The need and approach for characterization - U.S. air force perspectives on materials state awareness

NASA Astrophysics Data System (ADS)

Aldrin, John C.; Lindgren, Eric A.

2018-04-01

This paper expands on the objective and motivation for NDE-based characterization and includes a discussion of the current approach using model-assisted inversion being pursued within the Air Force Research Laboratory (AFRL). This includes a discussion of the multiple model-based methods that can be used, including physics-based models, deep machine learning, and heuristic approaches. The benefits and drawbacks of each method is reviewed and the potential to integrate multiple methods is discussed. Initial successes are included to highlight the ability to obtain quantitative values of damage. Additional steps remaining to realize this capability with statistical metrics of accuracy are discussed, and how these results can be used to enable probabilistic life management are addressed. The outcome of this initiative will realize the long-term desired capability of NDE methods to provide quantitative characterization to accelerate certification of new materials and enhance life management of engineered systems.

System and methods for determining masking signals for applying empirical mode decomposition (EMD) and for demodulating intrinsic mode functions obtained from application of EMD

DOEpatents

Senroy, Nilanjan [New Delhi, IN; Suryanarayanan, Siddharth [Littleton, CO

2011-03-15

A computer-implemented method of signal processing is provided. The method includes generating one or more masking signals based upon a computed Fourier transform of a received signal. The method further includes determining one or more intrinsic mode functions (IMFs) of the received signal by performing a masking-signal-based empirical mode decomposition (EMD) using the at least one masking signal.

A review of numerical techniques approaching microstructures of crystalline rocks

NASA Astrophysics Data System (ADS)

Zhang, Yahui; Wong, Louis Ngai Yuen

2018-06-01

The macro-mechanical behavior of crystalline rocks including strength, deformability and failure pattern are dominantly influenced by their grain-scale structures. Numerical technique is commonly used to assist understanding the complicated mechanisms from a microscopic perspective. Each numerical method has its respective strengths and limitations. This review paper elucidates how numerical techniques take geometrical aspects of the grain into consideration. Four categories of numerical methods are examined: particle-based methods, block-based methods, grain-based methods, and node-based methods. Focusing on the grain-scale characters, specific relevant issues including increasing complexity of micro-structure, deformation and breakage of model elements, fracturing and fragmentation process are described in more detail. Therefore, the intrinsic capabilities and limitations of different numerical approaches in terms of accounting for the micro-mechanics of crystalline rocks and their phenomenal mechanical behavior are explicitly presented.

Research and development of LANDSAT-based crop inventory techniques

NASA Technical Reports Server (NTRS)

Horvath, R.; Cicone, R. C.; Malila, W. A. (Principal Investigator)

1982-01-01

A wide spectrum of technology pertaining to the inventory of crops using LANDSAT without in situ training data is addressed. Methods considered include Bayesian based through-the-season methods, estimation technology based on analytical profile fitting methods, and expert-based computer aided methods. Although the research was conducted using U.S. data, the adaptation of the technology to the Southern Hemisphere, especially Argentina was considered.

Constrained CVT meshes and a comparison of triangular mesh generators

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nguyen, Hoa; Burkardt, John; Gunzburger, Max

2009-01-01

Mesh generation in regions in Euclidean space is a central task in computational science, and especially for commonly used numerical methods for the solution of partial differential equations, e.g., finite element and finite volume methods. We focus on the uniform Delaunay triangulation of planar regions and, in particular, on how one selects the positions of the vertices of the triangulation. We discuss a recently developed method, based on the centroidal Voronoi tessellation (CVT) concept, for effecting such triangulations and present two algorithms, including one new one, for CVT-based grid generation. We also compare several methods, including CVT-based methods, for triangulatingmore » planar domains. To this end, we define several quantitative measures of the quality of uniform grids. We then generate triangulations of several planar regions, including some having complexities that are representative of what one may encounter in practice. We subject the resulting grids to visual and quantitative comparisons and conclude that all the methods considered produce high-quality uniform grids and that the CVT-based grids are at least as good as any of the others.« less

Synthesis of carbohydrate-based surfactants

DOEpatents

Pemberton, Jeanne E.; Polt, Robin L.; Maier, Raina M.

2016-11-22

The present invention provides carbohydrate-based surfactants and methods for producing the same. Methods for producing carbohydrate-based surfactants include using a glycosylation promoter to link a carbohydrate or its derivative to a hydrophobic compound.

Raft cultivation area extraction from high resolution remote sensing imagery by fusing multi-scale region-line primitive association features

NASA Astrophysics Data System (ADS)

Wang, Min; Cui, Qi; Wang, Jie; Ming, Dongping; Lv, Guonian

2017-01-01

In this paper, we first propose several novel concepts for object-based image analysis, which include line-based shape regularity, line density, and scale-based best feature value (SBV), based on the region-line primitive association framework (RLPAF). We then propose a raft cultivation area (RCA) extraction method for high spatial resolution (HSR) remote sensing imagery based on multi-scale feature fusion and spatial rule induction. The proposed method includes the following steps: (1) Multi-scale region primitives (segments) are obtained by image segmentation method HBC-SEG, and line primitives (straight lines) are obtained by phase-based line detection method. (2) Association relationships between regions and lines are built based on RLPAF, and then multi-scale RLPAF features are extracted and SBVs are selected. (3) Several spatial rules are designed to extract RCAs within sea waters after land and water separation. Experiments show that the proposed method can successfully extract different-shaped RCAs from HR images with good performance.

Catalysts for converting syngas into liquid hydrocarbons and methods thereof

DOEpatents

Yu, Fei; Yan, Qiangu; Batchelor, William

2016-03-15

The presently-disclosed subject matter includes methods for producing liquid hydrocarbons from syngas. In some embodiments the syngas is obtained from biomass and/or comprises a relatively high amount of nitrogen and/or carbon dioxide. In some embodiments the present methods can convert syngas into liquid hydrocarbons through a one-stage process. Also provided are catalysts for producing liquid hydrocarbons from syngas, wherein the catalysts include a base material, a transition metal, and a promoter. In some embodiments the base material includes a zeolite-iron material or a cobalt-molybdenum carbide material. In still further embodiments the promoter can include an alkali metal.

A Review on Human Activity Recognition Using Vision-Based Method.

PubMed

Zhang, Shugang; Wei, Zhiqiang; Nie, Jie; Huang, Lei; Wang, Shuang; Li, Zhen

2017-01-01

Human activity recognition (HAR) aims to recognize activities from a series of observations on the actions of subjects and the environmental conditions. The vision-based HAR research is the basis of many applications including video surveillance, health care, and human-computer interaction (HCI). This review highlights the advances of state-of-the-art activity recognition approaches, especially for the activity representation and classification methods. For the representation methods, we sort out a chronological research trajectory from global representations to local representations, and recent depth-based representations. For the classification methods, we conform to the categorization of template-based methods, discriminative models, and generative models and review several prevalent methods. Next, representative and available datasets are introduced. Aiming to provide an overview of those methods and a convenient way of comparing them, we classify existing literatures with a detailed taxonomy including representation and classification methods, as well as the datasets they used. Finally, we investigate the directions for future research.

A Review on Human Activity Recognition Using Vision-Based Method

PubMed Central

Nie, Jie

2017-01-01

Human activity recognition (HAR) aims to recognize activities from a series of observations on the actions of subjects and the environmental conditions. The vision-based HAR research is the basis of many applications including video surveillance, health care, and human-computer interaction (HCI). This review highlights the advances of state-of-the-art activity recognition approaches, especially for the activity representation and classification methods. For the representation methods, we sort out a chronological research trajectory from global representations to local representations, and recent depth-based representations. For the classification methods, we conform to the categorization of template-based methods, discriminative models, and generative models and review several prevalent methods. Next, representative and available datasets are introduced. Aiming to provide an overview of those methods and a convenient way of comparing them, we classify existing literatures with a detailed taxonomy including representation and classification methods, as well as the datasets they used. Finally, we investigate the directions for future research. PMID:29065585

Method of coating an iron-based article

DOE Office of Scientific and Technical Information (OSTI.GOV)

Magdefrau, Neal; Beals, James T.; Sun, Ellen Y.

A method of coating an iron-based article includes a first heating step of heating a substrate that includes an iron-based material in the presence of an aluminum source material and halide diffusion activator. The heating is conducted in a substantially non-oxidizing environment, to cause the formation of an aluminum-rich layer in the iron-based material. In a second heating step, the substrate that has the aluminum-rich layer is heated in an oxidizing environment to oxidize the aluminum in the aluminum-rich layer.

Systems and Methods of Coordination Control for Robot Manipulation

NASA Technical Reports Server (NTRS)

Chang, Chu-Yin (Inventor); English, James (Inventor); Tardella, Neil (Inventor); Bacon, James (Inventor)

2013-01-01

Disclosed herein are systems and methods for controlling robotic apparatus having several movable elements or segments coupled by joints. At least one of the movable elements can include one or more mobile bases, while the others can form one or more manipulators. One of the movable elements can be treated as an end effector for which a certain motion is desired. The end effector may include a tool, for example, or represent a robotic hand (or a point thereon), or one or more of the one or more mobile bases. In accordance with the systems and methods disclosed herein, movement of the manipulator and the mobile base can be controlled and coordinated to effect a desired motion for the end effector. In many cases, the motion can include simultaneously moving the manipulator and the mobile base.

Multi-model blending

DOEpatents

Hamann, Hendrik F.; Hwang, Youngdeok; van Kessel, Theodore G.; Khabibrakhmanov, Ildar K.; Muralidhar, Ramachandran

2016-10-18

A method and a system to perform multi-model blending are described. The method includes obtaining one or more sets of predictions of historical conditions, the historical conditions corresponding with a time T that is historical in reference to current time, and the one or more sets of predictions of the historical conditions being output by one or more models. The method also includes obtaining actual historical conditions, the actual historical conditions being measured conditions at the time T, assembling a training data set including designating the two or more set of predictions of historical conditions as predictor variables and the actual historical conditions as response variables, and training a machine learning algorithm based on the training data set. The method further includes obtaining a blended model based on the machine learning algorithm.

A new method based on the Butler-Volmer formalism to evaluate voltammetric cation and anion sensors.

PubMed

Cano, Manuel; Rodríguez-Amaro, Rafael; Fernández Romero, Antonio J

2008-12-11

A new method based on the Butler-Volmer formalism is applied to assess the capability of two voltammetric ion sensors based on polypyrrole films: PPy/DBS and PPy/ClO4 modified electrodes were studied as voltammetric cation and anion sensors, respectively. The reversible potential versus electrolyte concentrations semilogarithm plots provided positive calibration slopes for PPy/DBS and negative ones for PPy/ClO4, as was expected from the proposed method and that based on the Nernst equation. The slope expressions deduced from Butler-Volmer include the electron-transfer coefficient, which allows slope values different from the ideal Nernstian value to be explained. Both polymeric films exhibited a degree of ion-selectivity when they were immersed in mixed-analyte solutions. Selectivity coefficients for the two proposed voltammetric cation and anion sensors were obtained by several experimental methods, including the separated solution method (SSM) and matched potential method (MPM). The K values acquired by the different methods were very close for both polymeric sensors.

A novel, colorimetric method for biogenic amine detection based on arylalkylamine N-acetyltransferase.

PubMed

Leng, Pei-Qiang; Zhao, Feng-Lan; Yin, Bin-Cheng; Ye, Bang-Ce

2015-05-21

We developed a novel colorimetric method for rapid detection of biogenic amines based on arylalkylamine N-acetyltransferase (aaNAT). The proposed method offers distinct advantages including simple handling, high speed, low cost, good sensitivity and selectivity.

Educating Instructional Designers: Different Methods for Different Outcomes.

ERIC Educational Resources Information Center

Rowland, Gordon; And Others

1994-01-01

Suggests new methods of teaching instructional design based on literature reviews of other design fields including engineering, architecture, interior design, media design, and medicine. Methods discussed include public presentations, visiting experts, competitions, artifacts, case studies, design studios, and internships and apprenticeships.…

Integrating structure-based and ligand-based approaches for computational drug design.

PubMed

Wilson, Gregory L; Lill, Markus A

2011-04-01

Methods utilized in computer-aided drug design can be classified into two major categories: structure based and ligand based, using information on the structure of the protein or on the biological and physicochemical properties of bound ligands, respectively. In recent years there has been a trend towards integrating these two methods in order to enhance the reliability and efficiency of computer-aided drug-design approaches by combining information from both the ligand and the protein. This trend resulted in a variety of methods that include: pseudoreceptor methods, pharmacophore methods, fingerprint methods and approaches integrating docking with similarity-based methods. In this article, we will describe the concepts behind each method and selected applications.

Intrinsic feature-based pose measurement for imaging motion compensation

DOEpatents

Baba, Justin S.; Goddard, Jr., James Samuel

2014-08-19

Systems and methods for generating motion corrected tomographic images are provided. A method includes obtaining first images of a region of interest (ROI) to be imaged and associated with a first time, where the first images are associated with different positions and orientations with respect to the ROI. The method also includes defining an active region in the each of the first images and selecting intrinsic features in each of the first images based on the active region. Second, identifying a portion of the intrinsic features temporally and spatially matching intrinsic features in corresponding ones of second images of the ROI associated with a second time prior to the first time and computing three-dimensional (3D) coordinates for the portion of the intrinsic features. Finally, the method includes computing a relative pose for the first images based on the 3D coordinates.

Systems and Methods for Automated Vessel Navigation Using Sea State Prediction

NASA Technical Reports Server (NTRS)

Huntsberger, Terrance L. (Inventor); Howard, Andrew B. (Inventor); Reinhart, Rene Felix (Inventor); Aghazarian, Hrand (Inventor); Rankin, Arturo (Inventor)

2017-01-01

Systems and methods for sea state prediction and autonomous navigation in accordance with embodiments of the invention are disclosed. One embodiment of the invention includes a method of predicting a future sea state including generating a sequence of at least two 3D images of a sea surface using at least two image sensors, detecting peaks and troughs in the 3D images using a processor, identifying at least one wavefront in each 3D image based upon the detected peaks and troughs using the processor, characterizing at least one propagating wave based upon the propagation of wavefronts detected in the sequence of 3D images using the processor, and predicting a future sea state using at least one propagating wave characterizing the propagation of wavefronts in the sequence of 3D images using the processor. Another embodiment includes a method of autonomous vessel navigation based upon a predicted sea state and target location.

Systems and Methods for Automated Vessel Navigation Using Sea State Prediction

NASA Technical Reports Server (NTRS)

Aghazarian, Hrand (Inventor); Reinhart, Rene Felix (Inventor); Huntsberger, Terrance L. (Inventor); Rankin, Arturo (Inventor); Howard, Andrew B. (Inventor)

2015-01-01

Systems and methods for sea state prediction and autonomous navigation in accordance with embodiments of the invention are disclosed. One embodiment of the invention includes a method of predicting a future sea state including generating a sequence of at least two 3D images of a sea surface using at least two image sensors, detecting peaks and troughs in the 3D images using a processor, identifying at least one wavefront in each 3D image based upon the detected peaks and troughs using the processor, characterizing at least one propagating wave based upon the propagation of wavefronts detected in the sequence of 3D images using the processor, and predicting a future sea state using at least one propagating wave characterizing the propagation of wavefronts in the sequence of 3D images using the processor. Another embodiment includes a method of autonomous vessel navigation based upon a predicted sea state and target location.

A Systematic Evaluation of Field-Based Screening Methods for the Assessment of Anterior Cruciate Ligament (ACL) Injury Risk.

PubMed

Fox, Aaron S; Bonacci, Jason; McLean, Scott G; Spittle, Michael; Saunders, Natalie

2016-05-01

Laboratory-based measures provide an accurate method to identify risk factors for anterior cruciate ligament (ACL) injury; however, these methods are generally prohibitive to the wider community. Screening methods that can be completed in a field or clinical setting may be more applicable for wider community use. Examination of field-based screening methods for ACL injury risk can aid in identifying the most applicable method(s) for use in these settings. The objective of this systematic review was to evaluate and compare field-based screening methods for ACL injury risk to determine their efficacy of use in wider community settings. An electronic database search was conducted on the SPORTDiscus™, MEDLINE, AMED and CINAHL databases (January 1990-July 2015) using a combination of relevant keywords. A secondary search of the same databases, using relevant keywords from identified screening methods, was also undertaken. Studies identified as potentially relevant were independently examined by two reviewers for inclusion. Where consensus could not be reached, a third reviewer was consulted. Original research articles that examined screening methods for ACL injury risk that could be undertaken outside of a laboratory setting were included for review. Two reviewers independently assessed the quality of included studies. Included studies were categorized according to the screening method they examined. A description of each screening method, and data pertaining to the ability to prospectively identify ACL injuries, validity and reliability, recommendations for identifying 'at-risk' athletes, equipment and training required to complete screening, time taken to screen athletes, and applicability of the screening method across sports and athletes were extracted from relevant studies. Of 1077 citations from the initial search, a total of 25 articles were identified as potentially relevant, with 12 meeting all inclusion/exclusion criteria. From the secondary search, eight further studies met all criteria, resulting in 20 studies being included for review. Five ACL-screening methods-the Landing Error Scoring System (LESS), Clinic-Based Algorithm, Observational Screening of Dynamic Knee Valgus (OSDKV), 2D-Cam Method, and Tuck Jump Assessment-were identified. There was limited evidence supporting the use of field-based screening methods in predicting ACL injuries across a range of populations. Differences relating to the equipment and time required to complete screening methods were identified. Only screening methods for ACL injury risk were included for review. Field-based screening methods developed for lower-limb injury risk in general may also incorporate, and be useful in, screening for ACL injury risk. Limited studies were available relating to the OSDKV and 2D-Cam Method. The LESS showed predictive validity in identifying ACL injuries, however only in a youth athlete population. The LESS also appears practical for community-wide use due to the minimal equipment and set-up/analysis time required. The Clinic-Based Algorithm may have predictive value for ACL injury risk as it identifies athletes who exhibit high frontal plane knee loads during a landing task, but requires extensive additional equipment and time, which may limit its application to wider community settings.

A technique for setting analytical thresholds in massively parallel sequencing-based forensic DNA analysis

PubMed Central

2017-01-01

Amplicon (targeted) sequencing by massively parallel sequencing (PCR-MPS) is a potential method for use in forensic DNA analyses. In this application, PCR-MPS may supplement or replace other instrumental analysis methods such as capillary electrophoresis and Sanger sequencing for STR and mitochondrial DNA typing, respectively. PCR-MPS also may enable the expansion of forensic DNA analysis methods to include new marker systems such as single nucleotide polymorphisms (SNPs) and insertion/deletions (indels) that currently are assayable using various instrumental analysis methods including microarray and quantitative PCR. Acceptance of PCR-MPS as a forensic method will depend in part upon developing protocols and criteria that define the limitations of a method, including a defensible analytical threshold or method detection limit. This paper describes an approach to establish objective analytical thresholds suitable for multiplexed PCR-MPS methods. A definition is proposed for PCR-MPS method background noise, and an analytical threshold based on background noise is described. PMID:28542338

A technique for setting analytical thresholds in massively parallel sequencing-based forensic DNA analysis.

PubMed

Young, Brian; King, Jonathan L; Budowle, Bruce; Armogida, Luigi

2017-01-01

Amplicon (targeted) sequencing by massively parallel sequencing (PCR-MPS) is a potential method for use in forensic DNA analyses. In this application, PCR-MPS may supplement or replace other instrumental analysis methods such as capillary electrophoresis and Sanger sequencing for STR and mitochondrial DNA typing, respectively. PCR-MPS also may enable the expansion of forensic DNA analysis methods to include new marker systems such as single nucleotide polymorphisms (SNPs) and insertion/deletions (indels) that currently are assayable using various instrumental analysis methods including microarray and quantitative PCR. Acceptance of PCR-MPS as a forensic method will depend in part upon developing protocols and criteria that define the limitations of a method, including a defensible analytical threshold or method detection limit. This paper describes an approach to establish objective analytical thresholds suitable for multiplexed PCR-MPS methods. A definition is proposed for PCR-MPS method background noise, and an analytical threshold based on background noise is described.

Method of plasma etching Ga-based compound semiconductors

DOEpatents

Qiu, Weibin; Goddard, Lynford L.

2012-12-25

A method of plasma etching Ga-based compound semiconductors includes providing a process chamber and a source electrode adjacent to the process chamber. The process chamber contains a sample comprising a Ga-based compound semiconductor. The sample is in contact with a platen which is electrically connected to a first power supply, and the source electrode is electrically connected to a second power supply. The method includes flowing SiCl.sub.4 gas into the chamber, flowing Ar gas into the chamber, and flowing H.sub.2 gas into the chamber. RF power is supplied independently to the source electrode and the platen. A plasma is generated based on the gases in the process chamber, and regions of a surface of the sample adjacent to one or more masked portions of the surface are etched to create a substantially smooth etched surface including features having substantially vertical walls beneath the masked portions.

Systems and Methods for Implementing Bulk Metallic Glass-Based Macroscale Compliant Mechanisms

NASA Technical Reports Server (NTRS)

Hofmann, Douglas C. (Inventor); Agnes, Gregory (Inventor)

2017-01-01

Systems and methods in accordance with embodiments of the invention implement bulk metallic glass-based macroscale compliant mechanisms. In one embodiment, a bulk metallic glass-based macroscale compliant mechanism includes: a flexible member that is strained during the normal operation of the compliant mechanism; where the flexible member has a thickness of 0.5 mm; where the flexible member comprises a bulk metallic glass-based material; and where the bulk metallic glass-based material can survive a fatigue test that includes 1000 cycles under a bending loading mode at an applied stress to ultimate strength ratio of 0.25.

