optimized by response surface methodology. The proposed approach was demonstrated as having higher efficiency, shorter extraction time and as a new alternative for the extraction of carnosic acid and rosmarinic acid from R. officinalis compared with traditional reference extraction methods. Ionic liquids are considered to be green solvents, in the ultrasound-assisted extraction of key chemicals from medicinal plants, and show great potential. PMID:23109836

In Vitro Antimicrobial Activity of Spices and Medicinal Herbs against Selected Microbes Associated with Juices

PubMed Central

Dhiman, Romika; Aggarwal, Neeraj; Aneja, Kamal Rai; Kaur, Manpreet

2016-01-01

In the present investigation, comparison of antimicrobial activities of different spices, Curcuma longa, Zingiber officinale, and Mentha arvensis, and medicinal herbs, such as Withania somnifera, Rauvolfia serpentina, Emblica officinalis, Terminalia arjuna, and Centella asiatica, was evaluated. Different extraction solvents (acetone, methanol, ethanol, and water) were used and extracts were examined against Bacillus cereus, Serratia sp., Rhodotorula mucilaginosa, Aspergillus flavus, and Penicillium citrinum isolated from juices. Extracts from the medicinal herb and spices have significant activity. B. cereus was the most sensitive and R. mucilaginosa was the most resistant among the microorganisms tested. Ethanolic and methanolic extract of C. asiatica displayed maximum diameter of inhibition zone against bacteria and yeast and percentage mycelial inhibition against moulds. This study confirmed the potential of selected extracts of spices as effective natural food preservative in juices. PMID:26880927

Medicinal activities of the leaves of Musa sapientum var. sylvesteris in vitro

PubMed Central

Sahaa, Repon Kumer; Acharyaa, Srijan; Shovon, Syed Sohidul Haque; Royb, Priyanka

2013-01-01

Objective This study is to investigate the medicinal value of methanolic extract of the leaves of Musa sapientum var. sylvesteris in Bangladesh. Methods Several biochemical assays, thin layer chormatogarphy and ultra-violet spectroscopy were used to detect the presence of various types of compounds in this extract. Antioxidant effects were measured by DPPH scavenging assay, total reducing assay and hydrogen peroxide scavenging assay. Receptor binding activities and hydrogen peroxide induced hemolysis assay were performed by hemagglutination assay and hemolysis assay using erythrocytes. Disk diffusion assay was performed to show the antibacterial effect of the extract. Results Methanolic extract of the leaves showed antioxidant and antibacterial activity in vitro. The extract showed hemaglutination inhibition activities and hydrogen peroxide induced hemolysis inhibition activity of human red blood cells. Conclusion Musa sapientum var. sylvesteris can be an useful medicinal plant. PMID:23730561

Combined Phytochemistry and Chemotaxis Assays for Identification and Mechanistic Analysis of Anti-Inflammatory Phytochemicals in Fallopia japonica

PubMed Central

Shen, Ming-Yi; Liu, Yan-Jun; Don, Ming-Jaw; Liu, Hsien-Yueh; Chen, Zeng-Weng; Mettling, Clément; Corbeau, Pierre; Chiang, Chih-Kang; Jang, Yu-Song; Li, Tzu-Hsuan; Young, Paul; Chang, Cicero L. T.; Lin, Yea-Lih; Yang, Wen-Chin

2011-01-01

Plants provide a rich source of lead compounds for a variety of diseases. A novel approach combining phytochemistry and chemotaxis assays was developed and used to identify and study the mechanisms of action of the active compounds in F. japonica, a medicinal herb traditionally used to treat inflammation. Based on a bioactivity-guided purification strategy, two anthranoids, emodin and physcion, were identified from F. japonica. Spectroscopic techniques were used to characterize its crude extract, fractions and phytochemicals. The crude extract, chloroform fraction, and anthranoids of F. japonica significantly inhibited CXCR4-mediated chemotaxis. Mechanistic studies showed that emodin and physcion inhibited chemotaxis via inactivating the MEK/ERK pathway. Moreover, the crude extract and emodin could prevent or treat type 1 diabetes in non-obese diabetic (NOD) mice. This study illustrates the applicability of a combinational approach for the study of anti-inflammatory medicine and shows the potential of F. japonica and its anthranoids for anti-inflammatory therapy. PMID:22087325

[Experimental study of bacteriostatic activity of Chinese herbal medicines on primary cariogenic bacteria in vitro].

PubMed

Wang, S; Fan, M; Bian, Z

2001-09-01

To screen some Chinese herbal medicines for their inhibitory activity on cariogenic bacteria, and investigate their active ingredients, and measure their minimum inhibitory concentration (MIC), minimum bactericidal concentration (MBC). Active components were isolated from every tested Chinese herbal medicine by means of aqueous extraction and ethanolic extraction. Berberine was purified from Coptis chinensis Fra. Disk agar diffusion method was employed in screening herbs with inhibiting effect on cariogenic bacteria. MIC and MBC were determined by broth dilution method. Against Streptococcus mutans Ingbritt, MBCs of Magnolia officinalis ethanolic extract, Berberine, Coptis chinensis Fra aqueous extract and Coptis chinensis Fra ethanolic extract were 0.488, 0.625, 7.800 and 1.950 g/L respectively. Against Streptococcus sobrinus 6715, MBCs of Magnolia extract, Coptis chinensis Fra ethanolic extract, Rhus chinensis Mill ethanolic extract and Phellodendron chinen ethanolic extract were 0.488, 0.625, 1.950, 3.900, 3.900 and 3.900 g/L respectively. Against Actinomyces viscosus ATCC 19246, MBCs of Berberine, Coptis chinensis Fra aqueous extract, Coptis chinensis Fra ethanolic extract, Rheum palmatum L aqueous extract and Rheum palmatum L ethanolic extract were 1.250, 3.900, 3.900, 15.600 and 31.250 g/L respectively. Magnolia officinalis, Coptis chinensis Fran, Rheum palmatum L aqueous extracts exhibit strong inhibition on cariogenic bacteria. Magnolia officinalis ethanolic extract has the strongest bactericidal effects on Streptococcus mutans and Streptococcus sobrinus.

History and Experience: A Survey of Traditional Chinese Medicine Treatment for Alzheimer's Disease

PubMed Central

Liu, Ping; Kong, Mingwang; Yuan, Shihe; Liu, Junfeng; Wang, Ping

2014-01-01

Traditional Chinese medicine (TCM) is practiced in the Chinese health care system for more than 2,000 years. In recent years, herbal medicines, which are used to treat Alzheimer's disease (AD) in China based on TCM or modern pharmacological theories have attracted considerable attention. In this paper, we discuss etiology and pathogenesis of AD, TCM therapy, and herbal extracts for the treatment of AD. There is evidence to suggest that TCM therapy may offer certain complementary cognitive benefits for the treatment of AD. Chinese herb may have advantages with multiple target regulation compared with the single-target antagonist in view of TCM. PMID:24624220

A Retrospective Quantitative Assessment of Trichloroethylene Exposure of Workers at Aircraft Maintenance Facilities at Hill Air Force Base Through the Use of Modeling

DTIC Science & Technology

1994-09-01

affording me the right mix of freedom and guidance, thus making the entire thesis writing process truly rewarding and memorable. - Anthony 0...have been in clinical medicine and industrial processes . The use of TCE for medicinal purposes gained recognition beginning in 1942 when Langston...fumigant mixtures and as an extractant in the decaffeination of coffee (Royal Society of Chemistry, 1986:102). Today, the major use of TCE is in

Southeast Asian Medicinal Plants as a Potential Source of Antituberculosis Agent

PubMed Central

Sanusi, Shuaibu Babaji; Mohamed, Maryati; Mainasara, Muhammad Murtala

2017-01-01

Despite all of the control strategies, tuberculosis (TB) is still a major cause of death globally and one-third of the world's population is infected with TB. The drugs used for TB treatment have drawbacks of causing adverse side effects and emergence of resistance strains. Plant-derived medicines have since been used in traditional medical system for the treatment of numerous ailments worldwide. There were nine major review publications on antimycobacteria from plants in the last 17 years. However, none is focused on Southeast Asian medicinal plants. Hence, this review is aimed at highlighting the medicinal plants of Southeast Asian origin evaluated for anti-TB. This review is based on literatures published in various electronic database. A total of 132 plants species representing 45 families and 107 genera were reviewed; 27 species representing 20.5% exhibited most significant in vitro anti-TB activity (crude extracts and/or bioactive compounds 0–<10 µg/ml). The findings may motivate various scientists to undertake the project that may result in the development of crude extract that will be consumed as complementary or alternative TB drug or as potential bioactive compounds for the development of novel anti-TB drug. PMID:29081822

Introducing Urtica dioica, A Native Plant of Khuzestan, As an Antibacterial Medicinal Plant.

PubMed

Motamedi, Hossein; Seyyednejad, Seyyed Mansour; Bakhtiari, Ameneh; Vafaei, Mozhan

2014-11-01

Urtica dioica is a flowering plant with long history of use in folk medicine and as a food source. This study examined in vitro antibacterial potential of alcoholic extracts of U. dioica. Hydroalcoholic extracts from aerial parts were prepared using aqueous solution of ethanol and methanol and their inhibitory effects against clinical isolates was examined by disc diffusion method at different doses. Minimum inhibitory concentrations (MIC) and minimum bactericidal concentration (MBC) indexes were also investigated. The scanning electron microscopy (SEM) analysis was also performed to find structural changes of affected bacteria consequent to exposing with extracts. Both extracts were active against Bacillus cereus, Staphylococcus aureus, Staphylococcus epidermidis, and Escherichia coli with respectively 16, 10, 18, and 14 mm (methanolic) and 11, 9, 17, and 16 mm (ethanolic) inhibition zone. The MIC of ethanolic extract against S. epidermidis and E. coli was respectively 10 and 40 mg/mL. The MIC of methanolic extract against S. aureus and S. epidermidis was 40 and 10 mg/mL, respectively. The MBC was found only for S. epidermidis (20 mg/mL). In SEM analysis the round shape of S. epidermidis was changed and irregular shapes were appeared, which suggest that the main target of these extracts was cell wall. Extracts of U. dioica showed significant antibacterial effect against some clinically important pathogenic bacteria. Based on the obtained results it can be concluded that U. dioica is useful as antibacterial and bactericidal agent in treating infectious diseases.

Optimization of Bioactive Ingredient Extraction from Chinese Herbal Medicine Glycyrrhiza glabra: A Comparative Study of Three Optimization Models

PubMed Central

Li, Xiaohong; Zhang, Yuyan

2018-01-01

The ultraviolet spectrophotometric method is often used for determining the content of glycyrrhizic acid from Chinese herbal medicine Glycyrrhiza glabra. Based on the traditional single variable approach, four extraction parameters of ammonia concentration, ethanol concentration, circumfluence time, and liquid-solid ratio are adopted as the independent extraction variables. In the present work, central composite design of four factors and five levels is applied to design the extraction experiments. Subsequently, the prediction models of response surface methodology, artificial neural networks, and genetic algorithm-artificial neural networks are developed to analyze the obtained experimental data, while the genetic algorithm is utilized to find the optimal extraction parameters for the above well-established models. It is found that the optimization of extraction technology is presented as ammonia concentration 0.595%, ethanol concentration 58.45%, return time 2.5 h, and liquid-solid ratio 11.065 : 1. Under these conditions, the model predictive value is 381.24 mg, the experimental average value is 376.46 mg, and the expectation discrepancy is 4.78 mg. For the first time, a comparative study of these three approaches is conducted for the evaluation and optimization of the effects of the extraction independent variables. Furthermore, it is demonstrated that the combinational method of genetic algorithm and artificial neural networks provides a more reliable and more accurate strategy for design and optimization of glycyrrhizic acid extraction from Glycyrrhiza glabra. PMID:29887907

Optimization of Bioactive Ingredient Extraction from Chinese Herbal Medicine Glycyrrhiza glabra: A Comparative Study of Three Optimization Models.

PubMed

Yu, Li; Jin, Weifeng; Li, Xiaohong; Zhang, Yuyan

2018-01-01

The ultraviolet spectrophotometric method is often used for determining the content of glycyrrhizic acid from Chinese herbal medicine Glycyrrhiza glabra . Based on the traditional single variable approach, four extraction parameters of ammonia concentration, ethanol concentration, circumfluence time, and liquid-solid ratio are adopted as the independent extraction variables. In the present work, central composite design of four factors and five levels is applied to design the extraction experiments. Subsequently, the prediction models of response surface methodology, artificial neural networks, and genetic algorithm-artificial neural networks are developed to analyze the obtained experimental data, while the genetic algorithm is utilized to find the optimal extraction parameters for the above well-established models. It is found that the optimization of extraction technology is presented as ammonia concentration 0.595%, ethanol concentration 58.45%, return time 2.5 h, and liquid-solid ratio 11.065 : 1. Under these conditions, the model predictive value is 381.24 mg, the experimental average value is 376.46 mg, and the expectation discrepancy is 4.78 mg. For the first time, a comparative study of these three approaches is conducted for the evaluation and optimization of the effects of the extraction independent variables. Furthermore, it is demonstrated that the combinational method of genetic algorithm and artificial neural networks provides a more reliable and more accurate strategy for design and optimization of glycyrrhizic acid extraction from Glycyrrhiza glabra .

Attitudes Toward Bile Extraction From Living Bears: Survey of Citizens and Students in Beijing.

PubMed

Liu, Zhao; Jiang, Zhigang; Yang, Aifang; Xu, Bingbing; Fang, Hongxia; Xie, Zongping; Li, Ning; Li, Chunwang; Meng, Zhibin; Zeng, Yan

2017-01-01

Bear bile is a traditional Chinese medicine that has been used for millennia. Several arguments support and oppose the use of bear farming in terms of conservation and nonhuman animal welfare. This study involved designing a questionnaire and surveying a random sample of general citizens and college students in Beijing to elicit their attitudes on bile extraction from living bears. Older people and people with lower education levels used more bear bile medicines. In total, 29.47% (n = 204) of citizens and 23.14% (n = 81) of students surveyed used bear bile medicine since 1990. Students were less willing to use bear bile medicines than citizens (p < .05). The level the respondents agreed with the blue side (against the extraction of bile from living bears; anti for short) was significantly higher than that for the red side (support the extraction of bile from living bears; pro for short; p < .05). Additionally, college students had a more distinct attitude toward the opposing views, which indicates they were more inclined to oppose bile extraction from living bears.

Study of antihyperglycaemic activity of medicinal plant extracts in alloxan induced diabetic rats

PubMed Central

Attanayake, Anoja P.; Jayatilaka, Kamani A. P. W.; Pathirana, Chitra; Mudduwa, Lakmini K. B.

2013-01-01

Background: Diabetes mellitus, for a long time, has been treated with plant derived medicines in Sri Lanka. Aim: The aim of this study is to determine the efficacy and dose response of oral antihyperglycaemic activity of eight Sri Lankan medicinal plant extracts, which are used to treat diabetes in traditional medicine in diabetic rats. Materials and Methods: Medicinal plants selected for the study on the basis of documented effectiveness and wide use among traditional Ayurveda physicians in the Southern region of Sri Lanka for the treatment of diabetes mellitus. The effect of different doses of aqueous stem bark extracts of Spondias pinnata (Anacardiaceae), Kokoona zeylanica (Celastraceae), Syzygium caryophyllatum (Myrtaceae), Gmelina arborea (Verbenaceae), aerial part extracts of Scoparia dulcis (Scrophulariaceae), Sida alnifolia (Malvaceae), leaf extract of Coccinia grandis (Cucurbitaceae) and root extract of Languas galanga (Zingiberaceae) on oral glucose tolerance test was evaluated. A single dose of 0.25, 0.50, 0.75, 1.00, 1.25, 2.00 g/kg of plant extract was administered orally to alloxan induced (150 mg/kg, ip) diabetic Wistar rats (n = 6). Glibenclamide (0.50 mg/kg) was used as the standard drug. The acute effect was evaluated over a 4 h period using area under the oral glucose tolerance curve. Statistical Analysis: The results were evaluated by analysis of variance followed by Dunnett's test. Results: The eight plant extracts showed statistically significant dose dependent improvement on glucose tolerance (P < 0.05). The optimum effective dose on glucose tolerance for six extracts was found to be 1.00 g/kg in diabetic rats with the exception of C. grandis: 0.75 g/kg and L. galanga: 1.25 g/kg. Conclusion: The aqueous extract of G. arborea, S. pinnata, K. zeylanica, S. caryophyllatum, S. dulcis, S. alnifolia, L. galanga and C. grandis possess potent acute antihyperglycaemic activity in alloxan induced diabetic rats. PMID:24991066

Study of antihyperglycaemic activity of medicinal plant extracts in alloxan induced diabetic rats.

PubMed

Attanayake, Anoja P; Jayatilaka, Kamani A P W; Pathirana, Chitra; Mudduwa, Lakmini K B

2013-04-01

Diabetes mellitus, for a long time, has been treated with plant derived medicines in Sri Lanka. The aim of this study is to determine the efficacy and dose response of oral antihyperglycaemic activity of eight Sri Lankan medicinal plant extracts, which are used to treat diabetes in traditional medicine in diabetic rats. Medicinal plants selected for the study on the basis of documented effectiveness and wide use among traditional Ayurveda physicians in the Southern region of Sri Lanka for the treatment of diabetes mellitus. The effect of different doses of aqueous stem bark extracts of Spondias pinnata (Anacardiaceae), Kokoona zeylanica (Celastraceae), Syzygium caryophyllatum (Myrtaceae), Gmelina arborea (Verbenaceae), aerial part extracts of Scoparia dulcis (Scrophulariaceae), Sida alnifolia (Malvaceae), leaf extract of Coccinia grandis (Cucurbitaceae) and root extract of Languas galanga (Zingiberaceae) on oral glucose tolerance test was evaluated. A single dose of 0.25, 0.50, 0.75, 1.00, 1.25, 2.00 g/kg of plant extract was administered orally to alloxan induced (150 mg/kg, ip) diabetic Wistar rats (n = 6). Glibenclamide (0.50 mg/kg) was used as the standard drug. The acute effect was evaluated over a 4 h period using area under the oral glucose tolerance curve. The results were evaluated by analysis of variance followed by Dunnett's test. The eight plant extracts showed statistically significant dose dependent improvement on glucose tolerance (P < 0.05). The optimum effective dose on glucose tolerance for six extracts was found to be 1.00 g/kg in diabetic rats with the exception of C. grandis: 0.75 g/kg and L. galanga: 1.25 g/kg. The aqueous extract of G. arborea, S. pinnata, K. zeylanica, S. caryophyllatum, S. dulcis, S. alnifolia, L. galanga and C. grandis possess potent acute antihyperglycaemic activity in alloxan induced diabetic rats.

Inhibitory effect on nitric oxide production and free radical scavenging activity of Thai medicinal plants in osteoarthritic knee treatment.

PubMed

Anuthakoengkun, Areeya; Itharat, Arunporn

2014-08-01

Thai medicine plants used for Osteoarthritis of knee (OA) treatment consist of twelve plants such as Crinumn asiaticum, Cleome viscosa, Drypetes roxburghii, Piper longum, Piper nigrum, Plumbago indica, Alpinia galanga, Curcuma aromatica, Globba malaccensis, Zingiber montanum, Zingiber officinale andZingiberzerumbet. They showedhighfrequency in OA formula. To investigate inhibitory effect on LPS-induced nitric oxide (NO) release from RAW264. 7 cell and free radical scavenging activity usingDPPH assay of these ethanolic plant extracts. Plant materials were extracted by maceration in 95% ethanol. Anti-inflammatory activity were tested on LPS-induced NO production. Free radical scavenging activity was performed by DPPH assay. All of ethanolic extracts exhibited potent inhibitory effect on NO release. The ethanolic extract of Z. zerumbet exhibited the highest inhibitory effect followed by Z. montanum and G. malaccensis, respectively. Except A. galanga and C. viscosa, all extracts possessed more influential than indomethacin (IC50 = 20.32±3.23 μLg/ml), a positive control. The investigation on antioxidant activity suggested that the ethanolic extracts of D. roxburghii, Z. officinale, Z. montanum, C. aromatic, A. galanga, P indica, G malaccensis, P nigrum exhibited antioxidant activity. By means ofD. roxburghii had the highest electron donating activity,followed by Z. officinale. Moreover both extracts were more effective than BHT apositive control (EC50 = 14.04±1.95 μg/ml). Thai medicinal plants had anti-inflammatory activity and could inhibit destruction of articular cartilage that corresponded to the traditional medicine and supported using these medicinal plants for OA treatment.

Antimicrobial effects of Thai medicinal plants against acne-inducing bacteria.

PubMed

Chomnawang, Mullika Traidej; Surassmo, Suvimol; Nukoolkarn, Veena S; Gritsanapan, Wandee

2005-10-03

Propionibacterium acnes and Staphylococcus epidermidis have been recognized as pus-forming bacteria triggering an inflammation in acne. The present study was conducted to evaluate antimicrobial activities of Thai medicinal plants against these etiologic agents of acne vulgaris. Crude extracts were tested for antimicrobial activities by disc diffusion and broth dilution methods. The results from the disc diffusion method showed that 13 medicinal plants could inhibit the growth of Propionibacterium acnes. Among those, Senna alata, Eupatorium odoratum, Garcinia mangostana, and Barleria lupulina had strong inhibitory effects. Based on a broth dilution method, the Garcinia mangostana extract had the greatest antimicrobial effect. The MIC values were the same (0.039 mg/ml) for both bacterial species and the MBC values were 0.039 and 0.156 mg/ml against Propionibacterium acnes and Staphylococcus epidermidis, respectively. In bioautography assay, the Garcinia mangostana extract produced strong inhibition zones against Propionibacterium acnes. Antimicrobial activity from fractions of column chromatography revealed one of the active compounds in Garcinia mangostana could be mangostin, a xanthone derivative. Taken together, our data indicated that Garcinia mangostana had a strong inhibitory effect on Propionibacterium acnes and Staphylococcus epidermidis. Therefore, this plant would be an interesting topic for further study and possibly for an alternative treatment for acne.

Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

PubMed

Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G

2017-07-19

Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

Antimicrobial and free radical scavenging activities of five Palestinian medicinal plants.

PubMed

Qabaha, Khaled Ibraheem

2013-01-01

Extracts from five indigenous Palestinian medicinal plants including Rosmarinus officinalis, Pisidium guajava, Punica granatum peel, grape seeds and Teucrium polium were investigated for antimicrobial and free radical scavenging activities against eight microorganisms, using well diffusion method. The microorganisms included six bacterial isolates (i.e. Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginos, Klebsiella pneumonia, Bacillus subtilis and Micrococcus luteus) and two fungal isolates (i.e. Candida albicans and Aspergillus niger). A standard antioxidant assay was performed on the plant extracts to assess their capability in scavenging 2,2-diphenyl-1-picrylhydrazyl (DPPH). Of the five tested plant extract, only Rosmarinus offcinalis extract contained significant antimicrobial activity against all eight microbial isolates including Pseudomonas aeruginosa. Extracts from other four plants exhibited a variable antimicrobial activity against all microorganisms, except Pseudomonas aeruginosa. Significant antioxidant activity was detected in all plant extracts. However, extracts from Pisidium guajava leaves contained significantly higher antioxidant activity compared to the other extracts tested. The antimicrobial and scavenging activities detected in this in vitro study in extracts from the five Palestinian medicinal plants suggest that further study is needed to identify active compounds to target diseases caused by a wide-spectrum pathogens.

Angiogenesis: from plants to blood vessels.

PubMed

Fan, Tai-Ping; Yeh, Ju-Ching; Leung, Kar Wah; Yue, Patrick Y K; Wong, Ricky N S

2006-06-01

Angiogenesis is a major pathological component of diseases such as cancer and coronary heart disease. Although major advances have been made and encouraging clinical results obtained, safer and more effective approaches are required. The identification of new drugs from plants has a long and successful history, and certain proangiogenic and antiangiogenic plant components have been used in traditional Chinese medicine (TCM) for thousands of years. Similar to Western combination therapy, TCM uses mixtures of plant extracts, termed fufang, to maximize efficacy and minimize adverse effects or toxicity. More evidence-based research and chemical optimization of these compounds could further enhance the effectiveness of these plant-based medicines in angiotherapy.

Objective research of auscultation signals in Traditional Chinese Medicine based on wavelet packet energy and support vector machine.

PubMed

Yan, Jianjun; Shen, Xiaojing; Wang, Yiqin; Li, Fufeng; Xia, Chunming; Guo, Rui; Chen, Chunfeng; Shen, Qingwei

2010-01-01

This study aims at utilising Wavelet Packet Transform (WPT) and Support Vector Machine (SVM) algorithm to make objective analysis and quantitative research for the auscultation in Traditional Chinese Medicine (TCM) diagnosis. First, Wavelet Packet Decomposition (WPD) at level 6 was employed to split more elaborate frequency bands of the auscultation signals. Then statistic analysis was made based on the extracted Wavelet Packet Energy (WPE) features from WPD coefficients. Furthermore, the pattern recognition was used to distinguish mixed subjects' statistical feature values of sample groups through SVM. Finally, the experimental results showed that the classification accuracies were at a high level.

[Research strategies in standard decoction of medicinal slices].

PubMed

Chen, Shi-Lin; Liu, An; Li, Qi; Toru, Sugita; Zhu, Guang-Wei; Sun, Yi; Dai, Yun-Tao; Zhang, Jun; Zhang, Tie-Jun; Takehisa, Tomoda; Liu, Chang-Xiao

2016-04-01

This paper discusses the research situation of the standard decoction of medicinal slices at home and abroad. Combined with the experimental data, the author proposes that the standard decoction of medicinal slices is made of single herb using standard process which should be guided by the theory of traditional Chinese medicine, based on clinical practice and referred to modern extraction method with a standard process. And the author also proposes the principles of establishing the specification of process parameters and quality standards and established the basis of drug efficacy material and biological reference. As a standard material and standard system, the standard decoction of medicinal slices can provide standards for clinical medication, standardize the use of the new type of medicinal slices especially for dispensing granules, which were widely used in clinical. It can ensure the accuracy of drugs and consistency of dose, and to solve current supervision difficulties. Moreover the study of standard decoction of medicinal slices will provide the research on dispensing granules, traditional Chinese medicine prescription standard decoction and couplet medicines standard decoction a useful reference. Copyright© by the Chinese Pharmaceutical Association.

Antibacterial activity of some medicinal plants against selected human pathogenic bacteria

PubMed Central

Khan, Usman Ali; Niaz, Zeeshan; Qasim, Muhammad; Khan, Jafar; Tayyaba; Rehman, Bushra

2013-01-01

Medicinal plants are traditionally used for the treatment of human infections. The present study was undertaken to investigate Bergenia ciliata, Jasminum officinale, and Santalum album for their potential activity against human bacterial pathogens. B. ciliata, J. officinale, and S. album extracts were prepared in cold and hot water. The activity of plant extracts and selected antibiotics was evaluated against five bacterial pathogens including Staphylococcus aureus, Bacillus subtilis, Proteus vulgaris, Pseudomonas aeruginosa, and Escherichia coli using agar well diffusion method. Among the three medicinal plants, B. ciliata extracts displayed potential activity against bacterial pathogens. Cold water extract of Bergenia ciliate showed the highest activity against B. subtilis, which is comparable with a zone of inhibition exhibited by ceftriaxone and erythromycin. J. officinale and S. album extracts demonstrated variable antibacterial activity. Further studies are needed to explore the novel antibacterial bioactive molecules. PMID:24294497

In vitro antioxidant potential of medicinal plant extracts and their activities against oral bacteria based on Brazilian folk medicine.

PubMed

Alviano, Wagner S; Alviano, Daniela S; Diniz, Cláudio G; Antoniolli, Angelo R; Alviano, Celuta S; Farias, Luiz M; Carvalho, Maria Auxiliadora R; Souza, Margareth M G; Bolognese, Ana Maria

2008-06-01

This study aims to determine antibacterial activities of Cocos nucifera (husk fiber), Ziziphus joazeiro (inner bark), Caesalpinia pyramidalis (leaves), aqueous extracts and Aristolochia cymbifera (rhizomes) alcoholic extract against Prevotella intermedia, Porphyromonas gingivalis, Fusobacterium nucleatum, Streptococcus mutans and Lactobacillus casei. The antioxidant activity and acute toxicity of these extracts were also evaluated. The plant extracts antibacterial activity was evaluated in vitro and the minimal inhibitory concentration (MIC) was determined by the broth micro-dilution assay. The bacterial killing kinetic was also evaluated for all extracts. In addition, the antibacterial effect of the extracts was tested in vitro on artificial oral biofilms. The acute toxicity of each extract was determined in according to Lorke [Lorke D. A new approach to practical acute toxicity testing. Arch Toxicol 1983;54:275-87] and the antioxidant activity was evaluated by DPPH photometric assay [Mensor LL, Menezes FS, Leitão GG, Reis AS, Santos TC, Coube CS, et al. Screening of Brazilian plants extract for antioxidant activity by the use of DPPH free radical method. Phytother Res 2001;15:127-30]. MIC and the bactericidal concentrations were identical, for each evaluated extract. However, microbes of artificial biofilms were less sensitive to the extracts than the planktonic strains. A. cymbifera extract induced the highest bactericidal effect against all tested bacteria, followed by C. nucifera, Z. joazeiro and C. pyramidalis extracts, respectively. All extracts showed good antioxidant potential, being C. nucifera and C. pyramidalis aqueous extracts the most active ones. In conclusion, all oral bacteria tested (planktonic or in artificial biofilms) were more susceptible to, and rapidly killed in presence of A. cymbifera, C. pyramidalis and C. nucifera than Z. joazeiro extracts, respectively. Thus, these extracts may be of great interest for future studies about treatment of oral diseases, considering their potent antioxidant activity and low toxicity.

Evaluation of the medicinal potentials of the methanol extracts of the leaves and stems of Halleria lucida.

PubMed

Adedapo, A A; Jimoh, F O; Koduru, S; Masika, P J; Afolayan, A J

2008-07-01

The medicinal potentials of the methanol extracts of the leaves and stems of Halleria lucida (Scrophulariaceae) were evaluated by assessing their antibacterial and antioxidant properties in vitro using standard procedures. The antioxidant activities of methanol extract of the leaves as determined by the ABTS, DPPH, proanthocyanidins and total flavonoids were higher than that of the stem. On the other hand, the total phenols, the flavonoids and the FRAP contents of the stem were higher than that of the leaves. The extracts however showed poor activity against both Gram-positive and Gram-negative bacteria. The methanol extract of the stem showed activities against Bacillus cereus and Staphylococcus epidermidis at MIC of 1.0 mg/ml. The methanol extract of the leaves did not show activity against any of the organisms used in this study. This study has to some extent validated the medicinal potential of the leaves and stems of H. lucida.

An ethnobotanical study of plants used for the treatment of sexually transmitted diseases (njovhera) in Guruve District, Zimbabwe.

PubMed

Kambizi, L; Afolayan, A J

2001-09-01

The use of medicinal plants in Guruve District, Zimbabwe, contributes significantly to primary health care of the people of the area. This paper presents findings of a survey of plants used for the treatment of sexually transmitted diseases (STDs) in the district. Ethnobotanical information obtained from traditional herbalists and other knowledgeable rural dwellers, has revealed 15 plant species belonging to 10 families as medicinal plants used for the treatment of these infections in the area. Six of these are the commonest and most frequently prescribed by the healers. Roots are the most frequently used parts of the plants constituting 53% of preparations while oral administration of extracts is the main method of prescription. Based on the information gathered from the traditional healers, Acacia nilotica (L.) Willd. ex Delile, Cassia abbreviata Oliv. Dichrostachys cinerea Wight and Arn, Solanum incanum L., Vernonia amygdalina Del. and Zanha africana (Radlk) Excell. are the most frequently used plants for the treatment of STDs. The methanol extracts of Cassia abbreviata, Zanha africana and Acacia nilotica showed significant inhibition against Gram-positive and Gram-negative bacteria, while acetone extracts of these plants inhibited most of the species. Generally the water extracts show less activity than acetone and methanol extracts.

Antimycobacterial and Antibacterial Activity of Allium sativum Bulbs

PubMed Central

Viswanathan, V.; Phadatare, A. G.; Mukne, Alka

2014-01-01

Tuberculosis is one of the major public health problems faced globally. Resistance of Mycobacterium tuberculosis to antitubercular agents has called for an urgent need to investigate newer drugs to combat tuberculosis. Garlic (Allium sativum) is an edible plant which has generated a lot of curiosity throughout human history as a medicinal plant. Garlic contains sulfur compounds like allicin, ajoene, allylmethyltrisulfide, diallyltrisulfide, diallyldisulphide and others which exhibit various biological properties like antimicrobial, anticancer, antioxidant, immunomodulatory, antiinflammatory, hypoglycemic, and cardiovascular effects. According to various traditional systems of medicine, garlic is one of the established remedies for tuberculosis. The objective of the current study was to investigate in vitro antimycobacterial activity as well as anti-bacterial activity of various extracts rich in specific phytoconstituents from garlic. Preparation of garlic extracts was done based on the chemistry of the constituents and their stability. The estimation of in vitro antimycobacterial activity of different garlic extracts was done using Resazurin microtire plate assay technique whereas activity of garlic oil was evaluated by colony count method. The antibacterial activity of extracts and oil was estimated by zone of inhibition method. Extracts of garlic rich in allicin and ajoene showed appreciable antimycobacterial activity as compared to standard drugs. Garlic oil demonstrated significant antibacterial activity, particularly against methicillin-resistant Staphylococcus aureus. PMID:25035540

Evaluation of Antioxidant Properties, Phenolic Compounds, Anthelmintic, and Cytotoxic Activities of Various Extracts Isolated from Nepeta cadmea: An Endemic Plant for Turkey.

PubMed

Kaska, Arzu; Deniz, Nahide; Çiçek, Mehmet; Mammadov, Ramazan

2018-05-10

Nepeta cadmea Boiss. is a species endemic to Turkey that belongs to the Nepeta genus. Several species of this genus are used in folk medicine. This study was designed to investigate the phenolic compounds, antioxidant, anthelmintic, and cytotoxic activities of various extracts (ethanol, methanol, acetone, and water) of N. cadmea. The antioxidant activities of these extracts were analyzed using scavenging methods (DPPH, ABTS, and H 2 O 2 scavenging activity), the β-carotene/linoleic acid test system, the phosphomolybdenum method, and metal chelating activity. Among the 4 different extracts of N. cadmea that were evaluated, the water extract showed the highest amount of radical scavenging (DPPH, 25.54 μg/mL and ABTS, 14.51 μg/mL) and antioxidant activities (β-carotene, 86.91%). In the metal chelating and H 2 O 2 scavenging activities, the acetone extract was statistically different from the other extracts. For the phosphomolybdenum method, the antioxidant capacity of the extracts was in the range of 8.15 to 80.40 μg/mg. The phenolic content of the ethanol extract was examined using HPLC and determined some phenolics: epicatechin, chlorogenic, and caffeic acids. With regard to the anthelmintic properties, dose-dependent activity was observed in each of the extracts of N. cadmea. All the extracts exhibited high cytotoxic activities. The results will provide additional information for further studies on the biological activities of N. cadmea, while also helping us to understand the importance of this species. Furthermore, based on the results obtained, N. cadmea may be considered as a potentially useful supplement for the human diet, as well as a natural antioxidant for medicinal applications. The plants of the Nepeta genus have been extensively used as traditional herbal medicines. Nepeta cadmea Boiss., one of the species belonging to the Nepeta genus, is a species endemic to Turkey. In our study, we demonstrated the antioxidant capacities, total phenolic, flavonoid, tannin content, anthelmintic, and cytotoxic activities of various extracts of Nepeta cadmea. The present study could well supply valuable data for future investigations and further information on the potential use of this endemic plant for humans, in both dietary and pharmacological applications. © 2018 Institute of Food Technologists®.

In vitro antioxidant potential of selected aphrodisiac medicinal plants.

PubMed

Riaz, M; Shahid, M; Jamil, A; Saqib, M

2017-01-01

The present study aimed to evaluate the antioxidant activity of six selected aphrodisiac medicinal plants. Useful parts of the selected medicinal plants were collected and extracted in methanolic solvent. The antioxidant activity of selected plant extract was determined through different antioxidant assays, namely DPPH radical scavenging assay and ferric reducing antioxidant assay. Moreover, antioxidant compounds, like total phenolics and total flavonoids contents, were also determined. Results showed that Mucuna pruriens seed extract displayed high contents of phenolic compounds with total phenolic content of 683.15±4.28 mg GAE/g dry plant material while the least phenolic content was observed in Asparagus racemosus (195.5±3.02 mg GAE/g dry plant material). Highest total flavonoids content was found in Anacyclus pyrethrum roots (156.58±4.01 μg CE/g) and the least content was found in Asparagus racemosus roots. Among the studied plant extracts, the highest radical scavenging activity was shown by Mucuna pruriens seed extract (82.05±0.55%) and the least percent scavenging activity was observed in Tribulus terrestris extract (36.40±2.01%). Vitamin C was used as positive control for antioxidant assays showing 93.54±0.9% radical scavenging activity. The plant extract also exhibited a strong reducing potential against free radicals. Therefore, the present study concluded that all the studied medicinal plants possess varying concentrations of secondary active metabolites responsible for the antioxidant properties of the tested plant extracts.

HSCCC-based strategy for preparative separation of in vivo metabolites after administration of an herbal medicine: Saussurea laniceps, a case study.

PubMed

Yi, Tao; Zhu, Lin; Zhu, Guo-Yuan; Tang, Yi-Na; Xu, Jun; Fan, Jia-Yi; Zhao, Zhong-Zhen; Chen, Hu-Biao

2016-09-13

This paper reports a novel strategy based on high-speed counter-current chromatography (HSCCC) technique to separate in vivo metabolites from refined extract of urine after administration of an herbal medicine. Saussurea laniceps (SL) was chosen as a model herbal medicine to be used to test the feasibility of our proposed strategy. This strategy succeeded in the case of separating four in vivo metabolites of SL from the urine of rats. Briefly, after oral administration of SL extract to three rats for ten days (2.0 g/kg/d), 269.1 mg of umbelliferone glucuronide (M1, purity, 92.5%), 432.5 mg of scopoletin glucuronide (M2, purity, 93.2%), 221.4 mg of scopoletin glucuronide (M3, purity, 92.9%) and 319.0 mg of scopoletin glucuronide (M4, purity, 90.4%) were separated from 420 mL of the rat urine by HSCCC using a two-phase solvent system composed of methyl tert-butyl ether-n-butanol-acetonitrile-water (MTBE-n-BuOH-ACN-H2O) at a volume ratio of 10:30:11:49. The chemical structures of the four metabolites, M1 to M4, were confirmed by MS and (1)H, (13)C NMR. As far as we know, this is the first report of the successful separation of in vivo metabolites by HSCCC after administration of an herbal medicine.

Potential feasibility of dental stem cells for regenerative therapies: stem cell transplantation and whole-tooth engineering.

PubMed

Nakahara, Taka

2011-07-01

Multipotent mesenchymal stem cells from bone marrow are expected to be a somatic stem cell source for the development of new cell-based therapy in regenerative medicine. However, dental clinicians are unlikely to carry out autologous cell/tissue collection from patients (i.e., marrow aspiration) as a routine procedure in their clinics; hence, the utilization of bone marrow stem cells seems impractical in the dental field. Dental tissues harvested from extracted human teeth are well known to contain highly proliferative and multipotent stem cell compartments and are considered to be an alternative autologous cell source in cell-based medicine. This article provides a short overview of the ongoing studies for the potential application of dental stem cells and suggests the utilization of 2 concepts in future regenerative medicine: (1) dental stem cell-based therapy for hepatic and other systemic diseases and (2) tooth replacement therapy using the bioengineered human whole tooth, called the "test-tube dental implant." Regenerative therapies will bring new insights and benefits to the fields of clinical medicine and dentistry.

ANTIOXIDANT AND ANTIFUNGAL ACTIVITY OF SELECTED MEDICINAL PLANT EXTRACTS AGAINST PHYTOPATHOGENIC FUNGI

PubMed Central

Mahlo, Salome Mamokone; Chauke, Hasani Richard; McGaw, Lyndy; Eloff, Jacobus

2016-01-01

Background: Medicinal plants are used by many ethnic groups as a source of medicine for the treatment of various ailments in both humans and domestic animals. These plants produce secondary metabolites that have antimicrobial properties, thus screening of medicinal plants provide another alternative for producing chemical fungicides that are relatively non-toxic and cost-effective. Materials and methods: Leaf extracts of selected South African plant species (Bucida buceras, Breonadia salicina, Harpephyllum caffrum, Olinia ventosa, Vangueria infausta and Xylotheca kraussiana) were investigated for activity against selected phytopathogenic fungi (Aspergillus niger, Aspergillus parasiticus, Colletotricum gloeosporioides, Penicillium janthinellum, P. expansum, Trichoderma harzianum and Fusarium oxysporum). These plant fungal pathogens causes major economic losses in fruit industry such as blue rot on nectaries and postharvest disease in citrus. Plant species were selected from 600 evaluated inter alia, against two animal fungal pathogens (Candida albicans and Cryptococcus neoformans). Antioxidant activity of the selected plant extracts were investigated using a qualitative assay (2, 2-diphenyl-1-picrylhydrazyl (DPPH)). Bioautography assay was used to determine the number of antifungal compounds in plant extracts. Results: All plant extracts were active against the selected plant phytopathogenic fungi. Moreover, Bucida buceras had the best antifungal activity against four of the fungi, with minimum inhibitory concentration (MIC) values as low as 0.02 mg/ml and 0.08 mg/ml against P. expansum, P. janthinellum, T. harzianum and F. oxysporum. The plant extracts of five plant species did not possess strong antioxidant activity. However, methanol extract of X. kraussiana was the most active radical scavenger in the DPPH assay amongst the six medicinal plants screened. No antifungal compounds were observed in some of the plant extracts with good antifungal activity as shown in the microdilution assay, indicating possible synergism between the separated metabolites. Conclusion: The results showed that acetone was the best extractant. Furthermore, our findings also confirm the traditional use of Breonadia salicina and demonstrate the potential value of developing biopesticides from plants. PMID:28852739

ANTIOXIDANT AND ANTIFUNGAL ACTIVITY OF SELECTED MEDICINAL PLANT EXTRACTS AGAINST PHYTOPATHOGENIC FUNGI.

PubMed

Mahlo, Salome Mamokone; Chauke, Hasani Richard; McGaw, Lyndy; Eloff, Jacobus

2016-01-01

Medicinal plants are used by many ethnic groups as a source of medicine for the treatment of various ailments in both humans and domestic animals. These plants produce secondary metabolites that have antimicrobial properties, thus screening of medicinal plants provide another alternative for producing chemical fungicides that are relatively non-toxic and cost-effective. Leaf extracts of selected South African plant species ( Bucida buceras, Breonadia salicina, Harpephyllum caffrum, Olinia ventosa, Vangueria infausta and Xylotheca kraussiana ) were investigated for activity against selected phytopathogenic fungi ( Aspergillus niger, Aspergillus parasiticus, Colletotricum gloeosporioides, Penicillium janthinellum, P. expansum, Trichoderma harzianum and Fusarium oxysporum ). These plant fungal pathogens causes major economic losses in fruit industry such as blue rot on nectaries and postharvest disease in citrus. Plant species were selected from 600 evaluated inter alia, against two animal fungal pathogens ( Candida albicans and Cryptococcus neoformans ). Antioxidant activity of the selected plant extracts were investigated using a qualitative assay (2, 2-diphenyl-1-picrylhydrazyl (DPPH)). Bioautography assay was used to determine the number of antifungal compounds in plant extracts. All plant extracts were active against the selected plant phytopathogenic fungi. Moreover, Bucida buceras had the best antifungal activity against four of the fungi, with minimum inhibitory concentration (MIC) values as low as 0.02 mg/ml and 0.08 mg/ml against P. expansum, P. janthinellum, T. harzianum and F. oxysporum . The plant extracts of five plant species did not possess strong antioxidant activity. However, methanol extract of X. kraussiana was the most active radical scavenger in the DPPH assay amongst the six medicinal plants screened. No antifungal compounds were observed in some of the plant extracts with good antifungal activity as shown in the microdilution assay, indicating possible synergism between the separated metabolites. The results showed that acetone was the best extractant. Furthermore, our findings also confirm the traditional use of Breonadia salicina and demonstrate the potential value of developing biopesticides from plants.

[Comparative analysis between origin of cooked traditional Chinese medicine powder and modern formula granules].

PubMed

Li, Rui; Zhai, Hua-Qiang; Tian, Wei-Lan; Hou, Ji-Ru; Jin, Shi-Yuan; Wang, Yong-Yan

2016-03-01

In this study, the origin and causes of cooked traditional Chinese medicine powder were reviewed, and a comprehensive analysis was made for the time background of modern traditional Chinese medicine formula granules and the future development trend, in order to provide reference for application and promotion of traditional Chinese medicine formula granules. By reference to ancient medical books of previous dynasties, a system review was conducted for infancy, formation, maturity and transition of cooked traditional Chinese medicine powder, and a comprehensive analysis was made for the six factors of cooked traditional Chinese medicine powder's maturity in the Song Dynasty. Efforts were made to collect domestic and foreign research literatures of modern formula granules, understand the detailed development, and conduct an objective analysis of the current clinical application of modern formula granules. According to the comparative analysis for the application characteristics of cooked traditional Chinese medicine powder and modern formula granules, ①the popularity of cooked traditional Chinese medicine powder in the Song Dynasty has six factors: soaring numbers of medical students and medical practitioners, high medical expenses due to huge army, rapid population growth, frequent epidemics and increasing diseases, and insufficient finances of central and local governments. ②On the basis of clinical application characteristics of traditional Chinese medicine formula granules, traditional Chinese medicine formula granules contain extracted and concentrated effective components, which guarantee the curative effect, meet modern people's demands for "quick, simple and convenience" traditional Chinese medicine decoctions, show a relatively high cost performance; however, formula granules are restricted by their varieties and lack unified quality control standards, and single-extract formula granules have not synergy and attenuation effects of combined traditional Chinese medicine decoctions, which also restricts its clinical application and promotion. ③Both have advantages in the process of clinical application, and shall be used based on syndromes. In conclusion, traditional Chinese medicine formula granules do not have disadvantages of "difficult, complicated, turbid and disorderly" cooked traditional Chinese medicine powder, and solve such problems as "inflexibility, expensiveness, restriction, disorder and inefficacy", which is the important basis for promoting traditional Chinese medicine formula granules. Copyright© by the Chinese Pharmaceutical Association.

An alternative medicine, Agaricus blazei, may have induced severe hepatic dysfunction in cancer patients.

PubMed

Mukai, Hirofumi; Watanabe, Toru; Ando, Masashi; Katsumata, Noriyuki

2006-12-01

We report three cases of patients with advanced cancer who showed severe hepatic damage, and two of whom died of fulminant hepatitis. All the patients were taking Agaricus blazei (Himematsutake) extract, one of the most popular complementary and alternative medicines among Japanese cancer patients. In one patient, liver functions recovered gradually after she stopped taking the Agaricus blazei, but she restarted taking it, which resulted in deterioration of the liver function again. The other patients who were admitted for severe liver damage had started taking the Agaricus blazei several days before admission. Although several other factors cannot be completely ruled out as the causes of liver damage, a strong causal relationship between the Agaricus blazei extract and liver damage was suggested and, at least, taking the Agaricus blazei extract made the clinical decision-making process much more complicated. Doctors who are aware of their patients taking the extract may accept it probably because they believe there is no harm in a complementary and alternative medicine. When unexpected liver damage is documented, however, doctors should consider the use of the Agaricus blazei extract as one of its causal factors. It is necessary to evaluate many modes of complementary and alternative medicines, including the Agaricus blazei extract, in rigorous, scientifically designed and peer-reviewed clinical trials.

Effect of medicinal plants extracts on the incidence of mosaic disease caused by cucumber mosaic virus and growth of chili

NASA Astrophysics Data System (ADS)

Hamidson, H.; Damiri, N.; Angraini, E.

2018-01-01

This research was conducted to study the effect of the application of several extracts of medicinal plants on the incidence of mosaic disease caused by Cucumber Mosaic Virus infection on the chili (Capsicum annuum L.) plantation. A Randomized Block Design with eight treatments including control was used throughout the experiment. Treatments consisted of Azadiracta indica (A), Piper bitle (B), Cymbopogon citrates (C), Curcuma domestica (D), Averroa bilimbi (E), Datura stramonium (F), Annona Muricata (G) and control (H). Each treatment consist of three replications. The parameters observed were the incidence of mosaic attack due to CMV, disease severity, plant height, wet and dry weight and production (number of fruits and the weight of total fruits) each plant. Results showed that the application of medicinal plant extracts reduced the disease severity due to CMV. Extracts of Annona muricata and Datura stramonium were most effective in suppressing disease severity caused by the virus as they significantly different from control and from a number of treatment. The plants medicinal extracts were found to have increased the plant height and total weight of the plant, fruit amount and fruit weight. Extracts of Curcuma domestica, Piper bitle and Cymbopogon citrates were the third highest in fruit amount and weight and significantly different from the control.

Antimicrobial agents from selected medicinal plants in Libya.

PubMed

Muhaisen, Hasan M H; Ab-Mous, Miftah Mailoud; Ddeeb, Fadel A; Rtemi, Aboclaid Ali; Taba, Omer M; Parveen, Mehtab

2016-03-01

To test the in vitro antimicrobial efficacy of water and methanol extracts of 23 plant species that are commonly used in Libyan folk medicine. The antimicrobial activity was determined using the well-diffusion method. Four test microorganisms were used namely, Escherichia coli, Salmonella species, Staphylococcus aureus and Bacillus subtilis. The minimum inhibitory concentration (MIC) was determined for the high biologically active crude plant extracts. Among 23 medicinal plants used in the study, only 5 methanolic extracts [Rosmarinus offcinalis L., Carduus marianium L., Lantana camara L., Rhus tripartite (ueria) Grande, and Thymus capitatus (L.) Hoffm (link)] showed the highest antimicrobial activity against Staphylococcus aureus, Bacillus subtilis and Salmonella species, while 22 methanolic and aqueous extracts showed moderate to weak antimicrobial activity on all tested organisms. However 19 of the extracts showed no activity at all against Gram-ve and Gram +ve microorganisms. MIC was found to be 1.25 mg/mL (Thymus capitatus), 3 mg/mL (Rhus tripartite), 4 mg/mL (Carduus marianium), 5 mg/mL (Rosamarinus officinalis) and 5 mg/mL (Lantana camara), respectively. The present results revealed that, crude methanolic extracts of the investigated Libyan folk medicinal plants exhibited mild to high in vitro antibacterial activities against Gram-positive and Gram-negative microorganisms.

Antibacterial activity of some African medicinal plants used traditionally against infectious diseases.

PubMed

Madureira, Ana M; Ramalhete, Cátia; Mulhovo, Silva; Duarte, Aida; Ferreira, Maria-José U

2012-04-01

Plants are known to play a crucial role in African traditional medicine for the treatment of infection diseases. To investigate the claimed antimicrobial properties of plants traditionally used in African countries, providing scientific validation for their use. Eighty-three polar and non-polar extracts from 22 medicinal plants were screened for their antibacterial activity against Gram-positive (Staphylococcus aureus and Enterococcus faecalis) and Gram-negative bacteria (Escherichia coli, Pseudomonas aeruginosa, Klebsiella pneumoniae) and Mycobacterium smegmatis using the broth microdilution method. In vitro antibacterial activity against one or more tested bacteria was shown by 83% of the extracts. The highest activity was obtained with the methanol extracts of the aerial parts of Acacia karroo Hayne (Fabaceae) and Anacardium occidentale L. (Anacardiaceae) and the roots of Bridelia cathartica G. Bertol (Euphorbiaceae), against S. aureus (minimum inhibitory concentration (MIC) = 7.5 µg/mL). The same MIC values were exhibited against E. faecalis by the methanol extract of A. occidentale, the dichloromethane and methanol extracts of B. cathartica and the ethyl acetate extract of Momordica balsamina l. (Curcubitaceae) leaves. Gram-negative bacteria were less sensitive; the growth of P. aeruginosa was significantly inhibited (MIC = 31 µg/mL) by the n-hexane and methanol extracts of Gomphocarpus fruticosus (l.) Ait. (Asclepiadaceae) fruits and by the dichloromethane extract of Trichilia emetica Vahl (Meliaceae) seeds. Most of the active extracts were rich in fenols/flavonoids. This study supports the use of most of the studied plants in traditional medicine, for the treatment of infectious diseases. Some of them are worthy of further investigation.

First report of anti-Trichomonas vaginalis activity of the medicinal plant Polygala decumbens from the Brazilian semi-arid region, Caatinga.

PubMed

Frasson, Amanda Piccoli; dos Santos, Odelta; Duarte, Mariana; da Silva Trentin, Danielle; Giordani, Raquel Brandt; da Silva, Alexandre Gomes; da Silva, Márcia Vanusa; Tasca, Tiana; Macedo, Alexandre José

2012-06-01

Trichomonosis, caused by the flagellate protozoan Trichomonas vaginalis, is the most common non-viral sexually transmitted disease worldwide. Actually, the infection treatment is based on 5-nitroimidazole drugs. However, an emergent number of resistant isolates makes important the search for new therapeutic arsenal. In this sense, the investigation of plants and their metabolites is an interesting approach. In the present study, the anti-T. vaginalis activity of 44 aqueous extracts from 23 Caatinga plants used in folk medicine was evaluated. After screening 44 aqueous extracts from 23 distinct plants against two isolates from ATCC and four fresh clinical isolates, only the Polygala decumbens root extract was effective in reducing significantly the trophozoite viability. The MIC value against all isolates tested, including the metronidazole resistant, was 1.56 mg/mL. The kinetic growth assays showed that the extract was able to completely abolish the parasite density in the first hours of incubation, confirmed by microscopy. In summary, this study describes the first report on the activity of P. decumbens from Caatinga against T. vaginalis, being directly related to the popular knowledge and use.

Extracts from the Mongolian traditional medicinal plants Dianthus versicolorFisch. and Lilium pumilum Delile stimulate bile flow in an isolated perfused rat liver model.

PubMed

Obmann, Astrid; Tsendayush, Damba; Thalhammer, Theresia; Zehl, Martin; Vo, Thanh Phuong Nha; Purevsuren, Sodnomtseren; Natsagdorj, Damdinsuren; Narantuya, Samdan; Kletter, Christa; Glasl, Sabine

2010-10-05

Dianthus versicolor (Caryophyllaceae) and Lilium pumilum (Liliaceae) are two medicinal plants used in traditional Mongolian medicine to treat hepatic and gastrointestinal disorders. In this study aqueous (AE) and methanolic (ME) extracts of Dianthus versicolor and Lilium pumilum were investigated for their influence on the bile flow. The aqueous extracts of both plants were tested in absence and presence of 10 μM taurocholic acid at three different concentrations (100, 250, and 500 mg/L). The aqueous extract of Dianthus versicolor was further purified in order to locate the active principles. Two resulting fractions, one enriched in flavonoids and the other in sugars, were investigated for their influence on the bile flow in absence of taurocholic acid at 10, 20, and 40 mg/L. The aqueous extracts of both plants were analysed qualitatively by LC-MS(n) and quantitatively by UV-spectrophotometry. The bile flow experiments were performed in the isolated perfused rat liver. The compounds were identified by LC-DAD-MS(n) and TLC using references. The UV-spectrophotometric analysis was based on the monograph "Passiflorae herba" of the European Pharmacopoeia, and the total flavonoid contents were calculated and expressed as vitexin. AE and ME of both plants increased the bile flow dose-dependently (between 9% and 30%), and no hepatotoxic effect was seen even during longer perfusions. Stimulation of bile secretion was comparable in the presence and in the absence of taurocholic acid. The flavonoid fraction of Dianthus versicolor increased the bile flow by 18% (p<0.05) at 40 mg/L, which was comparable to the positive control cynarin. The phytochemical investigations of the Dianthus versicolor AE (total flavonoid content 1.78%) revealed the presence of the isovitexin derivative saponarin. In the AE of Lilium pumilum (total flavonoid content 1.04%) the flavonoids rutoside, kaempferol-3-O-rutinoside, and isorhamnetin-3-O-rutinoside were detected. The results show that choleresis under extract application is due to a stimulation of the bile-salt-independent bile flow which might be caused by the osmotic power of the extracts (hydrocholeresis). The flavonoids seem to contribute to the bile-flow-stimulating effect of Dianthus versicolor. Both plants exhibit a considerable choleretic effect that contributes to their use in traditional Mongolian medicine against gastrointestinal disorders. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

[Investigation on production process quality control of traditional Chinese medicine--Banlangen granule as an example].

PubMed

Tan, Manrong; Yan, Dan; Qiu, Lingling; Chen, Longhu; Yan, Yan; Jin, Cheng; Li, Hanbing; Xiao, Xiaohe

2012-04-01

For the quality management system of herbal medicines, intermediate and finished products it exists the " short board" effect of methodologies. Based on the concept of process control, new strategies and new methods of the production process quality control had been established with the consideration of the actual production of traditional Chinese medicine an the characteristics of Chinese medicine. Taking Banlangen granule as a practice example, which was effective and widespread application, character identification, determination of index components, chemical fingerprint and biometrics technology were sequentially used respectively to assess the quality of Banlangen herbal medicines, intermediate (water extraction and alcohol precipitation) and finished product. With the transfer rate of chemical information and biological potency as indicators, the effectiveness and transmission of the above different assessments and control methods had been researched. And ultimately, the process quality control methods of Banlangen granule, which were based on chemical composition analysis-biometric analysis, had been set up. It can not only validly solute the current status that there were many manufacturers varying quality of Banlangen granule, but also ensure and enhance its clinical efficacy. Furthermore it provided a foundation for the construction of the quality control of traditional Chinese medicine production process.

Validation of green-solvent extraction combined with chromatographic chemical fingerprint to evaluate quality of Stevia rebaudiana Bertoni.

PubMed

Teo, Chin Chye; Tan, Swee Ngin; Yong, Jean Wan Hong; Hew, Choy Sin; Ong, Eng Shi

2009-02-01

An approach that combined green-solvent methods of extraction with chromatographic chemical fingerprint and pattern recognition tools such as principal component analysis (PCA) was used to evaluate the quality of medicinal plants. Pressurized hot water extraction (PHWE) and microwave-assisted extraction (MAE) were used and their extraction efficiencies to extract two bioactive compounds, namely stevioside (SV) and rebaudioside A (RA), from Stevia rebaudiana Bertoni (SB) under different cultivation conditions were compared. The proposed methods showed that SV and RA could be extracted from SB using pure water under optimized conditions. The extraction efficiency of the methods was observed to be higher or comparable to heating under reflux with water. The method precision (RSD, n = 6) was found to vary from 1.91 to 2.86% for the two different methods on different days. Compared to PHWE, MAE has higher extraction efficiency with shorter extraction time. MAE was also found to extract more chemical constituents and provide distinctive chemical fingerprints for quality control purposes. Thus, a combination of MAE with chromatographic chemical fingerprints and PCA provided a simple and rapid approach for the comparison and classification of medicinal plants from different growth conditions. Hence, the current work highlighted the importance of extraction method in chemical fingerprinting for the classification of medicinal plants from different cultivation conditions with the aid of pattern recognition tools used.

Prediction of the Passive Intestinal Absorption of Medicinal Plant Extract Constituents with the Parallel Artificial Membrane Permeability Assay (PAMPA).

PubMed

Petit, Charlotte; Bujard, Alban; Skalicka-Woźniak, Krystyna; Cretton, Sylvian; Houriet, Joëlle; Christen, Philippe; Carrupt, Pierre-Alain; Wolfender, Jean-Luc

2016-03-01

At the early drug discovery stage, the high-throughput parallel artificial membrane permeability assay is one of the most frequently used in vitro models to predict transcellular passive absorption. While thousands of new chemical entities have been screened with the parallel artificial membrane permeability assay, in general, permeation properties of natural products have been scarcely evaluated. In this study, the parallel artificial membrane permeability assay through a hexadecane membrane was used to predict the passive intestinal absorption of a representative set of frequently occurring natural products. Since natural products are usually ingested for medicinal use as components of complex extracts in traditional herbal preparations or as phytopharmaceuticals, the applicability of such an assay to study the constituents directly in medicinal crude plant extracts was further investigated. Three representative crude plant extracts with different natural product compositions were chosen for this study. The first extract was composed of furanocoumarins (Angelica archangelica), the second extract included alkaloids (Waltheria indica), and the third extract contained flavonoid glycosides (Pueraria montana var. lobata). For each medicinal plant, the effective passive permeability values Pe (cm/s) of the main natural products of interest were rapidly calculated thanks to a generic ultrahigh-pressure liquid chromatography-UV detection method and because Pe calculations do not require knowing precisely the concentration of each natural product within the extracts. The original parallel artificial membrane permeability assay through a hexadecane membrane was found to keep its predictive power when applied to constituents directly in crude plant extracts provided that higher quantities of the extract were initially loaded in the assay in order to ensure suitable detection of the individual constituents of the extracts. Such an approach is thus valuable for the high-throughput, cost-effective, and early evaluation of passive intestinal absorption of active principles in medicinal plants. In phytochemical studies, obtaining effective passive permeability values of pharmacologically active natural products is important to predict if natural products showing interesting activities in vitro may have a chance to reach their target in vivo. Georg Thieme Verlag KG Stuttgart · New York.

Evaluation of antibacterial activity, phytochemical constituents, and cytotoxicity effects of Thai household ancient remedies.

PubMed

Chusri, Sasitorn; Sinvaraphan, Naruephan; Chaipak, Ploypailin; Luxsananuwong, Atita; Voravuthikunchai, Supayang Piyawan

2014-12-01

Household ancient remedies reported here are described in the National List of Essential Medicines and have traditionally been used in Thailand to treat infection-related ailments. However, the safety and effectiveness of these remedies have been poorly evaluated. The aim of this study was to evaluate the antibacterial properties of these remedies against seven gram-positive and gram-negative multidrug-resistant bacteria species. Phytochemical constituents and cytotoxicity of these remedies were also determined. Seven remedies, consisting of Um-Ma-Luk-Ka-Wa-Tee, Chan-Ta-Lee-La, Kheaw-Hom, Learng-Pid-Sa-Mud, Pra-Sa-Chan-Dang, Dhart-Ban-Chob, and Tree-Hom, were prepared by a licensed traditional medical doctor using a mixture of medicinal plants. Antibacterial activity of ethanol extracts of the remedies was determined by using a broth microdilution method. Qualitative phytochemical screening analysis was carried out to identify the presence of major components. Cytotoxicity activities of the extracts against Vero cells were assessed by green fluorescent protein-based assay. With the exception of Dhart-Ban-Chob extract, significant minimum inhibitory concentrations (MICs) of <16 to 32 μg/mL were observed for the remedy extracts depending on the bacterial strains. The Um-Ma-Luk-Ka-Wa-Tee extract was noncytotoxic against Vero cells and possessed the highest activity, with MICs of <16 to 31 μg/mL against all methicillin-resistant Staphylococcus aureus isolates. Remarkable antibacterial activities against multidrug-resistant pathogens, as well as low toxicity on Vero cells, of Um-Ma-Luk-Ka-Wa-Tee support the use of this remedy in traditional medicine. Further investigation on other biological activities related to traditional applications, appropriate biomarkers, and treatment mechanisms of the household remedy are required.

Extract of valerian root (Valeriana officinalis L.) vs. placebo in treatment of obsessive-compulsive disorder: a randomized double-blind study.

PubMed

Pakseresht, Siroos; Boostani, Hatam; Sayyah, Mehdi

2011-10-11

Obsessive-Compulsive Disorder (OCD) is a common neuropsychiatric condition. Many herbs with psychotropic effects exist which can have fewer side effects compared to more conventional medications. Valeriana Officinalis L. is a well-known medicinal plant with a long history of usage in the world with an effect on GABA. This plant is reported to be safe on humans. Our objective in this study was to compare the efficacy of the extract of Valeriana Officinalis L. with placebo in the treatment of OCD. The study was an 8-week pilot double-blind randomized trial. Thirty-one adult outpatients who met the DSM-IV-TR criteria for OCD based on the structured clinical interview participated in the trial. In this double-blind and randomized trial, patients were randomly assigned to receive either capsule of the extract (765 mg/day) or placebo (30 mg/day) for 8 weeks. The results showed significant difference between the extract and placebo in the end of treatment (P=0.000). Somnolence was the only significant difference between the two groups in terms of observed side effects (P=0.02). The results suggest that Valeriana Officinalis L. has some antiobsessive and compulsive effects. However, further studies are needed to confirm these findings. Psychiatrists often find that many patients cannot tolerate the side effects of psychiatry medicine Valeriana Officinalis L. is a well-known medicinal plant with a long history of usage in world with effect on GABA.The results showed significant difference between the extract and placebo in the treatment of OCD. There was also no significant difference between the two groups in terms of observed side effects.

Evaluation of Antibacterial Activity, Phytochemical Constituents, and Cytotoxicity Effects of Thai Household Ancient Remedies

PubMed Central

Sinvaraphan, Naruephan; Chaipak, Ploypailin; Luxsananuwong, Atita; Voravuthikunchai, Supayang Piyawan

2014-01-01

Abstract Aim: Household ancient remedies reported here are described in the National List of Essential Medicines and have traditionally been used in Thailand to treat infection-related ailments. However, the safety and effectiveness of these remedies have been poorly evaluated. The aim of this study was to evaluate the antibacterial properties of these remedies against seven gram-positive and gram-negative multidrug-resistant bacteria species. Phytochemical constituents and cytotoxicity of these remedies were also determined. Methods: Seven remedies, consisting of Um-Ma-Luk-Ka-Wa-Tee, Chan-Ta-Lee-La, Kheaw-Hom, Learng-Pid-Sa-Mud, Pra-Sa-Chan-Dang, Dhart-Ban-Chob, and Tree-Hom, were prepared by a licensed traditional medical doctor using a mixture of medicinal plants. Antibacterial activity of ethanol extracts of the remedies was determined by using a broth microdilution method. Qualitative phytochemical screening analysis was carried out to identify the presence of major components. Cytotoxicity activities of the extracts against Vero cells were assessed by green fluorescent protein–based assay. Results: With the exception of Dhart-Ban-Chob extract, significant minimum inhibitory concentrations (MICs) of <16 to 32 μg/mL were observed for the remedy extracts depending on the bacterial strains. The Um-Ma-Luk-Ka-Wa-Tee extract was noncytotoxic against Vero cells and possessed the highest activity, with MICs of <16 to 31 μg/mL against all methicillin-resistant Staphylococcus aureus isolates. Conclusions: Remarkable antibacterial activities against multidrug-resistant pathogens, as well as low toxicity on Vero cells, of Um-Ma-Luk-Ka-Wa-Tee support the use of this remedy in traditional medicine. Further investigation on other biological activities related to traditional applications, appropriate biomarkers, and treatment mechanisms of the household remedy are required. PMID:25415453

[Research on optimal modeling strategy for licorice extraction process based on near-infrared spectroscopy technology].

PubMed

Wang, Hai-Xia; Suo, Tong-Chuan; Yu, He-Shui; Li, Zheng

2016-10-01

The manufacture of traditional Chinese medicine (TCM) products is always accompanied by processing complex raw materials and real-time monitoring of the manufacturing process. In this study, we investigated different modeling strategies for the extraction process of licorice. Near-infrared spectra associate with the extraction time was used to detemine the states of the extraction processes. Three modeling approaches, i.e., principal component analysis (PCA), partial least squares regression (PLSR) and parallel factor analysis-PLSR (PARAFAC-PLSR), were adopted for the prediction of the real-time status of the process. The overall results indicated that PCA, PLSR and PARAFAC-PLSR can effectively detect the errors in the extraction procedure and predict the process trajectories, which has important significance for the monitoring and controlling of the extraction processes. Copyright© by the Chinese Pharmaceutical Association.

Cytotoxicity of plants used in traditional medicine in Yemen.

PubMed

Al-Fatimi, M; Friedrich, U; Jenett-Siems, K

2005-06-01

Twenty-five extracts obtained from 14 plant species used in the traditional medicine in Yemen have been screened for cytotoxic activity against human ECV-304 cells. Extracts of Dracaena cinnabari, Eucalyptus camaldulensis, Euclea divinorum, Euphorbia cactus, Pulicaria crispa, and Withania somnifera displayed a remarkable activity.

Lumbee traditional medicine: Neuroprotective activities of medicinal plants used to treat Parkinson's disease-related symptoms.

PubMed

de Rus Jacquet, Aurélie; Timmers, Michael; Ma, Sin Ying; Thieme, Andrew; McCabe, George P; Vest, Jay Hansford C; Lila, Mary Ann; Rochet, Jean-Christophe

2017-07-12

Parkinson's disease (PD) is a neurodegenerative disorder characterized by a loss of dopaminergic neurons in the substantia nigra pars compacta and the presence in surviving neurons of Lewy body inclusions enriched with aggregated forms of the presynaptic protein α-synuclein (aSyn). Although current therapies provide temporary symptomatic relief, they do not slow the underlying neurodegeneration in the midbrain. In this study, we analyzed contemporary herbal medicinal practices used by members of the Lumbee tribe to treat PD-related symptoms, in an effort to identify safe and effective herbal medicines to treat PD. The aims of this study were to (i) document medicinal plants used by Lumbee Indians to treat PD and PD-related symptoms, and (ii) characterize a subset of plant candidates in terms of their ability to alleviate neurotoxicity elicited by PD-related insults and their potential mechanisms of neuroprotection. Interviews of Lumbee healers and local people were carried out in Pembroke, North Carolina, and in surrounding towns. Plant samples were collected and prepared as water extracts for subsequent analysis. Extracts were characterized in terms of their ability to induce activation of the nuclear factor E2-related factor 2 (Nrf2) antioxidant response in cortical astrocytes. An extract prepared from Sambucus caerulea flowers (elderflower extract) was further examined for the ability to induce Nrf2-mediated transcription in induced pluripotent stem cell (iPSC)-derived astrocytes and primary midbrain cultures, to ameliorate mitochondrial dysfunction, and to alleviate rotenone- or aSyn-mediated neurotoxicity. The ethnopharmacological interviews resulted in the documentation of 32 medicinal plants used to treat PD-related symptoms and 40 plants used to treat other disorders. A polyphenol-rich extract prepared from elderflower activated the Nrf2-mediated antioxidant response in cortical astrocytes, iPSC-derived astrocytes, and primary midbrain cultures, apparently via the inhibition of Nrf2 degradation mediated by the ubiquitin proteasome system. Furthermore, the elderflower extract rescued mitochondrial functional deficits in a neuronal cell line and alleviated neurotoxicity elicited by rotenone and aSyn in primary midbrain cultures. These results highlight potential therapeutic benefits of botanical extracts used in traditional Lumbee medicine, and they provide insight into mechanisms by which an elderflower extract could suppress neurotoxicity elicited by environmental and genetic PD-related insults. Copyright © 2017 Elsevier Ireland Ltd. All rights reserved.

The Key Role of Mitochondrial Apoptotic Pathway in the Cytotoxic Effect of Mushroom Extracts on Cancer Cells.

PubMed

Han, Mei; Ling, Ming-Tat; Chen, Jiezhong

2015-01-01

Mushroom extracts have been extensively studied for their medicinal effects. They can stimulate immune responses and thus have been explored in cancer treatment. Recently, it has also been shown that some mushroom extracts can produce direct cytotoxic effect on cancer cells. In this review, we summarize the cytotoxic effect of mushroom extracts in cancer treatment revealed by both in vitro and in vivo studies. We also summarize the current understanding of the mechanisms associated with such an effect with an emphasis on the mitochondrial apoptotic pathway. The recent finding that mushroom extracts have direct cytotoxic effects supplements their known immune stimulating effects. Thus, novel anticancer agents based on new findings from mushroom extracts may soon be added to the present pool of anticancer drugs. Specifically, we propose that nanodelivery of the bioactive compounds of mushroom extracts to mitochondria will further increase their potential treatment efficacy.

Compositional difference in antioxidant and antibacterial activity of all parts of the Carica papaya using different solvents.

PubMed

Asghar, Nazia; Naqvi, Syed Ali Raza; Hussain, Zaib; Rasool, Nasir; Khan, Zulfiqar Ali; Shahzad, Sohail Anjum; Sherazi, Tauqir A; Janjua, Muhammad Ramzan Saeed Ashraf; Nagra, Saeed Ahmad; Zia-Ul-Haq, Muhammad; Jaafar, Hawa Ze

2016-01-01

Carica papaya is a well known medicinal plant used in the West and Asian countries to cope several diseases. Patients were advised to eat papaya fruit frequently during dengue fever epidemic in Pakistan by physicians. This study was conducted to establish Polyphenols, flavonoids and antioxidant potential profile of extracts of all major parts of the C. papaya with seven major solvents i.e. water, ethanol, methanol, n-butanol, dichloromethane, ethyl acetate, and n-hexane. TPC, TFC, antioxidant and antibacterial potential were determined using different aqueous and organic solvents in addition to the determination of trace element in leaves, pulp and peel of C. papaya. Total soluble phenolics and flavonoids were found in promising quantity (≈66 mg GAE/g) especially in case of methanol and ethanol extracts. Antioxidant activity using DPPH free radical scavenging assay indicated leaves, bark, roots and pulp extracts showed >75.0 % scavenging potential while leaves and pulp showed 84.9 and 80.9 % inhibition of peroxidation, respectively. Reducing power assay showed leaves, pulp and roots extracts active to reduce Fe(3+) to Fe(2+) ions. The antibacterial study showed pulp extract is the best to cope infectious action of bacteria. This study was conducted to test the medicinal profile of all parts of C. papaya by extracting secondary metabolites with organic and aqueous solvents. Ethanol and methanol both were found to be the best solvents of choice to extract natural products to get maximum medicinal benefits and could be used to medicinal formulation against different infectious diseases.Graphical abstractMedicinal evaluation of different parts of C. papaya.

Pharmacological Effects of Active Components of Chinese Herbal Medicine in the Treatment of Alzheimer's Disease: A Review.

PubMed

Wang, Zhi-Yong; Liu, Jian-Gang; Li, Hao; Yang, Hui-Ming

2016-01-01

Alzheimer's disease (AD), the most common neurodegenerative disorder associated with dementia, not only severely decreases the quality of life for its victims, but also brings a heavy economic burden to the family and society. Unfortunately, few chemical drugs designed for clinical applications have reached the expected preventive or therapeutic effect so far, and combined with their significant side-effects, there is therefore an urgent need for new strategies to be developed for AD treatment. Traditional Chinese Medicine has accumulated many experiences in the treatment of dementia during thousands of years of practice; modern pharmacological studies have confirmed the therapeutic effects of many active components derived from Chinese herbal medicines (CHM). Ginsenoside Rg1, extracted from Radix Ginseng, exerts a [Formula: see text]-secretase inhibitor effect so as to decrease A[Formula: see text] aggregation. It can also inhibit the apoptosis of neuron cells. Tanshinone IIA, extracted from Radix Salviae miltiorrhizae, and baicalin, extracted from Radix Scutellariae[Formula: see text] can inhibit the oxidative stress injury in neuronal cells. Icariin, extracted from Epimedium brevicornum, can decrease A[Formula: see text] levels and the hyperphosphorylation of tau protein, and can also inhibit oxidative stress and apoptosis. Huperzine A, extracted from Huperzia serrata, exerts a cholinesterase inhibitor effect. Evodiamine, extracted from Fructus Evodiae, and curcumin, extracted from Rhizoma Curcumae Longae, exert anti-inflammatory actions. Curcumin can act on A[Formula: see text] and tau too. Due to the advantages of multi-target effects and fewer side effects, Chinese medicine is more appropriate for long-term use. In this present review, the pharmacological effects of commonly used active components derived from Chinese herbal medicines in the treatment of AD are discussed.

Antimutagenic evaluation of traditional medicinal plants from South America Peumus boldus and Cryptocarya alba using Drosophila melanogaster.

PubMed

Carmona, Erico R; Reyes-Díaz, Marjorie; Parodi, Jorge; Inostroza-Blancheteau, Claudio

2017-01-01

Peumus boldus Mol. ("Boldo") and Cryptocarya alba Mol. Looser ("Peumo") are medicinal shrubs with wide geographical distribution in South America. Their leaves and fruits are commonly used in traditional medicine because they exhibit natural medicinal properties for treatment of liver disorders and rheumatism. However, there are no apparent data regarding potential protective effects on cellular genetic components. In order to examine potential mutagenic and/or antimutagenic effects of these medicinal plants, the Drosophila melanogaster (D. melanogaster) wing-spot test was employed. This assay detects a wide range of mutational events, including point mutations, deletions, certain types of chromosomal aberrations (nondisjunction), and mitotic recombination. Qualitative and quantitative analyses of phenolic and anthocyanin compounds were carried out using biochemical and high-performance liquid chromatography methodologies. In addition, the antioxidant capacity of P. boldus and C. alba leaf extracts was also analyzed. P. boldus and C. alba extracts did not induce significant mutagenic effects in the D. melanogaster model. However, simultaneous treatment of extracts concurrently with the mutagen ethyl methane sulphonate showed a decrease of mutant spots in somatic cells of D. melanogaster, indicating desmutagenic effects in this in vivo model. Flavonoids and anthocyanins were detected predominantly in the extracts, and these compounds exerted significant antioxidant capacity. The observed antimutagenic effects may be related to the presence of phytochemicals with high antioxidant capacity, such as flavonoids and antohocyanins, in the extracts.

Identification of the protective effects of traditional medicinal plants against SDS-induced Drosophila gut damage.

PubMed

Zhou, Yang; Liu, Zonglin; Chen, Yuchen; Jin, Li Hua

2016-10-01

Traditional medicinal plants are widely used as immunomodulatory medicines that help improve health. A total of 50 different plants used for the treatment of toxicity were screened for their in vivo protective effects. Flies were fed a standard cornmeal-yeast medium (control group) or the standard medium containing medicinal plant extracts (experimental groups). Assessment of the survival rate was performed by feeding flies with toxic compounds. Gut epithelial cells were analyzed for cell proliferation and death by green fluorescent protein antibodies and 7-aminoactinomycin D staining under the microscope. The expression of antimicrobial peptides (AMPs) was evaluated by the quantitative polymerase chain reaction and the results revealed that after feeding the flies with toxic compounds, aqueous extracts from Codonopsis pilosula (Franch.) Nannf ( C. pilosula ), Saussurea lappa (Decne.) C.B.Clarke ( S. lappa ), Imperata cylindrica Beauv.var. major (Nees) C.E. Hubb. ( I. cylindrical var. major ) and Melia toosendan Sied. Et Zucc. ( M.toosendan ) increased the fly survival rate, reduced epithelial cell death and improved gut morphology. In addition, C. pilosula extracts induced the antimicrobial peptide levels (Dpt and Mtk) following treatment with sodium dodecyl sulfate (SDS). However, these extracts were not observed to increase SDS-induced cell proliferation in vivo . These results indicate that there are strong protective effects in extracts of C. pilosula , S. lappa , I. cylindrical var. major and M. toosendan on Drosophila intestinal cells among 50 medicinal plants.

Anti-inflammatory activity of Elaeagnus angustifolia fruit extract on rat paw edema.

PubMed

Motevalian, Manijeh; Shiri, Mehdi; Shiri, Saeedeh; Shiri, Zahra; Shiri, Hadi

2017-07-26

The Elaeagnus angustifolia fruit has been traditionally used in Iranian herbal medicine to treat diarrhea and rheumatoid arthritis. In the present study, the effects of E. angustifolia fruit extract on the acute and chronic phases of formalin-induced rat paw edema were examined. The acute and chronic anti-inflammatory effects of E. angustifolia fruit extract were investigated through the subcutaneous injection of 100 μL of formalin (2.5%) into a rat's hind paw. Thirty minutes before the procedure, the experimental groups were treated intraperitoneally with hydroalcoholic fruit extracts of E. angustifolia (concentrations of 100, 300, 700, and 1000 mg/kg); sodium salicylate (SS, 400 mg/kg) and distilled water were used as positive and negative control groups, respectively. Treatment with SS and the fruit extracts were performed daily for 8 days, and the degree of edema was measured by using mercury plethysmometer and digital caliper. In the acute anti-inflammatory study, the extract showed a significant anti-inflammatory effect in a dose-dependent manner. The results of 1000 mg/kg of the extract was significantly different compared with the negative control group (p<0.05) and was comparable to sodium salicylate (p<0.05). Results from the chronic study suggested that E. angustifolia extract significantly reduced paw edema and inflammation in a dose-dependent manner. The results also showed that the measurement by digital caliper and mercury plethysmometer were both reliable and might be applied interchangeably (p<0.01). Phytochemical tests indicated that the hydroalcoholic fruit extract of E. angustifolia was positive for cardiac glycosides, flavonoids, terpenoids, and saponins. Based on our findings, the E. angustifolia fruit extract probably has acute and chronic anti-inflammatory activities to support its applications in folk medicine.

Antiviral evaluation of plants from Brazilian Atlantic Tropical Forest.

PubMed

Andrighetti-Fröhner, C R; Sincero, T C M; da Silva, A C; Savi, L A; Gaido, C M; Bettega, J M R; Mancini, M; de Almeida, M T R; Barbosa, R A; Farias, M R; Barardi, C R M; Simões, C M O

2005-06-01

The antiviral activity of six medicinal plants from Brazilian Atlantic Tropical Forest was investigated against two viruses: herpes simplex virus type 1 (HSV-1) and poliovirus type 2 (PV-2). Cuphea carthagenensis and Tillandsia usneoides extracts showed the best antiherpes activity. T. usneoides dichloromethane, ethyl acetate and n-butanol extracts, and Lippia alba n-butanol extract showed inhibition of HSV-1, strain 29R/acyclovir resistant. In addition, only L. alba ethyl acetate extract showed antipoliovirus activity. These results corroborate that medicinal plants can be a rich source of potential antiviral compounds.

Jatropha gossypiifolia L. (Euphorbiaceae): A Review of Traditional Uses, Phytochemistry, Pharmacology, and Toxicology of This Medicinal Plant

PubMed Central

Félix-Silva, Juliana; Giordani, Raquel Brandt; da Silva-Jr, Arnóbio Antonio; Zucolotto, Silvana Maria; Fernandes-Pedrosa, Matheus de Freitas

2014-01-01

Jatropha gossypiifolia L. (Euphorbiaceae), widely known as “bellyache bush,” is a medicinal plant largely used throughout Africa and America. Several human and veterinary uses in traditional medicine are described for different parts and preparations based on this plant. However, critical reviews discussing emphatically its medicinal value are missing. This review aims to provide an up-to-date overview of the traditional uses, as well as the phytochemistry, pharmacology, and toxicity data of J. gossypiifolia species, in view of discussing its medicinal value and potential application in complementary and alternative medicine. Pharmacological studies have demonstrated significant action of different extracts and/or isolated compounds as antimicrobial, anti-inflammatory, antidiarrheal, antihypertensive, and anticancer agents, among others, supporting some of its popular uses. No clinical trial has been detected to date. Further studies are necessary to assay important folk uses, as well as to find new bioactive molecules with pharmacological relevance based on the popular claims. Toxicological studies associated with phytochemical analysis are important to understand the eventual toxic effects that could reduce its medicinal value. The present review provides insights for future research aiming for both ethnopharmacological validation of its popular use and its exploration as a new source of herbal drugs and/or bioactive natural products. PMID:25002902

Evidence-based innovative therapeutic medicine of Cretan plants: some encouraging specific functions and claims.

PubMed

Lionis, Christos

2015-01-01

The Island of Crete was the place where the use of herbal medicine has its roots since the Bronze Age period. Although, the consumption of aromatic plants as component in curing common diseases is still on population's practices, a new interest was appeared on the basis of studies with a focus on illness behavior as a mutual collaboration between the University of Crete and the University of Leiden, The Netherlands. The antioxidant activity of certain Cretan plants has been documented and it has been shown and reported that herbal extracts are possible to decrease lipid per oxidation in cultured lung cells exposed to iron or ozon. The biological effects and bioactivity of essential oils as well as their antibacterial properties have been previously discussed in the literature. However, it was the first attempt in Europe when a double blind randomized controlled trial examined the effectiveness of an essential-oil extract of three Cretan aromatic plants (Origanum Dictamnus, Coridothymus Capitatus, Salvia Friticosa) designed and implemented in rural Crete on patients with upper respiratory tract infection. Descriptive differences were recently reported in favorable direction especially in the virus-positive population, while these results guide at the moment a series of actions for further research and discussion on the potentialities in the therapeutic medicine. An over-the-counter drug under the name of "Cretan Iama" and as soft-gel capsules has recently circulated in Greece by the Olvos Science SA. A recent joint attempt (Clinic of Social and Family Medicine and Department of Experimental Endocrinology at the School of Medicine, University of Crete) under the support of the National Strategic Reference Framework Program focused on the effectiveness of functional extract of Mentha Spicata encapsulated in yogurt with honey on lipids profile of health patients in rural Crete. The first reported results of a cross-over study which was designed and implemented recently were in a favorite direction and it was in agreement with the animal based study that was carried out in the frame of this project. In conclusion, the two first studies on the Cretan medicinal and aromatic plants support the potentialities of the use of Ethno botanical methodology to move the needle of innovation on viral infections and lipids metabolism.

Introducing Urtica dioica, A Native Plant of Khuzestan, As an Antibacterial Medicinal Plant

PubMed Central

Motamedi, Hossein; Seyyednejad, Seyyed Mansour; Bakhtiari, Ameneh; Vafaei, Mozhan

2014-01-01

Background: Urtica dioica is a flowering plant with long history of use in folk medicine and as a food source. Objectives: This study examined in vitro antibacterial potential of alcoholic extracts of U. dioica. Materials and Methods: Hydroalcoholic extracts from aerial parts were prepared using aqueous solution of ethanol and methanol and their inhibitory effects against clinical isolates was examined by disc diffusion method at different doses. Minimum inhibitory concentrations (MIC) and minimum bactericidal concentration (MBC) indexes were also investigated. The scanning electron microscopy (SEM) analysis was also performed to find structural changes of affected bacteria consequent to exposing with extracts. Results: Both extracts were active against Bacillus cereus, Staphylococcus aureus, Staphylococcus epidermidis, and Escherichia coli with respectively 16, 10, 18, and 14 mm (methanolic) and 11, 9, 17, and 16 mm (ethanolic) inhibition zone. The MIC of ethanolic extract against S. epidermidis and E. coli was respectively 10 and 40 mg/mL. The MIC of methanolic extract against S. aureus and S. epidermidis was 40 and 10 mg/mL, respectively. The MBC was found only for S. epidermidis (20 mg/mL). In SEM analysis the round shape of S. epidermidis was changed and irregular shapes were appeared, which suggest that the main target of these extracts was cell wall. Conclusions: Extracts of U. dioica showed significant antibacterial effect against some clinically important pathogenic bacteria. Based on the obtained results it can be concluded that U. dioica is useful as antibacterial and bactericidal agent in treating infectious diseases. PMID:25625045

Screening and analysis of aconitum alkaloids and their metabolites in rat urine after oral administration of aconite roots extract using LC-TOFMS-based metabolomics.

PubMed

Tan, Guangguo; Lou, Ziyang; Jing, Jing; Li, Wuhong; Zhu, Zhenyu; Zhao, Liang; Zhang, Guoqing; Chai, Yifeng

2011-12-01

Aconite roots are popularly used in herbal medicines in China. Many cases of accidental and intentional intoxication with this plant have been reported; some of these are fatal because the toxicity of aconitum is very high. It is thus important to detect and identify aconitum alkaloids in biofluids. In this work, an improved method employing LC-TOFMS with multivariate data analysis was developed for screening and analysis of major aconitum alkaloids and their metabolites in rat urine following oral administration of aconite roots extract. Thirty-four signals highlighted by multivariate statistical analyses including 24 parent components and 10 metabolites were screened out and further identified by adjustment of the fragmentor voltage to produce structure-relevant fragment ions. It is helpful for studying aconite roots in toxicology, pharmacology and forensic medicine. This work also confirmed that the metabolomic approach provides effective tools for screening multiple absorbed and metabolic components of Chinese herbal medicines in vivo. Copyright © 2011 John Wiley & Sons, Ltd.

[Quality appraisal of systematic reviews or meta-analysis on traditional Chinese medicine published in Chinese journals].

PubMed

Liu, Jian-ping; Xia, Yun

2007-04-01

To critically assess the quality of literature about systematic review or meta-analysis on traditional Chinese medicine (TCM) published in Chinese journals. Electronic searches in CNKI, VIP and Wanfang data-base were conducted to retrieve the systematic reviews or meta-analysis reports on TCM, including herbal medicine, needling, acupuncture and moxibustion, as well as integrative medicine, they were identified and extracted according to the 18 items of QUOROM (quality of reporting of meta-analyses) Statement and relative information. The appraisal was made taking the indexes mainly including objectives, source of data, methods of data extraction, quality assessment of the included studies, measurement data synthesis, etc. Eighty-two systematic reviews were identified, except 6 reviews were excluded for repeatedly published or didn't comply with the enrolled criterion, 76 reviews concerning 51 kinds of diseases were enrolled for appraisal. Among them, 70 reviews evaluated the efficacy of TCM, mainly on Chinese herbs and 9 on acupuncture and moxibustion. In majority of the reviews, randomised controlled trials were included and the data resources were described, but in 26 reviews only the Chinese databases were searched and the description about data extraction and analysis method were too simple; and 70% of reviews assessed the quality of the included studies; none used flow chart to express the process of selection, inclusion and exclusion of studies. Few reviews or Meta-analysis reports reached the international standard and there is insufficient description of methodology for conducting systematic reviews, so it is hardly to be repeated. The authors suggested that advanced methodological training is necessary for reviewers.

Antibacterial activity of selected medicinal plants against multiple antibiotic resistant uropathogens: a study from Kolli Hills, Tamil Nadu, India.

PubMed

Narayanan, A S; Raja, S S S; Ponmurugan, K; Kandekar, S C; Natarajaseenivasan, K; Maripandi, A; Mandeel, Q A

2011-09-01

The increasing incidence of antibiotic resistance among bacterial pathogens necessitates medicinal plants as an alternate therapy in restricting the resistant infectious organisms. In this primitive study, the antibiotic resistance of organisms isolated from urinary tract infected patients was evaluated using the National Committee for Clinical Laboratory Standards (NCCLS) method and Multiple Antibiotic Resistance (MAR) index values, and the MAR values was also calculated for plant extracts. The 10 common medicinal plants collected from Kolli hills, Namakkal, south India were extracted using the chloroform, methanol, acetone, ethanol and saponification procedure. The efficacy of the extracts on the uropathogens was tested by agar disc diffusion method in order to analyse the inhibitory activity of plant extract on the organisms. Azadiracta indica A. Juss., Tinospora cordifolia (Wild.) and Euphorbia hirta Linn. exhibited high inhibitory activity against most of the 11 tested organisms followed by Cassia javanica Linn. and Phyllanthus niruri Linn. The maximum zone size of 46.3 mm was exhibited by methanol extract of P. niruri Linn. against Pseudomonas aeruginosa. Asparagus racemosus Willd. and Eupatorium triplinerve Vahl had the least activity against resistant pathogens. Saponified lipids of most of the plants exhibited maximum antibacterial activity. Among the tested organisms, P. aeruginosa and Staphylococcus epidermidis were the most susceptible and Serratia marcescens, Enterobacter cloaceae, Citrobacter koseri, and Citrobacter freundii were the least inhibited by most of the extracts of medicinal plants. It is concluded that revised antibiotic policies and more importantly the development of herbal medicine as an alternative may be incorporated in urological practice.

Antibacterial activity in spices and local medicinal plants against clinical isolates of Karachi, Pakistan.

PubMed

Ali, Nafisa Hassan; Faizi, Shaheen; Kazmi, Shahana Urooj

2011-08-01

Development of resistance in human pathogens against conventional antibiotic necessitates searching indigenous medicinal plants having antibacterial property. Twenty-seven medicinal plants used actively in folklore, ayurvedic and traditional system of medicine were selected for the evaluation of their antimicrobial activity for this study. Eleven plants chosen from these 27 are used as spices in local cuisine. Evaluation of the effectiveness of some medicinal plant extracts against clinical isolates. Nonedible plant parts were extracted with methanol and evaporated in vacuo to obtain residue. Powdered edible parts were boiled three times and cooled in sterile distilled water for 2 min each and filtrate collected. The minimum inhibitory concentration (MIC) of plant extracts and filtrates/antibiotics was evaluated against clinical isolates by microbroth dilution method. Water extract of Syzygium aromaticum L. (Myrtaceae) buds, methanol extracts of Ficus carica L. (Moraceae) and Olea europaea L. (Oleaceae) leaves and Peganum harmala L. (Nitrariaceae) seeds had MIC ranges of 31.25-250 µg/ml. S. aromaticum inhibited growth of Staphylococcus aureus, Staphylococcus epidermidis, Streptococcus pyogenes, Salmonella enterica serovar Typhi and Pseudomonas aeruginosa. F. carica and O. europaea inhibited growth of S. aureus, S. epidermidis, and S. pyogenes whereas P. harmala was effective against S. aureus, Acinetobacter calcoaceticus and Candida albicans. Ampicillin, velosef, sulfamethoxazole, tetracycline and ceftazidime, cefotaxime, cefepime, which are used as control, had MIC ≥ 50 and 1.5 µg/ml, respectively, for organisms sensitive to extracts. Mono/multiextract from identified plants will provide an array of safe antimicrobial agents to control infections by drug-resistant bacteria.

[Evaluation for extraction process of Shenqi Tongmai Yizhi particles based on antioxidant capacity in vitro and its spectrum-effect relation].

PubMed

Zhang, Xiao-Li; Liu, Yu-Ling; Fan, Li-Jiao; Wang, Yue-Liang; Chen, Kai; Li, Hui

2016-05-01

Based on DPPH method, the antioxidant activities of Shenqi Tongmai Yizhi particles with different extraction processes were compared. The contribution to the anti-oxidant capacity in vitro was explored by means of grey relational analysis on different chemical compositions in the fingerprint. The results showed that the IC₅₀ concentration values of water extract, water extract from alcohol precipitation, alcohol extract, and alcohol and water extract were 0.801 4, 0.859 1, 0.796 1, 0.918 0 g•L⁻¹; and the alcohol extract is the best method to extract antioxidative components, with the highest antioxidant activity and lowest IC₅₀. When the mass concentration of the herbs reached a certain degree, its free radical clearance rate was similar to that of vitamin C control group. The order of different chemical contributions of constituents to the antioxidant activity in the fingerprint was 4>3>33>53>9>10>11>34>15>59>8>61>52>20>42>18>29. The preliminary exploration for the spectrum efficiency relations provides reference for studying traditional Chinese medicine compound processing method and the pharmacodyamic material basis. Copyright© by the Chinese Pharmaceutical Association.

Exploration and practice of methods and processes of evidence-based rapid review on peer review of WHO EML application.

PubMed

Li, Youping; Yu, Jiajie; Du, Liang; Sun, Xin; Kwong, Joey S W; Wu, Bin; Hu, Zhiqiang; Lu, Jing; Xu, Ting; Zhang, Lingli

2015-11-01

After 38 years of development, the procedure of selection and evaluation of the World Health Organization Essential Medicine List (WHO EML) is increasingly scientific and formal. However, peer review for the applications of World Health Organization Essential Medicine List is always required in a short period. It is necessary to build up a set of methods and processes for rapid review. We identified the process of evidenced-based rapid review on WHO EML application for peer reviews according to 11 items which were required during reporting of the peer review results of the proposals. The most important items for the rapid review of World Health Organization Essential Medicine List peer reviewers are (1) to confirm the requirements and identify the purposes; (2) to establish the research questions and translate the questions into the 'Participants, Interventions, Comparators, Outcomes, Study design' (PICOS) format; (3) to search and screen available evidence, for which high-level evidence is preferred, such as systematic reviews or meta-analyses, health technology assessment, clinical guidelines; (4) to extract data, where we extract primary information based on the purposes; (5) to synthesize data by qualitative methods, assess the quality of evidence, and compare the results; (6) to provide the answers to the applications, quality of evidences and strength of recommendations. Our study established a set of methods and processes for the rapid review of World Health Organization Essential Medicine List peer review, and our findings were used to guide the reviewers to fulfill the 19(th) World Health Organization Essential Medicine List peer review. The methods and processes were feasible and met the necessary requirements in terms of time and quality. Continuous improvement and evaluation in practice are warranted. © 2015 Chinese Cochrane Center, West China Hospital of Sichuan University and Wiley Publishing Asia Pty Ltd.

The Effects of Chinese Herbal Medicines on the Quorum Sensing-Regulated Virulence in Pseudomonas aeruginosa PAO1.

PubMed

Chong, Yee Meng; How, Kah Yan; Yin, Wai Fong; Chan, Kok Gan

2018-04-21

The quorum sensing (QS) system has been used by many opportunistic pathogenic bacteria to coordinate their virulence determinants in relation to cell-population density. As antibiotic-resistant bacteria are on the rise, interference with QS has been regarded as a novel way to control bacterial infections. As such, many plant-based natural products have been widely explored for their therapeutic roles. These natural products may contain anti-QS compounds that could block QS signals generation or transmission to combat QS pathogens. In this study, we report the anti-QS activities of four different Chinese herbal plant extracts: Poria cum Radix pini , Angelica dahurica , Rhizoma cibotii and Schizonepeta tenuifolia , on Pseudomonas aeruginosa PAO1. All the plants extracted using hexane, chloroform and methanol were tested and found to impair swarming motility and pyocyanin production in P. aeruginosa PAO1, particularly by Poria cum Radix pini . In addition, all the plant extracts also inhibited violacein production in C. violaceum CV026 up to 50% while bioluminescence activities were reduced in lux -based E. coli biosensors, pSB401 and pSB1075, up to about 57%. These anti-QS properties of the four medicinal plants are the first documentation that demonstrates a potential approach to attenuate pathogens’ virulence determinants.

Acute toxicity and genotoxic activity of avocado seed extract (Persea americana Mill., c.v. Hass).

PubMed

Padilla-Camberos, Eduardo; Martínez-Velázquez, Moisés; Flores-Fernández, José Miguel; Villanueva-Rodríguez, Socorro

2013-01-01

The use of vegetal extracts requires toxicological and genotoxic evaluations to establish and verify safety before being added to human cosmetic, pharmaceutical medicine, or alimentary products. Persea americana seeds have been used in traditional medicine as treatment for several diseases. In this work, the ethanolic seed extract of Persea americana was evaluated with respect to its genotoxic potential through micronucleus assay in rodents. The frequency of micronuclei in groups of animals treated with avocado seed extract showed no differences compared to the negative control (vehicle); therefore, it is considered that the avocado seed extract showed no genotoxic activity in the micronucleus test.

Acute Toxicity and Genotoxic Activity of Avocado Seed Extract (Persea americana Mill., c.v. Hass)

PubMed Central

Padilla-Camberos, Eduardo; Martínez-Velázquez, Moisés; Flores-Fernández, José Miguel; Villanueva-Rodríguez, Socorro

2013-01-01

The use of vegetal extracts requires toxicological and genotoxic evaluations to establish and verify safety before being added to human cosmetic, pharmaceutical medicine, or alimentary products. Persea americana seeds have been used in traditional medicine as treatment for several diseases. In this work, the ethanolic seed extract of Persea americana was evaluated with respect to its genotoxic potential through micronucleus assay in rodents. The frequency of micronuclei in groups of animals treated with avocado seed extract showed no differences compared to the negative control (vehicle); therefore, it is considered that the avocado seed extract showed no genotoxic activity in the micronucleus test. PMID:24298206

[Ibogaine--the substance for treatment of toxicomania. Neurochemical and pharmacological action].

PubMed

Kazlauskas, Saulius; Kontrimaviciūte, Violeta; Sveikata, Audrius

2004-01-01

The review of scientific literature, concerning the indol alkaloid Ibogaine, which is extracted from the bush Tabernanthe Iboga, is presented in this article. Used as a stimulating factor for hundred of years in non-traditional medicine, this alkaloid could be important for modern pharmacology because of potential anti-addictive properties. The mechanism of action of this alkaloid is closely related to different neurotransmitting systems. Studies with animals allow concluding that Ibogaine or medicines based on this alkaloid can be used for treatment of drug dependencies.

Evaluation of traditional Chinese medicinal plants for anti-MRSA activity with reference to the treatment record of infectious diseases.

PubMed

Zuo, Guo-Ying; Zhang, Xin-Juan; Yang, Cui-Xian; Han, Jun; Wang, Gen-Chun; Bian, Zhong-Qi

2012-03-09

The in vitro antimicrobial activities of 30 Chinese medicinal plants were evaluated with reference to the treatment record of infectious diseases in the Traditional Chinese Medicine (TCM) literature. The plant materials were extracted with 80% ethanol and the extracts were primarily screened against conventional clinical pathogens like Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa and Candida albicans by the agar diffusion method. Their inhibition zone diameters (IZDs, mm, 50 mg/mL) ranged from 2,048 by the standard broth microdilution method. The seven extracts from M. yunnanensis, S. sinensis, G. morella, E. daneillii, M. squamulata, S. arborescens and B. hancei were determined as the most active extracts, with MICs of 8-64 μg/mL. The results were in good agreement with their traditional applications in skin and other infections.

Anti-plasmodial activity of Norcaesalpin D and extracts of four medicinal plants used traditionally for treatment of malaria.

PubMed

Nondo, Ramadhani Selemani Omari; Moshi, Mainen Julius; Erasto, Paul; Masimba, Pax Jessey; Machumi, Francis; Kidukuli, Abdul Waziri; Heydenreich, Matthias; Zofou, Denis

2017-03-24

Malaria is an old life-threatening parasitic disease that is still affecting many people, mainly children living in sub-Saharan Africa. Availability of effective antimalarial drugs played a significant role in the treatment and control of malaria. However, recent information on the emergence of P. falciparum parasites resistant to one of the artemisinin-based combination therapies suggests the need for discovery of new drug molecules. Therefore, this study aimed to evaluate the antiplasmodial activity of extracts, fractions and isolated compound from medicinal plants traditionally used in the treatment of malaria in Tanzania. Dry powdered plant materials were extracted by cold macerations using different solvents. Norcaesalpin D was isolated by column chromatography from dichloromethane root extract of Caesalpinia bonducella and its structure was assigned based on the spectral data. Crude extracts, fractions and isolated compound were evaluated for antiplasmodial activity against chloroquine-sensitive P. falciparum (3D7), chloroquine-resistant P. falciparum (Dd2, K1) and artemisinin-resistant P. falciparum (IPC 5202 Battambang, IPC 4912 Mondolkiri) strains using the parasite lactate dehydrogenase assay. The results indicated that extracts of Erythrina schliebenii, Holarrhena pubescens, Dissotis melleri and C. bonducella exhibited antiplasmodial activity against Dd2 parasites. Ethanolic root extract of E. schliebenii had an IC 50 of 1.87 μg/mL while methanolic and ethanolic root extracts of H. pubescens exhibited an IC 50  = 2.05 μg/mL and IC 50  = 2.43 μg/mL, respectively. Fractions from H. pubescens and C. bonducella roots were found to be highly active against K1, Dd2 and artemisinin-resistant parasites. Norcaesalpin D from C. bonducella root extract was active with IC 50 of 0.98, 1.85 and 2.13 μg/mL against 3D7, Dd2 and IPC 4912-Mondolkiri parasites, respectively. Antiplasmodial activity of norcaesalpin D and extracts of E. schliebenii, H. pubescens, D. melleri and C. bonducella reported in this study requires further attention for the discovery of antimalarial lead compounds for future drug development.

Ethnomedicinal survey and in vitro anti-plasmodial activity of the palm Borassus aethiopum Mart.

PubMed

Gruca, Marta; Yu, Wanwan; Amoateng, Patrick; Nielsen, Morten Agertoug; Poulsen, Thomas B; Balslev, Henrik

2015-12-04

Malaria remains a major global health threat, with the heaviest burden of disease in sub-Saharan Africa. Effective treatment is not available in many affected areas, and the Plasmodium falciparum parasite is becoming resistant to existing drugs. Alternative therapies are necessary to overcome these challenges. Borassus aethiopum is the third most used palm species in traditional medicines in Africa. Yet, there is only limited information substantiating medicinal properties of the palm. The objective of this study was to document medicinal uses of B. aethiopum and investigate anti-plasmodial activity of the palm extracts used in traditional medicine to treat malaria. The fieldwork and collection of samples was done in Ghana in the Greater Accra, Brong Ahafo, and Volta regions. Our ethnomedicinal survey did not specifically focus on medicinal uses against malaria; any medicinal application of B. aethiopum was of interest. Data collection employed a structured questionnaire, open-ended questions, and group discussion. The experimental extraction of samples was carried out using three common solvents: distilled water, absolute ethanol, and dichloromethane (CH2Cl2). Anti-plasmodial activity of compounds was determined against erythrocytic stages of the FCR3 strain of P. falciparum by a [3H]-hypoxanthine incorporation assay. A total of 37 use records were documented regarding the medicinal uses of B. aethiopum for the management of 24 different disorders. The highest medicinal use value was recorded for the use of B. aethiopum against malaria, and a subsequent laboratory investigation focused on evaluating anti-plasmodial activity of the palm. Several root and leaf extracts displayed anti-plasmodial activity, with the highest (78% at 50 μg/mL) elicited by one of the dichloromethane root extracts. Our results demonstrate the value of integrating ethnobotanical and pharmacological research in the study of beneficial effects of palm products on human health. While the high inhibitory activity found in dichloromethane extracts cannot validate the ethnomedicinal use, the anti-plasmodial effect observed cannot be nullified. We brought preliminary evidence that this palm is a promising source of alternative medicines that could contribute to improving health conditions in malaria endemic areas of sub-Saharan Africa. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

A water-based topical Chinese traditional medicine (Zicao) for wound healing developed using 2-hydroxypropyl-β-cyclodextrin.

PubMed

Chen Chen, Ta; Yu, Song-Cu; Hsu, Chin-Mu; Tsai, Fuu-Jen; Tsai, Yuhsin

2018-05-01

Zicao is a traditional Chinese herbal medicine that has been used for the topical treatment of wounds in the form of oil-based ointment for several hundred years. To overcome the disadvantages of oil-based ointment such as irritation, discomfort, and difficulty in cleaning, this study developed a water-based topical formulation of Zicao. An ethanol extract of Zicao was included in 2-hydroxypropyl-β-cyclodextrin (HP-β-CD) to form a water-soluble Zicao-HP-β-CD complex. The formation of the Zicao-HP-β-CD complex was determined using LC-MS, 1 H NMR, ROSEY, and solubility analysis. The bioactivity of Zicao-HP-β-CD complex in aqueous solution was evaluated using cellular uptake in vitro and experimental excision wounds in vivo. The LC-MS, 1 H NMR, ROESY, and solubility analyses results show that Zicao extract was successfully included by the HP-β-CD. The results of the cellular uptake in vitro and wound healing in vivo suggest that the effect of Zicao was enhanced following the formation of the Zicao-HP-β-CD complex. Therefore, we concluded that complexation with HP-β-CD might provide a potential method for developing an effective water-based topical solution of Zicao. Copyright © 2018 Elsevier B.V. All rights reserved.

Beneficial Effects of Trillium govanianum Rhizomes in Pain and Inflammation.

PubMed

Ur Rahman, Shafiq; Adhikari, Achyut; Ismail, Muhammad; Raza Shah, Muhammad; Khurram, Muhammad; Shahid, Muhammad; Ali, Farman; Haseeb, Abdul; Akbar, Fazal; Iriti, Marcello

2016-08-20

Trillium govanianum rhizome is used as an analgesic and anti-inflammatory remedy in traditional medicine in northern Pakistan. In an attempt to establish its medicinal value, the present research evaluated the analgesic and anti-inflammatory potential of T. govanianum. The in vivo anti-inflammatory activity of extract and fractions was investigated in the carrageenan induced paw edema assay. The in vitro suppression of oxidative burst of extract, fractions and isolated compounds was assessed through luminol-enhanced chemiluminescence assay. The in vivo analgesic activity was assayed in chemical and thermal induced nociceptive pain models. The crude methanol extract and its solvent fractions showed anti-inflammatory and analgesic responses, exhibited by significant amelioration of paw edema and relieve of the tonic visceral chemical and acute phasic thermal nociception. In the oxidative burst assay, based on IC50, the crude methanol extract and n-butanol soluble fraction produced a significant inhibition, followed by chloroform and hexane soluble fractions as compared to ibuprofen. Similarly, the isolated compounds pennogenin and borassoside E exhibited significant level of oxidative burst suppressive activity. The in vivo anti-inflammatory and analgesic activities as well as the in vitro inhibition of oxidative burst validated the traditional use of T. govanianum rhizomes as a phytotherapeutic remedy for both inflammatory conditions and pain. The observed activities might be attributed to the presence of steroids and steroid-based compounds. Therefore, the rhizomes of this plant species could serve as potential novel source of compounds effective for alleviating pain and inflammation.

A Metabolomic Approach Applied to a Liquid Chromatography Coupled to High-Resolution Tandem Mass Spectrometry Method (HPLC-ESI-HRMS/MS): Towards the Comprehensive Evaluation of the Chemical Composition of Cannabis Medicinal Extracts.

PubMed

Citti, Cinzia; Battisti, Umberto Maria; Braghiroli, Daniela; Ciccarella, Giuseppe; Schmid, Martin; Vandelli, Maria Angela; Cannazza, Giuseppe

2018-03-01

Cannabis sativa L. is a powerful medicinal plant and its use has recently increased for the treatment of several pathologies. Nonetheless, side effects, like dizziness and hallucinations, and long-term effects concerning memory and cognition, can occur. Most alarming is the lack of a standardised procedure to extract medicinal cannabis. Indeed, each galenical preparation has an unknown chemical composition in terms of cannabinoids and other active principles that depends on the extraction procedure. This study aims to highlight the main differences in the chemical composition of Bediol® extracts when the extraction is carried out with either ethyl alcohol or olive oil for various times (0, 60, 120 and 180 min for ethyl alcohol, and 0, 60, 90 and 120 min for olive oil). Cannabis medicinal extracts (CMEs) were analysed by liquid chromatography coupled to high-resolution tandem mass spectrometry (LC-MS/MS) using an untargeted metabolomics approach. The data sets were processed by unsupervised multivariate analysis. Our results suggested that the main difference lies in the ratio of acid to decarboxylated cannabinoids, which dramatically influences the pharmacological activity of CMEs. Minor cannabinoids, alkaloids, and amino acids contributing to this difference are also discussed. The main cannabinoids were quantified in each extract applying a recently validated LC-MS and LC-UV method. Notwithstanding the use of a standardised starting plant material, great changes are caused by different extraction procedures. The metabolomics approach is a useful tool for the evaluation of the chemical composition of cannabis extracts. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

Antioxidant and anti-glycation capacities of some medicinal plants and their potential inhibitory against digestive enzymes related to type 2 diabetes mellitus.

PubMed

Franco, Rodrigo Rodrigues; da Silva Carvalho, Danúbia; de Moura, Francyelle Borges Rosa; Justino, Allisson Benatti; Silva, Heitor Cappato Guerra; Peixoto, Leonardo Gomes; Espindola, Foued Salmen

2018-04-06

Plants preparations are used by traditional medicine in the treatment of various diseases, such as type-2 diabetes mellitus. Some medicinal plants are capable of controlling the complications of this metabolic disease at different levels, for example, providing antioxidant compounds that act against oxidative stress and protein glycation and others which are capable of inhibiting the catalysis of digestive enzymes and thus contribute to the reduction of hyperglycemia and hyperlipidemia. Our objective was to investigate the antioxidant and anti-glycation activities of some medicinal plants and their potential inhibitory against α-amylase, α-glucosidase and pancreatic lipase activities. Based on the ethnobotanical researches carried out by academic studies conducted at the Federal University of Uberlandia, ten plants traditionally used in the treatment of type-2 diabetes mellitus were selected. Ethanol (EtOH) and hexane (Hex) extracts of specific parts of these plants were used in enzymatic assays to evaluate their inhibitory potential against α-amylase, α-glucosidase and lipase, as well as their antioxidant (DPPH, ORAC and FRAP) and anti-glycation (BSA/fructose model) capacities. The results indicate that EtOH extract of four of the ten analyzed plants exhibited more than 70% of antioxidant and anti-glycation capacities, and α-amylase and lipase inhibitory activities; no extract was able to inhibit more than 40% the α-glucosidase activity. The EtOH extracts of Bauhinia forficata and Syzygium. cumini inhibited α-amylase (IC 50 8.17 ± 2.24 and 401.8 ± 14.7 μg/mL, respectively), whereas EtOH extracts of B. forficata, Chamomilla recutita and Echinodorus grandiflorus inhibited lipase (IC 50 59.6 ± 10.8, 264.2 ± 87.2 and 115.8 ± 57.1 μg/mL, respectively). In addition, EtOH extracts of B. forficata, S. cumini, C. recutita and E. grandiflorus showed, respectively, higher antioxidant capacity (DPPH IC 50 0.7 ± 0.1, 2.5 ± 0.2, 1.3 ± 0.2 and 35.3 ± 9.0 μg/mL) and anti-glycation activity (IC 50 22.7 ± 4.4, 246.2 ± 81.7, 18.5 ± 2.8 and 339.0 ± 91.0 μg/mL). EtOH extracts of four of the ten species popularly cited for treatment of type 2 diabetes mellitus have shown promising antioxidant and anti-glycation properties, as well as the ability to inhibit the digestive enzymes α-amylase and lipase. Thus, our results open new possibilities for further studies in order to evaluate the antidiabetic potential of these medicinal plants. Copyright © 2017 Elsevier B.V. All rights reserved.

Nyctanthes arbor-tristis Linn--a critical ethnopharmacological review.

PubMed

Agrawal, Jyoti; Pal, Anirban

2013-04-19

Nyctanthes arbor-tristis (Oleaceae) is a mythological plant; has high medicinal values in Ayurveda. The popular medicinal use of this plant are anti-helminthic and anti-pyretic besides its use as a laxative, in rheumatism, skin ailments and as a sedative. Vitally, the natives plant it in their home gardens to pass on its medicinal usage to oncoming generations. The present review encompasses an ethnopharmacological evaluation focusing on information on the chemical constituents, pharmacological actions and toxicology in order to reveal the therapeutic potential and gaps requiring research involvement. The present review is based on searches in Scifinder(®), Pubmed (National Library of Medicine) and books published on the subject during the period 1933 to 2012. Nyctanthes arbor-tristis is most important in local and traditional medicines especially in India for treating intermittent fevers, arthritis and obstinate sciatica. Crude extracts and isolated compounds from the plant were shown to be pharmacologically active against inflammation, malaria, viral infection, leishmanisis and as an immunostimulant. The major class of biologically active compounds are the iridoid glucosides incl., Arbortristoside A, B and C from the seeds active as anticancer, anti-leishmania, anti-inflammatory, anti-allergic, immunomodulatory and antiviral. Other molecules; calceolarioside A, 4-hydroxyhexahydrobenzofuran-7one and β-sitosterol from leaves have been reported to be active as anti-leishmanial, anticancer and anti-inflammatory, respectively. The crude extracts have been found to be safe with an LD50 of 16gm/kg, while the LD50 of arbortristoside-A isolated from the seeds was found to be 0.5g/kg. Mostly in-vitro or in some cases in-vivo models provide some evidence especially in the treatment of inflammatory conditions like arthritis, fevers related to malaria and protozoan diseases especially leishmaniasis. The only clinical study found, is for treating malaria, but with crude extract only. Further, more detailed safety data pertaining to the acute and sub-acute toxicity, cardio and immunotoxicity also needs to be generated for crude extracts or pure compounds. Crown Copyright © 2013. Published by Elsevier Ireland Ltd. All rights reserved.

In vivo Antibacterial and Wound Healing Activities of Roman Chamomile (Chamaemelum nobile).

PubMed

Kazemian, Hossein; Ghafourian, Sobhan; Sadeghifard, Nourkhoda; Houshmandfar, Reza; Badakhsh, Behzad; Taji, Asieh; Shavalipour, Aref; Mohebi, Reza; Ebrahim-Saraie, Hadi Sedigh; Houri, Hamidreza; Heidari, Hamid

2018-01-01

Today considerable number of drugs are produced from plants. Several plants with antibacterial and healing applications are used in medicine such as Roman chamomile (Chamaemelum nobile L.). Wound infection is one of the most prevalent infections among infectious diseases around the world. Due to appearance of drug resistance, researchers are now paying attention to medicinal plants. Therefore, this study was designed to investigate the antimicrobial and wound healing properties of C. nobile against Pseudomonas aeruginosa using in vivo conditions. Ethanolic extract of C. nobile was provided using standard method. The 5% C. nobile ointment was prepared by dissolving lyophilized extract in eucerin. Forty five male rats were obtained from Ilam university. After anesthetization and wound creation, wounds were infected by P. aeruginosa. The rats were divided into three groups, group I was treated with C. nobile ointment, group II was treated with tetracycline ointment and the third group was treated with base gel as control group. Antibacterial and wound healing activities of C. nobile ointment were more than tetracycline ointment significantly. Our results indicated that extract of C. nobile had effective antibacterial activity and accelerated the progression of wound healing. Our study indicated that antibacterial and wound healing activities of C. nobile ointment were notable. C. nobile therapy in combination with antibiotics can also be useful because medicinal plants contents operate in synergy with antibiotics. These results revealed the value of plant extracts to control antibiotic resistant bacteria in wound infections. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Antiviral activity of some South American medicinal plants.

PubMed

Abad, M J; Bermejo, P; Sanchez Palomino, S; Chiriboga, X; Carrasco, L

1999-03-01

Folk medicinal plants are potential sources of useful therapeutic compounds including some with antiviral activities. Extracts prepared from 10 South American medicinal plants (Baccharis trinervis, Baccharis teindalensis, Eupatorium articulatum, Eupatorium glutinosum, Tagetes pusilla, Neurolaena lobata, Conyza floribunda, Phytolacca bogotensis, Phytolacca rivinoides and Heisteria acuminata) were screened for in vitro antiviral activity against herpes simplex type I (HSV-1), vesicular stomatitis virus (VSV) and poliovirus type 1. The most potent inhibition was observed with an aqueous extract of B. trinervis, which inhibited HSV-1 replication by 100% at 50-200 micrograms/mL, without showing cytotoxic effects. Good activities were also found with the ethanol extract of H. acuminata and the aqueous extract of E. articulatum, which exhibited antiviral effects against both DNA and RNA viruses (HSV-1 and VSV, respectively) at 125-250 micrograms/mL. The aqueous extracts of T. pusilla (100-250 micrograms/mL), B. teindalensis (50-125 micrograms/mL) and E. glutinosum (50-125 micrograms/mL) also inhibited the replication of VSV, but none of the extracts tested had any effect on poliovirus replication.

Biological Activities of Extracts from Loquat (Eriobotrya japonica Lindl.): A Review

PubMed Central

Liu, Yilong; Zhang, Wenna; Xu, Changjie; Li, Xian

2016-01-01

Loquat (Eriobotrya japonica Lindl.) is a subtropical fruit tree with high medicinal value native to China. Different organs of loquat have been used historically as folk medicines and this has been recorded in Chinese history for thousands of years. Research shows that loquat extracts contain many antioxidants, and different extracts exhibit bioactivity capable of counteracting inflammation, diabetes, cancer, bacterial infection, aging, pain, allergy and other health issues. Bioactive compounds such as phenolics and terpenoids have been isolated and characterized to provide a better understanding of the chemical mechanisms underlying the biological activities of loquat extracts. As the identification of compounds progresses, studies investigating the in vivo metabolism, bioavailability, and structure–activity relationships, as well as potential toxicity of loquat extracts in animal or cell models are receiving more attention. In addition, genetic studies and breeding of loquat germplasms for high contents of health-benefiting compounds may provide new insight for the loquat industry and research. This review is focused on the main medicinal properties reported and the possible pharmaceutically active compounds identified in different loquat extracts. PMID:27929430

Antibacterial activities of extracts from Ugandan medicinal plants used for oral care.

PubMed

Ocheng, Francis; Bwanga, Freddie; Joloba, Moses; Borg-Karlson, Ann-Karin; Gustafsson, Anders; Obua, Celestino

2014-08-08

Medicinal plants are widely used for treatment of oral/dental diseases in Uganda. To investigate antibacterial activities of 16 commonly used medicinal plants on microorganisms associated with periodontal diseases (PD) and dental caries (DC). Pulp juice and solvent extracts (hexane, methanol and water) from the plants were tested against Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis, Tannerella forsythia associated with PD and Streptococcus mutans, Streptococcus sobrinus, Lactobacillus acidophilus associated with DC. Tests were done using agar well-diffusion (pulp juice) and agar-dilution (Solvent extracts) assays. Pulp juice from Zanthoxylum chalybeum and Euclea latidens showed activity against all the bacteria, Zanthoxylum chalybeum being most active. Hexane extract from aerial part of Helichrysum odoratissimum was most active (MIC: 0.125-0.5 mg/ml). Methanol extract from leaves of Lantana trifolia showed activity against all bacteria (MIC: 0.25-1 mg/ml). Several of the tested plants showed antibacterial activities against bacteria associated with PD and DC, meriting further investigations. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Inhibition of human P450 enzymes by natural extracts used in traditional medicine.

PubMed

Rodeiro, Idania; Donato, María T; Jimenez, Nuria; Garrido, Gabino; Molina-Torres, Jorge; Menendez, Roberto; Castell, José V; Gómez-Lechón, María J

2009-02-01

Different medicinal plants are widely used in Cuba and Mexico to treat several disorders. This paper reports in vitro inhibitory effects on the P450 system of herbal products commonly used by people in Cuba and Mexico in traditional medicine for decades. Experiments were conducted in human liver microsomes. The catalytic activities of CYP1A1/2, 2D6, and 3A4 were measured using specific probe substrates. The Heliopsis longipes extract exhibited a concentration-dependent inhibition of the three enzymes, and similar effects were produced by affinin (an alkamide isolated from the H. longipes extract) and two catalytically reduced alkamides. Mangifera indica L. and Thalassia testudinum extracts, two natural polyphenol-rich extracts, diminished CYP1A1/2 and 3A4 activities, but not the CYP2D6 activity. These results suggest that these herbs inhibit the major human P450 enzymes involved in drug metabolism and could induce potential herbal-drug interactions. Copyright (c) 2008 John Wiley & Sons, Ltd.

Guava extract (Psidium guajava) alters the labelling of blood constituents with technetium-99m.

PubMed

Abreu, P R C; Almeida, M C; Bernardo, R M; Bernardo, L C; Brito, L C; Garcia, E A C; Fonseca, A S; Bernardo-Filho, M

2006-06-01

Psidium guajava (guava) leaf is a phytotherapic used in folk medicine to treat gastrointestinal and respiratory disturbances and is used as anti-inflammatory medicine. In nuclear medicine, blood constituents (BC) are labelled with technetium-99m ((99m)Tc) and used to image procedures. However, data have demonstrated that synthetic or natural drugs could modify the labelling of BC with (99m)Tc. The aim of this work was to evaluate the effects of aqueous extract of guava leaves on the labelling of BC with (99m)Tc. Blood samples of Wistar rats were incubated with different concentrations of guava extract and labelled with (99m)Tc after the percentage of incorporated radioactivity (%ATI) in BC was determined. The results suggest that aqueous guava extract could present antioxidant action and/or alters the membrane structures involved in ion transport into cells, thus decreasing the radiolabelling of BC with (99m)Tc. The data showed significant (P<0.05) alteration of ATI in BC from blood incubated with guava extract.

In vitro antiplasmodial activity of crude extracts from Togolese medicinal plants.

PubMed

Koudouvo, Koffi; Karou, Simplice D; Ilboudo, Denise P; Kokou, Kouami; Essien, Kodjo; Aklikokou, Kodjo; de Souza, Comlan; Simpore, Jacques; Gbéassor, Mensavi

2011-02-01

To investigate the antimalarial effect of a few plants in Togo folk medicine. After ethnobotanical survey, Opilia celtidifolia, Pavetta corymbosa (P. corymbosa) and Tamarindus indica (T. indica) were selected for screening. In vitro antimalarial tests were performed on crude extracts against fresh clinical isolates of Plasmodium falciparum using the semi microtest. Different IC(50) values of the extracts ranged from 2.042 to 100.000 μg/mL. According to the results, the methanol extract of aerial part of P. corymbosa followed by aqueous extract of fruit of T. indica were the most active (IC(50) of 2.042 and 4.786 μg/mL, respectively). Qualitative test revealed the presence of alkaloids in the leaves of P. corymbosa that may be responsible for the activity of the plant. Our study provides scientific evidence for usage of plant in the folk medicine, and further studies are needed for identification and purification of the active principles. Copyright © 2011 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

Redox properties of ginger extracts: Perspectives of use of Zingiber officinale Rosc. as antidiabetic agent

PubMed Central

Cupáková, Máriá; Ťažký, Anton; Mičová, Júlia; Kolek, Emil; Košt'álová, Daniela

2013-01-01

In traditional medicine, several medicinal plants or their extracts have been used to treat diabetes. Zingiber officinale Roscoe, known commonly as ginger, is consumed worldwide in cookeries as a spice and flavouring agent. It has been used as the spice and medicine for thousands of years. The present study was undertaken to investigate the potential protective effect of Zingiber officinale Rosc. in a model of oxidative damage to pancreatic β cells. The free radical scavenging activities and composition of the isolated n-hexane and ethanolic extracts were confronted with their protective, antioxidant and cytotoxic effects in INS-1E β cells. Unlike the n-hexane extract (exerting, paradoxically, stronger antiradical capacity), both low cytotoxicity and remarkable protective effects on β cell viability, followed by lowering oxidative stress markers were found for the ethanolic extract Zingiber officinale Rosc. The present study is the first pilot study to assess the protective potential of Zingiber officinale Rosc. in a model of cytotoxic conditions imposed by diabetes in β cells. PMID:24170976

Redox properties of ginger extracts: Perspectives of use of Zingiber officinale Rosc. as antidiabetic agent.

PubMed

Račková, Lucia; Cupáková, Máriá; Tažký, Anton; Mičová, Júlia; Kolek, Emil; Košt'álová, Daniela

2013-03-01

In traditional medicine, several medicinal plants or their extracts have been used to treat diabetes. Zingiber officinale Roscoe, known commonly as ginger, is consumed worldwide in cookeries as a spice and flavouring agent. It has been used as the spice and medicine for thousands of years. The present study was undertaken to investigate the potential protective effect of Zingiber officinale Rosc. in a model of oxidative damage to pancreatic β cells. The free radical scavenging activities and composition of the isolated n-hexane and ethanolic extracts were confronted with their protective, antioxidant and cytotoxic effects in INS-1E β cells. Unlike the n-hexane extract (exerting, paradoxically, stronger antiradical capacity), both low cytotoxicity and remarkable protective effects on β cell viability, followed by lowering oxidative stress markers were found for the ethanolic extract Zingiber officinale Rosc. The present study is the first pilot study to assess the protective potential of Zingiber officinale Rosc. in a model of cytotoxic conditions imposed by diabetes in β cells.

Herbal Medicine

MedlinePlus

... used for its scent, flavor, or therapeutic properties. Herbal medicines are one type of dietary supplement. They are ... extracts, and fresh or dried plants. People use herbal medicines to try to maintain or improve their health. ...