Use of a problem-based learning teaching model for undergraduate medical and nursing education: a systematic review and meta-analysis

PubMed Central

Sayyah, Mehdi; Shirbandi, Kiarash; Saki-Malehi, Amal; Rahim, Fakher

2017-01-01

Objectives The aim of this systematic review and meta-analysis was to evaluate the problem-based learning (PBL) method as an alternative to conventional educational methods in Iranian undergraduate medical courses. Materials and methods We systematically searched international datasets banks, including PubMed, Scopus, and Embase, and internal resources of banks, including MagirIran, IranMedex, IranDoc, and Scientific Information Database (SID), using appropriate search terms, such as “PBL”, “problem-based learning”, “based on problems”, “active learning”, and“ learner centered”, to identify PBL studies, and these were combined with other key terms such as “medical”, “undergraduate”, “Iranian”, “Islamic Republic of Iran”, “I.R. of Iran”, and “Iran”. The search included the period from 1980 to 2016 with no language limits. Results Overall, a total of 1,057 relevant studies were initially found, of which 21 studies were included in the systematic review and meta-analysis. Of the 21 studies, 12 (57.14%) had a high methodological quality. Considering the pooled effect size data, there was a significant difference in the scores (standardized mean difference [SMD]=0.80, 95% CI [0.52, 1.08], P<0.000) in favor of PBL, compared with the lecture-based method. Subgroup analysis revealed that using PBL alone is more favorable compared to using a mixed model with other learning methods such as lecture-based learning (LBL). Conclusion The results of this systematic review showed that using PBL may have a positive effect on the academic achievement of undergraduate medical courses. The results suggest that teachers and medical education decision makers give more attention on using this method for effective and proper training. PMID:29042827

Practical Methods for Including Torsional Anharmonicity in Thermochemical Calculations on Complex Molecules: The Internal-Coordinate Multi-Structural Approximation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zheng, J.; Yu, T.; Papajak, E.

2011-01-01

Many methods for correcting harmonic partition functions for the presence of torsional motions employ some form of one-dimensional torsional treatment to replace the harmonic contribution of a specific normal mode. However, torsions are often strongly coupled to other degrees of freedom, especially other torsions and low-frequency bending motions, and this coupling can make assigning torsions to specific normal modes problematic. Here, we present a new class of methods, called multi-structural (MS) methods, that circumvents the need for such assignments by instead adjusting the harmonic results by torsional correction factors that are determined using internal coordinates. We present three versions ofmore » the MS method: (i) MS-AS based on including all structures (AS), i.e., all conformers generated by internal rotations; (ii) MS-ASCB based on all structures augmented with explicit conformational barrier (CB) information, i.e., including explicit calculations of all barrier heights for internal-rotation barriers between the conformers; and (iii) MS-RS based on including all conformers generated from a reference structure (RS) by independent torsions. In the MS-AS scheme, one has two options for obtaining the local periodicity parameters, one based on consideration of the nearly separable limit and one based on strongly coupled torsions. The latter involves assigning the local periodicities on the basis of Voronoi volumes. The methods are illustrated with calculations for ethanol, 1-butanol, and 1-pentyl radical as well as two one-dimensional torsional potentials. The MS-AS method is particularly interesting because it does not require any information about conformational barriers or about the paths that connect the various structures.« less

Practical methods for including torsional anharmonicity in thermochemical calculations on complex molecules: the internal-coordinate multi-structural approximation.

PubMed

Zheng, Jingjing; Yu, Tao; Papajak, Ewa; Alecu, I M; Mielke, Steven L; Truhlar, Donald G

2011-06-21

Many methods for correcting harmonic partition functions for the presence of torsional motions employ some form of one-dimensional torsional treatment to replace the harmonic contribution of a specific normal mode. However, torsions are often strongly coupled to other degrees of freedom, especially other torsions and low-frequency bending motions, and this coupling can make assigning torsions to specific normal modes problematic. Here, we present a new class of methods, called multi-structural (MS) methods, that circumvents the need for such assignments by instead adjusting the harmonic results by torsional correction factors that are determined using internal coordinates. We present three versions of the MS method: (i) MS-AS based on including all structures (AS), i.e., all conformers generated by internal rotations; (ii) MS-ASCB based on all structures augmented with explicit conformational barrier (CB) information, i.e., including explicit calculations of all barrier heights for internal-rotation barriers between the conformers; and (iii) MS-RS based on including all conformers generated from a reference structure (RS) by independent torsions. In the MS-AS scheme, one has two options for obtaining the local periodicity parameters, one based on consideration of the nearly separable limit and one based on strongly coupled torsions. The latter involves assigning the local periodicities on the basis of Voronoi volumes. The methods are illustrated with calculations for ethanol, 1-butanol, and 1-pentyl radical as well as two one-dimensional torsional potentials. The MS-AS method is particularly interesting because it does not require any information about conformational barriers or about the paths that connect the various structures.

Computational Methods in Drug Discovery

PubMed Central

Sliwoski, Gregory; Kothiwale, Sandeepkumar; Meiler, Jens

2014-01-01

Computer-aided drug discovery/design methods have played a major role in the development of therapeutically important small molecules for over three decades. These methods are broadly classified as either structure-based or ligand-based methods. Structure-based methods are in principle analogous to high-throughput screening in that both target and ligand structure information is imperative. Structure-based approaches include ligand docking, pharmacophore, and ligand design methods. The article discusses theory behind the most important methods and recent successful applications. Ligand-based methods use only ligand information for predicting activity depending on its similarity/dissimilarity to previously known active ligands. We review widely used ligand-based methods such as ligand-based pharmacophores, molecular descriptors, and quantitative structure-activity relationships. In addition, important tools such as target/ligand data bases, homology modeling, ligand fingerprint methods, etc., necessary for successful implementation of various computer-aided drug discovery/design methods in a drug discovery campaign are discussed. Finally, computational methods for toxicity prediction and optimization for favorable physiologic properties are discussed with successful examples from literature. PMID:24381236

Uncooled infrared photon detector and multicolor infrared detection using microoptomechanical sensors

DOEpatents

Datskos, Panagiotis G.; Rajic, Solobodan; Datskou, Irene C.

1999-01-01

Systems and methods for infrared detection are described. An optomechanical photon detector includes a semiconductor material and is based on measurement of a photoinduced lattice strain. A multicolor infrared sensor includes a stack of frequency specific optomechanical detectors. The stack can include one, or more, of the optomechanical photon detectors that function based on the measurement of photoinduced lattice strain. The systems and methods provide advantages in that rapid, sensitive multicolor infrared imaging can be performed without the need for a cooling subsystem.

Chemical Mixture Risk Assessment Additivity-Based Approaches

EPA Science Inventory

Powerpoint presentation includes additivity-based chemical mixture risk assessment methods. Basic concepts, theory and example calculations are included. Several slides discuss the use of "common adverse outcomes" in analyzing phthalate mixtures.

Human Pose Estimation from Monocular Images: A Comprehensive Survey

PubMed Central

Gong, Wenjuan; Zhang, Xuena; Gonzàlez, Jordi; Sobral, Andrews; Bouwmans, Thierry; Tu, Changhe; Zahzah, El-hadi

2016-01-01

Human pose estimation refers to the estimation of the location of body parts and how they are connected in an image. Human pose estimation from monocular images has wide applications (e.g., image indexing). Several surveys on human pose estimation can be found in the literature, but they focus on a certain category; for example, model-based approaches or human motion analysis, etc. As far as we know, an overall review of this problem domain has yet to be provided. Furthermore, recent advancements based on deep learning have brought novel algorithms for this problem. In this paper, a comprehensive survey of human pose estimation from monocular images is carried out including milestone works and recent advancements. Based on one standard pipeline for the solution of computer vision problems, this survey splits the problem into several modules: feature extraction and description, human body models, and modeling methods. Problem modeling methods are approached based on two means of categorization in this survey. One way to categorize includes top-down and bottom-up methods, and another way includes generative and discriminative methods. Considering the fact that one direct application of human pose estimation is to provide initialization for automatic video surveillance, there are additional sections for motion-related methods in all modules: motion features, motion models, and motion-based methods. Finally, the paper also collects 26 publicly available data sets for validation and provides error measurement methods that are frequently used. PMID:27898003

Iron-based amorphous alloys and methods of synthesizing iron-based amorphous alloys

DOEpatents

Saw, Cheng Kiong; Bauer, William A.; Choi, Jor-Shan; Day, Dan; Farmer, Joseph C.

2016-05-03

A method according to one embodiment includes combining an amorphous iron-based alloy and at least one metal selected from a group consisting of molybdenum, chromium, tungsten, boron, gadolinium, nickel phosphorous, yttrium, and alloys thereof to form a mixture, wherein the at least one metal is present in the mixture from about 5 atomic percent (at %) to about 55 at %; and ball milling the mixture at least until an amorphous alloy of the iron-based alloy and the at least one metal is formed. Several amorphous iron-based metal alloys are also presented, including corrosion-resistant amorphous iron-based metal alloys and radiation-shielding amorphous iron-based metal alloys.

Infrared Ship Target Segmentation Based on Spatial Information Improved FCM.

PubMed

Bai, Xiangzhi; Chen, Zhiguo; Zhang, Yu; Liu, Zhaoying; Lu, Yi

2016-12-01

Segmentation of infrared (IR) ship images is always a challenging task, because of the intensity inhomogeneity and noise. The fuzzy C-means (FCM) clustering is a classical method widely used in image segmentation. However, it has some shortcomings, like not considering the spatial information or being sensitive to noise. In this paper, an improved FCM method based on the spatial information is proposed for IR ship target segmentation. The improvements include two parts: 1) adding the nonlocal spatial information based on the ship target and 2) using the spatial shape information of the contour of the ship target to refine the local spatial constraint by Markov random field. In addition, the results of K -means are used to initialize the improved FCM method. Experimental results show that the improved method is effective and performs better than the existing methods, including the existing FCM methods, for segmentation of the IR ship images.

Neutron absorption detector

DOEpatents

Bell, Zane William [Oak Ridge, TN; Boatner, Lynn Allen [Oak Ridge, TN

2011-05-31

A method of detecting an activator, the method including impinging a receptor material that is not predominately water and lacks a photoluminescent material with an activator and generating Cherenkov effect light due to the activator impinging the receptor material. The method further including identifying a characteristic of the activator based on the light.

A Ricin Forensic Profiling Approach Based on a Complex Set of Biomarkers

DOE PAGES

Fredriksson, Sten-Ake; Wunschel, David S.; Lindstrom, Susanne Wiklund; ...

2018-03-28

A forensic method for the retrospective determination of preparation methods used for illicit ricin toxin production was developed. The method was based on a complex set of biomarkers, including carbohydrates, fatty acids, seed storage proteins, in combination with data on ricin and Ricinus communis agglutinin. The analyses were performed on samples prepared from four castor bean plant (R. communis) cultivars by four different sample preparation methods (PM1 – PM4) ranging from simple disintegration of the castor beans to multi-step preparation methods including different protein precipitation methods. Comprehensive analytical data was collected by use of a range of analytical methods andmore » robust orthogonal partial least squares-discriminant analysis- models (OPLS-DA) were constructed based on the calibration set. By the use of a decision tree and two OPLS-DA models, the sample preparation methods of test set samples were determined. The model statistics of the two models were good and a 100% rate of correct predictions of the test set was achieved.« less

A Ricin Forensic Profiling Approach Based on a Complex Set of Biomarkers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fredriksson, Sten-Ake; Wunschel, David S.; Lindstrom, Susanne Wiklund

A forensic method for the retrospective determination of preparation methods used for illicit ricin toxin production was developed. The method was based on a complex set of biomarkers, including carbohydrates, fatty acids, seed storage proteins, in combination with data on ricin and Ricinus communis agglutinin. The analyses were performed on samples prepared from four castor bean plant (R. communis) cultivars by four different sample preparation methods (PM1 – PM4) ranging from simple disintegration of the castor beans to multi-step preparation methods including different protein precipitation methods. Comprehensive analytical data was collected by use of a range of analytical methods andmore » robust orthogonal partial least squares-discriminant analysis- models (OPLS-DA) were constructed based on the calibration set. By the use of a decision tree and two OPLS-DA models, the sample preparation methods of test set samples were determined. The model statistics of the two models were good and a 100% rate of correct predictions of the test set was achieved.« less

Improved lossless intra coding for H.264/MPEG-4 AVC.

PubMed

Lee, Yung-Lyul; Han, Ki-Hun; Sullivan, Gary J

2006-09-01

A new lossless intra coding method based on sample-by-sample differential pulse code modulation (DPCM) is presented as an enhancement of the H.264/MPEG-4 AVC standard. The H.264/AVC design includes a multidirectional spatial prediction method to reduce spatial redundancy by using neighboring samples as a prediction for the samples in a block of data to be encoded. In the new lossless intra coding method, the spatial prediction is performed based on samplewise DPCM instead of in the block-based manner used in the current H.264/AVC standard, while the block structure is retained for the residual difference entropy coding process. We show that the new method, based on samplewise DPCM, does not have a major complexity penalty, despite its apparent pipeline dependencies. Experiments show that the new lossless intra coding method reduces the bit rate by approximately 12% in comparison with the lossless intra coding method previously included in the H.264/AVC standard. As a result, the new method is currently being adopted into the H.264/AVC standard in a new enhancement project.

Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

DOEpatents

Cruz-Perez, Patricia; Buttner, Mark P.

2004-05-11

A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

System and method for integrating hazard-based decision making tools and processes

DOEpatents

Hodgin, C Reed [Westminster, CO

2012-03-20

A system and method for inputting, analyzing, and disseminating information necessary for identified decision-makers to respond to emergency situations. This system and method provides consistency and integration among multiple groups, and may be used for both initial consequence-based decisions and follow-on consequence-based decisions. The system and method in a preferred embodiment also provides tools for accessing and manipulating information that are appropriate for each decision-maker, in order to achieve more reasoned and timely consequence-based decisions. The invention includes processes for designing and implementing a system or method for responding to emergency situations.

System and method of self-properties for an autonomous and automatic computer environment

NASA Technical Reports Server (NTRS)

Sterritt, Roy (Inventor); Hinchey, Michael G. (Inventor)

2010-01-01

Systems, methods and apparatus are provided through which in some embodiments self health/urgency data and environment health/urgency data may be transmitted externally from an autonomic element. Other embodiments may include transmitting the self health/urgency data and environment health/urgency data together on a regular basis similar to the lub-dub of a heartbeat. Yet other embodiments may include a method for managing a system based on the functioning state and operating status of the system, wherein the method may include processing received signals from the system indicative of the functioning state and the operating status to obtain an analysis of the condition of the system, generating one or more stay alive signals based on the functioning status and the operating state of the system, transmitting the stay-alive signal, transmitting self health/urgency data, and transmitting environment health/urgency data. Still other embodiments may include an autonomic element that includes a self monitor, a self adjuster, an environment monitor, and an autonomic manager.

Availability and performance of image/video-based vital signs monitoring methods: a systematic review protocol.

PubMed

Harford, Mirae; Catherall, Jacqueline; Gerry, Stephen; Young, Duncan; Watkinson, Peter

2017-10-25

For many vital signs, monitoring methods require contact with the patient and/or are invasive in nature. There is increasing interest in developing still and video image-guided monitoring methods that are non-contact and non-invasive. We will undertake a systematic review of still and video image-based monitoring methods. We will perform searches in multiple databases which include MEDLINE, Embase, CINAHL, Cochrane library, IEEE Xplore and ACM Digital Library. We will use OpenGrey and Google searches to access unpublished or commercial data. We will not use language or publication date restrictions. The primary goal is to summarise current image-based vital signs monitoring methods, limited to heart rate, respiratory rate, oxygen saturations and blood pressure. Of particular interest will be the effectiveness of image-based methods compared to reference devices. Other outcomes of interest include the quality of the method comparison studies with respect to published reporting guidelines, any limitations of non-contact non-invasive technology and application in different populations. To the best of our knowledge, this is the first systematic review of image-based non-contact methods of vital signs monitoring. Synthesis of currently available technology will facilitate future research in this highly topical area. PROSPERO CRD42016029167.

Cyanine-based probe\\tag-peptide pair fluorescence protein imaging and fluorescence protein imaging methods

DOEpatents

Mayer-Cumblidge, M. Uljana; Cao, Haishi

2013-01-15

A molecular probe comprises two arsenic atoms and at least one cyanine based moiety. A method of producing a molecular probe includes providing a molecule having a first formula, treating the molecule with HgOAc, and subsequently transmetallizing with AsCl.sub.3. The As is liganded to ethanedithiol to produce a probe having a second formula. A method of labeling a peptide includes providing a peptide comprising a tag sequence and contacting the peptide with a biarsenical molecular probe. A complex is formed comprising the tag sequence and the molecular probe. A method of studying a peptide includes providing a mixture containing a peptide comprising a peptide tag sequence, adding a biarsenical probe to the mixture, and monitoring the fluorescence of the mixture.

Cyanine-based probe\\tag-peptide pair for fluorescence protein imaging and fluorescence protein imaging methods

DOEpatents

Mayer-Cumblidge, M Uljana [Richland, WA; Cao, Haishi [Richland, WA

2010-08-17

A molecular probe comprises two arsenic atoms and at least one cyanine based moiety. A method of producing a molecular probe includes providing a molecule having a first formula, treating the molecule with HgOAc, and subsequently transmetallizing with AsCl.sub.3. The As is liganded to ethanedithiol to produce a probe having a second formula. A method of labeling a peptide includes providing a peptide comprising a tag sequence and contacting the peptide with a biarsenical molecular probe. A complex is formed comprising the tag sequence and the molecular probe. A method of studying a peptide includes providing a mixture containing a peptide comprising a peptide tag sequence, adding a biarsenical probe to the mixture, and monitoring the fluorescence of the mixture.

Creating wavelet-based models for real-time synthesis of perceptually convincing environmental sounds

NASA Astrophysics Data System (ADS)

Miner, Nadine Elizabeth

1998-09-01

This dissertation presents a new wavelet-based method for synthesizing perceptually convincing, dynamic sounds using parameterized sound models. The sound synthesis method is applicable to a variety of applications including Virtual Reality (VR), multi-media, entertainment, and the World Wide Web (WWW). A unique contribution of this research is the modeling of the stochastic, or non-pitched, sound components. This stochastic-based modeling approach leads to perceptually compelling sound synthesis. Two preliminary studies conducted provide data on multi-sensory interaction and audio-visual synchronization timing. These results contributed to the design of the new sound synthesis method. The method uses a four-phase development process, including analysis, parameterization, synthesis and validation, to create the wavelet-based sound models. A patent is pending for this dynamic sound synthesis method, which provides perceptually-realistic, real-time sound generation. This dissertation also presents a battery of perceptual experiments developed to verify the sound synthesis results. These experiments are applicable for validation of any sound synthesis technique.

Method and system for detecting a failure or performance degradation in a dynamic system such as a flight vehicle

NASA Technical Reports Server (NTRS)

Miller, Robert H. (Inventor); Ribbens, William B. (Inventor)

2003-01-01

A method and system for detecting a failure or performance degradation in a dynamic system having sensors for measuring state variables and providing corresponding output signals in response to one or more system input signals are provided. The method includes calculating estimated gains of a filter and selecting an appropriate linear model for processing the output signals based on the input signals. The step of calculating utilizes one or more models of the dynamic system to obtain estimated signals. The method further includes calculating output error residuals based on the output signals and the estimated signals. The method also includes detecting one or more hypothesized failures or performance degradations of a component or subsystem of the dynamic system based on the error residuals. The step of calculating the estimated values is performed optimally with respect to one or more of: noise, uncertainty of parameters of the models and un-modeled dynamics of the dynamic system which may be a flight vehicle or financial market or modeled financial system.

Scheduled Peripheral Component Interconnect Arbiter

NASA Technical Reports Server (NTRS)

Nixon, Scott Alan (Inventor)

2015-01-01

Systems and methods are described for arbitrating access of a communication bus. In one embodiment, a method includes performing steps on one or more processors. The steps include: receiving an access request from a device of the communication bus; evaluating a bus schedule to determine an importance of the device based on the access request; and selectively granting access of the communication bus to the device based on the importance of the device.

The Weakest Link: Library Catalogs.

ERIC Educational Resources Information Center

Young, Terrence E., Jr.

2002-01-01

Describes methods of correcting MARC records in online public access catalogs in school libraries. Highlights include in-house methods; professional resources; conforming to library cataloging standards; vendor services, including Web-based services; software specifically developed for record cleanup; and outsourcing. (LRW)

A Survey of Colormaps in Visualization

PubMed Central

Zhou, Liang; Hansen, Charles D.

2016-01-01

Colormaps are a vital method for users to gain insights into data in a visualization. With a good choice of colormaps, users are able to acquire information in the data more effectively and efficiently. In this survey, we attempt to provide readers with a comprehensive review of colormap generation techniques and provide readers a taxonomy which is helpful for finding appropriate techniques to use for their data and applications. Specifically, we first briefly introduce the basics of color spaces including color appearance models. In the core of our paper, we survey colormap generation techniques, including the latest advances in the field by grouping these techniques into four classes: procedural methods, user-study based methods, rule-based methods, and data-driven methods; we also include a section on methods that are beyond pure data comprehension purposes. We then classify colormapping techniques into a taxonomy for readers to quickly identify the appropriate techniques they might use. Furthermore, a representative set of visualization techniques that explicitly discuss the use of colormaps is reviewed and classified based on the nature of the data in these applications. Our paper is also intended to be a reference of colormap choices for readers when they are faced with similar data and/or tasks. PMID:26513793

Possible incorporation of petroleum-based carbons in biochemicals produced by bioprocess--biomass carbon ratio measured by accelerator mass spectrometry.

PubMed

Kunioka, Masao

2010-06-01

The biomass carbon ratios of biochemicals related to biomass have been reviewed. Commercial products from biomass were explained. The biomass carbon ratios of biochemical compounds were measured by accelerator mass spectrometry (AMS) based on the (14)C concentration of carbons in the compounds. This measuring method uses the mechanism that biomass carbons include a very low level of (14)C and petroleum carbons do not include (14)C similar to the carbon dating measuring method. It was confirmed that there were some biochemicals synthesized from petroleum-based carbons. This AMS method has a high accuracy with a small standard deviation and can be applied to plastic products.

Methods for Equating Mental Tests.

DTIC Science & Technology

1984-11-01

1983) compared conventional and IRT methods for equating the Test of English as a Foreign Language ( TOEFL ) after chaining. Three conventional and...three IRT equating methods were examined in this study; two sections of TOEFL were each (separately) equated. The IRT methods included the following: (a...group. A separate base form was established for each of the six equating methods. Instead of equating the base-form TOEFL to itself, the last (eighth

Chemical modification of nanocrystal surfaces

DOEpatents

Alivisatos, A. Paul; Owen, Jonathan

2013-05-07

A method is disclosed. The method includes obtaining a precursor nanoparticle comprising a base material and a first ligand attached to the base material, and reacting the precursor nanoparticle with a reactant comprising a silicon bond, thereby removing the first ligand.

An overview of very high level software design methods

NASA Technical Reports Server (NTRS)

Asdjodi, Maryam; Hooper, James W.

1988-01-01

Very High Level design methods emphasize automatic transfer of requirements to formal design specifications, and/or may concentrate on automatic transformation of formal design specifications that include some semantic information of the system into machine executable form. Very high level design methods range from general domain independent methods to approaches implementable for specific applications or domains. Applying AI techniques, abstract programming methods, domain heuristics, software engineering tools, library-based programming and other methods different approaches for higher level software design are being developed. Though one finds that a given approach does not always fall exactly in any specific class, this paper provides a classification for very high level design methods including examples for each class. These methods are analyzed and compared based on their basic approaches, strengths and feasibility for future expansion toward automatic development of software systems.

Problem-Based Learning Method: Secondary Education 10th Grade Chemistry Course Mixtures Topic

ERIC Educational Resources Information Center

Üce, Musa; Ates, Ismail

2016-01-01

In this research; aim was determining student achievement by comparing problem-based learning method with teacher-centered traditional method of teaching 10th grade chemistry lesson mixtures topic. Pretest-posttest control group research design is implemented. Research sample includes; two classes of (total of 48 students) an Anatolian High School…

Methods and systems for detecting abnormal digital traffic

DOEpatents

Goranson, Craig A [Kennewick, WA; Burnette, John R [Kennewick, WA

2011-03-22

Aspects of the present invention encompass methods and systems for detecting abnormal digital traffic by assigning characterizations of network behaviors according to knowledge nodes and calculating a confidence value based on the characterizations from at least one knowledge node and on weighting factors associated with the knowledge nodes. The knowledge nodes include a characterization model based on prior network information. At least one of the knowledge nodes should not be based on fixed thresholds or signatures. The confidence value includes a quantification of the degree of confidence that the network behaviors constitute abnormal network traffic.

Content-based fused off-axis object illumination direct-to-digital holography

DOEpatents

Price, Jeffery R.

2006-05-02

Systems and methods are described for content-based fused off-axis illumination direct-to-digital holography. A method includes calculating an illumination angle with respect to an optical axis defined by a focusing lens as a function of data representing a Fourier analyzed spatially heterodyne hologram; reflecting a reference beam from a reference mirror at a non-normal angle; reflecting an object beam from an object the object beam incident upon the object at the illumination angle; focusing the reference beam and the object beam at a focal plane of a digital recorder to from the content-based off-axis illuminated spatially heterodyne hologram including spatially heterodyne fringes for Fourier analysis; and digitally recording the content based off-axis illuminated spatially heterodyne hologram including spatially heterodyne fringes for Fourier analysis.

Enhancing Student Learning in Knowledge-Based Courses: Integrating Team-Based Learning in Mass Communication Theory Classes

ERIC Educational Resources Information Center

Han, Gang; Newell, Jay

2014-01-01

This study explores the adoption of the team-based learning (TBL) method in knowledge-based and theory-oriented journalism and mass communication (J&MC) courses. It first reviews the origin and concept of TBL, the relevant theories, and then introduces the TBL method and implementation, including procedures and assessments, employed in an…

Implications to Postsecondary Faculty of Alternative Calculation Methods of Gender-Based Wage Differentials.

ERIC Educational Resources Information Center

Hagedorn, Linda Serra

1998-01-01

A study explored two distinct methods of calculating a precise measure of gender-based wage differentials among college faculty. The first estimation considered wage differences using a formula based on human capital; the second included compensation for past discriminatory practices. Both measures were used to predict three specific aspects of…

MR/PET quantification tools: Registration, segmentation, classification, and MR-based attenuation correction

PubMed Central

Fei, Baowei; Yang, Xiaofeng; Nye, Jonathon A.; Aarsvold, John N.; Raghunath, Nivedita; Cervo, Morgan; Stark, Rebecca; Meltzer, Carolyn C.; Votaw, John R.

2012-01-01

Purpose: Combined MR/PET is a relatively new, hybrid imaging modality. A human MR/PET prototype system consisting of a Siemens 3T Trio MR and brain PET insert was installed and tested at our institution. Its present design does not offer measured attenuation correction (AC) using traditional transmission imaging. This study is the development of quantification tools including MR-based AC for quantification in combined MR/PET for brain imaging. Methods: The developed quantification tools include image registration, segmentation, classification, and MR-based AC. These components were integrated into a single scheme for processing MR/PET data. The segmentation method is multiscale and based on the Radon transform of brain MR images. It was developed to segment the skull on T1-weighted MR images. A modified fuzzy C-means classification scheme was developed to classify brain tissue into gray matter, white matter, and cerebrospinal fluid. Classified tissue is assigned an attenuation coefficient so that AC factors can be generated. PET emission data are then reconstructed using a three-dimensional ordered sets expectation maximization method with the MR-based AC map. Ten subjects had separate MR and PET scans. The PET with [11C]PIB was acquired using a high-resolution research tomography (HRRT) PET. MR-based AC was compared with transmission (TX)-based AC on the HRRT. Seventeen volumes of interest were drawn manually on each subject image to compare the PET activities between the MR-based and TX-based AC methods. Results: For skull segmentation, the overlap ratio between our segmented results and the ground truth is 85.2 ± 2.6%. Attenuation correction results from the ten subjects show that the difference between the MR and TX-based methods was <6.5%. Conclusions: MR-based AC compared favorably with conventional transmission-based AC. Quantitative tools including registration, segmentation, classification, and MR-based AC have been developed for use in combined MR/PET. PMID:23039679

Species-richness of the Anopheles annulipes Complex (Diptera: Culicidae) Revealed by Tree and Model-Based Allozyme Clustering Analyses

DTIC Science & Technology

2007-01-01

including tree- based methods such as the unweighted pair group method of analysis ( UPGMA ) and Neighbour-joining (NJ) (Saitou & Nei, 1987). By...based Bayesian approach and the tree-based UPGMA and NJ cluster- ing methods. The results obtained suggest that far more species occur in the An...unlikely that groups that differ by more than these levels are conspecific. Genetic distances were clustered using the UPGMA and NJ algorithms in MEGA

Monte Carlo approaches to sampling forested tracts with lines or points

Treesearch

Harry T. Valentine; Jeffrey H. Gove; Timothy G. Gregoire

2001-01-01

Several line- and point-based sampling methods can be employed to estimate the aggregate dimensions of trees standing on a forested tract or pieces of coarse woody debris lying on the forest floor. Line methods include line intersect sampling, horizontal line sampling, and transect relascope sampling; point methods include variable- and fixed-radius plot sampling, and...

Spectral multigrid methods for elliptic equations 2

NASA Technical Reports Server (NTRS)

Zang, T. A.; Wong, Y. S.; Hussaini, M. Y.

1983-01-01

A detailed description of spectral multigrid methods is provided. This includes the interpolation and coarse-grid operators for both periodic and Dirichlet problems. The spectral methods for periodic problems use Fourier series and those for Dirichlet problems are based upon Chebyshev polynomials. An improved preconditioning for Dirichlet problems is given. Numerical examples and practical advice are included.

Fast and accurate grid representations for atom-based docking with partner flexibility.

PubMed

de Vries, Sjoerd J; Zacharias, Martin

2017-06-30

Macromolecular docking methods can broadly be divided into geometric and atom-based methods. Geometric methods use fast algorithms that operate on simplified, grid-like molecular representations, while atom-based methods are more realistic and flexible, but far less efficient. Here, a hybrid approach of grid-based and atom-based docking is presented, combining precalculated grid potentials with neighbor lists for fast and accurate calculation of atom-based intermolecular energies and forces. The grid representation is compatible with simultaneous multibody docking and can tolerate considerable protein flexibility. When implemented in our docking method ATTRACT, grid-based docking was found to be ∼35x faster. With the OPLSX forcefield instead of the ATTRACT coarse-grained forcefield, the average speed improvement was >100x. Grid-based representations may allow atom-based docking methods to explore large conformational spaces with many degrees of freedom, such as multiple macromolecules including flexibility. This increases the domain of biological problems to which docking methods can be applied. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

42 CFR 441.472 - Budget methodology.

Code of Federal Regulations, 2011 CFR

2011-10-01

... based utilizing valid, reliable cost data. (2) The State's method is applied consistently to participants. (3) The State's method is open for public inspection. (4) The State's method includes a...

42 CFR 441.472 - Budget methodology.

Code of Federal Regulations, 2013 CFR

2013-10-01

... based utilizing valid, reliable cost data. (2) The State's method is applied consistently to participants. (3) The State's method is open for public inspection. (4) The State's method includes a...

Who gets how much: funding formulas in federal public health programs.

PubMed

Buehler, James W; Holtgrave, David R

2007-01-01

Federal public health programs use a mix of formula-based and competitive methods to allocate funds among states and other constituent jurisdictions. Characteristics of formula-based allocations used by a convenience sample of four programs, three from the Centers for Disease Control and Prevention and one from the Health Resources and Services Administration, are described to illustrate formula-based allocation methods in public health. Data sources in these public health formulas include population counts and funding proportions based on historical precedent. None include factors that adjust allocations based on variations in the availability of local resources or the cost of delivering services. Formula-funded activities are supplemented by programs that target specific prevention needs or encourage development of innovative methods to address emerging problems, using set-aside funds. A public health finance research agenda should address ways to improve the fit between funding allocation formulas and program objectives.

A Real-Time Infrared Ultra-Spectral Signature Classification Method via Spatial Pyramid Matching

PubMed Central

Mei, Xiaoguang; Ma, Yong; Li, Chang; Fan, Fan; Huang, Jun; Ma, Jiayi

2015-01-01

The state-of-the-art ultra-spectral sensor technology brings new hope for high precision applications due to its high spectral resolution. However, it also comes with new challenges, such as the high data dimension and noise problems. In this paper, we propose a real-time method for infrared ultra-spectral signature classification via spatial pyramid matching (SPM), which includes two aspects. First, we introduce an infrared ultra-spectral signature similarity measure method via SPM, which is the foundation of the matching-based classification method. Second, we propose the classification method with reference spectral libraries, which utilizes the SPM-based similarity for the real-time infrared ultra-spectral signature classification with robustness performance. Specifically, instead of matching with each spectrum in the spectral library, our method is based on feature matching, which includes a feature library-generating phase. We calculate the SPM-based similarity between the feature of the spectrum and that of each spectrum of the reference feature library, then take the class index of the corresponding spectrum having the maximum similarity as the final result. Experimental comparisons on two publicly-available datasets demonstrate that the proposed method effectively improves the real-time classification performance and robustness to noise. PMID:26205263

Systems and Methods for Implementing Bulk Metallic Glass-Based Strain Wave Gears and Strain Wave Gear Components

NASA Technical Reports Server (NTRS)

Hofmann, Douglas C. (Inventor); Wilcox, Brian (Inventor)

2016-01-01

Bulk metallic glass-based strain wave gears and strain wave gear components. In one embodiment, a strain wave gear includes: a wave generator; a flexspline that itself includes a first set of gear teeth; and a circular spline that itself includes a second set of gear teeth; where at least one of the wave generator, the flexspline, and the circular spline, includes a bulk metallic glass-based material.

Modeling Interactions Among Turbulence, Gas-Phase Chemistry, Soot and Radiation Using Transported PDF Methods

NASA Astrophysics Data System (ADS)

Haworth, Daniel

2013-11-01

The importance of explicitly accounting for the effects of unresolved turbulent fluctuations in Reynolds-averaged and large-eddy simulations of chemically reacting turbulent flows is increasingly recognized. Transported probability density function (PDF) methods have emerged as one of the most promising modeling approaches for this purpose. In particular, PDF methods provide an elegant and effective resolution to the closure problems that arise from averaging or filtering terms that correspond to nonlinear point processes, including chemical reaction source terms and radiative emission. PDF methods traditionally have been associated with studies of turbulence-chemistry interactions in laboratory-scale, atmospheric-pressure, nonluminous, statistically stationary nonpremixed turbulent flames; and Lagrangian particle-based Monte Carlo numerical algorithms have been the predominant method for solving modeled PDF transport equations. Recent advances and trends in PDF methods are reviewed and discussed. These include advances in particle-based algorithms, alternatives to particle-based algorithms (e.g., Eulerian field methods), treatment of combustion regimes beyond low-to-moderate-Damköhler-number nonpremixed systems (e.g., premixed flamelets), extensions to include radiation heat transfer and multiphase systems (e.g., soot and fuel sprays), and the use of PDF methods as the basis for subfilter-scale modeling in large-eddy simulation. Examples are provided that illustrate the utility and effectiveness of PDF methods for physics discovery and for applications to practical combustion systems. These include comparisons of results obtained using the PDF method with those from models that neglect unresolved turbulent fluctuations in composition and temperature in the averaged or filtered chemical source terms and/or the radiation heat transfer source terms. In this way, the effects of turbulence-chemistry-radiation interactions can be isolated and quantified.

A ricin forensic profiling approach based on a complex set of biomarkers.

PubMed

Fredriksson, Sten-Åke; Wunschel, David S; Lindström, Susanne Wiklund; Nilsson, Calle; Wahl, Karen; Åstot, Crister

2018-08-15

A forensic method for the retrospective determination of preparation methods used for illicit ricin toxin production was developed. The method was based on a complex set of biomarkers, including carbohydrates, fatty acids, seed storage proteins, in combination with data on ricin and Ricinus communis agglutinin. The analyses were performed on samples prepared from four castor bean plant (R. communis) cultivars by four different sample preparation methods (PM1-PM4) ranging from simple disintegration of the castor beans to multi-step preparation methods including different protein precipitation methods. Comprehensive analytical data was collected by use of a range of analytical methods and robust orthogonal partial least squares-discriminant analysis- models (OPLS-DA) were constructed based on the calibration set. By the use of a decision tree and two OPLS-DA models, the sample preparation methods of test set samples were determined. The model statistics of the two models were good and a 100% rate of correct predictions of the test set was achieved. Copyright © 2018 Elsevier B.V. All rights reserved.

Partial spline models for the inclusion of tropopause and frontal boundary information in otherwise smooth two- and three-dimensional objective analysis

NASA Technical Reports Server (NTRS)

Shiau, Jyh-Jen; Wahba, Grace; Johnson, Donald R.

1986-01-01

A new method, based on partial spline models, is developed for including specified discontinuities in otherwise smooth two- and three-dimensional objective analyses. The method is appropriate for including tropopause height information in two- and three-dimensinal temperature analyses, using the O'Sullivan-Wahba physical variational method for analysis of satellite radiance data, and may in principle be used in a combined variational analysis of observed, forecast, and climate information. A numerical method for its implementation is described and a prototype two-dimensional analysis based on simulated radiosonde and tropopause height data is shown. The method may also be appropriate for other geophysical problems, such as modeling the ocean thermocline, fronts, discontinuities, etc.

Apparatus and method for inspecting a bearing ball

NASA Technical Reports Server (NTRS)

Bankston, B. F. (Inventor)

1985-01-01

A method and apparatus for inspecting the surface of a ball bearing is disclosed which includes a base having a high friction non-abrasive base scanning surface. A holding device includes a cone-shaped cup recess in which a ball element is received. Air is introduced through a passage to relieve friction between the wall of the recess and the ball element and facilitate rolling of the ball over the high friction base surface. The holding device is moved over the base scanning surface in a predetermined pattern such that the entire surface of the ball element is inspected byan eddy current probe which detects any surface defects.

Research Methods Tutor: evaluation of a dialogue-based tutoring system in the classroom.

PubMed

Arnott, Elizabeth; Hastings, Peter; Allbritton, David

2008-08-01

Research Methods Tutor (RMT) is a dialogue-based intelligent tutoring system for use in conjunction with undergraduate psychology research methods courses. RMT includes five topics that correspond to the curriculum of introductory research methods courses: ethics, variables, reliability, validity, and experimental design. We evaluated the effectiveness of the RMT system in the classroom using a nonequivalent control group design. Students in three classes (n = 83) used RMT, and students in two classes (n = 53) did not use RMT. Results indicated that the use of RMT yieldedstrong learning gains of 0.75 standard deviations above classroom instruction alone. Further, the dialogue-based tutoring condition of the system resulted in higher gains than did the textbook-style condition (CAI version) of the system. Future directions for RMT include the addition of new topics and tutoring elements.

Current Progress in Gene Delivery Technology Based on Chemical Methods and Nano-carriers

PubMed Central

Jin, Lian; Zeng, Xin; Liu, Ming; Deng, Yan; He, Nongyue

2014-01-01

Gene transfer methods are promising in the field of gene therapy. Current methods for gene transfer include three major groups: viral, physical and chemical methods. This review mainly summarizes development of several types of chemical methods for gene transfer in vitro and in vivo by means of nano-carriers like; calcium phosphates, lipids, and cationic polymers including chitosan, polyethylenimine, polyamidoamine dendrimers, and poly(lactide-co-glycolide). This review also briefly introduces applications of these chemical methods for gene delivery. PMID:24505233

Measurement of Walking Ground Reactions in Real-Life Environments: A Systematic Review of Techniques and Technologies.

PubMed

Shahabpoor, Erfan; Pavic, Aleksandar

2017-09-12

Monitoring natural human gait in real-life environments is essential in many applications, including quantification of disease progression, monitoring the effects of treatment, and monitoring alteration of performance biomarkers in professional sports. Nevertheless, developing reliable and practical techniques and technologies necessary for continuous real-life monitoring of gait is still an open challenge. A systematic review of English-language articles from scientific databases including Scopus, ScienceDirect, Pubmed, IEEE Xplore, EBSCO and MEDLINE were carried out to analyse the 'accuracy' and 'practicality' of the current techniques and technologies for quantitative measurement of the tri-axial walking ground reactions outside the laboratory environment, and to highlight their strengths and shortcomings. In total, 679 relevant abstracts were identified, 54 full-text papers were included in the paper and the quantitative results of 17 papers were used for meta-analysis and comparison. Three classes of methods were reviewed: (1) methods based on measured kinematic data; (2) methods based on measured plantar pressure; and (3) methods based on direct measurement of ground reactions. It was found that all three classes of methods have competitive accuracy levels with methods based on direct measurement of the ground reactions showing highest accuracy while being least practical for long-term real-life measurement. On the other hand, methods that estimate ground reactions using measured body kinematics show highest practicality of the three classes of methods reviewed. Among the most prominent technical and technological challenges are: (1) reducing the size and price of tri-axial load-cells; (2) improving the accuracy of orientation measurement using IMUs; (3) minimizing the number and optimizing the location of required IMUs for kinematic measurement; (4) increasing the durability of pressure insole sensors, and (5) enhancing the robustness and versatility of the ground reactions estimation methods to include pathological gaits and natural variability of gait in real-life physical environment.

Measurement of Walking Ground Reactions in Real-Life Environments: A Systematic Review of Techniques and Technologies

PubMed Central

Shahabpoor, Erfan; Pavic, Aleksandar

2017-01-01

Monitoring natural human gait in real-life environments is essential in many applications, including quantification of disease progression, monitoring the effects of treatment, and monitoring alteration of performance biomarkers in professional sports. Nevertheless, developing reliable and practical techniques and technologies necessary for continuous real-life monitoring of gait is still an open challenge. A systematic review of English-language articles from scientific databases including Scopus, ScienceDirect, Pubmed, IEEE Xplore, EBSCO and MEDLINE were carried out to analyse the ‘accuracy’ and ‘practicality’ of the current techniques and technologies for quantitative measurement of the tri-axial walking ground reactions outside the laboratory environment, and to highlight their strengths and shortcomings. In total, 679 relevant abstracts were identified, 54 full-text papers were included in the paper and the quantitative results of 17 papers were used for meta-analysis and comparison. Three classes of methods were reviewed: (1) methods based on measured kinematic data; (2) methods based on measured plantar pressure; and (3) methods based on direct measurement of ground reactions. It was found that all three classes of methods have competitive accuracy levels with methods based on direct measurement of the ground reactions showing highest accuracy while being least practical for long-term real-life measurement. On the other hand, methods that estimate ground reactions using measured body kinematics show highest practicality of the three classes of methods reviewed. Among the most prominent technical and technological challenges are: (1) reducing the size and price of tri-axial load-cells; (2) improving the accuracy of orientation measurement using IMUs; (3) minimizing the number and optimizing the location of required IMUs for kinematic measurement; (4) increasing the durability of pressure insole sensors, and (5) enhancing the robustness and versatility of the ground reactions estimation methods to include pathological gaits and natural variability of gait in real-life physical environment. PMID:28895909

A new automated NaCl based robust method for routine production of gallium-68 labeled peptides

PubMed Central

Schultz, Michael K.; Mueller, Dirk; Baum, Richard P.; Watkins, G. Leonard; Breeman, Wouter A. P.

2017-01-01

A new NaCl based method for preparation of gallium-68 labeled radiopharmaceuticals has been adapted for use with an automated gallium-68 generator system. The method was evaluated based on 56 preparations of [68Ga]DOTATOC and compared to a similar acetone-based approach. Advantages of the new NaCl approach include reduced preparation time (< 15 min) and removal of organic solvents. The method produces high peptide-bound % (> 97%), and specific activity (> 40 MBq nmole−1 [68Ga]DOTATOC) and is well-suited for clinical production of radiopharmaceuticals. PMID:23026223

Pre-form ceramic matrix composite cavity and method of forming and method of forming a ceramic matrix composite component

DOEpatents

Monaghan, Philip Harold; Delvaux, John McConnell; Taxacher, Glenn Curtis

2015-06-09

A pre-form CMC cavity and method of forming pre-form CMC cavity for a ceramic matrix component includes providing a mandrel, applying a base ply to the mandrel, laying-up at least one CMC ply on the base ply, removing the mandrel, and densifying the base ply and the at least one CMC ply. The remaining densified base ply and at least one CMC ply form a ceramic matrix component having a desired geometry and a cavity formed therein. Also provided is a method of forming a CMC component.

Nested PCR and RFLP analysis based on the 16S rRNA gene

USDA-ARS?s Scientific Manuscript database

Current phytoplasma detection and identification method is primarily based on nested PCR followed by restriction fragment length polymorphism analysis and gel electrophoresis. This method can potentially detect and differentiate all phytoplasmas including those previously not described. The present ...

Extraction film for optical waveguide and method of producing same

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tarsa, Eric J.; Durkee, John W.

2017-05-16

An optical waveguide includes a waveguide body and a film disposed on a surface of the waveguide body. The film includes a base and a plurality of undercut light extraction elements disposed between the base and the surface.

A calibration method of infrared LVF based spectroradiometer

NASA Astrophysics Data System (ADS)

Liu, Jiaqing; Han, Shunli; Liu, Lei; Hu, Dexin

2017-10-01

In this paper, a calibration method of LVF-based spectroradiometer is summarize, including spectral calibration and radiometric calibration. The spectral calibration process as follow: first, the relationship between stepping motor's step number and transmission wavelength is derivative by theoretical calculation, including a non-linearity correction of LVF;second, a line-to-line method was used to corrected the theoretical wavelength; Finally, the 3.39 μm and 10.69 μm laser is used for spectral calibration validation, show the sought 0.1% accuracy or better is achieved.A new sub-region multi-point calibration method is used for radiometric calibration to improving accuracy, results show the sought 1% accuracy or better is achieved.