Extracting Fitness Relationships and Oncogenic Patterns among Driver Genes in Cancer.

PubMed

Zhang, Xindong; Gao, Lin; Jia, Songwei

2017-12-25

Driver mutation provides fitness advantage to cancer cells, the accumulation of which increases the fitness of cancer cells and accelerates cancer progression. This work seeks to extract patterns accumulated by driver genes ("fitness relationships") in tumorigenesis. We introduce a network-based method for extracting the fitness relationships of driver genes by modeling the network properties of the "fitness" of cancer cells. Colon adenocarcinoma (COAD) and skin cutaneous malignant melanoma (SKCM) are employed as case studies. Consistent results derived from different background networks suggest the reliability of the identified fitness relationships. Additionally co-occurrence analysis and pathway analysis reveal the functional significance of the fitness relationships with signaling transduction. In addition, a subset of driver genes called the "fitness core" is recognized for each case. Further analyses indicate the functional importance of the fitness core in carcinogenesis, and provide potential therapeutic opportunities in medicinal intervention. Fitness relationships characterize the functional continuity among driver genes in carcinogenesis, and suggest new insights in understanding the oncogenic mechanisms of cancers, as well as providing guiding information for medicinal intervention.

In vitro functional properties of crude extracts and isolated compounds from banana pseudostem and rhizome.

PubMed

Kandasamy, Saravanan; Ramu, Sasikala; Aradhya, Somaradhya Mallikarjuna

2016-03-15

Pseudostem and rhizome are the significant bio-waste generated (43.48%) from the banana plant post fruit harvest, which are usually left in the plantation or incinerated and wasted. Amounts used in production for consumption are negligible. However, the material has an important part to play in indigenous systems of medicine. Based on the huge volume of bio-waste generated and its traditional medicinal use, it is worth exploiting it as a source of natural bioactive compounds. In the current study, sequential extracts from banana pseudostem (BPS) and rhizome (BR), and isolated compounds including chlorogenic acid, 4-epicyclomusalenone and cycloeucalenol acetate, were tested for their antimicrobial activity, antiplatelet aggregation and cytotoxicity. Isolated compounds and crude extracts exhibited strong antimicrobial activity against a wide range of bacterial and fungal strains, platelet aggregation induced by collagen and cytotoxicity towards human liver cancer (HepG2) cells. Banana plant bio-waste, pseudostem and rhizome may serve as a potential source of multifunctional bioactive compounds and functional ingredient in food and other allied industries. © 2015 Society of Chemical Industry.

Antioxidant and antibacterial activity of Thai medicinal plant (Capparis micracantha)

NASA Astrophysics Data System (ADS)

Laoprom, Nonglak; Sangprom, Araya; Chaisri, Patcharaporn

2018-04-01

This work aims to study the antioxidants capacity, Total phenolic content and antibacterial activity of Thai medicinal plant for the treatment of dermatitis-related inflammations, Capparis micracantha. Crude extract from stem of Thai medicinal plant was extracted with hexane, ethyl acetate, methanol and water. The antioxidant activities (IC50) was evaluated with 1,1-diphenyl-1-princylhydrazyl (DPPH) radical scavenging assay. Total phenolic content (TPC) was determined by using Folin-Ciocalteu method. Bacterial activities was tested with four human pathogenic bacteria; Escherichia coli, Listeria monocytogenes, Staphylococcus aureus and Stapylococcus epidermidis by using agar diffusion assay. Minimum Inhibition Concentration (MIC) and Minimum Bactericidal Concentration (MBC) were also determined by broth dilution method. For antioxidant activity, the methanol fraction from stem extract showed the highest activity with an IC50 of 2.4 mg/ml. Water extraction was the high TPC with 10,136.9 mg GAE/g dry weight. Methanol and water extraction showed the remarkable inhibition of bacterial growth was shown against L. monocytogenes and S. aureus. In addition, ethyl acetate, methanol and water fraction from stem extract against S. epidermidis. The present finding suggests that the extract of C. micracantha could be used to discover bioactive natural products that may serve as pharmaceutical products.

Further evaluation of Rwandan medicinal plant extracts for their antimicrobial and antiviral activities.

PubMed

Cos, P; Hermans, N; De Bruyne, T; Apers, S; Sindambiwe, J B; Vanden Berghe, D; Pieters, L; Vlietinck, A J

2002-02-01

A total of 45 Rwandan plant extracts, belonging to 37 different plant species out of 21 families, were investigated for their antibacterial, antifungal, and antiviral properties. The plants were selected on the base of their ethnomedicinal use against infections and autoimmune diseases. From all the plant extracts tested, only Clematis hirsuta (leaves) showed a pronounced antifungal activity against Candida albicans and the dermatophytes Trichophyton rubrum, Epidermophyton floccosum, and Microsporum canis. Seven plant extracts showed a high antiviral activity against the DNA-virus Herpes simplex type 1, while five and three plant extracts were highly active against the RNA-viruses Coxsackie and Polio, respectively. Only Macaranga kilimandscharica (leaves) showed an interesting anti-measles activity, whereas Eriosema montanum (leaves) and Entada abyssinica (leaves) were highly active against Semliki forest virus. Some plant extracts showed an antibacterial activity against Gram-positive bacteria and Mycobacterium fortuitum, but none of them were active against the Gram-negative bacteria tested.

Harnessing Biomedical Natural Language Processing Tools to Identify Medicinal Plant Knowledge from Historical Texts.

PubMed

Sharma, Vivekanand; Law, Wayne; Balick, Michael J; Sarkar, Indra Neil

2017-01-01

The growing amount of data describing historical medicinal uses of plants from digitization efforts provides the opportunity to develop systematic approaches for identifying potential plant-based therapies. However, the task of cataloguing plant use information from natural language text is a challenging task for ethnobotanists. To date, there have been only limited adoption of informatics approaches used for supporting the identification of ethnobotanical information associated with medicinal uses. This study explored the feasibility of using biomedical terminologies and natural language processing approaches for extracting relevant plant-associated therapeutic use information from historical biodiversity literature collection available from the Biodiversity Heritage Library. The results from this preliminary study suggest that there is potential utility of informatics methods to identify medicinal plant knowledge from digitized resources as well as highlight opportunities for improvement.

Harnessing Biomedical Natural Language Processing Tools to Identify Medicinal Plant Knowledge from Historical Texts

PubMed Central

Sharma, Vivekanand; Law, Wayne; Balick, Michael J.; Sarkar, Indra Neil

2017-01-01

The growing amount of data describing historical medicinal uses of plants from digitization efforts provides the opportunity to develop systematic approaches for identifying potential plant-based therapies. However, the task of cataloguing plant use information from natural language text is a challenging task for ethnobotanists. To date, there have been only limited adoption of informatics approaches used for supporting the identification of ethnobotanical information associated with medicinal uses. This study explored the feasibility of using biomedical terminologies and natural language processing approaches for extracting relevant plant-associated therapeutic use information from historical biodiversity literature collection available from the Biodiversity Heritage Library. The results from this preliminary study suggest that there is potential utility of informatics methods to identify medicinal plant knowledge from digitized resources as well as highlight opportunities for improvement. PMID:29854223

Saraca indica Bark Extract Shows In Vitro Antioxidant, Antibreast Cancer Activity and Does Not Exhibit Toxicological Effects

PubMed Central

Yadav, Navneet Kumar; Saini, Karan Singh; Hossain, Zakir; Omer, Ankur; Sharma, Chetan; Gayen, Jiaur R.; Singh, Poonam; Arya, K. R.; Singh, R. K.

2015-01-01

Medicinal plants are used as a complementary and alternative medicine in treatment of various diseases including cancer worldwide, because of their ease of accessibility and cost effectiveness. Multicomposed mixture of compounds present in a plant extract has synergistic activity, increases the therapeutic potential many folds, compensates toxicity, and increases bioavailability. Saraca indica (family Caesalpiniaceae) is one of the most ancient sacred plants with medicinal properties, exhibiting a number of pharmacological effects. Antioxidant, antibreast cancer activity and toxicological evaluation of Saraca indica bark extract (SIE) were carried out in the present study. The results of the study indicated that this herbal preparation has antioxidant and antibreast cancer activity. Toxicological studies suggest that SIE is safer to use and may have a potential to be used as complementary and alternative medicine for breast cancer therapy. PMID:25861411

Screening of Six Medicinal Plant Extracts Obtained by Two Conventional Methods and Supercritical CO₂ Extraction Targeted on Coumarin Content, 2,2-Diphenyl-1-picrylhydrazyl Radical Scavenging Capacity and Total Phenols Content.

PubMed

Molnar, Maja; Jerković, Igor; Suknović, Dragica; Bilić Rajs, Blanka; Aladić, Krunoslav; Šubarić, Drago; Jokić, Stela

2017-02-24

Six medicinal plants Helichrysum italicum (Roth) G. Don, Angelica archangelica L., Lavandula officinalis L., Salvia officinalis L., Melilotus officinalis L., and Ruta graveolens L. were used. The aim of the study was to compare their extracts obtained by Soxhlet (hexane) extraction, maceration with ethanol (EtOH), and supercritical CO₂ extraction (SC-CO₂) targeted on coumarin content (by high performance liquid chromatography with ultraviolet detection, HPLC-UV), 2,2-diphenyl-1-picrylhydrazyl radical (DPPH) scavenging capacity, and total phenols (TPs) content (by Folin-Ciocalteu assay). The highest extraction yields were obtained by EtOH, followed by hexane and SC-CO₂. The highest coumarin content (316.37 mg/100 g) was found in M. officinalis EtOH extracts, but its SC-CO₂ extraction yield was very low for further investigation. Coumarin was also found in SC-CO₂ extracts of S. officinalis , R. graveolens , A. archangelica , and L. officinalis . EtOH extracts of all plants exhibited the highest DPPH scavenging capacity. SC-CO₂ extracts exhibited antiradical capacity similar to hexane extracts, while S. officinalis SC-CO₂ extracts were the most potent (95.7%). EtOH extracts contained the most TPs (up to 132.1 mg gallic acid equivalents (GAE)/g from H. italicum ) in comparison to hexane or SC-CO₂ extracts. TPs content was highly correlated to the DPPH scavenging capacity of the extracts. The results indicate that for comprehensive screening of different medicinal plants, various extraction techniques should be used in order to get a better insight into their components content or antiradical capacity.

Identification of the protective effects of traditional medicinal plants against SDS-induced Drosophila gut damage

PubMed Central

Zhou, Yang; Liu, Zonglin; Chen, Yuchen; Jin, Li Hua

2016-01-01

Traditional medicinal plants are widely used as immunomodulatory medicines that help improve health. A total of 50 different plants used for the treatment of toxicity were screened for their in vivo protective effects. Flies were fed a standard cornmeal-yeast medium (control group) or the standard medium containing medicinal plant extracts (experimental groups). Assessment of the survival rate was performed by feeding flies with toxic compounds. Gut epithelial cells were analyzed for cell proliferation and death by green fluorescent protein antibodies and 7-aminoactinomycin D staining under the microscope. The expression of antimicrobial peptides (AMPs) was evaluated by the quantitative polymerase chain reaction and the results revealed that after feeding the flies with toxic compounds, aqueous extracts from Codonopsis pilosula (Franch.) Nannf (C. pilosula), Saussurea lappa (Decne.) C.B.Clarke (S. lappa), Imperata cylindrica Beauv.var.major (Nees) C.E. Hubb. (I. cylindrical var. major) and Melia toosendan Sied. Et Zucc. (M.toosendan) increased the fly survival rate, reduced epithelial cell death and improved gut morphology. In addition, C. pilosula extracts induced the antimicrobial peptide levels (Dpt and Mtk) following treatment with sodium dodecyl sulfate (SDS). However, these extracts were not observed to increase SDS-induced cell proliferation in vivo. These results indicate that there are strong protective effects in extracts of C. pilosula, S. lappa, I. cylindrical var. major and M. toosendan on Drosophila intestinal cells among 50 medicinal plants. PMID:27698771

Evaluation of antioxidant, antibacterial, and antidiabetic potential of two traditional medicinal plants of India: Swertia cordata and Swertia chirayita.

PubMed

Roy, Priyanka; Abdulsalam, Fatima I; Pandey, D K; Bhattacharjee, Aniruddha; Eruvaram, Naveen Reddy; Malik, Tabarak

2015-06-01

Swertia cordata and Swertia chirayita are temperate Himalayan medicinal plants used as potent herbal drugs in Indian traditional systems of medicine (Ayurvedic, Unani and Siddha). Assessment of Antioxidant, antibacterial, and antidiabetic potential of Swertia cordata and Swertia chirayita. Phytochemicals of methanolic and aqueous extracts of the two Swertia species were analyzed. The antioxidant potential of all the extracts was assessed by measuring total phenolic content, total flavonoid content and free radical scavenging potential was assessed by 1,1-diphenyl-2-picrilhydrazyl (DPPH) assay, antibacterial activity was assessed against various pathogenic and nonpathogenic bacteria in vitro by Kirby-Bauer agar well diffusion method and antidiabetic activity was assessed by α-amylase inhibition. Methanolic leaf extracts of both the species of Swertia contain significant antibacterial as well as anti-diabetic potential, whereas methanolic root extracts of both species were found to have potential antioxidant activity. However, Swertia chirayita showed better activities than Swertia cordata although both species have good reputation in traditional Indian medicine. Both the species are having high medicinal potential in terms of their antioxidant, antibacterial and antidiabetic activities. Studies are required to further elucidate antioxidant, anti-diabetic and antibacterial potentials using various in-vitro, in-vivo biochemical and molecular biology techniques.

Evaluation of antioxidant, antibacterial, and antidiabetic potential of two traditional medicinal plants of India: Swertia cordata and Swertia chirayita

PubMed Central

Roy, Priyanka; Abdulsalam, Fatima I.; Pandey, D. K.; Bhattacharjee, Aniruddha; Eruvaram, Naveen Reddy; Malik, Tabarak

2015-01-01

Background: Swertia cordata and Swertia chirayita are temperate Himalayan medicinal plants used as potent herbal drugs in Indian traditional systems of medicine (Ayurvedic, Unani and Siddha). Objective: Assessment of Antioxidant, antibacterial, and antidiabetic potential of Swertia cordata and Swertia chirayita. Materials and Methods: Phytochemicals of methanolic and aqueous extracts of the two Swertia species were analyzed. The antioxidant potential of all the extracts was assessed by measuring total phenolic content, total flavonoid content and free radical scavenging potential was assessed by 1,1-diphenyl-2-picrilhydrazyl (DPPH) assay, antibacterial activity was assessed against various pathogenic and nonpathogenic bacteria in vitro by Kirby-Bauer agar well diffusion method and antidiabetic activity was assessed by α-amylase inhibition. Results: Methanolic leaf extracts of both the species of Swertia contain significant antibacterial as well as anti-diabetic potential, whereas methanolic root extracts of both species were found to have potential antioxidant activity. However, Swertia chirayita showed better activities than Swertia cordata although both species have good reputation in traditional Indian medicine. Conclusion: Both the species are having high medicinal potential in terms of their antioxidant, antibacterial and antidiabetic activities. Studies are required to further elucidate antioxidant, anti-diabetic and antibacterial potentials using various in-vitro, in-vivo biochemical and molecular biology techniques. PMID:26109789

Text mining facilitates database curation - extraction of mutation-disease associations from Bio-medical literature.

PubMed

Ravikumar, Komandur Elayavilli; Wagholikar, Kavishwar B; Li, Dingcheng; Kocher, Jean-Pierre; Liu, Hongfang

2015-06-06

Advances in the next generation sequencing technology has accelerated the pace of individualized medicine (IM), which aims to incorporate genetic/genomic information into medicine. One immediate need in interpreting sequencing data is the assembly of information about genetic variants and their corresponding associations with other entities (e.g., diseases or medications). Even with dedicated effort to capture such information in biological databases, much of this information remains 'locked' in the unstructured text of biomedical publications. There is a substantial lag between the publication and the subsequent abstraction of such information into databases. Multiple text mining systems have been developed, but most of them focus on the sentence level association extraction with performance evaluation based on gold standard text annotations specifically prepared for text mining systems. We developed and evaluated a text mining system, MutD, which extracts protein mutation-disease associations from MEDLINE abstracts by incorporating discourse level analysis, using a benchmark data set extracted from curated database records. MutD achieves an F-measure of 64.3% for reconstructing protein mutation disease associations in curated database records. Discourse level analysis component of MutD contributed to a gain of more than 10% in F-measure when compared against the sentence level association extraction. Our error analysis indicates that 23 of the 64 precision errors are true associations that were not captured by database curators and 68 of the 113 recall errors are caused by the absence of associated disease entities in the abstract. After adjusting for the defects in the curated database, the revised F-measure of MutD in association detection reaches 81.5%. Our quantitative analysis reveals that MutD can effectively extract protein mutation disease associations when benchmarking based on curated database records. The analysis also demonstrates that incorporating discourse level analysis significantly improved the performance of extracting the protein-mutation-disease association. Future work includes the extension of MutD for full text articles.

Authentication of Herbal Supplements Using Next-Generation Sequencing

PubMed Central

Braukmann, Thomas W. A.; Borisenko, Alex V.; Zakharov, Evgeny V.

2016-01-01

Background DNA-based testing has been gaining acceptance as a tool for authentication of a wide range of food products; however, its applicability for testing of herbal supplements remains contentious. Methods We utilized Sanger and Next-Generation Sequencing (NGS) for taxonomic authentication of fifteen herbal supplements representing three different producers from five medicinal plants: Echinacea purpurea, Valeriana officinalis, Ginkgo biloba, Hypericum perforatum and Trigonella foenum-graecum. Experimental design included three modifications of DNA extraction, two lysate dilutions, Internal Amplification Control, and multiple negative controls to exclude background contamination. Ginkgo supplements were also analyzed using HPLC-MS for the presence of active medicinal components. Results All supplements yielded DNA from multiple species, rendering Sanger sequencing results for rbcL and ITS2 regions either uninterpretable or non-reproducible between the experimental replicates. Overall, DNA from the manufacturer-listed medicinal plants was successfully detected in seven out of eight dry herb form supplements; however, low or poor DNA recovery due to degradation was observed in most plant extracts (none detected by Sanger; three out of seven–by NGS). NGS also revealed a diverse community of fungi, known to be associated with live plant material and/or the fermentation process used in the production of plant extracts. HPLC-MS testing demonstrated that Ginkgo supplements with degraded DNA contained ten key medicinal components. Conclusion Quality control of herbal supplements should utilize a synergetic approach targeting both DNA and bioactive components, especially for standardized extracts with degraded DNA. The NGS workflow developed in this study enables reliable detection of plant and fungal DNA and can be utilized by manufacturers for quality assurance of raw plant materials, contamination control during the production process, and the final product. Interpretation of results should involve an interdisciplinary approach taking into account the processes involved in production of herbal supplements, as well as biocomplexity of plant-plant and plant-fungal biological interactions. PMID:27227830

Authentication of Herbal Supplements Using Next-Generation Sequencing.

PubMed

Ivanova, Natalia V; Kuzmina, Maria L; Braukmann, Thomas W A; Borisenko, Alex V; Zakharov, Evgeny V

2016-01-01

DNA-based testing has been gaining acceptance as a tool for authentication of a wide range of food products; however, its applicability for testing of herbal supplements remains contentious. We utilized Sanger and Next-Generation Sequencing (NGS) for taxonomic authentication of fifteen herbal supplements representing three different producers from five medicinal plants: Echinacea purpurea, Valeriana officinalis, Ginkgo biloba, Hypericum perforatum and Trigonella foenum-graecum. Experimental design included three modifications of DNA extraction, two lysate dilutions, Internal Amplification Control, and multiple negative controls to exclude background contamination. Ginkgo supplements were also analyzed using HPLC-MS for the presence of active medicinal components. All supplements yielded DNA from multiple species, rendering Sanger sequencing results for rbcL and ITS2 regions either uninterpretable or non-reproducible between the experimental replicates. Overall, DNA from the manufacturer-listed medicinal plants was successfully detected in seven out of eight dry herb form supplements; however, low or poor DNA recovery due to degradation was observed in most plant extracts (none detected by Sanger; three out of seven-by NGS). NGS also revealed a diverse community of fungi, known to be associated with live plant material and/or the fermentation process used in the production of plant extracts. HPLC-MS testing demonstrated that Ginkgo supplements with degraded DNA contained ten key medicinal components. Quality control of herbal supplements should utilize a synergetic approach targeting both DNA and bioactive components, especially for standardized extracts with degraded DNA. The NGS workflow developed in this study enables reliable detection of plant and fungal DNA and can be utilized by manufacturers for quality assurance of raw plant materials, contamination control during the production process, and the final product. Interpretation of results should involve an interdisciplinary approach taking into account the processes involved in production of herbal supplements, as well as biocomplexity of plant-plant and plant-fungal biological interactions.

Ethnobotanical survey, chemical composition, and antioxidant capacity of methanolic extract of the root bark of Annona cuneata Oliv.

PubMed

Khallouki, Farid; Haubner, Roswitha; Ulrich, Cornelia M; Owen, Robert W

2011-11-01

The root bark of Annona cuneata Oliv. is traditionally used in the Democratic Republic of Congo to treat several debilitating conditions, such as hernia, female sterility, sexual asthenia, and parasitic infections. However, little is known about the composition of the secondary plant substances, which may contribute to these traditional medicinal effects. We conducted an ethnobotanical study and then evaluated the composition of the secondary plant substances in extracts of the root bark by using spectroscopic methods. After delipidation, the root bark was lixiviated in methanol, and components in the extract were studied by gas chromatography-mass spectometry, high-performance liquid chromatography (HPLC)-electrospray ionization-MS and nano-electrospray ionization-MS-MS. These methods identified 13 secondary plant substances (almost exclusively phenolic compounds): p-hydroxybenzaldehyde (I), vanillin (II), tyrosol (III), 3,4-dihydroxybenzaldehyde (IV), p-hydroxybenzoic acid (V), vanillyl alcohol (VI), syringaldehyde (VII), 4-hydroxy-3-methoxyphenylethanol (VIII), vanillic acid (IX), 3,4-dihydroxybenzoic acid (X), syringic acid (XI), and ferulic acid (XII), along with the phytosterol squalene (XIII). In the HPLC-based hypoxanthine/xanthine oxidase antioxidant assay system, the methanolic extract exhibited potent antioxidant capacity, with a 50% inhibitory concentration of 72 μL, equivalent to 1.38 mg/mL of raw extract. Thus, a methanol extract of A. cuneata Oliv. contained a range of polyphenolic compounds, which may be partly responsible for its known traditional medicinal effects. More detailed studies on the phytochemistry of this important plant species are therefore warranted.

Antimicrobial Activity of Extracts of the Oyster Culinary Medicinal Mushroom Pleurotus ostreatus (Higher Basidiomycetes) and Identification of a New Antimicrobial Compound.

PubMed

Younis, Ahmed M; Wu, Fang-Sheng; El Shikh, Hussien H

2015-01-01

Pleurotus ostreatus is an edible mushroom that also has high medicinal values. In this study, P. ostreatus was tested for its ability to inhibit the growth of fungi and bacteria. The freeze-dried fruiting body, broth from submerged culture, and mycelial biomass of P. ostreatus were extracted using alcohols and water as solvents. The extracts were then tested for their antimicrobial activity against the growth of fungi and bacteria. It was observed that the water extract from fruiting bodies had the strongest effect in inhibiting the growth of most fungi. The most sensitive test microfungi to the inhibition were Candida albicans, Cryptococcus humicola, and Trichosporon cutaneum, and the most sensitive test bacteria were Staphylococcus aureus followed by Escherichia coli. Water extracts from culture broth or mycelial biomass were moderately inhibitive to the growth of fungi and bacteria. The alcohol-based solvents from all samples had much less antimicrobial activity against most test microorganisms. An antimicrobial compound was purified from the water extracts of fruiting bodies with Sephadex G 100 column chromatography and characterized by infrared absorption spectrum (IR), nuclear magnetic resonance (NMR), and mass spectroscopic analysis. We have identified this compound to be 3-(2-aminopheny1thio)-3-hydroxypropanoic acid. This purified compound had a minimum inhibitory concentration of 30 µg/mL and 20 µg/mL against the growth of fungi and bacteria, respectively.

Anti-inflammatory, wound healing and in-vivo antioxidant properties of the leaves of Ficus amplissima Smith.

PubMed

Arunachalam, Karuppusamy; Parimelazhagan, Thangaraj

2013-01-09

Ficus amplissima, commonly known as kal-itchchi, being used in folklore medicine, leaves juice is applied externally on old chronic wounds and the latex is applied on the wound. There was no scientific evidence justifying the medicinal use of Ficus amplissima, therefore the present study was aimed at evaluation of anti-inflammatory, wound healing and in-vivo antioxidant activity of the plant. In the present study the acetone extract of Ficus amplissima leaves were studied for enzymatic antioxidant activity through different assays, anti-inflammatory by using carrageenan and histamine induced rat paw edema models (50mg, 100mg acetone extract) and wound healing activity by incorporating the two doses (1% (w/w) and 2% (w/w)) of acetone extract and simple ointment base B.P. in concentration of 0.5% (w/w) using excision and incision wound models in rats. In case of the excision wound model wound contraction and period of epithelization was studied while incision wound model was evaluated by determining tensile strength. Ficus amplissima leaves expressed the potent anti-inflammatory and in-vivo antioxidant activity where 100mg acetone extract showed high activity. Treatment of wound with ointment containing 2% (w/w) acetone extract exhibited significant (P<0.001) wound healing activity. The acetone extract of Ficus amplissima leaves exhibited better anti-inflammatory, wound healing and in-vivo antioxidant activity probably due to phenols constituents. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Angolan Cymbopogon citratus used for therapeutic benefits: nutritional composition and influence of solvents in phytochemicals content and antioxidant activity of leaf extracts.

PubMed

Soares, Marta O; Alves, Rita C; Pires, Pedro C; Oliveira, M Beatriz P P; Vinha, Ana F

2013-10-01

Folk medicine is a relevant and effective part of indigenous healthcare systems which are, in practice, totally dependent on traditional healers. An outstanding coincidence between indigenous medicinal plant uses and scientifically proved pharmacological properties of several phytochemicals has been observed along the years. This work focused on the leaves of a medicinal plant traditionally used for therapeutic benefits (Angolan Cymbopogon citratus), in order to evaluate their nutritional value. The bioactive phytochemical composition and antioxidant activity of leaf extracts prepared with different solvents (water, methanol and ethanol) were also evaluated. The plant leaves contained ∼60% of carbohydrates, protein (∼20%), fat (∼5%), ash (∼4%) and moisture (∼9%). The phytochemicals screening revealed the presence of tannins, flavonoids, and terpenoids in all extracts. Methanolic extracts also contained alkaloids and steroids. Several methods were used to evaluate total antioxidant capacity of the different extracts (DPPH·, NO·, and H₂O₂ scavenging assays, reducing power, and FRAP). Ethanolic extracts presented a significantly higher antioxidant activity (p<0.05) except for FRAP, in which the best results were achieved by the aqueous extracts. Methanolic extracts showed the lowest radical scavenging activities for both DPPH· and NO· radicals. Copyright © 2013 Elsevier Ltd. All rights reserved.

[Effectiveness of aqueous extracts of aromatic and medicinal plants against tomato grey mould in Morocco].

PubMed

Kasmi, Manal; Aourach, Mohammed; El Boukari, Mohammed; Barrijal, Said; Essalmani, Haiat

2017-08-01

Grey mould is a major disease threatening the Moroccan tomato; this disease is often controlled by fungicides. However, the latter are a real danger to human health and environment. Thus, this study is part of the research of harmless alternatives such extracts of aromatic and medicinal plants (Lavandula officinalis, Thymus vulgaris, Cymbopogon citratus, and Melissa officinalis). In this study, the extracts of four medicinal and aromatic plants were tested for their antifungal potency in vitro and in vivo in order to select the most effective. The results show that, in vitro, the Lavandula officinalis, Thymus vulgaris and Cymbopogon citratus aqueous extracts all possess significant antifungal activity, whereas Melissa officinalis shows the least effective. Also in vivo only the aqueous extract of Cymbopogon citratus proves most effective against B. cinerea on tomato fruit. The test of the plants confirms that aqueous extracts of Cymbopogon citratus and Thymus vulgaris are most effective, while the aqueous extracts of Melissa officinalis and Lavandula officinalis always seem to be the least effective. Therefore, the aqueous extracts of Cymbopogon citratus and Thymus vulgaris are the most envisaged for the biological control of grey mould. Copyright © 2017 Académie des sciences. Published by Elsevier Masson SAS. All rights reserved.

Analysis of prescription database extracted from standard textbooks of traditional Dai medicine.

PubMed

Zhang, Chuang; Chongsuvivatwong, Virasakdi; Keawpradub, Niwat; Lin, Yanfang

2012-08-29

Traditional Dai Medicine (TDM) is one of the four major ethnomedicine of China. In 2007 a group of experts produced a set of seven Dai medical textbooks on this subject. The first two were selected as the main data source to analyse well recognized prescriptions. To quantify patterns of prescriptions, common ingredients, indications and usages of TDM. A relational database linking the prescriptions, ingredients, herb names, indications, and usages was set up. Frequency of pattern of combination and common ingredients were tabulated. A total of 200 prescriptions and 402 herbs were compiled. Prescriptions based on "wind" disorders, a detoxification theory that most commonly deals with symptoms of digestive system diseases, accounted for over one third of all prescriptions. The major methods of preparations mostly used roots and whole herbs. The information extracted from the relational database may be useful for understanding symptomatic treatments. Antidote and detoxification theory deserves further research.

From medical herbalism to phytotherapy in dermatology: back to the future.

PubMed

Dattner, Alan M

2003-01-01

Plant-based therapeutic preparations are cyclically returning to complement dermatologic therapy. They serve as therapeutic alternatives, safer choices, or in some cases, as the only effective treatment. Folk medicine tradition provides different indicators for use than the medical disease model. Advantages of multiple synergistic components of crude extracts are discussed, as well as herbs already used in dermatology. Bitter digestive stimulants are used for vitiligo. Bioflavinoids from buckwheat and horse chestnut are used for varicose veins, and silymarin is used for liver protection. Gotu kola and sarsaparilla are used for inflammatory skin conditions. Oregon grape root has synergistic antibacterial, anti-inflammatory, and bile-stimulating properties which make the crude extract useful in acne. Philosophical differences in herbology compared to medicine exist in the application of science toward improving elimination and strengthening the host as opposed to destroying the vector or manifestation of the disease.

Antibacterial screening of traditional herbal plants and standard antibiotics against some human bacterial pathogens.

PubMed

Awan, Uzma Azeem; Andleeb, Saiqa; Kiyani, Ayesha; Zafar, Atiya; Shafique, Irsa; Riaz, Nazia; Azhar, Muhammad Tehseen; Uddin, Hafeez

2013-11-01

Chloroformic and isoamyl alcohol extracts of Cinnnamomum zylanicum, Cuminum cyminum, Curcuma long Linn, Trachyspermum ammi and selected standard antibiotics were investigated for their in vitro antibacterial activity against six human bacterial pathogens. The antibacterial activity was evaluated and based on the zone of inhibition using agar disc diffusion method. The tested bacterial strains were Streptococcus pyogenes, Staphylococcus epidermidis, Klebsiella pneumonia, Staphylococcus aurues, Serratia marcesnces, and Pseudomonas aeruginosa. Ciprofloxacin showed highly significant action against K. pneumonia and S. epidermidis while Ampicillin and Amoxicillin indicated lowest antibacterial activity against tested pathogens. Among the plants chloroform and isoamyl alcohol extracts of C. cyminum, S. aromaticum and C. long Linn had significant effect against P. aeruginosa, S. marcesnces and S. pyogenes. Comparison of antibacterial activity of medicinal herbs and standard antibiotics was also recorded via activity index. Used medicinal plants have various phytochemicals which reasonably justify their use as antibacterial agent.

Medicinal Plants from Mexico, Central America, and the Caribbean Used as Immunostimulants

PubMed Central

Juárez-Vázquez, María del Carmen; Campos-Xolalpa, Nimsi

2016-01-01

A literature review was undertaken by analyzing distinguished books, undergraduate and postgraduate theses, and peer-reviewed scientific articles and by consulting worldwide accepted scientific databases, such as SCOPUS, Web of Science, SCIELO, Medline, and Google Scholar. Medicinal plants used as immunostimulants were classified into two categories: (1) plants with pharmacological studies and (2) plants without pharmacological research. Medicinal plants with pharmacological studies of their immunostimulatory properties were subclassified into four groups as follows: (a) plant extracts evaluated for in vitro effects, (b) plant extracts with documented in vivo effects, (c) active compounds tested on in vitro studies, and (d) active compounds assayed in animal models. Pharmacological studies have been conducted on 29 of the plants, including extracts and compounds, whereas 75 plants lack pharmacological studies regarding their immunostimulatory activity. Medicinal plants were experimentally studied in vitro (19 plants) and in vivo (8 plants). A total of 12 compounds isolated from medicinal plants used as immunostimulants have been tested using in vitro (11 compounds) and in vivo (2 compounds) assays. This review clearly indicates the need to perform scientific studies with medicinal flora from Mexico, Central America, and the Caribbean, to obtain new immunostimulatory agents. PMID:27042188

Medicinal Plants from Mexico, Central America, and the Caribbean Used as Immunostimulants.

PubMed

Alonso-Castro, Angel Josabad; Juárez-Vázquez, María Del Carmen; Campos-Xolalpa, Nimsi

2016-01-01

A literature review was undertaken by analyzing distinguished books, undergraduate and postgraduate theses, and peer-reviewed scientific articles and by consulting worldwide accepted scientific databases, such as SCOPUS, Web of Science, SCIELO, Medline, and Google Scholar. Medicinal plants used as immunostimulants were classified into two categories: (1) plants with pharmacological studies and (2) plants without pharmacological research. Medicinal plants with pharmacological studies of their immunostimulatory properties were subclassified into four groups as follows: (a) plant extracts evaluated for in vitro effects, (b) plant extracts with documented in vivo effects, (c) active compounds tested on in vitro studies, and (d) active compounds assayed in animal models. Pharmacological studies have been conducted on 29 of the plants, including extracts and compounds, whereas 75 plants lack pharmacological studies regarding their immunostimulatory activity. Medicinal plants were experimentally studied in vitro (19 plants) and in vivo (8 plants). A total of 12 compounds isolated from medicinal plants used as immunostimulants have been tested using in vitro (11 compounds) and in vivo (2 compounds) assays. This review clearly indicates the need to perform scientific studies with medicinal flora from Mexico, Central America, and the Caribbean, to obtain new immunostimulatory agents.

Investigation of antioxidant capacity of the extracts of bilberry (VACCINUM MYRTILLIS L.) by voltammetry

NASA Astrophysics Data System (ADS)

Vtorushina, A. N.; Nikonova, E. D.

2016-02-01

This paper deals with the urgent issue of the search of new drugs based on plant raw materials that have an influence on various stages of oxidation processes occurring in the human body. The aim of this paper is to determine the antioxidant activity of the bilberry extracts that are used in the medicine practice by a cathodic voltammetry method. We consider the influence of water and alcohol bilberry extracts on the process of oxygen electroreduction. From these extracts the most activity relation to the process of cathodic oxygen reduction showed alcohol (40%) bilberry extract. It was also stated that the alcohol extract of bilberry has a greater antioxidant activity than other known antioxidants such as ascorbic acid, glucose, dihydroquercetin. Thus, after consideration of a number of plant objects, we showed the possibility of applying the method of cathodic voltammetry for the determination of total antioxidant activity of plant material and identifying and highlighting the most perspective sources of biologically active substances (BAS), as well as the ability of identifying extractants that fully extract BAS from plant raw materials. The activity data of extracts of plant raw materials gives an opportunity of establishing an effective yield phytopreparation based on bilberry that has an antioxidant effect.

Evaluation of Antimicrobial Activity of the Methanol Extracts from 8 Traditional Medicinal Plants

PubMed Central

Kang, Chang-Geun; Hah, Dae-Sik; Kim, Chung-Hui; Kim, Young-Hwan; Kim, Euikyung

2011-01-01

The methanol extract of 12 medicinal plants were evaluated for its antibacterial activity against Gram-positive (5 strains) and Gram-negative bacteria (10 strains) by assay for minimum inhibitory concentration (MIC) and minimum bacterial concentration (MBC) . The antibacterial activity was determined by an agar dilution method (according to the guidelines of Clinical and Laboratory Standard Institute) . All the compounds (12 extracts) of the 8 medicinal plants (leaf or root) were active against both Gram-negative and Gram-positive bacteria. Gram-negative showed a more potent action than Gram positive bacteria. The MIC concentrations were various ranged from 0.6 μg/ml to 5000 μg/ml. The lowest MIC (0.6 μg/ml) and MBC (1.22 μg/ml) values were obtained with extract on 4 and 3 of the 15 microorganisms tested, respectively. PMID:24278548

Preliminary phytochemical screening and antimicrobial evaluation of three medicinal plants used in Nigeria.

PubMed

Baba, Haruna; Onanuga, Adebola

2011-01-01

Methanol extract of three Nigerian medicinal plants were screened for antimicrobial activity using modified Kirby-Bauer disc diffusion and agar dilution techniques to determine the diameters of zone of inhibition and minimum inhibitory concentrations (MIC) of the extracts respectively. The extract of each of the plants were tested against five clinical bacterial isolates comprising of two Gram-positive bacteria (Bacillus subtilis and Staphylococcus aureus) and three Gram-negative bacteria (Pseudomonas aeruginosa, Escherichia coli and Klebsiella pneumonia) organisms. All the extracts exhibited moderate to high level of antimicrobial activities against these microorganisms. Phytochemical screening of powdered plant material revealed the presence of some secondary metabolites such as alkaloids, saponins, tannins, anthraquinones and flavonoids. These Nigerian medicinal plants could be developed into cheap, safe and culturally acceptable standardized herbal products and may serve as a source of new molecules for broad-spectrum antimicrobial agents.

Medicinal and antimicrobial role of the oyster culinary-medicinal mushroom Pleurotus ostreatus (higher Basidiomycetes) cultivated on banana agrowastes in India.

PubMed

Kunjadia, Prashant D; Nagee, Anju; Pandya, Parth Y; Mukhopadhyaya, Pratap N; Sanghvi, Gaurav V; Dave, Gaurav S

2014-01-01

Oyster mushrooms, species of the genus Pleurotus, are recognized for producing secondary metabolites with important medicinal properties. Investigations were carried out to evaluate the antioxidative and antimicrobial properties of the edible mushroom Pleurotus ostreatus (MTCC142) extracts cultivated on banana agrowastes. Ethanolic extracts showed antimicrobial activities against gram-positive and gram-negative bacteria, and their in vitro antifungal activities against all fungi tested revealed a promising role. Qualitative phytochemical analysis of Pleurotus grown on yeast dextrose broth and banana agrowaste confirmed the presence of steroids, cardiac glycosides, terpenoids, and alkaloids, whereas ethanolic extract after 40 days exhibited a phenol concentration of 521.67 µg/mL in banana waste compared to 155 µg/mL in yeast dextrose broth. The minimum inhibitory concentration of ethanolic extracts ranged from 19.74 to 56.84 mg/mL and 35.53 to 102.31 mg/mL in solid-state and submerged grown mycelium extracts, respectively, after 40 days. Moreover, banana agrowaste could be a significant economic source for the production of the oyster mushroom P. ostreatus. The nutritive, medicinal, and antimicrobial properties of P. ostreatus can be used to develop a new nutraceutical formulation; it can also be used as an additive to routine and fast food.

Synthesis and characterization of nanoparticles capped with medicinal plant extracts

NASA Astrophysics Data System (ADS)

Rekulapally, Sujith R.

In this study, synthesis, characterization and biological application of series nanometal (silver, Ag) and nanometal oxide (titania, TiO2) were carried out. These nanomaterials were prepared using wet-chemistry method and then coated using natural plant extract. Three medicinal plants, namely Zingiber officinale (Ginger), Allium sativum (Garlic) and Capsicum annuum (Chili) were chosen as grafting agent to decrease the side-effects and increase the efficiency of NPs towards living organism. Extraction conditions were controlled under 60-100 °C for 8 hrs. Ag and TiO2 NPs were fabricated using colloidal chemistry and variables were controlled at ambient condition. The band gap of TiO2 NPs used as disinfectant was also modified through coating the medicinal plant extracts. The medicinal plant extracts and coated NPs were measured using spectroscopic methods. Ultraviolet-visible spectra indicated the Ag NPs were formed. The peak at 410 nm resulted from the electrons transferred from their ground to the excited state. The broadened full width at half maximum (FWHM) suggested the ultrafine particles were obtained. The lipid soluble compounds, phenols, tri-terpenoids, flavanoids, capsaicinoids, flavonoids, carotenoids, steroids steroidal glycosides, and vitamins were determined from the high performance liquid chromatographical analyses. X-ray powder diffraction indicated that the face-centered cubic Ag (PDF: 00-004-0783, a = 4.0862A, a = 90°) and anatase TiO2 (PDF: 01-08-1285, a = 3.7845, c = 9.5143A, a = 90°) were obtained using colloidal chemistry. Bactericidal activity indicated that these core-shelled TiO 2 were effective (MBC=0.6 ppm, within 30 mins) at inactivating Gram-positive and Gram-negative bacteria. It is proposed that the medicinal extracts enhanced the potency of NPs against bacteria. From our previous study, the Ag NPs were highly effective at inactivating both bacteria.

Antimycobacterial activity of selected medicinal plants traditionally used in Sudan to treat infectious diseases.

PubMed

Abuzeid, Nadir; Kalsum, Sadaf; Koshy, Richin John; Larsson, Marie; Glader, Mikaela; Andersson, Henrik; Raffetseder, Johanna; Pienaar, Elsje; Eklund, Daniel; Alhassan, Muddathir S; AlGadir, Haidar A; Koko, Waleed S; Schön, Thomas; Ahmed Mesaik, M; Abdalla, Omer M; Khalid, Asaad; Lerm, Maria

2014-11-18

The emergence of multidrug-resistant strains of Mycobacterium tuberculosis underscores the need for continuous development of new and efficient methods to determine the susceptibility of isolates of Mycobacterium tuberculosis in the search for novel antimycobacterial agents. Natural products constitute an important source of new drugs, and design and implementation of antimycobacterial susceptibility testing methods are necessary to evaluate the different extracts and compounds. In this study we have explored the antimycobacterial properties of 50 ethanolic extracts from different parts of 46 selected medicinal plants traditionally used in Sudan to treat infectious diseases. Plants were harvested and ethanolic extracts were prepared. For selected extracts, fractionation with hydrophilic and hydrophobic solvents was undertaken. A luminometry-based assay was used for determination of mycobacterial growth in broth cultures and inside primary human macrophages in the presence or absence of plant extracts and fractions of extracts. Cytotoxicity was also assessed for active fractions of plant extracts. Of the tested extracts, three exhibited a significant inhibitory effect on an avirulent strain of Mycobacterium tubercluosis (H37Ra) at the initial screening doses (125 and 6.25µg/ml). These were bark and leaf extracts of Khaya senegalensis and the leaf extract of Rosmarinus officinalis L. Further fractions of these plant extracts were prepared with n-hexane, chloroform, ethyl acetate, n-butanol, ethanol and water, and the activity of these extracts was retained in hydrophobic fractions. Cytotoxicity assays revealed that the chloroform fraction of Khaya senegalensis bark was non-toxic to human monocyte-derived macrophages and other cell types at the concentrations used and hence, further analysis, including assessment of IC50 and intracellular activity was done with this fraction. These results encourage further investigations to identify the active compound(s) within the chloroform fraction of Khaya senegalensis bark. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Toxicity of herbal extracts used in ethno-veterinary medicine and green-encapsulated ZnO nanoparticles against Aedes aegypti and microbial pathogens.

PubMed

Banumathi, Balan; Vaseeharan, Baskaralingam; Ishwarya, Ramachandran; Govindarajan, Marimuthu; Alharbi, Naiyf S; Kadaikunnan, Shine; Khaled, Jamal M; Benelli, Giovanni

2017-06-01

Dengue and chikungunya are arboviral diseases mainly vectored by the mosquito Aedes aegypti. Presently, there is no treatment for these viral diseases and their prevention is still based on vector control measures. Nanopesticides fabricated using herbal extracts as reducing and capping agents currently represent an excellent platform for pest control. In this scenario, the present study assessed the acute toxicity of seven plants employed in ethno-veterinary medicine of southern India, as well as the green synthesis of zinc oxide nanoparticles, on third-instar larvae of A. aegypti. Larvae were exposed to extracts of the seven plants obtained with solvents of different polarity (acetone, ethanol, petroleum ether, and water) for 24 h. Maximum efficacy was observed for Lobelia leschenaultiana leaf extracts prepared using all the four solvent extracts (LC 50  = 22.83, 28.12, 32.61, and 36.85 mg/L, respectively). Therefore, this plant species was used for the synthesis and stabilization of ZnO nanoparticles based on its maximum efficacy against third-instar larvae of A. aegypti. L. leschenaultiana-encapsulated ZnO nanoparticles showed 100% mortality when tested at 10 mg/L, the LC 50 was extremely low,  1.57 mg/L. Zinc acetate achieved only 65.33% when tested at 60 mg/L, with a LC 50 of 51.62 mg/L. Additionally, ZnO nanoparticles inhibited growth of Pseudomonas aeruginosa, Proteus vulgaris, Shigella sonnei, and Vibrio parahaemolyticus and also inhibited biofilm formation on selected microbila pathogens, showing impact on EPS production and hydrophobicity. Overall, our results suggest that L. leschenaultiana-fabricated ZnO nanoparticles have a significant potential to control A. aegypti mosquitoes and Gram-negative bacterial pathogens.

Extracts of Edible and Medicinal Plants Damage Membranes of Vibrio cholerae▿

PubMed Central

Sánchez, Eduardo; García, Santos; Heredia, Norma

2010-01-01

The use of natural compounds from plants can provide an alternative approach against food-borne pathogens. The mechanisms of action of most plant extracts with antimicrobial activity have been poorly studied. In this work, changes in membrane integrity, membrane potential, internal pH (pHin), and ATP synthesis were measured in Vibrio cholerae cells after exposure to extracts of edible and medicinal plants. A preliminary screen of methanolic, ethanolic, and aqueous extracts of medicinal and edible plants was performed. Minimal bactericidal concentrations (MBCs) were measured for extracts showing high antimicrobial activity. Our results indicate that methanolic extracts of basil (Ocimum basilicum L.), nopal cactus (Opuntia ficus-indica var. Villanueva L.), sweet acacia (Acacia farnesiana L.), and white sagebrush (Artemisia ludoviciana Nutt.) are the most active against V. cholera, with MBCs ranging from 0.5 to 3.0 mg/ml. Using four fluorogenic techniques, we studied the membrane integrity of V. cholerae cells after exposure to these four extracts. Extracts from these plants were able to disrupt the cell membranes of V. cholerae cells, causing increased membrane permeability, a clear decrease in cytoplasmic pH, cell membrane hyperpolarization, and a decrease in cellular ATP concentration in all strains tested. These four plant extracts could be studied as future alternatives to control V. cholerae contamination in foods and the diseases associated with this microorganism. PMID:20802077

Extracts of edible and medicinal plants damage membranes of Vibrio cholerae.

PubMed

Sánchez, Eduardo; García, Santos; Heredia, Norma

2010-10-01

The use of natural compounds from plants can provide an alternative approach against food-borne pathogens. The mechanisms of action of most plant extracts with antimicrobial activity have been poorly studied. In this work, changes in membrane integrity, membrane potential, internal pH (pH(in)), and ATP synthesis were measured in Vibrio cholerae cells after exposure to extracts of edible and medicinal plants. A preliminary screen of methanolic, ethanolic, and aqueous extracts of medicinal and edible plants was performed. Minimal bactericidal concentrations (MBCs) were measured for extracts showing high antimicrobial activity. Our results indicate that methanolic extracts of basil (Ocimum basilicum L.), nopal cactus (Opuntia ficus-indica var. Villanueva L.), sweet acacia (Acacia farnesiana L.), and white sagebrush (Artemisia ludoviciana Nutt.) are the most active against V. cholera, with MBCs ranging from 0.5 to 3.0 mg/ml. Using four fluorogenic techniques, we studied the membrane integrity of V. cholerae cells after exposure to these four extracts. Extracts from these plants were able to disrupt the cell membranes of V. cholerae cells, causing increased membrane permeability, a clear decrease in cytoplasmic pH, cell membrane hyperpolarization, and a decrease in cellular ATP concentration in all strains tested. These four plant extracts could be studied as future alternatives to control V. cholerae contamination in foods and the diseases associated with this microorganism.

Papers published from 1995 to 2012 by six Traditional Chinese Medicine universities in China: a bibliometric analysis based on science citation index.

PubMed

Gao, Kuo; Tian, Guihua; Ye, Qing; Zhai, Xing; Chen, Jianxin; Liu, Tiegang; Liu, Kaifeng; Zhao, Jingyi; Ding, Shengyun

2013-12-01

The quality and quantity of published research papers are important in both scientific and technology fields. Although there are several bibliometric studies based on citation analysis, very few have focused on research related to Traditional Chinese Medicine in China. The bibliometric method used in this study included the following focuses: publication outputs for each year, paper type, language of publication, distribution of internationally collaborative countries, sources of funding, authorization number, distribution of institutes regarding collaborative publications, research fields, distribution of outputs in journals, citation, data, and h-index. A total of 3809 papers published from 1995 to 2012 were extracted from the science citation index (SCI). The cumulative number of papers from all six universities is constantly increasing. The United States attained the dominant position regarding complementary and alternative medicine research. The Chinese Academy of Sciences was the greatest participator in collaborative efforts. Research field analysis showed that the research mainly focused on pharmacology pharmacy, chemistry, integrative complementary medicine, plant sciences, and biochemistry molecular biology. The Shanghai University of Chinese Medicine had the most citations. In recent years, in terms of SCI papers, the six Traditional Chinese Medicine universities studied here have made great advances in scientific research.

In vitro evaluation of novel antiviral activities of 60 medicinal plants extracts against hepatitis B virus.

PubMed

Arbab, Ahmed Hassan; Parvez, Mohammad Khalid; Al-Dosari, Mohammed Salem; Al-Rehaily, Adnan Jathlan

2017-07-01

Currently, >35 Saudi Arabian medicinal plants are traditionally used for various liver disorders without a scientific rationale. This is the first experimental evaluation of the anti-hepatitis B virus (HBV) potential of the total ethanolic and sequential organic extracts of 60 candidate medicinal plants. The extracts were tested for toxicity on HepG2.2.15 cells and cytotoxicity concentration (CC 50 ) values were determined. The extracts were further investigated on HepG2.2.15 cells for anti-HBV activities by analyzing the inhibition of HBsAg and HBeAg production in the culture supernatants, and their half maximal inhibitory concentration (IC 50 ) and therapeutic index (TI) values were determined. Of the screened plants, Guiera senegalensis (dichloromethane extract, IC 50 =10.65), Pulicaria crispa (ethyl acetate extract, IC 50 =14.45), Coccinea grandis (total ethanol extract, IC 50 =31.57), Fumaria parviflora (hexane extract, IC 50 =35.44), Capparis decidua (aqueous extract, IC 50 =66.82), Corallocarpus epigeus (total ethanol extract, IC 50 =71.9), Indigofera caerulea (methanol extract, IC 50 =73.21), Abutilon figarianum (dichloromethane extract, IC 50 =99.76) and Acacia oerfota (total ethanol extract, IC 50 =101.46) demonstrated novel anti-HBV activities in a time- and dose-dependent manner. Further qualitative phytochemical analysis of the active extracts revealed the presence of alkaloids, tannins, flavonoids and saponins, which are attributed to antiviral efficacies. In conclusion, P. crispa, G. senegalensis and F. parviflora had the most promising anti-HBV potentials, including those of C. decidua , C. epigeus, A. figarianum , A. oerfota and I. caerulea with marked activities. However, a detailed phytochemical study of these extracts is essential to isolate the active principle(s) responsible for their novel anti-HBV potential.

Toxicity of medicinal plants used in traditional medicine in Northern Peru

PubMed Central

Bussmann, R.W.; Malca, G.; Glenn, A.; Sharon, D.; Nilsen, B.; Parris, B.; Dubose, D; Ruiz, D.; Saleda, J.; Martinez, M.; Carillo, L.; Walker, K.; Kuhlman, A.; Townesmith, A.

2011-01-01

Aim The plant species reported here are traditionally used in Northern Peru for a wide range of illnesses. Most remedies are prepared as ethanol or aqueous extracts and then ingested. The aim of this study was to evaluate the potential toxicity of these extracts. Materials and methods The toxicity of ethanolic and water extracts of 341 plant species was determined using a Brine-Shrimp assay. Results Overall 24% of the species in water extract and 76% of the species in alcoholic extract showed elevated toxicity levels to brine-shrimp. Although in most cases multiple extracts of the same species showed very similar toxicity values, in some cases the toxicity of different extracts of the same species varied from non-toxic to highly toxic. Conclusions Traditional preparation methods take different toxicity levels in aqueous and ethanol extracts into account when choosing the appropriate solvent for the preparation of a remedy. PMID:21575699

Conversion of conifer wastes into edible and medicinal mushrooms.

Treesearch

Suki C. Croan

2004-01-01

Mushroom-producing white-rot fungi can be used to convert woodwaste into gourmet and medicinal mushrooms. White-rot fungi do not always readily colonize on conifer wood because of its extractives content. This study evaluated the resinous extractive content of loblolly pine (Pinus taeda), ponderosa pine (Pinus ponderosa), and an unknown species of southern yellow pine...

Phytotherapy of nephrotoxicity-induced by cancer drugs: an updated review

PubMed Central

Heidari-Soreshjani, Saeid; Asadi-Samani, Majid; Yang, Qian; Saeedi-Boroujeni, Ali

2017-01-01

Context: Kidney is one of the vital organs maintaining homeostasis of body and thus dysfunction of kidney affects quality of life and health severely. Anticancer drugs, particularly chemotherapeutic agents, cause high toxicity leading kidney dysfunction and irreparable kidney injury. Therefore, attention has recently been paid to seeking out alternatives such as nature-based drugs that are effective but less toxic. In this regard, this systematic review article is to report and introduce the most important medicinal plants and their derivatives that are used to reduce anticancer drug-induced nephrotoxicity. Evidence Acquisitions: The word nephrotoxicity alongside the words cancer or chemotherapy in combination with some herbal terms such as medicinal plant, plants, herbs, and extracts were administered to search for relevant publications indexed in PubMed. Results: According to this study, 16 medicinal plants, 12 plant-based derivatives, and three traditional plant-based formulations were found to help control and modulate anticancer drug-induced nephrotoxicity indices. Conclusions: Anticancer drugs cause nephrotoxicity through activating pathways of oxidative stress, damage-associated molecular patterns (DAMPs) production, inflammatory processes, and cell apoptosis, while medicinal plants and their derivatives can cause reduction in nephrotoxicity and anticancer drugs side effects via their antioxidant and anti-inflammatory properties. PMID:28975109

Clinical cytomics

NASA Astrophysics Data System (ADS)

Tárnok, Attila; Mittag, Anja; Lenz, Dominik

2006-02-01

The goal of predictive medicine is the detection of changes in patient's state prior to the clinical manifestation of the deterioration of the patients current status. Therefore, both the diagnostic of diseases like cancer, coronary atherosclerosis or congenital heart failure and the prognosis of the effect specific therapeutics on patients outcome are the main fields of predictive medicine. Clinical Cytomcs is based on the analysis of specimens from the patient by Cytomic technologies that are mainly imaging based techniques and their combinations with other assays. Predictive medicine aims at the recognition of the "fate" of each individual patients in order to yield unequivocal indications for decision making (i.e. how does the patient respond to therapy, react to medication etc.). This individualized prediction is based on the Predictive Medicine by Clinical Cytomics concept. These considerations have recently stimulated the idea of the Human Cytome Project. A major focus of the Human Cytome Project is multiplexed cy-tomic analysis of individual cells of the patient, extraction of predictive information and individual prediction that merges into individualized therapy. Although still at the beginning, Clinical Cytomics is a promising new field that may change therapy in the near future for the benefit of the patients.

(1)H NMR-Based Metabolomics and Neurotoxicity Study of Cerebrum and Cerebellum in Rats Treated with Cinnabar, a Traditional Chinese Medicine.

PubMed

Wei, Lai; Xue, Rong; Zhang, Panpan; Wu, Yijie; Li, Xiaojing; Pei, Fengkui

2015-08-01

Cinnabar, an important traditional Chinese mineral medicine, has been widely used as a Chinese patent medicine ingredient for sedative therapy. Nevertheless, the neurotoxic effects of cinnabar have also been noted. In this study, (1)H NMR-based metabolomics, combined with multivariate pattern recognition, were applied to investigate the neurotoxic effects of cinnabar after intragastrical administration (dosed at 2 and 5 g/kg body weight) on male Wistar rats. The metabolite variations induced by cinnabar were characterized by increased levels of glutamate, glutamine, myo-inositol, and choline, as well as decreased levels of GABA, taurine, NAA, and NAAG in tissue extracts of the cerebellum and cerebrum. These findings suggested that cinnabar induced glutamate excitotoxicity, neuronal cell loss, osmotic state changes, membrane fluidity disruption, and oxidative injury in the brain. We also show here that there is a dose- and time-dependent neurotoxicity of cinnabar, and that cerebellum was more sensitive to cinnabar induction than cerebrum. This work illustrates the utility and reliability of (1)H NMR-based metabolomics approach for examining the potential neurotoxic effects of cinnabar and other traditional Chinese medicines.

Antioxidant and anti-inflammatory activities of extracts from Cassia alata, Eleusine indica, Eremomastax speciosa, Carica papaya and Polyscias fulva medicinal plants collected in Cameroon.

PubMed

Sagnia, Bertrand; Fedeli, Donatella; Casetti, Rita; Montesano, Carla; Falcioni, Giancarlo; Colizzi, Vittorio

2014-01-01

The vast majority of the population around the world has always used medicinal plants as first source of health care to fight infectious and non infectious diseases. Most of these medicinal plants may have scientific evidence to be considered in general practice. The aim of this work was to investigate the antioxidant capacities and anti-inflammatory activities of ethanol extracts of leaves of Cassia alata, Eleusine indica, Carica papaya, Eremomastax speciosa and the stem bark of Polyscias fulva, collected in Cameroon. Chemiluminescence was used to analyze the antioxidant activities of plant extracts against hydrogen peroxide or superoxide anion. Comet assays were used to analyze the protection against antioxidant-induced DNA damage induced in white blood cells after treating with hydrogen peroxide. Flow cytometry was used to measure γδ T cells proliferation and anti-inflammatory activity of γδ T cells and of immature dendritic cells (imDC) in the presence of different concentrations of plant extracts. Ethanol extracts showed strong antioxidant properties against both hydrogen peroxide and superoxide anion. Cassia alata showed the highest antioxidant activity. The effect of plant extracts on γδ T cells and imDC was evidenced by the dose dependent reduction in TNF-α production in the presence of Cassia alata, Carica papaya, Eremomastax speciosa Eleusine indica, and Polyscias fulva. γδ T cells proliferation was affected to the greatest extent by Polyscias fulva. These results clearly show the antioxidant capacity and anti-inflammatory activities of plant extracts collected in Cameroon. These properties of leaves and stem bark extracts may contribute to the value for these plants in traditional medicine and in general medical practice.

Antioxidant and Anti-Inflammatory Activities of Extracts from Cassia alata, Eleusine indica, Eremomastax speciosa, Carica papaya and Polyscias fulva Medicinal Plants Collected in Cameroon

PubMed Central

Sagnia, Bertrand; Fedeli, Donatella; Casetti, Rita; Montesano, Carla; Falcioni, Giancarlo; Colizzi, Vittorio

2014-01-01

Background The vast majority of the population around the world has always used medicinal plants as first source of health care to fight infectious and non infectious diseases. Most of these medicinal plants may have scientific evidence to be considered in general practice. Objective The aim of this work was to investigate the antioxidant capacities and anti-inflammatory activities of ethanol extracts of leaves of Cassia alata, Eleusine indica, Carica papaya, Eremomastax speciosa and the stem bark of Polyscias fulva, collected in Cameroon. Methods Chemiluminescence was used to analyze the antioxidant activities of plant extracts against hydrogen peroxide or superoxide anion. Comet assays were used to analyze the protection against antioxidant-induced DNA damage induced in white blood cells after treating with hydrogen peroxide. Flow cytometry was used to measure γδ T cells proliferation and anti-inflammatory activity of γδ T cells and of immature dendritic cells (imDC) in the presence of different concentrations of plant extracts. Results Ethanol extracts showed strong antioxidant properties against both hydrogen peroxide and superoxide anion. Cassia alata showed the highest antioxidant activity. The effect of plant extracts on γδ T cells and imDC was evidenced by the dose dependent reduction in TNF-α production in the presence of Cassia alata, Carica papaya, Eremomastax speciosa Eleusine indica, and Polyscias fulva. γδ T cells proliferation was affected to the greatest extent by Polyscias fulva. Conclusion These results clearly show the antioxidant capacity and anti-inflammatory activities of plant extracts collected in Cameroon. These properties of leaves and stem bark extracts may contribute to the value for these plants in traditional medicine and in general medical practice. PMID:25090613

The diuretic effect in human subjects of an extract of Taraxacum officinale folium over a single day.

PubMed

Clare, Bevin A; Conroy, Richard S; Spelman, Kevin

2009-08-01

Taraxacum officinale (L.) Weber (Asteraceae) has been extensively employed as a diuretic in traditional folk medicine and in modern phytotherapy in Europe, Asia, and the Americas without prior clinical trial substantiation. In this pilot study, a high-quality fresh leaf hydroethanolic extract of the medicinal plant T. officinale (dandelion) was ingested by volunteers to investigate whether an increased urinary frequency and volume would result. Volume of urinary output and fluid intake were recorded by subjects. Baseline values for urinary frequency and excretion ratio (urination volume:fluid intake) were established 2 days prior to dandelion dosing (8 mL TID) and monitored throughout a 1-day dosing period and 24 hours postdosing. For the entire population (n = 17) there was a significant (p < 0.05) increase in the frequency of urination in the 5-hour period after the first dose. There was also a significant (p < 0.001) increase in the excretion ratio in the 5-hour period after the second dose of extract. The third dose failed to change any of the measured parameters. Based on these first human data, T. officinale ethanolic extract shows promise as a diuretic in humans. Further studies are needed to establish the value of this herb for induction of diuresis in human subjects.

Cancer cell specific cytotoxic effect of Rhoeo discolor extracts and solvent fractions.