Teaching Data Base Search Strategies.

ERIC Educational Resources Information Center

Hannah, Larry

1987-01-01

Discusses database searching as a method for developing thinking skills, and describes an activity suitable for fifth grade through high school using a president's and vice president's database. Teaching methods are presented, including student team activities, and worksheets designed for the AppleWorks database are included. (LRW)

Measuring Symmetry in Children With Unrepaired Cleft Lip: Defining a Standard for the Three-Dimensional Midfacial Reference Plane.

PubMed

Wu, Jia; Heike, Carrie; Birgfeld, Craig; Evans, Kelly; Maga, Murat; Morrison, Clinton; Saltzman, Babette; Shapiro, Linda; Tse, Raymond

2016-11-01

  Quantitative measures of facial form to evaluate treatment outcomes for cleft lip (CL) are currently limited. Computer-based analysis of three-dimensional (3D) images provides an opportunity for efficient and objective analysis. The purpose of this study was to define a computer-based standard of identifying the 3D midfacial reference plane of the face in children with unrepaired cleft lip for measurement of facial symmetry.   The 3D images of 50 subjects (35 with unilateral CL, 10 with bilateral CL, five controls) were included in this study.   Five methods of defining a midfacial plane were applied to each image, including two human-based (Direct Placement, Manual Landmark) and three computer-based (Mirror, Deformation, Learning) methods.   Six blinded raters (three cleft surgeons, two craniofacial pediatricians, and one craniofacial researcher) independently ranked and rated the accuracy of the defined planes.   Among computer-based methods, the Deformation method performed significantly better than the others. Although human-based methods performed best, there was no significant difference compared with the Deformation method. The average correlation coefficient among raters was .4; however, it was .7 and .9 when the angular difference between planes was greater than 6° and 8°, respectively.   Raters can agree on the 3D midfacial reference plane in children with unrepaired CL using digital surface mesh. The Deformation method performed best among computer-based methods evaluated and can be considered a useful tool to carry out automated measurements of facial symmetry in children with unrepaired cleft lip.

Infra-red signature neutron detector

DOEpatents

Bell, Zane William [Oak Ridge, TN; Boatner, Lynn Allen [Oak Ridge, TN

2009-10-13

A method of detecting an activator, the method including impinging with an activator a receptor material that includes a photoluminescent material that generates infrared radiation and generation a by-product of a nuclear reaction due to the activator impinging the receptor material. The method further includes generating light from the by-product via the Cherenkov effect, wherein the light activates the photoluminescent material so as to generate the infrared radiation. Identifying a characteristic of the activator based on the infrared radiation.

Determining postural stability

NASA Technical Reports Server (NTRS)

Forth, Katharine E. (Inventor); Paloski, William H. (Inventor); Lieberman, Erez (Inventor)

2011-01-01

A method for determining postural stability of a person can include acquiring a plurality of pressure data points over a period of time from at least one pressure sensor. The method can also include the step of identifying a postural state for each pressure data point to generate a plurality of postural states. The method can include the step of determining a postural state of the person at a point in time based on at least the plurality of postural states.

A Framework for Problem-Based Learning: Teaching Mathematics with a Relational Problem-Based Pedagogy

ERIC Educational Resources Information Center

Schettino, Carmel

2016-01-01

One recommendation for encouraging young women and other underrepresented students in their mathematical studies is to find instructional methods, such as problem-based learning (PBL), that allow them to feel included in the learning process. Using a more relationally centered pedagogy along with more inclusive instructional methods may be a way…

An analysis of shock coalescence including three-dimensional effects with application to sonic boom extrapolation. Ph.D. Thesis - George Washington Univ.

NASA Technical Reports Server (NTRS)

Darden, C. M.

1984-01-01

A method for analyzing shock coalescence which includes three dimensional effects was developed. The method is based on an extension of the axisymmetric solution, with asymmetric effects introduced through an additional set of governing equations, derived by taking the second circumferential derivative of the standard shock equations in the plane of symmetry. The coalescence method is consistent with and has been combined with a nonlinear sonic boom extrapolation program which is based on the method of characteristics. The extrapolation program, is able to extrapolate pressure signatures which include embedded shocks from an initial data line in the plane of symmetry at approximately one body length from the axis of the aircraft to the ground. The axisymmetric shock coalescence solution, the asymmetric shock coalescence solution, the method of incorporating these solutions into the extrapolation program, and the methods used to determine spatial derivatives needed in the coalescence solution are described. Results of the method are shown for a body of revolution at a small, positive angle of attack.

Flight-Test Evaluation of Flutter-Prediction Methods

NASA Technical Reports Server (NTRS)

Lind, RIck; Brenner, Marty

2003-01-01

The flight-test community routinely spends considerable time and money to determine a range of flight conditions, called a flight envelope, within which an aircraft is safe to fly. The cost of determining a flight envelope could be greatly reduced if there were a method of safely and accurately predicting the speed associated with the onset of an instability called flutter. Several methods have been developed with the goal of predicting flutter speeds to improve the efficiency of flight testing. These methods include (1) data-based methods, in which one relies entirely on information obtained from the flight tests and (2) model-based approaches, in which one relies on a combination of flight data and theoretical models. The data-driven methods include one based on extrapolation of damping trends, one that involves an envelope function, one that involves the Zimmerman-Weissenburger flutter margin, and one that involves a discrete-time auto-regressive model. An example of a model-based approach is that of the flutterometer. These methods have all been shown to be theoretically valid and have been demonstrated on simple test cases; however, until now, they have not been thoroughly evaluated in flight tests. An experimental apparatus called the Aerostructures Test Wing (ATW) was developed to test these prediction methods.

Light Scattering based detection of food pathogens

USDA-ARS?s Scientific Manuscript database

The current methods for detecting foodborne pathogens are mostly destructive (i.e., samples need to be pretreated), and require time, personnel, and laboratories for analyses. Optical methods including light scattering based techniques have gained a lot of attention recently due to its their rapid a...

Evaluation of medical students of teacher-based and student-based teaching methods in Infectious diseases course.

PubMed

Ghasemzadeh, I; Aghamolaei, T; Hosseini-Parandar, F

2015-01-01

Introduction: In recent years, medical education has changed dramatically and many medical schools in the world have been trying for expand modern training methods. Purpose of the research is to appraise the medical students of teacher-based and student-based teaching methods in Infectious diseases course, in the Medical School of Hormozgan Medical Sciences University. Methods: In this interventional study, a total of 52 medical scholars that used Section in this Infectious diseases course were included. About 50% of this course was presented by a teacher-based teaching method (lecture) and 50% by a student-based teaching method (problem-based learning). The satisfaction of students regarding these methods was assessed by a questionnaire and a test was used to measure their learning. information are examined with using SPSS 19 and paired t-test. Results: The satisfaction of students of student-based teaching method (problem-based learning) was more positive than their satisfaction of teacher-based teaching method (lecture).The mean score of students in teacher-based teaching method was 12.03 (SD=4.08) and in the student-based teaching method it was 15.50 (SD=4.26) and where is a considerable variation among them (p<0.001). Conclusion: The use of the student-based teaching method (problem-based learning) in comparison with the teacher-based teaching method (lecture) to present the Infectious diseases course led to the student satisfaction and provided additional learning opportunities.

Integrating Ethics into the Social Studies Curriculum.

ERIC Educational Resources Information Center

Howe, Kenneth R.

1991-01-01

Urges incorporation of ethics into social studies curriculum. Provides an overview of ethical theory including principle-based theories of utilitarianism and deontology and virtue-based theories. Discusses philosophies of social science including positivism, interpretivism, and critical social science. Suggests teaching methods and curriculum…

Hooked on Coal: Meeting Energy Demands in the Philippines

DTIC Science & Technology

2011-10-27

has chosen to employ a variety of methods to generate power. In 2016 the country’s electrical generation mix included coal, natural gas, oil -based...12 percent, hydroelectric 9 percent, oil -based 6 percent, and biomass, solar, and wind-based generation methods each account for 1 percent of the...increased by 17 percent, and oil - based generation has decreased by 8 percent. During that same period, however, coal-based generation has increased

System and method for air temperature control in an oxygen transport membrane based reactor

DOEpatents

Kelly, Sean M

2016-09-27

A system and method for air temperature control in an oxygen transport membrane based reactor is provided. The system and method involves introducing a specific quantity of cooling air or trim air in between stages in a multistage oxygen transport membrane based reactor or furnace to maintain generally consistent surface temperatures of the oxygen transport membrane elements and associated reactors. The associated reactors may include reforming reactors, boilers or process gas heaters.

System and method for temperature control in an oxygen transport membrane based reactor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kelly, Sean M.

A system and method for temperature control in an oxygen transport membrane based reactor is provided. The system and method involves introducing a specific quantity of cooling air or trim air in between stages in a multistage oxygen transport membrane based reactor or furnace to maintain generally consistent surface temperatures of the oxygen transport membrane elements and associated reactors. The associated reactors may include reforming reactors, boilers or process gas heaters.

Impact of Active Teaching Methods Implemented on Therapeutic Chemistry Module: Performance and Impressions of First-Year Pharmacy Students

ERIC Educational Resources Information Center

Derfoufi, Sanae; Benmoussa, Adnane; El Harti, Jaouad; Ramli, Youssef; Taoufik, Jamal; Chaouir, Souad

2015-01-01

This study investigates the positive impact of the Case Method implemented during a 4- hours tutorial in "therapeutic chemistry module." We view the Case Method as one particular approach within the broader spectrum of problem based or inquiry based learning approaches. Sixty students were included in data analysis. A pre-test and…

A text zero-watermarking method based on keyword dense interval

NASA Astrophysics Data System (ADS)

Yang, Fan; Zhu, Yuesheng; Jiang, Yifeng; Qing, Yin

2017-07-01

Digital watermarking has been recognized as a useful technology for the copyright protection and authentication of digital information. However, rarely did the former methods focus on the key content of digital carrier. The idea based on the protection of key content is more targeted and can be considered in different digital information, including text, image and video. In this paper, we use text as research object and a text zero-watermarking method which uses keyword dense interval (KDI) as the key content is proposed. First, we construct zero-watermarking model by introducing the concept of KDI and giving the method of KDI extraction. Second, we design detection model which includes secondary generation of zero-watermark and the similarity computing method of keyword distribution. Besides, experiments are carried out, and the results show that the proposed method gives better performance than other available methods especially in the attacks of sentence transformation and synonyms substitution.

The spa typing of methicillin-resistant Staphylococcus aureus isolates by High Resolution Melting (HRM) analysis.

PubMed

Fasihi, Yasser; Fooladi, Saba; Mohammadi, Mohammad Ali; Emaneini, Mohammad; Kalantar-Neyestanaki, Davood

2017-09-06

Molecular typing is an important tool for control and prevention of infection. A suitable molecular typing method for epidemiological investigation must be easy to perform, highly reproducible, inexpensive, rapid and easy to interpret. In this study, two molecular typing methods including the conventional PCR-sequencing method and high resolution melting (HRM) analysis were used for staphylococcal protein A (spa) typing of 30 Methicillin-resistant Staphylococcus aureus (MRSA) isolates recovered from clinical samples. Based on PCR-sequencing method results, 16 different spa types were identified among the 30 MRSA isolates. Among the 16 different spa types, 14 spa types separated by HRM method. Two spa types including t4718 and t2894 were not separated from each other. According to our results, spa typing based on HRM analysis method is very rapid, easy to perform and cost-effective, but this method must be standardized for different regions, spa types, and real-time machinery.

Automatic identification of abstract online groups

DOEpatents

Engel, David W; Gregory, Michelle L; Bell, Eric B; Cowell, Andrew J; Piatt, Andrew W

2014-04-15

Online abstract groups, in which members aren't explicitly connected, can be automatically identified by computer-implemented methods. The methods involve harvesting records from social media and extracting content-based and structure-based features from each record. Each record includes a social-media posting and is associated with one or more entities. Each feature is stored on a data storage device and includes a computer-readable representation of an attribute of one or more records. The methods further involve grouping records into record groups according to the features of each record. Further still the methods involve calculating an n-dimensional surface representing each record group and defining an outlier as a record having feature-based distances measured from every n-dimensional surface that exceed a threshold value. Each of the n-dimensional surfaces is described by a footprint that characterizes the respective record group as an online abstract group.

Method and system for efficient video compression with low-complexity encoder

NASA Technical Reports Server (NTRS)

Chen, Jun (Inventor); He, Dake (Inventor); Sheinin, Vadim (Inventor); Jagmohan, Ashish (Inventor); Lu, Ligang (Inventor)

2012-01-01

Disclosed are a method and system for video compression, wherein the video encoder has low computational complexity and high compression efficiency. The disclosed system comprises a video encoder and a video decoder, wherein the method for encoding includes the steps of converting a source frame into a space-frequency representation; estimating conditional statistics of at least one vector of space-frequency coefficients; estimating encoding rates based on the said conditional statistics; and applying Slepian-Wolf codes with the said computed encoding rates. The preferred method for decoding includes the steps of; generating a side-information vector of frequency coefficients based on previously decoded source data, encoder statistics, and previous reconstructions of the source frequency vector; and performing Slepian-Wolf decoding of at least one source frequency vector based on the generated side-information, the Slepian-Wolf code bits and the encoder statistics.

Gamma ray spectroscopy employing divalent europium-doped alkaline earth halides and digital readout for accurate histogramming

DOEpatents

Cherepy, Nerine Jane; Payne, Stephen Anthony; Drury, Owen B; Sturm, Benjamin W

2014-11-11

A scintillator radiation detector system according to one embodiment includes a scintillator; and a processing device for processing pulse traces corresponding to light pulses from the scintillator, wherein pulse digitization is used to improve energy resolution of the system. A scintillator radiation detector system according to another embodiment includes a processing device for fitting digitized scintillation waveforms to an algorithm based on identifying rise and decay times and performing a direct integration of fit parameters. A method according to yet another embodiment includes processing pulse traces corresponding to light pulses from a scintillator, wherein pulse digitization is used to improve energy resolution of the system. A method in a further embodiment includes fitting digitized scintillation waveforms to an algorithm based on identifying rise and decay times; and performing a direct integration of fit parameters. Additional systems and methods are also presented.

Determination of allergenic egg proteins in food by protein-, mass spectrometry-, and DNA-based methods.

PubMed

Lee, Ji-Yun; Kim, Chang Jong

2010-01-01

Egg allergy is one of the most common food allergies in both adults and children, and foods including eggs and their byproducts should be declared under food allergen labeling policies in industrial countries. Therefore, to develop and validate a sensitive and specific method to detect hidden egg allergens in foods, we compared immunochemical, DNA-based, and proteomic methods for detecting egg allergens in foods using egg allergen standards such as egg whole protein, egg white protein, egg yolk protein, ovomucoid, ovalbumin, ovotransferrin, lysozyme, and alpha-livetin. Protein-based immunochemical methods, including ELISA as an initial screening quantitative analysis and immunoblotting as a final confirmatory qualitative analysis, were very sensitive and specific in detecting potentially allergenic egg residues in processed foods in trace amounts. In contrast, the proteomics-based, matrix-assisted laser desorption/ionization time-of-flight MS and LC-tandem quadrupole time-of-flight MS methods were not able to detect some egg allergens, such as ovomucoid, because of its nondenaturing property under urea and trypsin. The DNA-based PCR method could not distinguish between egg and chicken meat because it is tissue-nonspecific. In further studies for the feasibility of these immunochemical methods on 100 real raw dietary samples, four food samples without listed egg ingredients produced a positive response by ELISA, but exhibited negative results by immunoblotting.

The use of rapid review methods in health technology assessments: 3 case studies.

PubMed

Kaltenthaler, Eva; Cooper, Katy; Pandor, Abdullah; Martyn-St James, Marrissa; Chatters, Robin; Wong, Ruth

2016-08-26

Rapid reviews are of increasing importance within health technology assessment due to time and resource constraints. There are many rapid review methods available although there is little guidance as to the most suitable methods. We present three case studies employing differing methods to suit the evidence base for each review and outline some issues to consider when selecting an appropriate method. Three recently completed systematic review short reports produced for the UK National Institute for Health Research were examined. Different approaches to rapid review methods were used in the three reports which were undertaken to inform the commissioning of services within the NHS and to inform future trial design. We describe the methods used, the reasoning behind the choice of methods and explore the strengths and weaknesses of each method. Rapid review methods were chosen to meet the needs of the review and each review had distinctly different challenges such as heterogeneity in terms of populations, interventions, comparators and outcome measures (PICO) and/or large numbers of relevant trials. All reviews included at least 10 randomised controlled trials (RCTs), each with numerous included outcomes. For the first case study (sexual health interventions), very diverse studies in terms of PICO were included. P-values and summary information only were presented due to substantial heterogeneity between studies and outcomes measured. For the second case study (premature ejaculation treatments), there were over 100 RCTs but also several existing systematic reviews. Data for meta-analyses were extracted directly from existing systematic reviews with new RCT data added where available. For the final case study (cannabis cessation therapies), studies included a wide range of interventions and considerable variation in study populations and outcomes. A brief summary of the key findings for each study was presented and narrative synthesis used to summarise results for each pair of interventions compared. Rapid review methods need to be chosen to meet both the nature of the evidence base of a review and the challenges presented by the included studies. Appropriate methods should be chosen after an assessment of the evidence base.

Field-based generation and social validation managers and staff competencies for small community residences.

PubMed

Thousand, J S; Burchard, S N; Hasazi, J E

1986-01-01

Characteristics and competencies for four staff positions in community residences for individuals with mental retardation were identified utilizing multiple empirical and deductive methods with field-based practitioners and field-based experts. The more commonly used competency generation methods of expert opinion and job performance analysis generated a high degree of knowledge and skill-based competencies similar to course curricula. Competencies generated by incumbent practitioners through open-ended methods of personal structured interview and critical incident analysis were ones which related to personal style, interpersonal interaction, and humanistic orientation. Although seldom included in staff, paraprofessional, or professional training curricula, these latter competencies include those identified by Carl Rogers as essential for developing an effective helping relationship in a therapeutic situation (i.e., showing liking, interest, and respect for the clients; being able to communicate positive regard to the client). Of 21 core competency statements selected as prerequisites to employment for all four staff positions, the majority (17 of 21) represented interpersonal skills important to working with others, including responsiveness to resident needs, personal valuation of persons with mental retardation, and normalization principles.

Methods of making non-covalently bonded carbon-titania nanocomposite thin films and applications of the same

DOEpatents

Liang, Yu Teng; Vijayan, Baiju K.; Gray, Kimberly A.; Hersam, Mark C.

2016-07-19

In one aspect, a method of making non-covalently bonded carbon-titania nanocomposite thin films includes: forming a carbon-based ink; forming a titania (TiO.sub.2) solution; blade-coating a mechanical mixture of the carbon-based ink and the titania solution onto a substrate; and annealing the blade-coated substrate at a first temperature for a first period of time to obtain the carbon-based titania nanocomposite thin films. In certain embodiments, the carbon-based titania nanocomposite thin films may include solvent-exfoliated graphene titania (SEG-TiO.sub.2) nanocomposite thin films, or single walled carbon nanotube titania (SWCNT-TiO.sub.2) nanocomposite thin films.

Method for improving the toughness of silicon carbide-based ceramics

DOEpatents

Tein, Tseng-Ying; Hilmas, Gregory E.

1996-01-01

Method of improving the toughness of SiC-based ceramics. SiC, , AlN, Al.sub.2 O.sub.3 and optionally .alpha.-Si.sub.3 N.sub.4 are hot pressed to form a material which includes AlN polytypoids within its structure.

Detection and categorization of bacteria habitats using shallow linguistic analysis

PubMed Central

2015-01-01

Background Information regarding bacteria biotopes is important for several research areas including health sciences, microbiology, and food processing and preservation. One of the challenges for scientists in these domains is the huge amount of information buried in the text of electronic resources. Developing methods to automatically extract bacteria habitat relations from the text of these electronic resources is crucial for facilitating research in these areas. Methods We introduce a linguistically motivated rule-based approach for recognizing and normalizing names of bacteria habitats in biomedical text by using an ontology. Our approach is based on the shallow syntactic analysis of the text that include sentence segmentation, part-of-speech (POS) tagging, partial parsing, and lemmatization. In addition, we propose two methods for identifying bacteria habitat localization relations. The underlying assumption for the first method is that discourse changes with a new paragraph. Therefore, it operates on a paragraph-basis. The second method performs a more fine-grained analysis of the text and operates on a sentence-basis. We also develop a novel anaphora resolution method for bacteria coreferences and incorporate it with the sentence-based relation extraction approach. Results We participated in the Bacteria Biotope (BB) Task of the BioNLP Shared Task 2013. Our system (Boun) achieved the second best performance with 68% Slot Error Rate (SER) in Sub-task 1 (Entity Detection and Categorization), and ranked third with an F-score of 27% in Sub-task 2 (Localization Event Extraction). This paper reports the system that is implemented for the shared task, including the novel methods developed and the improvements obtained after the official evaluation. The extensions include the expansion of the OntoBiotope ontology using the training set for Sub-task 1, and the novel sentence-based relation extraction method incorporated with anaphora resolution for Sub-task 2. These extensions resulted in promising results for Sub-task 1 with a SER of 68%, and state-of-the-art performance for Sub-task 2 with an F-score of 53%. Conclusions Our results show that a linguistically-oriented approach based on the shallow syntactic analysis of the text is as effective as machine learning approaches for the detection and ontology-based normalization of habitat entities. Furthermore, the newly developed sentence-based relation extraction system with the anaphora resolution module significantly outperforms the paragraph-based one, as well as the other systems that participated in the BB Shared Task 2013. PMID:26201262

Methods, media, and systems for detecting attack on a digital processing device

DOEpatents

Stolfo, Salvatore J.; Li, Wei-Jen; Keromylis, Angelos D.; Androulaki, Elli

2014-07-22

Methods, media, and systems for detecting attack are provided. In some embodiments, the methods include: comparing at least part of a document to a static detection model; determining whether attacking code is included in the document based on the comparison of the document to the static detection model; executing at least part of the document; determining whether attacking code is included in the document based on the execution of the at least part of the document; and if attacking code is determined to be included in the document based on at least one of the comparison of the document to the static detection model and the execution of the at least part of the document, reporting the presence of an attack. In some embodiments, the methods include: selecting a data segment in at least one portion of an electronic document; determining whether the arbitrarily selected data segment can be altered without causing the electronic document to result in an error when processed by a corresponding program; in response to determining that the arbitrarily selected data segment can be altered, arbitrarily altering the data segment in the at least one portion of the electronic document to produce an altered electronic document; and determining whether the corresponding program produces an error state when the altered electronic document is processed by the corresponding program.

Methods, media, and systems for detecting attack on a digital processing device

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stolfo, Salvatore J.; Li, Wei-Jen; Keromytis, Angelos D.

Methods, media, and systems for detecting attack are provided. In some embodiments, the methods include: comparing at least part of a document to a static detection model; determining whether attacking code is included in the document based on the comparison of the document to the static detection model; executing at least part of the document; determining whether attacking code is included in the document based on the execution of the at least part of the document; and if attacking code is determined to be included in the document based on at least one of the comparison of the document tomore » the static detection model and the execution of the at least part of the document, reporting the presence of an attack. In some embodiments, the methods include: selecting a data segment in at least one portion of an electronic document; determining whether the arbitrarily selected data segment can be altered without causing the electronic document to result in an error when processed by a corresponding program; in response to determining that the arbitrarily selected data segment can be altered, arbitrarily altering the data segment in the at least one portion of the electronic document to produce an altered electronic document; and determining whether the corresponding program produces an error state when the altered electronic document is processed by the corresponding program.« less

Composites comprising novel RTIL-based polymers, and methods of making and using same

DOEpatents

Gin, Douglas; Carlisle, Trevor; Noble, Richard; Nicodemus, Garret; McDanel, William; Cowan, Matthew

2017-06-27

The invention includes compositions comprising curable imidazolium-functionalized poly(room-temperature ionic liquid) copolymers and homopolymers. The invention further includes methods of preparing and using the compositions of the invention. The invention further includes novel methods of preparing thin, supported, room-temperature ionic liquid-containing polymeric films on a porous support. In certain embodiments, the methods of the invention avoid the use of a gutter layer, which greatly reduces the overall gas permeance and selectivity of the composite membrane. In other embodiments, the films of the invention have increased gas selectivity and permeance over films prepared using methods described in the prior art.

A Survey of Model Evaluation Approaches with a Tutorial on Hierarchical Bayesian Methods

ERIC Educational Resources Information Center

Shiffrin, Richard M.; Lee, Michael D.; Kim, Woojae; Wagenmakers, Eric-Jan

2008-01-01

This article reviews current methods for evaluating models in the cognitive sciences, including theoretically based approaches, such as Bayes factors and minimum description length measures; simulation approaches, including model mimicry evaluations; and practical approaches, such as validation and generalization measures. This article argues…

Maintaining a permanent plot data base for growth and yield research: Solutions to some recurring problems

Treesearch

John C. Byrne

1993-01-01

Methods for solving some recurring problems of maintaining a permanent plot data base for growth and yield reseuch are described. These methods include documenting data from diverse sampling designs, changing sampling designs, changing field procedures, and coordinating activities in the plots with the land management agency. Managing a permanent plot data base (...

Internet-based biosurveillance methods for vector-borne diseases: Are they novel public health tools or just novelties?

PubMed

Pollett, Simon; Althouse, Benjamin M; Forshey, Brett; Rutherford, George W; Jarman, Richard G

2017-11-01

Internet-based surveillance methods for vector-borne diseases (VBDs) using "big data" sources such as Google, Twitter, and internet newswire scraping have recently been developed, yet reviews on such "digital disease detection" methods have focused on respiratory pathogens, particularly in high-income regions. Here, we present a narrative review of the literature that has examined the performance of internet-based biosurveillance for diseases caused by vector-borne viruses, parasites, and other pathogens, including Zika, dengue, other arthropod-borne viruses, malaria, leishmaniasis, and Lyme disease across a range of settings, including low- and middle-income countries. The fundamental features, advantages, and drawbacks of each internet big data source are presented for those with varying familiarity of "digital epidemiology." We conclude with some of the challenges and future directions in using internet-based biosurveillance for the surveillance and control of VBD.

Internet-based biosurveillance methods for vector-borne diseases: Are they novel public health tools or just novelties?

PubMed Central

Pollett, Simon; Althouse, Benjamin M.; Forshey, Brett; Rutherford, George W.; Jarman, Richard G.

2017-01-01

Internet-based surveillance methods for vector-borne diseases (VBDs) using “big data” sources such as Google, Twitter, and internet newswire scraping have recently been developed, yet reviews on such “digital disease detection” methods have focused on respiratory pathogens, particularly in high-income regions. Here, we present a narrative review of the literature that has examined the performance of internet-based biosurveillance for diseases caused by vector-borne viruses, parasites, and other pathogens, including Zika, dengue, other arthropod-borne viruses, malaria, leishmaniasis, and Lyme disease across a range of settings, including low- and middle-income countries. The fundamental features, advantages, and drawbacks of each internet big data source are presented for those with varying familiarity of “digital epidemiology.” We conclude with some of the challenges and future directions in using internet-based biosurveillance for the surveillance and control of VBD. PMID:29190281

Waterflooding injectate design systems and methods

DOEpatents

Brady, Patrick V.; Krumhansl, James L.

2016-12-13

A method of recovering a liquid hydrocarbon using an injectate includes recovering the liquid hydrocarbon through primary extraction. Physico-chemical data representative of electrostatic interactions between the liquid hydrocarbon and the reservoir rock are measured. At least one additive of the injectate is selected based on the physico-chemical data. The method includes recovering the liquid hydrocarbon from the reservoir rock through secondary extraction using the injectate.

Method and apparatus for wind turbine braking

DOEpatents

Barbu, Corneliu [Laguna Hills, CA; Teichmann, Ralph [Nishkayuna, NY; Avagliano, Aaron [Houston, TX; Kammer, Leonardo Cesar [Niskayuna, NY; Pierce, Kirk Gee [Simpsonville, SC; Pesetsky, David Samuel [Greenville, SC; Gauchel, Peter [Muenster, DE

2009-02-10

A method for braking a wind turbine including at least one rotor blade coupled to a rotor. The method includes selectively controlling an angle of pitch of the at least one rotor blade with respect to a wind direction based on a design parameter of a component of the wind turbine to facilitate reducing a force induced into the wind turbine component as a result of braking.

Using Corporate-Based Methods To Assess Technical Communication Programs.

ERIC Educational Resources Information Center

Faber, Brenton; Bekins, Linn; Karis, Bill

2002-01-01

Investigates methods of program assessment used by corporate learning sites and profiles value added methods as a way to both construct and evaluate academic programs in technical communication. Examines and critiques assessment methods from corporate training environments including methods employed by corporate universities and value added…

PASTA for Proteins.

PubMed

Collins, Kodi; Warnow, Tandy

2018-06-19

PASTA is a multiple sequence method that uses divide-and-conquer plus iteration to enable base alignment methods to scale with high accuracy to large sequence datasets. By default, PASTA included MAFFT L-INS-i; our new extension of PASTA enables the use of MAFFT G-INS-i, MAFFT Homologs, CONTRAlign, and ProbCons. We analyzed the performance of each base method and PASTA using these base methods on 224 datasets from BAliBASE 4 with at least 50 sequences. We show that PASTA enables the most accurate base methods to scale to larger datasets at reduced computational effort, and generally improves alignment and tree accuracy on the largest BAliBASE datasets. PASTA is available at https://github.com/kodicollins/pasta and has also been integrated into the original PASTA repository at https://github.com/smirarab/pasta. Supplementary data are available at Bioinformatics online.

Three-dimensional, position-sensitive radiation detection

DOEpatents

He, Zhong; Zhang, Feng

2010-04-06

Disclosed herein is a method of determining a characteristic of radiation detected by a radiation detector via a multiple-pixel event having a plurality of radiation interactions. The method includes determining a cathode-to-anode signal ratio for a selected interaction of the plurality of radiation interactions based on electron drift time data for the selected interaction, and determining the radiation characteristic for the multiple-pixel event based on both the cathode-to-anode signal ratio and the electron drift time data. In some embodiments, the method further includes determining a correction factor for the radiation characteristic based on an interaction depth of the plurality of radiation interactions, a lateral distance between the selected interaction and a further interaction of the plurality of radiation interactions, and the lateral positioning of the plurality of radiation interactions.

Does time-lapse imaging have favorable results for embryo incubation and selection compared with conventional methods in clinical in vitro fertilization? A meta-analysis and systematic review of randomized controlled trials

PubMed Central

Yuan, Jing; Liu, Fenghua

2017-01-01

Objective The present study aimed to undertake a review of available evidence assessing whether time-lapse imaging (TLI) has favorable outcomes for embryo incubation and selection compared with conventional methods in clinical in vitro fertilization (IVF). Methods Using PubMed, EMBASE, Cochrane library and ClinicalTrial.gov up to February 2017 to search for randomized controlled trials (RCTs) comparing TLI versus conventional methods. Both studies randomized women and oocytes were included. For studies randomized women, the primary outcomes were live birth and ongoing pregnancy, the secondary outcomes were clinical pregnancy and miscarriage; for studies randomized oocytes, the primary outcome was blastocyst rate, the secondary outcome was good quality embryo on Day 2/3. Subgroup analysis was conducted based on different incubation and embryo selection between groups. Results Ten RCTs were included, four randomized oocytes and six randomized women. For oocyte-based review, the pool-analysis observed no significant difference between TLI group and control group for blastocyst rate [relative risk (RR) 1.08, 95% CI 0.94–1.25, I2 = 0%, two studies, including 1154 embryos]. The quality of evidence was moderate for all outcomes in oocyte-based review. For woman-based review, only one study provided live birth rate (RR 1,23, 95% CI 1.06–1.44,I2 N/A, one study, including 842 women), the pooled result showed no significant difference in ongoing pregnancy rate (RR 1.04, 95% CI 0.80–1.36, I2 = 59%, four studies, including 1403 women) between two groups. The quality of the evidence was low or very low for all outcomes in woman-based review. Conclusions Currently there is insufficient evidence to support that TLI is superior to conventional methods for human embryo incubation and selection. In consideration of the limitations and flaws of included studies, more well designed RCTs are still in need to comprehensively evaluate the effectiveness of clinical TLI use. PMID:28570713

Method for improving the toughness of silicon carbide-based ceramics

DOEpatents

Tein, T.Y.; Hilmas, G.E.

1996-12-03

Method of improving the toughness of SiC-based ceramics is disclosed. SiC, , AlN, Al{sub 2}O{sub 3} and optionally {alpha}-Si{sub 3}N{sub 4} are hot pressed to form a material which includes AlN polytypoids within its structure. 1 fig.

Knowledge Acquisition Using Linguistic-Based Knowledge Analysis

Treesearch

Daniel L. Schmoldt

1998-01-01

Most knowledge-based system developmentefforts include acquiring knowledge from one or more sources. difficulties associated with this knowledge acquisition task are readily acknowledged by most researchers. While a variety of knowledge acquisition methods have been reported, little has been done to organize those different methods and to suggest how to apply them...

Technology in Social Work Education: A Systematic Review

ERIC Educational Resources Information Center

Wretman, Christopher J.; Macy, Rebecca J.

2016-01-01

Given the growing prevalence of technology-based instruction, social work faculty need a clear understanding of the strengths and limitations of these methods. We systematically examined the evidence for technology-based instruction in social work education. Using comprehensive and rigorous methods, 38 articles were included in the review. Of…

Does time-lapse imaging have favorable results for embryo incubation and selection compared with conventional methods in clinical in vitro fertilization? A meta-analysis and systematic review of randomized controlled trials.

PubMed

Chen, Minghao; Wei, Shiyou; Hu, Junyan; Yuan, Jing; Liu, Fenghua

2017-01-01

The present study aimed to undertake a review of available evidence assessing whether time-lapse imaging (TLI) has favorable outcomes for embryo incubation and selection compared with conventional methods in clinical in vitro fertilization (IVF). Using PubMed, EMBASE, Cochrane library and ClinicalTrial.gov up to February 2017 to search for randomized controlled trials (RCTs) comparing TLI versus conventional methods. Both studies randomized women and oocytes were included. For studies randomized women, the primary outcomes were live birth and ongoing pregnancy, the secondary outcomes were clinical pregnancy and miscarriage; for studies randomized oocytes, the primary outcome was blastocyst rate, the secondary outcome was good quality embryo on Day 2/3. Subgroup analysis was conducted based on different incubation and embryo selection between groups. Ten RCTs were included, four randomized oocytes and six randomized women. For oocyte-based review, the pool-analysis observed no significant difference between TLI group and control group for blastocyst rate [relative risk (RR) 1.08, 95% CI 0.94-1.25, I2 = 0%, two studies, including 1154 embryos]. The quality of evidence was moderate for all outcomes in oocyte-based review. For woman-based review, only one study provided live birth rate (RR 1,23, 95% CI 1.06-1.44,I2 N/A, one study, including 842 women), the pooled result showed no significant difference in ongoing pregnancy rate (RR 1.04, 95% CI 0.80-1.36, I2 = 59%, four studies, including 1403 women) between two groups. The quality of the evidence was low or very low for all outcomes in woman-based review. Currently there is insufficient evidence to support that TLI is superior to conventional methods for human embryo incubation and selection. In consideration of the limitations and flaws of included studies, more well designed RCTs are still in need to comprehensively evaluate the effectiveness of clinical TLI use.

Assessment methods for the evaluation of vitiligo.

PubMed

Alghamdi, K M; Kumar, A; Taïeb, A; Ezzedine, K

2012-12-01

There is no standardized method for assessing vitiligo. In this article, we review the literature from 1981 to 2011 on different vitiligo assessment methods. We aim to classify the techniques available for vitiligo assessment as subjective, semi-objective or objective; microscopic or macroscopic; and as based on morphometry or colorimetry. Macroscopic morphological measurements include visual assessment, photography in natural or ultraviolet light, photography with computerized image analysis and tristimulus colorimetry or spectrophotometry. Non-invasive micromorphological methods include confocal laser microscopy (CLM). Subjective methods include clinical evaluation by a dermatologist and a vitiligo disease activity score. Semi-objective methods include the Vitiligo Area Scoring Index (VASI) and point-counting methods. Objective methods include software-based image analysis, tristimulus colorimetry, spectrophotometry and CLM. Morphometry is the measurement of the vitiliginous surface area, whereas colorimetry quantitatively analyses skin colour changes caused by erythema or pigment. Most methods involve morphometry, except for the chromameter method, which assesses colorimetry. Some image analysis software programs can assess both morphometry and colorimetry. The details of these programs (Corel Draw, Image Pro Plus, AutoCad and Photoshop) are discussed in the review. Reflectance confocal microscopy provides real-time images and has great potential for the non-invasive assessment of pigmentary lesions. In conclusion, there is no single best method for assessing vitiligo. This review revealed that VASI, the rule of nine and Wood's lamp are likely to be the best techniques available for assessing the degree of pigmentary lesions and measuring the extent and progression of vitiligo in the clinic and in clinical trials. © 2012 The Authors. Journal of the European Academy of Dermatology and Venereology © 2012 European Academy of Dermatology and Venereology.

Polyphosphazine-based polymer materials

DOEpatents

Fox, Robert V.; Avci, Recep; Groenewold, Gary S.

2010-05-25

Methods of removing contaminant matter from porous materials include applying a polymer material to a contaminated surface, irradiating the contaminated surface to cause redistribution of contaminant matter, and removing at least a portion of the polymer material from the surface. Systems for decontaminating a contaminated structure comprising porous material include a radiation device configured to emit electromagnetic radiation toward a surface of a structure, and at least one spray device configured to apply a capture material onto the surface of the structure. Polymer materials that can be used in such methods and systems include polyphosphazine-based polymer materials having polyphosphazine backbone segments and side chain groups that include selected functional groups. The selected functional groups may include iminos, oximes, carboxylates, sulfonates, .beta.-diketones, phosphine sulfides, phosphates, phosphites, phosphonates, phosphinates, phosphine oxides, monothio phosphinic acids, and dithio phosphinic acids.

Nanoparticle-based gas sensors and methods of using the same

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mickelson, William; Zettl, Alex

Gas sensors are provided. The gas sensors include a gas sensing element having metal oxide nanoparticles and a thin-film heating element. Systems that include the gas sensors, as well as methods of using the gas sensors, are also provided. Embodiments of the present disclosure find use in a variety of different applications, including detecting whether an analyte is present in a gaseous sample.

Emerging Technologies for Assembly of Microscale Hydrogels

PubMed Central

Kavaz, Doga; Demirel, Melik C.; Demirci, Utkan

2013-01-01

Assembly of cell encapsulating building blocks (i.e., microscale hydrogels) has significant applications in areas including regenerative medicine, tissue engineering, and cell-based in vitro assays for pharmaceutical research and drug discovery. Inspired by the repeating functional units observed in native tissues and biological systems (e.g., the lobule in liver, the nephron in kidney), assembly technologies aim to generate complex tissue structures by organizing microscale building blocks. Novel assembly technologies enable fabrication of engineered tissue constructs with controlled properties including tunable microarchitectural and predefined compositional features. Recent advances in micro- and nano-scale technologies have enabled engineering of microgel based three dimensional (3D) constructs. There is a need for high-throughput and scalable methods to assemble microscale units with a complex 3D micro-architecture. Emerging assembly methods include novel technologies based on microfluidics, acoustic and magnetic fields, nanotextured surfaces, and surface tension. In this review, we survey emerging microscale hydrogel assembly methods offering rapid, scalable microgel assembly in 3D, and provide future perspectives and discuss potential applications. PMID:23184717

Rapid methods for the detection of foodborne bacterial pathogens: principles, applications, advantages and limitations

PubMed Central

Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han

2015-01-01

The incidence of foodborne diseases has increased over the years and resulted in major public health problem globally. Foodborne pathogens can be found in various foods and it is important to detect foodborne pathogens to provide safe food supply and to prevent foodborne diseases. The conventional methods used to detect foodborne pathogen are time consuming and laborious. Hence, a variety of methods have been developed for rapid detection of foodborne pathogens as it is required in many food analyses. Rapid detection methods can be categorized into nucleic acid-based, biosensor-based and immunological-based methods. This review emphasizes on the principles and application of recent rapid methods for the detection of foodborne bacterial pathogens. Detection methods included are simple polymerase chain reaction (PCR), multiplex PCR, real-time PCR, nucleic acid sequence-based amplification (NASBA), loop-mediated isothermal amplification (LAMP) and oligonucleotide DNA microarray which classified as nucleic acid-based methods; optical, electrochemical and mass-based biosensors which classified as biosensor-based methods; enzyme-linked immunosorbent assay (ELISA) and lateral flow immunoassay which classified as immunological-based methods. In general, rapid detection methods are generally time-efficient, sensitive, specific and labor-saving. The developments of rapid detection methods are vital in prevention and treatment of foodborne diseases. PMID:25628612

Transmission overhaul and replacement predictions using Weibull and renewel theory

NASA Technical Reports Server (NTRS)

Savage, M.; Lewicki, D. G.

1989-01-01

A method to estimate the frequency of transmission overhauls is presented. This method is based on the two-parameter Weibull statistical distribution for component life. A second method is presented to estimate the number of replacement components needed to support the transmission overhaul pattern. The second method is based on renewal theory. Confidence statistics are applied with both methods to improve the statistical estimate of sample behavior. A transmission example is also presented to illustrate the use of the methods. Transmission overhaul frequency and component replacement calculations are included in the example.

The Architecture Based Design Method

DTIC Science & Technology

2000-01-01

implementation of components of different types. The software templates include a description of how components interact with shared services and also include citizenship responsibilities for components.

Automatic construction of subject-specific human airway geometry including trifurcations based on a CT-segmented airway skeleton and surface

PubMed Central

Miyawaki, Shinjiro; Tawhai, Merryn H.; Hoffman, Eric A.; Wenzel, Sally E.; Lin, Ching-Long

2016-01-01

We propose a method to construct three-dimensional airway geometric models based on airway skeletons, or centerlines (CLs). Given a CT-segmented airway skeleton and surface, the proposed CL-based method automatically constructs subject-specific models that contain anatomical information regarding branches, include bifurcations and trifurcations, and extend from the trachea to terminal bronchioles. The resulting model can be anatomically realistic with the assistance of an image-based surface; alternatively a model with an idealized skeleton and/or branch diameters is also possible. This method systematically identifies and classifies trifurcations to successfully construct the models, which also provides the number and type of trifurcations for the analysis of the airways from an anatomical point of view. We applied this method to 16 normal and 16 severe asthmatic subjects using their computed tomography images. The average distance between the surface of the model and the image-based surface was 11% of the average voxel size of the image. The four most frequent locations of trifurcations were the left upper division bronchus, left lower lobar bronchus, right upper lobar bronchus, and right intermediate bronchus. The proposed method automatically constructed accurate subject-specific three-dimensional airway geometric models that contain anatomical information regarding branches using airway skeleton, diameters, and image-based surface geometry. The proposed method can construct (i) geometry automatically for population-based studies, (ii) trifurcations to retain the original airway topology, (iii) geometry that can be used for automatic generation of computational fluid dynamics meshes, and (iv) geometry based only on a skeleton and diameters for idealized branches. PMID:27704229

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fernandes, Ana; Pereira, Rita C.; Sousa, Jorge

The Instituto de Plasmas e Fusao Nuclear (IPFN) has developed dedicated re-configurable modules based on field programmable gate array (FPGA) devices for several nuclear fusion machines worldwide. Moreover, new Advanced Telecommunication Computing Architecture (ATCA) based modules developed by IPFN are already included in the ITER catalogue. One of the requirements for re-configurable modules operating in future nuclear environments including ITER is the remote update capability. Accordingly, this work presents an alternative method for FPGA remote programing to be implemented in new ATCA based re-configurable modules. FPGAs are volatile devices and their programming code is usually stored in dedicated flash memoriesmore » for properly configuration during module power-on. The presented method is capable to store new FPGA codes in Serial Peripheral Interface (SPI) flash memories using the PCIexpress (PCIe) network established on the ATCA back-plane, linking data acquisition endpoints and the data switch blades. The method is based on the Xilinx Quick Boot application note, adapted to PCIe protocol and ATCA based modules. (authors)« less

Costs and Efficiency of Online and Offline Recruitment Methods: A Web-Based Cohort Study

PubMed Central

Riis, Anders H; Hatch, Elizabeth E; Wise, Lauren A; Nielsen, Marie G; Rothman, Kenneth J; Toft Sørensen, Henrik; Mikkelsen, Ellen M

2017-01-01

Background The Internet is widely used to conduct research studies on health issues. Many different methods are used to recruit participants for such studies, but little is known about how various recruitment methods compare in terms of efficiency and costs. Objective The aim of our study was to compare online and offline recruitment methods for Internet-based studies in terms of efficiency (number of recruited participants) and costs per participant. Methods We employed several online and offline recruitment methods to enroll 18- to 45-year-old women in an Internet-based Danish prospective cohort study on fertility. Offline methods included press releases, posters, and flyers. Online methods comprised advertisements placed on five different websites, including Facebook and Netdoktor.dk. We defined seven categories of mutually exclusive recruitment methods and used electronic tracking via unique Uniform Resource Locator (URL) and self-reported data to identify the recruitment method for each participant. For each method, we calculated the average cost per participant and efficiency, that is, the total number of recruited participants. Results We recruited 8252 study participants. Of these, 534 were excluded as they could not be assigned to a specific recruitment method. The final study population included 7724 participants, of whom 803 (10.4%) were recruited by offline methods, 3985 (51.6%) by online methods, 2382 (30.8%) by online methods not initiated by us, and 554 (7.2%) by other methods. Overall, the average cost per participant was €6.22 for online methods initiated by us versus €9.06 for offline methods. Costs per participant ranged from €2.74 to €105.53 for online methods and from €0 to €67.50 for offline methods. Lowest average costs per participant were for those recruited from Netdoktor.dk (€2.99) and from Facebook (€3.44). Conclusions In our Internet-based cohort study, online recruitment methods were superior to offline methods in terms of efficiency (total number of participants enrolled). The average cost per recruited participant was also lower for online than for offline methods, although costs varied greatly among both online and offline recruitment methods. We observed a decrease in the efficiency of some online recruitment methods over time, suggesting that it may be optimal to adopt multiple online methods. PMID:28249833

Prediction of ground effects on aircraft noise

NASA Technical Reports Server (NTRS)

Pao, S. P.; Wenzel, A. R.; Oncley, P. B.