PubMed

García-Varela, Rebeca; Fajardo Ramírez, Oscar Raúl; Serna-Saldivar, Sergio O; Altamirano, Julio; Cardineau, Guy A

2016-08-22

Traditional or folk medicine has led to the discovery of important bioactive substances used in several health-related areas. Phytochemicals in Rhoeo discolor (R. discolor) extracts have proven to have important cancer cell specific cytotoxic activity. In the present research, we determined the cytotoxic effect of extracts of R. discolor, a plant commonly used in Mexico for both medicinal and ornamental purposes. We evaluated the cytotoxic effects against three representative human cancer cell lines: HT-29 colon cancer, Hep-G2 liver cancer and PC-3 prostate cancer cell lines, as well as a control fibroblast cell line NIH 3T3. Ten different crude extracts were tested along with fractions derived from the five most bioactive crude extracts. Analytical data, HPLC-MS-TOF, revealed a high content of phenolic compounds such as anthocyanins, ferulic, vanillic, chlorogenic and p-coumaric acid in the extracts. Phenolic compounds have previously been reported as health beneficial with antioxidant and potential cancer specific cytotoxic effects. Studies revealed that low concentrations of these crude bioactive extracts (10µg/ml) and their fractions (50µg/ml) were effective as cancer specific cytotoxic agents, since they caused a significant proliferation inhibition on cancer cell lines (up to 94.2% in HT-29, 92.9% in Hep-G2 and 61.8% in PC-3 of apoptosis induction) with little harm to the control cell line (no higher than 28.3% apoptosis induction), and, importantly, the most effective extracts were mainly water, methanol and ethanol based. These results suggest that a diet containing these compounds may function as a medical aid or chemoprotective. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Studies of the in vitro anticancer, antimicrobial and antioxidant potentials of selected Yemeni medicinal plants from the island Soqotra

PubMed Central

2009-01-01

Background Recent years have witnessed that there is a revival of interest in drug discovery from medicinal plants for the maintenance of health in all parts of the world. The aim of this work was to investigate 26 plants belonging to 17 families collected from a unique place in Yemen (Soqotra Island) for their in vitro anticancer, antimicrobial and antioxidant activities. Methods The 26 plants were extracted with methanol and hot water to yield 52 extracts. Evaluation for in vitro anticancer activity was done against three human cancer cell lines (A-427, 5637 and MCF-7) by using an established microtiter plate assay based on cellular staining with crystal violet. Antimicrobial activity was tested against three Gram-positive bacteria, two Gram-negative bacteria, one yeast species and three multiresistant Staphylococcus strains by using an agar diffusion method and the determination of MIC against three Gram-positive bacteria with the broth micro-dilution assay. Antioxidant activity was investigated by measuring the scavenging activity of the DPPH radical. Moreover, a phytochemical screening of the methanolic extracts was done. Results Notable cancer cell growth inhibition was observed for extracts from Ballochia atro-virgata, Eureiandra balfourii and Hypoestes pubescens, with IC50 values ranging between 0.8 and 8.2 μg/ml. The methanol extracts of Acanthospermum hispidum, Boswellia dioscorides, Boswellia socotrana, Commiphora ornifolia and Euphorbia socotrana also showed noticeable antiproliferative potency with IC50 values < 50 μg/ml. The greatest antimicrobial activity was exhibited by extracts from Acacia pennivenia, Boswellia dioscorides, Boswellia socotrana, Commiphora ornifolia, Euclea divinorum, Euphorbia socotrana, Leucas samhaensis, Leucas virgata, Rhus thyrsiflora, and Teucrium sokotranum with inhibition zones > 15 mm and MIC values ≤ 250 μg/ml. In addition, the methanolic extracts of Acacia pennivenia, Boswellia dioscorides, Boswellia socotrana and Commiphora ornifolia showed good antioxidant potential at low concentrations (more than 80% at 50 μg/ml). Conclusion Our results show once again that medicinal plants can be promising sources of natural products with potential anticancer, antimicrobial and antioxidative activity. The results will guide the selection of some plant species for further pharmacological and phytochemical investigations. PMID:19320966

Antiamoebic and spasmolytic activities of extracts from some antidiarrhoeal traditional preparations used in Kinshasa, Congo.

PubMed

Tona, L; Kambu, K; Ngimbi, N; Mesia, K; Penge, O; Lusakibanza, M; Cimanga, K; De Bruyne, T; Apers, S; Totte, J; Pieters, L; Vlietinck, A J

2000-03-01

Three major extracts from some traditional preparations, based on medicinal plants, used as antidiarrhoeal agents were investigated for their putative antiamoebic and spasmolytic activities in vitro. Results indicated that both biological activities are concentrated in the polyphenolic fraction, and not in the saponin or alkaloid containing fractions. The most active polyphenolic extracts were those from Euphorbia hirta whole plant, leaves of Alchornea cordifolia, Crossopteryx febrifuga, Nauclea latifolia, Psidium guajava, Tithonia diversifolia, stem bark of Harungana madagascariensis, Mangifera indica, Maprounea africana and Psidium guajava, inhibiting Entamoeba histolytica growth with MAC < 10 micrograms/ml. The same extracts, at a concentration of 80 micrograms/ml in an organ bath, also exhibited more than 70% inhibition of acetylcholine and/or KCl solution-induced contractions on isolated guinea-pig ileum.

The paradox of natural products as pharmaceuticals. Experimental evidences of a mango stem bark extract.

PubMed

Núñez-Sellés, Alberto J; Delgado-Hernández, René; Garrido-Garrido, Gabino; García-Rivera, Dagmar; Guevara-García, Mariela; Pardo-Andreu, Gilberto L

2007-05-01

Recent findings regarding basic, pre-clinical and clinical studies on a mango stem bark extract (MSBE) developed in Cuba (Vimang) on an industrial scale are summarized. Ethnomedical studies, extract reproducibility, biological effects and clinical evaluations in terms of patient quality of life are described as experimental evidences to support the statement that natural products, even being a mixture of compounds, could be as effective as "monoceuticals" for medical uses. Discussion about the use of "monoceuticals" versus "natureceuticals" in health care and medicine is based on effectiveness and availability, taking Vimang as an example of a natural product with supported scientific evidence to be used as antioxidant, analgesic, anti-inflammatory and immunomodulator.

Lion's Mane, Hericium erinaceus and Tiger Milk, Lignosus rhinocerotis (Higher Basidiomycetes) Medicinal Mushrooms Stimulate Neurite Outgrowth in Dissociated Cells of Brain, Spinal Cord, and Retina: An In Vitro Study.

PubMed

Samberkar, Snehlata; Gandhi, Sivasangkary; Naidu, Murali; Wong, Kah-Hui; Raman, Jegadeesh; Sabaratnam, Vikineswary

2015-01-01

Neurodegenerative disease is defined as a deterioration of the nervous system in the intellectual and cognitive capabilities. Statistics show that more than 80-90 million individuals age 65 and above in 2050 may be affected by neurodegenerative conditions like Alzheimer's and Parkinson's disease. Studies have shown that out of 2000 different types of edible and/or medicinal mushrooms, only a few countable mushrooms have been selected until now for neurohealth activity. Hericium erinaceus is one of the well-established medicinal mushrooms for neuronal health. It has been documented for its regenerative capability in peripheral nerve. Another mushroom used as traditional medicine is Lignosus rhinocerotis, which has been used for various illnesses. It has been documented for its neurite outgrowth potential in PC12 cells. Based on the regenerative capabilities of both the mushrooms, priority was given to select them for our study. The aim of this study was to investigate the potential of H. erinaceus and L. rhinocerotis to stimulate neurite outgrowth in dissociated cells of brain, spinal cord, and retina from chick embryo when compared to brain derived neurotrophic factor (BDNF). Neurite outgrowth activity was confirmed by the immu-nofluorescence method in all tissue samples. Treatment with different concentrations of extracts resulted in neuronal differentiation and neuronal elongation. H. erinaceus extract at 50 µg/mL triggered neurite outgrowth at 20.47%, 22.47%, and 21.70% in brain, spinal cord, and retinal cells. L. rhinocerotis sclerotium extract at 50 µg/mL induced maximum neurite outgrowth of 20.77% and 24.73% in brain and spinal cord, whereas 20.77% of neurite outgrowth was observed in retinal cells at 25 µg/mL, respectively.

In Vitro efficacy of antimicrobial extracts against the atypical ruminant pathogen Mycoplasma mycoides subsp. capri.

PubMed

Arjoon, Amanda V; Saylor, Charlotte V; May, Meghan

2012-10-02

Mycoplasmosis is a common infection in human and veterinary medicine, and is associated with chronic inflammation and high morbidity. Mycoplasma species are often intrinsically resistant to many conventional antimicrobial therapies, and the resistance patterns of pathogenic mycoplasmas to commonly used medicinal (antimicrobial) plant extracts are currently unknown. Aqueous extracts, ethanol extracts, or oils of the targeted plant species and colloidal silver were prepared or purchased. Activity against the wall-less bacterial pathogen Mycoplasma mycoides subsp. capri was determined and compared to activities measured against Escherichia coli and Bacillus subtilis. Antimicrobial susceptibility testing was performed by broth microdilution assays. The lethal or inhibitory nature of each extract was determined by subculture into neat growth medium. Growth of M. mycoides capri, E. coli, and B. subtilis was inhibited by elderberry extract, oregano oil, ethanol extract of oregano leaves, and ethanol extract of goldenseal root. No inhibition was seen with aqueous extract of astragalus or calendula oil. Growth of M. mycoides capri and B. subtilis was inhibited by ethanol extract of astragalus, whereas growth of E. coli was not. Similarly, M. mycoides capri and E. coli were inhibited by aqueous extract of thyme, but B. subtilis was unaffected. Only B. subtilis was inhibited by colloidal silver. Measured MICs ranged from 0.0003 mg/mL to 3.8 mg/mL. Bacteriostatic and bactericidal effects differed by species and extract. The atypical pathogen M. mycoides capri was sensitive to extracts from many medicinal plants commonly used as antimicrobials in states of preparation and concentrations currently available for purchase in the United States and Europe. Variation in bacteriostatic and bactericidal activities between species and extracts indicates that multiple effecter compounds are present in these plant species.

In Vitro efficacy of antimicrobial extracts against the atypical ruminant pathogen Mycoplasma mycoides subsp. capri

PubMed Central

2012-01-01

Background Mycoplasmosis is a common infection in human and veterinary medicine, and is associated with chronic inflammation and high morbidity. Mycoplasma species are often intrinsically resistant to many conventional antimicrobial therapies, and the resistance patterns of pathogenic mycoplasmas to commonly used medicinal (antimicrobial) plant extracts are currently unknown. Methods Aqueous extracts, ethanol extracts, or oils of the targeted plant species and colloidal silver were prepared or purchased. Activity against the wall-less bacterial pathogen Mycoplasma mycoides subsp. capri was determined and compared to activities measured against Escherichia coli and Bacillus subtilis. Antimicrobial susceptibility testing was performed by broth microdilution assays. The lethal or inhibitory nature of each extract was determined by subculture into neat growth medium. Results Growth of M. mycoides capri, E. coli, and B. subtilis was inhibited by elderberry extract, oregano oil, ethanol extract of oregano leaves, and ethanol extract of goldenseal root. No inhibition was seen with aqueous extract of astragalus or calendula oil. Growth of M. mycoides capri and B. subtilis was inhibited by ethanol extract of astragalus, whereas growth of E. coli was not. Similarly, M. mycoides capri and E. coli were inhibited by aqueous extract of thyme, but B. subtilis was unaffected. Only B. subtilis was inhibited by colloidal silver. Measured MICs ranged from 0.0003 mg/mL to 3.8 mg/mL. Bacteriostatic and bactericidal effects differed by species and extract. Conclusions The atypical pathogen M. mycoides capri was sensitive to extracts from many medicinal plants commonly used as antimicrobials in states of preparation and concentrations currently available for purchase in the United States and Europe. Variation in bacteriostatic and bactericidal activities between species and extracts indicates that multiple effecter compounds are present in these plant species. PMID:23031072

Extraction and labeling high-resolution images from PDF documents

NASA Astrophysics Data System (ADS)

Chachra, Suchet K.; Xue, Zhiyun; Antani, Sameer; Demner-Fushman, Dina; Thoma, George R.

2013-12-01

Accuracy of content-based image retrieval is affected by image resolution among other factors. Higher resolution images enable extraction of image features that more accurately represent the image content. In order to improve the relevance of search results for our biomedical image search engine, Open-I, we have developed techniques to extract and label high-resolution versions of figures from biomedical articles supplied in the PDF format. Open-I uses the open-access subset of biomedical articles from the PubMed Central repository hosted by the National Library of Medicine. Articles are available in XML and in publisher supplied PDF formats. As these PDF documents contain little or no meta-data to identify the embedded images, the task includes labeling images according to their figure number in the article after they have been successfully extracted. For this purpose we use the labeled small size images provided with the XML web version of the article. This paper describes the image extraction process and two alternative approaches to perform image labeling that measure the similarity between two images based upon the image intensity projection on the coordinate axes and similarity based upon the normalized cross-correlation between the intensities of two images. Using image identification based on image intensity projection, we were able to achieve a precision of 92.84% and a recall of 82.18% in labeling of the extracted images.

Potential of medicinal plants from the Brazilian semi-arid region (Caatinga) against Staphylococcus epidermidis planktonic and biofilm lifestyles.

PubMed

Trentin, Danielle da Silva; Giordani, Raquel Brandt; Zimmer, Karine Rigon; da Silva, Alexandre Gomes; da Silva, Márcia Vanusa; Correia, Maria Tereza Dos Santos; Baumvol, Israel Jacob Rabin; Macedo, Alexandre José

2011-09-01

Medicinal plants from the Caatinga, a Brazilian xeric shrubland, are used in folk medicine to treat infections. These ethnopharmacological data can contribute to obtaining new antimicrobial/antibiofilm extracts and natural product prototypes for the development of new drugs. The aim of this study was to investigate the antibiofilm and antibacterial activities of 45 aqueous extracts from 24 Caatinga plant species. The effect of aqueous extracts on planktonic cells and on biofilm formation by Staphylococcus epidermidis was studied by the OD(600) absorbance and by the crystal violet assay, respectively. Scanning electron microscopy (SEM) was used to generate comparative images of extract-treated and untreated biofilms. Chromatographic analyses were performed to characterize the active extracts. The in vitro screening, at 0.4 mg/mL and 4.0mg/mL, showed 20 plants effective in preventing biofilm formation and 13 plants able to inhibit planktonic bacterial growth. SEM images demonstrated distinct profiles of bacterial adhesion, matrix production and cell morphology according to different treatments and surfaces. The phytochemical analysis of the selected active extracts indicates the polyphenols, coumarins, steroids and terpenes as possible active compounds. This study describes the first antibiofilm and antibacterial screening of Caatinga plants against S. epidermidis. The evaluation presented in this study confirms several ethnopharmacological reports and can be utilized to identify new antibiofilm and antibacterial products against S. epidermidis from traditional Brazilian medicine. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

Biomaterial based sulphur di oxide gas sensor

NASA Astrophysics Data System (ADS)

Ghosh, P. K.; Sarkar, A.

2013-06-01

Biomaterials are getting importance in the present research field of sensors. In this present paper performance of biomaterial based gas sensor made of gum Arabica and garlic extract had been studied. Extract of garlic clove with multiple medicinal and chemical utility can be proved to be useful in sensing Sulphur di Oxide gas. On exposure to Sulphur di Oxide gas the material under observation suffers some temporary structural change, which can be observed in form of amplified potentiometric change through simple electronic circuitry. Exploiting this very property a potentiometric gas sensor of faster response and recovery time can be designed. In this work sensing property of the said material has been studied through DC conductance, FTIR spectrum etc.

An examination of the prescription and dispensing of medicines by Western herbal therapists: a national survey in Australia.

PubMed

Casey, M G; Adams, J; Sibbritt, D

2007-03-01

To describe the patterns of prescription and dispensing of herbal medicines employed by Western herbal practitioners in Australia. A national postal survey sent to all full members of the National Herbalist Association of Australia (NHAA). Nationwide clinics of professional herbal practitioners in Australia. Measures of medicinal use were collected including aspects of prescription, formulation, dispensing and preparation forms of medicines used. The practitioners were asked if they dispensed their own medicines, about the form of herbal preparations used, aspects of formulation and dosages. The predominant prescription by most Western herbal practitioners in Australia is individualised herbal formulae rather than the use of single herbs. Traditional preparations of herbals such as teas and powders are used but liquid herbal extracts are most commonly dispensed. These liquid medicines are in the form of highly concentrated fluid extracts in ratios of 1:1 or 1:2, herb material to liquid. Pre-formulated tablets or capsules made by herbal manufacturers are being incorporated into modern practice but most prescriptions are individualised liquid formulae prepared and dispensed, from the clinic dispensary, after patient consultation. In addition to internal prescriptions, topical creams, pessaries, douches, gargles, eyebaths and poultices or washes are still incorporated into treatments. Although there is variation in used dosage ranges, the predominant system is that of pharmacologically active doses of highly concentrated fluid extracts. The professional prescription of Western herbal medicines is different to commercial usage. As opposed to pre-formulated tablets, or use of single herbals, the vast majority of Western herbalists in Australia construct individualised herbal formulations for their patients after consultation. The preferred form of administration of these prescriptions is as highly concentrated liquid herbal extracts in pharmacologically active doses.

The Effect of Storage and Extraction Methods on Amplification of Plasmodium falciparum DNA from Dried Blood Spots.

PubMed

Schwartz, Alanna; Baidjoe, Amrish; Rosenthal, Philip J; Dorsey, Grant; Bousema, Teun; Greenhouse, Bryan

2015-05-01

Extraction and amplification of DNA from dried blood spots (DBS) collected in field studies is commonly used for detection of Plasmodium falciparum. However, there have been few systematic efforts to determine the effects of storage and extraction methods on the sensitivity of DNA amplification. We investigated the effects of storage conditions, length of storage, and DNA extraction methods on amplification via three PCR-based assays using field samples and laboratory controls. Samples stored as DBS for 2 or more years at ambient temperature showed a significant loss of sensitivity that increased with time; after 10 years only 10% samples with parasite densities > 1,000 parasites/μL were detectable by nested polymerase chain reaction (PCR). Conversely, DBS and extracted DNA stored at -20°C showed no loss of sensitivity with time. Samples with low parasite densities amplified more successfully with saponin/Chelex compared with spin-column-based extraction, though the latter method performed better on samples with higher parasite densities stored for 2 years at ambient temperature. DNA extracted via both methods was stable after 20 freeze-thaw cycles. Our results suggest that DBS should be stored at -20°C or extracted immediately, especially if anticipating 2 or more years of storage. © The American Society of Tropical Medicine and Hygiene.

GC-MS evaluation of Cymbopogon citratus (DC) Stapf oil obtained using modified hydrodistillation and microwave extraction methods.

PubMed

Ajayi, E O; Sadimenko, A P; Afolayan, A J

2016-10-15

Bioactive compounds of Cymbopogon citratus essential oil, using different media have been tentatively identified with the aid of gas chromatography-mass spectrometry (GC-MS). Hydrodistillation was complemented using weakly acidic and alkaline media for the oil extraction. Solvent-free microwave extraction (SFME) was also used. Analyses of the oils revealed the presence of 7, 16, 22, and 15 compounds in the water-distilled (WD), microwave-distilled (MD), acid-distilled (AD), and base-distilled (BD), essential oils, respectively. Total yield of the volatile fractions was 0.73%, 0.64%, 0.70%, and 0.45%, respectively. Citral was found to be the major component, the base extraction having the highest content. This was followed by 2-isopropenyl-5-methylhex-4-enal, p-cymene, and 2-thujene. The antimicrobial, antibacterial, and antioxidant activities and assessment of medicinal/nutritional uses of the essential oils are subjects of future studies. Copyright © 2016. Published by Elsevier Ltd.

[Effect of medicinal plant extracts on the growth of microorganisms].

PubMed

Baronets, N G; Adlova, G P; Mel'nikova, V A

2001-01-01

Extracts obtained from sweatweed and licorice roots, flax seeds, milfoil, bur-marigold, plantain, coltsfoot, nettle, Indian corn stigmas, laminaria produced a stimulating effect on the growth of Candida albicans test strain and Streptococcus pyogenes test strain Dick 1. Sweatweed, licorice, Aerva lanata and violet extracts influenced the growth of Corynebacterium xerosis 1911, while sweatweed, violet, horse-tail, bur-marigold, camomile, plantain, and nettle extracts influenced the growth of shigellae. The stimulating effect could be supposedly produced by biologically active substances contained in medicinal plants (organic acids, alkaloids, carotinoids, vitamins, microelements). Further studies aimed at the identification of substances producing the stimulating effect are planned.

[Study on scavenging activity to DPPH free radical of different polarity components in Guizhou Miao medicine "bod zangd dak"].

PubMed

Du, Hong-zhi; Nong, Heng; Dong, Li-sha; Li, Jia-li; Liu, Ming; He, Xi-cheng; Zhang, Jing

2015-06-01

The paper is aimed to search more natural plant antioxidants and further research and develop new medicinal plant resources in Guizhou. The Guizhou special miao medicine "bod zangd dak" was extracted with 60% ethanol. The antioxidant activity of the different polarity components separated from the extract was tested by DPPH method with ascorbic acid as positive control. The results showed that the IC50 of the different polarity components was as following: ascorbic acid (0.033 4 g x L(-1)) < ethyl acetate components (0.052 3 g x L(-1)) < total tannins components (0.054 9 g x L(-1)) < 60% ethanol extraction components (0.076 7 g x L(-1)) < butanol extraction components (0.110 g x L(-1)) < water-soluble polysaccharides components (0.168 g x L(-1)) < water extraction components (0.174 g x L(-1)) < water components after extraction (0.226 g x L(-1)) < total polysaccharides components (0.645 g x L(-1)). It is concluded that the different polarity components have different free radical scavenging activity and that provides a scientific basis for further search of the active ingredients and the activive mechanism.

ANTI-QUORUM SENSING ACTIVITY OF SOME MEDICINAL PLANTS.

PubMed

Al-Haidari, Rwaida A; Shaaban, Mona I; Ibrahim, Sabrin R M; Mohamed, Gamal A

2016-01-01

Quorum sensing is the key regulator of virulence factors of Pseudomonas aeruginosa such as biofilm formation, motility, productions of proteases, hemolysin, pyocyanin, and toxins. The aim of this study was to explore the effect of the extracts from some medicinal plants on quorum sensing and related virulence factors of P. aeruginosa . Quorum sensing inhibitory (OSI) effect of the alcohol extracts of 20 medicinal plants was evaluated by Chromobacterium violaceum reporter using agar cup diffusion method. The efficient QSI extracts were tested for their activity against biofilm synthesis, motility, and synthesis of pyocyanin from P. aeruginosa PA14. The extracts of Citrus sinensis, Laurus nobilis, Elettaria cardamomum, Allium cepa , and Coriandrum sativum exhibited potent quorum quenching effect. On the other hand, Psidium guajava and Mentha longifolia extracts showed lower QSI activity. These extracts exhibited significant elimination of pyocyanin formation and biofilm development of Pseudomonas aeruginosa PA14. In addition, they significantly inhibited twitching and swimming motilities of P. aeruginosa PA14. This study illustrated, for the first time, the importance of C. sinensis, L. nobilis, E. cardamomum, A. cepa , and C. sativum as quorum sensing inhibitors and virulence suppressors of P. aeruginosa . Thus, these plants could provide a natural source for the elimination of Pseudomonas pathogenesis.

Development of Mushroom-Based Cosmeceutical Formulations with Anti-Inflammatory, Anti-Tyrosinase, Antioxidant, and Antibacterial Properties.

PubMed

Taofiq, Oludemi; Heleno, Sandrina A; Calhelha, Ricardo C; Alves, Maria José; Barros, Lillian; Barreiro, Maria Filomena; González-Paramás, Ana M; Ferreira, Isabel C F R

2016-10-14

The cosmetic industry is in a constant search for natural compounds or extracts with relevant bioactive properties, which became valuable ingredients to design cosmeceutical formulations. Mushrooms have been markedly studied in terms of nutritional value and medicinal properties. However, there is still slow progress in the biotechnological application of mushroom extracts in cosmetic formulations, either as antioxidants, anti-aging, antimicrobial, and anti-inflammatory agents or as hyperpigmentation correctors. In the present work, the cosmeceutical potential of ethanolic extracts prepared from Agaricus bisporus , Pleurotus ostreatus , and Lentinula edodes was analyzed in terms of anti-inflammatory, anti-tyrosinase, antioxidant, and antibacterial activities. The extracts were characterized in terms of phenolic acids and ergosterol composition, and further incorporated in a base cosmetic cream to achieve the same bioactive purposes. From the results obtained, the final cosmeceutical formulations presented 85%-100% of the phenolic acids and ergosterol levels found in the mushroom extracts, suggesting that there was no significant loss of bioactive compounds. The final cosmeceutical formulation also displayed all the ascribed bioactivities and as such, mushrooms can further be exploited as natural cosmeceutical ingredients.

1H NMR based metabolic profiling of eleven Algerian aromatic plants and evaluation of their antioxidant and cytotoxic properties.

PubMed

Brahmi, Nabila; Scognamiglio, Monica; Pacifico, Severina; Mekhoukhe, Aida; Madani, Khodir; Fiorentino, Antonio; Monaco, Pietro

2015-10-01

Eleven Algerian medicinal and aromatic plants (Aloysia triphylla, Apium graveolens, Coriandrum sativum, Laurus nobilis, Lavandula officinalis, Marrubium vulgare, Mentha spicata, Inula viscosa, Petroselinum crispum, Salvia officinalis, and Thymus vulgaris) were selected and their hydroalcoholic extracts were screened for their antiradical and antioxidant properties in cell-free systems. In order to identify the main metabolites constituting the extracts, 1 H NMR-based metabolic profiling was applied. Data obtained emphasized the antiradical properties of T. vulgaris, M. spicata and L. nobilis extracts (RACI 1.37, 0.97 and 0.93, respectively), whereas parsley was the less active as antioxidant (RACI -1.26). When the cytotoxic effects of low and antioxidant doses of each extract were evaluated towards SK-N-BE(2)C neuronal and HepG2 hepatic cell lines, it was observed that all the extracts weakly affected the metabolic redox activity of the tested cell lines. Overall, data strongly plead in favor of the use of these plants as potential food additives in replacement of synthetic compounds. Copyright © 2015 Elsevier Ltd. All rights reserved.

Novel mathematic models for quantitative transitivity of quality-markers in extraction process of the Buyanghuanwu decoction.

PubMed

Zhang, Yu-Tian; Xiao, Mei-Feng; Deng, Kai-Wen; Yang, Yan-Tao; Zhou, Yi-Qun; Zhou, Jin; He, Fu-Yuan; Liu, Wen-Long

2018-06-01

Nowadays, to research and formulate an efficiency extraction system for Chinese herbal medicine, scientists have always been facing a great challenge for quality management, so that the transitivity of Q-markers in quantitative analysis of TCM was proposed by Prof. Liu recently. In order to improve the quality of extraction from raw medicinal materials for clinical preparations, a series of integrated mathematic models for transitivity of Q-markers in quantitative analysis of TCM were established. Buyanghuanwu decoction (BYHWD) was a commonly TCMs prescription, which was used to prevent and treat the ischemic heart and brain diseases. In this paper, we selected BYHWD as an extraction experimental subject to study the quantitative transitivity of TCM. Based on theory of Fick's Rule and Noyes-Whitney equation, novel kinetic models were established for extraction of active components. Meanwhile, fitting out kinetic equations of extracted models and then calculating the inherent parameters in material piece and Q-marker quantitative transfer coefficients, which were considered as indexes to evaluate transitivity of Q-markers in quantitative analysis of the extraction process of BYHWD. HPLC was applied to screen and analyze the potential Q-markers in the extraction process. Fick's Rule and Noyes-Whitney equation were adopted for mathematically modeling extraction process. Kinetic parameters were fitted and calculated by the Statistical Program for Social Sciences 20.0 software. The transferable efficiency was described and evaluated by potential Q-markers transfer trajectory via transitivity availability AUC, extraction ratio P, and decomposition ratio D respectively. The Q-marker was identified with AUC, P, D. Astragaloside IV, laetrile, paeoniflorin, and ferulic acid were studied as potential Q-markers from BYHWD. The relative technologic parameters were presented by mathematic models, which could adequately illustrate the inherent properties of raw materials preparation and affection of Q-markers transitivity in equilibrium processing. AUC, P, D for potential Q-markers of AST-IV, laetrile, paeoniflorin, and FA were obtained, with the results of 289.9 mAu s, 46.24%, 22.35%; 1730 mAu s, 84.48%, 1.963%; 5600 mAu s, 70.22%, 0.4752%; 7810 mAu s, 24.29%, 4.235%, respectively. The results showed that the suitable Q-markers were laetrile and paeoniflorin in our study, which exhibited acceptable traceability and transitivity in the extraction process of TCMs. Therefore, these novel mathematic models might be developed as a new standard to control TCMs quality process from raw medicinal materials to product manufacturing. Copyright © 2018 Elsevier GmbH. All rights reserved.

Biological activity of common mullein, a medicinal plant.

PubMed

Turker, Arzu Ucar; Camper, N D

2002-10-01

Common Mullein (Verbascum thapsus L., Scrophulariaceae) is a medicinal plant that has been used for the treatment of inflammatory diseases, asthma, spasmodic coughs, diarrhea and other pulmonary problems. The objective of this study was to assess the biological activity of Common Mullein extracts and commercial Mullein products using selected bench top bioassays, including antibacterial, antitumor, and two toxicity assays--brine shrimp and radish seed. Extracts were prepared in water, ethanol and methanol. Antibacterial activity (especially the water extract) was observed with Klebsiella pneumonia, Staphylococcus aureus, Staphylococcus epidermidis and Escherichia coli. Agrobacterium tumefaciens-induced tumors in potato disc tissue were inhibited by all extracts. Toxicity to Brine Shrimp and to radish seed germination and growth was observed at higher concentrations of the extracts.

Anti-bacterial activity of some Brazilian medicinal plants.

PubMed

de Lima, Maria Raquel Ferreira; de Souza Luna, Josiane; dos Santos, Aldenir Feitosa; de Andrade, Maria Cristina Caño; Sant'Ana, Antônio Euzébio Goulart; Genet, Jean-Pierre; Marquez, Béatrice; Neuville, Luc; Moreau, Nicole

2006-04-21

Extracts from various organs of 25 plants of Brazilian traditional medicine were assayed with respect to their anti-bacterial activities against Escherichia coli, a susceptible strain of Staphylococcus aureus and two resistant strains of Staphylococcus aureus harbouring the efflux pumps NorA and MsrA. Amongst the 49 extracts studied, 14 presented anti-bacterial activity against Staphylococcus aureus, including the ethanolic extracts from the rhizome of Jatropha elliptica, from the stem barks of Schinus terebinthifolius and Erythrina mulungu, from the stems and leaves of Caesalpinia pyramidalis and Serjania lethalis, and from the stem bark and leaves of Lafoensia pacari. The classes of compounds present in the active extracts were determined as a preliminary step towards their bioactivity-guided separation. No extracts were active against Escherichia coli.

Traditional Preparations and Methanol Extracts of Medicinal Plants from Papua New Guinea Exhibit Similar Cytochrome P450 Inhibition

PubMed Central

Rai, Prem P.; Matainaho, Teatulohi K.; Piskaut, Pius; Franklin, Michael R.

2016-01-01

The hypothesis underlying this current work is that fresh juice expressed from Papua New Guinea (PNG) medicinal plants (succus) will inhibit human Cytochrome P450s (CYPs). The CYP inhibitory activity identified in fresh material was compared with inhibition in methanol extracts of dried material. Succus is the most common method of traditional medicine (TM) preparation for consumption in PNG. There is increasing concern that TMs might antagonize or complicate drug therapy. We have previously shown that methanol extracts of commonly consumed PNG medicinal plants are able to induce and/or inhibit human CYPs in vitro. In this current work plant succus was prepared from fresh plant leaves. Inhibition of three major CYPs was determined using human liver microsomes and enzyme-selective model substrates. Of 15 species tested, succus from 6/15 was found to inhibit CYP1A2, 7/15 inhibited CYP3A4, and 4/15 inhibited CYP2D6. Chi-squared tests determined differences in inhibitory activity between succus and methanol preparations. Over 80% agreement was found. Thus, fresh juice from PNG medicinal plants does exhibit the potential to complicate drug therapy in at risk populations. Further, the general reproducibility of these findings suggests that methanol extraction of dried material is a reasonable surrogate preparation method for fresh plant samples. PMID:27642356

Guava extract (Psidium guajava) alters the labelling of blood constituents with technetium-99m*

PubMed Central

Abreu, P.R.C.; Almeida, M.C.; Bernardo, R.M.; Bernardo, L.C.; Brito, L.C.; Garcia, E.A.C.; Fonseca, A.S.; Bernardo-Filho, M.

2006-01-01

Psidium guajava (guava) leaf is a phytotherapic used in folk medicine to treat gastrointestinal and respiratory disturbances and is used as anti-inflammatory medicine. In nuclear medicine, blood constituents (BC) are labelled with technetium-99m (99mTc) and used to image procedures. However, data have demonstrated that synthetic or natural drugs could modify the labelling of BC with 99mTc. The aim of this work was to evaluate the effects of aqueous extract of guava leaves on the labelling of BC with 99mTc. Blood samples of Wistar rats were incubated with different concentrations of guava extract and labelled with 99mTc after the percentage of incorporated radioactivity (%ATI) in BC was determined. The results suggest that aqueous guava extract could present antioxidant action and/or alters the membrane structures involved in ion transport into cells, thus decreasing the radiolabelling of BC with 99mTc. The data showed significant (P<0.05) alteration of ATI in BC from blood incubated with guava extract. PMID:16691636

Antioxidant activity, phenolic content, and peroxide value of essential oil and extracts of some medicinal and aromatic plants used as condiments and herbal teas in Turkey.

PubMed

Ozcan, Mehmet Musa; Erel, Ozcan; Herken, Emine Etöz

2009-02-01

The antioxidant activity, total peroxide values, and total phenol contents of several medicinal and aromatic plant essential oil and extracts from Turkey were examined. Total phenolic contents were determined using a spectrophotometric technique and calculated as gallic acid equivalents. Total antioxidant activity of essential oil and extracts varied from 0.6853 to 1.3113 and 0.3189 to 0.6119 micromol of Trolox equivalents/g, respectively. The total phenolic content of essential oil ranged from 0.0871 to 0.5919 mg of gallic acid/g dry weight. However, the total phenolic contents of extracts were found to be higher compared with those of essential oils. The amount of total peroxide values of oils varied from 7.31 (pickling herb) to 58.23 (bitter fennel flower) mumol of H(2)O(2)/g. As a result, it is shown that medicinal plant derivatives such as extract and essential oils can be useful as a potential source of total phenol, peroxide, and antioxidant capacity for protection of processed foods.

Effective Method of Purification of Betulin from Birch Bark: The Importance of Its Purity for Scientific and Medicinal Use

PubMed Central

Šiman, Pavel; Filipová, Alžběta; Tichá, Alena; Niang, Mohamed; Bezrouk, Aleš; Havelek, Radim

2016-01-01

A new and relatively simple method for purification of betulin from birch bark extract was developed in this study. Its five purification steps are based on the differential solubility of extract components in various solvents and their crystallization and/or precipitation, on their affinity for Ca(OH)2 in ethanol, and on the affinity of some impurities for silica gel in chloroform. In addition, all used solvents can be simply recycled. Betulin of more than 99% purity can be prepared by this method with minimal costs. Various observations including crystallization of betulin, changes in crystals during heating, and attempt of localization of betulin in outer birch bark are also described in this work. The original extract, fraction without betulinic acid and lupeol, amorphous fraction of pure betulin, final crystalline fraction of pure betulin and commercial betulin as a standard were employed to determine the antiproliferative/cytotoxic effect. We used WST-1 tetrazolium-based assays with triple negative breast cancer cell line BT-549. The decrease in cell survival showed clear relationship with the purity of the samples, being most pronounced using our final product of pure crystalline betulin. WST-1 proliferation/cytotoxicity test using triple negative breast cancer cell line BT-549 clearly showed the importance of purity of betulin for biological experiments and, apparently, for its medicinal use. PMID:27152419

Modern extraction techniques and their impact on the pharmacological profile of Serenoa repens extracts for the treatment of lower urinary tract symptoms

PubMed Central

2014-01-01

Background Bioactive compounds from plants (i.e., Serenoa repens) are often used in medicine in the treatment of several pathologies, among which benign prostatic hyperplasia (BPH) associated to lower urinary tract symptoms (LUTS). Discussion There are different techniques of extraction, also used in combination, with the aim of enhancing the amount of the target molecules, gaining time and reducing waste of solvents. However, the qualitative and quantitative composition of the bioactives depends on the extractive process, and so the brands of the recovered products from the same plant are different in terms of clinical efficacy (no product interchangeability among different commercial brands). Summary In this review, we report on several and recent extraction techniques and their impact on the composition/biological activity of S. repens-based available products. PMID:25112532

Bioactive molecules in Kalanchoe pinnata leaves: extraction, purification, and identification.

PubMed

El Abdellaoui, Saïda; Destandau, Emilie; Toribio, Alix; Elfakir, Claire; Lafosse, Michel; Renimel, Isabelle; André, Patrice; Cancellieri, Perrine; Landemarre, Ludovic

2010-10-01

Kalanchoe pinnata (Lam.) Pers. (syn. Bryophyllum pinnatum; family Crassulaceae) is a popular plant used in traditional medicine in many temperate regions of the world and particularly in South America. In Guyana, the leaves are traditionally used as an anti-inflammatory and antiseptic to treat coughs, ulcers, and sores. The purpose of this study was to implement a method for targeting and identifying molecules with antimicrobial activity, which could replace chemical preservatives in cosmetic applications. The leaves were extracted by a method based on pressurized liquid extraction (PLE), using different solvents. A study of antimicrobial activity and cytotoxicity tests were performed to select the most interesting extract. To isolate one or more active molecules, the selected crude extract was fractionated by centrifugal partition chromatography (CPC) and then antimicrobial activity and cytotoxicity of each fraction were tested under the same procedure. The last step consisted of identifying the main compounds in the most active fraction by LC-MS/MS.

Inhibitory potential of some Romanian medicinal plants against enzymes linked to neurodegenerative diseases and their antioxidant activity

PubMed Central

Paun, Gabriela; Neagu, Elena; Albu, Camelia; Radu, Gabriel Lucian

2015-01-01

Context: Eryngium planum, Geum urbanum and Cnicus benedictus plants are an endemic botanical from the Romanian used in folk medicine. Objective: The extracts from three Romanian medicinal plants were investigated for their possible neuroprotective potential. Materials and Methods: Within this study, in vitro neuroprotective activity of the extracts of E. planum, G. urbanum, and C. benedictus plants were investigated via inhibition of acetylcholinesterase (AChE) and tyrosinase (TYR). Total content of phenolics, flavonoids, and proanthocyanidins, high-performance liquid chromatography profile of the main phenolic compounds and antioxidant activity were also determined. Results: Among the tested extracts, the best inhibition of AChE (88.76 ± 5.2%) and TYR (88.5 ± 5.2%) was caused by C. benedictus ethanol (EtOH) extract. The G. urbanum extracts exerted remarkable scavenging effect against 2, 2-diphenyl-1-picrylhydrazyl (IC50, 7.8 ± 0.5 μg/mL aqueous extract, and IC50, 1.3 ± 0.1 μg/mL EtOH extract, respectively) and reducing power, whereas the EtOH extract of C. benedictus showed high scavenging activity (IC50, 0.609 ± 0.04 mg/mL), also. Conclusion: According to our knowledge, this is the first study that demonstrates in vitro neuroprotective effects of E. planum, G. urbanum and C. benedictus. PMID:26109755

Anti-tumorigenic activity of five culinary and medicinal herbs grown under greenhouse conditions and their combination effects.

PubMed

Yi, Weiguang; Wetzstein, Hazel Y

2011-08-15

Herbs and spices have been used as food preservatives, flavorings, and in traditional medicines for thousands of years. More and more scientific evidence supports the medicinal properties of culinary herbs. Colon cancer is the third leading cause of cancer death in the USA, and the fourth most common form of cancer worldwide. The objectives of this study were to evaluate the antitumor activity of five selected herbs grown under greenhouse conditions, and to study the potential synergistic effects among different herbal extract combinations. Thyme, rosemary, sage, spearmint, and peppermint extracts significantly inhibited SW-480 colon cancer cell growth, with sage extracts exhibiting the highest bioactivity, with 50% inhibition at 35.9 µg mL⁻¹, which was equivalent to 93.9 µg dried leaves mL⁻¹ of culture medium. Some mixtures of different herbal extracts had combination effects on cancer cell growth. The inhibitory effects of peppermint + sage combinations at a 1:1 ratio were significantly higher than rosemary + sage combinations at 1:1 ratio, although peppermint extracts showed lower inhibition than rosemary extracts. Extracts from herb species (thyme, rosemary, sage, spearmint and peppermint) can significantly inhibit the growth of human colon cancer cells. Mixtures of herb extracts can have combination effects on cancer cell growth. The study suggests that these five herbs may have potential health benefits to suppress colon cancer. Copyright © 2011 Society of Chemical Industry.

Antimicrobial Activity of Medicinal Plants Correlates with the Proportion of Antagonistic Endophytes

PubMed Central

Egamberdieva, Dilfuza; Wirth, Stephan; Behrendt, Undine; Ahmad, Parvaiz; Berg, Gabriele

2017-01-01

Medicinal plants are known to harbor potential endophytic microbes, due to their bioactive compounds. In a first study of ongoing research, endophytic bacteria were isolated from two medicinal plants, Hypericum perforatum and Ziziphora capitata with contrasting antimicrobial activities from the Chatkal Biosphere Reserve of Uzbekistan, and their plant-specific traits involved in biocontrol and plant growth promotion were evaluated. Plant extracts of H. perforatum exhibited a remarkable activity against bacterial and fungal pathogens, whereas extracts of Z. capitata did not exhibit any potential antimicrobial activity. Matrix-assisted laser desorption ionization (MALDI) time-of-flight (TOF) mass spectrometry (MS) was used to identify plant associated culturable endophytic bacteria. The isolated culturable endophytes associated with H. perforatum belong to eight genera (Arthrobacter, Achromobacter, Bacillus, Enterobacter, Erwinia, Pseudomonas, Pantoea, Serratia, and Stenotrophomonas). The endophytic isolates from Z. capitata also contain those genera except Arthrobacter, Serratia, and Stenotrophomonas. H. perforatum with antibacterial activity supported more bacteria with antagonistic activity, as compared to Z. capitata. The antagonistic isolates were able to control tomato root rot caused by Fusarium oxysporum and stimulated plant growth under greenhouse conditions and could thus be a cost-effective source for agro-based biological control agents. PMID:28232827

Enzymatic, antimicrobial and toxicity studies of the aqueous extract of Ananas comosus (pineapple) crown leaf.

PubMed

Dutta, Sangita; Bhattacharyya, Debasish

2013-11-25

Various parts of the plant pineapple (Ananas comosus) are used in traditional medicine worldwide for treatment of a number of diseases and disorders. In folk medicine, pineapple leaf extract was used as an antimicrobial, vermicide, purgative, emmenagoogue, abortifacient, anti-oedema and anti-inflammatory agent. Compared to the fruit and stem extracts of pineapple, information about its leaf extract is limited. The potential of pineapple crown leaf extract as an ethno-medicine has been evaluated in terms of its enzymatic activities related to wound healing, antimicrobial property and toxicity. Major protein components of the extract were revealed by 2-D gel electrophoresis followed by MS/MS analysis. Zymography, DQ-gelatin assay were performed to demonstrate proteolytic, fibrinolytic, gelatinase and collagenase activities. DNase and RNase activities were revealed from agarose gel electrophoresis. Antimicrobial activity was evaluated spectrophotometrically from growth inhibition. Sprague-Dawley rat model was used to measure acute and sub-acute toxicity of the extract by analyzing blood markers. The extract contains several proteins that were clustered under native condition. Proteomic studies indicated presence of fruit bromelain as major protein constituent of the extract. It showed nonspecific protease activity, gelatinolytic, collagenase, fibrinolytic, acid and alkaline phosphatase, peroxidase, DNase and RNase activities along with considerable anti-microbial property. The leaf extract did not induce any toxicity in rats after oral administration of acute and sub-acute doses. Pineapple leaf extract is nontoxic, contains enzymes related to damage tissue repairing, wound healing and possibly prevents secondary infections from microbial organisms. © 2013 Elsevier Ireland Ltd. All rights reserved.

[Construction and practice on rational medication model of Chinese patent medicine for orthopedics based on ″symdrome-dosage-toxicity differentiation″ theory].

PubMed

Wang, Yu-Guang; Jin, Rui; Qiang, Si-Si; Lin, Zhi-Jian; Li, Hong-Yan; Lu, Shu; Kong, Xiang-Wen

2016-01-01

Chinese patent medicines for orthopedics are among the hotspot and difficulty in the rational medication of traditional Chinese medicine (TCM), because they mostly contain toxic medicinal herbs and oriented to special patients. According to the hospital pharmacy practices and the therapeutic theories of TCM, this paper focused on a novel model of rational drug use of Chinese patent medicine for orthopedics based on the principles of ″syndrome-dosage-toxicity differentiation″. We also proposed relevant specifications for guiding their clinical use. Firstly, we proposed a list of the primary clinical application characteristics for rational drug use of orthopedic TCMs, including the syndromes of patient, the dosage of medicine and the toxic ingredients in medicine. Secondly, a database was established for recording the package inserts of all of the 81 orthopedic patent medicines in our hospital, and 2 000 retrospective recipes were analyzed for looking for the high-frequency medicines and common irrational factors. Then clinical case reports involving the adverse reactions and side effects of related drugs were searched from CNKI, VIP and WanFang databases. Then the key information for rational application of each medicine was extracted from these resources and some survey questionnaires. Finally, we established a guide named instructions for clinical use of orthopedic Chinese patient medicines (ICUOCPM) after the discusstion with experts. According to the effect after the practice in hospital for 2 months, the proposed principles of ″syndrome-dosage-toxicity differentiation″ in this paper were believed to be the core elements and the most important clinical monitoring points in TCM for orthopedic patents. It would provide innovative ideas, theoretical guarantee and data support for the development of TCM clinical pharmacy. Copyright© by the Chinese Pharmaceutical Association.

Cornus mas L. (cornelian cherry), an important European and Asian traditional food and medicine: Ethnomedicine, phytochemistry and pharmacology for its commercial utilization in drug industry.

PubMed

Dinda, Biswanath; Kyriakopoulos, Anthony M; Dinda, Subhajit; Zoumpourlis, Vassilis; Thomaidis, Nikolaos S; Velegraki, Aristea; Markopoulos, Charlambos; Dinda, Manikarna

2016-12-04

Cornus mas L. (cornelian cherry) fruits have been used for centuries as traditional cuisine and folk medicine in various countries of Europe and Asia. In folk medicines, the fruits and other parts of the plant have been used for prevention and treatment of a wide range of diseases such as diabetes, diarrhea, gastrointestinal disorders, fevers, rheumatic pain, skin and urinary tract infections, kidney and liver diseases, sunstroke, among others. This review provides a systematic and constructive overview of ethnomedicinal uses, chemical constituents and pharmacological activities of this plant as well as future research need for its commercial utilization as nutraceutical food supplement and medicine. This review is based on available literature on ethnomedicinal uses, phytochemical, pharmacological, toxicity and clinical studies on Cornus mas L. (cornelian cherry) fruits and other organs that was collected from electronic (SciFinder, PubMed, Science Direct and ACS among others) and library searches of books and journals. Versatile ethnomedicinal uses of the plant in different European and Asian countries have been reported. Phytochemical investigations on different parts of this plant have resulted in the identification of 101 compounds, among which anthocyanins, flavonoids and iridoids are the predominant groups. The crude extracts of fruits and other parts of the plant and their pure isolates exhibit a broad spectrum of pharmacological activities such as anti-microbial, anti-diabetic, anti-atherosclerotic, cyto-, hepato-, neuro- and renalprotective, antiplatelet and antiglaucomic activities. Anthocyanins, flavonoids, iridoids and vitamin C are the major bioactive constituents of the fruits. Fruits are non-toxic and safe food on acute toxicity studies in rat and human models. Clinical trials in diabetic type2 and hyperlipidemic patients showed significant trends of amelioration in sugar level, insulin secretion in diabetic patients and amelioration of lipid profile, apolipoprotein status and vascular inflammation in hyperlipidemic patients. Based on our review, Cornus mas L. (cornelian cherry) fruits and leaves can be used mainly in the treatment of diabetes, obesity, atherosclerosis, skin diseases, gastrointestinal and rheumatic problems. Some indications from ethnomedicines have been validated by pharmacological activities of the fruits and its extracts/pure isolates. The reported data reveal that the fruits are a potential source for treatment of diabetes, obesity, hyperlipidemia and gastrointestinal disorders. Unfortunately, the pharmacological studies in these areas are still insufficient to substantiate these preventive effects in confirmatory trials on the mass-scale clinical settings. Future studies on mechanisms of action, bioavailability, pharmacokinetics and adverse effects of the extracts and their bioactive constituents as well as their effective doses and long term toxic effects in humans are needed for commercial applications of these extracts/isolates in modern medicines. The available literature showed that most of the activities of the extracts are due to their constituents, anthocyanins, flavonoids and other phenolics, iridoids and vitamins for their antioxidant and other properties. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Antibacterial properties of traditionally used Indian medicinal plants.

PubMed

Aqil, F; Ahmad, I

2007-03-01

In search of broad-spectrum antibacterial activity from traditionally used Indian medicinal plants, 66 ethanolic plant extracts were screened against nine different bacteria. Of these, 39 extracts demonstrated activity against six or more test bacteria. Twelve extracts showing broad-spectrum activity were tested against specific multidrug-resistant (MDR) bacteria, methicillin-resistant Staphylococcus aureus (MRSA) and extended spectrum beta-lactamases (ESbetaL)-producing enteric bacteria. In vitro efficacy was expressed in terms of minimum inhibitory concentration (MIC) values of plant extracts. MIC values ranged from 0.32-7.5 mg/ml against MRSA and 0.31-6.25 mg/ml against ESbetaL-producing enteric bacteria. The overall activity against all groups of bacteria was found in order of Plumbago zeylanica > Hemidesmus indicus > Acorus calamus > Camellia sinensis > Terminalia chebula > Terminalia bellerica > Holarrhena antidysenterica > Lawsonia inermis > Mangifera indica > Punica granatum > Cichorium intybus and Delonix regia. In addition, these extracts showed synergistic interaction with tetracycline, chloramphenicol and ciprofloxacin against S. aureus and/or Escherichia coli. The ethanolic extracts of more than 12 plants were found nontoxic to sheep erythrocytes and nonmutagenic, determined by Ames test using Salmonella typhimurium test strains (TA 97a, TA 100, TA 102 and TA 104). Based on above properties, six plants-Plumbago zeylanica, Hemidesmus indicus, Acorus calamus, Punica granatum, Holarrhena antidysenterica and Delonix regia-were further subjected to fractionation-based study. Ethyl acetate, acetone and methanol fractions of more than six plants indicated that the active phytocompounds were distributed mainly into acetone and ethyl acetate fractions, whereas they were least prevalent in methanol fractions as evident from their antibacterial activity against MDR bacteria. Gram-positive and Gram-negative MDR bacteria are almost equally sensitive to these extracts/fractions, indicating their broad-spectrum nature. However, strain- and plant extract-dependent variations in the antibacterial activity were also evident. Time-kill assay with the most promising plant fraction Plumbago zeylanica (ethyl acetate fraction) demonstrated killing of test bacteria at the level lower than its MIC. Further, identification of active constituents in each fraction and their additive and synergistic interactions are needed to exploit them in evaluating efficacy and safety in vivo against MDR bacteria. Copyright 2007 Prous Science.

[Bacopa Monnieri - activity and applications in medicine].

PubMed

Sokołowska, Lilianna; Bylka, Wiesława

2015-01-01

Recently appeared medicinal preparations containing an extract of Bacopa monnieri. B. monnieri has been used in the Ayurvedic system of medicine for centuries, especially to enhance cognitive functions. Active compounds in this plant include numerous saponins type dammarane, mainly bacoside A and B, alkaloids and sterols. The pharmacological research of the extract of Bacopa monnieri support traditional uses of this plant. The results of so far clinical studies of the extract from B. monnieri, indicate to beneficial effect on memory, learning and concentration in adults, children and to improve in anxiety and depression after prolonged administration, although further clinical studies are needed to confirm medical indications. It has been found to be well tolerated. The present review summarizes current knowledge of mechanisms of actions also presents of dietary supplements with B. monnieri.

Saffron, passionflower, valerian and sage for mental health.

PubMed

Modabbernia, Amirhossein; Akhondzadeh, Shahin

2013-03-01

Many cultures have developed folk herbal remedies to treat symptoms of mental illness. An evidence-based view is now being developed for some of these so-called alternative herbal treatments. This article discusses clinically relevant scientific information on medicinal extracts of 4 herbs: saffron, passionflower, valerian, and sage. Copyright © 2013 Elsevier Inc. All rights reserved.

Anti-Helicobacter pylori activity of plants used in Mexican traditional medicine for gastrointestinal disorders.

PubMed

Castillo-Juárez, Israel; González, Violeta; Jaime-Aguilar, Héctor; Martínez, Gisela; Linares, Edelmira; Bye, Robert; Romero, Irma

2009-03-18

Helicobacter pylori is the major etiological agent of chronic active gastritis and peptic ulcer disease and is linked to gastric carcinoma. Treatment to eradicate the bacteria failed in many cases, mainly due to antibiotic resistance, hence the necessity of developing better therapeutic regimens. Mexico has an enormous unexplored potential of medicinal plants. This work evaluates the in vitro anti-H. pylori activity of 53 plants used in Mexican traditional medicine for gastrointestinal disorders. To test the in vitro antibacterial activity, agar dilution and broth dilution methods were used for aqueous and methanolic extracts, respectively. Aqueous extracts of Artemisia ludoviciana subsp. mexicana, Cuphea aequipetala, Ludwigia repens,and Mentha x piperita (MIC 125 to <250 microg/ml) as well as methanolic extracts of Persea americana, Annona cherimola, Guaiacum coulteri, and Moussonia deppeana (MIC <7.5 to 15.6 microg/ml) showed the highest inhibitory effect. The results contribute to understanding the mode of action of the studied medicinal plants and for detecting plants with high anti-Helicobacter pylori activity.

Antimicrobial properties of Honduran medicinal plants.

PubMed

Lentz, D L; Clark, A M; Hufford, C D; Meurer-Grimes, B; Passreiter, C M; Cordero, J; Ibrahimi, O; Okunade, A L

1998-12-01

Ninety-two plants used in the traditional pharmacopoeia of the Pech and neighboring Mestizo peoples of central Honduras are reported. The results of in vitro antimicrobial screens showed that 19 of the extracts from medicinal plants revealed signs of antifungal activity while 22 demonstrated a measurable inhibitory effect on one or more bacterial cultures. Bioassay-guided fractionation of extracts from Mikania micrantha, Neurolaena lobata and Piper aduncum produced weak to moderately active isolates. The broad spectrum of activity of the extracts helps to explain the widespread use of these plants for wound healing and other applications.

Identification of traditional medicinal plant extracts with novel anti-influenza activity.

PubMed

Rajasekaran, Dhivya; Palombo, Enzo A; Chia Yeo, Tiong; Lim Siok Ley, Diana; Lee Tu, Chu; Malherbe, Francois; Grollo, Lara

2013-01-01

The emergence of drug resistant variants of the influenza virus has led to a need to identify novel and effective antiviral agents. As an alternative to synthetic drugs, the consolidation of empirical knowledge with ethnopharmacological evidence of medicinal plants offers a novel platform for the development of antiviral drugs. The aim of this study was to identify plant extracts with proven activity against the influenza virus. Extracts of fifty medicinal plants, originating from the tropical rainforests of Borneo used as herbal medicines by traditional healers to treat flu-like symptoms, were tested against the H1N1 and H3N1 subtypes of the virus. In the initial phase, in vitro micro-inhibition assays along with cytotoxicity screening were performed on MDCK cells. Most plant extracts were found to be minimally cytotoxic, indicating that the compounds linked to an ethnomedical framework were relatively innocuous, and eleven crude extracts exhibited viral inhibition against both the strains. All extracts inhibited the enzymatic activity of viral neuraminidase and four extracts were also shown to act through the hemagglutination inhibition (HI) pathway. Moreover, the samples that acted through both HI and neuraminidase inhibition (NI) evidenced more than 90% reduction in virus adsorption and penetration, thereby indicating potent action in the early stages of viral replication. Concurrent studies involving Receptor Destroying Enzyme treatments of HI extracts indicated the presence of sialic acid-like component(s) that could be responsible for hemagglutination inhibition. The manifestation of both modes of viral inhibition in a single extract suggests that there may be a synergistic effect implicating more than one active component. Overall, our results provide substantive support for the use of Borneo traditional plants as promising sources of novel anti-influenza drug candidates. Furthermore, the pathways involving inhibition of hemagglutination could be a solution to the global occurrence of viral strains resistant to neuraminidase drugs.

Identification of Traditional Medicinal Plant Extracts with Novel Anti-Influenza Activity

PubMed Central

Rajasekaran, Dhivya; Palombo, Enzo A.; Chia Yeo, Tiong; Lim Siok Ley, Diana; Lee Tu, Chu; Malherbe, Francois; Grollo, Lara

2013-01-01

The emergence of drug resistant variants of the influenza virus has led to a need to identify novel and effective antiviral agents. As an alternative to synthetic drugs, the consolidation of empirical knowledge with ethnopharmacological evidence of medicinal plants offers a novel platform for the development of antiviral drugs. The aim of this study was to identify plant extracts with proven activity against the influenza virus. Extracts of fifty medicinal plants, originating from the tropical rainforests of Borneo used as herbal medicines by traditional healers to treat flu-like symptoms, were tested against the H1N1 and H3N1 subtypes of the virus. In the initial phase, in vitro micro-inhibition assays along with cytotoxicity screening were performed on MDCK cells. Most plant extracts were found to be minimally cytotoxic, indicating that the compounds linked to an ethnomedical framework were relatively innocuous, and eleven crude extracts exhibited viral inhibition against both the strains. All extracts inhibited the enzymatic activity of viral neuraminidase and four extracts were also shown to act through the hemagglutination inhibition (HI) pathway. Moreover, the samples that acted through both HI and neuraminidase inhibition (NI) evidenced more than 90% reduction in virus adsorption and penetration, thereby indicating potent action in the early stages of viral replication. Concurrent studies involving Receptor Destroying Enzyme treatments of HI extracts indicated the presence of sialic acid-like component(s) that could be responsible for hemagglutination inhibition. The manifestation of both modes of viral inhibition in a single extract suggests that there may be a synergistic effect implicating more than one active component. Overall, our results provide substantive support for the use of Borneo traditional plants as promising sources of novel anti-influenza drug candidates. Furthermore, the pathways involving inhibition of hemagglutination could be a solution to the global occurrence of viral strains resistant to neuraminidase drugs. PMID:24312177

Inhibition of Nuclear Factor κB Activation and Cyclooxygenase-2 Expression by Aqueous Extracts of Hispanic Medicinal Herbs

PubMed Central

Gonzales, Amanda M.; Hunsaker, Lucy A.; Franco, Carolina R.; Royer, Robert E.; Vander Jagt, David L.; Vander Jagt, Dorothy J.

2010-01-01

Abstract Nonsteroidal anti-inflammatory drugs (NSAIDs) are a primary choice of therapy for diseases with a chronic inflammatory component. Unfortunately, long-term NSAID therapy is often accompanied by severe side effects, including cardiovascular and gastrointestinal complications. Because of this, there is critical need for identification of new and safer treatments for chronic inflammation to circumvent these side effects. Inflammatory diseases have been successfully remedied with natural herbs by many cultures. To better understand the potential of natural herbs in treating chronic inflammation and to identify their mechanism of action, we have evaluated the anti-inflammatory activities of 20 medicinal herbs commonly used in the Hispanic culture. We have established a standardized method for preparing aqueous extracts (teas) from the selected medicinal herbs and screened for inhibition of tumor necrosis factor-α-induced activation of nuclear factor κB (NF-κB), which is the central signaling pathway of the inflammatory response. A number of herbal teas were identified that exhibited significant anti-inflammatory activity. In particular, tea from the herb commonly called laurel was found to be an especially potent inhibitor of NF-κB-dependent cyclooxygenase-2 gene expression and prostaglandin E2 production in cultured murine macrophages. These findings indicate that laurel tea extract contains potent anti-inflammatory compounds that function by inhibiting the major signal transduction pathway responsible for inducing an inflammatory event. Based on these results, laurel may represent a new, safe therapeutic agent for managing chronic inflammation. PMID:20482259

In vitro anti-plasmodial activity of some traditionally used medicinal plants against Plasmodium falciparum.

PubMed

Venkatesalu, V; Gopalan, N; Pillai, C R; Singh, Vineeta; Chandrasekaran, M; Senthilkumar, A; Chandramouli, N

2012-07-01

The anti-plasmodial activity of different solvent extracts of Adhatoda vasica (root), Caesalpinia pulcherrima (leaf), Carica papaya (pulp), Erythroxylum monogynum (leaf), Lantana camara (whole plant), Ocimum sanctum (root) and Phyllanthus niruri (whole plant) were studied against Plasmodium falciparum. Of the 35 extracts tested, seven extracts showed good anti-plasmodial activity. Methanol extract of C. pulcherrima showed the lowest IC50 value (10.96 μg/mL) followed by methanol extract of A. vasica (IC(50)=11.1 μg/mL), chloroform extract of O. sanctum (IC(50)=11.47 μg/mL), methanol extract of E. monogynum (IC(50)=12.23 μg/mL), acetone extract of C. pulcherrima (IC(50)=12.49 μg/mL), methanol extract of O. sanctum and acetone extract of A. vasica (IC(50)=14.04 μg/mL). The results of the present study justify the use of these medicinal plants in traditional practice, and also, a further study on the isolation of anti-plasmodial molecules from their active crude extracts is in progress.

Sensitive assay for measurement of volatile borneol, isoborneol, and the metabolite camphor in rat pharmacokinetic study of Borneolum (Bingpian) and Borneolum syntheticum (synthetic Bingpian)

PubMed Central

Cheng, Chen; Liu, Xin-wei; Du, Fei-fei; Li, Mei-juan; Xu, Fang; Wang, Feng-qing; Liu, Yang; Li, Chuan; Sun, Yan

2013-01-01

Aim: Both Borneolum (Chinese name Bingpian; dextrorotatory borneol) and Borneolum syntheticum (synthetic Bingpian; a mixture of optically inactive borneol and isoborneol) have been used for medicinal purposes in Chinese traditional medicine. The aim of this study was to develop a sensitive assay for measuring volatile ingredients borneol, isoborneol, and their metabolite camphor in pharmacokinetic study of Bingpian. Methods: Rat plasma samples were prepared using liquid-liquid microextraction: 70 μL of plasma sample (containing 125 nmol/L naphthalene as the internal standard) was extracted with 35 μL of n-hexane. The resulting n-hexane extract (20 μL) was introduced into a gas chromatography/mass spectrometry system using programmable temperature vaporizing-based large-volume injection. The assay was validated to demonstrate its reliability for the intended use. Using this assay, pharmacokinetic studies of Bingpian, synthetic Bingpian, and Fufang-Danshen tablets (containing synthetic Bingpian) were conducted in rats. Results: The extraction efficiency for the analytes and the internal standard from plasma was almost constant with decrease in n-hexane-to-plasma volume ratio, thus enabling a small volume of extracting solvent to be used for sample preparation, and enhancing the assay sensitivity. The lower quantification limit for measuring borneol, isoborneol, and camphor in plasma was 0.98 nmol/L, which was 33–330 times more sensitive than those reported earlier for Bingpian and synthetic Bingpian. The applicability of the miniaturized liquid-liquid extraction technique could be extended to measure other volatile and nonvolatile medicinal compounds in biomatrices, which can be predicted according to the analytes' octanol/water distribution coefficient (logD) and acid dissociation constant (pKa). Conclusion: This assay is sensitive, accurate and free of matrix effects, and can be applied to pharmacokinetic studies of Bingpian, synthetic Bingpian, and Bingpian-containing herbal products. PMID:23974515

Radial artery pulse waveform analysis based on curve fitting using discrete Fourier series.