1978-01-01

A unified method is recommended for predicting ground effects on noise. This method may be used in flyover noise predictions and in correcting static test-stand data to free-field conditions. The recommendation is based on a review of recent progress in the theory of ground effects and of the experimental evidence which supports this theory. It is shown that a surface wave must be included sometimes in the prediction method. Prediction equations are collected conveniently in a single section of the paper. Methods of measuring ground impedance and the resulting ground-impedance data are also reviewed because the recommended method is based on a locally reactive impedance boundary model. Current practice of estimating ground effects are reviewed and consideration is given to practical problems in applying the recommended method. These problems include finite frequency-band filters, finite source dimension, wind and temperature gradients, and signal incoherence.

A suite of phantom-based test methods for assessing image quality of photoacoustic tomography systems

NASA Astrophysics Data System (ADS)

Vogt, William C.; Jia, Congxian; Wear, Keith A.; Garra, Brian S.; Pfefer, T. Joshua

2017-03-01

As Photoacoustic Tomography (PAT) matures and undergoes clinical translation, objective performance test methods are needed to facilitate device development, regulatory clearance and clinical quality assurance. For mature medical imaging modalities such as CT, MRI, and ultrasound, tissue-mimicking phantoms are frequently incorporated into consensus standards for performance testing. A well-validated set of phantom-based test methods is needed for evaluating performance characteristics of PAT systems. To this end, we have constructed phantoms using a custom tissue-mimicking material based on PVC plastisol with tunable, biologically-relevant optical and acoustic properties. Each phantom is designed to enable quantitative assessment of one or more image quality characteristics including 3D spatial resolution, spatial measurement accuracy, ultrasound/PAT co-registration, uniformity, penetration depth, geometric distortion, sensitivity, and linearity. Phantoms contained targets including high-intensity point source targets and dye-filled tubes. This suite of phantoms was used to measure the dependence of performance of a custom PAT system (equipped with four interchangeable linear array transducers of varying design) on design parameters (e.g., center frequency, bandwidth, element geometry). Phantoms also allowed comparison of image artifacts, including surface-generated clutter and bandlimited sensing artifacts. Results showed that transducer design parameters create strong variations in performance including a trade-off between resolution and penetration depth, which could be quantified with our method. This study demonstrates the utility of phantom-based image quality testing in device performance assessment, which may guide development of consensus standards for PAT systems.

37: COMPARISON OF TWO METHODS: TBL-BASED AND LECTURE-BASED LEARNING IN NURSING CARE OF PATIENTS WITH DIABETES IN NURSING STUDENTS

PubMed Central

Khodaveisi, Masoud; Qaderian, Khosro; Oshvandi, Khodayar; Soltanian, Ali Reza; Vardanjani, Mehdi molavi

2017-01-01

Background and aims learning plays an important role in developing nursing skills and right care-taking. The Present study aims to evaluate two learning methods based on team –based learning and lecture-based learning in learning care-taking of patients with diabetes in nursing students. Method In this quasi-experimental study, 64 students in term 4 in nursing college of Bukan and Miandoab were included in the study based on knowledge and performance questionnaire including 15 questions based on knowledge and 5 questions based on performance on care-taking in patients with diabetes were used as data collection tool whose reliability was confirmed by cronbach alpha (r=0.83) by the researcher. To compare the mean score of knowledge and performance in each group in pre-test step and post-test step, pair –t test and to compare mean of scores in two groups of control and intervention, the independent t- test was used. Results There was not significant statistical difference between two groups in pre terms of knowledge and performance score (p=0.784). There was significant difference between the mean of knowledge scores and diabetes performance in the post-test in the team-based learning group and lecture-based learning group (p=0.001). There was significant difference between the mean score of knowledge of diabetes care in pre-test and post-test in base learning groups (p=0.001). Conclusion In both methods team-based and lecture-based learning approaches resulted in improvement in learning in students, but the rate of learning in the team-based learning approach is greater compared to that of lecture-based learning and it is recommended that this method be used as a higher education method in the education of students.

An evaluation method for nanoscale wrinkle

NASA Astrophysics Data System (ADS)

Liu, Y. P.; Wang, C. G.; Zhang, L. M.; Tan, H. F.

2016-06-01

In this paper, a spectrum-based wrinkling analysis method via two-dimensional Fourier transformation is proposed aiming to solve the difficulty of nanoscale wrinkle evaluation. It evaluates the wrinkle characteristics including wrinkling wavelength and direction simply using a single wrinkling image. Based on this method, the evaluation results of nanoscale wrinkle characteristics show agreement with the open experimental results within an error of 6%. It is also verified to be appropriate for the macro wrinkle evaluation without scale limitations. The spectrum-based wrinkling analysis is an effective method for nanoscale evaluation, which contributes to reveal the mechanism of nanoscale wrinkling.

Spacelike matching to null infinity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zenginoglu, Anil; Tiglio, Manuel

2009-07-15

We present two methods to include the asymptotic domain of a background spacetime in null directions for numerical solutions of evolution equations so that both the radiation extraction problem and the outer boundary problem are solved. The first method is based on the geometric conformal approach, the second is a coordinate based approach. We apply these methods to the case of a massless scalar wave equation on a Kerr spacetime. Our methods are designed to allow existing codes to reach the radiative zone by including future null infinity in the computational domain with relatively minor modifications. We demonstrate the flexibilitymore » of the methods by considering both Boyer-Lindquist and ingoing Kerr coordinates near the black hole. We also confirm numerically predictions concerning tail decay rates for scalar fields at null infinity in Kerr spacetime due to Hod for the first time.« less

a Method of 3d Measurement and Reconstruction for Cultural Relics in Museums

NASA Astrophysics Data System (ADS)

Zheng, S.; Zhou, Y.; Huang, R.; Zhou, L.; Xu, X.; Wang, C.

2012-07-01

Three-dimensional measurement and reconstruction during conservation and restoration of cultural relics have become an essential part of a modem museum regular work. Although many kinds of methods including laser scanning, computer vision and close-range photogrammetry have been put forward, but problems still exist, such as contradiction between cost and good result, time and fine effect. Aimed at these problems, this paper proposed a structure-light based method for 3D measurement and reconstruction of cultural relics in museums. Firstly, based on structure-light principle, digitalization hardware has been built and with its help, dense point cloud of cultural relics' surface can be easily acquired. To produce accurate 3D geometry model from point cloud data, multi processing algorithms have been developed and corresponding software has been implemented whose functions include blunder detection and removal, point cloud alignment and merge, 3D mesh construction and simplification. Finally, high-resolution images are captured and the alignment of these images and 3D geometry model is conducted and realistic, accurate 3D model is constructed. Based on such method, a complete system including hardware and software are built. Multi-kinds of cultural relics have been used to test this method and results prove its own feature such as high efficiency, high accuracy, easy operation and so on.

A new rational-based optimal design strategy of ship structure based on multi-level analysis and super-element modeling method

NASA Astrophysics Data System (ADS)

Sun, Li; Wang, Deyu

2011-09-01

A new multi-level analysis method of introducing the super-element modeling method, derived from the multi-level analysis method first proposed by O. F. Hughes, has been proposed in this paper to solve the problem of high time cost in adopting a rational-based optimal design method for ship structural design. Furthermore, the method was verified by its effective application in optimization of the mid-ship section of a container ship. A full 3-D FEM model of a ship, suffering static and quasi-static loads, was used as the analyzing object for evaluating the structural performance of the mid-ship module, including static strength and buckling performance. Research results reveal that this new method could substantially reduce the computational cost of the rational-based optimization problem without decreasing its accuracy, which increases the feasibility and economic efficiency of using a rational-based optimal design method in ship structural design.

Correlation of cystatin C and creatinine based estimates of renal function in children with hydronephrosis.

PubMed

Momtaz, Hossein-Emad; Dehghan, Arash; Karimian, Mohammad

2016-01-01

The use of a simple and accurate glomerular filtration rate (GFR) estimating method aiming minute assessment of renal function can be of great clinical importance. This study aimed to determine the association of a GFR estimating by equation that includes only cystatin C (Gentian equation) to equation that include only creatinine (Schwartz equation) among children. A total of 31 children aged from 1 day to 5 years with the final diagnosis of unilateral or bilateral hydronephrosis referred to Besat hospital in Hamadan, between March 2010 and February 2011 were consecutively enrolled. Schwartz and Gentian equations were employed to determine GFR based on plasma creatinine and cystatin C levels, respectively. The proportion of GFR based on Schwartz equation was 70.19± 24.86 ml/min/1.73 m(2), while the level of this parameter based on Gentian method and using cystatin C was 86.97 ± 21.57 ml/min/1.73 m(2). The Pearson correlation coefficient analysis showed a strong direct association between the two levels of GFR measured by Schwartz equation based on serum creatinine level and Gentian method and using cystatin C (r = 0.594, P < 0.001). The linear association between GFR values measured with the two methods included cystatin C based GFR = 50.8+ 0.515 × Schwartz GFR. The correlation between GFR values measured by using serum creatinine and serum cystatin C measurements remained meaningful even after adjustment for patients' gender and age (r = 0.724, P < 0.001). The equation developed based on cystatin C level is comparable with another equation, based on serum creatinine (Schwartz formula) to estimate GFR in children.

Methods of Si based ceramic components volatilization control in a gas turbine engine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garcia-Crespo, Andres Jose; Delvaux, John; Dion Ouellet, Noemie

A method of controlling volatilization of silicon based components in a gas turbine engine includes measuring, estimating and/or predicting a variable related to operation of the gas turbine engine; correlating the variable to determine an amount of silicon to control volatilization of the silicon based components in the gas turbine engine; and injecting silicon into the gas turbine engine to control volatilization of the silicon based components. A gas turbine with a compressor, combustion system, turbine section and silicon injection system may be controlled by a controller that implements the control method.

Diagnostics of Tree Diseases Caused by Phytophthora austrocedri Species.

PubMed

Mulholland, Vincent; Elliot, Matthew; Green, Sarah

2015-01-01

We present methods for the detection and quantification of four Phytophthora species which are pathogenic on trees; Phytophthora ramorum, Phytophthora kernoviae, Phytophthora lateralis, and Phytophthora austrocedri. Nucleic acid extraction methods are presented for phloem tissue from trees, soil, and pure cultures on agar plates. Real-time PCR methods are presented and include primer and probe sets for each species, general advice on real-time PCR setup and data analysis. A method for sequence-based identification, useful for pure cultures, is also included.

Catalytic reforming methods

DOEpatents

Tadd, Andrew R; Schwank, Johannes

2013-05-14

A catalytic reforming method is disclosed herein. The method includes sequentially supplying a plurality of feedstocks of variable compositions to a reformer. The method further includes adding a respective predetermined co-reactant to each of the plurality of feedstocks to obtain a substantially constant output from the reformer for the plurality of feedstocks. The respective predetermined co-reactant is based on a C/H/O atomic composition for a respective one of the plurality of feedstocks and a predetermined C/H/O atomic composition for the substantially constant output.

Novel approach for the simultaneous detection of DNA from different fish species based on a nuclear target: quantification potential.

PubMed

Prado, Marta; Boix, Ana; von Holst, Christoph

2012-07-01

The development of DNA-based methods for the identification and quantification of fish in food and feed samples is frequently focused on a specific fish species and/or on the detection of mitochondrial DNA of fish origin. However, a quantitative method for the most common fish species used by the food and feed industry is needed for official control purposes, and such a method should rely on the use of a single-copy nuclear DNA target owing to its more stable copy number in different tissues. In this article, we report on the development of a real-time PCR method based on the use of a nuclear gene as a target for the simultaneous detection of fish DNA from different species and on the evaluation of its quantification potential. The method was tested in 22 different fish species, including those most commonly used by the food and feed industry, and in negative control samples, which included 15 animal species and nine feed ingredients. The results show that the method reported here complies with the requirements concerning specificity and with the criteria required for real-time PCR methods with high sensitivity.

Chemical Modification of Polysaccharides

PubMed Central

Cumpstey, Ian

2013-01-01

This review covers methods for modifying the structures of polysaccharides. The introduction of hydrophobic, acidic, basic, or other functionality into polysaccharide structures can alter the properties of materials based on these substances. The development of chemical methods to achieve this aim is an ongoing area of research that is expected to become more important as the emphasis on using renewable starting materials and sustainable processes increases in the future. The methods covered in this review include ester and ether formation using saccharide oxygen nucleophiles, including enzymatic reactions and aspects of regioselectivity; the introduction of heteroatomic nucleophiles into polysaccharide chains; the oxidation of polysaccharides, including oxidative glycol cleavage, chemical oxidation of primary alcohols to carboxylic acids, and enzymatic oxidation of primary alcohols to aldehydes; reactions of uronic-acid-based polysaccharides; nucleophilic reactions of the amines of chitosan; and the formation of unsaturated polysaccharide derivatives. PMID:24151557

Algorithm for personal identification in distance learning system based on registration of keyboard rhythm

NASA Astrophysics Data System (ADS)

Nikitin, P. V.; Savinov, A. N.; Bazhenov, R. I.; Sivandaev, S. V.

2018-05-01

The article describes the method of identifying a person in distance learning systems based on a keyboard rhythm. An algorithm for the organization of access control is proposed, which implements authentication, identification and verification of a person using the keyboard rhythm. Authentication methods based on biometric personal parameters, including those based on the keyboard rhythm, due to the inexistence of biometric characteristics without a particular person, are able to provide an advanced accuracy and inability to refuse authorship and convenience for operators of automated systems, in comparison with other methods of conformity checking. Methods of permanent hidden keyboard monitoring allow detecting the substitution of a student and blocking the key system.

Charge gradient microscopy

DOEpatents

Roelofs, Andreas; Hong, Seungbum

2018-02-06

A method for rapid imaging of a material specimen includes positioning a tip to contact the material specimen, and applying a force to a surface of the material specimen via the tip. In addition, the method includes moving the tip across the surface of the material specimen while removing electrical charge therefrom, generating a signal produced by contact between the tip and the surface, and detecting, based on the data, the removed electrical charge induced through the tip during movement of the tip across the surface. The method further includes measuring the detected electrical charge.

A Computer Game-Based Method for Studying Bullying and Cyberbullying

ERIC Educational Resources Information Center

Mancilla-Caceres, Juan F.; Espelage, Dorothy; Amir, Eyal

2015-01-01

Even though previous studies have addressed the relation between face-to-face bullying and cyberbullying, none have studied both phenomena simultaneously. In this article, we present a computer game-based method to study both types of peer aggression among youth. Study participants included fifth graders (N = 93) in two U.S. Midwestern middle…

Service-Learning's Ongoing Journey as a Method of Instruction: Implications for School-Based Agricultural Education

ERIC Educational Resources Information Center

Roberts, Richie; Edwards, M. Craig

2015-01-01

American education's journey has witnessed the rise and fall of various progressive education approaches, including service-learning. In many respects, however, service-learning is still undergoing formation and adoption as a teaching method, specifically in School-Based, Agricultural Education (SBAE). For this reason, the interest existed to…

Bioethics and the whole: pluralism, consensus, and the transmutation of bioethical methods into gold.

PubMed

Martin, P A

1999-01-01

Arguing that a consensus-based method of bioethical decision making can transform ethical pluralism into an ethical whole, author examines the theory of three consensus-based models--clinical pragmatism, ethics facilitation, and mediation--and develops a practical guide to ethics facilitation that includes a hypothetical case.

Missing texture reconstruction method based on error reduction algorithm using Fourier transform magnitude estimation scheme.

PubMed

Ogawa, Takahiro; Haseyama, Miki

2013-03-01

A missing texture reconstruction method based on an error reduction (ER) algorithm, including a novel estimation scheme of Fourier transform magnitudes is presented in this brief. In our method, Fourier transform magnitude is estimated for a target patch including missing areas, and the missing intensities are estimated by retrieving its phase based on the ER algorithm. Specifically, by monitoring errors converged in the ER algorithm, known patches whose Fourier transform magnitudes are similar to that of the target patch are selected from the target image. In the second approach, the Fourier transform magnitude of the target patch is estimated from those of the selected known patches and their corresponding errors. Consequently, by using the ER algorithm, we can estimate both the Fourier transform magnitudes and phases to reconstruct the missing areas.

Multigrid Methods for Aerodynamic Problems in Complex Geometries

NASA Technical Reports Server (NTRS)

Caughey, David A.

1995-01-01

Work has been directed at the development of efficient multigrid methods for the solution of aerodynamic problems involving complex geometries, including the development of computational methods for the solution of both inviscid and viscous transonic flow problems. The emphasis is on problems of complex, three-dimensional geometry. The methods developed are based upon finite-volume approximations to both the Euler and the Reynolds-Averaged Navier-Stokes equations. The methods are developed for use on multi-block grids using diagonalized implicit multigrid methods to achieve computational efficiency. The work is focused upon aerodynamic problems involving complex geometries, including advanced engine inlets.

Evaluating a vessel for suitability for containing fluid

DOEpatents

Barefield, II, James E.; Judge, Elizabeth J.; Le, Loan A.; Lopez, Leon N.; Beveridge, Andrew C.; Chapman, Daniel R.; Taylor, Seth T.

2017-05-30

A method for evaluating a vessel for suitability to contain a fluid includes providing a vessel and forming a polished surface portion of the vessel by removing oxidation and/or contaminants from a portion of the vessel. The method further includes applying a focused laser to the polished surface portion to form plasma on the polished surface portion, and determining whether the vessel is suitable for containing a fluid based on silicon content of the polished surface portion. The silicon content is estimated based on light emitted from the plasma.

Position detectors, methods of detecting position, and methods of providing positional detectors

DOEpatents

Weinberg, David M.; Harding, L. Dean; Larsen, Eric D.

2002-01-01

Position detectors, welding system position detectors, methods of detecting various positions, and methods of providing position detectors are described. In one embodiment, a welding system positional detector includes a base that is configured to engage and be moved along a curved surface of a welding work piece. At least one position detection apparatus is provided and is connected with the base and configured to measure angular position of the detector relative to a reference vector. In another embodiment, a welding system positional detector includes a weld head and at least one inclinometer mounted on the weld head. The one inclinometer is configured to develop positional data relative to a reference vector and the position of the weld head on a non-planar weldable work piece.

Community structure in networks

NASA Astrophysics Data System (ADS)

Newman, Mark

2004-03-01

Many networked systems, including physical, biological, social, and technological networks, appear to contain ``communities'' -- groups of nodes within which connections are dense, but between which they are sparser. The ability to find such communities in an automated fashion could be of considerable use. Communities in a web graph for instance might correspond to sets of web sites dealing with related topics, while communities in a biochemical network or an electronic circuit might correspond to functional units of some kind. We present a number of new methods for community discovery, including methods based on ``betweenness'' measures and methods based on modularity optimization. We also give examples of applications of these methods to both computer-generated and real-world network data, and show how our techniques can be used to shed light on the sometimes dauntingly complex structure of networked systems.

Fast Ignition and Sustained Combustion of Ionic Liquids

NASA Technical Reports Server (NTRS)

Joshi, Prakash B. (Inventor); Piper, Lawrence G. (Inventor); Oakes, David B. (Inventor); Sabourin, Justin L. (Inventor); Hicks, Adam J. (Inventor); Green, B. David (Inventor); Tsinberg, Anait (Inventor); Dokhan, Allan (Inventor)

2016-01-01

A catalyst free method of igniting an ionic liquid is provided. The method can include mixing a liquid hypergol with a HAN (Hydroxylammonium nitrate)-based ionic liquid to ignite the HAN-based ionic liquid in the absence of a catalyst. The HAN-based ionic liquid and the liquid hypergol can be injected into a combustion chamber. The HAN-based ionic liquid and the liquid hypergol can impinge upon a stagnation plate positioned at top portion of the combustion chamber.

A human-machine cooperation route planning method based on improved A* algorithm

NASA Astrophysics Data System (ADS)

Zhang, Zhengsheng; Cai, Chao

2011-12-01

To avoid the limitation of common route planning method to blindly pursue higher Machine Intelligence and autoimmunization, this paper presents a human-machine cooperation route planning method. The proposed method includes a new A* path searing strategy based on dynamic heuristic searching and a human cooperated decision strategy to prune searching area. It can overcome the shortage of A* algorithm to fall into a local long term searching. Experiments showed that this method can quickly plan a feasible route to meet the macro-policy thinking.

Comparison of liver volumetry on contrast-enhanced CT images: one semiautomatic and two automatic approaches.