PubMed

Jiang, Zhixing; Zhang, David; Lu, Guangming

2018-04-19

Radial artery pulse diagnosis has been playing an important role in traditional Chinese medicine (TCM). For its non-invasion and convenience, the pulse diagnosis has great significance in diseases analysis of modern medicine. The practitioners sense the pulse waveforms in patients' wrist to make diagnoses based on their non-objective personal experience. With the researches of pulse acquisition platforms and computerized analysis methods, the objective study on pulse diagnosis can help the TCM to keep up with the development of modern medicine. In this paper, we propose a new method to extract feature from pulse waveform based on discrete Fourier series (DFS). It regards the waveform as one kind of signal that consists of a series of sub-components represented by sine and cosine (SC) signals with different frequencies and amplitudes. After the pulse signals are collected and preprocessed, we fit the average waveform for each sample using discrete Fourier series by least squares. The feature vector is comprised by the coefficients of discrete Fourier series function. Compared with the fitting method using Gaussian mixture function, the fitting errors of proposed method are smaller, which indicate that our method can represent the original signal better. The classification performance of proposed feature is superior to the other features extracted from waveform, liking auto-regression model and Gaussian mixture model. The coefficients of optimized DFS function, who is used to fit the arterial pressure waveforms, can obtain better performance in modeling the waveforms and holds more potential information for distinguishing different psychological states. Copyright © 2018 Elsevier B.V. All rights reserved.

Antibacterial activity of traditional medicinal plants used by Haudenosaunee peoples of New York State

PubMed Central

2010-01-01

Background The evolution and spread of antibiotic resistance, as well as the evolution of new strains of disease causing agents, is of great concern to the global health community. Our ability to effectively treat disease is dependent on the development of new pharmaceuticals, and one potential source of novel drugs is traditional medicine. This study explores the antibacterial properties of plants used in Haudenosaunee traditional medicine. We tested the hypothesis that extracts from Haudenosaunee medicinal plants used to treat symptoms often caused by bacterial infection would show antibacterial properties in laboratory assays, and that these extracts would be more effective against moderately virulent bacteria than less virulent bacteria. Methods After identification and harvesting, a total of 57 different aqueous extractions were made from 15 plant species. Nine plant species were used in Haudenosaunee medicines and six plant species, of which three are native to the region and three are introduced, were not used in traditional medicine. Antibacterial activity against mostly avirulent (Escherichia coli, Streptococcus lactis) and moderately virulent (Salmonella typhimurium, Staphylococcus aureus) microbes was inferred through replicate disc diffusion assays; and observed and statistically predicted MIC values were determined through replicate serial dilution assays. Results Although there was not complete concordance between the traditional use of Haudenosaunee medicinal plants and antibacterial activity, our data support the hypothesis that the selection and use of these plants to treat disease was not random. In particular, four plant species exhibited antimicrobial properties as expected (Achillea millefolium, Ipomoea pandurata, Hieracium pilosella, and Solidago canadensis), with particularly strong effectiveness against S. typhimurium. In addition, extractions from two of the introduced species (Hesperis matronalis and Rosa multiflora) were effective against this pathogen. Conclusions Our data suggest that further screening of plants used in traditional Haudenosaunee medicine is warranted, and we put forward several species for further investigation of activity against S. typhimurium (A. millefolium, H. matronalis, I. pandurata, H. pilosella, R. multiflora, S. canadensis). PMID:21054887

Development of multiplex PCR assay for authentication of Cornu Cervi Pantotrichum in traditional Chinese medicine based on cytochrome b and C oxidase subunit 1 genes.

PubMed

Gao, Lijun; Xia, Wei; Ai, Jinxia; Li, Mingcheng; Yuan, Guanxin; Niu, Jiamu; Fu, Guilian; Zhang, Lihua

2016-07-01

This study describes a method for discriminating the true Cervus antlers from its counterfeits using multiplex PCR. Bioinformatics were carried out to design the specific alleles primers for mitochondrial (mt) cytochrome b (Cyt b) and cytochrome C oxidase subunit 1 (Cox 1) genes. The mt DNA and genomic DNA were extracted from Cervi Cornu Pantotrichum through the modified alkaline and the salt-extracting method in addition to its counterfeits, respectively. Sufficient DNA templates were extracted from all samples used in two methods, and joint fragments of 354 bp and 543 bp that were specifically amplified from both of true Cervus antlers served as a standard control. The data revealed that the multiplex PCR-based assays using two primer sets can be used for forensic and quantitative identification of original Cervus deer products from counterfeit antlers in a single step.

SureChEMBL: a large-scale, chemically annotated patent document database.

PubMed

Papadatos, George; Davies, Mark; Dedman, Nathan; Chambers, Jon; Gaulton, Anna; Siddle, James; Koks, Richard; Irvine, Sean A; Pettersson, Joe; Goncharoff, Nicko; Hersey, Anne; Overington, John P

2016-01-04

SureChEMBL is a publicly available large-scale resource containing compounds extracted from the full text, images and attachments of patent documents. The data are extracted from the patent literature according to an automated text and image-mining pipeline on a daily basis. SureChEMBL provides access to a previously unavailable, open and timely set of annotated compound-patent associations, complemented with sophisticated combined structure and keyword-based search capabilities against the compound repository and patent document corpus; given the wealth of knowledge hidden in patent documents, analysis of SureChEMBL data has immediate applications in drug discovery, medicinal chemistry and other commercial areas of chemical science. Currently, the database contains 17 million compounds extracted from 14 million patent documents. Access is available through a dedicated web-based interface and data downloads at: https://www.surechembl.org/. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

SureChEMBL: a large-scale, chemically annotated patent document database

PubMed Central

Papadatos, George; Davies, Mark; Dedman, Nathan; Chambers, Jon; Gaulton, Anna; Siddle, James; Koks, Richard; Irvine, Sean A.; Pettersson, Joe; Goncharoff, Nicko; Hersey, Anne; Overington, John P.

2016-01-01

SureChEMBL is a publicly available large-scale resource containing compounds extracted from the full text, images and attachments of patent documents. The data are extracted from the patent literature according to an automated text and image-mining pipeline on a daily basis. SureChEMBL provides access to a previously unavailable, open and timely set of annotated compound-patent associations, complemented with sophisticated combined structure and keyword-based search capabilities against the compound repository and patent document corpus; given the wealth of knowledge hidden in patent documents, analysis of SureChEMBL data has immediate applications in drug discovery, medicinal chemistry and other commercial areas of chemical science. Currently, the database contains 17 million compounds extracted from 14 million patent documents. Access is available through a dedicated web-based interface and data downloads at: https://www.surechembl.org/. PMID:26582922

Sequential Extraction Results in Improved Proteome Profiling of Medicinal Plant Pinellia ternata Tubers, Which Contain Large Amounts of High-Abundance Proteins

PubMed Central

An, SuFang; Gong, FangPing; Wang, Wei

2012-01-01

Pinellia ternata tuber is one of the well-known Chinese traditional medicines. In order to understand the pharmacological properties of tuber proteins, it is necessary to perform proteome analysis of P. ternata tubers. However, a few high-abundance proteins (HAPs), mainly mannose-binding lectin (agglutinin), exist in aggregates of various sizes in the tubers and seriously interfere with proteome profiling by two-dimensional electrophoresis (2-DE). Therefore, selective depletion of these HAPs is a prerequisite for enhanced proteome analysis of P. ternata tubers. Based on differential protein solubility, we developed a novel protocol involving two sequential extractions for depletion of some HAPs and prefractionation of tuber proteins prior to 2-DE. The first extraction using 10% acetic acid selectively extracted acid-soluble HAPs and the second extraction using the SDS-containing buffer extracted remaining acid-insoluble proteins. After application of the protocol, 2-DE profiles of P. ternata tuber proteins were greatly improved and more protein spots were detected, especially low-abundance proteins. Moreover, the subunit composition of P. ternata lectin was analyzed by electrophoresis. Native lectin consists of two hydrogen-bonded subunits (11 kDa and 25 kDa) and the 11 kDa subunit was a glycoprotein. Subsequently, major HAPs in the tubers were analyzed by mass spectrometry, with nine protein spots being identified as lectin isoforms. The methodology was easy to perform and required no specialized apparatus. It would be useful for proteome analysis of other tuber plants of Araceae. PMID:23185632

Sequential extraction results in improved proteome profiling of medicinal plant Pinellia ternata tubers, which contain large amounts of high-abundance proteins.

PubMed

Wu, Xiaolin; Xiong, Erhui; An, Sufang; Gong, Fangping; Wang, Wei

2012-01-01

Pinellia ternata tuber is one of the well-known Chinese traditional medicines. In order to understand the pharmacological properties of tuber proteins, it is necessary to perform proteome analysis of P. ternata tubers. However, a few high-abundance proteins (HAPs), mainly mannose-binding lectin (agglutinin), exist in aggregates of various sizes in the tubers and seriously interfere with proteome profiling by two-dimensional electrophoresis (2-DE). Therefore, selective depletion of these HAPs is a prerequisite for enhanced proteome analysis of P. ternata tubers. Based on differential protein solubility, we developed a novel protocol involving two sequential extractions for depletion of some HAPs and prefractionation of tuber proteins prior to 2-DE. The first extraction using 10% acetic acid selectively extracted acid-soluble HAPs and the second extraction using the SDS-containing buffer extracted remaining acid-insoluble proteins. After application of the protocol, 2-DE profiles of P. ternata tuber proteins were greatly improved and more protein spots were detected, especially low-abundance proteins. Moreover, the subunit composition of P. ternata lectin was analyzed by electrophoresis. Native lectin consists of two hydrogen-bonded subunits (11 kDa and 25 kDa) and the 11 kDa subunit was a glycoprotein. Subsequently, major HAPs in the tubers were analyzed by mass spectrometry, with nine protein spots being identified as lectin isoforms. The methodology was easy to perform and required no specialized apparatus. It would be useful for proteome analysis of other tuber plants of Araceae.

In vitro antioxidant and antimicrobial activity of extracts from Morus alba L. leaves, stems and fruits.

PubMed

Wang, Wei; Zu, Yuangang; Fu, Yujie; Efferth, Thomas

2012-01-01

In this study, the aqueous and ethanolic extracts (leaves, stems and fruits) from Morus alba L., a traditional Chinese medicine, were evaluated for their antioxidant and antimicrobial properties. Ethanolic extracts showed higher contents of both total phenolics and flavonoids than aqueous extracts. The total phenolic content was in the order of: leaf extracts > fruit extracts > stem extracts, whereas the total flavonoids was: leaf extracts > stem extracts > fruit extracts. Using DPPH assays, the concentrations providing 50% inhibition (IC(50)) values of aqueous extracts from leaves, stems and fruits were 7.11 ± 1.45 mg/ml, 86.78 ± 3.21 mg/ml and 14.38 ± 2.83 mg/ml, respectively, whereas the IC(50) values of ethanolic extracts were 3.11 ± 0.86 mg/ml, 14.62 ± 2.45 mg/ml and 12.42 ± 2.76 mg/ml, respectively. In sum, the antioxidant activities of ethanolic extracts from M. alba L. were stronger than the aqueous extracts, and in the order of: leaf extracts > fruit extracts > stem extracts. The ethanolic extracts exhibited moderate antimicrobial activities, whereas the aqueous extracts showed poor antimicrobial properties in our test system. This study validated the medicinal potential of M. alba L.

Automatic extraction and identification of users' responses in Facebook medical quizzes.

PubMed

Rodríguez-González, Alejandro; Menasalvas Ruiz, Ernestina; Mayer Pujadas, Miguel A

2016-04-01

In the last few years the use of social media in medicine has grown exponentially, providing a new area of research based on the analysis and use of Web 2.0 capabilities. In addition, the use of social media in medical education is a subject of particular interest which has been addressed in several studies. One example of this application is the medical quizzes of The New England Journal of Medicine (NEJM) that regularly publishes a set of questions through their Facebook timeline. We present an approach for the automatic extraction of medical quizzes and their associated answers on a Facebook platform by means of a set of computer-based methods and algorithms. We have developed a tool for the extraction and analysis of medical quizzes stored on Facebook timeline at the NEJM Facebook page, based on a set of computer-based methods and algorithms using Java. The system is divided into two main modules: Crawler and Data retrieval. The system was launched on December 31, 2014 and crawled through a total of 3004 valid posts and 200,081 valid comments. The first post was dated on July 23, 2009 and the last one on December 30, 2014. 285 quizzes were analyzed with 32,780 different users providing answers to the aforementioned quizzes. Of the 285 quizzes, patterns were found in 261 (91.58%). From these 261 quizzes where trends were found, we saw that users follow trends of incorrect answers in 13 quizzes and trends of correct answers in 248. This tool is capable of automatically identifying the correct and wrong answers to a quiz provided on Facebook posts in a text format to a quiz, with a small rate of false negative cases and this approach could be applicable to the extraction and analysis of other sources after including some adaptations of the information on the Internet. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Complementary and Alternative Medicine Treatments for Generalized Anxiety Disorder: Systematic Review and Meta-analysis of Randomized Controlled Trials.

PubMed

Barić, Hrvoje; Đorđević, Veljko; Cerovečki, Ivan; Trkulja, Vladimir

2018-03-01

The objective was to evaluate efficacy/safety of complementary and alternative medicine (CAM) methods for generalized anxiety disorder (GAD) based on randomized controlled trials in adults. Data sources. Six electronic databases ("generalized anxiety (disorder)" and "randomized trial") and reference lists of identified publications were searched to March 2017. Eligibility: full-text publications (English, German language); CAM versus conventional treatment, placebo/sham or no treatment; GAD diagnosed according to standard criteria; and a validated scale for disease severity. Of the 6693 screened records, 32 were included (18 on biologically-based therapies, exclusively herbal preparations; eight on manipulative and body-based therapies; and three on alternative medical systems and three on mind-body therapies). Cochrane Collaboration methodology was used for quality assessment and data extraction. Direct comparisons of Kava Kava (Piper methysticum) extracts to placebo (4 quality trials, n = 233) were highly heterogeneous. Network meta-regression reduced heterogeneity and suggested a modest Kava effect [end-of-treatment Hamilton Anxiety scale score difference adjusted for baseline scores and trial duration: - 3.24 (95% CI - 6.65, 0.17; P = 0.059), Kava Kava 4 arms, n = 139; placebo 5 arms, n = 359]. Lavender (Lavandula angustifolia) extract (1 quality trial, 10 weeks, n = 523) and a combination of extracts of C. oxycantha, E. californica and magnesium (1 quality trial, 12 weeks, n = 264) were superior to placebo and balneotherapy was superior to paroxetine (1 quality trial, 8 weeks, n = 237) indicating efficacy. All other trials were small and/or of modest/low quality and/or lacked assay sensitivity. Safety reporting was poor. Evidence about efficacy/safety of most CAM methods in GAD is limited. Apparent efficacy of certain herbal preparations and body-based therapies requires further confirmation.

Joint Feature Extraction and Classifier Design for ECG-Based Biometric Recognition.

PubMed

Gutta, Sandeep; Cheng, Qi

2016-03-01

Traditional biometric recognition systems often utilize physiological traits such as fingerprint, face, iris, etc. Recent years have seen a growing interest in electrocardiogram (ECG)-based biometric recognition techniques, especially in the field of clinical medicine. In existing ECG-based biometric recognition methods, feature extraction and classifier design are usually performed separately. In this paper, a multitask learning approach is proposed, in which feature extraction and classifier design are carried out simultaneously. Weights are assigned to the features within the kernel of each task. We decompose the matrix consisting of all the feature weights into sparse and low-rank components. The sparse component determines the features that are relevant to identify each individual, and the low-rank component determines the common feature subspace that is relevant to identify all the subjects. A fast optimization algorithm is developed, which requires only the first-order information. The performance of the proposed approach is demonstrated through experiments using the MIT-BIH Normal Sinus Rhythm database.

19 CFR 191.103 - Additional requirements.

Code of Federal Regulations, 2010 CFR

2010-04-01

... TREASURY (CONTINUED) DRAWBACK Internal Revenue Tax on Flavoring Extracts and Medicinal or Toilet... requirements. (a) Manufacturer claims domestic drawback. In the case of medicinal preparations and flavoring... filed with the Bureau of Alcohol, Tobacco and Firearms for domestic drawback on medicinal preparations...

Update on botulinum neurotoxin use in aesthetic dermatology.

PubMed

Ibrahim, Omer; Keller, Emily C; Arndt, Kenneth A

2014-12-01

Botulinum toxins are among the most widely studied and versatile drugs in the medicinal market. Since their extraction from Clostridium botulinum, they have been harnessed and incorporated into different formulations with varied properties and actions. These products have been used to treat countless disorders such as musculoskeletal disorders, headaches, and eye disorders, among many others. In the realm of aesthetic cutaneous medicine, the evolution and creativity in the use of botulinum toxins has been swift and ever changing. Knowledge of the science and innovation behind this toxin enables the user to provide the patient with a variety of treatment options founded in evidence-based medicine. This review will highlight the properties and actions of the newer, more recent neurotoxin preparations, as well as some of the latest and novel therapeutic applications of botulinum toxins.

In vivo anti-arthritic and anti-nociceptive effects of ethanol extract of Moringa oleifera leaves on complete Freund's adjuvant (CFA)-induced arthritis in rats.

PubMed

Mahdi, Harith Jameel; Khan, Nurzalina Abdul Karim; Asmawi, Mohd Zaini Bin; Mahmud, Roziahanim; A/L Murugaiyah, Vikneswaran

2018-03-01

The medicinal uses of plants are in many cases based exclusively on traditional knowledge without enough scientific evidences. Different parts of Moringa oleifera were traditionally used for the treatment of wide variety of ailments including arthritis and joints pain. The present study had been designed to evaluate the anti-arthritic and anti-nociceptive activities of ethanol extract of Moringa leaves, this being the most abundant plant part suitable for commercial mass production of botanical medicinal products. Complete Freund's adjuvant (CFA)-induced arthritis in rats was used as disease model. CFA-induced inflammatory paw edema, body weight, arthritic index, X-ray radiography, hematological parameters, and walk track and locomotion analysis were all evaluated for the assessment of disease progression. In addition to that, anti-nociceptive activity was examined at different dose levels in both normal and arthritic-induced rats using Eddy's hot plate and tail flick thermal analgesia. The analysis of various arthritic assessment parameters used in this study revealed that Moringa extract has a considerable effect in preventing development or ameliorate arthritis disease severity. Moreover, the ethanol extract of Moringa leaves revealed significant anti-nociceptive activity at in both normal and CFA-induced arthritis rats in a dose-dependent manner. Ethanol extract of Moringa leaves appears to be a really promising as analgesic and arthritis medication, but a larger and more detailed preclinical and clinical studies especially in human is highly recommended.

Functional food quality of Curcuma caesia, Curcuma zedoaria and Curcuma aeruginosa endemic to Northeastern India.

PubMed

Liu, Yunbao; Roy, Subhra Saikat; Nebie, Roger H C; Zhang, Yanjun; Nair, Muraleedharan G

2013-03-01

Curcuma spp. (Zingiberaceae) is one of the significant ingredients in food and traditional medicines. The current study was to investigate health-benefits of the rhizomes of endemic Curcuma caesia, Curcuma zedoaria and Curcuma aeruginosa using in vitro antioxidant, antiinflammatory and human tumor cell proliferation inhibitory activities. Among these, C. caesia (black turmeric) showed the best overall biological activities based on [3-(4, 5-dimethylthiazole-2-yl)-2,5-diphenyltetrazolium bromide] (MTT) and lipid peroxidation (LPO), cyclooxygenase (COX-1 and -2) enzymes, and tumor cell growth inhibitory assays. The hexane and methanolic extracts of C. caesia (CCH and CCM) showed LPO inhibition by 31 and 43 %, and COX-2 enzyme by 29 and 38 %, respectively, at 100 μg/ml. Eleven terpenoids were isolated and identified. The MTT antioxidant assay revealed that the extracts of three Curcuma spp. at 250 μg/ml and isolates at 5 μg/ml demonstrated activity comparable to positive controls vitamin C and t-butyl hydroquinone (TBHQ) at 25 μg/ml. The extracts inhibited LPO by 40 % at 250 μg/ml whereas pure isolates 1-11 by about 20 %. The extracts and isolates inhibited COX-1 and -2 enzymes between the ranges of 3-56 and 5-30 %, respectively. The in vitro biological activity exhibited by the extracts and isolates of C. caesia rhizome further supported its use in traditional medicine.

Qualitative comparison of active compounds between red and green Mariposa Christia Vespertillonis leaves extracts

NASA Astrophysics Data System (ADS)

Osman, M. S.; Ghani, Z. A.; Ismail, N. F.; Razak, N. A. A.; Jaapar, J.; Ariff, M. A. M.

2017-09-01

At present time, Mariposa Christia Vespertillonis (MCV) leave has become popular for its anti-cancer and thus is used widely among the traditional medicine in Malaysia. There are several types of MCV plants and the one that is currently well-known for traditional medicine in Malaysia is the green MCV (GMCV). Red MCV (RMCV) is another type of MCV plant which can also be found easily in Malaysia. In this study, the active compounds for GMCV and RMCV will be compared and analyzed by using Liquid Chromatography - Mass Spectrometry (LC-MS). The active compounds will be extracted from the MCV leaves by using Supercritical Fluid Extraction (SFE). The findings of this study indicates the global yield of the MCV oils is 31 mg/g while the compound identification indicates the presence of anti-cancer, anti-inflammatory and beneficial phytochemicals. This work is an explorative study to reveal the potential of MCV to be extracted using SFE method as potential therapeutic plants for the traditional medicine in Malaysia.

Anti-inflammatory effects of an ethanolic extract of guava (Psidium guajava L.) leaves in vitro and in vivo.

PubMed

Jang, Mi; Jeong, Seung-Weon; Cho, Somi K; Ahn, Kwang Seok; Lee, Jong Hyun; Yang, Deok Chun; Kim, Jong-Chan

2014-06-01

Plant extracts have been used as a source of medicines for a wide variety of human ailments. Among the numerous traditional medicinal herbs, Psidium guajava L. (Myrtaceae), commonly known as guava, has long been used in folk medicines as a therapeutic agent for the treatment of numerous diseases in East Asian and other countries. The aim of this study was to investigate the anti-inflammatory activity of an ethanolic leaf extract of P. guajava (guava) in vitro and in vivo. Our results demonstrated that guava leaf extract (GLE) significantly inhibited lipopolysaccharide (LPS)-induced production of nitric oxide and prostaglandin E2 in a dose-dependent manner. GLE suppressed the expression and activity of both inducible nitric oxide synthase and cyclooxygenase-2 in part through the downregulation of ERK1/2 activation in RAW264.7 macrophages. Furthermore, GLE exhibited significant anti-inflammatory activity in 2 different animal models-Freund's complete adjuvant-induced hyperalgesia in the rat and LPS-induced endotoxic shock in mice.

Hydroalcoholic extracts of Indian medicinal plants can help in amelioration from oxidative stress through antioxidant properties.

PubMed

Sarkar, Rhitajit; Mandal, Nripendranath

2012-01-01

The in vitro study of the antioxidant properties of the hydroalcoholic extracts of various Indian medicinal plants can logically help to develop a better and safer way of amelioration from oxidative stress. As aimed, the present study has been done to estimate and thereby conclude regarding the antioxidant activities of a few Indian medicinal plants, viz., Terminalia chebula, Terminalia belerica, Emblica officinalis, Caesalpinia crista, Cajanus cajan, and Tinospora cordifolia. The extracts of the plants have been subjected to the evaluation of antioxidant properties through scavenging assays for reactive oxygen species like superoxide, nitric oxide, peroxynitrite, hypochlorous acid, singlet oxygen, etc. and measurement of TEAC values and other phytochemical parameters. The phenolic and flavonoid contents of each plant have been found to be correlated to their individual antioxidant activity. The results showed the hydroalcoholic extracts of the plants were efficient indicators of their antioxidant capacity thus concreting their basis to be used as natural antioxidant.

Screening of medicinal plants for PPPAR-alpha and PPAR-gamma activation and evaluation of their effects on glucose uptake and 3T3-L1 adipogenesis

USDA-ARS?s Scientific Manuscript database

Medicinal plants are a rich source of ligands for nuclear receptors. The present study was aimed to screen a collection of plant extracts for PPAR-alpha/gamma activating properties and identify the active extract that can stimulate cellular glucose uptake without enhancing the adipogenesis. A report...

Brine shrimp toxicity of some plants used as traditional medicines in Kagera Region, north western Tanzania.

PubMed

Moshi, M J; Innocent, E; Magadula, J J; Otieno, D F; Weisheit, A; Mbabazi, P K; Nondo, R S O

2010-01-01

Dichloromethane and/or ethanol extracts of 30 plants used as traditional medicines in Bukoba district, northwestern Tanzania were evaluated for brine shrimp toxicity. Among the 50 extracts tested, 32 extracts (64%) showed very low toxicity with LC50 values above 100 microg/ml. Among these 12 (24%) which had LC50 >500 microg/ml can be categorized as being practically non-toxic. Among the remaining extracts 19 (38%) which showed LC50 > 100 < 500 microg/ml are also considered to be non-toxic. Extracts that showed LC50 results between 30-100 microg/ml have been categorized as mildly toxic; these include ethanol extracts of Lantana trifolia (LC50 32.3 microg/ml), Vernonia bradycalyx (LC50 33.9 microg/ml), Antiaris toxicaria (LC50 38.2 microg/ml) and Rubus rigidus (LC50 41.7 microg/ml) and the dichloromethane extracts of Gynura scandens (LC50 36.5 microg/ml) and Bridelia micrantha (LC50 32.0 microg/ml). The dichloromethane extracts of Picralima nitida (LC50 18.3 microg/ml) and Rubus rigidus (LC50 19.8 microg/ml), were only moderately toxic. Picralima nitida and Rubus rigidus extracts are only 1.1 and 1.2 less toxic than the standard drug, cyclophosphamide (LC50 16.3 microg/ml). In conclusion, the results indicate that among the 30 plants used as traditional medicines, 28 are safe for short term use. Picralima nitida and Rubus rigidus extracts are mildly toxic, but by comparison have a remote possibility to yield active anticancer compounds.

Bioactivity Evaluation of Plant Extracts Used in Indigenous Medicine against the Snail, Biomphalaria glabrata, and the Larvae of Aedes aegypti.

PubMed

Dos Santos, Edilson Alves; de Carvalho, Cenira M; Costa, Ana L S; Conceição, Adilva S; Moura, Flávia de B Prado; Santana, Antônio Euzébio Goulart

2012-01-01

This investigation examined the molluscicidal and larvicidal activity of eight plants that are used in the traditional medicine of the Pankararé indigenous people in the Raso da Catarina region, Bahia state, Brazil. The tested plants were chosen based on the results of previous studies. Only those plants that were used either as insect repellents or to treat intestinal parasitic infections were included in the study. Crude extracts (CEs) of these plants were tested for their larvicidal activity (against Aedes aegypti larvae in the fourth instar) and molluscicidal activity (against the snail Biomphalaria glabrata). The plant species Scoparia dulcis and Helicteres velutina exhibited the best larvicidal activities (LC(50) 83.426 mg/L and LC(50) 138.896 mg/L, resp.), and Poincianella pyramidalis, Chenopodium ambrosoides, and Mimosa tenuiflora presented the best molluscicidal activities (LC(50) 0.94 mg/L, LC(50) 13.51 mg/L, and LC(50) 20.22 mg/L, resp.). As we used crude extracts as the tested materials, further study is warranted to isolate and purify the most active compounds.

Bioactivity Evaluation of Plant Extracts Used in Indigenous Medicine against the Snail, Biomphalaria glabrata, and the Larvae of Aedes aegypti

PubMed Central

dos Santos, Edilson Alves; de Carvalho, Cenira M.; Costa, Ana L. S.; Conceição, Adilva S.; Moura, Flávia de B. Prado; Santana, Antônio Euzébio Goulart

2012-01-01

This investigation examined the molluscicidal and larvicidal activity of eight plants that are used in the traditional medicine of the Pankararé indigenous people in the Raso da Catarina region, Bahia state, Brazil. The tested plants were chosen based on the results of previous studies. Only those plants that were used either as insect repellents or to treat intestinal parasitic infections were included in the study. Crude extracts (CEs) of these plants were tested for their larvicidal activity (against Aedes aegypti larvae in the fourth instar) and molluscicidal activity (against the snail Biomphalaria glabrata). The plant species Scoparia dulcis and Helicteres velutina exhibited the best larvicidal activities (LC50 83.426 mg/L and LC50 138.896 mg/L, resp.), and Poincianella pyramidalis, Chenopodium ambrosoides, and Mimosa tenuiflora presented the best molluscicidal activities (LC50 0.94 mg/L, LC50 13.51 mg/L, and LC50 20.22 mg/L, resp.). As we used crude extracts as the tested materials, further study is warranted to isolate and purify the most active compounds. PMID:22194773

Management of diabetic complications: a chemical constituents based approach.

PubMed

Singh, Randhir; Kaur, Navpreet; Kishore, Lalit; Gupta, Girish Kumar

2013-10-28

Long term hyperglycemia leads to development of complications associated with diabetes. Diabetic complications are now a global health problem without effective therapeutic approach. Hyperglycemia and oxidative stress are important components for the development of diabetic complications. Over the past few decades, herbal medicines have attracted much attention as potential therapeutic agents in the prevention and treatment of diabetic complications due to their multiple targets and less toxic side effects. This review aims to assess the current available knowledge of medicinal herbs for attenuation and management of diabetic complications and their underlying mechanisms. Bibliographic investigation was carried out by scrutinizing classical text books and peer reviewed papers, consulting worldwide accepted scientific databases (SCOPUS, PUBMED, SCIELO, NISCAIR, Google Scholar) to retrieve available published literature. The inclusion criteria for the selection of plants were based upon all medicinal herbs and their active compounds with attributed potentials in relieving diabetic complications. Moreover, plants which have potential effect in ameliorating oxidative stress in diabetic animals have been included. Overall, 238 articles were reviewed for plant literature and out of the reviewed literature, 127 articles were selected for the study. Various medicinal plants/plant extracts containing flavonoids, alkaloids, phenolic compounds, terpenoids, saponins and phytosterol type chemical constituents were found to be effective in the management of diabetic complications. This effect might be attributed to amelioration of persistent hyperglycemia, oxidative stress and modulation of various metabolic pathways involved in the pathogenesis of diabetic complications. Screening chemical candidate from herbal medicine might be a promising approach for new drug discovery to treat the diabetic complications. There is still a dire need to explore the mechanism of action of various plant extracts and their toxicity profile and to determine their role in therapy of diabetic complications. Moreover, a perfect rodent model which completely mimics human diabetic complications should be developed. © 2013 Elsevier Ireland Ltd. All rights reserved.

Anti-Gastric Ulcer Activity of Polysaccharide Fraction Isolated from Mycelium Culture of Lion's Mane Medicinal Mushroom, Hericium erinaceus (Higher Basidiomycetes).

PubMed

Wang, Mingxing; Konishi, Tetsuya; Gao, Yang; Xu, Duoduo; Gao, Qipin

2015-01-01

Hericium erinaceus is a culinary-medicinal mushroom that is used in traditional medicine, in folk medicine, and as medicinal cuisine in Asian countries such as China, Japan, and Korea. H. erinaceus exhibits various pharmacological properties, such as anti-cancer, immunomodulation, anti-dementia, and anti-gastric ulcer effects. The extracts of the fruiting body of H. erinaceus demonstrate anti-gastritis activity. However, the active principle in the extract, as well as the mechanism to treat gastric ulcers, remains uncertain. The current study aims to identify the active component, with anti-gastric ulcer function, from the extracts of the H. erinaceus mycelium culture. In the experiment, anti-gastric ulcer activity was evaluated using an ethanol-induced ulcer model in mice and with an 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide assay using MC cell lines. The results suggest that the polysaccharide fraction can significantly decrease the ulcerated area compared with the control group and the effect is fairly dose dependent, irrespective of animal or cell experiments. These results indicate that the polysaccharide fraction is the active component of the H. erinaceus mycelium culture, which protects against gastric ulcers.

Extraction Method and Analysis of Cannabinoids in Cannabis Olive Oil Preparations.

PubMed

Casiraghi, Antonella; Roda, Gabriella; Casagni, Eleonora; Cristina, Cecilia; Musazzi, Umberto Maria; Franzè, Silvia; Rocco, Paolo; Giuliani, Claudia; Fico, Gelsomina; Minghetti, Paola; Gambaro, Veniero

2018-03-01

Recently, an increasing number of pharmacists had to supply medicinal products based on Cannabis sativa L. (Cannabaceae), prescribed by physicians to individual patients. Cannabis olive oil preparation is the first choice as a concentrated extract of cannabinoids, even though standardized operative conditions for obtaining it are still not available. In this work, the impact of temperature and extraction time on the concentration of active principles was studied to harmonize the different compounding methods, optimize the extraction process, and reduce the variability among preparations. Moreover, starting from the cannabis inflorescence, the effect of temperature on tetrahydrocannabinolic acid decarboxylation was evaluated. For the analysis, a GC/MS method, as suggested by the Italian Ministry of Health, and a GC/flame ionization detection method were developed, validated, and compared. Georg Thieme Verlag KG Stuttgart · New York.

Antioxidants in medicinal plant extracts. A research study of the antioxidant capacity of Crataegus, Hamamelis and Hydrastis.

PubMed

Periera da Silva, A; Rocha, R; Silva, C M; Mira, L; Duarte, M F; Florêncio, M H

2000-12-01

The antioxidant capacity of extracts of Crataegus oxyacantha, Hamamelis virginiana, Hydrastis canadensis, plants native to Europe and North America which have long been used in herbal medicine for the treatment of cardiac and circulatory functions, has been investigated. The total antioxidant potential conferred by all hydrogen donating antioxidants present in these extracts has been assessed by the ABTS assay and the relative order of antioxidant potential has been established. Gas chromatography coupled to mass spectrometry (GC-MS) has been used for the chemical identification of the antioxidant volatile compounds present in the extracts. The GC-MS data were related to the results obtained using the ABTS assay.

Screening of some Palestinian medicinal plants for antibacterial activity.

PubMed

Essawi, T; Srour, M

2000-06-01

Antibacterial activity of organic and aqueous extracts of 15 Palestinian medicinal plants were carried against eight different species of bacteria: Bacillus subtilis, two Escherichia coli species, Staphylococcus aureus (methicillin resistant), two S. aureus (methicillin sensitive) species, Pseudomonas aeruginosa, and Enterococcus fecalis. Of the 15 plants tested, eight showed antibacterial activity. Each plant species has unique against different bacteria. The most active antibacterial plants against both gram-positive and gram-negative bacteria were Thymus vulgaris and Thymus origanium. The organic and aqueous extract from the same plants showed different activities; the organic extract showed the same or greater activity than the aqueous extract. Finally, the hole-plate diffusion method showed larger activity than the disc diffusion method.

Downstream processing of hyperforin from Hypericum perforatum root cultures.

PubMed

Haas, Paul; Gaid, Mariam; Zarinwall, Ajmal; Beerhues, Ludger; Scholl, Stephan

2018-05-01

Hyperforin is a major metabolite of the medicinal plant Hypericum perforatum (St. John's Wort) and has recently been found in hormone induced root cultures. The objective of this study is to identify a downstream process for the production of a hyperforin-rich extract with maximum extraction efficiency and minimal decomposition. The maximum extraction time was found to be 60min. The comparison of two equipment concepts for the extraction and solvent evaporation was performed employing two different solvents. While the rotary mixer showed better results for the extraction efficiency than a stirred vessel, the latter set-up was able to handle larger volumes but did not meet all process requirements. For the evaporation the prompt evaporation of the extraction agent using nitrogen stripping led to minor decomposition. In a 5L stirred vessel, the highest specific extraction of hyperforin was 4.3mg hyperforin/g dry weight bio material. Parameters for the equipment design for extraction and solvent evaporation were determined based on the experimental data. Copyright © 2017 Elsevier B.V. All rights reserved.

Metabolomics study of Saw palmetto extracts based on 1H NMR spectroscopy.

PubMed

de Combarieu, Eric; Martinelli, Ernesto Marco; Pace, Roberto; Sardone, Nicola

2015-04-01

Preparations containing Saw palmetto extracts are used in traditional medicine to treat benign prostatic hyperplasia. According to the European and the American Pharmacopoeias, the extract is obtained from comminuted Saw palmetto berries by a suitable extracting procedure using ethanol or supercritical carbon dioxide or a mixture of n-hexane and methylpentanes. In the present study an approach to metabolomics profiling using nuclear magnetic resonance (NMR) has been used as a finger-printing tool to assess the overall composition of the extracts. The phytochemical analysis coupled with principal component analysis (PCA) showed the same composition of the Saw palmetto extracts obtained with carbon dioxide and hexane with minor not significant differences for extracts obtained with ethanol. In fact these differences are anyhow lower than the batch-to-batch variability ascribable to the natural-occurring variability in the Saw palmetto fruits' phytochemical composition. The fingerprinting analysis combined with chemometric method, is a technique, which would provide a tool to comprehensively assess the quality control of Saw palmetto extracts. Copyright © 2015 Elsevier B.V. All rights reserved.

Ultrasound-assisted extraction of three bufadienolides from Chinese medicine ChanSu.

PubMed

Sun, Yinshi; Bi, Jianjie; Zhang, Li; Ye, Baoxing

2012-11-01

In this study, the application of ultrasound-assisted extraction (UAE) method was shown to be more efficient in extracting anti-tumor bufadienolides (bufalin, cinobufagin and resibufogenin) from important animal medicine of ChanSu than the maceration extraction (ME) and soxhlet extraction (SE) method. The effects of ultrasonic variables including extraction solvent, solvent concentration, solvent to solid ratio, ultrasound power, temperature, extraction time and particle size on the yields of three bufadienolides were investigated. The optimum extraction conditions found were: 70% (v/v) methanol solution, solvent to solid ratio of 10ml/g, ultrasound power of 125W, temperature of 20°C, extraction time of 20min and particle size of 60-80 mesh. The extraction yields of bufalin, cinobufagin and resibufogenin were 43.17±0.85, 52.58±1.12, 137.70±2.65mg/g, respectively. In order to achieve a similar yield as UAE, soxhlet extraction required 6h and maceration extraction required much longer time of 18h. The results indicated that UAE is an alternative method for extracting bufadienolides from ChanSu. Copyright © 2012 Elsevier B.V. All rights reserved.

Preliminary phytochemical screening, Antibacterial potential and GC-MS analysis of two medicinal plant extracts.

PubMed

Vijayaram, Seerangaraj; Kannan, Suruli; Saravanan, Konda Mani; Vasantharaj, Seerangaraj; Sathiyavimal, Selvam; P, Palanisamy Senthilkumar

2016-05-01

The presence study was aimed to catalyze the primary metabolites and their confirmation by using GC-MS analysis and antibacterial potential of leaf extract of two important medicinal plant viz., Eucalyptus and Azadirachta indica. The antibacterial potential of the methanol leaf extract of the studied species was tested against Escherichia coli, Pseudomonas aeruginosa, Klebsiellap neumoniae, Streptococcus pyogens, Staphylococcus aureus using by agar well diffusion method. The higher zone of inhibition (16mm) was observed against the bacterium Pseudomonas aeruginosa at 100μl concentration of methanol leaf extract. Preliminary phytochemical analysis of studied species shows that presence of phytochemical compounds like steroids, phenolic compounds and flavonoids. GC-MS analysis confirms the occurrence of 20 different compounds in the methanol leaf extract of the both studied species.

Antisecretory activity of plants used to treat gastrointestinal disorders in Mexico.

PubMed

Velázquez, Claudia; Calzada, Fernando; Torres, Javier; González, Felipe; Ceballos, Guillermo

2006-01-03

Aqueous and methanolic extracts from 26 medicinal plants used in Mexico to treat gastrointestinal disorders were screened to evaluate their antisecretory activity on cholera toxin-induced intestinal secretion in rat jejunal loops model. Extracts were tested at a dose of 300 mg/kg. From 56 samples tested, both extracts from Chiranthodendron pentadactylon, Hippocratea excelsa and Ocimum basilicum were the most potent with inhibition values ranging from 68.0 to 87.6%. On the other hand, the methanolic extract of Geranium mexicanum (aerial parts) and the aqueous extract of Bocconia frutescens showed the highest activity with inhibition values of 93.4 and 86.0%, respectively. The results obtained in this study give some scientific support to the use of the Mexican medicinal plants employed for the treatment of gastrointestinal disorders such as diarrhea.

Supercritical fluid extraction of grape seeds: extract chemical composition, antioxidant activity and inhibition of nitrite production in LPS-stimulated Raw 264.7 cells.

PubMed

Pérez, Concepción; Ruiz del Castillo, María Luisa; Gil, Carmen; Blanch, Gracia Patricia; Flores, Gema

2015-08-01

Grape by-products are a rich source of bioactive compounds having broad medicinal properties, but are usually wasted from juice/wine processing industries. The present study investigates the use of supercritical fluid extraction (SFE) for obtaining an extract rich in bioactive compounds. First, some variables involved in the extraction were applied. SFE conditions were selected based on the oil mass yield, fatty acid profile and total phenolic composition. As a result, 40 °C and 300 bar were selected as operational conditions. The phenolic composition of the grape seed oil was determined using LC-DAD. The antioxidant activity was determined by ABTS and DPPH assays. For the anti-inflammatory activity the inhibition of nitrite production was assessed. The grape seed oil extracted was rich in phenolic compounds and fatty acids with significant antioxidant and anti-inflammatory activities. From these results, added economic value to this agroindustrial residue is proposed using environmentally friendly techniques.

Consumer-oriented interventions for evidence-based prescribing and medicines use: an overview of systematic reviews.

PubMed

Ryan, Rebecca; Santesso, Nancy; Hill, Sophie; Lowe, Dianne; Kaufman, Caroline; Grimshaw, Jeremy

2011-05-11

Numerous systematic reviews exist on interventions to improve consumers' medicines use, but this research is distributed across diseases, populations and settings. The scope and focus of reviews on consumers' medicines use also varies widely. Such differences create challenges for decision makers seeking review-level evidence to inform decisions about medicines use. To synthesise the evidence from systematic reviews on the effects of interventions which target healthcare consumers to promote evidence-based prescribing for, and medicines use, by consumers. We sought evidence on the effects on health and other outcomes for healthcare consumers, professionals and services. We included systematic reviews published on the Cochrane Database of Systematic Reviews and the Database of Abstracts of Reviews of Effects. We identified relevant reviews by handsearching both databases from start date to Issue 3 2008. We screened and ranked reviews based on relevance to consumers' medicines use, using criteria developed for this overview. Standardised forms were used to extract data, and reviews were assessed for methodological quality using the AMSTAR instrument. We used standardised language to summarise results within and across reviews; and a further synthesis step was used to give bottom-line statements about intervention effectiveness. Two review authors selected reviews, extracted and analysed data. We used a taxonomy of interventions to categorise reviews. We included 37 reviews (18 Cochrane, 19 non-Cochrane), of varied methodological quality.Reviews assessed interventions with diverse aims including support for behaviour change, risk minimisation, skills acquisition and information provision. No reviews aimed to promote systems-level consumer participation in medicines-related activities. Medicines adherence was the most commonly reported outcome, but others such as clinical (health and wellbeing), service use and knowledge outcomes were also reported. Reviews rarely reported adverse events or harms, and the evidence was sparse for several populations, including children and young people, carers, and people with multimorbidity.Promising interventions to improve adherence and other key medicines use outcomes (eg adverse events, knowledge) included self-monitoring and self-management, simplified dosing and interventions directly involving pharmacists. Other strategies showed promise in relation to adherence but their effects were less consistent. These included reminders; education combined with self-management skills training, counselling or support; financial incentives; and lay health worker interventions.No interventions were effective to improve all medicines use outcomes across all diseases, populations or settings. For some interventions, such as information or education provided alone, the evidence suggests ineffectiveness; for many others there is insufficient evidence to determine effects on medicines use outcomes. Systematically assembling the evidence across reviews allows identification of effective or promising interventions to improve consumers' medicines use, as well as those for which the evidence indicates ineffectiveness or uncertainty.Decision makers faced with implementing interventions to improve consumers' medicines use can use this overview to inform these decisions and also to consider the range of interventions available; while researchers and funders can use this overview to determine where research is needed. However, the limitations of the literature relating to the lack of evidence for important outcomes and specific populations, such as people with multimorbidity, should also be considered.

DNA barcoding and NMR spectroscopy-based assessment of species adulteration in the raw herbal trade of Saraca asoca (Roxb.) Willd, an important medicinal plant.

PubMed

Urumarudappa, Santhosh Kumar Jayanthinagar; Gogna, Navdeep; Newmaster, Steven G; Venkatarangaiah, Krishna; Subramanyam, Ragupathy; Saroja, Seethapathy Gopalakrishnan; Gudasalamani, Ravikanth; Dorai, Kavita; Ramanan, Uma Shaanker

2016-11-01

Saraca asoca (Roxb.) Willd, commonly known as "Asoka" or "Ashoka," is one of the most important medicinal plants used in raw herbal trade in India. The bark extracts of the tree are used in the treatment of leucorrhea and other uterine disorders besides also having anti-inflammatory, anti-bacterial, anti-pyretic, anti-helminthic, and analgesic activity. The indiscriminate and rampant extraction of the wood to meet the ever-increasing market demand has led to a sharp decline in naturally occurring populations of the species in the country. Consequently, the species has recently been classified as "vulnerable" by the International Union for Conservation of Nature (IUCN). Increasing deforestation and increasing demand for this medicinal plant have resulted in a limited supply and suspected widespread adulteration of the species in the raw herbal trade market. Adulteration is a serious concern due to: (i) reduction in the efficacy of this traditional medicine, (ii) considerable health risk to consumers, and (iii) fraudulent product substitution that impacts the economy for the Natural Health Product (NHP) Industry and consumers. In this paper, we provide the first attempt to assess the extent of adulteration in the raw herbal trade of S. asoca using DNA barcoding validated by NMR spectroscopic techniques. Analyzing market samples drawn from 25 shops, mostly from peninsular India, we show that more than 80 % of the samples were spurious, representing plant material from at least 7 different families. This is the first comprehensive and large-scale study to demonstrate the widespread adulteration of market samples of S. asoca in India. These results pose grave implications for the use of raw herbal drugs, such as that of S. asoca, on consumer health and safety. Based on these findings, we argue for a strong and robust regulatory framework to be put in place, which would ensure the quality of raw herbal trade products and reassure consumer confidence in indigenous medicinal systems. Graphical Abstract DNA barcoding and NMR spectroscopy-based assessment of adulteration in Saraca asoca.

Pharmacokinetic Studies of Chinese Medicinal Herbs Using an Automated Blood Sampling System and Liquid Chromatography-mass Spectrometry.

PubMed

Wu, Yu-Tse; Wu, Ming-Tsang; Lin, Chia-Chun; Chien, Chao-Feng; Tsai, Tung-Hu

2012-01-01

The safety of herbal products is one of the major concerns for the modernization of traditional Chinese medicine, and pharmacokinetic data of medicinal herbs guide us to design the rational use of the herbal formula. This article reviews the advantages of the automated blood sampling (ABS) systems for pharmacokinetic studies. In addition, three commonly used sample preparative methods, protein precipitation, liquid-liquid extraction and solid-phase extraction, are introduced. Furthermore, the definition, causes and evaluation of matrix effects in liquid chromatography-mass spectrometry (LC/MS) analysis are demonstrated. Finally, we present our previous works as practical examples of the application of ABS systems and LC/MS for the pharmacokinetic studies of Chinese medicinal herbs.

Medicinally important aromatic plants with radioprotective activity

PubMed Central

Samarth, Ravindra M; Samarth, Meenakshi; Matsumoto, Yoshihisa

2017-01-01

Aromatic plants are often used as natural medicines because of their remedial and inherent pharmacological properties. Looking into natural resources, particularly products of plant origin, has become an exciting area of research in drug discovery and development. Aromatic plants are mainly exploited for essential oil extraction for applications in industries, for example, in cosmetics, flavoring and fragrance, spices, pesticides, repellents and herbal beverages. Although several medicinal plants have been studied to treat various conventional ailments only a handful studies are available on aromatic plants, especially for radioprotection. Many plant extracts have been reported to contain antioxidants that scavenge free radicals produced due to radiation exposure, thus imparting radioprotective efficacy. The present review focuses on a subset of medicinally important aromatic plants with radioprotective activity. PMID:29134131

Antibacterial activity of extracts from five medicinal plants and their formula against bacteria that cause chronic wound infection.

PubMed

Temrangsee, Pornthep; Kondo, Sumalee; Itharat, Arunporn

2011-12-01

Chronic wound is caused by various factors such as chemotherapy, gene damage, treatment with steroids, diabetes mellitus, renal failure, blood pressure, infection and nutritional factors. One of the most common causes is bacterial infection. Antibacterial activity of several herbal plants has been reported. Thai medicinal plants which possess biological activities are potential to develop an alternative treatment of bacterial infection. To study efficiency of extracts from medicinal plants and their formula against bacteria that cause chronic wound infection. Extraction of Thai medicinal plants including Curcuma longa Linn, Rhinacanthus nasutus Linn, Garcinia mangostana Linn, Caesalpinia sappan Linn and Centellia asiatica Linn was performed by maceration with 95% ethanol and decoction followed by freeze dry. Formulation was conducted by varying the ratio of each components. Antibacterial activity were determined disk diffusion and broth dilution against Staphylococcus aureus, Methicillin-resistant Staphylococcus aureus (MRSA), Pseudomonas aeruginosa, Acinetobacter baumanii, Escherichia coli and Klebsiella pneumoniae. Ethanolic extracts exhibited better antibacterial activity against tested strains than water extracts. Antibacterial activity of Caesalpinia sappan Linn. against S. aureus and MRSA showed the most effective with MIC value of 0.625 mg/ml. One of the five different formulas which contained two times proportion of C. sappan revealed that this formula was able to inhibit all tested strains with the MIC ranging between 0.156 mg/ml and 10 mg/ml. C. sappan is the most effective herbal plant. The formula with two times proportion of C. sappan is potentially best formula for development of medicinal product of chronic wound infection. The potential active compound of C. sappan is suggested for further investigation of antimicrobial activity and other biological properties.

Effects of herbal medicinal formulas on suppressing viral replication and modulating immune responses.

PubMed

Liao, Hui-Fen; Lu, Min-Chi; Chang, Hon-Chou; Wei, Cheng-Chung; Kao, Chih-Hsiung; Chen, Zong-Huei; Huang, Chin-Chin; Li, Ching

2010-01-01

The Chinese medicinal herbs Radix Isatidis and Viola yedoensis Makino have been suggested to possess antiviral activity. This study tests whether these and other Chinese and Western herbal medicinal formulas can modulate the immune functions involving virus-suppression in BALB/c mouse. We first confirmed the extract from Viola yedoensis Makino, but not from Radix Isatidis, the traditional Chinese medicine (TCM) formula Chui-Uren-Chien (CUC), or a Western homeopathic medicinal drink Método Canova, could inhibit the replications of herpes simplex virus-1 and enterovirus 71 in the human neuroblastoma SK-N-SH cell line. Subsequently, the same herbal extracts and drink underwent toxicity and immunomodulatory tests on mice of 5-7 weeks old. After 8 weeks of feeding different herbal medicinal formulas, no hepatic or renal toxicity was noted in any tested animal; whereas among the immune function evaluations, only the mice treated with CUC extract were found to be associated with significant increases (p < 0.05) in both the level of plasma IgG and the percentage of monocyte in blood mononuclear cells as well as the activation of macrophage Raw264.7 cells for nitric oxide production, suggesting its role in modulating the non-specific immune response. Analyses using protein arrays showed CUC was the most potent herbal medicinal formula eliciting fluctuations in plasma cytokine and chemokine concentrations. Taking all experimental data together, we conclude Chui-Uren-Chien possesses immunomodulatory capability in mouse, but none of the herbal medicinal formulas tested here are involved in strengthening antiviral immunity.

High performance thin layer chromatography fingerprinting, phytochemical and physico-chemical studies of anti-diabetic herbal extracts

PubMed Central

Itankar, Prakash R.; Sawant, Dattatray B.; Tauqeer, Mohd.; Charde, Sonal S.

2015-01-01

Introduction: Herbal medicines have gained increasing popularity in the last few decades, and this global resurgence of herbal medicines increases their commercial value. However, this increasing demand has resulted in a decline in their quality, primarily due to a lack of adequate regulations pertaining to herbal medicines. Aim: To develop an optimized methodology for the standardization of herbal raw materials. Materials and Methods: The present study has been designed to examine each of the five herbal anti-diabetic drugs, Gymnema sylvester R. Br., Pterocarpus marsupium Roxburgh., Enicostema littorale Blume., Syzygium cumini (L.) Skeels. and Emblica officinalis Gaertn. The in-house extracts and marketed extracts were evaluated using physicochemical parameters, preliminary phytochemical screening, quantification of polyphenols (Folin–Ciocalteu colorimetric method) and high performance thin layer chromatography (HPTLC) fingerprint profiling with reference to marker compounds in plant extracts. Results: All the plants mainly contain polyphenolic compounds and are quantified in the range of 3.6–21.72% w/w. E. officinalis contain the highest and E. littorale contain the lowest content of polyphenol among plant extracts analyzed. HPTLC fingerprinting showed that the in-house extracts were of better quality than marketed extracts. Conclusion: The results obtained from the study could be utilized for setting limits for the reference phytoconstituents (biomarker) for the quality control and quality assurance of these anti-diabetic drugs. PMID:27011722

Antiplasmodial activity of four Kenyan medicinal plants.

PubMed

Omulokoli, E; Khan, B; Chhabra, S C

1997-04-01

A preliminary antiplasmodial and phytochemical screening of four Kenyan medicinal plants was carried out. The medicinal plants were extracted and tested for in vitro antiplasmodial activity against chloroquine-sensitive (K67) and chloroquine-resistant (ENT36) strains of Plasmodium falciparum. Out of 16 extracts, 12 were active against ENT36 strain while seven were active against K67 strain, that is, IC50 < or = 50 micrograms/ml. The most active extracts on both strains were those of leaves of Phyllanthus reticulatus Poir, and Suregada zanzibariensis Baill. (Euphorbiaceae) with IC50 < or = 10 micrograms/ml. The stembark of Terminalia spinosa Engl. (Combretaceae) and the stems of Dissotis brazzae Cogn. (Melastomataceae) had IC50 < or = 10 micrograms/ml for strains K67 and ENT36, respectively. A preliminary phytochemical analysis of these plants revealed the presence of different classes of primary and secondary metabolites.

Assessment of antimalarial activity against Plasmodium falciparum and phytochemical screening of some Yemeni medicinal plants

PubMed Central

Alshawsh, Mohammed A.; Al-shamahy, Hassan A.; Alsllami, Salah F.; Lindequist, Ulrike

2009-01-01

Developing countries, where malaria is one of the most prevalent diseases, still rely on traditional medicine as a source for the treatment of this disease. In the present study, six selected plants (Acalypha fruticosa, Azadirachta indica, Cissus rotundifolia, Echium rauwalfii, Dendrosicyos socotrana and Boswellia elongata) commonly used in Yemen by traditional healers for the treatment of malaria as well as other diseases, were collected from different localities of Yemen, dried and extracted with methanol and water successfully. The antiplasmodial activity of the extracts was evaluated against fresh clinical isolates of Plasmodium falciparum. The selectivity parameters to evaluate the efficacy of these medicinal plants were measured by in vitro micro test (Mark III) according to World Health Organization (WHO) 1996 & WHO 2001 protocols of antimalarial drug tests. Among the investigated 12 extracts, three were found to have significant antiplasmodial activity with IC50 values less than 4 µg/ml, namely the water extracts of A. fruticosa, A. indica and D. socotrana. Six extracts showed moderate activity with IC50 values ranging from 10 to 30 µg/ml and three appeared to be inactive with IC50 values more than 30 µg/ml. In addition, preliminary phytochemical screening of the methanolic and aqueous extracts indicated the presence of saponins, tannins, flavonoids, terpenoids, polysaccharides and peptides. PMID:18955251

Aqueous Extracts of Some Medicinal Plants are as Toxic as Lmidacloprid to the Sweet Potato Whitefly, Bemisia tabaci

PubMed Central

Ateyyat, Mazen A.; Al-Mazra'awi, Mohammad; Abu-Rjai, Talal; Shatnawi, Mohamad A.

2009-01-01

Aqueous extracts of nine plants, known to have medicinal activity, were tested for their toxicity against the sweet potato whitefly, Bemisia tabaci Genn. (Homoptera: Aleurodidae) compared to the toxicity of the insecticide, Imidacloprid. Extracts of Lepidiuim sativum L. (Brassicales: Brassicaceae) killed 71 % of early stage nymphs, which was not significantly different from mortality caused by Imidacloprid. Treatment of pupae with three plant extracts, L. sativum, Achillea biebersteinii L. (Asterales: Asteraceae), or Retama raetam (Forssk.) Webb and Berthel (Fabales: Fabaceae) prevented adult development, and treatment with R. raetam extract killed adults, at levels that were not significantly different from Imidacloprid. None of the other plants showed significant toxicity. However extracts of four plants, Pimpinella anisum L. (Apiales: Apiaceae), Galium longifolium (Sibth. and SM.) (Gentianales: Rubiaceae), R. raetam and Ballota undulata Bentham (Lamiales: Lamiaceae) had a repellent effect. PMID:19613450

Wound healing activity of an aqueous extract of the Lingzhi or Reishi medicinal mushroom Ganoderma lucidum (higher Basidiomycetes).

PubMed

Gupta, Asheesh; Kirar, Vandana; Keshri, Gaurav Kr; Gola, Shefali; Yadav, Anju; Negi, Prem Singh; Misra, Kshipra

2014-01-01

The Lingzhi or Reishi medicinal mushroom Ganoderma lucidum (higher Basidiomycetes) is popular because of its health-promoting properties. The effects of G. lucidum extract on cancer, hypertension, hypercholesterolemia, and hepatitis have been reported by many researchers. This investigation was undertaken to evaluate the healing efficacy of an aqueous lyophilized extract of G. lucidum from the Indian Himalayan region on dermal excision wound in experimental rats. The extract used in the study was found to be rich in total polyphenol and flavonoid contents. The healing efficacy was comparatively assessed with a reference povidone-iodine ointment. The G. lucidum extract showed significant enhanced healing activity, evidenced by an increase in wound contraction, collagen accumulation (hydroxyproline), hexosamine, and total protein contents. Histopathological findings further supported the biochemical indices. The results suggest that aqueous lyophilized extract of G. lucidum possesses significant wound-healing activity.

Alpha-Glucosidase Enzyme Biosensor for the Electrochemical Measurement of Antidiabetic Potential of Medicinal Plants

NASA Astrophysics Data System (ADS)

Mohiuddin, M.; Arbain, D.; Islam, A. K. M. Shafiqul; Ahmad, M. S.; Ahmad, M. N.

2016-02-01

A biosensor for measuring the antidiabetic potential of medicinal plants was developed by covalent immobilization of α-glucosidase (AG) enzyme onto amine-functionalized multi-walled carbon nanotubes (MWCNTs-NH2). The immobilized enzyme was entrapped in freeze-thawed polyvinyl alcohol (PVA) together with p-nitrophenyl-α- d-glucopyranoside (PNPG) on the screen-printed carbon electrode at low pH to prevent the premature reaction between PNPG and AG enzyme. The enzymatic reaction within the biosensor is inhibited by bioactive compounds in the medicinal plant extracts. The capability of medicinal plants to inhibit the AG enzyme on the electrode correlates to the potential of the medicinal plants to inhibit the production of glucose from the carbohydrate in the human body. Thus, the inhibition indicates the antidiabetic potential of the medicinal plants. The performance of the biosensor was evaluated to measure the antidiabetic potential of three medicinal plants such as Tebengau ( Ehretis laevis), Cemumar ( Micromelum pubescens), and Kedondong ( Spondias dulcis) and acarbose (commercial antidiabetic drug) via cyclic voltammetry, amperometry, and spectrophotometry. The cyclic voltammetry (CV) response for the inhibition of the AG enzyme activity by Tebengau plant extracts showed a linear relation in the range from 0.423-8.29 μA, and the inhibition detection limit was 0.253 μA. The biosensor exhibited good sensitivity (0.422 μA/mg Tebengau plant extracts) and rapid response (22 s). The biosensor retains approximately 82.16 % of its initial activity even after 30 days of storage at 4 °C.

Loranthus ferrugineus: a Mistletoe from Traditional Uses to Laboratory Bench

PubMed Central

Omar Z., Ameer; Ibrahim M., Salman; Ko Jin, Quek; Mohd. Z., Asmawi

2015-01-01

Objectives: Loranthus ferrugineus (L. ferrugineus) from Loranthaceae, a mistletoe, is a medicinal herb used for a variety of human ailments. Traditionally, decoctions of this parasitic shrub have been mainly used to treat high blood pressure (BP) and gastrointestinal complaints; usage which is supported by experimental based pharmacological investigations. Nonetheless, there is still limited data available evaluating this plant’s traditions, and few studies have been scientifically translated toward evidence based phytomedicine. We therefore provide a concise review of the currently available L. ferrugineus literature and discuss potential directions for future areas of investigation. Methods: We surveyed available literature covering ethnopharmacological usage of L. ferrugineus and discussed relevant findings, including important future directions and shortcomings for the medicinal values of this parasitic shrub. Results: Evidence based pharmacological approaches significantly covered the medicinal application of L. ferrugineus for hypertension and gastrointestinal complaint management, with a particular focus on the active hydrophilic extract of this herb. Conclusion: Understanding the sites of action of this plant and its beneficial effects will provide justification for its use in old traditional treatments, and potentially lead to the development of therapies. Other medicinal applicative areas of this parasitic shrub, such as wound healing, gerontological effects, and antiviral and anticancer activities, are yet to be researched. PMID:25830054

IN VITRO ANTIFUNGAL ACTIVITY OF METHANOLIC EXTRACTS OF DIFFERENT Senna didymobotrya (FRESEN.) H.S. IRWIN & BARNEBY PLANT PARTS.

PubMed

P, Jeruto; P F, Arama; B, Anyango; T, Akenga; R, Nyunja; D, Khasabuli

2016-01-01

Herbal medicines have been in use for many years and remain widespread in developing countries; whereas, the use of complementary alternative medicine is on the increase in developed countries. Senna didymobotrya is important for its medicinal benefits among most communities in treating a wide range of ailments. Plants were collected from a cluster in Siaya, Nandi and Nakuru counties (Kenya). Stem bark, root bark, leaves, flowers and immature pods were obtained; air-dried and ground into fine powder. Methanol was used to extract the plant extracts. The extracts were reconstituted in water and incorporated into growth media to obtain 0%, 2.5%, 5%, 7.5% and 10%. Bioassays were carried out on T. tonsurans (ATCC 28942) and C. albicans (14053). The growth of cultures on the plates was measured over a period of sixteen days. The area under disease progress stairs was determined and subjected to ANOVA and comparison of means using LSD. Results indicated that the growth of C. albicans was not significantly affected by the plant extracts. Growth of T. tonsurans was completely inhibited by immature pods extract at 10%, the leaves and flowers extracts inhibited the growth at 7.5%. The stem and root bark extracts inhibited growth at low dosages of 2.5- 5 %. There is need to carry out research on root and stem barks to identify the active phytochemicals that contribute to their high efficacies. On species conservation, harvesting of roots may lead to depletion of S. didymobotrya .

Antimicrobial Activities of a Plethora of Medicinal Plant Extracts and Hydrolates against Human Pathogens and Their Potential to Reverse Antibiotic Resistance

PubMed Central

Njimoh, Dieudonné Lemuh; Assob, Jules Clement N.; Mokake, Seraphine Ebenye; Nyhalah, Dinga Jerome; Yinda, Claude Kwe; Sandjon, Bertrand

2015-01-01

Microbial infections till date remain a scourge of humanity due to lack of vaccine against some infections, emergence of drug resistant phenotypes, and the resurgence of infections amongst others. Continuous quest for novel therapeutic approaches remains imperative. Here we (i) assessed the effects of extracts/hydrolates of some medicinal plants on pathogenic microorganisms and (ii) evaluated the inhibitory potential of the most active ones in combination with antibiotics. Extract E03 had the highest DZI (25 mm). Extracts E05 and E06 were active against all microorganisms tested. The MICs and MBCs of the methanol extracts ranged from 16.667 × 103  μg/mL to 2 μg/mL and hydrolates from 0.028 to 333333 ppm. Extract E30 had the highest activity especially against S. saprophyticus (MIC of 6 ppm) and E. coli (MIC of 17 ppm). Combination with conventional antibiotics was shown to overcome resistance especially with E30. Analyses of the extracts revealed the presence of alkaloids, flavonoids, triterpenes, steroids, phenols, and saponins. These results justify the use of these plants in traditional medicine and the practice of supplementing decoctions/concoctions with conventional antibiotics. Nauclea pobeguinii (E30), the most active and synergistic of all these extracts, and some hydrolates with antimicrobial activity need further exploration for the development of novel antimicrobials. PMID:26180528

Comparison of two Jatropha species (Euphorbiaceae) used popularly to treat snakebites in Northeastern Brazil: Chemical profile, inhibitory activity against Bothrops erythromelas venom and antibacterial activity.

PubMed

Félix-Silva, Juliana; Gomes, Jacyra A S; Fernandes, Júlia M; Moura, Angela K C; Menezes, Yamara A S; Santos, Elizabeth C G; Tambourgi, Denise V; Silva-Junior, Arnóbio A; Zucolotto, Silvana M; Fernandes-Pedrosa, Matheus F

2018-03-01

Jatropha species (Euphorbiaceae) are largely used in traditional medicine to treat different pathologies in Africa, Asia and Latin America. In Northeastern Brazilian folk medicine, several Jatropha species, such as Jatropha gossypiifolia L. and Jatropha mollissima (Pohl) Baill., are indistinctly used to treat snakebites. To compare two of the Brazilian most used Jatropha species for snakebites (J. gossypiifolia and J. mollissima), in relation to their ability to inhibit local edematogenic activity of Bothrops erythromelas snake venom in mice, their in vitro antibacterial activity and phytochemical profile. Aqueous leaf extracts of J. gossypiifolia (AEJg) and J. mollissima (AEJm) were prepared by decoction. AEJg and AEJm were compared chemically, by thin layer chromatography (TLC) and high-performance liquid chromatography with diode array detection (HPLC-DAD) analysis. They were also pharmacologically compared, using the mouse model of paw edema induced by Bothrops erythromelas snake venom (BeV), and in vitro by broth microdilution and agar dilution antimicrobial tests. Flavonoids were detected as the major compounds in both extracts. However, AEJg and AEJm showed quantitatively different chemical profiles by HPLC-DAD. AEJg presented fewer peaks of flavonoids than AEJm, however, when the intensity of peaks were analyzed, these compounds were at high concentration in AEJg, even using the same concentration of both extracts. Differences were also observed in the biological activity of the two extracts. While no difference was observed when the extracts were administered by oral route (P > 0.05), by the intraperitoneal route AEJg presented anti-edematogenic activity significantly (P < 0.001) higher than AEJm. In antimicrobial assays, only AEJg presented antibacterial activity against Staphylococcus epidermidis, Staphylococcus aureus and Bacillus cereus. Although used indistinctly by folk medicine, our results suggested that AEJg is more active than AEJm in relation to its antiedematogenic and antibacterial activities. Significant differences were observed in their phytochemical profiles, especially a higher content of C-glycosylated flavonoids in the most active species, which could justify the different biological effects observed. These findings strengthen the potentiality of J. gossypiifolia species for use as complementary treatment for local effects induced by Bothrops venoms and could be helpful for distinction of the species and control quality assessment of future herbal medicines based on Jatropha plants. Copyright © 2017 Elsevier B.V. All rights reserved.

Hydroalcoholic extract based-ointment from Punica granatum L. peels with enhanced in vivo healing potential on dermal wounds.

PubMed

Hayouni, E A; Miled, K; Boubaker, S; Bellasfar, Z; Abedrabba, M; Iwaski, H; Oku, H; Matsui, T; Limam, F; Hamdi, M

2011-08-15

The present study reports for the first time, the in vivo wound healing potential of Punica granatum L. peels. A 5% (w/w) methanolic extract based-ointment was formulated and evaluated for its wound healing in guinea pigs. The ointment was applied in vivo on the paravertebral area of twelve excised wounded models once a day for 10 consecutive days. The ointment significantly enhanced the wound contraction and the period of epithelialization as assessed by the mechanical (contraction rate, tensile strength), the biochemical (increasing of collagen, DNA and proteins synthesis) and the histopathological characteristics. Such investigation was encouraged by the efficiency of the methanolic extract as antimicrobial and antioxidant. Indeed, the extract showed antioxidant activity as strong as natural and synthetic compounds (Trolox, BHA, Quercetin). Furthermore, the extract exhibited significant antibacterial and antifungal activity against almost all tested bacteria: Pseudomonas aeruginosa ATCC 9027, Staphylococcus aureus ATCC 25923, Escherichia coli ATCC 25922, Klebsiella pneumoniae, Salmonella anatum, Salmonella typhimurium, Streptococcus pneumoniae, and fungi Candida albicans, Candida glabrata, Trichopyton rubrum and Aspergillus niger. The formulated ointment might well find use as skin repair agent without hazard to human health based on these results and on the fact that it has been well established that the extracts of pomegranate used in conditions similar to those applied by traditional medicine, showed no toxic effects. Copyright © 2011 Elsevier GmbH. All rights reserved.

The Multivariate Regression Statistics Strategy to Investigate Content-Effect Correlation of Multiple Components in Traditional Chinese Medicine Based on a Partial Least Squares Method.

PubMed

Peng, Ying; Li, Su-Ning; Pei, Xuexue; Hao, Kun

2018-03-01

Amultivariate regression statisticstrategy was developed to clarify multi-components content-effect correlation ofpanaxginseng saponins extract and predict the pharmacological effect by components content. In example 1, firstly, we compared pharmacological effects between panax ginseng saponins extract and individual saponin combinations. Secondly, we examined the anti-platelet aggregation effect in seven different saponin combinations of ginsenoside Rb1, Rg1, Rh, Rd, Ra3 and notoginsenoside R1. Finally, the correlation between anti-platelet aggregation and the content of multiple components was analyzed by a partial least squares algorithm. In example 2, firstly, 18 common peaks were identified in ten different batches of panax ginseng saponins extracts from different origins. Then, we investigated the anti-myocardial ischemia reperfusion injury effects of the ten different panax ginseng saponins extracts. Finally, the correlation between the fingerprints and the cardioprotective effects was analyzed by a partial least squares algorithm. Both in example 1 and 2, the relationship between the components content and pharmacological effect was modeled well by the partial least squares regression equations. Importantly, the predicted effect curve was close to the observed data of dot marked on the partial least squares regression model. This study has given evidences that themulti-component content is a promising information for predicting the pharmacological effects of traditional Chinese medicine.

The Diuretic Effect in Human Subjects of an Extract of Taraxacum officinale Folium over a Single Day

PubMed Central

Clare, Bevin A.; Conroy, Richard S.

2009-01-01

Abstract Background Taraxacum officinale (L.) Weber (Asteraceae) has been extensively employed as a diuretic in traditional folk medicine and in modern phytotherapy in Europe, Asia, and the Americas without prior clinical trial substantiation. Objectives In this pilot study, a high-quality fresh leaf hydroethanolic extract of the medicinal plant T. officinale (dandelion) was ingested by volunteers to investigate whether an increased urinary frequency and volume would result. Design Volume of urinary output and fluid intake were recorded by subjects. Baseline values for urinary frequency and excretion ratio (urination volume:fluid intake) were established 2 days prior to dandelion dosing (8 mL TID) and monitored throughout a 1-day dosing period and 24 hours postdosing. Results For the entire population (n = 17) there was a significant (p < 0.05) increase in the frequency of urination in the 5-hour period after the first dose. There was also a significant (p < 0.001) increase in the excretion ratio in the 5-hour period after the second dose of extract. The third dose failed to change any of the measured parameters. Conclusions Based on these first human data, T. officinale ethanolic extract shows promise as a diuretic in humans. Further studies are needed to establish the value of this herb for induction of diuresis in human subjects. PMID:19678785

Medicinal Plants Used by a Mbyá-Guarani Tribe Against Infections: Activity on KPC-Producing Isolates and Biofilm-Forming Bacteria.

PubMed

Brandelli, Clara Lia Costa; Ribeiro, Vanessa Bley; Zimmer, Karine Rigon; Barth, Afonso Luís; Tasca, Tiana; Macedo, Alexandre José

2015-11-01

The traditional use of medicinal plants for treatment of infectious diseases by an indigenous Mbyá-Guarani tribe from South Brazil was assessed by evaluating the antibiotic and antibiofilm activities against relevant bacterial pathogens. Aqueous extracts from 10 medicinal plants were prepared according to indigenous Mbyá-Guarani traditional uses. To evaluate antibiotic (OD600) and antibiofilm (crystal violet method) activities, Pseudomonas aeruginosa ATCC 27853, Staphylococcus epidermidis ATCC 35984 and seven multi-drug resistant Klebsiella pneumoniae carbapenemase (KPC)-producing bacterial clinical isolates were challenged with the extracts. Furthermore, the susceptibility profile of KPC-producing bacteria and the ability of these isolates to form biofilm were evaluated. The plants Campomanesia xanthocarpa, Maytenus ilicifolia, Bidens pilosa and Verbena sp. showed the best activity against bacterial growth and biofilm formation. The majority of KPC-producing isolates, which showed strong ability to form biofilm and a multidrug resistance profile, was inhibited by more than 50% by some extracts. The Enterobacter cloacae (KPC 05) clinical isolate was the only one resistant to all extracts. This study confirms the importance of indigenous traditional medicinal knowledge and describes for the first time the ability of these plants to inhibit biofilm formation and/or bacterial growth of multi-drug resistant KPC-producing isolates.

Analysis of Flavonoid in Medicinal Plant Extract Using Infrared Spectroscopy and Chemometrics

PubMed Central

Retnaningtyas, Yuni; Nuri; Lukman, Hilmia

2016-01-01

Infrared (IR) spectroscopy combined with chemometrics has been developed for simple analysis of flavonoid in the medicinal plant extract. Flavonoid was extracted from medicinal plant leaves by ultrasonication and maceration. IR spectra of selected medicinal plant extract were correlated with flavonoid content using chemometrics. The chemometric method used for calibration analysis was Partial Last Square (PLS) and the methods used for classification analysis were Linear Discriminant Analysis (LDA), Soft Independent Modelling of Class Analogies (SIMCA), and Support Vector Machines (SVM). In this study, the calibration of NIR model that showed best calibration with R 2 and RMSEC value was 0.9916499 and 2.1521897, respectively, while the accuracy of all classification models (LDA, SIMCA, and SVM) was 100%. R 2 and RMSEC of calibration of FTIR model were 0.8653689 and 8.8958149, respectively, while the accuracy of LDA, SIMCA, and SVM was 86.0%, 91.2%, and 77.3%, respectively. PLS and LDA of NIR models were further used to predict unknown flavonoid content in commercial samples. Using these models, the significance of flavonoid content that has been measured by NIR and UV-Vis spectrophotometry was evaluated with paired samples t-test. The flavonoid content that has been measured with both methods gave no significant difference. PMID:27529051

Analysis and Recognition of Traditional Chinese Medicine Pulse Based on the Hilbert-Huang Transform and Random Forest in Patients with Coronary Heart Disease

PubMed Central

Wang, Yiqin; Yan, Hanxia; Yan, Jianjun; Yuan, Fengyin; Xu, Zhaoxia; Liu, Guoping; Xu, Wenjie

2015-01-01

Objective. This research provides objective and quantitative parameters of the traditional Chinese medicine (TCM) pulse conditions for distinguishing between patients with the coronary heart disease (CHD) and normal people by using the proposed classification approach based on Hilbert-Huang transform (HHT) and random forest. Methods. The energy and the sample entropy features were extracted by applying the HHT to TCM pulse by treating these pulse signals as time series. By using the random forest classifier, the extracted two types of features and their combination were, respectively, used as input data to establish classification model. Results. Statistical results showed that there were significant differences in the pulse energy and sample entropy between the CHD group and the normal group. Moreover, the energy features, sample entropy features, and their combination were inputted as pulse feature vectors; the corresponding average recognition rates were 84%, 76.35%, and 90.21%, respectively. Conclusion. The proposed approach could be appropriately used to analyze pulses of patients with CHD, which can lay a foundation for research on objective and quantitative criteria on disease diagnosis or Zheng differentiation. PMID:26180536

Analysis and Recognition of Traditional Chinese Medicine Pulse Based on the Hilbert-Huang Transform and Random Forest in Patients with Coronary Heart Disease.

PubMed

Guo, Rui; Wang, Yiqin; Yan, Hanxia; Yan, Jianjun; Yuan, Fengyin; Xu, Zhaoxia; Liu, Guoping; Xu, Wenjie

2015-01-01

Objective. This research provides objective and quantitative parameters of the traditional Chinese medicine (TCM) pulse conditions for distinguishing between patients with the coronary heart disease (CHD) and normal people by using the proposed classification approach based on Hilbert-Huang transform (HHT) and random forest. Methods. The energy and the sample entropy features were extracted by applying the HHT to TCM pulse by treating these pulse signals as time series. By using the random forest classifier, the extracted two types of features and their combination were, respectively, used as input data to establish classification model. Results. Statistical results showed that there were significant differences in the pulse energy and sample entropy between the CHD group and the normal group. Moreover, the energy features, sample entropy features, and their combination were inputted as pulse feature vectors; the corresponding average recognition rates were 84%, 76.35%, and 90.21%, respectively. Conclusion. The proposed approach could be appropriately used to analyze pulses of patients with CHD, which can lay a foundation for research on objective and quantitative criteria on disease diagnosis or Zheng differentiation.

Screening of medicinal plants from Trinidad and Tobago for antimicrobial and insecticidal properties.

PubMed

Chariandy, C M; Seaforth, C E; Phelps, R H; Pollard, G V; Khambay, B P

1999-03-01

Antibacterial activity in 51 extracts from 29 plant species currently used in traditional medicine in Trinidad and the neighbouring Caribbean islands was tested for by the agar dilution streak method using six bacteria: Escherichia coli, Pseudomonas aeruginosa. Salmonella tophimurium, Staphylococcus aureus, Staphylococcus epidermidis and Enterococcus faecalis. The extracts from eight of the plants tested showed significant activity against one or more micro-organisms and the most susceptible bacterium was Staphylococcus aureus. In the bioassays for toxicity towards the Aedes aegypti mosquito the most effective plant extracts were from Justicia pectoralis, Manihot utilissima and Stachytarpheta jamaicensis.

Herbal Medicine for Oligomenorrhea and Amenorrhea: A Systematic Review of Ancient and Conventional Medicine

PubMed Central

Tansaz, Mojgan; Nazemiyeh, Hossein; Fazljou, Seyed Mohammad Bagher

2018-01-01

Introduction Menstrual bleeding cessation is one of the most frequent gynecologic disorders among women in reproductive age. The treatment is based on hormone therapy. Due to the increasing request for alternative medicine remedies in the field of women's diseases, in present study, it was tried to overview medicinal plants used to treat oligomenorrhea and amenorrhea according to the pharmaceutical textbooks of traditional Persian medicine (TPM) and review the evidence in the conventional medicine. Methods This systematic review was designed and performed in 2017 in order to gather information regarding herbal medications of oligomenorrhea and amenorrhea in TPM and conventional medicine. This study had several steps as searching Iranian traditional medicine literature and extracting the emmenagogue plants, classifying the plants, searching the electronic databases, and finding evidences. To search traditional Persian medicine references, Noor digital library was used, which includes several ancient traditional medical references. The classification of plants was done based on the repetition and potency of the plants in the ancient literatures. The required data was gathered using databases such as PubMed, Scopus, Google Scholar, Cochrane Library, Science Direct, and web of knowledge. Results In present study of all 198 emmenagogue medicinal plants found in TPM, 87 cases were specified to be more effective in treating oligomenorrhea and amenorrhea. In second part of present study, where a search of conventional medicine was performed, 12 studies were found, which had 8 plants investigated: Vitex agnus-castus, Trigonella foenum-graecum, Foeniculum vulgare, Cinnamomum verum, Paeonia lactiflora, Sesamum indicum, Mentha longifolia, and Urtica dioica. Conclusion. Traditional Persian medicine has proposed many different medicinal plants for treatment of oligomenorrhea and amenorrhea. Although just few plants have been proven to be effective for treatment of menstrual irregularities, the results and the classification in present study can be used as an outline for future studies and treatment. PMID:29744355

Herbal Medicine for Oligomenorrhea and Amenorrhea: A Systematic Review of Ancient and Conventional Medicine.

PubMed

Moini Jazani, Arezoo; Hamdi, Kobra; Tansaz, Mojgan; Nazemiyeh, Hossein; Sadeghi Bazargani, Homayoun; Fazljou, Seyed Mohammad Bagher; Nasimi Doost Azgomi, Ramin

2018-01-01

Menstrual bleeding cessation is one of the most frequent gynecologic disorders among women in reproductive age. The treatment is based on hormone therapy. Due to the increasing request for alternative medicine remedies in the field of women's diseases, in present study, it was tried to overview medicinal plants used to treat oligomenorrhea and amenorrhea according to the pharmaceutical textbooks of traditional Persian medicine (TPM) and review the evidence in the conventional medicine. This systematic review was designed and performed in 2017 in order to gather information regarding herbal medications of oligomenorrhea and amenorrhea in TPM and conventional medicine. This study had several steps as searching Iranian traditional medicine literature and extracting the emmenagogue plants, classifying the plants, searching the electronic databases, and finding evidences. To search traditional Persian medicine references, Noor digital library was used, which includes several ancient traditional medical references. The classification of plants was done based on the repetition and potency of the plants in the ancient literatures. The required data was gathered using databases such as PubMed, Scopus, Google Scholar, Cochrane Library, Science Direct, and web of knowledge. In present study of all 198 emmenagogue medicinal plants found in TPM, 87 cases were specified to be more effective in treating oligomenorrhea and amenorrhea. In second part of present study, where a search of conventional medicine was performed, 12 studies were found, which had 8 plants investigated: Vitex agnus-castus, Trigonella foenum-graecum, Foeniculum vulgare, Cinnamomum verum, Paeonia lactiflora, Sesamum indicum, Mentha longifolia, and Urtica dioica. Conclusion . Traditional Persian medicine has proposed many different medicinal plants for treatment of oligomenorrhea and amenorrhea. Although just few plants have been proven to be effective for treatment of menstrual irregularities, the results and the classification in present study can be used as an outline for future studies and treatment.

Analysis of prescription database extracted from standard textbooks of traditional Dai medicine

PubMed Central

2012-01-01

Background Traditional Dai Medicine (TDM) is one of the four major ethnomedicine of China. In 2007 a group of experts produced a set of seven Dai medical textbooks on this subject. The first two were selected as the main data source to analyse well recognized prescriptions. Objective To quantify patterns of prescriptions, common ingredients, indications and usages of TDM. Methods A relational database linking the prescriptions, ingredients, herb names, indications, and usages was set up. Frequency of pattern of combination and common ingredients were tabulated. Results A total of 200 prescriptions and 402 herbs were compiled. Prescriptions based on "wind" disorders, a detoxification theory that most commonly deals with symptoms of digestive system diseases, accounted for over one third of all prescriptions. The major methods of preparations mostly used roots and whole herbs. Conclusion The information extracted from the relational database may be useful for understanding symptomatic treatments. Antidote and detoxification theory deserves further research. PMID:22931752

Metabonomic study of biochemical changes in the urine of Morning Glory Seed treated rat.

PubMed

Ma, Chao; Bi, Kaishun; Zhang, Ming; Su, Dan; Fan, Xinxin; Ji, Wei; Wang, Chao; Chen, Xiaohui

2010-11-02

This paper was designed to study metabonomic characters of the nephrotoxicity induced by Morning Glory Seed (MGS), a well-known traditional Chinese medicine which was used for the treatment of edema, simple obesity and lung fever. Urinary samples from control and MGS treated rats were analyzed by ultra-performance liquid chromatography/mass spectrometry (UPLC-MS) in positive ionization mode. Blood biochemistry and histopathology were examined to identify specific changes of renal damage. The results affirmatively suggested that ethanol extract of Morning Glory Seed (EMGS), instead of water extract of Morning Glory Seed (WMGS), should be responsible for the nephrotoxicity caused by this herbal medicine. The UPLC-MS analysis revealed that the levels of 8 endogenous metabolites as biomarkers were significantly changed in urine from EMGS treated rats. The underlying regulations of EMGS-perturbed metabolic pathways were discussed according to the identified metabolites. The present study proves the potential of UPLC-MS based metabonomics in mapping metabolic response for toxicology. Copyright (c) 2010 Elsevier B.V. All rights reserved.

American palm ethnomedicine: A meta-analysis

PubMed Central

2009-01-01

Background Many recent papers have documented the phytochemical and pharmacological bases for the use of palms (Arecaceae) in ethnomedicine. Early publications were based almost entirely on interviews that solicited local knowledge. More recently, ethnobotanically guided searches for new medicinal plants have proven more successful than random sampling for identifying plants that contain biodynamic ingredients. However, limited laboratory time and the high cost of clinical trials make it difficult to test all potential medicinal plants in the search for new drug candidates. The purpose of this study was to summarize and analyze previous studies on the medicinal uses of American palms in order to narrow down the search for new palm-derived medicines. Methods Relevant literature was surveyed and data was extracted and organized into medicinal use categories. We focused on more recent literature than that considered in a review published 25 years ago. We included phytochemical and pharmacological research that explored the importance of American palms in ethnomedicine. Results Of 730 species of American palms, we found evidence that 106 species had known medicinal uses, ranging from treatments for diabetes and leishmaniasis to prostatic hyperplasia. Thus, the number of American palm species with known uses had increased from 48 to 106 over the last quarter of a century. Furthermore, the pharmacological bases for many of the effects are now understood. Conclusions Palms are important in American ethnomedicine. Some, like Serenoa repens and Roystonea regia, are the sources of drugs that have been approved for medicinal uses. In contrast, recent ethnopharmacological studies suggested that many of the reported uses of several other palms do not appear to have a strong physiological basis. This study has provided a useful assessment of the ethnobotanical and pharmacological data available on palms. PMID:20034398

Clarifying Evidence-Based Medicine in Educational and Therapeutic Experiences of Clinical Faculty Members: A Qualitative Study in Iran

PubMed Central

Safari, Yahya

2015-01-01

Introduction: Although evidence-based medicine has been a significant part of recent research efforts to reform the health care system, it requires an assessment of real life community and patient. The present study strives to clarify the concept of evidence-based medicine in educational and therapeutic experiences of clinical faculty members of Kermanshah University of Medical Sciences (2014). Materials and Methods: It was a qualitative study of phenomenology. The population consists of 12 clinical faculty members of Kermanshah University Medical Sciences. Sampling was carried out using a purposeful method. Sample volume was determined using adequacy of samples’ law. Data gathering occurred through semi-structured interviews. Collaizzi pattern was employed for data interpretation concurrent with data gathering. Results: interpreting the data, three main themes were extracted. They include: 1. Unawareness and disuse (unaware of the concept, disuse, referral to colleagues, experiment prescription) 2. Conscious or unconscious use (using journals and scientific websites, aware of the process). 3. Beliefs (belief or disbelief in necessity). Conclusion: It sounds essential to change the behavior of clinical faculty members from passive to active with respect to employing evidence-based medicine as well as to alter negative attitudes into positive ones. In so doing, systematic training program aiming at behavior changing is necessary. Also, providing dissent facilities and infrastructures and removing barriers to the use of EBM can be effective. PMID:26153205

Clarifying Evidence-Based Medicine in Educational and Therapeutic Experiences of Clinical Faculty Members: A Qualitative Study in Iran.

PubMed

Safari, Yahya

2015-03-26

Although evidence-based medicine has been a significant part of recent research efforts to reform the health care system, it requires an assessment of real life community and patient. The present study strives to clarify the concept of evidence-based medicine in educational and therapeutic experiences of clinical faculty members of Kermanshah University of Medical Sciences (2014). It was a qualitative study of phenomenology. The population consists of 12 clinical faculty members of Kermanshah University Medical Sciences. Sampling was carried out using a purposeful method. Sample volume was determined using adequacy of samples' law. Data gathering occurred through semi-structured interviews. Collaizzi pattern was employed for data interpretation concurrent with data gathering. interpreting the data, three main themes were extracted. They include: 1. Unawareness and disuse (unaware of the concept, disuse, referral to colleagues, experiment prescription) 2. Conscious or unconscious use (using journals and scientific websites, aware of the process). 3. Beliefs (belief or disbelief in necessity). It sounds essential to change the behavior of clinical faculty members from passive to active with respect to employing evidence-based medicine as well as to alter negative attitudes into positive ones. In so doing, systematic training program aiming at behavior changing is necessary. Also, providing dissent facilities and infrastructures and removing barriers to the use of EBM can be effective.

The bioactivity of plant extracts against representative bacterial pathogens of the lower respiratory tract

PubMed Central

Bocanegra-García, Virgilio; del Rayo Camacho-Corona, María; Ramírez-Cabrera, Mónica; Rivera, Gildardo; Garza-González, Elvira

2009-01-01

Background Lower respiratory tract infections are a major cause of illness and death. Such infections are common in intensive care units (ICU) and their lethality persists despite advances in diagnosis, treatment and prevention. In Mexico, some plants are used in traditional medicine to treat respiratory diseases or ailments such as cough, bronchitis, tuberculosis and other infections. Medical knowledge derived from traditional societies has motivated searches for new bioactive molecules derived from plants that show potent activity against bacterial pathogens. Therefore, the aim of this study was to evaluate the effect of hexanic, chloroformic (CLO), methanolic (MET) and aqueous extracts from various plants used in Mexican traditional medicine on various microorganisms associated with respiratory disease. Methods thirty-five extracts prepared from nine plants used in Mexican traditional medicine for the treatment of respiratory infections were evaluated against 15 control bacterial species and clinical isolates. Results Both chloroformic (CLO) and methanolic (MET) extracts of Larrea tridentata were active against Methicillin-resistant S. aureus, B. subtilis and L. monocytogenes. A MET extract of L. tridentata was also active against S. aureus, S. pneumoniae, S. maltophilia, E. faecalis and H. influenzae and the CLO extract was active against A. baumannii. An Aqueous extract of M. acumitata and a MET extract of N. officinale were active against S. pneumoniae. CLO and MET extracts of L. tridentata were active against clinical isolates of S. aureus, S. pneumoniae and E. faecalis. Conclusion Overall, our results support the potential use of L. tridentata as a source of antibacterial compounds. PMID:19486533

Antimicrobial activities of four Tunisian Chrysanthemum species.

PubMed

Sassi, Ahlem Ben; Harzallah-Skhiri, Fethia; Bourgougnon, Nathalie; Aouni, Mahjoub

2008-02-01

Tunisian Chrysanthemum species are known to have medicinal activity and some of the species are used in traditional medicine. We have earlier shown the use of C. trifurcatum flowerheads in Tunisian traditional medicine to treat constipation. In the present study we investigated the anti microbiol activity of four Tunision Chrysanthemum species. Different parts (flowers, leaves, stems, roots, leaves and flowers and leaves and stems) of four Tunisian Chrysanthemum species, were extracted with solvents of increasing polarity to obtain aqueous and organic extracts. These extracts were tested in vitro for their antimicrobial activity against 14 bacteria and four yeasts, using agar diffusion and microdilution methods. Activity was evaluated by measuring the zones of inhibition against the tested organisms and minimum inhibitory concentrations (MIC) were determined from the lowest concentrations of extracts to inhibit the growth of microorganisms. Cytotoxity and antiviral activities against Herpes simplex virus type 1 (HSV-1), were evaluated using the neutral red incorporation method. Extracts of the 4 Chrysanthemum species showed some degree of activity against one or more of the microbial strains with MIC ranging from 0.625 to 1.25 mg/ml. Most of the extracts were well tolerated by Vero cells with CC(50) > 500 microg/ml. The petroleum ether extract of C. trifurcatum stems and leaves protected infected cells with EC(50) of 100 microg/ml. Our findings showed that some Chrysanthemum extracts exhibited antimicrobial and/or anti-HSV-1 activities. Further studies aimed to the isolation and identification of active substances from the extracts which exhibited interest activities, need to be done.

Assessment of biological activity and UPLC-MS based chromatographic profiling of ethanolic extract of Ochradenus arabicus.

PubMed

Ali, M Ajmal; Farah, M Abul; Al-Hemaid, Fahad M; Abou-Tarboush, Faisal M; Al-Anazi, Khaled M; Wabaidur, S M; Alothman, Z A; Lee, Joongku

2016-03-01

Natural products from wild and medicinal plants, either in the form of crude extracts or pure compounds provide unlimited opportunities for new drug leads owing to the unmatched availability of chemical diversity. In the present study, the cytotoxic potential of crude ethanolic extract of Ochradenus arabicus was analyzed by MTT cell viability assay in MCF-7 adenocarcinoma breast cancer cells. We further investigated its effect against oxidative stress induced by anticancer drug doxorubicin. In addition, Ultra Performance Liquid Chromatography-Mass Spectrometry (UPLC-MS) based chromatographic profiling of crude extract of O. arabicus was performed. The MTT assay data showed that the extract is moderately toxic to the MCF-7 cells. However, its treatment alone does not induce oxidative stress while doxorubicin increases the level of oxidative stress in MCF-7 cells. Whereas, simultaneous treatment of plant extract and doxorubicin significantly (p < 0.05) decreased the level of intracellular reactive oxygen species (ROS) and lipid peroxidation while an increase in the reduced glutathione and superoxide dismutase activity was observed in time and dose dependent manner. Hence, our finding confirmed cytotoxic and antioxidant potential of crude extract of O. arabicus in MCF-7 cells. However, further investigations on O. arabicus as a potential chemotherapeutic agent are needed. The analysis of bioactive compounds present in the plant extracts involving the applications of common phytochemical screening assays such as chromatographic techniques is discussed.

In vivo antiplasmodial and toxicological effect of crude ethanol extract of Echinops kebericho traditionally used in treatment of malaria in Ethiopia.

PubMed

Toma, Alemayehu; Deyno, Serawit; Fikru, Abrham; Eyado, Amalework; Beale, Andrew

2015-05-10

Medicinal plants have contributed significantly to current malaria treatment. Emergence of resistance to currently available drugs has necessitated the search for new plant-based anti-malarial agents and several plant-based, pharmacologically active anti-malarial compounds have been isolated. This study was conducted to validate the traditional usage of Echinops kebericho for treating malaria in the traditional health care system of Ethiopia. The roots of E. kebericho were collected from Masha Woreda, Sheka Zone. After collection, the plant materials were identified by a taxonomist, dried under shade and crushed to powder for extraction. The powdered roots were extracted by maceration using 70 % ethanol. Acute toxicity study of the crude extract was carried out in Swiss albino mice. The in vivo anti-malarial activity of plant extract (200, 350 and 500 mg/kg) of E. kebericho roots against a chloroquine (CQ) sensitive strain of Plasmodium berghei strain ANKA was assessed using the four-day suppressive test procedure. Parameters such as parasitaemia, packed cell volume, body weight and survival time were then determined using standard tests. Oral administration of the ethanol extract showed significant (P<0.001) parasitaemia suppression at dose levels of 350 and 500 mg/kg in dose-related manner compared with the negative control. Five hundred mg/kg showed the highest (57.29±1.76 %) parasitaemia suppression. The survival times of P. berghei-infected mice were also increased in a dose-dependent manner but the test material did not prevent weight loss associated with increased parasitaemia. The result also showed the plant material prevented the loss in packed cell volume associated with increased parasitaemia. Its oral LD50 was found to be greater than 5,000 mg/kg, indicating its wider safety margin in mice. The result revealed the ethanol extract of E. kebericho roots has anti-malarial activity against P. berghei in an animal model and lends support to the use of the plant to combat malaria in Ethiopian folk medicine. Further work is necessary to isolate, identify and characterize the active principles from the plant material.

Medicinal plants used to treat TB in Ghana.

PubMed

Nguta, Joseph Mwanzia; Appiah-Opong, Regina; Nyarko, Alexander K; Yeboah-Manu, Dorothy; Addo, Phyllis G A

2015-06-01

The current study was designed to document medicinal plant species that are traditionally used to treat tuberculosis (TB) by Ghanaian communities. The medicinal plants used against TB or its signs and symptoms were selected using library and online published data searches. A guided questionnaire interview was also conducted with a botanist involved in plant collection at the Centre for Scientific Research into Plant Medicine (CSRPM) at Mampong. Data obtained were entered in Excel and summarized into means and frequencies using SPSS 12.0.1 for windows, and expressed as tables and bar graphs. A total of 15 medicinal plant species distributed between 13 genera and 13 families were documented. The following medicinal plant species were found to be used against TB in Greater Accra and Eastern parts of Ghana: Azadirachta indica A. Juss. Stem bark (Meliaceae), Hygrophila auriculata Heine, whole plant (Acanthaceae), Chenopodium ambrosioides L. leaves (Amaranthaceae), Coix lacryma-jobi L. glumes (Poaceae), Solanum torvum Sw. unripe fruits (Solanaceae), Solanum torvum Sw. leaves (Solanaceae), Bidens pilosa L. whole plant (Asteraceae), Phyllanthus fraternus G.L. Webster leaves (Phyllanthaceae), Dissotis rotundifolia (Sm.) Triana, leaves (Melastomataceae), Cymbopogon giganteus Chiov. Leaves (Poaceae), Cyperus articulatus L. roots (Cyperaceae), Allium sativum L. bulb (Amaryllidaceae), Zingiber officinale Roscoe, rhizomes (Zingiberaceae), Allium cepa L. bulbs (Amaryllidaceae), Allium cepa L. leaves (Amaryllidaceae), Aloe vera var. barbadensis aqueous extract from leaves (Xanthorrhoeaceae), Aloe vera var. barbadensis organic extract from leaves (Xanthorrhoeaceae), Cocos nucifera Linn, water (Arecaceae) and Cocos nucifera Linn. Husk (Arecaceae). The collected plant species could be a source of a new class of drugs against TB. Bioactivity guided fractionation is recommended to identify lead compounds for antimycobacterial activity. The current paper documents for the first time medicinal plant species used by Ghanaian communities to treat TB. These results are a basis for selection of plants for further pharmacological, toxicological and phytochemical studies in developing new plant-based antimycobacterial drugs. Copyright © 2015 Asian African Society for Mycobacteriology. Published by Elsevier Ltd. All rights reserved.

Phyllanthus piscatorum, ethnopharmacological studies on a women's medicinal plant of the Yanomamï Amerindians.

PubMed

Gertsch, Jürg; Niomawë; Gertsch-Roost, Kathrin; Sticher, Otto

2004-04-01

The shrub Phyllanthus piscatorum Kunth (Euphorbiaceae) is cultivated by various ethnic groups of the Amazon because of its piscicidal properties. During ethnobotanical fieldwork among the Yanomamï Amerindians in Venezuela we observed that Phyllanthus piscatorum was exclusively cultivated and used by the women. Aerial parts of this herbaceous shrub are employed as fish poison and medicine to treat wounds and fungal infections. In addition, the leaves are used as tobacco substitute. Ethnobotanical data regarding the context of the use of this plant are presented. To validate ethnobotanical information related to its medicinal indications, antimicrobial, and antiprotozoal properties of water, methanol (MeOH) and dichloromethane (DCM) extracts were studied. No activity against Gram-positive bacterial strains but significant activity against the fungi Aspergillus fumigatus, Aspergillus flavus and the yeast Candida albicans were found. All extracts showed weak in vitro activity against Plasmodium falciparum and Trypanosoma brucei rhodesiense. The extracts were further investigated for cytotoxic effects in an in vitro test system with leukemia Jurkat T, HeLa, and human peripheral mononuclear blood cells (PBMCs). During the first 48 h the extracts did not exhibit any cytotoxicity. After 72 h the DCM extract potently inhibited viability of HeLa cells. Although in several communities along the upper Orinoco the cultivation and use of Phyllanthus piscatorum is being lost because of the ongoing acculturation, the traditional medicinal use of Phyllanthus piscatorum might provide an effective and cheap remedy against dermatological diseases linked with Candida albicans infections.

Antibacterial Activities of Five Medicinal Plants in Ethiopia against Some Human and Animal Pathogens

PubMed Central

Admasu, Birhanu; Hiwot Gebrekidan, Tsegaye; Gebru, Gebreyohans

2018-01-01

Objective To evaluate the in vitro antibacterial activities of five plant extracts which have been used as traditional medicines by local healers against three multidrug resistant bacteria, namely, Staphylococcus aureus, Escherichia coli, and Pseudomonas aeruginosa. Results The highest mean zone of inhibition (4.66 mm) was recorded from methanol extract of Calpurnia aurea (Ait.) Benth. at a concentration of 200 mg/ml against S. aureus, followed by Croton macrostachyus Del. (4.43 mm) at the same dose and solvent for the same bacterial species, while methanol and chloroform extracts of E. brucei Schwein. did not inhibit growth of any bacterial species. The lowest value (100 μg/ml) of minimum inhibitory concentration (MIC) was observed from both methanol and chloroform extracts of C. aurea (Ait.) Benth. against all the three bacteria. The results of the positive control had no statistically significant difference (P > 0.05) when compared with crude extracts of C. aurea (Ait.) Benth. at concentration of 200 mg/ml against S. aureus. Conclusion The results of the present study support the traditional uses of these medicinal plants by the local healers. Except Erythrina brucei Schwein., all the plants investigated in this study exhibited antibacterial activities against the test bacterial species. Further researches are needed to be conducted to evaluate efficacy of these medicinal plant species on other microbes in different agroecological settings and their safety levels as well as their phytochemical compositions. PMID:29552081

Antibacterial Activities of Five Medicinal Plants in Ethiopia against Some Human and Animal Pathogens.

PubMed

Romha, Gebremedhin; Admasu, Birhanu; Hiwot Gebrekidan, Tsegaye; Aleme, Hailelule; Gebru, Gebreyohans

2018-01-01

To evaluate the in vitro antibacterial activities of five plant extracts which have been used as traditional medicines by local healers against three multidrug resistant bacteria, namely, Staphylococcus aureus , Escherichia coli , and Pseudomonas aeruginosa . The highest mean zone of inhibition (4.66 mm) was recorded from methanol extract of Calpurnia aurea (Ait.) Benth. at a concentration of 200 mg/ml against S. aureus , followed by Croton macrostachyus Del. (4.43 mm) at the same dose and solvent for the same bacterial species, while methanol and chloroform extracts of E. brucei Schwein. did not inhibit growth of any bacterial species. The lowest value (100  μ g/ml) of minimum inhibitory concentration (MIC) was observed from both methanol and chloroform extracts of C. aurea (Ait.) Benth. against all the three bacteria. The results of the positive control had no statistically significant difference ( P > 0.05) when compared with crude extracts of C. aurea (Ait.) Benth. at concentration of 200 mg/ml against S. aureus . The results of the present study support the traditional uses of these medicinal plants by the local healers. Except Erythrina brucei Schwein., all the plants investigated in this study exhibited antibacterial activities against the test bacterial species. Further researches are needed to be conducted to evaluate efficacy of these medicinal plant species on other microbes in different agroecological settings and their safety levels as well as their phytochemical compositions.

Antiproliferative activities and phenolic acid content of water and ethanolic extracts of the powdered formula of Houttuynia cordata Thunb. fermented broth and Phyllanthus emblica Linn. fruit.

PubMed

Kumnerdkhonkaen, Piyawan; Saenglee, Somprasong; Asgar, Md Ali; Senawong, Gulsiri; Khongsukwiwat, Kanoknan; Senawong, Thanaset

2018-04-11

Houttuynia cordata Thunb. and Phyllanthus emblica Linn. are native plants with medicinal and nutritive significance in Asia. The present study was aimed at evaluating antiproliferative effects on human cancer cell lines and identifying the phenolic acid composition of water and ethanolic extracts of the powdered formula of H. cordata fermented broth and P. emblica fruit. Anticancer activity of the extracts was evaluated against HeLa, HT29, HCT116, MCF7 and Jurkat cells using an MTT assay and flow cytometric analysis of apoptosis induction and cell cycle arrest. Reverse phase HPLC was exploited for identification and quantification of some phenolic acids. MTT assay showed that both water and ethanolic extracts significantly decreased the viability of cancer cells in a dose- and time-dependent fashion. Based on the IC 50 values, ethanolic extract (IC 50 values = 0.12-0.65 mg/mL) was more cytotoxic than water extract (IC 50 values = 0.22-0.85 mg/mL) and Jurkat cells were the most sensitive to both extracts (IC 50 values = 0.12-0.69 mg/mL). The underlying mechanism for antiproliferative activity was apoptosis induction, especially in HT29, HCT116, MCF7 and Jurkat cells. HT29 cells were the most sensitive to extract-induced apoptosis. Ethanolic extract was more effective at inducing apoptosis than water extract. Moreover, cell cycle arrest was found to be another mechanism behind growth inhibition in Jurkat and HCT116 cells. However, these extracts were relatively less toxic to non-cancer Vero cells. HPLC analysis demonstrated that the powder mix extracts contained seven identified phenolic acids namely gallic, p-hydroxybenzoic, vanillic, syringic, p-coumaric, ferulic and sinapinic acids, where p-coumaric acid was detected in the highest concentration followed by ferulic acid. Overall, the results of this study suggest the powdered formula of H. cordata fermented broth and P. emblica fruit as an alternative medicine for cancer prevention and treatment.

(1)H NMR-based metabonomics revealed protective effect of Naodesheng bioactive extract on ischemic stroke rats.

PubMed

Luo, Lan; Zhen, Lifeng; Xu, Yatao; Yang, Yongxia; Feng, Suxiang; Wang, Shumei; Liang, Shengwang

2016-06-20

Stroke is a leading cause of death and disability in the world. However, current therapies are limited. Naodesheng, a widely used traditional Chinese medicine prescription, has shown a good clinical curative effect on ischemic stroke. Also, Naodesheng has been suggested to have neuroprotective effect on focal cerebral ischemia rats, but the underlying molecular mechanism remains unclear. The present study was designed to evaluate the effect of Naodesheng bioactive extract on the metabolic changes in brain tissue, plasma and urine induced by cerebral ischemia perfusion injury, and explore the possible metabolic mechanisms by using a (1)H NMR-based metabonomics approach. A middle cerebral artery occlusion rat model was established and confirmed by the experiments of neurobehavioral abnormality evaluation, brain tissue TTC staining and pathological examination. The metabolic changes in brain tissue, plasma and urine were then assessed by a (1)H NMR technique combined with multivariate statistical analysis method. These NMR data showed that cerebral ischemia reperfusion induced great metabolic disorders in brain tissue, plasma and urine metabolisms. However, Naodesheng bioactive extract could reverse most of the imbalanced metabolites. Meanwhile, it was found that both the medium and high dosages of Naodesheng bioactive extract were more effective on the metabolic changes than the low dosage, consistent with histopathological assessments. These results revealed that Naodesheng had protective effect on ischemic stroke rats and the underlying mechanisms involved multiple metabolic pathways, including energy metabolism, amino acid metabolism, oxidative stress and inflammatory injury. The present study could provide evidence that metabonomics revealed its capacity to evaluate the holistic efficacy of traditional Chinese medicine and explore the underlying mechanisms. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Development of a quantitative intracranial vascular features extraction tool on 3D MRA using semiautomated open-curve active contour vessel tracing.

PubMed

Chen, Li; Mossa-Basha, Mahmud; Balu, Niranjan; Canton, Gador; Sun, Jie; Pimentel, Kristi; Hatsukami, Thomas S; Hwang, Jenq-Neng; Yuan, Chun

2018-06-01

To develop a quantitative intracranial artery measurement technique to extract comprehensive artery features from time-of-flight MR angiography (MRA). By semiautomatically tracing arteries based on an open-curve active contour model in a graphical user interface, 12 basic morphometric features and 16 basic intensity features for each artery were identified. Arteries were then classified as one of 24 types using prediction from a probability model. Based on the anatomical structures, features were integrated within 34 vascular groups for regional features of vascular trees. Eight 3D MRA acquisitions with intracranial atherosclerosis were assessed to validate this technique. Arterial tracings were validated by an experienced neuroradiologist who checked agreement at bifurcation and stenosis locations. This technique achieved 94% sensitivity and 85% positive predictive values (PPV) for bifurcations, and 85% sensitivity and PPV for stenosis. Up to 1,456 features, such as length, volume, and averaged signal intensity for each artery, as well as vascular group in each of the MRA images, could be extracted to comprehensively reflect characteristics, distribution, and connectivity of arteries. Length for the M1 segment of the middle cerebral artery extracted by this technique was compared with reviewer-measured results, and the intraclass correlation coefficient was 0.97. A semiautomated quantitative method to trace, label, and measure intracranial arteries from 3D-MRA was developed and validated. This technique can be used to facilitate quantitative intracranial vascular research, such as studying cerebrovascular adaptation to aging and disease conditions. Magn Reson Med 79:3229-3238, 2018. © 2017 International Society for Magnetic Resonance in Medicine. © 2017 International Society for Magnetic Resonance in Medicine.

27 CFR 17.1 - Scope of regulations.

Code of Federal Regulations, 2010 CFR

2010-04-01

... manufacture of medicines, medicinal preparations, food products, flavors, flavoring extracts, and perfume that... following topics: obtaining drawback of internal revenue tax on distilled spirits used in the manufacture of...

In Vitro Screening for Cytotoxic Activity of Herbal Extracts

PubMed Central

Lombardi, Valter R. M.; Cacabelos, Ramón

2017-01-01

Experimental studies have shown that a variety of chemopreventive plant components affect tumor initiation, promotion, and progression and the main difference, between botanical medicines and synthetic drugs, resides in the presence of complex metabolite mixtures shown by botanical medicine which in turn exert their action on different levels and via different mechanisms. In the present study, we performed an in vitro screening of ethanol extracts from commercial plants in order to investigate potential antitumor activity against human tumor cell lines. Experimental results obtained through a variety of methods and techniques indicated that extracts of I. verum, G. glabra, R. Frangula, and L. usitatissimum present significant reduction in in vitro tumor cell proliferation, suggesting these extracts as possible chemotherapeutical adjuvants for different cancer treatments. PMID:28386288

Antimalarial drug discovery: screening of Brazilian medicinal plants and purified compounds.

PubMed

Krettli, Antoniana Ursine

2009-02-01

Malaria is the most important parasitic disease and its control depends on specific chemotherapy, now complicated by Plasmodium falciparum that has become resistant to most commonly available antimalarials. Treatment of the disease requires quinine or drug combinations of artemisinin derivatives and other antimalarials. Further drug resistance is expected. New active compounds need to be discovered. To find new antimalarials from medicinal and randomly collected plants, crude extracts are screened against P. falciparum in cultures and in malaria animal models, following bioassays of purified fractions, and cytotoxicity tests. For antimalarial research, screening medicinal plants is more efficient than screening randomly chosen plants. Biomonitored fractionation allows selection of new active molecules identified as potential antimalarials in multidisciplinary projects in Brazil; no new molecule is available for human testing. The advantages of projects based on ethnopharmacology are discussed.

Suppression of tumor growth by Pleurotus ferulae ethanol extract through induction of cell apoptosis, and inhibition of cell proliferation and migration.

PubMed

Wang, Weilan; Chen, Kaixu; Liu, Qing; Johnston, Nathan; Ma, Zhenghai; Zhang, Fuchun; Zheng, Xiufen

2014-01-01

Cancer is the second leading cause of death worldwide. Edible medicinal mushrooms have been used in traditional medicine as regimes for cancer patients. Recently anti-cancer bioactive components from some mushrooms have been isolated and their anti-cancer effects have been tested. Pleurotus ferulae, a typical edible medicinal mushroom in Xinjiang China, has also been used to treat cancer patients in folk medicine. However, little studies have been reported on the anti-cancer components of Pleurotus ferulae. This study aims to extract bioactive components from Pleurotus ferulae and to investigate the anti-cancer effects of the extracts. We used ethanol to extract anti-cancer bioactive components enriched with terpenoids from Pleurotus ferulae. We tested the anti-tumour effects of ethanol extracts on the melanoma cell line B16F10, the human gastric cancer cell line BGC 823 and the immortalized human gastric epithelial mucosa cell line GES-1 in vitro and a murine melanoma model in vivo. Cell toxicity and cell proliferation were measured by MTT assays. Cell cycle progression, apoptosis, caspase 3 activity, mitochondrial membrane potential (MMP), migration and gene expression were studied in vitro. PFEC suppressed tumor cell growth, inhibited cell proliferation, arrested cells at G0/G1 phases and was not toxic to non-cancer cells. PFEC also induced cell apoptosis and necrosis, increased caspase 3 activity, reduced the MMP, prevented cell invasion and changed the expression of genes associated with apoptosis and the cell cycle. PFEC delayed tumor formation and reduced tumor growth in vivo. In conclusion, ethanol extracted components from Pleurotus ferulae exert anti-cancer effects through direct suppression of tumor cell growth and invasion, demonstrating its therapeutic potential in cancer treatment.

Biosynthesis of silver nanoparticles using Acacia leucophloea extract and their antibacterial activity

PubMed Central

Murugan, Kasi; Senthilkumar, Balakrishnan; Senbagam, Duraisamy; Al-Sohaibani, Saleh

2014-01-01

The immense potential of nanobiotechnology makes it an intensely researched field in modern medicine. Green nanomaterial synthesis techniques for medicinal applications are desired because of their biocompatibility and lack of toxic byproducts. We report the toxic byproducts free phytosynthesis of stable silver nanoparticles (AgNPs) using the bark extract of the traditional medicinal plant Acacia leucophloea (Fabaceae). Visual observation, ultraviolet–visible spectroscopy, and transmission electron microscopy (TEM) were used to characterize the synthesized AgNPs. The visible yellow-brown color formation and surface plasmon resonance at 440 nm indicates the biosynthesis of AgNP. The TEM images show polydisperse, mostly spherical AgNP particles of 17–29 nm. Fourier transform infrared spectroscopy revealed that primary amines, aldehyde/ketone, aromatic, azo, and nitro compounds of the A. leucophloea extract may participate in the bioreduction and capping of the formed AgNPs. X-ray diffraction confirmed the crystallinity of the AgNPs. The in vitro agar well diffusion method confirmed the potential antibacterial activity of the plant extract and synthesized AgNPs against the common bacterial pathogens Staphylococcus aureus (MTCC 737), Bacillus cereus (MTCC 1272), Listeria monocytogenes (MTCC 657), and Shigella flexneri (MTCC 1475). This research combines the inherent antimicrobial activity of silver metals with the A. leucophloea extract, yielding antibacterial activity-enhanced AgNPs. This new biomimetic approach using traditional medicinal plant (A. leucophloea) barks to synthesize biocompatible antibacterial AgNPs could easily be scaled up for additional biomedical applications. These polydisperse AgNPs green-synthesized via A. leucophloea bark extract can readily be used in many applications not requiring high uniformity in particle size or shape. PMID:24876776

A review of antimalarial plants used in traditional medicine in communities in Portuguese-speaking countries: Brazil, Mozambique, Cape Verde, Guinea-Bissau, São Tomé and Príncipe and Angola.

PubMed

Silva, Jefferson Rocha de A; Ramos, Aline de S; Machado, Marta; de Moura, Dominique F; Neto, Zoraima; Canto-Cavalheiro, Marilene M; Figueiredo, Paula; do Rosário, Virgilio E; Amaral, Ana Claudia F; Lopes, Dinora

2011-08-01

The isolation of bioactive compounds from medicinal plants, based on traditional use or ethnomedical data, is a highly promising potential approach for identifying new and effective antimalarial drug candidates. The purpose of this review was to create a compilation of the phytochemical studies on medicinal plants used to treat malaria in traditional medicine from the Community of Portuguese-Speaking Countries (CPSC): Angola, Brazil, Cape Verde, Guinea-Bissau, Mozambique and São Tomé and Príncipe. In addition, this review aimed to show that there are several medicinal plants popularly used in these countries for which few scientific studies are available. The primary approach compared the antimalarial activity of native species used in each country with its extracts, fractions and isolated substances. In this context, data shown here could be a tool to help researchers from these regions establish a scientific and technical network on the subject for the CPSC where malaria is a public health problem.

Socio-cultural contribution to medicinal plants assessment and sustainable development: case of antidiabetic and antihypertensive plants in Cameroon

PubMed Central

Tsabang, N; Tsambang, LWD; Yedjou, CG; Tchounwou, Paul B.

2017-01-01

Diabetes and hypertension rank among human diseases that are very difficult to control. The medicinal material of Cameroon can provide much information on ethnic folklore practices and traditional aspects of therapeutically important natural products. Cameroon has a very rich cultural diversity with different traditional systems of medicine that need more evidence-based studies on both crude extracts and purified phytomolecules. Therefore, an ethnobotanical study was conducted on 58 socio-cultural population groups living in different phytogeographic units of Cameroon in order to collect various medicinal plants or recipes. A two by two comparison of social-cultural groups of the same phytogeographic unit indicated a significant difference in 86.97% of medicinal plants or recipes comparisons’ cases. A total of two hundred and eight recipes were identified, among which 75 were used for diabetes and hypertension treatment, 74 for hypertension alone, and 59 for diabetes alone. Also, two hundred and three plants were identified among which 33 were cultivated and marketed by 25 farming families engaged in integrated agriculture and selling of antidiabetic and antihypertensive plants to enhance their socio-economic status.

Effective Heart Disease Detection Based on Quantitative Computerized Traditional Chinese Medicine Using Representation Based Classifiers.

PubMed

Shu, Ting; Zhang, Bob; Tang, Yuan Yan

2017-01-01

At present, heart disease is the number one cause of death worldwide. Traditionally, heart disease is commonly detected using blood tests, electrocardiogram, cardiac computerized tomography scan, cardiac magnetic resonance imaging, and so on. However, these traditional diagnostic methods are time consuming and/or invasive. In this paper, we propose an effective noninvasive computerized method based on facial images to quantitatively detect heart disease. Specifically, facial key block color features are extracted from facial images and analyzed using the Probabilistic Collaborative Representation Based Classifier. The idea of facial key block color analysis is founded in Traditional Chinese Medicine. A new dataset consisting of 581 heart disease and 581 healthy samples was experimented by the proposed method. In order to optimize the Probabilistic Collaborative Representation Based Classifier, an analysis of its parameters was performed. According to the experimental results, the proposed method obtains the highest accuracy compared with other classifiers and is proven to be effective at heart disease detection.

An optimized protocol for DNA extraction in plants with a high content of secondary metabolites, based on leaves of Mimosa tenuiflora (Willd.) Poir. (Leguminosae).

PubMed

Arruda, S R; Pereira, D G; Silva-Castro, M M; Brito, M G; Waldschmidt, A M

2017-07-06

Some species are characterized by a high content of tannins, alkaloids, and phenols in their leaves. These secondary metabolites are released during DNA extraction and might hinder molecular studies based on PCR (polymerase chain reaction). To provide an efficient method to extract DNA, Mimosa tenuiflora, an important leguminous plant from Brazilian semiarid region used in popular medicine and as a source of fuelwood or forage, was used. Eight procedures previously reported for plants were tested and adapted from leaf tissues of M. tenuiflora stored at -20°C. The optimized procedure in this study encompassed the utilization of phenol during deproteinization, increased concentrations of cetyltrimethylammonium bromide and sodium chloride, and a shorter period and lower temperature of incubation concerning other methods. The extracted DNA did not present degradation, and amplification via PCR was successful using ISSR, trnL, ITS, and ETS primers. Besides M. tenuiflora, this procedure was also tested and proved to be efficient in genetic studies of other plant species.

Secondary metabolite credentials of Evolvulus alsinoides by high performance thin layer chromatography (HPTLC)

PubMed Central

Gomathi, Duraisamy; Kalaiselvi, Manokaran; Ravikumar, Ganesan; Sophia, Dominic; Gopalakrishnan, Velliyur Kanniappan; Uma, Chandrasekar

2012-01-01

Plants and plant-based products are the bases of many modern pharmaceuticals that are current in use today for various diseases. The aim of the study was to investigate the biochemical constituents and high performance thin layer chromatography (HPTLC) finger printing of the ethanolic extract of Evolvulus alsinoides. Phytochemical screening was done by standard procedures and HPTLC method was also established to analyze alkaloids, flavonoids and phenolic compounds from the ethanolic extract of Evolvulus alsinoides. Preliminary phytochemical screening showed that ethanol extracted more secondary metabolites than other solvents. HPTLC fingerprinting analysis showed the presence of various alkaloids, flavonoids and phenols (quercetin) in the ethanolic extract. It can be concluded that Evolvulus alsinoides may serve as a source of potent antioxidants that may be used in the prevention of various diseases such as cancer, diabetes and cardiovascular diseases due to the presence of phenolic compounds. HPTLC finger print of Evolvulus alsinoides may be useful in the differentiation of the species from adulterants and act as a biochemical marker for this medicinally important plant in the pharmaceutical industry and plant systematic studies. PMID:23554763

Cytotoxicity of blended versus single medicinal mushroom extracts on human cancer cell lines: contribution of polyphenol and polysaccharide content.

PubMed

Durgo, Ksenija; Koncar, Mladen; Komes, Drazenka; Belscak-Cvitanovic, Ana; Franekic, Jasna; Jakopovich, Ivan; Jakopovich, Neven; Jakopovich, Boris

2013-01-01

The use of mushrooms contributes to human nutrition by providing low lipid content of lipids and high dietary fiber content, as well as significant content of other biologically active compounds such as polysaccharides, minerals, vitamins, and polyphenolic antioxidants. This study aimed to determine the content of polyphenols and polysaccharides, as well as the cytotoxic and antioxidative properties of several medicinal mushroom preparations. The content of total phenols and flavonoids of preparations of blended mushroom extracts (Lentifom, Super Polyporin, Agarikon, Agarikon Plus, Agarikon.1, and Mykoprotect.1) was evaluated quantitatively by using ultraviolet-visible spectroscopy spectrophotometric methods. The antioxidant capacity of the preparations was evaluated using the ABTS (2,2'-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid) and ferric reducing/antioxidant power assays. The content of water-soluble polysaccharides was determined using a specific gravimetric method, based on ethanol precipitation. To determine cytotoxic effects of single and blended mushroom extracts, MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) and neutral red assays were conducted using human small cell lung cancer, lung adenocarcinoma, colon cancer, and brain astrocytoma cancer cells. The obtained results suggest that due to the significant content of beneficial polyphenolic antioxidants and soluble polysaccharides, use of these mushroom preparations is beneficial in maintaining good health, as well as in the prevention and adjuvant biotherapy of various human pathological aberrations. These results reveal that these extracts exhibit different cytotoxic effects on tumor cells originating from different tissues. In addition, the comparison of investigated blended mushroom extracts with three well-known commercial mushroom products derived from single mushroom species or single mushroom compounds shows that blended mushroom extracts exhibit significantly stronger cytotoxic effects on human tumor cell lines.

In vitro antimicrobial and anti-proliferative activities of plant extracts from Spathodea campanulata, Ficus bubu, and Carica papaya.

PubMed

Mbosso Teinkela, Jean Emmanuel; Assob Nguedia, Jules Clément; Meyer, Franck; Vouffo Donfack, Erik; Lenta Ndjakou, Bruno; Ngouela, Silvère; Tsamo, Etienne; Adiogo, Dieudonné; Guy Blaise Azebaze, Anatole; Wintjens, René

2016-01-01

African medicinal plants represent a prominent source of new active substances. In this context, three plants were selected for biological investigations based on their traditional uses. The antimicrobial and anti-proliferative features of three plants used for medicinal purpose were evaluated. The antimicrobial activities of methanol extracts of Ficus bubu Warb. (Moraceae) stem bark and leaves, of Spathodea campanulata P. Beauv. (Bignoniaceae) flowers, as well as those of Carica papaya Linn. (Caricaceae) latex, were determined using the microbroth dilution method against a set of bacteria and fungi pathogens including: Enterococcus faecalis, Staphylococcus aureus, S. saprophyticus, S. epidermididis, Escherichia coli, Klebsiella pneumonia, Salmonella typhimurium, Candida albicans, and Trichophyton rubrum. The tested concentrations of extracts ranged from 2500.0 to 2.4 μg/mL and MIC values were evaluated after 24 h incubation at 37 °C. Subsequently, MTT assay was used to estimate anti-proliferative activity of these methanol extracts and of F. bubu latex on three human cancer cell lines (U373 glioblastoma, A549 NSCLC, and SKMEL-28 melanoma). The methanol extract of F. bubu stem bark exhibited the highest antimicrobial activity against C. albicans with a MIC value of 9.8 μg/mL, while the F. bubu latex and the methanol extract of F. bubu leaves induced significant anti-proliferative activity against lung (IC50 values of 10 and 14 μg/mL, respectively) and glioma (IC50 values of 13 and 16 μg/mL, respectively) cancer cells. These results indicate that effective drugs could be derived from the three studied plants.

Condensed tannins in extracts from European medicinal plants and herbal products.

PubMed

Ropiak, Honorata M; Ramsay, Aina; Mueller-Harvey, Irene

2016-03-20

Medicinal plant materials are not usually analysed for condensed tannins (CT). Thirty commercially available European medicinal plants and herbal products were screened for CT and fourteen CT samples were analysed in detail. This is also the first comprehensive CT analysis of pine buds, walnut leaves, heather flowers and great water dock roots. Acetone/water extracts contained between 3.2 and 25.9 g CT/100g of extract, had CT with mean degrees of polymerisation of 2.9 to 13.3, procyanidin/prodelphinidin ratios of 1.6/98.4 to 100/0 and cis/trans flavan-3-ol ratios of 17.7/82.3 to 97.3/2.7. The majority of samples contained procyanidins, four contained A-type linkages (blackthorn flowers, heather flowers, bilberry leaves and cowberry leaves) and one sample also had galloylated procyanidins (great water dock roots). Copyright © 2015 Elsevier B.V. All rights reserved.

Anti-inflammatory agents from plants: progress and potential.

PubMed

Recio, M C; Andujar, I; Rios, J L

2012-01-01

The identification of substances that can promote the resolution of inflammation in a way that is homeostatic, modulatory, efficient, and well-tolerated by the body is of fundamental importance. Traditional medicines have long provided front-line pharmacotherapy for many millions of people worldwide. Medicinal extracts are a rich source of therapeutic leads for the pharmaceutical industry. The use of medicinal plant therapies to treat chronic illness, including rheumatoid arthritis (RA) and inflammatory bowel disease (IBD), is thus widespread and on the rise.The aim of this review is to present recent progress in clinical anti-inflammatory studies of plant extracts and compound leads such as green tea polyphenols, curcumin, resveratrol, boswellic acid, and cucurbitacins, among others, against chronic inflammatory diseases, mainly RA and IBD. In this context, the present paper also highlights the most promising experimental data on those plant extracts and pure compounds active in animal models of the aforementioned diseases.

Antioxidant Activities of Functional Beverage Concentrates Containing Herbal Medicine Extracts.