PubMed

Cai, Wei; He, Baochun; Fan, Yingfang; Fang, Chihua; Jia, Fucang

2016-11-08

This study was to evaluate the accuracy, consistency, and efficiency of three liver volumetry methods- one interactive method, an in-house-developed 3D medical Image Analysis (3DMIA) system, one automatic active shape model (ASM)-based segmentation, and one automatic probabilistic atlas (PA)-guided segmentation method on clinical contrast-enhanced CT images. Forty-two datasets, including 27 normal liver and 15 space-occupying liver lesion patients, were retrospectively included in this study. The three methods - one semiautomatic 3DMIA, one automatic ASM-based, and one automatic PA-based liver volumetry - achieved an accuracy with VD (volume difference) of -1.69%, -2.75%, and 3.06% in the normal group, respectively, and with VD of -3.20%, -3.35%, and 4.14% in the space-occupying lesion group, respectively. However, the three methods achieved an efficiency of 27.63 mins, 1.26 mins, 1.18 mins on average, respectively, compared with the manual volumetry, which took 43.98 mins. The high intraclass correlation coefficient between the three methods and the manual method indicated an excel-lent agreement on liver volumetry. Significant differences in segmentation time were observed between the three methods (3DMIA, ASM, and PA) and the manual volumetry (p < 0.001), as well as between the automatic volumetries (ASM and PA) and the semiautomatic volumetry (3DMIA) (p < 0.001). The semiautomatic interactive 3DMIA, automatic ASM-based, and automatic PA-based liver volum-etry agreed well with manual gold standard in both the normal liver group and the space-occupying lesion group. The ASM- and PA-based automatic segmentation have better efficiency in clinical use. © 2016 The Authors.

Method for extruding pitch based foam

DOEpatents

Klett, James W.

2002-01-01

A method and apparatus for extruding pitch based foam is disclosed. The method includes the steps of: forming a viscous pitch foam; passing the precursor through an extrusion tube; and subjecting the precursor in said extrusion tube to a temperature gradient which varies along the length of the extrusion tube to form an extruded carbon foam. The apparatus includes an extrusion tube having a passageway communicatively connected to a chamber in which a viscous pitch foam formed in the chamber paring through the extrusion tube, and a heating mechanism in thermal communication with the tube for heating the viscous pitch foam along the length of the tube in accordance with a predetermined temperature gradient.

Method and tool to reverse the charges in anti-reflection films used for solar cell applications

DOEpatents

Sharma, Vivek; Tracy, Clarence

2017-01-31

A method is provided for making a solar cell. The method includes providing a stack including a substrate, a barrier layer disposed on the substrate, and an anti-reflective layer disposed on the barrier layer, where the anti-reflective layer has charge centers. The method also includes generating a corona with a charging tool and contacting the anti-reflective layer with the corona thereby injecting charge into at least some of the charge centers in the anti-reflective layer. Ultra-violet illumination and temperature-based annealing may be used to modify the charge of the anti-reflective layer.

Comparison of methods for the detection of coliphages in recreational water at two California, United States beaches.

PubMed

Rodríguez, Roberto A; Love, David C; Stewart, Jill R; Tajuba, Julianne; Knee, Jacqueline; Dickerson, Jerold W; Webster, Laura F; Sobsey, Mark D

2012-04-01

Methods for detection of two fecal indicator viruses, F+ and somatic coliphages, were evaluated for application to recreational marine water. Marine water samples were collected during the summer of 2007 in Southern California, United States from transects along Avalon Beach (n=186 samples) and Doheny Beach (n=101 samples). Coliphage detection methods included EPA method 1601 - two-step enrichment (ENR), EPA method 1602 - single agar layer (SAL), and variations of ENR. Variations included comparison of two incubation times (overnight and 5-h incubation) and two final detection steps (lysis zone assay and a rapid latex agglutination assay). A greater number of samples were positive for somatic and F+ coliphages by ENR than by SAL (p<0.01). The standard ENR with overnight incubation and detection by lysis zone assay was the most sensitive method for the detection of F+ and somatic coliphages from marine water, although the method takes up to three days to obtain results. A rapid 5-h enrichment version of ENR also performed well, with more positive samples than SAL, and could be performed in roughly 24h. Latex agglutination-based detection methods require the least amount of time to perform, although the sensitivity was less than lysis zone-based detection methods. Rapid culture-based enrichment of coliphages in marine water may be possible by further optimizing culture-based methods for saline water conditions to generate higher viral titers than currently available, as well as increasing the sensitivity of latex agglutination detection methods. Copyright © 2012 Elsevier B.V. All rights reserved.

Proposal of Classification Method of Time Series Data in International Emissions Trading Market Using Agent-based Simulation

NASA Astrophysics Data System (ADS)

Nakada, Tomohiro; Takadama, Keiki; Watanabe, Shigeyoshi

This paper proposes the classification method using Bayesian analytical method to classify the time series data in the international emissions trading market depend on the agent-based simulation and compares the case with Discrete Fourier transform analytical method. The purpose demonstrates the analytical methods mapping time series data such as market price. These analytical methods have revealed the following results: (1) the classification methods indicate the distance of mapping from the time series data, it is easier the understanding and inference than time series data; (2) these methods can analyze the uncertain time series data using the distance via agent-based simulation including stationary process and non-stationary process; and (3) Bayesian analytical method can show the 1% difference description of the emission reduction targets of agent.

40 CFR 60.715 - Test methods and procedures.

Code of Federal Regulations, 2010 CFR

2010-07-01

... base film (i.e., the sample shall include any dilution solvent or other VOC added during the... for gas analysis. (f) Method 4 is used for stack gas moisture. (g) Methods 2, 2A, 2C, 2D, 3, and 4...

Graphene-based structure, method of suspending graphene membrane, and method of depositing material onto graphene membrane

DOEpatents

Zettl, Alexander K.; Meyer, Jannik Christian

2013-04-02

An embodiment of a method of suspending a graphene membrane across a gap in a support structure includes attaching graphene to a substrate. A pre-fabricated support structure having the gap is attached to the graphene. The graphene and the pre-fabricated support structure are then separated from the substrate which leaves the graphene membrane suspended across the gap in the pre-fabricated support structure. An embodiment of a method of depositing material includes placing a support structure having a graphene membrane suspended across a gap under vacuum. A precursor is adsorbed to a surface of the graphene membrane. A portion of the graphene membrane is exposed to a focused electron beam which deposits a material from the precursor onto the graphene membrane. An embodiment of a graphene-based structure includes a support structure having a gap, a graphene membrane suspended across the gap, and a material deposited in a pattern on the graphene membrane.

Nucleic acid aptamer-based methods for diagnosis of infections.

PubMed

Park, Ki Soo

2018-04-15

Infectious diseases are a serious global problem, which not only take an enormous human toll but also incur tremendous economic losses. In combating infectious diseases, rapid and accurate diagnostic tests are required for pathogen identification at the point of care (POC). In this review, investigations of diagnostic strategies for infectious diseases that are based on aptamers, especially nucleic acid aptamers, oligonucleotides that have high affinities and specificities toward their targets, are described. Owing to their unique features including low cost of production, easy chemical modification, high chemical stability, reproducibility, and low levels of immunogenicity and toxicity, aptamers have been widely utilized as bio-recognition elements (bio-receptors) for the development of infection diagnostic systems. We discuss nucleic acid aptamer-based methods that have been developed for diagnosis of infections using a format that organizes discussion according to the target pathogenic analytes including toxins or proteins, whole cells and nucleic acids. Also included is, a summary of recent advances made in the sensitive detection of pathogenic bacteria utilizing the isothermal nucleic acid amplification method. Lastly, a nucleic acid aptamer-based POC system is described and future directions of studies in this area are discussed. Copyright © 2017 Elsevier B.V. All rights reserved.

Objective and subjective methods for quantifying training load in wheelchair basketball small-sided games.

PubMed

Iturricastillo, Aitor; Granados, Cristina; Los Arcos, Asier; Yanci, Javier

2017-04-01

The aim of the present study was to analyse the training load in wheelchair basketball small-sided games and determine the relationship between heart rate (HR)-based training load and perceived exertion (RPE)-based training load methods among small-sided games bouts. HR-based measurements of training load included Edwards' training load and Stagno's training impulses (TRIMP MOD ) while RPE-based training load measurements included cardiopulmonary (session RPEres) and muscular (session RPEmus) values. Data were collected from 12 wheelchair basketball players during five consecutive weeks. The total load for the small-sided games sessions was 67.5 ± 6.7 and 55.3 ± 12.5 AU in HR-based training load (Edwards' training load and TRIMP MOD ), while the RPE-based training loads were 99.3 ± 26.9 (session RPEres) and 100.8 ± 31.2 AU (session RPEmus). Bout-to-bout analysis identified greater session RPEmus in the third [P < 0.05; effect size (ES) = 0.66, moderate] and fourth bouts (P < 0.05; ES = 0.64, moderate) than in the first bout, but other measures did not differ. Mean correlations indicated a trivial and small relationship among HR-based and RPE-based training loads. It is suggested that HR-based and RPE-based training loads provide different information, but these two methods could be complementary because one method could help us to understand the limitations of the other.

YIP Formal Synthesis of Software-Based Control Protocols for Fractionated,Composable Autonomous Systems

DTIC Science & Technology

2016-07-08

Systems Using Automata Theory and Barrier Certifi- cates We developed a sound but incomplete method for the computational verification of specifications...method merges ideas from automata -based model checking with those from control theory including so-called barrier certificates and optimization-based... Automata theory meets barrier certificates: Temporal logic verification of nonlinear systems,” IEEE Transactions on Automatic Control, 2015. [J2] R

Method for smoothing the surface of a protective coating

DOEpatents

Sangeeta, D.; Johnson, Curtis Alan; Nelson, Warren Arthur

2001-01-01

A method for smoothing the surface of a ceramic-based protective coating which exhibits roughness is disclosed. The method includes the steps of applying a ceramic-based slurry or gel coating to the protective coating surface; heating the slurry/gel coating to remove volatile material; and then further heating the slurry/gel coating to cure the coating and bond it to the underlying protective coating. The slurry/gel coating is often based on yttria-stabilized zirconia, and precursors of an oxide matrix. Related articles of manufacture are also described.

An atlas-based multimodal registration method for 2D images with discrepancy structures.

PubMed

Lv, Wenchao; Chen, Houjin; Peng, Yahui; Li, Yanfeng; Li, Jupeng

2018-06-04

An atlas-based multimodal registration method for 2-dimension images with discrepancy structures was proposed in this paper. Atlas was utilized for complementing the discrepancy structure information in multimodal medical images. The scheme includes three steps: floating image to atlas registration, atlas to reference image registration, and field-based deformation. To evaluate the performance, a frame model, a brain model, and clinical images were employed in registration experiments. We measured the registration performance by the squared sum of intensity differences. Results indicate that this method is robust and performs better than the direct registration for multimodal images with discrepancy structures. We conclude that the proposed method is suitable for multimodal images with discrepancy structures. Graphical Abstract An Atlas-based multimodal registration method schematic diagram.

Slope, Scarp and Sea Cliff Instability Susceptibility Mapping for Planning Regulations in Almada County, Portugal

NASA Astrophysics Data System (ADS)

Marques, Fernando; Queiroz, Sónia; Gouveia, Luís; Vasconcelos, Manuel

2017-12-01

In Portugal, the modifications introduced in 2008 and 2012 in the National Ecological Reserve law (REN) included the mandatory study of slope instability, including slopes, natural scarps, and sea cliffs, at municipal or regional scale, with the purpose of avoiding the use of hazardous zones with buildings and other structures. The law also indicates specific methods to perform these studies, with different approaches for slope instability, natural scarps and sea cliffs. The methods used to produce the maps required by REN law, with modifications and improvements to the law specified methods, were applied to the 71 km2 territory of Almada County, and included: 1) Slope instability mapping using the statistically based Information Value method validated with the landslide inventory using ROC curves, which provided an AAC=0.964, with the higher susceptibility zones which cover at least 80% of the landslides of the inventory to be included in REN map. The map was object of a generalization process to overcome the inconveniences of the use of a pixel based approach. 2) Natural scarp mapping including setback areas near the top, defined according to the law and setback areas near the toe defined by the application of the shadow angle calibrated with the major rockfalls which occurred in the study area; 3) Sea cliffs mapping including two levels of setback zones near the top, and one setback zone at the cliffs toe, which were based on systematic inventories of cliff failures occurred between 1947 and 2010 in a large scale regional littoral monitoring project. In the paper are described the methods used and the results obtained in this study, which correspond to the final maps of areas to include in REN. The results obtained in this study may be considered as an example of good practice of the municipal authorities in terms of solid, technical and scientifically supported regulation definitions, hazard prevention and safe and sustainable land use management.

The Navigation Guide systematic review methodology: a rigorous and transparent method for translating environmental health science into better health outcomes.

PubMed

Woodruff, Tracey J; Sutton, Patrice

2014-10-01

Synthesizing what is known about the environmental drivers of health is instrumental to taking prevention-oriented action. Methods of research synthesis commonly used in environmental health lag behind systematic review methods developed in the clinical sciences over the past 20 years. We sought to develop a proof of concept of the "Navigation Guide," a systematic and transparent method of research synthesis in environmental health. The Navigation Guide methodology builds on best practices in research synthesis in evidence-based medicine and environmental health. Key points of departure from current methods of expert-based narrative review prevalent in environmental health include a prespecified protocol, standardized and transparent documentation including expert judgment, a comprehensive search strategy, assessment of "risk of bias," and separation of the science from values and preferences. Key points of departure from evidence-based medicine include assigning a "moderate" quality rating to human observational studies and combining diverse evidence streams. The Navigation Guide methodology is a systematic and rigorous approach to research synthesis that has been developed to reduce bias and maximize transparency in the evaluation of environmental health information. Although novel aspects of the method will require further development and validation, our findings demonstrated that improved methods of research synthesis under development at the National Toxicology Program and under consideration by the U.S. Environmental Protection Agency are fully achievable. The institutionalization of robust methods of systematic and transparent review would provide a concrete mechanism for linking science to timely action to prevent harm.

Logic Learning Machine and standard supervised methods for Hodgkin's lymphoma prognosis using gene expression data and clinical variables.

PubMed

Parodi, Stefano; Manneschi, Chiara; Verda, Damiano; Ferrari, Enrico; Muselli, Marco

2018-03-01

This study evaluates the performance of a set of machine learning techniques in predicting the prognosis of Hodgkin's lymphoma using clinical factors and gene expression data. Analysed samples from 130 Hodgkin's lymphoma patients included a small set of clinical variables and more than 54,000 gene features. Machine learning classifiers included three black-box algorithms ( k-nearest neighbour, Artificial Neural Network, and Support Vector Machine) and two methods based on intelligible rules (Decision Tree and the innovative Logic Learning Machine method). Support Vector Machine clearly outperformed any of the other methods. Among the two rule-based algorithms, Logic Learning Machine performed better and identified a set of simple intelligible rules based on a combination of clinical variables and gene expressions. Decision Tree identified a non-coding gene ( XIST) involved in the early phases of X chromosome inactivation that was overexpressed in females and in non-relapsed patients. XIST expression might be responsible for the better prognosis of female Hodgkin's lymphoma patients.

Control methods and systems for indirect evaporative coolers

DOEpatents

Woods, Jason; Kozubal, Erik

2015-09-22

A control method for operating an indirect evaporative cooler to control temperature and humidity. The method includes operating an airflow control device to provide supply air at a flow rate to a liquid desiccant dehumidifier. The supply air flows through the dehumidifier and an indirect evaporative cooler prior to exiting an outlet into a space. The method includes operating a pump to provide liquid desiccant to the liquid desiccant dehumidifier and sensing a temperature of an airstream at the outlet of the indirect evaporative cooler. The method includes comparing the temperature of the airstream at the outlet to a setpoint temperature at the outlet and controlling the pump to set the flow rate of the liquid desiccant. The method includes sensing space temperature, comparing the space temperature with a setpoint temperature, and controlling the airflow control device to set the flow rate of the supply air based on the comparison.

Integrated narrowband optical filter based on embedded subwavelength resonant grating structures

DOEpatents

Grann, Eric B.; Sitter, Jr., David N.

2000-01-01

A resonant grating structure in a waveguide and methods of tuning the performance of the grating structure are described. An apparatus includes a waveguide; and a subwavelength resonant grating structure embedded in the waveguide. The systems and methods provide advantages including narrowband filtering capabilities, minimal sideband reflections, spatial control, high packing density, and tunability.

School-Based Mentoring for Adolescents: A Systematic Review and Meta-Analysis

ERIC Educational Resources Information Center

Wood, Sarah; Mayo-Wilson, Evan

2012-01-01

Objectives: To evaluate the impact of school-based mentoring for adolescents (11-18 years) on academic performance, attendance, attitudes, behavior, and self-esteem. Method: A systematic review and meta-analysis. The authors searched 12 databases from 1980 to 2011. Eight studies with 6,072 participants were included, 6 were included in…

Implementing Curriculum-Based Learning Portfolio: A Case Study in Taiwan

ERIC Educational Resources Information Center

Chen, Shu-Chin Susan; Cheng, Yu-Pay

2011-01-01

The main purpose of this descriptive research is to examine and document the development of a curriculum-based learning portfolio model for children in a preschool for three-six-year-olds in Taiwan. Data collection methods adopted include classroom observation, in-depth interviews, questionnaires and documentation. Participants include a preschool…

Identification of Essential Food Skills for Skill-Based Healthful Eating Programs in Secondary Schools

ERIC Educational Resources Information Center

Fordyce-Voorham, Sandra

2011-01-01

Objective: To identify the food skills deemed essential to include in skill-based healthful eating programs in secondary schools. Methods: Fifty-one food experts including home economics educators, chefs, nutritionists and dietitians, community educators, homemakers, and young people were recruited by invitation, mail, and advertising. Data were…

Advances in explosives analysis—part II: photon and neutron methods

DOE PAGES

Brown, Kathryn E.; Greenfield, Margo T.; McGrane, Shawn D.; ...

2015-10-07

The number and capability of explosives detection and analysis methods have increased dramatically since publication of the Analytical and Bioanalytical Chemistry special issue devoted to Explosives Analysis [Moore DS, Goodpaster JV, Anal Bioanal Chem 395:245–246, 2009]. Here we review and critically evaluate the latest (the past five years) important advances in explosives detection, with details of the improvements over previous methods, and suggest possible avenues towards further advances in, e.g., stand-off distance, detection limit, selectivity, and penetration through camouflage or packaging. Our review consists of two parts. Part I discussed methods based on animals, chemicals (including colorimetry, molecularly imprinted polymers,more » electrochemistry, and immunochemistry), ions (both ion-mobility spectrometry and mass spectrometry), and mechanical devices. In Part II, we review methods based on photons, from very energetic photons including X-rays and gamma rays down to the terahertz range, and neutrons.« less

Advances in explosives analysis—part I. animal, chemical, ion, and mechanical methods

DOE PAGES

Brown, Kathryn E.; Greenfield, Margo T.; McGrane, Shawn D.; ...

2015-10-13

The number and capability of explosives detection and analysis methods have increased substantially since the publication of the Analytical and Bioanalytical Chemistry special issue devoted to Explosives Analysis (Moore and Goodpaster, Anal Bioanal Chem 395(2):245–246, 2009). We review and critically evaluate the latest (the past five years) important advances in explosives detection, with details of the improvements over previous methods, and suggest possible avenues towards further advances in, e.g., stand-off distance, detection limit, selectivity, and penetration through camouflage or packaging. The review consists of two parts. Moreover, Part I, reviews methods based on animals, chemicals (including colorimetry, molecularly imprinted polymers,more » electrochemistry, and immunochemistry), ions (both ion-mobility spectrometry and mass spectrometry), and mechanical devices. Part II will review methods based on photons, from very energetic photons including X-rays and gamma rays down to the terahertz range, and neutrons.« less

The International College of Neuropsychopharmacology (CINP) Treatment Guidelines for Bipolar Disorder in Adults (CINP-BD-2017), Part 1: Background and Methods of the Development of Guidelines

PubMed Central

Young, Allan; Yatham, Lakshmi; Grunze, Heinz; Vieta, Eduard; Blier, Pierre; Moeller, Hans Jurgen; Kasper, Siegfried

2017-01-01

Abstract Background: This paper includes a short description of the important clinical aspects of Bipolar Disorder with emphasis on issues that are important for the therapeutic considerations, including mixed and psychotic features, predominant polarity, and rapid cycling as well as comorbidity. Methods: The workgroup performed a review and critical analysis of the literature concerning grading methods and methods for the development of guidelines. Results: The workgroup arrived at a consensus to base the development of the guideline on randomized controlled trials and related meta-analyses alone in order to follow a strict evidence-based approach. A critical analysis of the existing methods for the grading of treatment options was followed by the development of a new grading method to arrive at efficacy and recommendation levels after the analysis of 32 distinct scenarios of available data for a given treatment option. Conclusion: The current paper reports details on the design, method, and process for the development of CINP guidelines for the treatment of Bipolar Disorder. The rationale and the method with which all data and opinions are combined in order to produce an evidence-based operationalized but also user-friendly guideline and a specific algorithm are described in detail in this paper. PMID:27815414

Including α s1 casein gene information in genomic evaluations of French dairy goats.

PubMed

Carillier-Jacquin, Céline; Larroque, Hélène; Robert-Granié, Christèle

2016-08-04

Genomic best linear unbiased prediction methods assume that all markers explain the same fraction of the genetic variance and do not account effectively for genes with major effects such as the α s1 casein polymorphism in dairy goats. In this study, we investigated methods to include the available α s1 casein genotype effect in genomic evaluations of French dairy goats. First, the α s1 casein genotype was included as a fixed effect in genomic evaluation models based only on bucks that were genotyped at the α s1 casein locus. Less than 1 % of the females with phenotypes were genotyped at the α s1 casein gene. Thus, to incorporate these female phenotypes in the genomic evaluation, two methods that allowed for this large number of missing α s1 casein genotypes were investigated. Probabilities for each possible α s1 casein genotype were first estimated for each female of unknown genotype based on iterative peeling equations. The second method is based on a multiallelic gene content approach. For each model tested, we used three datasets each divided into a training and a validation set: (1) two-breed population (Alpine + Saanen), (2) Alpine population, and (3) Saanen population. The α s1 casein genotype had a significant effect on milk yield, fat content and protein content. Including an α s1 casein effect in genetic and genomic evaluations based only on male known α s1 casein genotypes improved accuracies (from 6 to 27 %). In genomic evaluations based on all female phenotypes, the gene content approach performed better than the other tested methods but the improvement in accuracy was only slightly better (from 1 to 14 %) than that of a genomic model without the α s1 casein effect. Including the α s1 casein effect in a genomic evaluation model for French dairy goats is possible and useful to improve accuracy. Difficulties in predicting the genotypes for ungenotyped animals limited the improvement in accuracy of the obtained estimated breeding values.