PubMed

Park, Seon-Joo; Kim, Mi-Ok; Kim, Jung Hoan; Jeong, Sehyun; Kim, Min Hee; Yang, Su-Jin; Lee, Jongsung; Lee, Hae-Jeung

2017-03-01

This study investigated the antioxidant activity of functional beverage concentrates containing herbal medicine extracts (FBCH) using various antioxidant assays, such as 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical scavenging activity, 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid (ABTS) radical scavenging activity, and reducing power assay. The total polyphenolic content of FBCH (81.45 mg/100 g) was higher than Ssanghwa tea (SHT, 37.56 mg/100 g). The antioxidant activities of FBCH showed 52.92% DPPH and 55.18% ABTS radical scavenging activities at 100 mg/mL, respectively. FBCH showed significantly higher antioxidant activities compared to the SHT (DPPH, 23.43%; ABTS, 22.21%; reducing power optical density; 0.23, P <0.05). In addition, intracellular reactive oxygen species generation significantly decreased in a concentration-dependent manner following FBCH treatment. These results suggest that the addition of herbal medicine extract contributes to the improved functionality of beverage concentrates.

Establishment of Application Guidance for OTC non-Kampo Crude Drug Extract Products in Japan

PubMed Central

Somekawa, Layla; Maegawa, Hikoichiro; Tsukada, Shinsuke; Nakamura, Takatoshi

2017-01-01

Currently, there are no standardized regulatory systems for herbal medicinal products worldwide. Communication and sharing of knowledge between different regulatory systems will lead to mutual understanding and might help identify topics which deserve further discussion in the establishment of common standards. Regulatory information on traditional herbal medicinal products in Japan is updated by the establishment of Application Guidance for over-the-counter non-Kampo Crude Drug Extract Products. We would like to report on updated regulatory information on the new Application Guidance. Methods for comparison of Crude Drug Extract formulation and standard decoction and criteria for application and the key points to consider for each criterion are indicated in the guidance. Establishment of the guidance contributes to improvements in public health. We hope that the regulatory information about traditional herbal medicinal products in Japan will be of contribution to tackling the challenging task of regulating traditional herbal products worldwide. PMID:28894633

Anti-Trypanosoma cruzi activity of 10 medicinal plants used in northeast Mexico.

PubMed

Molina-Garza, Zinnia Judith; Bazaldúa-Rodríguez, Aldo Fabio; Quintanilla-Licea, Ramiro; Galaviz-Silva, Lucio

2014-08-01

The aim of this study was to screen the trypanocidal activity of plants used in traditional Mexican medicine for the treatment of various diseases related to parasitic infections. Cultured Trypanosoma cruzi epimastigotes were incubated for 96h with different concentrations of methanolic extracts obtained from Artemisia mexicana, Castela texana, Cymbopogon citratus, Eryngium heterophyllum, Haematoxylum brasiletto, Lippia graveolens, Marrubium vulgare, Persea americana, Ruta chalepensis and Schinus molle. The inhibitory concentration (IC50) was determined for each extract via a colorimetric method. Among the evaluated species, the methanolic extracts of E. heterophyllum, H. brasiletto, M. vulgare and S. molle exhibited the highest trypanocidal activity, showing percentages of growth inhibition between 88 and 100% at a concentration of 150μg/ml. These medicinal plants may represent a valuable source of new bioactive compounds for the therapeutic treatment of trypanosomiasis. Copyright © 2014 Elsevier B.V. All rights reserved.

The impact of computer science in molecular medicine: enabling high-throughput research.

PubMed

de la Iglesia, Diana; García-Remesal, Miguel; de la Calle, Guillermo; Kulikowski, Casimir; Sanz, Ferran; Maojo, Víctor

2013-01-01

The Human Genome Project and the explosion of high-throughput data have transformed the areas of molecular and personalized medicine, which are producing a wide range of studies and experimental results and providing new insights for developing medical applications. Research in many interdisciplinary fields is resulting in data repositories and computational tools that support a wide diversity of tasks: genome sequencing, genome-wide association studies, analysis of genotype-phenotype interactions, drug toxicity and side effects assessment, prediction of protein interactions and diseases, development of computational models, biomarker discovery, and many others. The authors of the present paper have developed several inventories covering tools, initiatives and studies in different computational fields related to molecular medicine: medical informatics, bioinformatics, clinical informatics and nanoinformatics. With these inventories, created by mining the scientific literature, we have carried out several reviews of these fields, providing researchers with a useful framework to locate, discover, search and integrate resources. In this paper we present an analysis of the state-of-the-art as it relates to computational resources for molecular medicine, based on results compiled in our inventories, as well as results extracted from a systematic review of the literature and other scientific media. The present review is based on the impact of their related publications and the available data and software resources for molecular medicine. It aims to provide information that can be useful to support ongoing research and work to improve diagnostics and therapeutics based on molecular-level insights.

Titration-based screening for evaluation of natural product extracts: identification of an aspulvinone family of luciferase inhibitors

PubMed Central

Cruz, Patricia G.; Auld, Douglas S.; Schultz, Pamela J.; Lovell, Scott; Battaile, Kevin P.; MacArthur, Ryan; Shen, Min; Tamayo-Castillo, Giselle; Inglese, James; Sherman, David H.

2011-01-01

The chemical diversity of nature has tremendous potential for discovery of new molecular probes and medicinal agents. However, sensitivity of HTS assays to interfering components of crude extracts derived from plants, macro- and microorganisms has curtailed their use in lead discovery efforts. Here we describe a process for leveraging the concentration-response curves (CRCs) obtained from quantitative HTS to improve the initial selection of “actives” from a library of partially fractionated natural product extracts derived from marine actinomycetes and fungi. By using pharmacological activity, the first-pass CRC paradigm aims to improve the probability that labor-intensive subsequent steps of re-culturing, extraction and bioassay-guided isolation of active component(s) target the most promising strains and growth conditions. We illustrate how this process identified a family of fungal metabolites as potent inhibitors of firefly luciferase, subsequently resolved in molecular detail by x-ray crystallography. PMID:22118678

Titration-based screening for evaluation of natural product extracts: identification of an aspulvinone family of luciferase inhibitors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cruz, P.G.; Auld, D.S.; Schultz, P.J.

2011-11-28

The chemical diversity of nature has tremendous potential for the discovery of molecular probes and medicinal agents. However, sensitivity of HTS assays to interfering components of crude extracts derived from plants, and macro- and microorganisms has curtailed their use in lead discovery. Here, we describe a process for leveraging the concentration-response curves obtained from quantitative HTS to improve the initial selection of actives from a library of partially fractionated natural product extracts derived from marine actinomycetes and fungi. By using pharmacological activity, the first-pass CRC paradigm improves the probability that labor-intensive subsequent steps of reculturing, extraction, and bioassay-guided isolation ofmore » active component(s) target the most promising strains and growth conditions. We illustrate how this process identified a family of fungal metabolites as potent inhibitors of firefly luciferase, subsequently resolved in molecular detail by X-ray crystallography.« less

Amperometric biosensor based on prussian blue and nafion modified screen-printed electrode for screening of potential xanthine oxidase inhibitors from medicinal plants.

PubMed

El Harrad, Loubna; Amine, Aziz

2016-04-01

A simple and sensitive amperometric biosensor was developed for the screening of potential xanthine oxidase inhibitors from medicinal plants. This biosensor was prepared by immobilization of xanthine oxidase on the surface of prussian blue modified screen-printed electrodes using nafion and glutaraldehyde. The developed biosensor showed a linear amperometric response at an applied potential of +0.05 V toward the detection of hypoxanthine from 5 μM to 45 μM with a detection limit of 0.4 μM (S/N=3) and its sensitivity was found to be 600 mA M(-1) cm(-2). In addition, the biosensor exhibited a good storage stability. The inhibition of xanthine oxidase by allopurinol was studied under the optimized conditions. The linear range of allopurinol concentration is obtained up to 2.5 μM with an estimated 50% of inhibitionI50=1.8 μM. The developed biosensor was successfully applied to the screening of xanthine oxidase inhibitors from 13 medicinal plants belonging to different families. Indeed, Moroccan people traditionally use these plants as infusion for the treatment of gout and its related symptoms. For this purpose, water extracts obtained from the infusion of these plants were used for the experiments. In this work, 13 extracts were assayed and several of them demonstrated xanthine oxidase inhibitory effect, with an inhibition greater than 50% compared to spectrophotometry measurements that only few extracts showed an inhibition greater than 50%. Copyright © 2016 Elsevier Inc. All rights reserved.

Review of complementary and alternative medicine and selected nutraceuticals: background for a pilot study on nutrigenomic intervention in patients with advanced cancer.

PubMed

Varker, Kimberly A; Ansel, Adam; Aukerman, Glen; Carson, William E

2012-01-01

As commonly defined, complementary and alternative medicine (CAM) is a broad category that includes biologically based practices, mind-body medicine, manipulative and bodybased practices, and energy medicine as well as complete medical systems such as naturopathy, homeopathy, Ayurvedic medicine, and traditional Chinese medicine. Several CAM methodologies show promise for the treatment of chronic conditions such as depression and pain disorders or have demonstrated effects upon the immune response in experimental studies. There is growing interest in the use of integrative medicine the combination of CAM methodologies with a conventional medical approach-for the optimization of treatment of various cancers. The Ohio State University Center for Integrative Medicine has developed a specialized nutrigenomic protocol for integrative cancer care. The center uses a comprehensive nutritional and medical evaluation, including a panel of proinflammatory molecules and physiologic parameters, to guide a program of individualized dietary interventions. Dietary supplementation is a current focus of study, including: (1) Omega-3 fatty acids and B vitamins, which are thought to play important roles in immunomodulation; (2) Magnesium oxide, which has been shown to decrease inflammation and improve insulin resistance and lipid profiles; and (3) Cinnamon extract, which reportedly decreases serum glucose levels. This article presents a brief overview of CAM and integrative medicine and a discussion of the relevant nutraceuticals.

Inhibition of Th1 and Th17 Cells by Medicinal Plants and Their Derivatives: A Systematic Review.

PubMed

Asadi-Samani, Majid; Bagheri, Nader; Rafieian-Kopaei, Mahmoud; Shirzad, Hedayatollah

2017-08-01

Searching for new natural drugs that are capable of targeting Th1 and Th17 may lead to development of more effective treatments for inflammatory and autoimmune diseases. Most of the natural drugs can be derived from plants that are used in traditional medicine and folk medicine. The aim of this systematic review is to identify and introduce plants or plant derivatives that are effective on inflammatory diseases by inhibiting Th1 and Th17 responses. To achieve this purpose, the search terms herb, herbal medicine, herbal drug, medicinal plant, phytochemical, traditional Chinese medicine, Ayurvedic medicine, natural compound, inflammation, inflammatory diseases, Th1, Th17, T helper 1 or T helper 17 were used separately in Title/Keywords/Abstract in Web of Science and PubMed databases. In articles investigating the effect of the medicinal plants and their derivatives in inhibiting Th1 and Th17 cells, the effects of eight extracts of the medicinal plants, 21 plant-based compounds and some of their derivatives, and eight drugs derived from the medicinal plants' compounds in inhibiting Th1 and Th17 cells were reviewed. The results showed that medicinal plants and their derivates are able to suppress Th17 and Th1 T cell functions as well as cytokine secretion and differentiation. The results can be used to produce herbal drugs that suppress Th, especially Th17, responses. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

Harnessing the medicinal properties of Andrographis paniculata for diseases and beyond: a review of its phytochemistry and pharmacology

PubMed Central

Okhuarobo, Agbonlahor; Falodun, Joyce Ehizogie; Erharuyi, Osayemwenre; Imieje, Vincent; Falodun, Abiodun; Langer, Peter

2014-01-01

Andrographis paniculata Wall (family Acanthaceae) is one of the most popular medicinal plants used traditionally for the treatment of array of diseases such as cancer, diabetes, high blood pressure, ulcer, leprosy, bronchitis, skin diseases, flatulence, colic, influenza, dysentery, dyspepsia and malaria for centuries in Asia, America and Africa continents. It possesses several photochemical constituents with unique and interesting biological properties. This review describes the past and present state of research on Andrographis paniculata with respect to the medicinal usage, phytochemistry, pharmacological activities, toxicity profile and therapeutic usage, in order to bridge the gap requiring future research opportunities. This review is based on literature study on scientific journals and books from library and electronic sources. Diterpenes, flavonoids, xanthones, noriridoides and other miscellaneous compounds have been isolated from the plant. Extract and pure compounds of the plant have been reported for their anti-microbial, cytotoxicity, anti-protozoan, anti-inflammatory, anti-oxidant, immunostimulant, anti-diabetic, anti-infective, anti-angiogenic, hepato-renal protective, sex hormone/sexual function modulation, liver enzymes modulation insecticidal and toxicity activities. The results of numerous toxicity evaluations of extracts and metabolites isolated from this plant did not show any significant acute toxicity in experimental animals. Detailed and more comprehensive toxicity profile on mammalian tissues and organs is needed in future studies.

Scientific evaluation of traditional Chinese medicine under DSHEA: a conundrum. Dietary Supplement Health and Education Act.

PubMed

Chang, J

1999-04-01

In the United States, traditional Chinese medicines (TCM) are currently sold as dietary supplements, as defined by The Dietary Supplement Health and Education Act (DSHEA). This legislation is unique to the United States and while "structure and function" claims are allowable under DSHEA, disease claims are not. The narrow definition, however, poses a challenge to designing appropriate clinical studies that can provide data for "structure and function" claim substantiation. The process of melding Chinese herbal medicines into the dietary supplement category is complex and there is a need to define a clinical trial paradigm carefully that addresses "structure and function claims" without sacrificing scientific rigor. It is frequently not recognized that TCM favors an amalgamation of several herbs to generate the putative clinical effect. Because of this historical multiherb approach, the reliance on retrospective data to support the potential health benefits of an herb extract has severe limitations. Notwithstanding the immense value of identifying the pharmacological activity of a TCM herb to a chemical suitable for pharmaceutical development, another approach to safe and efficacious herbal products is to develop a standardized herbal extract. This article highlights issues related to the latter approach and will discuss a research-based strategy that may be suitable for validating, in part, the putative health benefits of TCM.

[Application characteristics and situation analysis of volatile oils in database of Chinese patent medicine].

PubMed

Wang, Sai-Jun; Wu, Zhen-Feng; Yang, Ming; Wang, Ya-Qi; Hu, Peng-Yi; Jie, Xiao-Lu; Han, Fei; Wang, Fang

2014-09-01

Aromatic traditional Chinese medicines have a long history in China, with wide varieties. Volatile oils are active ingredients extracted from aromatic herbal medicines, which usually contain tens or hundreds of ingredients, with many biological activities. Therefore, volatile oils are often used in combined prescriptions and made into various efficient preparations for oral administration or external use. Based on the sources from the database of Newly Edited National Chinese Traditional Patent Medicines (the second edition), the author selected 266 Chinese patent medicines containing volatile oils in this paper, and then established an information sheet covering such items as name, dosage, dosage form, specification and usage, and main functions. Subsequently, on the basis of the multidisciplinary knowledge of pharmaceutics, traditional Chinese pharmacology and basic theory of traditional Chinese medicine, efforts were also made in the statistics of the dosage form and usage, variety of volatile oils and main functions, as well as the status analysis on volatile oils in terms of the dosage form development, prescription development, drug instruction and quality control, in order to lay a foundation for the further exploration of the market development situations of volatile oils and the future development orientation.

Antimycobacterial activity of medicinal plants used by the Mayo people of Sonora, Mexico.

PubMed

Coronado-Aceves, Enrique Wenceslao; Sánchez-Escalante, José Jesús; López-Cervantes, Jaime; Robles-Zepeda, Ramón Enrique; Velázquez, Carlos; Sánchez-Machado, Dalia Isabel; Garibay-Escobar, Adriana

2016-08-22

Tuberculosis (TB) is an infectious disease mainly caused by Mycobacterium tuberculosis (Mtb), which generates 9 million new cases worldwide each year. The Mayo ethnicity of southern Sonora, Mexico is more than 2000 years old, and the Mayos possess extensive knowledge of traditional medicine. To evaluate the antimycobacterial activity levels of extracts of medicinal plants used by the Mayos against Mtb and Mycobacterium smegmatis (Msm) in the treatment of TB, respiratory diseases and related symptoms. A total of 34 plant species were collected, and 191 extracts were created with n-hexane, dichloromethane, ethyl acetate (EtOAc), methanol and water. Their minimum inhibitory concentrations (MICs) and minimum bactericidal concentrations (MBCs) were determined against Mtb H37Rv using the microplate alamar blue assay (MABA) and against Msm using the resazurin microplate assay (REMA) at 6 and 2 days of exposure, respectively, and at concentrations of 250-1.9µg/mL (n-hexane extracts) and 1000-7.81µg/mL (extracts obtained with dichloromethane, EtOAc, methanol and water). Rhynchosia precatoria (Willd.) DC. (n-hexane root extract), Euphorbia albomarginata Torr. and A. Gray. (EtOAc shoot extract) and Helianthus annuus L. (n-hexane stem extract) were the most active plants against Mtb H37Rv, with MICs of 15.6, 250, 250µg/mL and MBCs of 31.25, 250, 250µg/mL, respectively. R. precatoria (root) was the only active plant against Msm, with MIC and MBC values of ≥250µg/mL. None of the aqueous extracts were active. This study validates the medicinal use of certain plants used by the Mayo people in the treatment of TB and related symptoms. R. precatoria, E. albomarginata and H. annuus are promising plant sources of active compounds that act against Mtb H37Rv. To our knowledge, this is the first time that their antimycobacterial activity has been reported. Crude extracts obtained with n-hexane, EtOAc and dichloromethane were the most active against Mtb H37Rv. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Pipette tip solid-phase extraction and high-performance liquid chromatography for the determination of flavonoids from Epimedii herba in rat serum and application of the technique to pharmacokinetic studies.

PubMed

Wang, Nani; Huang, Xiaowen; Wang, Xuping; Zhang, Yang; Wu, Renjie; Shou, Dan

2015-05-15

Epimedii herba is a traditional Chinese medicine for the treatment of osteoporosis. Epimedin A, B and C and icariin are the primary effective ingredients of this medicine. In this study, a simple and low-cost method based on pipette tip solid-phase extraction, high-performance liquid chromatography separation, and diode array detection has been developed for the simultaneous analysis of four flavonoids (epimedin A, B and C and icariin) from Epimedii herba in rat serum samples. In this novel extraction configuration, the sorbents were placed between a filter (hollow fiber) and the pipette tip. Pipette tip solid-phase extraction has several advantages compared to conventional extraction methods: faster extraction time (6.0min); lower sample volume (100μL); lower solvent volume (100μL); and less solvent waste. Under the optimum extraction conditions, the method showed good linearity (0.05-10.0μgmL(-1)), acceptable intra- and inter precision (RSD<6%), low limits of quantification (0.027-0.045μgmL(-1)) and satisfactory relative recoveries (98.63-103.18%). This method was successfully applied to investigate the pharmacokinetics of the major flavonoids in Epimedii herba extract after oral administration to rats (10gkg(-1) body weight). The primary pharmacokinetic parameters for rats were determined as follows: Cmax, 0.45-4.11μgmL(-1); Tmax, 0.21-0.26h; t1/2α, 0.06-0.12h; t1/2β, 2.02-3.48h; AUC0-∞: 0.50-2.58μghmL(-1); CL, 19.53-44.72Lkg(-1)h(-1); and MRT0-∞, 2.25-3.77h. The developed method has the potential to promulgate the pharmacokinetics and provide more information for clinical applications. Copyright © 2015 Elsevier B.V. All rights reserved.

[Construction and realization of real world integrated data warehouse from HIS on re-evaluation of post-maketing traditional Chinese medicine].

PubMed

Zhuang, Yan; Xie, Bangtie; Weng, Shengxin; Xie, Yanming

2011-10-01

To construct real world integrated data warehouse on re-evaluation of post-marketing traditional Chinese medicine for the research on key techniques of clinic re-evaluation which mainly includes indication of traditional Chinese medicine, dosage usage, course of treatment, unit medication, combined disease and adverse reaction, which provides data for reviewed research on its safety,availability and economy,and provides foundation for perspective research. The integrated data warehouse extracts and integrate data from HIS by information collection system and data warehouse technique and forms standard structure and data. The further research is on process based on the data. A data warehouse and several sub data warehouses were built, which focused on patients' main records, doctor orders, diseases diagnoses, laboratory results and economic indications in hospital. These data warehouses can provide research data for re-evaluation of post-marketing traditional Chinese medicine, and it has clinical value. Besides, it points out the direction for further research.

The medicinal Agaricus mushroom cultivated in Brazil: biology, cultivation and non-medicinal valorisation.

PubMed

Largeteau, Michèle L; Llarena-Hernández, Régulo Carlos; Regnault-Roger, Catherine; Savoie, Jean-Michel

2011-12-01

Sun mushroom is a cultivated mushroom extensively studied for its medicinal properties for several years and literature abounds on the topic. Besides, agronomical aspects were investigated in Brazil, the country the mushroom comes from, and some studies focus on the biology of the fungus. This review aimed to present an overview of the non-medicinal knowledge on the mushroom. Areas of commercial production and marketing trends are presented. Its specific fragrance, taste, nutritional value and potential use of extracts as food additives are compared to those of the most cultivated fungi and laboratory models. The interest of the mushroom for lignocellulosic enzyme production and source of biomolecules for the control of plant pathogens are shown. Investigation of genetic variability among cultivars is reported. Growing and storage of mycelium, as well as cultivation conditions (substrate and casing generally based on local products; indoor and outdoor cultivation; diseases and disorders) are described and compared to knowledge on Agaricus bisporus.

Traditional Chinese medicine and sports drug testing: identification of natural steroid administration in doping control urine samples resulting from musk (pod) extracts.

PubMed

Thevis, Mario; Schänzer, Wilhelm; Geyer, Hans; Thieme, Detlef; Grosse, Joachim; Rautenberg, Claudia; Flenker, Ulrich; Beuck, Simon; Thomas, Andreas; Holland, Ruben; Dvorak, Jiri

2013-01-01

The administration of musk extract, that is, ingredients obtained by extraction of the liquid secreted from the preputial gland or resulting grains of the male musk deer (eg, Moschus moschiferus), has been recommended in Traditional Chinese Medicine (TCM) applications and was listed in the Japanese pharmacopoeia for various indications requiring cardiovascular stimulation, anti-inflammatory medication or androgenic hormone therapy. Numerous steroidal components including cholesterol, 5α-androstane-3,17-dione, 5β-androstane-3,17-dione, androsterone, etiocholanolone, epiandrosterone, 3β-hydroxy-androst-5-en-17-one, androst-4-ene-3,17-dione and the corresponding urea adduct 3α-ureido-androst-4-en-17-one were characterised as natural ingredients of musk over several decades, implicating an issue concerning doping controls if used for the treatment of elite athletes. In the present study, the impact of musk extract administration on sports drug testing results of five females competing in an international sporting event is reported. In the course of routine doping controls, adverse analytical findings concerning the athletes' steroid profile, corroborated by isotope-ratio mass spectrometry (IRMS) data, were obtained. The athletes' medical advisors admitted the prescription of TCM-based musk pod preparations and provided musk pod samples for comparison purposes to clarify the antidoping rule violation. Steroid profiles, IRMS results, literature data and a musk sample obtained from a living musk deer of a local zoo conclusively demonstrated the use of musk pod extracts in all cases which, however, represented a doping offence as prohibited anabolic-androgenic steroids were administered.

Safety Assessment of Ocimum Basilicum Hydroalcoholic Extract in Wistar Rats: Acute and Subchronic Toxicity Studies

PubMed Central

Rasekh, Hamid Reza; Hosseinzadeh, Leila; Mehri, Soghra; Kamli-Nejad, Mohammad; Aslani, Majid; Tanbakoosazan, Farahnaz

2012-01-01

Objective(s) Ocimum basilicum L. is widely used in folk medicine of many countries including . Both O. basilicum and its oil extract have received considerable attention for their potential medicinal properties, but there are a few reports about possible toxicity of this plant. Therefore, in the present study, acute and subchronic toxicity of O. basilicum hydroalcohlic extract have been evaluated in Wistar rats. Materials and Methods For the acute toxicity assessment, five groups of 10 animals (5 male, 5 female) received four different single dose of extract orally, the animals were, then, kept under observation for 14 days. For subchronic toxicity, the animals were divided into four groups (5 male, 5 female) and were gavaged daily by 50, 200 and 500 mg/kg of extract. Mortality, clinical signs, body weight changes, food and water consumption, and hematological and biochemical parameters were monitored during the study period. On the 45th day, animals were sacrificed and gross findings, weight of liver and left kidney and liver histological markers were assessed. Results The results of acute study indicated that LD50 of O. basilicum is higher than 5 mg/kg. In subchronic study, no adverse effects were observed on serum parameters in male and female rats. The hematological results showed a reduction in the hematocrit, platelets and RBC in both sexes. No abnormalities were observed in other parameters. Conclusion Based on the results of this study, present data suggest that hematologic system could serve as a target organ in oral toxicity of this plant. PMID:23493182

Trace determination of five triazole fungicide residues in traditional Chinese medicine samples by dispersive solid-phase extraction combined with ultrasound-assisted dispersive liquid-liquid microextraction and UHPLC-MS/MS.

PubMed

Ma, Shuping; Yuan, Xucan; Zhao, Pengfei; Sun, Hong; Ye, Xiu; Liang, Ning; Zhao, Longshan

2017-08-01

A novel and reliable method for determination of five triazole fungicide residues (triadimenol, tebuconazole, diniconazole, flutriafol, and hexaconazol) in traditional Chinese medicine samples was developed using dispersive solid-phase extraction combined with ultrasound-assisted dispersive liquid-liquid microextraction before ultra-high performance liquid chromatography with tandem mass spectrometry. The clean up of the extract was conducted using dispersive solid-phase extraction by directly adding sorbents into the extraction solution, followed by shaking and centrifugation. After that, a mixture of 400 μL trichloromethane (extraction solvent) and 0.5 mL of the above supernatant was injected rapidly into water for the dispersive liquid-liquid microextraction procedure. The factors affecting the extraction efficiency were optimized. Under the optimum conditions, the calibration curves showed good linearity in the range of 2.0-400 (tebuconazole, diniconazole, and hexaconazole) and 4.0-800 ng/g (triadimenol and flutriafol) with the regression coefficients higher than 0.9958. The limit of detection and limit of quantification for the present method were 0.5-1.1 and 1.8-4.0 ng/g, respectively. The recoveries of the target analytes ranged from 80.2 to 103.2%. The proposed method has been successfully applied to the analysis of five triazole fungicides in traditional Chinese medicine samples, and satisfactory results were obtained. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Antibacterial properties of Chinese herbal medicines against nosocomial antibiotic resistant strains of Pseudomonas aeruginosa in Taiwan.

PubMed

Liu, Ching-Shen; Cham, Thau-Ming; Yang, Cheng-Hong; Chang, Hsueh-Wei; Chen, Chia-Hong; Chuang, Li-Yeh

2007-01-01

Pseudomonas aeruginosa is well-recognized as a nosocomial pathogen, which exhibits inherent drug resistance. In this study, the antibacterial activity of ethanol extracts of 58 Chinese herbal medicines used in Taiwan were tested against 89 nosocomial antibiotic resistant strains of Pseudomonas aeruginosa. The results gathered by the disc diffusion method showed that 26 out of the 58 herbal extracts exhibited antibacterial activity. Among the 26 herbal extracts, 10 extracts showed broad-spectrum antibacterial activities and were selected for further antibacterial property assay. The minimum inhibitory concentrations (MIC) of the active partition fractions ranged from 0.25 to 11.0 mg/L. The presence of flavonoid compounds in the active fractions of test herbal extracts was observed by the TLC-bioautography. The results from the time-kill assay revealed that most of the herbal extracts completely killed the test organisms within 4 hours. Exposure of the test strains to a sub-MIC level of the herbal extracts for 10 consecutive subcultures did not induce resistance to the active components. A combination of the active herbal fractions with antibiotics showed that one of the herbal medicines, the hexane fraction of Ramulus Cinnamomi, possessed a synergistic effect with tetracycline, gentamycin, and streptomycin. In conclusion, the tested Chinese medical herbs have the potential to be developed into natural antibiotics. This is the first evaluation for screening large amounts of medical plants against nosocomial antibiotic resistant bacteria in Taiwan.

Antimycoplasmal activity of some plant species from northern Nigeria compared to the currently used therapeutic agent.

PubMed

Muraina, I A; Adaudi, A O; Mamman, M; Kazeem, H M; Picard, J; McGaw, L J; Eloff, J N

2010-10-01

Mycoplasma spp. are obligate parasites of humans and animals. But due to the special requirements needed to culture Mycoplasma in the laboratory, little or no research has been done to evaluate the efficacy of medicinal plants on the organism. To screen medicinal plants traditionally used to treat infections for possible antimycoplasmal and cytotoxic activities. Acetone extracts of 21 Nigerian medicinal plants were analyzed for antimycoplasmal and cytotoxicity activities using the metabolic inhibition and colorimetric methods, respectively. The extract with the best antimycoplasmal activities was also analyzed for its phytochemical constituents using the desktop method. Calotropis procera (Aiton) R.Br (Asclepiadaceae) extract had the best antimycoplasmal effect with a minimum inhibitory concentration (MIC) of 80 µg/mL and minimum mycoplasmacidal concentration (MMC) of 160 µg/mL. This extract contained saponins, tannins, cardiac glycosides, alkaloids, and flavonoids. The extract of Vernonia amygdalina Delile (Compositae) was the most cytotoxic with median lethal concentration (LC(50)) of approximately 17 µg/mL, and that of Anacardium occidentale L. (Anacardiaceae) was the least cytotoxic with an LC(50) of approximately 1919 µg/mL. Calotropis procera is a promising plant for an alternative antimycoplasmal agent because the crude acetone extract had a higher mycoplasmacidal activity than the conventional drug tylosin, which is currently used in treatment of the disease in Nigeria. The crude extract of Calotropis procera is worth investigating for the development of a potent agent against cattle Mycoplasma, which has long defied solution by conventional chemotherapy.

Ethnomedicinal values, phenolic contents and antioxidant properties of wild culinary vegetables.

PubMed

Abbasi, Arshad Mehmood; Shah, Munir H; Li, Tong; Fu, Xiong; Guo, Xinbo; Liu, Rui Hai

2015-03-13

Traditional medicines comprise a variety of health practices, approaches, knowledge, and beliefs. Documentation of traditional knowledge, estimation of total phenolics and antioxidant properties of plant species used as wild vegetables and in traditional medicines by the local communities of Lesser Himalayas-Pakistan are targeted. Interviews, questionnaires, and focus group conversation with local informants were carried out to record ethno-medicinal values. Used value, percentage of people who have traditional knowledge, preference ranking and informant consensus factors were also measured. Standard analytical methods were applied to estimate phenolic contents and antioxidant properties in water and acetone extracts. A total of 39 plant species used as culinary vegetables and to treat 44 different health disorders are investigated. Significant levels of use value (0.571) and preference ranking (58% PPK, PR-5) are calculated for Ficus palmata, Ficus carica and Solanum nigrum. Elevated levels of total phenolics (144.5 mg GAE/100 g, FW), and flavonoid contents (142.5 mgRtE/100 g, FW) were measured in the water extracts of Origanum vulgare, while Ficus palmata exhibits the highest flavonol contents (142.7 mg RtE/100 g, FW). Maximum DPPH activity is noted in the flowering buds of Bauhinia variegata (85.34%). However, highest values for OH(-) radical scavenging activity (75.12%), Fe(3+) reducing antioxidant power (54.50 µM GAE/100 g, FW), and total antioxidant capacity (180.8 µM AAE/100 g, FW) were measured in the water extracts of Origanum vulgare. Lesser Himalayas is a rich source of traditional cultural heritage, and plant biodiversity, which are under threat and necessitate urgent documentation. Present study is focused on the plant species used in traditional medicines and culinary vegetables as well. Preliminary determinations of phenoloic contents and antioxidant properties of various plant species were carried out. Present work will introduce new resource of medicinal and food plants, which could be used as functional food. Furthermore, phytochemical profiles, cellular based antioxidant properties, and isolation of active ingredients will be useful for consumers, and in the pharmaceutical and nutraceutical industries of the country. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Alpha-Glucosidase Enzyme Biosensor for the Electrochemical Measurement of Antidiabetic Potential of Medicinal Plants.

PubMed

Mohiuddin, M; Arbain, D; Islam, A K M Shafiqul; Ahmad, M S; Ahmad, M N

2016-12-01

A biosensor for measuring the antidiabetic potential of medicinal plants was developed by covalent immobilization of α-glucosidase (AG) enzyme onto amine-functionalized multi-walled carbon nanotubes (MWCNTs-NH2). The immobilized enzyme was entrapped in freeze-thawed polyvinyl alcohol (PVA) together with p-nitrophenyl-α-D-glucopyranoside (PNPG) on the screen-printed carbon electrode at low pH to prevent the premature reaction between PNPG and AG enzyme. The enzymatic reaction within the biosensor is inhibited by bioactive compounds in the medicinal plant extracts. The capability of medicinal plants to inhibit the AG enzyme on the electrode correlates to the potential of the medicinal plants to inhibit the production of glucose from the carbohydrate in the human body. Thus, the inhibition indicates the antidiabetic potential of the medicinal plants. The performance of the biosensor was evaluated to measure the antidiabetic potential of three medicinal plants such as Tebengau (Ehretis laevis), Cemumar (Micromelum pubescens), and Kedondong (Spondias dulcis) and acarbose (commercial antidiabetic drug) via cyclic voltammetry, amperometry, and spectrophotometry. The cyclic voltammetry (CV) response for the inhibition of the AG enzyme activity by Tebengau plant extracts showed a linear relation in the range from 0.423-8.29 μA, and the inhibition detection limit was 0.253 μA. The biosensor exhibited good sensitivity (0.422 μA/mg Tebengau plant extracts) and rapid response (22 s). The biosensor retains approximately 82.16 % of its initial activity even after 30 days of storage at 4 °C.

IN VITRO ANTIFUNGAL ACTIVITY OF METHANOLIC EXTRACTS OF DIFFERENT Senna didymobotrya (FRESEN.) H.S. IRWIN & BARNEBY PLANT PARTS

PubMed Central

P., Jeruto; P. F., Arama; B., Anyango; T., Akenga; R., Nyunja; D., Khasabuli

2016-01-01

Background: Herbal medicines have been in use for many years and remain widespread in developing countries; whereas, the use of complementary alternative medicine is on the increase in developed countries. Senna didymobotrya is important for its medicinal benefits among most communities in treating a wide range of ailments. Materials and methods: Plants were collected from a cluster in Siaya, Nandi and Nakuru counties (Kenya). Stem bark, root bark, leaves, flowers and immature pods were obtained; air-dried and ground into fine powder. Methanol was used to extract the plant extracts. The extracts were reconstituted in water and incorporated into growth media to obtain 0%, 2.5%, 5%, 7.5% and 10%. Bioassays were carried out on T. tonsurans (ATCC 28942) and C. albicans (14053). The growth of cultures on the plates was measured over a period of sixteen days. The area under disease progress stairs was determined and subjected to ANOVA and comparison of means using LSD. Results: Results indicated that the growth of C. albicans was not significantly affected by the plant extracts. Growth of T. tonsurans was completely inhibited by immature pods extract at 10%, the leaves and flowers extracts inhibited the growth at 7.5%. The stem and root bark extracts inhibited growth at low dosages of 2.5- 5 %. Conclusion: There is need to carry out research on root and stem barks to identify the active phytochemicals that contribute to their high efficacies. On species conservation, harvesting of roots may lead to depletion of S. didymobotrya. PMID:28480375

Analgesic and Anti-Inflammatory Effects of 80% Methanol Extract of Leonotis ocymifolia (Burm.f.) Iwarsson Leaves in Rodent Models

PubMed Central

Alemu, Asnakech

2018-01-01

Background Pain and inflammation are the major health problems commonly treated with traditional remedies mainly using medicinal plants. Leonotis ocymifolia is one of such medicinal plants used in folkloric medicine of Ethiopia. However, the plant has not been scientifically evaluated. The aim of this study was to evaluate analgesic and anti-inflammatory effects of the 80% methanol leaves extract of Leonotis ocymifolia using rodent models. Method The central and peripheral analgesic effect of the extract at 100, 200, and 400 mg/kg dose levels was evaluated using hot plate and acetic acid induced writhing rodent models, whereas carrageenan induced paw edema and cotton pellet granuloma methods were used to screen anti-inflammatory effect of the extract at the same dose levels. Acute toxicity test was also done. Data were analyzed using one-way ANOVA followed by Tukey's post hoc test and p < 0.05 was considered significant. Results The extract did not produce mortality up to 2000 mg/kg. All tested doses of the extract showed significant analgesic effect with maximum latency response of 62.8% and inhibition of acetic acid induced writhing. Maximum anti-inflammatory effect was recorded at 6 h after induction, with 75.88% reduction in carrageenan induced paw edema. Moreover, all tested doses of extract significantly inhibited the formation of inflammatory exudates and granuloma formation (p < 0.001). Conclusion The study indicated that the extract was safe in mice and it has both analgesic and anti-inflammatory effect in rodent models. PMID:29675050

Pharmacological Assessment of the Medicinal Potential of Acacia mearnsii De Wild.: Antimicrobial and Toxicity Activities

PubMed Central

Olajuyigbe, Olufunmiso O.; Afolayan, Anthony J.

2012-01-01

Acacia mearnsii De Wild. (Fabaceae) is a medicinal plant used in the treatment of microbial infections in South Africa without scientific validation of its bioactivity and toxicity. The antimicrobial activity of the crude acetone extract was evaluated by both agar diffusion and macrobroth dilution methods while its cytotoxicity effect was assessed with brine shrimp lethality assay. The study showed that both bacterial and fungal isolates were highly inhibited by the crude extract. The MIC values for the gram-positive bacteria (78.1–312.5) μg/mL, gram-negative bacteria (39.1–625) μg/mL and fungal isolates (625–5000) μg/mL differ significantly. The bacteria were more susceptible than the fungal strains tested. The antibiosis determination showed that the extract was more (75%) bactericidal than bacteriostatic (25%) and more fungicidal (66.67%) than fungistatic (33.33%). The cytotoxic activity of the extract was observed between 31.25 μg/mL and 500 μg/mL and the LC50 value (112.36 μg/mL) indicates that the extract was nontoxic in the brine shrimp lethality assay (LC50 > 100 μg/mL). These results support the use of A. mearnsii in traditional medicine for treatment of microbial infections. The extract exhibiting significant broad spectrum antimicrobial activity and nontoxic effects has potential to yield active antimicrobial compounds. PMID:22605976

Ginkgo Biloba extract for angina pectoris: a systematic review.

PubMed

Sun, Tian; Wang, Xian; Xu, Hao

2015-07-01

To evaluate the efficacy and safety of Ginkgo Biloba extract for patients with angina pectoris according to the available evidence. Electronic databases were searched for all of the randomized controlled trials (RCTs) of angina pectoris treatments with Ginkgo Biloba extract, either alone or combined with routine Western medicine (RWM), and controlled by untreated, placebo, Chinese patent medicine, or RWM treatment. The RCTs were retrieved from the following electronic databases: PubMed/MEDLINE, ProQuest Health and Medical Complete, Springer, Elsevier, and ProQuest Dissertations and Theses, Wanfang Data, China National Knowledge Infrastructure (CNKI), VIP database, China Biology Medicine (CBM), Chinese Medical Citation Index (CMCI), from the earliest database records to December 2012. No language restriction was applied. Study selection, data extraction, quality assessment, and data analyses were conducted according to the Cochrane standards. RevMan 5.1.0 provided by Cochrane Collaboration The data were analysed by using. A total of 23 RCTs (involving 2,529 patients) were included and the methodological quality was evaluated as generally low. Ginkgo Biloba extract with RWM was more effective in angina relief and electrocardiogram improvement than RWM alone. Reported adverse events included epigastric discomfort, nausea, gastrointestinal reaction, and bitter taste. Ginkgo Biloba extract may have beneficial effects on patients with angina pectoris, although the low quality of existing trials makes it difficult to draw a satisfactory conclusion. More rigorous, high quality clinical trials are needed to provide conclusive evidence.

Inhibition of TNF-α production in LPS-activated THP-1 monocytic cells by the crude extracts of seven Bhutanese medicinal plants.

PubMed

Wangchuk, Phurpa; Keller, Paul A; Pyne, Stephen G; Taweechotipatr, Malai

2013-07-30

Seven studied medicinal plants; Aconitum laciniatum, Ajania nubigena, Codonopsis bhutanica, Corydalis crispa, Corydalis dubia, Meconopsis simplicifolia and Pleurospermum amabile, are currently used in the Bhutanese Traditional Medicine (BTM) for the management of different types of disorders including the diseases that bore relevance to various inflammatory conditions. This study aimed to evaluate the inhibition of TNF-α production in LPS-activated THP-1 monocytic cells by the crude extracts of seven selected Bhutanese medicinal plants. It is expected to; (a) generate a scientific basis for their use in the BTM and (b) form a basis for prioritization of the seven plants for further phytochemical and anti-inflammatory studies. Seven plants were selected using an ethno-directed bio-rational approach and their crude extracts were prepared using four different solvents (methanol, hexane, dichloromethane and chloroform). The TNF-α inhibitory activity of these extracts was determined by cytokine-specific sandwich quantitative enzyme-linked immunosorbent assays (ELISAs). The results were quantified statistically and the statistical significance were evaluated by GraphPad Prism version 5.01 using Student's t-test with one-tailed distribution. A p-value ≤0.05 was considered statistically significant. Of the seven plants studied, the crude extracts of six of them inhibited the production of pro-inflammatory cytokine, TNF-α in LPS-activated THP-1 monocytic cells. Amongst the six plants, Corydalis crispa gave the best inhibitory activity followed by Pleurospermum amabile, Ajania nubigena, Corydalis dubia, Meconopsis simplicifolia and Codonopsis bhutanica. Of the 13 extracts that exhibited statistically significant TNF-α inhibitory activity (p<0.05; p<0.01), five of them showed very strong inhibition when compared to the DMSO control and RPMI media. Six medicinal plants studied here showed promising TNF-α inhibitory activity. These findings rationalize the traditional use of these selected medicinal plants in the BTM as an individual plant or in combination with other ingredients for the treatment of disorders bearing relevance to the inflammatory conditions. The results forms a good preliminary basis for the prioritization of candidate plant species for an in-depth phytochemical study and anti-inflammatory activity screening of the pure compounds contained within those seven plants. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Techniques for extraction and isolation of natural products: a comprehensive review.

PubMed

Zhang, Qing-Wen; Lin, Li-Gen; Ye, Wen-Cai

2018-01-01

Natural medicines were the only option for the prevention and treatment of human diseases for thousands of years. Natural products are important sources for drug development. The amounts of bioactive natural products in natural medicines are always fairly low. Today, it is very crucial to develop effective and selective methods for the extraction and isolation of those bioactive natural products. This paper intends to provide a comprehensive view of a variety of methods used in the extraction and isolation of natural products. This paper also presents the advantage, disadvantage and practical examples of conventional and modern techniques involved in natural products research.

Phytochemical screening of Diplazium esculentum as medicinal plant from Central Kalimantan, Indonesia

NASA Astrophysics Data System (ADS)

Zannah, Fathul; Amin, Mohammad; Suwono, Hadi; Lukiati, Betty

2017-05-01

Diplazium esculentum is one of the ferns used by the Dayak's people in Central Kalimantan as a traditional medicine to treat tumors, asthma, and acne. This study aims to determine the content of bioactive compounds in Diplazium esculentum in Central Kalimantan. This research is a descriptive study with a qualitative approach. Qualitative phytochemical screening detected the presence of flavonoids, polyphenols, alkaloids, terpenoids and saponins in aqueous extracts with the boiled and brewed method, while in ethanol extract this detected polyphenols, alkaloids, terpenoids, and saponins. The results show that the use of water as a solvent can be an alternative in plant extracts.

Phytochemicals Analysis and Medicinal Potentials of Hydroalcoholic Extract from Curtisia dentata (Burm.f) C.A. Sm Stem Bark

PubMed Central

Oyedemi, Sunday Oyewole; Oyedemi, Blessing Ogochukwuamaka; Arowosegbe, Sunday; Afolayan, Anthony Jide

2012-01-01

Curtisia dentata (CD) is a vulnerable medicinal plant used for the treatment of stomach ailments in South Africa. However, there is a lack of sufficient data on its phytochemical components and medicinal properties. The phytochemical analysis of the extract was estimated using standard assay methods while its antibacterial activity was determined by the agar dilution method against selected bacteria. The antioxidant activity of the extract was done using ferric reducing power, 1,1-diphenyl-2-picrylhydrazyl (DPPH), 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic-acid (ABTS), nitric oxide (NO), hydrogen peroxide (H2O2) and lipid peroxidation (LPO). The cytotoxicity assay of the extract was assessed using the brine shrimp lethality test with LC50 value of 0.302 mg/mL. The antibacterial activity of the extract demonstrated an appreciable broad spectrum activity against the tested bacteria with minimum inhibitory concentration (MIC) ranges between 5000 and 0.5 mg/L. Both phenol and flavonoid concentrations were 14.86 mg tannic acid equivalent/g and 13.64 mg quercetin equivalent/g, respectively. The percentage composition of saponins (13.26) was highest, followed by steroids (1.42), while alkaloids and tannins had the same value of 0.51. Similarly, IC50 values of the extract against DPPH, ABTS, H2O2, LPO and NO were 0.017, 0.018, 0.159, 0.06 and 0.052 mg/mL, respectively. The reducing power of the extract was found to be concentration dependent. Our data suggest that the 70% ethanol extract from the CD extract has antibacterial and antioxidant properties due to the presence of bio-active compounds and thus support its folkloric use in the treatment of diseases. PMID:22754358

Anti-Acne Activity of Italian Medicinal Plants Used for Skin Infection

PubMed Central

Nelson, Kate; Lyles, James T.; Li, Tracy; Saitta, Alessandro; Addie-Noye, Eugenia; Tyler, Paula; Quave, Cassandra L.

2016-01-01

Propionibacterium acnes is implicated in the pathogenesis of acne vulgaris, which impacts >85% of teenagers. Novel therapies are in high demand and an ethnopharmacological approach to discovering new plant sources of anti-acne therapeutics could contribute to filling this void in effective therapies. The aims of our study were two-fold: (1) To determine if species identified in ethnopharmacological field studies as having traditional uses for skin and soft tissue infection (SSTI) exhibit significantly more activity against P. acnes than species with no such reported use; and (2) Chemically characterize active extracts and assess their suitability for future investigation. Extracts of Italian medicinal (for acne and other skin infection) and randomly collected plants and fungi were screened for growth-inhibitory and anti-biofilm activity in P. acnes using broth microdilution methods. Bioactive extracts were chemically characterized by HPLC and examined for cytotoxicity against human keratinocytes (HaCaTs). Following evaluation of 157 extracts from 10 fungi and 58 plants, we identified crude extracts from seven species exhibiting growth inhibitory activity (MICs 64–256 μg mL−1). All active extracts were examined for cytotoxicity against HaCaTs; extracts from one fungal and one plant species were toxic (IC50 256 μg mL−1). HPLC analysis with chemical standards revealed many of these extracts contained chlorogenic acid, p-coumaric acid, ellagic acid, gallic acid, and tannic acid. In conclusion, species used in traditional medicine for the skin exhibited significantly greater (p < 0.05) growth inhibitory and biofilm eradication activity than random species, supporting the validity of an ethnobotanical approach to identifying new therapeutics. The anti-acne activity of three extracts is reported for the first time: Vitis vinifera leaves, Asphodelus microcarpus leaves, and Vicia sativa aerial parts. PMID:27891094

Inhibition of Group IIA Secretory Phospholipase A2 and its Inflammatory Reactions in Mice by Ethanolic Extract of Andrographis paniculata, a Well-known Medicinal Food

PubMed Central

Kishore, V.; Yarla, N. S.; Zameer, F.; Nagendra Prasad, M. N.; Santosh, M. S.; More, S. S.; Rao, D. G.; Dhananjaya, Bhadrapura Lakkappa

2016-01-01

Andrographis paniculata Nees is an important medicinal plant found in the tropical regions of the world, which has been traditionally used in Indian and Chinese medicinal systems. It is also used as medicinal food. A. paniculata is found to exhibit anti-inflammatory activities; however, its inhibitory potential on inflammatory Group IIA phospholipases A2 (PLA2) and its associated inflammatory reactions are not clearly understood. The aim of the present study is to evaluate the inhibitory/neutralizing potential of ethanolic extract of A. paniculata on the isolated inflammatory PLA2 (VRV-PL-VIIIa) from Daboii rusellii pulchella (belonging to Group IIA inflammatory secretory PLA2 [sPLA2]) and its associated edema-induced activities in Swiss albino mice. A. paniculata extract dose dependently inhibited the Group IIA sPLA2 enzymatic activity with an IC50 value of 10.3 ± 0.5 μg/ml. Further, the extract dose dependently inhibited the edema formation, when co-injected with enzyme indicating that a strong correlation exists between lipolytic and pro-inflammatory activities of the enzyme. In conclusion, results of this study shows that the ethanolic extract of A. paniculata effectively inhibits Group IIA sPLA2 and its associated inflammatory activities, which substantiate its anti-inflammatory properties. The results of the present study warranted further studies to develop bioactive compound (s) in ethanolic extract of A. paniculata as potent therapeutic agent (s) for inflammatory diseases. SUMMARY This study emphasis the anti-inflammatory effect of A. paniculata by inhibiting the inflammatory Group IIA sPLA2 and its associated inflammatory activities such as edema. It was found that there is a strong correlation between lipolytic activity and pro-inflammatory activity inhibition. Therefore, the study suggests that the extract processes potent anti-inflammatory agents, which could be developed as a potential therapeutic agent against inflammatory and related diseases. PMID:27365993

Sodium metabisulfite–induced polymerization of sickle cell hemoglobin incubated in the extracts of three medicinal plants (Anacardium occidentale, Psidium guajava, and Terminalia catappa)

PubMed Central

Chikezie, Paul Chidoka

2011-01-01

Background: The exploitation and utilization of vast varieties of herbal extracts may serve as alternative measures to deter aggregation of deoxygenated sickle cell hemoglobin (deoxyHbS) molecules. Objective: The present in vitro study ascertained the capacity of three medicinal plants, namely, Anacardium occidentale, Psidium guajava, and Terminalia catappa, to alter polymerization of HbS. Materials and Methods: Spectrophotometric method was used to monitor the level of polymerization of hemolysate HbS molecules treated with sodium metabisulfite (Na2 S2 O5) at a regular interval of 30 s for a period of 180 s in the presence of separate aqueous extracts of A. occidentale, P. guajava, and T. catappa. At time intervals of 30 s, the level of polymerization was expressed as percentage of absorbance relative to the control sample at the 180th s. Results: Although extracts of the three medicinal plants caused significant (P < 0.05) reduction in polymerization of deoxyHbS molecules, the corresponding capacity in this regard diminished with increase in incubation time. Aqueous extract of P. guajava exhibited the highest capacity to reduced polymerization of deoxyHbS molecules. Whereas at t > 60 s, extract concentration of 400 mg% of A. occidentale activated polymerization of deoxyHbS molecules by 6.23±1.34, 14.53±1.67, 21.15±1.89, and 24.42±1.09%, 800 mg% of T. catappa at t > 30 s gave values of 2.50±1.93, 5.09±1.96, 10.00±0.99, 15.38±1.33, and 17.31±0.97%. Conclusion: The capacity of the three medicinal plants to interfere with polymerization of deoxyHbS molecules depended on the duration of incubation and concentration of the extracts. PMID:21716622

In vitro inhibitory activities of selected Australian medicinal plant extracts against protein glycation, angiotensin converting enzyme (ACE) and digestive enzymes linked to type II diabetes.

PubMed

Deo, Permal; Hewawasam, Erandi; Karakoulakis, Aris; Claudie, David J; Nelson, Robert; Simpson, Bradley S; Smith, Nicholas M; Semple, Susan J

2016-11-04

There is a need to develop potential new therapies for the management of diabetes and hypertension. Australian medicinal plants collected from the Kuuku I'yu (Northern Kaanju) homelands, Cape York Peninsula, Queensland, Australia were investigated to determine their therapeutic potential. Extracts were tested for inhibition of protein glycation and key enzymes relevant to the management of hyperglycaemia and hypertension. The inhibitory activities were further correlated with the antioxidant activities. Extracts of five selected plant species were investigated: Petalostigma pubescens, Petalostigma banksii, Memecylon pauciflorum, Millettia pinnata and Grewia mesomischa. Enzyme inhibitory activity of the plant extracts was assessed against α-amylase, α-glucosidase and angiotensin converting enzyme (ACE). Antiglycation activity was determined using glucose-induced protein glycation models and formation of protein-bound fluorescent advanced glycation endproducts (AGEs). Antioxidant activity was determined by measuring the scavenging effect of plant extracts against 1, 1-diphenyl-2-picryl hydrazyl (DPPH) and using the ferric reducing anti-oxidant potential assay (FRAP). Total phenolic and flavonoid contents were also determined. Extracts of the leaves of Petalostigma banksii and P. pubescens showed the strongest inhibition of α-amylase with IC 50 values of 166.50 ± 5.50 μg/mL and 160.20 ± 27.92 μg/mL, respectively. The P. pubescens leaf extract was also the strongest inhibitor of α-glucosidase with an IC 50 of 167.83 ± 23.82 μg/mL. Testing for the antiglycation potential of the extracts, measured as inhibition of formation of protein-bound fluorescent AGEs, showed that P. banksii root and fruit extracts had IC 50 values of 34.49 ± 4.31 μg/mL and 47.72 ± 1.65 μg/mL, respectively, which were significantly lower (p < 0.05) than other extracts. The inhibitory effect on α-amylase, α-glucosidase and the antiglycation potential of the extracts did not correlate with the total phenolic, total flavonoid, FRAP or DPPH. For ACE inhibition, IC 50 values ranged between 266.27 ± 6.91 to 695.17 ± 15.38 μg/mL. The tested Australian medicinal plant extracts inhibit glucose-induced fluorescent AGEs, α-amylase, α-glucosidase and ACE with extracts of Petalostigma species showing the most promising activity. These medicinal plants could potentially be further developed as therapeutic agents in the treatment of hyperglycaemia and hypertension.

Characterization of an anti-tuberculosis resin glycoside from the prairie medicinal plant Ipomoea leptophylla.

PubMed

Barnes, Curtis C; Smalley, Mary K; Manfredi, Kirk P; Kindscher, Kelly; Loring, Hillary; Sheeley, Douglas M

2003-11-01

The organic soluble extract from the leaves of the native North American prairie plant Ipomoea leptophylla (big root morning glory) showed in vitro activity against M. tuberculosis. Bioassay-guided fractionation of this extract resulted in the identification of two new resin glycosides (6, 7). Base-catalyzed hydrolysis of these glycosides gave operculinic acid (1) as the glycosidic acid component as well as trans-cinnamic acid, propanoic acid, and lauric acid. The complete structure elucidation was accomplished through derivatization, 1D and 2D NMR spectroscopy (TOCSY, ROESY, HSQC, HMBC), and MS/MS experiments on 6 and 7 as well as the permethylated derivative 8.

Biologically active extracts with kidney affections applications

NASA Astrophysics Data System (ADS)

Pascu (Neagu), Mihaela; Pascu, Daniela-Elena; Cozea, Andreea; Bunaciu, Andrei A.; Miron, Alexandra Raluca; Nechifor, Cristina Aurelia

2015-12-01

This paper is aimed to select plant materials rich in bioflavonoid compounds, made from herbs known for their application performances in the prevention and therapy of renal diseases, namely kidney stones and urinary infections (renal lithiasis, nephritis, urethritis, cystitis, etc.). This paper presents a comparative study of the medicinal plant extracts composition belonging to Ericaceae-Cranberry (fruit and leaves) - Vaccinium vitis-idaea L. and Bilberry (fruit) - Vaccinium myrtillus L. Concentrated extracts obtained from medicinal plants used in this work were analyzed from structural, morphological and compositional points of view using different techniques: chromatographic methods (HPLC), scanning electronic microscopy, infrared, and UV spectrophotometry, also by using kinetic model. Liquid chromatography was able to identify the specific compounds of the Ericaceae family, present in all three extracts, arbutosid, as well as specific components of each species, mostly from the class of polyphenols. The identification and quantitative determination of the active ingredients from these extracts can give information related to their therapeutic effects.

Proximate, Phytochemical, and In Vitro Antimicrobial Properties of Dried Leaves from Ocimum gratissimum.

PubMed

Talabi, Justina Y; Makanjuola, Solomon Akinremi

2017-09-01

Ocimum gratissimum is a common plant in the tropics and has been used in food and medicine. Its usage in food and medicine could be attributed to its phtyochemical and antimicrobial properties. In this study we investigated the proximate, phytochemical, and antimicrobial attributes of air dried leaves of O. gratissimum . The aqueous extract was found to contain phtyochemicals with alkaloid and saponin present in appreciable amounts. The proximate analysis (crude protein and crude fibre content were 15.075% and 17.365%, respectively) showed that the leaf could be a good source of protein and fibre. The aqueous ethanolic extract of the leaf exhibited activity against a wider range of organisms when compared to the aqueous extract at the investigated concentrations. Aqueous ethanolic extracts of O. gratissimum leaf was active against Escherichia coli , Pseudomonas aeruginosa , Staphylococcus aureus , and Bacillus cereus and the aqueous extract of the leaf was active against P. aeruginosa .

Antimalarial activity of three Pakistani medicinal plants.

PubMed

Irshad, Saba; Mannan, Abdul; Mirza, Bushra

2011-10-01

This study was conducted to determine the in vitro anti-malarial activity of three medicinal plants, Picrorhiza kurroa, Caesalpinia bonducella and Artemisia absinthium of Pakistan. Different extracts of various parts of these plants were prepared by maceration and percolation, and were evaluated for their antimalarial activity. Aqueous, cold alcoholic and hot alcoholic extracts of Picrorhiza kurroa showed 34%, 100% and 90% inhibition in growth of Plasmodium falciparum, respectively, at 2.00 mg/ml. While aqueous, cold alcoholic and hot alcoholic extracts of Caesalpinia bonducella showed 65%, 56% and 76% inhibition in growth of Plasmodium falciparum, respectively at same concentrations. In the case of Artemisia absinthium, aqueous, cold alcoholic and hot alcoholic extract of Artemisia absinthium showed 35%, 55% and 21% inhibition in growth of Plasmodium falciparum, respectively at 2.00 mg/ml. In our study, extracts of Picrorhiza kurroa were found good for traditional therapy with highly significant results.

The Australian Pharmaceutical Benefits Scheme data collection: a practical guide for researchers.

PubMed

Mellish, Leigh; Karanges, Emily A; Litchfield, Melisa J; Schaffer, Andrea L; Blanch, Bianca; Daniels, Benjamin J; Segrave, Alicia; Pearson, Sallie-Anne

2015-11-02

The Pharmaceutical Benefits Scheme (PBS) is Australia's national drug subsidy program. This paper provides a practical guide to researchers using PBS data to examine prescribed medicine use. Excerpts of the PBS data collection are available in a variety of formats. We describe the core components of four publicly available extracts (the Australian Statistics on Medicines, PBS statistics online, section 85 extract, under co-payment extract). We also detail common analytical challenges and key issues regarding the interpretation of utilisation using the PBS collection and its various extracts. Research using routinely collected data is increasing internationally. PBS data are a valuable resource for Australian pharmacoepidemiological and pharmaceutical policy research. A detailed knowledge of the PBS, the nuances of data capture, and the extracts available for research purposes are necessary to ensure robust methodology, interpretation, and translation of study findings into policy and practice.

Hericium erinaceus extracts alter behavioral rhythm in mice.

PubMed

Furuta, Shoko; Kuwahara, Rika; Hiraki, Eri; Ohnuki, Koichiro; Yasuo, Shinobu; Shimizu, Kuniyoshi

2016-01-01

Hericium erinaceus (HE), an edible mushroom, has been used as a herbal medicine in several Asian countries since ancient times. HE has potential as a medicine for the treatment and prevention of dementia, a disorder closely linked with circadian rhythm. This study investigated the effects of the intake of HE extracts on behavioral rhythm, photosensitivity of the circadian clock, and clock gene mRNA expression in the suprachiasmatic nucleus (SCN), a central clock, in mice. Although the HE ethanol extract only affected the offset time of activity, the HE water extract advanced the sleep-wake cycle without affecting the free-running period, photosensitivity, or the clock gene mRNA expression in SCN. In addition, both extracts decreased wakefulness around end of active phase. The findings of the present study suggest that HE may serve as a functional food in the prevention and treatment of Alzheimer's disease and delayed sleep phase syndrome.

Low Potency Homeopathic Remedies and Allopathic Herbal Medicines: Is There an Overlap?

PubMed Central

Csupor, Dezső; Boros, Klára; Hohmann, Judit

2013-01-01

Classical homeopathy is based on the therapeutic application of highly diluted homeopathic stocks. The indications of such medicines are determined by proving, i.e. by applying the remedies in healthy subjects. However, there are several complex homeopathic medicinal products on the market with approved therapeutic indications. The efficacy of these medicines has been assessed in clinical trials on patients. There is no upper limit of dosing for such homeopathic remedies, and these products often contain undiluted mother tincture. The aim of our study was to compare an allopathic herbal medicine and a homeopathic product containing undiluted mother tincture based on the same plant. Two products (an allopathic herbal medicine and a homeopathic product) containing Vitex agnus-castus extract were analyzed by HPLC-DAD for their agnuside and casticin contents. The agnuside content of the allopathic product was approximately four times higher, while the amount of casticin was in the same order of magnitude. Our experiments revealed the presence of active ingredients in allopathic quantity in a homeopathic preparation, highlighting the controversy between the principles of classical and practice of contemporary homeopathy. According to the principles of classical homeopathy these remedies cannot be considered as homeopathic remedies but rather as (allopathic) herbal ones. This phenomenon necessitates a case-by-case approach towards the possible adverse effects and drug interactions of homeopathics in the daily medical practice. Homeopathic products containing active agents in allopathic doses should be treated the same way as allopathic medicines from the point of view of quality assurance and pharmacovigilance. PMID:24019954

The diversity and antimicrobial activity of endophytic fungi associated with medicinal plant Baccharis trimera (Asteraceae) from the Brazilian savannah.

PubMed

Vieira, Mariana L A; Johann, Susana; Hughes, Frederic M; Rosa, Carlos A; Rosa, Luiz H

2014-12-01

The fungal endophyte community associated with Baccharis trimera, a Brazilian medicinal plant, was characterized and screened for its ability to present antimicrobial activity. By using molecular methods, we identified and classified the endophytic fungi obtained into 25 different taxa from the phyla Ascomycota and Basidiomycota. The most abundant species were closely related to Diaporthe phaseolorum, Pestalotiopsis sp. 1, and Preussia pseudominima. The differences observed in endophytic assemblages from different B. trimera specimens might be associated with their crude extract activities. Plants that had higher α-biodiversity were also those that contributed more to the regional (γ) diversity. All fungal isolates were cultured and their crude extracts screened to examine the antimicrobial activities. Twenty-three extracts (12.8%) displayed antimicrobial activities against at least one target microorganism. Among these extracts, those obtained from Epicoccum sp., Pestalotiopsis sp. 1, Cochliobolus lunatus, and Nigrospora sp. presented the best minimum inhibitory concentration values. Our results show that the endophytic fungal community associated with the medicinal plant B. trimera included few dominant bioactive taxa, which may represent sources of compounds with antifungal activity. Additionally, the discovery of these bioactive fungi in association with B. trimera suggests that Brazilian plants used as folk medicine may shelter a rich fungal diversity as well as taxa able to produce bioactive metabolites with antimicrobial activities.

Inhibitory Effects of Bangladeshi Medicinal Plant Extracts on Interactions between Transcription Factors and Target DNA Sequences

PubMed Central

Lampronti, Ilaria; Khan, Mahmud T.H.; Borgatti, Monica; Bianchi, Nicoletta

2008-01-01

Several transcription factors (TFs) play crucial roles in governing the expression of different genes involved in the immune response, embryo or cell lineage development, cell apoptosis, cell cycle progression, oncogenesis, repair and fibrosis processes and inflammation. As far as inflammation, TFs playing pivotal roles are nuclear factor kappa B (NF-kB), activator protein (AP-1), signal transducer and activator of transcription (STATs), cAMP response element binding protein (CREB) and GATA-1 factors. All these TFs regulate the expression of pro-inflammatory cytokines and are involved in the pathogenesis of a number of human disorders, particularly those with an inflammatory component. Since several medicinal plants can be employed to produce extracts exhibiting biological effects and because alteration of gene transcription represents a very interesting approach to control the expression of selected genes, this study sought to verify the ability of several extracts derived from Bangladeshi medicinal plants in interfering with molecular interactions between different TFs and specific DNA sequences. We first analyzed the antiproliferative activity of 19 medicinal plants on different human cell lines, including erythroleukemia K562, B lymphoid Raji and T lymphoid Jurkat cell lines. Secondly, we employed the electrophoretic mobility shift assay as a suitable technique for a fast screening of plant extracts altering the binding between NF-kB, AP-1, GATA-1, STAT-3, CREB and the relative target DNA elements. PMID:18830455

Two-dimensional correlation infrared spectroscopy applied to analyzing and identifying the extracts of Baeckea frutescens medicinal materials.

PubMed

Adib, Adiana Mohamed; Jamaludin, Fadzureena; Kiong, Ling Sui; Hashim, Nuziah; Abdullah, Zunoliza

2014-08-05

Baeckea frutescens or locally known as Cucur atap is used as antibacterial, antidysentery, antipyretic and diuretic agent. In Malaysia and Indonesia, they are used as an ingredient of the traditional medicine given to mothers during confinement. A three-steps infra-red (IR) macro-fingerprinting method combining conventional IR spectra, and the secondary derivative spectra with two dimensional infrared correlation spectroscopy (2D-IR) have been proved to be effective methods to examine a complicated mixture such as herbal medicines. This study investigated the feasibility of employing multi-steps IR spectroscopy in order to study the main constituents of B. frutescens and its different extracts (extracted by chloroform, ethyl acetate, methanol and aqueous in turn). The findings indicated that FT-IR and 2D-IR can provide many holistic variation rules of chemical constituents. The structural information of the samples indicated that B. frutescens and its extracts contain a large amount of flavonoids, since some characteristic absorption peaks of flavonoids, such as ∼1600cm(-1), ∼1500cm(-1), ∼1450cm(-1), and ∼1270cm(-1) can be observed. The macroscopical fingerprint characters of FT-IR and 2D-IR spectra can not only provide the information of main chemical constituents in medicinal materials and their different extracts, but also compare the components differences among the similar samples. In conclusion, the multi-steps IR macro-fingerprint method is rapid, effective, visual and accurate for pharmaceutical research. Copyright © 2014 Elsevier B.V. All rights reserved.

Antibacterial activity of Thai herbal extracts on acne involved microorganism.

PubMed

Niyomkam, P; Kaewbumrung, S; Kaewnpparat, S; Panichayupakaranant, P

2010-04-01

Ethyl acetate and methanol extracts of 18 Thai medicinal plants were investigated for their antibacterial activity against Propionibacterium acnes, Stapylococcus aureus, and S. epidermidis. Thirteen plant extracts were capable of inhibiting the growth of P. acnes and S. epidermidis, while 14 plant extracts exhibited an inhibitory effect on S. aureus. Based on the broth dilution method, the ethyl acetate extract of Alpinia galanga (L.) Wild. (Zingiberaceae) rhizome showed the strongest antibacterial effect against P. acnes, with minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) values of 156.0 and 312.0 microg/mL, respectively. On the basis of bioassay-guided purification, the ethyl acetate extract was isolated to afford the antibacterial active compound, which was identified as 1'-acetoxychavicol acetate (1'-ACA). 1'-ACA had a strong inhibitory effect on P. acnes with MIC and MBC values of 62.0 and 250.0 microg/mL, respectively. Thus, 1'-ACA was used as an indicative marker for standardization of A. galanga extract using high performance liquid chromatography. These results suggest that A. galanga extract could be an interesting agent for further studies on an alternative treatment of acne.

Naturally occurring medicinal mushroom-derived antimicrobials: a case-study using Lingzhi or Reishi Ganoderma lucidum (W. Curt.:Fr.) P. Karst. (higher Basidiomycetes).

PubMed

Karwa, Alka S; Rai, Mahendra K

2012-01-01

Antibacterial activity of Lingzhi or Reishi medicinal mushroom, Ganoderma lucidum, collected from Central India was evaluated against four bacterial pathogens. Ethyl alcohol and water extracts of fruit body powder were tested using the disc diffusion method against Staphylococcus aureus, Klebsiella pneumoniae, Bacillus cereus, and Pseudomonas aeruginosa. It was noted that the aqueous extract inhibited growth of pathogenic bacteria. The combined effect of fruit body extract with synthetic antibiotic discs was found to increase the activity significantly more than the antibiotics alone. The present study is an attempt to assess antibacterial activity of extracts of G. lucidum singly and in combination. The combination of G. lucidum with commercial antibiotics proves that it enhances antibacterial activity.

Screening of antibacterial potentials of some medicinal plants from Melghat forest in India.

PubMed

Tambekar, D H; Khante, B S; Chandak, B R; Titare, A S; Boralkar, S S; Aghadte, S N

2009-05-07

Cyperus rotundus, Caesalpinia bonducella, Tinospora cordifolia, Gardenia gummifera, Ailanthus excelsa, Acacia arabica, Embelia ribes and Ventilago maderspatana from Melghat forest were screened for their antibacterial potential against Escherichia coli, Staphylococcus aureus, Klebsiella pneumoniae, Proteus vulgaris, Salmonella typhi, Shigella flexneri, Salmonella paratyphi, Salmonella typhimurium, Pseudomonas aeruginosa, Enterobacter aerogenes by disc diffusion method. Out of these medicinal plants Caesalpinia bonducella, Gardenia gummifera and Acacia arabica showed remarkable antibacterial potential. The phytochemical analysis had showed the presence of Cardiac glycosides in all extracts (aqueous, acetone, ethanol and methanol) of Acacia arabica, Gardenia gummifera and ethanol, methanol extracts of Caesalpinia bonducella. Flavonoids were present in Gardenia gummifera, Ailanthus excelsa and acetone, methanol extracts of Acacia Arabica. Tannins and phenolic were present in Cyperus rotundus, Embelia ribes, and organic extracts of Ventilago maderspatana.

Biologically active traditional medicinal herbs from Balochistan, Pakistan.

PubMed

Zaidi, Mudassir A; Crow, Sidney A

2005-01-04

The biological activities of the following four important medicinal plants of Balochistan, Pakistan were checked; Grewia erythraea Schwein f. (Tiliaceae), Hymenocrater sessilifolius Fisch. and C.A. Mey (Lamiaceae), Vincetoxicum stocksii Ali and Khatoon (Asclepiadaceae) and Zygophyllum fabago L. (Zygophyllaceae). The methanolic extracts were fractionated into hexane, ethyl acetate, chloroform, butanol and water. The antifungal and antibacterial activities of these plants were determined against 12 fungal and 12 bacterial strains by agar well diffusion and disk diffusion assays. The extract of Zygophyllum fabago was found to be highly effective against Candida albicans and Escherichia coli. The extract of Vincetoxicum stocksii was also found to be significantly active against Candida albicans, Bacillus subtilis and Bacillus cereus. Extracts of Hymenocrater sessilifolius and Grewia erythraea showed good activity only against Pseudomonas aeruginosa.

Analysis of the Impact of Isoquinoline Alkaloids, Derived from Macleaya cordata Extract, on the Development and Innate Immune Response in Swine and Poultry.

PubMed

Ni, Hengjia; Martínez, Yordan; Guan, Guiping; Rodríguez, Román; Más, Dairon; Peng, Hanhui; Valdivié Navarro, Manuel; Liu, Gang

2016-01-01

Medicinal extract has been chronicled extensively in traditional Chinese medicine. Isoquinoline alkaloids, extract of Macleaya cordata (Willd.) R. Br., have been used as feed additive in both swine and poultry. Dietary supplementation with isoquinoline alkaloids increases feed intake and weight gain. In addition, recent researches have demonstrated that isoquinoline alkaloids can regulate metabolic processes, innate immune system, and digestive functioning in animals. This review summarizes the latest scientific researches on isoquinoline alkaloids which are extracted from Macleaya cordata (Willd.) R. Br. This review specifically focuses on its role as a feed supplement and its associated impact on growth performance and innate immune system, as well as its capacity to act as a substitute for oral antibiotics.

Analysis of the Impact of Isoquinoline Alkaloids, Derived from Macleaya cordata Extract, on the Development and Innate Immune Response in Swine and Poultry

PubMed Central

Martínez, Yordan; Rodríguez, Román; Más, Dairon; Peng, Hanhui; Valdivié Navarro, Manuel

2016-01-01

Medicinal extract has been chronicled extensively in traditional Chinese medicine. Isoquinoline alkaloids, extract of Macleaya cordata (Willd.) R. Br., have been used as feed additive in both swine and poultry. Dietary supplementation with isoquinoline alkaloids increases feed intake and weight gain. In addition, recent researches have demonstrated that isoquinoline alkaloids can regulate metabolic processes, innate immune system, and digestive functioning in animals. This review summarizes the latest scientific researches on isoquinoline alkaloids which are extracted from Macleaya cordata (Willd.) R. Br. This review specifically focuses on its role as a feed supplement and its associated impact on growth performance and innate immune system, as well as its capacity to act as a substitute for oral antibiotics. PMID:28042566

An approach to optimize the batch mixing process for improving the quality consistency of the products made from traditional Chinese medicines*

PubMed Central

Yan, Bin-jun; Qu, Hai-bin

2013-01-01

The efficacy of traditional Chinese medicine (TCM) is based on the combined effects of its constituents. Variation in chemical composition between batches of TCM has always been the deterring factor in achieving consistency in efficacy. The batch mixing process can significantly reduce the batch-to-batch quality variation in TCM extracts by mixing them in a well-designed proportion. However, reducing the quality variation without sacrificing too much of the production efficiency is one of the challenges. Accordingly, an innovative and practical batch mixing method aimed at providing acceptable efficiency for industrial production of TCM products is proposed in this work, which uses a minimum number of batches of extracts to meet the content limits. The important factors affecting the utilization ratio of the extracts (URE) were studied by simulations. The results have shown that URE was affected by the correlation between the contents of constituents, and URE decreased with the increase in the number of targets and the relative standard deviations of the contents. URE could be increased by increasing the number of storage tanks. The results have provided a reference for designing the batch mixing process. The proposed method has possible application value in reducing the quality variation in TCM and providing acceptable production efficiency simultaneously. PMID:24190450

An approach to optimize the batch mixing process for improving the quality consistency of the products made from traditional Chinese medicines.

PubMed

Yan, Bin-jun; Qu, Hai-bin

2013-11-01

The efficacy of traditional Chinese medicine (TCM) is based on the combined effects of its constituents. Variation in chemical composition between batches of TCM has always been the deterring factor in achieving consistency in efficacy. The batch mixing process can significantly reduce the batch-to-batch quality variation in TCM extracts by mixing them in a well-designed proportion. However, reducing the quality variation without sacrificing too much of the production efficiency is one of the challenges. Accordingly, an innovative and practical batch mixing method aimed at providing acceptable efficiency for industrial production of TCM products is proposed in this work, which uses a minimum number of batches of extracts to meet the content limits. The important factors affecting the utilization ratio of the extracts (URE) were studied by simulations. The results have shown that URE was affected by the correlation between the contents of constituents, and URE decreased with the increase in the number of targets and the relative standard deviations of the contents. URE could be increased by increasing the number of storage tanks. The results have provided a reference for designing the batch mixing process. The proposed method has possible application value in reducing the quality variation in TCM and providing acceptable production efficiency simultaneously.

Induction of murine embryonic stem cell differentiation by medicinal plant extracts

PubMed Central

Reynertson, Kurt A.; Charlson, Mary E.; Gudas, Lorraine J.

2010-01-01

Epidemiological evidence indicates that diets high in fruits and vegetables provide a measure of cancer chemoprevention due to phytochemical constituents. Natural products are a rich source of cancer chemotherapy drugs, and primarily target rapidly-cycling tumor cells. Increasing evidence indicates that many cancers contain small populations of resistant, stem-like cells that have the capacity to regenerate tumors following chemotherapy and radiation, and have been linked to the initiation of metastases. Our goal is to discover natural product-based clinical or dietary interventions that selectively target cancer stem cells, inducing differentiation. We adapted an alkaline phosphatase (AP) stain to assay plant extracts for the capacity to induce differentiation in embryonic stem (ES) cells. AP is a characteristic marker of undifferentiated ES cells, and this represents a novel approach to screening medicinal plant extracts. Following a survey of approximately 100 fractions obtained from twelve species of ethnomedically utilized plants, we found fractions from three species that induced differentiation, decreasing AP and transcript levels of pluripotency markers (Nanog, Oct-4, Rex-1). These fractions affected proliferation of murine ES, and human embryonal, prostate, and breast carcinoma cells in a dose-dependent manner. Several phytochemical constituents were isolated; the antioxidant phytochemicals ellagic acid and gallic acid were shown to affect viability of cultured breast carcinoma cells. PMID:20955699

HFIP Extraction Followed by 2D CTAB/SDS-PAGE Separation: A New Methodology for Protein Identification from Tissue Sections after MALDI Mass Spectrometry Profiling for Personalized Medicine Research

PubMed Central

Longuespée, Rémi; Tastet, Christophe; Desmons, Annie; Kerdraon, Olivier; Day, Robert

2014-01-01

Abstract Matrix-assisted laser desorption ionization mass spectrometry imaging (MALDI-MSI) and profiling technology have become the easiest methods for quickly accessing the protein composition of a tissue area. Unfortunately, the demand for the identification of these proteins remains unmet. To overcome this bottleneck, we combined several strategies to identify the proteins detected via MALDI profiling including on-tissue protein extraction using hexafluoroIsopropanol (1,1,1,3,3,3-hexafluoro-2-propanol, HFIP) coupled with two-dimensional cetyl trimethylammonium bromide/sodium dodecyl sulfate–polyacrylamide gel electrophoresis (2D CTAB/SDS-PAGE) for separation followed by trypsin digestion and MALDI-MS analyses for identification. This strategy was compared with an on-tissue bottom-up strategy that we previously developed. The data reflect the complementarity of the approaches. An increase in the number of specific proteins identified has been established. This approach demonstrates the potential of adapted extraction procedures and the combination of parallel identification approaches for personalized medicine applications. The anatomical context provides important insight into identifying biomarkers and may be considered a first step for tissue-based biomarker research, as well as the extemporaneous examination of biopsies during surgery. PMID:24841221

Bioactivity of Malva Sylvestris L., a Medicinal Plant from Iran

PubMed Central

Razavi, Seyed Mehdi; Zarrini, Gholamreza; Molavi, Ghader; Ghasemi, Ghader

2011-01-01

Objective(s) Malva sylvestris L. (Malvaceae), an annual plant, has been already commonly used as a medicinal plant in Iran. In the present work, we evaluate some bioactivities of the plant extracts. Materials and Methods The aired-dried plant flowers and leaves were extracted by soxhlet apparatus with n-hexane, dichloromethane and methanol. The antimicrobial, cytotoxic, and phytotoxic of the plant extracts were evaluated using disk diffusion method, MTT, and Lettuce assays, respectively. Results Both flowers and leaves of M. sylvestris methanol extracts exhibited strong antibacterial effects against Erwinia carotovora, a plant pathogen, with MIC value of 128 and 256 µg/ml, respectively. The flowers extract also showed high antibacterial effects against some human pathogen bacteria strains such as Staphylococcus aureus, Streptococcus agalactiae, Entrococcus faecalis, with MIC value of 192, 200 and 256 µg/ml, respectively. The plant methanol extracts had relatively high cytotoxic activity against MacCoy cell line. Conclusion We concluded that Malva sylvestris can be candidated as an antiseptic, a chemopreventive or a chemotherapeutic agent. PMID:23493458

Antibacterial properties of some plants used in Mexican traditional medicine for the treatment of gastrointestinal disorders.

PubMed

Alanís, A D; Calzada, F; Cervantes, J A; Torres, J; Ceballos, G M

2005-08-22

Antibacterial properties of aqueous and methanolic extracts of 26 medicinal plants used in Mexico to treat gastrointestinal disorders were tested against eight different species of enteropathogens: two Escherichia coli species; two Shigella sonnei species; two Shigella flexneri species; and two Salmonella sp. species. The results showed that all crude extracts exhibited antibacterial activity, at least against one of the microorganisms tested, at concentrations of 8 mg/mL or lower. The extracts from Caesalpinia pulcherria, Chiranthodendron pentadactylon, Cocos nucifera, Geranium mexicanum (aerial parts and roots), Hippocratea excelsa, and Punica granatum possessed strong antibacterial activity against most of the pathogens tested. In general, methanolic extracts were more active than aqueous extracts. Their activity was higher than chloramphenicol but did not exceed that of trimethoprim. Shigella sonnei species showed the highest susceptibility to both extracts. This is the first evaluation of these plants against bacterial pathogen isolates, which cause diarrhea and dysentery in Mexican population.

Verification of biological activity of irradiated Sopoongsan, an oriental medicinal prescription, for industrial application of functional cosmetic material

NASA Astrophysics Data System (ADS)

Lee, Jin-Young; Park, Tae-Soon; Ho Son, Jun; Jo, Cheorun; Woo Byun, Myung; Jeun An, Bong

2007-11-01

Sopoongsan is an oriental medicinal prescription including 12 medicinal herbs. Sopoongsan is known to have anti-inflammatory, anti-microbial, anti-allergic, and anti-cancer effects on human skin. To use Sopoongsan extract for functional cosmetic composition, its dark color should be brighter for seeking consumer demand, clear products, without any adverse change in its function. Irradiation with doses 0, 5, 10, and 20 kGy was applied to improve color of ethanol- or water-extracted Sopoongsan and also superoxide dismutase (SOD), xanthine oxidase (XO), melanoma cell growth inhibition, and anti-microbial activity was investigated. Generally, ethanol extract was better than water extract in function and irradiation up to 20 kGy did not change any functional effect. Especially, the inhibition of melanin deposition on skin measured by inhibition of B16F10 (melanoma) cell growth was as high as arbutin, commercially available product, when the ethanol-extracted Sopoongsan was irradiated for 20 kGy. Results showed that when irradiation technology is used, the limitation of addition amount of natural materials for food or cosmetic composition caused by color problem can be decreased significantly with time saving and cost benefit compared to conventional color removal process. Therefore, irradiation would be one of the good methods to pose an additional value for related industry.

[Antiinflammatory activity of extracts and fractions obtained from Physalis peruviana L. calyces].

PubMed

Franco, Luis A; Matiz, Germán E; Calle, Jairo; Pinzón, Roberto; Ospina, Luis F

2007-03-01

Cape gooseberry calyces (Physalis peruviana) have been used in folk medicine for their medicinal properties including anticancer, antimycobacterial, antipyretic, diuretic, immunomodulatory and antiinflammatory properties. The antiinflammatory effect was evaluated for extracts and fractions obtained from Physalis peruviana calyces in a mice model of acute inflammation. The fractions responsible for antiinflammatory activity were extracted for possible identification. The Physalis peruviana calyces were extracted by percolation with organic solvents. The primary hydroalcoholic fraction was purified by column chromatography. The antiinflammatory effect of extracts and fractions was evaluated using the 12-O-tetradecanoylphorbol-13-acetate-induced mouse model of ear edema. Thirty-eight secondary fractions were obtained by column chromatography of primary hydroalcoholic fraction. Six fractions, evaluated in 12-O-tetradecanoylphorbol-13-acetate-induced inflammation assay, showed significant antiinflammatory activity (p<0.05). The major fraction, Pp-D28-LF, showed a significant dose-dependent response at doses over 250 microg/ear. The antiinflammatory activity attributed to Physalis peruviana calyces was confirmed and validated its use in folk medicine. Fractions responsible for the antiinflammatory action were identified and seem promising for phytomedicinal development. Further studies are needed to isolate and identify the active constituents of these fractions as well as to ascertain the mechanisms involved in the antiinflammatory effect.

The effect of filler addition and oven temperature to the antioxidant quality in the drying of Physalis angulata fruit extract obtained by subcritical water extraction

NASA Astrophysics Data System (ADS)

Susanti, R. F.; Christianto, G.

2016-01-01

Physalis angulata or ceplukan is medicinal herb, which grows naturally in Indonesia. It has been used in traditional medicine to treat several diseases. It is also reported to have antimycobacterial, antileukemic, antipyretic. In this research, Pysalis angulata fruit was investigated for its antioxidant capacity. In order to avoid the toxic organic solvent commonly used in conventional extraction, subcritical water extraction method was used. During drying, filler which is inert was added to the extract. It can absorb water and change the oily and sticky form of extract to powder form. The effects of filler types, concentrations and drying temperatures were investigated to the antioxidant quality covering total phenol, flavonoid and antioxidant activity. The results showed that total phenol, flavonoid and antioxidant activity were improved by addition of filler because the drying time was shorter compared to extract without filler. Filler absorbs water and protects extract from exposure to heat during drying. The combination between high temperature and shorter drying time are beneficial to protect the antioxidant in extract. The type of fillers investigation showed that aerosil gave better performance compared to Microcrystalline Celullose (MCC).

In vitro antifugal activity of medicinal plant extract against Fusarium oxysporum f. sp. lycopersici race 3 the causal agent of tomato wilt.

PubMed

Isaac, G S; Abu-Tahon, M A

2014-03-01

Medicinal plant extracts of five plants; Adhatoda vasica, Eucalyptus globulus, Lantana camara, Nerium oleander and Ocimum basilicum collected from Cairo, Egypt were evaluated against Fusarium oxysporum f. sp. lycopersici race 3 in vitro conditions using water and certain organic solvents. The results revealed that cold distilled water extracts of O. basilicum and E. globulus were the most effective ones for inhibiting the growth of F. oxysporum f. sp. lycopersici. Butanolic and ethanolic extracts of the tested plants inhibited the pathogen growth to a higher extent than water extracts. Butanolic extract of O. basilicum completely inhibited the growth of F. oxysporum f. sp. lycopersici at concentrations 1.5 and 2.0% (v/v). Butanolic extracts (2.0%) of tested plants had a strong inhibitory effect on hydrolytic enzymes; β-glucosidase, pectin lyase and protease of F. oxysporum f. sp. lycopersici. This study has confirmed that the application of plant extracts, especially from O. basilicum for controlling F. oxysporum f. sp. lycopersici is environmentally safe, cost effective and does not disturb ecological balance. Investigations are in progress to test the efficacy of O. basilicum extract under in vivo conditions.

Visualization of DNA in highly processed botanical materials.

PubMed

Lu, Zhengfei; Rubinsky, Maria; Babajanian, Silva; Zhang, Yanjun; Chang, Peter; Swanson, Gary

2018-04-15

DNA-based methods have been gaining recognition as a tool for botanical authentication in herbal medicine; however, their application in processed botanical materials is challenging due to the low quality and quantity of DNA left after extensive manufacturing processes. The low amount of DNA recovered from processed materials, especially extracts, is "invisible" by current technology, which has casted doubt on the presence of amplifiable botanical DNA. A method using adapter-ligation and PCR amplification was successfully applied to visualize the "invisible" DNA in botanical extracts. The size of the "invisible" DNA fragments in botanical extracts was around 20-220 bp compared to fragments of around 600 bp for the more easily visualized DNA in botanical powders. This technique is the first to allow characterization and visualization of small fragments of DNA in processed botanical materials and will provide key information to guide the development of appropriate DNA-based botanical authentication methods in the future. Copyright © 2017 Elsevier Ltd. All rights reserved.

Composition of herba pogostemonis water extract and protection of infected mice against salmonella typhimurium-induced liver damage and mortality by stimulation of innate immune cells

USDA-ARS?s Scientific Manuscript database

We investigated the composition and antibacterial effects of a lyophilized hot water extract of the medicinal herb Herba Pogostemonis (HP) against murine salmonellosis. The extract contained 31 compounds characterized by GC/MS. Although the extract showed significant inhibitory activity on Salmonell...

Study on Medicinal Plant Active Substances Extraction and Antibacterial Activity of Houttuynia Cordata

NASA Astrophysics Data System (ADS)

Yubin, Ji; Junjun, Yang; Miao, Yu; Yue, Cao; Shizhen, Guo; Anna, Qiao

2017-12-01

This study was about the effective component extraction from Houttuynia cordata by steam distillation and antibacterial effect on Escherichia coli, Staphylococcus aureus and Bacillus subtilis. The extraction of Herba Houttuyniae extract of Escherichia coli, Staphylococcus aureus and Bacillus subtilis were certain inhibitory effect of, which inhibitory effect on Staphylococcus aureus the most obvious.

Optimized extraction of polysaccharides from corn silk by pulsed electric field and response surface quadratic design.

PubMed

Zhao, Wenzhu; Yu, Zhipeng; Liu, Jingbo; Yu, Yiding; Yin, Yongguang; Lin, Songyi; Chen, Feng

2011-09-01

Corn silk is a traditional Chinese herbal medicine, which has been widely used for treatment of some diseases. In this study the effects of pulsed electric field on the extraction of polysaccharides from corn silk were investigated. Polysaccharides in corn silk were extracted by pulsed electric field and optimized by response surface methodology (RSM), based on a Box-Behnken design (BBD). Three independent variables, including electric field intensity (kV cm(-1) ), ratio of liquid to raw material and pulse duration (µs), were investigated. The experimental data were fitted to a second-order polynomial equation and also profiled into the corresponding 3-D contour plots. Optimal extraction conditions were as follows: electric field intensity 30 kV cm(-1) , ratio of liquid to raw material 50, and pulse duration 6 µs. Under these condition, the experimental yield of extracted polysaccharides was 7.31% ± 0.15%, matching well with the predicted value. The results showed that a pulsed electric field could be applied to extract value-added products from foods and/or agricultural matrix. Copyright © 2011 Society of Chemical Industry.

Dandelion Extracts Protect Human Skin Fibroblasts from UVB Damage and Cellular Senescence

PubMed Central

Yang, Yafan; Li, Shuangshuang

2015-01-01

Ultraviolet (UV) irradiation causes damage in skin by generating excessive reactive oxygen species (ROS) and induction of matrix metalloproteinases (MMPs), leading to skin photoageing. Dandelion extracts have long been used for traditional Chinese medicine and native American medicine to treat cancers, hepatitis, and digestive diseases; however, less is known on the effects of dandelion extracts in skin photoageing. Here we found that dandelion leaf and flower extracts significantly protect UVB irradiation-inhibited cell viability when added before UVB irradiation or promptly after irradiation. Dandelion leaf and flower extracts inhibited UVB irradiation-stimulated MMP activity and ROS generation. Dandelion root extracts showed less action on protecting HDFs from UVB irradiation-induced MMP activity, ROS generation, and cell death. Furthermore, dandelion leaf and flower but not root extracts stimulated glutathione generation and glutathione reductase mRNA expression in the presence or absence of UVB irradiation. We also found that dandelion leaf and flower extracts help absorb UVB irradiation. In addition, dandelion extracts significantly protected HDFs from H2O2-induced cellular senescence. In conclusion, dandelion extracts especially leaf and flower extracts are potent protective agents against UVB damage and H2O2-induced cellular senescence in HDFs by suppressing ROS generation and MMP activities and helping UVB absorption. PMID:26576225

[Application of rapid PCR to authenticate medicinal snakes].

PubMed

Chen, Kang; Jiang, Chao; Yuan, Yuan; Huang, Lu-Qi; Li, Man

2014-10-01

To obtained an accurate, rapid and efficient method for authenticate medicinal snakes listed in Chinese Pharmacopoeia (Zaocysd humnades, Bungarus multicinctus, Agkistrodon acutus), a rapid PCR method for authenticate snakes and its adulterants was established based on the classic molecular authentication methods. DNA was extracted by alkaline lysis and the specific primers were amplified by two-steps PCR amplification method. The denatured and annealing temperature and cycle numbers were optimized. When 100 x SYBR Green I was added in the PCR product, strong green fluorescence was visualized under 365 nm UV whereas adulterants without. The whole process can complete in 30-45 minutes. The established method provides the technical support for authentication of the snakes on field.

Phenolic extracts of Rubus ulmifolius Schott flowers: characterization, microencapsulation and incorporation into yogurts as nutraceutical sources.

PubMed

Martins, Ana; Barros, Lillian; Carvalho, Ana Maria; Santos-Buelga, Celestino; Fernandes, Isabel P; Barreiro, Filomena; Ferreira, Isabel C F R

2014-06-01

Rubus ulmifolius Schott (Rosaceae), known as wild blackberry, is a perennial shrub found in wild and cultivated habitats in Europe, Asia and North Africa. Traditionally, it is used for homemade remedies because of its medicinal properties, including antioxidant activity. In the present work, phenolic extracts of R. ulmifolius flower buds obtained by decoction and hydroalcoholic extraction were chemically and biologically characterized. Several phenolic compounds were identified in both decoction and hydroalcoholic extracts of flowers, ellagitannin derivatives being the most abundant ones, namely the sanguiin H-10 isomer and lambertianin. Additionally, comparing with the decoction form, the hydroalcoholic extract presented both higher phenolic content and antioxidant activity. The hydroalcoholic extract was thereafter microencapsulated in an alginate-based matrix and incorporated into a yogurt to achieve antioxidant benefits. In what concerns the performed incorporation tests, the obtained results pointed out that, among the tested samples, the yoghurt containing the microencapsulated extract presented a slightly higher antioxidant activity, and that both forms (free and microencapsulated extracts) gave rise to products with higher activity than the control. In conclusion, this study demonstrated the antioxidant potential of the R. ulmifolius hydroalcoholic extract and the effectiveness of the microencapsulation technique used for its preservation, thus opening new prospects for the exploitation of these natural phenolic extracts in food applications.

Authentication of medicinal herbs using PCR-amplified ITS2 with specific primers.

PubMed

Chiou, Shu-Jiau; Yen, Jui-Hung; Fang, Cheng-Li; Chen, Hui-Ling; Lin, Tsai-Yun

2007-10-01

Different parts of medicinal herbs have long been used as traditional Chinese drugs for treating many diseases, whereas materials of similar morphology and chemical fingerprints are often misidentified. Analyses of sequence variations in the nuclear ribosomal DNA (rDNA) internal transcribed spacer (ITS) have become a valid method for authentication of medicinal herbs at the intergenic and interspecific levels. DNA extracted from processed materials is usually severely degraded or contaminated by microorganisms, thus generates no or unexpected PCR products. The goal of this study is to apply the ITS fragments selectively amplified with two designed primer sets for efficient and precise authentication of medicinal herbs. The designed primers led to an accurate PCR product of the specific region in ITS2, which was confirmed with DNA extracted from 55 processed medicinal herbs belonging to 48 families. Moreover, the selectively amplified ITS2 authenticated five sets of easily confusable Chinese herbal materials. The designed primers were proven to be suitable for a broad application in the authentication of herbal materials.

Comparison of pharmacokinetic profiles of Terminalia phenolics after intragastric administration of the aqueous extracts of the fruit of Terminalia chebula and a Mongolian compound medicine-Gurigumu-7.

PubMed

Gao, Jie; Ajala, Olusegun S; Wang, Chun-Ying; Xu, Hai-Yan; Yao, Jia-Huan; Zhang, Hai-Peng; Jukov, Azzaya; Ma, Chao-Mei

2016-06-05

The dried fruit of Terminalia chebula (fructus chebulae) is an important Traditional Medicine used for intestinal and hepatic detoxification. Gurigumu-7 which is made of fructus chebulae and 6 other traditional medicines is one of the most frequently used compound Mongolian and Tibet medicines for liver diseases. Terminalia phenolics are considered as the bioactive constituents of fructus chebulae and consequently of Gurigumu-7. To compare the pharmacokinetic profiles of Terminalia phenolics after intragastric administration of the aqueous extracts of fructus chebulae and Gurigumu-7 and to evaluate the possible influence of intestinal bacterial metabolism on these pharmacokinetic profiles. An ultra performance liquid chromatography with triple quadrupole mass spectrometry method was established and validated for simultaneously determining the pharmacokinetic profiles of seven Terminalia phenolics after intragastric administration of pure compounds, fructus chebulae extract, and Gurigumu-7 extract. In vitro rat fecal lysates experiments were carried out to explore the metabolic discrepancy between fructus chebulae and Gurigumu-7. Seven Terminalia phenolics were detected in rat plasma after intragastric administration of the aqueous extracts of fructus chebulae and Gurigumu-7. Administration of Gurigumu-7 could promote the absorption and increase the Cmax and AUC values of these phenolic constituents compared to fructus chebulae administration. The fecal lysates studies showed that the Terminalia phenolics in Gurigumu-7 were less rapidly bio-transformed than those in fructus chebulae. This may be a contributing factor to the pharmacokinetic discrepancy between the phenolics in fructus chebulae and Gurigumu-7. Administration of Gurigumu-7 could increase the absorption of Terminalia phenolics through slowing down the intestinal bacteria metabolism. These results provide, in part, an in vivo rationale for the formulation of the traditional Mongolia / Tibet medicine, Gurigumu-7. Copyright © 2016. Published by Elsevier Ireland Ltd.

FERN Ethnomedicinal Plant Database: Exploring Fern Ethnomedicinal Plants Knowledge for Computational Drug Discovery.

PubMed

Thakar, Sambhaji B; Ghorpade, Pradnya N; Kale, Manisha V; Sonawane, Kailas D

2015-01-01

Fern plants are known for their ethnomedicinal applications. Huge amount of fern medicinal plants information is scattered in the form of text. Hence, database development would be an appropriate endeavor to cope with the situation. So by looking at the importance of medicinally useful fern plants, we developed a web based database which contains information about several group of ferns, their medicinal uses, chemical constituents as well as protein/enzyme sequences isolated from different fern plants. Fern ethnomedicinal plant database is an all-embracing, content management web-based database system, used to retrieve collection of factual knowledge related to the ethnomedicinal fern species. Most of the protein/enzyme sequences have been extracted from NCBI Protein sequence database. The fern species, family name, identification, taxonomy ID from NCBI, geographical occurrence, trial for, plant parts used, ethnomedicinal importance, morphological characteristics, collected from various scientific literatures and journals available in the text form. NCBI's BLAST, InterPro, phylogeny, Clustal W web source has also been provided for the future comparative studies. So users can get information related to fern plants and their medicinal applications at one place. This Fern ethnomedicinal plant database includes information of 100 fern medicinal species. This web based database would be an advantageous to derive information specifically for computational drug discovery, botanists or botanical interested persons, pharmacologists, researchers, biochemists, plant biotechnologists, ayurvedic practitioners, doctors/pharmacists, traditional medicinal users, farmers, agricultural students and teachers from universities as well as colleges and finally fern plant lovers. This effort would be useful to provide essential knowledge for the users about the adventitious applications for drug discovery, applications, conservation of fern species around the world and finally to create social awareness.

Evaluation of anthelmintic activity and in silico PASS assisted prediction of Cordia dichotoma (Forst.) root extract.

PubMed

Jamkhande, Prasad G; Barde, Sonal R

2014-01-01

Worm infection and associated complications are severe problems that afflict a large population worldwide. Failure of synthetic drugs in worm infections because of drug resistance has made alternative drug therapy desirable. Cordia dichotoma (Forst.) is an ethnomedicinal plant which is rich in several secondary metabolites. Traditionally, the plant has been claimed to have high medicinal properties including antimicrobial activity and cytotoxicity. The study begun with an aim to explore plant-based natural anthelmintic agents against Pheretima posthuma, an Indian earthworm. Methanol extract of the drug was obtained by successive soxhlet extraction. The extract was tested for different phytochemicals. Worms were exposed to 10 mg/ml, 25 mg/ml, 50 mg/ml, and 75 mg/ml concentrations of extract and standard drug, albendazole. A software-based tool, prediction of activity spectra for substances was used to estimate anthelmintic efficacy of plant metabolites. The phytochemical analysis revealed presence of alkaloids, tannins, glycosides, saponins, flavonoids, and phenols. The extract showed dose-dependent effects, affecting worm motility, viability, and mortality. It was also found that the biological activity spectrum of the plant phytoconstituents such as octacosanol, lupeol, caffeic acid, and hentricontanol were >0.5 (probable activity > 0.5). The findings of the present work suggest that the extract of C. dichotoma significantly interferes with motility pattern of P. posthuma. The paralysis and mortality of P. posthuma might be due to the combined effects different phytoconstituents. The extract of C. dichotoma promises natural sources to control worm infection.

Interactions of 172 plant extracts with human organic anion transporter 1 (SLC22A6) and 3 (SLC22A8): a study on herb-drug interactions

PubMed Central

Lu, Hang; Lu, Zhiqiang; Li, Xue; Li, Gentao; Qiao, Yilin

2017-01-01

Background Herb-drug interactions (HDIs) resulting from concomitant use of herbal products with clinical drugs may cause adverse reactions. Organic anion transporter 1 (OAT1) and 3 (OAT3) are highly expressed in the kidney and play a key role in the renal elimination of substrate drugs. So far, little is known about the herbal extracts that could modulate OAT1 and OAT3 activities. Methods HEK293 cells stably expressing human OAT1 (HEK-OAT1) and OAT3 (HEK-OAT3) were established and characterized. One hundred seventy-two extracts from 37 medicinal and economic plants were prepared. An initial concentration of 5 µg/ml for each extract was used to evaluate their effects on 6-carboxylfluorescein (6-CF) uptake in HEK-OAT1 and HEK-OAT3 cells. Concentration-dependent inhibition studies were conducted for those extracts with more than 50% inhibition to OAT1 and OAT3. The extract of Juncus effusus, a well-known traditional Chinese medicine, was assessed for its effect on the in vivo pharmacokinetic parameters of furosemide, a diuretic drug which is a known substrate of both OAT1 and OAT3. Results More than 30% of the plant extracts at the concentration of 5 µg/ml showed strong inhibitory effect on the 6-CF uptake mediated by OAT1 (61 extracts) and OAT3 (55 extracts). Among them, three extracts for OAT1 and fourteen extracts for OAT3 were identified as strong inhibitors with IC50 values being <5 µg/ml. Juncus effusus showed a strong inhibition to OAT3 in vitro, and markedly altered the in vivo pharmacokinetic parameters of furosemide in rats. Conclusion The present study identified the potential interactions of medicinal and economic plants with human OAT1 and OAT3, which is helpful to predict and to avoid potential OAT1- and OAT3-mediated HDIs. PMID:28560096

Antibacterial activity of crude extracts of prasaprohyai formula and its components against pathogenic bacteria.

PubMed

Sattaponpan, Chisanucha; Kondo, Sumalee

2011-12-01

Prasaprohyai formula is a Thai Traditional Medicine which has been used for reducing feverish in child. Fever is a symptom resulting from various infections and diseases. The major cause of fever is bacterial and viral infections. The Prasaprohyai formula and its components potentially have biological activities including antipyretic and antimicrobial activities. It is in a hope to develop the formula and its components for an alternative medicine of infectious diseases. To study antibacterial activity of Prasaprohyai formula and its components against pathogenic bacteria. Prasaprohyai formula and its components were extracted by different methods, A: maceration with 95% ethanol followed by evaporation (ET), B: ET followed by freeze drying (EF) and C: water distillation (VO). All extracts were tested against clinical isolates from Thammasat University Hospital, Staphylococcus aureus ATCC 25923 and Escherichia coli ATCC 25922. Disk diffusion and broth dilution methods were performed. Crude extracts of ET had higher yield of extraction than other methods. The results showed that the crude extract from different methods of Syzygium aromaticum (Linn) Merr & Perry (Flower) was effective against all bacterial strains with the inhibition zone ranging from 9 to 19 mm. The VO extract of Prasaprohyai formula showed antibacterial activity against most of the pathogenic bacteria in the present study. The activity against Streptococcus pyogenes was found in the VO extract of some components. The ET extracts of Lepidium sativum Linn, Myristica fragrans Houtt (seed) and Myristica fragrans Houtt (aril) had no antibacterial activity against all microorganism. However the EF extracts of this formula and some components were able to mostly inhibit Gram positive bacteria. The results indicated that Prasaprohyai formula and its components were able to inhibit the growth of both Gram positive and Gram negative bacteria including multiresistant strains. The volatile oil extracts seemed to play an important role in antimicrobial activities. The development of Prasaprohyai formula for alternative medicine will be approached in future.

[THE INFLUENCE OF LEU-ENKEPHALIN AND MEDICAL PLANTS ON MOTOR ACTIVITY OF STOMACH IN DOGS].

PubMed

Vymjatnina, Z K; Prosekina, E Y; Tomova, T A

2015-01-01

The aim of the real research was a study influence of leu-enkephalin and extracts from the leaves of goose-grass large, of burdock of felted and root of chicory on the motor function of stomach for dogs. The study was carried out on 6 outbred dogs-males, by mass 14-17 kg, with the fistula of stomach by Basov. A leu-enkephalin ("Vector", Russia) was entered intravenously in a dose 7 mcg/kg. The corresponding plant-based preparations entered perorally during 10-14 days to beginning of experiments, on an empty stomach, in a volume a no more than 20 ml. Experiments put in a morning clock, in 16-18 hours after eating, after the careful washing of stomach. For 30 mines to the record of motive activity of stomach an animal was enter a peptide or gave a corresponding extract as water or spirit infusion. At the choice of doses of vegetable preparations came from the before obtained data about the antiulcerous action of the used plants. The conduct of peptide rendered considerable stimulant influence on motor activity of stomach, that was expressed in the increase of period of work and increase of force of reductions especially tonic. All used plants preparations rendered modulating influence on motive activity of stomach. Changes consisted in strengthening of tonic and oppressing of phase component. The most considerable decline of amount of phase reductions caused application of extract of goose-grass. Not only an amount but also force of phase reductions diminished thus. An extract from the root of chicory less considerably reduced the arnount of Phase reJuctions, but here substantially increased their force. All used herbal medicines stimulated tonic activity. Thus, peptide and all studied herbal medicines stimulated motion activity of the stomach that could cause acceleration of evacuation of food to duodenum. Such effect should be considered while choosing the medicine for correction of stomach functional activity.

Antiplasmodial activity of extracts of Tridax procumbens and Phyllanthus amarus in in vitro Plasmodium falciparum culture systems.

PubMed

Appiah-Opong, R; Nyarko, A K; Dodoo, D; Gyang, F N; Koram, K A; Ayisi, N K

2011-12-01

Aqueous extracts of Tridax procumbens (TP) (Compositae) and Phyllanthus amarus (PA) (Euphorbiaceae) are used in traditional medicine in Ghana to treat malaria. Previous studies have demonstrated the anti-trypanosoma, anti-bacterial and anti-HIV effects of TP and PA. To assess the antiplasmodial activity of extracts of TP and PA. Aqueous extracts of TP and PA were prepared. A portion of each was freeze-dried and the remaining extracted sequentially with ethyl acetate and chloroform. Ethanolic extracts were also prepared. The antiplasmodial activity of the extracts was assessed with the 3H-hypoxanthine assay using chloroquine-resistant (Dd2) Plasmodium falciparum parasites. Chloroquine was used as the reference drug. The modified tetrazolium-based colorimetric assay was also used to evaluate the red blood cell (RBC)-protective/antiplasmodial activities and cytotoxicities of the extracts. Results showed that TP and PA have antiplasmodial activities. The aqueous and ethanolic extracts of PA were the most active, yielding EC50 values of 34.9 µg/ml and 31.2 µg/ml, respectively in the tetrazolium-based assay. The TP and PA produced and IC50 values of 24.8 µg/ml and 11.7 µg/ml, respectively in the hypoxanthine assay. Protection of human RBCs against P. falciparum damage by the extracts highly correlated with their antiplasmodial activities. None of the extracts, within the concentration range (1.9-500 µg/ml) studied produced any overt toxicity to human RBCs. The results indicate that both PA and TP have activities against chloroquine-resistant P. falciparum (Dd2) parasites. The antiplasmodial principles extracted into water and ethanol but not chloroform or ethyl acetate.

Application of Ultra-performance Liquid Chromatography with Time-of-Flight Mass Spectrometry for the Rapid Analysis of Constituents and Metabolites from the Extracts of Acanthopanax senticosus Harms Leaf

PubMed Central

Zhang, Yingzhi; Zhang, Aihua; Zhang, Ying; Sun, Hui; Meng, Xiangcai; Yan, Guangli; Wang, Xijun

2016-01-01

Acanthopanax senticosus (Rupr and Maxim) Harms (AS), a member of Araliaceae family, is a typical folk medicinal herb, which is widely distributed in the Northeastern part of China. Due to lack of this resource caused by the extensive use of its root, this work studied the chemical constituents of leaves of this plant with the purpose of looking for an alternative resource. In this work, a fast and optimized ultra-performance liquid chromatography method with quadrupole time-of-flight mass spectrometry (UPLC-QTOF-MS) has been developed for the analysis of constituents in leaves extracts. A total of 131 compounds were identified or tentatively characterized including triterpenoid saponins, phenols, flavonoids, lignans, coumarins, polysaccharides, and other compounds based on their fragmentation behaviors. Besides, a total of 21 metabolites were identified in serum in rats after oral administration, among which 12 prototypes and 9 metabolites through the metabolic pathways of reduction, methylation, sulfate conjugation, sulfoxide to thioether and deglycosylation. The coupling of UPLC-QTOF-MS led to the in-depth characterization of the leaves extracts of AS both in vitro and in vivo on the basis of retention time, mass accuracy, and tandem MS/MS spectra. It concluded that this analytical tool was very valuable in the study of complex compounds in medicinal herb. HIGHLIGHT OF PAPER A fast UPLC-QTOF-MS has been developed for analysis of constituents in leaves extractsA total of 131 compounds were identified in leaves extractsA total of 21 metabolites including 12 prototypes and 9 metabolites were identified in vivo. SUMMARY Constituent’s analysis of Acanthopanax senticosus Harms leaf by ultra-performance liquid chromatography method with quadrupole time-of-flight mass spectrometry. Abbreviations used: AS: Acanthopanax senticosus (Rupr and Maxim) Harms, TCHM: Traditional Chinese herbal medicine, UPLC-QTOF-MS: Ultra-performance liquid chromatography method with time-of-flight mass spectrometry, MS/MS: Tandem mass spectrometry, PCA: Principal component analysis, PLS-DA: Partial least squared discriminant analysis, OPLS-DA: Orthogonal projection to latent structure-discriminant analysis. PMID:27076752

Study of anticancer and antibacterial activities of Foeniculum vulgare, Justicia adhatoda and Urtica dioica as natural curatives.

PubMed

Batool, R; Salahuddin, H; Mahmood, T; Ismail, M

2017-09-30

High-throughput technologies, such as synthetic biology and genomics have paved new paths for discovery and utility of medicinally beneficial plants. Bioactive molecules isolated from different plants have significantly higher biological activities. The present study was done to analyze antibacterial potential of some medicinal plants against multi drug resistant (MDR) pathogens and anticancer effect against MCF-7 cell line. Methanolic and ethanolic extracts were tested for their antibacterial activity by disc diffusion method against six MDR bacterial strains and for cytotoxicity evaluation by MTT assay. Ethanolic extracts of the three tested plants exhibited growth inhibitory effect against Klebsiella pneumonia, Serratia marcescens and Methicillin-resistant S. aureus. Pseudomonas aeruginosa was more resistant to all extracts as its growth was least inhibited by the extracts of all tested plants. Ethanol extract of Foeniculum vulgare exhibited significant inhibition of cancer cells proliferation. Methanol extract of Justicia adhatoda also showed considerable inhibition of cancer cells. Future studies must converge on detailed investigation of modes of action of extracts of tested plants.

Anti-inflammatory and antioxidant activities of extracts from Musa sapientum peel.

PubMed

Phuaklee, Pathompong; Ruangnoo, Srisopa; Itharat, Arunporn

2012-01-01

Many parts of Musa sapientum Linn. (Musaceae) are used in Thai traditional medicine as drugs, food supplements and cosmetics. The banana peel is used as an astringent in foot care, the unripe fruit is used to treat diarrhea and, the ripe fruit is used as tonic. To evaluate anti-inflammatory and antioxidant activities of banana peel extracts obtained from different extraction methods and to determine their total phenolic content. Four extraction methods were used to extract unripe and ripe peels. Nitric oxide inhibitory and DPPH scavenging assays were used to evaluate anti-inflammatory and antioxidant activities, respectively. Folin-Ciocalteu's reagent was used to determine total phenolic content. The water extract of fresh ripe peel exhibited the most potent NO inhibitory activity (IC50 = 6.68 +/- 0.34 microg/ml), but apparently exhibited no antioxidant activity. The decoction extract of fresh unripe peel exhibited strong antioxidant activity as well as had the highest total phenolic compound. The antioxidant activity exhibited a correlation with the total phenolic content. This study supports the use of Musa sapientum peel in Thai Traditional Medicine for treatment of inflammatory-related diseases.

Antimycobacterial activity of Juglans regia, Juglans mollis, Carya illinoensis and Bocconia frutescens.

PubMed

Cruz-Vega, Delia Elva; Verde-Star, María Julia; Salinas-González, Noé; Rosales-Hernández, Bibiana; Estrada-García, Iris; Mendez-Aragón, Patricia; Carranza-Rosales, Pilar; González-Garza, María Teresa; Castro-Garza, Jorge

2008-04-01

Mycobacterium tuberculosis is a serious worldwide health threat, killing almost 2 million people per year. Alternative antimycobacterial drugs are urgently needed; studies have shown that medicinal plants traditionally used to treat respiratory diseases are a potential source of compounds to treat tuberculosis. This paper studied the antimycobacterial activity of 28 extracts from four different plant species that have been used in traditional Mexican medicine to treat tuberculosis. Bark and leaf crude extracts of Juglans regia L., Juglans mollis Engelm., Carya illinoensis (Wangenh) K. Koch and Bocconia frutescens showed in vitro anti-M. tuberculosis activity. Hexane bark extracts from C. illinoensis, J. mollis and J. regia were the most active with a minimal inhibitory concentration (MIC) of 31, 50 and 100 microg/mL, respectively. Ethanol bark extracts from C. illinoensis and J. mollis showed activity at 100 and 125 microg/mL, respectively. Leaf extracts had the lowest activity. Methanol and hexane leaves extracts from B. frutescens had a MIC of 125 microg/mL. None of the aqueous extracts showed antimycobacterial activity. (c) 2008 John Wiley & Sons, Ltd.

Antimicrobial and Anti-Inflammatory Activities of Pterygota macrocarpa and Cola gigantea (Sterculiaceae)

PubMed Central

Agyare, Christian; Koffuor, George Asumeng; Boamah, Vivian Etsiapa; Adu, Francis; Mensah, Kwesi Boadu; Adu-Amoah, Louis

2012-01-01

Pterygota macrocarpa and Cola gigantea are African medicinal plants used in traditional medicine for the treatment of sores, skin infections, and other inflammatory conditions including pains. This study therefore aims at investigating the antimicrobial properties of ethanol leaf and stem bark extracts of P. macrocarpa and C. gigantea using the agar diffusion and the micro-dilution techniques and also determining the anti-inflammatory properties of the extracts of these plants in carrageenan-induced foot edema in seven-day old chicks. The minimum inhibitory concentration of both ethanol leaf and bark extracts of P. macrocarpa against the test organisms was from 0.125 to 2.55 mg/mL and that of C. gigantea extracts was 0.125 to 2.75 mg/mL. Extracts with concentration of 50 mg/mL were most active against the test organisms according to the agar diffusion method. All the extracts of P. macrocarpa and C. gigantea at 30, 100, and 300 mg/kg body weight except ethanol leaf extract of C. gigantea exhibited significant anti-inflammatory effects (P ≤ 0.001). PMID:22690251

Phytochemical Characteristics, Free Radical Scavenging Activities, and Neuroprotection of Five Medicinal Plant Extracts

PubMed Central

Chang, Chia Lin; Lin, Che San; Lai, Guia Hung

2012-01-01

The objective of this study was to determine phytochemical characteristics, chemiluminescence antioxidant capacities, and neuroprotective effects on PC12 cells for methanol extracts of Spatholobus suberectus, Uncaria rhynchophylla, Alpinia officinarum, Drynaria fortunei, and Crataegus pinnatifida. The C. pinnatifida extract (CPE) afforded the greatest yield and total phenolic content. The S. suberectus extract (SSE) yielded the greatest total flavonoid content. The U. rhynchophylla extract (URE) produced the greatest total tannin content, and the A. officinarum extract (AOE) produced the greatest total triterpenoid content. The D. fortunei extract, assayed using horseradish peroxidase-luminol-hydrogen peroxide (H2O2), and AOE using pyrogallol-luminol assay each exhibited better antioxidant activity than the L-ascorbic acid and 6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid did. The CPE, SSE, and URE presented neurogrowth effects and neuroprotective activities on H2O2-induced PC12 cell death at 0.5–5.0 μg/mL. The CPE represents a promising medicinal plant source for the treatment of H2O2-induced neurodegenerative disease, because of its useful phytochemical characteristics. PMID:21845204

Actovegin--Cutting-edge sports medicine or "voodoo" remedy?

PubMed

Lee, Paul; Kwan, Alvin; Nokes, Len

2011-07-01

Actovegin is a deproteinized serum extract of bovine origin, and in recent years it has been used widely in treating sport injuries with many anecdotal reports of success. However, the use of Actovegin in sport medicine has caused a substantial amount of controversy, especially concerning its supposed oxygen-enhancing capacity and an anecdotal belief that its use can increase an athlete's performance. In 2009, a sports physician was arrested with this "performance-enhancing drug," while an editorial in a sports medicine journal strongly questioned the evidence base for using this drug for acute muscle injury. There is also a report that suggested that Actovegin might have induced anaphylactic shock in a cyclist. In this review, we have systematically examined the current evidence on Actovegin. Its mechanism of action, clinical evidence, legal status with sports governing bodies, and its potential role in sport injuries will be discussed.

Hepatitis Diagnosis Using Facial Color Image

NASA Astrophysics Data System (ADS)

Liu, Mingjia; Guo, Zhenhua

Facial color diagnosis is an important diagnostic method in traditional Chinese medicine (TCM). However, due to its qualitative, subjective and experi-ence-based nature, traditional facial color diagnosis has a very limited application in clinical medicine. To circumvent the subjective and qualitative problems of facial color diagnosis of Traditional Chinese Medicine, in this paper, we present a novel computer aided facial color diagnosis method (CAFCDM). The method has three parts: face Image Database, Image Preprocessing Module and Diagnosis Engine. Face Image Database is carried out on a group of 116 patients affected by 2 kinds of liver diseases and 29 healthy volunteers. The quantitative color feature is extracted from facial images by using popular digital image processing techni-ques. Then, KNN classifier is employed to model the relationship between the quantitative color feature and diseases. The results show that the method can properly identify three groups: healthy, severe hepatitis with jaundice and severe hepatitis without jaundice with accuracy higher than 73%.

Recovery of biomolecules from food wastes--a review.

PubMed

Baiano, Antonietta

2014-09-17

Food wastes are produced by a variety of sources, ranging from agricultural operations to household consumption. About 38% occurs during food processing. At present, the European Union legislation encourages the exploitation of co-products. This valorisation can be achieved through the extraction of high-value components such as proteins, polysaccharides, fibres, flavour compounds, and phytochemicals, which can be re-used as nutritionally and pharmacologically functional ingredients. Extraction can proceed according to solid-liquid extraction, Soxhlet extraction, pressurized fluid extraction, supercritical fluid extraction, ultrasound-assisted extraction, microwave-assisted extraction, pulsed electric field extraction, and enzyme-assisted extraction. Nevertheless, these techniques cannot be used indiscriminately and their choice depends on the type of biomolecules and matrix, the scale processing (laboratory or industrial), the ratio between production costs and economic values of the compounds to be extracted. The vegetable wastes include trimmings, peelings, stems, seeds, shells, bran, residues remaining after extraction of oil, starch, sugar, and juice. The animal-derived wastes include wastes from bred animals, wastes from seafood, wastes from dairy processing. The recovered biomolecules and by-products can be used to produce functional foods or as adjuvants in food processing or in medicinal and pharmaceutical preparations. This work is an overview of the type and amounts of food wastes; food waste legislation; conventional and novel techniques suitable for extracting biomolecules; food, medicinal and pharmaceutical uses of the recovered biomolecules and by-products, and future trends in these areas.

Green synthesis of silver nanoparticle and silver based chitosan bionanocomposite using stem extract of Saccharum officinarum and assessment of its antibacterial activity

NASA Astrophysics Data System (ADS)

Paulkumar, Kanniah; Gnanajobitha, Gnanadhas; Vanaja, Mahendran; Pavunraj, Manickam; Annadurai, Gurusamy

2017-09-01

Synthesis of nanoparticles and nanocomposites using green route is a major focus of modern nanotechnology. Herein we demonstrate the synthesis of silver nanoparticle and silver based chitosan bionanocomposite using the stem extract of Saccharum officinarum. The absorbance peak at 460 nm in the UV-Vis spectrum reveals the synthesis of silver nanoparticles using the stem extract of Saccharum officinarum. The size of the synthesized silver nanoparticle was in the range of 10-60 nm obtained from transmission electron microscope (TEM) analysis. The presence of silver nanoparticles on the chitosan suspension was identified by scanning electron microscope (SEM) and energy dispersive x-ray spectroscopy (EDS). The presence of possible functional group involved in the reduction of silver metal ions into silver nanoparticles was identified by Fourier transform infrared spectroscopy (FTIR) analysis. The antibacterial activity of the synthesized silver based chitosan bionanocomposite was evaluated against Bacillus subtilis (MTCC 3053), Klebsiella planticola (MTCC 2277), Streptococcus faecalis (ATCC 8043), Pseudomonas aeruginosa (ATCC 9027) and Escherichia coli (ATCC 8739). The antibacterial activity of silver based chitosan bionanocomposite has remarkable scope in medicine, food packaging, textile and pharmaceuticals.

Moringa oleifera's Nutritious Aqueous Leaf Extract Has Anticancerous Effects by Compromising Mitochondrial Viability in an ROS-Dependent Manner.

PubMed

Madi, Niveen; Dany, Mohammed; Abdoun, Salah; Usta, Julnar

2016-01-01

Moringa oleifera (MO) is an important dietary component for many populations in West Africa and the Indian subcontinent. In addition to its highly nutritious value, almost all parts of this plant have been widely used in folk medicine in curing infectious, cardiovascular, gastrointestinal, hepatic, and other diseases. Evidence-based research supported its versatile medicinal properties; however, more rigorous research is required to establish it in cancer therapy. As such, in this study we aim to investigate the in vitro anticancerous effect of Moringa oleifera's aqueous leaf extract. Moringa extract was prepared by soaking pulverized leaves in hot water mimicking the people's mode of the leaf drink preparation. Several assays were used to study the effect of different percentage concentrations of the extract on viability of A549 cells; levels of adenosine triphosphate (ATP), reactive oxygen species (ROS), and glutathione (GSH) generated; as well as percentage of lactate dehydrogenase (LDH) released at different time points. In addition to mitochondrial membrane potential, apoptotic events were assessed using western blotting for apoptotic markers and immunoflourescent flourescent labeled inhibitor of caspases (FLICA) assay. MO extract treatment resulted in a significant decrease in mitochondrial membrane potential (1 hour) and ATP levels (3 hours), followed by an increase in (6 hours) ROS, caspase activation, proapoptotic proteins expression (p53, SMAC/Diablo, AIF), and PARP-1 cleavage. This eventually resulted in decreased GSH levels and a decrease in viability. The cytotoxic effect was prevented upon pretreatment with antioxidant N-acetyl-cysteine. MO decreased as well the viability of HepG2, CaCo2, Jurkat, and HEK293 cells. Our findings identify a plant extract with an anticancerous effect on cancer cell lines. MO extract exerts its cytotoxic effect in A549 cancer cells by affecting mitochondrial viability and inducing apoptosis in an ROS-dependent manner.

PHYTOCHEMICAL SCREENING, ANTI-INFLAMMATORY AND ANALGESIC PROPERTIES OF PENTANISIA PRUNELLOIDES FROM THE EASTERN CAPE PROVINCE, SOUTH AFRICA.

PubMed

Mathews, Miya Gugulethu; Ajayi, Oyemitan Idris; Opeoluwa, Oyedeji Oyehan; Oluwatobi, Oluwafemi Samuel; Benedicta N, Nkeh-Chungag; Phindile, Songca Sandile; Oyedeji; Omowumi, Adebola

2016-01-01

Pentanisia prunelloides is a medicinal plant widely used to remedy various ailments including infections, fever and rheumatism in Eastern Cape Province of South Africa. There is scanty report on the phytochemical and biological properties of the plant; hence various solvent extracts of the dried plant materials were phytochemically screened, and its aqueous extract evaluated for acute toxicity effect, analgesic and antiinflammatory properties in rodents. Different extracts of both leaf and rhizome were obtained separately with ethanol, methanol and water. Portions of the filtrate were used for qualitative screening of secondary metabolites and remaining portions were concentrated and dried. Dried grounded leaf and rhizome of the plant were also used for quantitative screening for some major components. The aqueous extract of the leaf and rhizome were used for acute toxicity (LD 50 ) test, antiinflammatory and analgesic activities in rodents. The qualitative phytochemical screening showed the presence of several phytoconstituents with saponins, flavonoids and alkaloids constituting highest constituents in the leaf and rhizome. The LD50: of the aqueous extracts (from leaf or rhizome) was found to be ≥5000 mg/kg orally. The leaf and rhizome aqueous extract (250-500 mg/kg) significantly (p<0.01) reduced egg albumin-induced paw oedema and paw licking in mice induced by formalin, signifying antinociceptive and antiinflammatory activities respectively. It is concluded that the leaf and rhizome of P. prunelloides are rich in various phytochemicals which could be associated with their medicinal uses. The aqueous leaf and rhizome extracts are similarly non-toxic orally, showed antiinflammatory and analgesic potentials thus rationalizing its use in folkloric medicine.

Safety classification of herbal medicines used among pregnant women in Asian countries: a systematic review.

PubMed

Ahmed, Mansoor; Hwang, Jung Hye; Choi, Soojeung; Han, Dongwoon

2017-11-14

High prevalence of herbal medicines used in pregnancy and the lack of information on their safety is a public concern. Despite this, no significant research has been done regarding potential adverse effects of using herbal medicines during pregnancy, especially among developing Asian countries. Cross-sectional studies were searched up to year 2016 on PubMed/Medline and EMBASE, the data were extracted and quality of studies was assessed using the quality appraisal tool. The findings are reported in accordance to the PRISMA checklist (Preferred Reporting Items for Systematic Reviews and Meta-Analyses). Classification on safety of identified herbal medicines was done based on current scientific literature. This study included eight cross-sectional studies (2729 participants) from seven different Asian countries, of which 1283 (47.01%) women used one or more herbal medicines during pregnancy. Peppermint (22.8%), aniseed (14.7%), olibanum (12.9%), flixweed seed (12.2%) and ginger (11.5%) were the most frequently used herbal medicines. Out of the 33 identified herbal medicines, 13 were classified as safe to use, five as use with caution, eight were potentially harmful to use in pregnancy and information on seven herbal medicines was not available in the current literature. Several herbal medicines identified in this review were classified to be potentially harmful or the information regarding safety in pregnancy was missing. It is recommended that contraindicated herbal medicines should be avoided and other herbals should be taken under supervision of a qualified health care practitioner. The classification regarding safety of herbal medicines in pregnancy can be utilized to create awareness on prevention of adverse effects.