Filter replacement lifetime prediction

DOEpatents

Hamann, Hendrik F.; Klein, Levente I.; Manzer, Dennis G.; Marianno, Fernando J.

2017-10-25

Methods and systems for predicting a filter lifetime include building a filter effectiveness history based on contaminant sensor information associated with a filter; determining a rate of filter consumption with a processor based on the filter effectiveness history; and determining a remaining filter lifetime based on the determined rate of filter consumption. Methods and systems for increasing filter economy include measuring contaminants in an internal and an external environment; determining a cost of a corrosion rate increase if unfiltered external air intake is increased for cooling; determining a cost of increased air pressure to filter external air; and if the cost of filtering external air exceeds the cost of the corrosion rate increase, increasing an intake of unfiltered external air.

Technology-based self-care methods of improving antiretroviral adherence: a systematic review.

PubMed

Saberi, Parya; Johnson, Mallory O

2011-01-01

As HIV infection has shifted to a chronic condition, self-care practices have emerged as an important topic for HIV-positive individuals in maintaining an optimal level of health. Self-care refers to activities that patients undertake to maintain and improve health, such as strategies to achieve and maintain high levels of antiretroviral adherence. Technology-based methods are increasingly used to enhance antiretroviral adherence; therefore, we systematically reviewed the literature to examine technology-based self-care methods that HIV-positive individuals utilize to improve adherence. Seven electronic databases were searched from 1/1/1980 through 12/31/2010. We included quantitative and qualitative studies. Among quantitative studies, the primary outcomes included ARV adherence, viral load, and CD4+ cell count and secondary outcomes consisted of quality of life, adverse effects, and feasibility/acceptability data. For qualitative/descriptive studies, interview themes, reports of use, and perceptions of use were summarized. Thirty-six publications were included (24 quantitative and 12 qualitative/descriptive). Studies with exclusive utilization of medication reminder devices demonstrated less evidence of enhancing adherence in comparison to multi-component methods. This systematic review offers support for self-care technology-based approaches that may result in improved antiretroviral adherence. There was a clear pattern of results that favored individually-tailored, multi-function technologies, which allowed for periodic communication with health care providers rather than sole reliance on electronic reminder devices.

Hybrid statistics-simulations based method for atom-counting from ADF STEM images.

PubMed

De Wael, Annelies; De Backer, Annick; Jones, Lewys; Nellist, Peter D; Van Aert, Sandra

2017-06-01

A hybrid statistics-simulations based method for atom-counting from annular dark field scanning transmission electron microscopy (ADF STEM) images of monotype crystalline nanostructures is presented. Different atom-counting methods already exist for model-like systems. However, the increasing relevance of radiation damage in the study of nanostructures demands a method that allows atom-counting from low dose images with a low signal-to-noise ratio. Therefore, the hybrid method directly includes prior knowledge from image simulations into the existing statistics-based method for atom-counting, and accounts in this manner for possible discrepancies between actual and simulated experimental conditions. It is shown by means of simulations and experiments that this hybrid method outperforms the statistics-based method, especially for low electron doses and small nanoparticles. The analysis of a simulated low dose image of a small nanoparticle suggests that this method allows for far more reliable quantitative analysis of beam-sensitive materials. Copyright © 2017 Elsevier B.V. All rights reserved.

A systematic and critical review of the evolving methods and applications of value of information in academia and practice.

PubMed

Steuten, Lotte; van de Wetering, Gijs; Groothuis-Oudshoorn, Karin; Retèl, Valesca

2013-01-01

This article provides a systematic and critical review of the evolving methods and applications of value of information (VOI) in academia and practice and discusses where future research needs to be directed. Published VOI studies were identified by conducting a computerized search on Scopus and ISI Web of Science from 1980 until December 2011 using pre-specified search terms. Only full-text papers that outlined and discussed VOI methods for medical decision making, and studies that applied VOI and explicitly discussed the results with a view to informing healthcare decision makers, were included. The included papers were divided into methodological and applied papers, based on the aim of the study. A total of 118 papers were included of which 50 % (n = 59) are methodological. A rapidly accumulating literature base on VOI from 1999 onwards for methodological papers and from 2005 onwards for applied papers is observed. Expected value of sample information (EVSI) is the preferred method of VOI to inform decision making regarding specific future studies, but real-life applications of EVSI remain scarce. Methodological challenges to VOI are numerous and include the high computational demands, dealing with non-linear models and interdependency between parameters, estimations of effective time horizons and patient populations, and structural uncertainties. VOI analysis receives increasing attention in both the methodological and the applied literature bases, but challenges to applying VOI in real-life decision making remain. For many technical and methodological challenges to VOI analytic solutions have been proposed in the literature, including leaner methods for VOI. Further research should also focus on the needs of decision makers regarding VOI.

Sector-Based Detection for Hands-Free Speech Enhancement in Cars

NASA Astrophysics Data System (ADS)

Lathoud, Guillaume; Bourgeois, Julien; Freudenberger, Jürgen

2006-12-01

Adaptation control of beamforming interference cancellation techniques is investigated for in-car speech acquisition. Two efficient adaptation control methods are proposed that avoid target cancellation. The "implicit" method varies the step-size continuously, based on the filtered output signal. The "explicit" method decides in a binary manner whether to adapt or not, based on a novel estimate of target and interference energies. It estimates the average delay-sum power within a volume of space, for the same cost as the classical delay-sum. Experiments on real in-car data validate both methods, including a case with[InlineEquation not available: see fulltext.] km/h background road noise.

Realizing Improvement through Team Empowerment (RITE): A Team-based, Project-based Multidisciplinary Improvement Program.

PubMed

Larson, David B; Mickelsen, L Jake; Garcia, Kandice

2016-01-01

Performance improvement in a complex health care environment depends on the cooperation of diverse individuals and groups, allocation of time and resources, and use of effective improvement methods. To address this challenge, we developed an 18-week multidisciplinary training program that would also provide a vehicle for effecting needed improvements, by using a team- and project-based model. The program began in the radiology department and subsequently expanded to include projects from throughout the medical center. Participants were taught a specific method for team-based problem solving, which included (a) articulating the problem, (b) observing the process, (c) analyzing possible causes of problems, (d) identifying key drivers, (e) testing and refining interventions, and (f) providing for sustainment of results. Progress was formally reviewed on a weekly basis. A total of 14 teams consisting of 78 participants completed the course in two cohorts; one project was discontinued. All completed projects resulted in at least modest improvement. Mean skill scores increased from 2.5/6 to 4.5/6 (P < .01), and the mean satisfaction score was 4.7/5. Identified keys to success include (a) engagement of frontline staff, (b) teams given authority to make process changes, (c) capable improvement coaches, (d) a physician-director with improvement expertise and organizational authority, (e) capable administrative direction, (f) supportive organizational leaders, (g) weekly progress reviews, (h) timely educational material, (i) structured problem-solving methods, and ( j ) multiple projects working simultaneously. The purpose of this article is to review the program, including the methods and results, and discuss perceived keys to program success. © RSNA, 2016.

77 FR 25954 - Receipt of Several Pesticide Petitions Filed for Residues of Pesticide Chemicals in or on Various...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-05-02

... commodities. These methods include: Gas-Liquid Chromatography ((GLC)--Method I in PAM II); HPLC with... methodology for proquinazid in plant- based matrices is the DFG-S19 multi-residue method which uses gas...

Method and system for fault accommodation of machines

NASA Technical Reports Server (NTRS)

Goebel, Kai Frank (Inventor); Subbu, Rajesh Venkat (Inventor); Rausch, Randal Thomas (Inventor); Frederick, Dean Kimball (Inventor)

2011-01-01

A method for multi-objective fault accommodation using predictive modeling is disclosed. The method includes using a simulated machine that simulates a faulted actual machine, and using a simulated controller that simulates an actual controller. A multi-objective optimization process is performed, based on specified control settings for the simulated controller and specified operational scenarios for the simulated machine controlled by the simulated controller, to generate a Pareto frontier-based solution space relating performance of the simulated machine to settings of the simulated controller, including adjustment to the operational scenarios to represent a fault condition of the simulated machine. Control settings of the actual controller are adjusted, represented by the simulated controller, for controlling the actual machine, represented by the simulated machine, in response to a fault condition of the actual machine, based on the Pareto frontier-based solution space, to maximize desirable operational conditions and minimize undesirable operational conditions while operating the actual machine in a region of the solution space defined by the Pareto frontier.

Ionospheric Delay Compensation Using a Scale Factor Based on an Altitude of a Receiver

NASA Technical Reports Server (NTRS)

Zhao, Hui (Inventor); Savoy, John (Inventor)

2014-01-01

In one embodiment, a method for ionospheric delay compensation is provided. The method includes determining an ionospheric delay based on a signal having propagated from the navigation satellite to a location below the ionosphere. A scale factor can be applied to the ionospheric delay, wherein the scale factor corresponds to a ratio of an ionospheric delay in the vertical direction based on an altitude of the satellite navigation system receiver. Compensation can be applied based on the ionospheric delay.

Design and realization of retina-like three-dimensional imaging based on a MOEMS mirror

NASA Astrophysics Data System (ADS)

Cao, Jie; Hao, Qun; Xia, Wenze; Peng, Yuxin; Cheng, Yang; Mu, Jiaxing; Wang, Peng

2016-07-01

To balance conflicts for high-resolution, large-field-of-view and real-time imaging, a retina-like imaging method based on time-of flight (TOF) is proposed. Mathematical models of 3D imaging based on MOEMS are developed. Based on this method, we perform simulations of retina-like scanning properties, including compression of redundant information and rotation and scaling invariance. To validate the theory, we develop a prototype and conduct relevant experiments. The preliminary results agree well with the simulations.

Community-Involved Learning to Expand Possibilities for Vulnerable Children: A Critical Communicative, Sen's Capability, and Action Research Approach

ERIC Educational Resources Information Center

Kim, Kyung Hi

2014-01-01

This research, based on a case study of vulnerable children in Korea, used a mixed methods transformative approach to explore strategies to support and help disadvantaged children. The methodological approach includes three phases: a mixed methods contextual analysis, a qualitative dominant analysis based on Sen's capability approach and critical…

pyro: Python-based tutorial for computational methods for hydrodynamics

NASA Astrophysics Data System (ADS)

Zingale, Michael

2015-07-01

pyro is a simple python-based tutorial on computational methods for hydrodynamics. It includes 2-d solvers for advection, compressible, incompressible, and low Mach number hydrodynamics, diffusion, and multigrid. It is written with ease of understanding in mind. An extensive set of notes that is part of the Open Astrophysics Bookshelf project provides details of the algorithms.

Enhancing Science Education Instruction: A Mixed-Methods Study on University and Middle School Collaborations

ERIC Educational Resources Information Center

Owen-Stone, Deborah S.

2012-01-01

The purpose of this concurrent mixed methods study was to examine the collaborative relationship between scientists and science teachers and to incorporate and advocate scientific literacy based on past and current educational theories such as inquiry based teaching. The scope of this study included archived student standardized test scores,…

Design and test of a hybrid foot force sensing and GPS system for richer user mobility activity recognition.

PubMed

Zhang, Zelun; Poslad, Stefan

2013-11-01

Wearable and accompanied sensors and devices are increasingly being used for user activity recognition. However, typical GPS-based and accelerometer-based (ACC) methods face three main challenges: a low recognition accuracy; a coarse recognition capability, i.e., they cannot recognise both human posture (during travelling) and transportation mode simultaneously, and a relatively high computational complexity. Here, a new GPS and Foot-Force (GPS + FF) sensor method is proposed to overcome these challenges that leverages a set of wearable FF sensors in combination with GPS, e.g., in a mobile phone. User mobility activities that can be recognised include both daily user postures and common transportation modes: sitting, standing, walking, cycling, bus passenger, car passenger (including private cars and taxis) and car driver. The novelty of this work is that our approach provides a more comprehensive recognition capability in terms of reliably recognising both human posture and transportation mode simultaneously during travel. In addition, by comparing the new GPS + FF method with both an ACC method (62% accuracy) and a GPS + ACC based method (70% accuracy) as baseline methods, it obtains a higher accuracy (95%) with less computational complexity, when tested on a dataset obtained from ten individuals.

Thermoelectric skutterudite compositions and methods for producing the same

DOEpatents

Ren, Zhifeng; Yang, Jian; Yan, Xiao; He, Qinyu; Chen, Gang; Hao, Qing

2014-11-11

Compositions related to skutterudite-based thermoelectric materials are disclosed. Such compositions can result in materials that have enhanced ZT values relative to one or more bulk materials from which the compositions are derived. Thermoelectric materials such as n-type and p-type skutterudites with high thermoelectric figures-of-merit can include materials with filler atoms and/or materials formed by compacting particles (e.g., nanoparticles) into a material with a plurality of grains each having a portion having a skutterudite-based structure. Methods of forming thermoelectric skutterudites, which can include the use of hot press processes to consolidate particles, are also disclosed. The particles to be consolidated can be derived from (e.g., grinded from), skutterudite-based bulk materials, elemental materials, other non-Skutterudite-based materials, or combinations of such materials.

Thermoelectric Skutterudite Compositions and Methods for Producing the Same

NASA Technical Reports Server (NTRS)

Yang, Jian (Inventor); Yan, Xiao (Inventor); Ren, Zhifeng (Inventor); Hao, Qing (Inventor); He, Qinyu (Inventor); Chen, Gang (Inventor)

2014-01-01

Compositions related to skutterudite-based thermoelectric materials are disclosed. Such compositions can result in materials that have enhanced ZT values relative to one or more bulk materials from which the compositions are derived. Thermoelectric materials such as n-type and p-type skutterudites with high thermoelectric figures-of-merit can include materials with filler atoms and/or materials formed by compacting particles (e.g., nanoparticles) into a material with a plurality of grains each having a portion having a skutterudite-based structure. Methods of forming thermoelectric skutterudites, which can include the use of hot press processes to consolidate particles, are also disclosed. The particles to be consolidated can be derived from (e.g., grinded from), skutterudite-based bulk materials, elemental materials, other non-Skutterudite-based materials, or combinations of such materials.

Optical enhancing durable anti-reflective coating

DOEpatents

Maghsoodi, Sina; Varadarajan, Aravamuthan; Movassat, Meisam

2016-07-05

Disclosed herein are polysilsesquioxane based anti-reflective coating (ARC) compositions, methods of preparation, and methods of deposition on a substrate. In embodiments, the polysilsesquioxane of this disclosure is prepared in a two-step process of acid catalyzed hydrolysis of organoalkoxysilane followed by addition of tetralkoxysilane that generates silicone polymers with >40 mol % silanol based on Si-NMR. These high silanol siloxane polymers are stable and have a long shelf-life in the polar organic solvents at room temperature. Also disclosed are low refractive index ARC made from these compositions with and without additives such as porogens, templates, Si--OH condensation catalyst and/or nanofillers. Also disclosed are methods and apparatus for applying coatings to flat substrates including substrate pre-treatment processes, coating processes including flow coating and roll coating, and coating curing processes including skin-curing using hot-air knives. Also disclosed are coating compositions and formulations for highly tunable, durable, highly abrasion-resistant functionalized anti-reflective coatings.

Routing Based on Length of Time of Available Connection

NASA Technical Reports Server (NTRS)

Anandappan, Thanga (Inventor); Roy, Aloke (Inventor); Malve, Sharath Babu (Inventor); Toth, Louis T. (Inventor)

2016-01-01

In an embodiment, a method of routing packets at a first node in an ad-hoc network is provided. The method includes receiving, at the first node, a plurality of route-alive messages corresponding to a destination, each of the plurality of route-alive messages including a route time indicating a length of time in which a communicative connection is available between the second node that sent the respective route-alive message and the destination. The method also includes determining an updated route time for each second node. The updated route time corresponds to a length of time in which a communication connection is available between the first node and the destination through the respective second node. A second node is selected for sending a packet to based on the updated route time for each of the second nodes, wherein a node having a longer updated route time is given higher priority for selection.

Method of producing catalytic material for fabricating nanostructures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Seals, Roland D.; Menchhofer, Paul A.; Howe, Jane Y.

Methods of fabricating nano-catalysts are described. In some embodiments the nano-catalyst is formed from a powder-based substrate material and is some embodiments the nano-catalyst is formed from a solid-based substrate material. In some embodiments the substrate material may include metal, ceramic, or silicon or another metalloid. The nano-catalysts typically have metal nanoparticles disposed adjacent the surface of the substrate material. The methods typically include functionalizing the surface of the substrate material with a chelating agent, such as a chemical having dissociated carboxyl functional groups (--COO), that provides an enhanced affinity for metal ions. The functionalized substrate surface may then bemore » exposed to a chemical solution that contains metal ions. The metal ions are then bound to the substrate material and may then be reduced, such as by a stream of gas that includes hydrogen, to form metal nanoparticles adjacent the surface of the substrate.« less

Method of producing catalytic materials for fabricating nanostructures

DOEpatents

Seals, Roland D; Menchhofer, Paul A; Howe, Jane Y; Wang, Wei

2013-02-19

Methods of fabricating nano-catalysts are described. In some embodiments the nano-catalyst is formed from a powder-based substrate material and is some embodiments the nano-catalyst is formed from a solid-based substrate material. In some embodiments the substrate material may include metal, ceramic, or silicon or another metalloid. The nano-catalysts typically have metal nanoparticles disposed adjacent the surface of the substrate material. The methods typically include functionalizing the surface of the substrate material with a chelating agent, such as a chemical having dissociated carboxyl functional groups (--COO), that provides an enhanced affinity for metal ions. The functionalized substrate surface may then be exposed to a chemical solution that contains metal ions. The metal ions are then bound to the substrate material and may then be reduced, such as by a stream of gas that includes hydrogen, to form metal nanoparticles adjacent the surface of the substrate.

[Comparison of two algorithms for development of design space-overlapping method and probability-based method].

PubMed

Shao, Jing-Yuan; Qu, Hai-Bin; Gong, Xing-Chu

2018-05-01

In this work, two algorithms (overlapping method and the probability-based method) for design space calculation were compared by using the data collected from extraction process of Codonopsis Radix as an example. In the probability-based method, experimental error was simulated to calculate the probability of reaching the standard. The effects of several parameters on the calculated design space were studied, including simulation number, step length, and the acceptable probability threshold. For the extraction process of Codonopsis Radix, 10 000 times of simulation and 0.02 for the calculation step length can lead to a satisfactory design space. In general, the overlapping method is easy to understand, and can be realized by several kinds of commercial software without coding programs, but the reliability of the process evaluation indexes when operating in the design space is not indicated. Probability-based method is complex in calculation, but can provide the reliability to ensure that the process indexes can reach the standard within the acceptable probability threshold. In addition, there is no probability mutation in the edge of design space by probability-based method. Therefore, probability-based method is recommended for design space calculation. Copyright© by the Chinese Pharmaceutical Association.

Multidisciplinary Design Techniques Applied to Conceptual Aerospace Vehicle Design. Ph.D. Thesis Final Technical Report

NASA Technical Reports Server (NTRS)

Olds, John Robert; Walberg, Gerald D.

1993-01-01

Multidisciplinary design optimization (MDO) is an emerging discipline within aerospace engineering. Its goal is to bring structure and efficiency to the complex design process associated with advanced aerospace launch vehicles. Aerospace vehicles generally require input from a variety of traditional aerospace disciplines - aerodynamics, structures, performance, etc. As such, traditional optimization methods cannot always be applied. Several multidisciplinary techniques and methods were proposed as potentially applicable to this class of design problem. Among the candidate options are calculus-based (or gradient-based) optimization schemes and parametric schemes based on design of experiments theory. A brief overview of several applicable multidisciplinary design optimization methods is included. Methods from the calculus-based class and the parametric class are reviewed, but the research application reported focuses on methods from the parametric class. A vehicle of current interest was chosen as a test application for this research. The rocket-based combined-cycle (RBCC) single-stage-to-orbit (SSTO) launch vehicle combines elements of rocket and airbreathing propulsion in an attempt to produce an attractive option for launching medium sized payloads into low earth orbit. The RBCC SSTO presents a particularly difficult problem for traditional one-variable-at-a-time optimization methods because of the lack of an adequate experience base and the highly coupled nature of the design variables. MDO, however, with it's structured approach to design, is well suited to this problem. The result of the application of Taguchi methods, central composite designs, and response surface methods to the design optimization of the RBCC SSTO are presented. Attention is given to the aspect of Taguchi methods that attempts to locate a 'robust' design - that is, a design that is least sensitive to uncontrollable influences on the design. Near-optimum minimum dry weight solutions are determined for the vehicle. A summary and evaluation of the various parametric MDO methods employed in the research are included. Recommendations for additional research are provided.

Worker-specific exposure monitor and method for surveillance of workers

DOEpatents

Lovejoy, Michael L.; Peeters, John P.; Johnson, A. Wayne

2000-01-01

A person-specific monitor that provides sensor information regarding hazards to which the person is exposed and means to geolocate the person at the time of the exposure. The monitor also includes means to communicate with a remote base station. Information from the monitor can be downloaded at the base station for long term storage and analysis. The base station can also include means to recharge the monitor.

Methods for chromosome-specific staining

DOEpatents

Gray, Joe W.; Pinkel, Daniel

1995-01-01

Methods and compositions for chromosome-specific staining are provided. Compositions comprise heterogenous mixtures of labeled nucleic acid fragments having substantially complementary base sequences to unique sequence regions of the chromosomal DNA for which their associated staining reagent is specific. Methods include methods for making the chromosome-specific staining compositions of the invention, and methods for applying the staining compositions to chromosomes.

A Method of Spatial Mapping and Reclassification for High-Spatial-Resolution Remote Sensing Image Classification

PubMed Central

Wang, Guizhou; Liu, Jianbo; He, Guojin

2013-01-01

This paper presents a new classification method for high-spatial-resolution remote sensing images based on a strategic mechanism of spatial mapping and reclassification. The proposed method includes four steps. First, the multispectral image is classified by a traditional pixel-based classification method (support vector machine). Second, the panchromatic image is subdivided by watershed segmentation. Third, the pixel-based multispectral image classification result is mapped to the panchromatic segmentation result based on a spatial mapping mechanism and the area dominant principle. During the mapping process, an area proportion threshold is set, and the regional property is defined as unclassified if the maximum area proportion does not surpass the threshold. Finally, unclassified regions are reclassified based on spectral information using the minimum distance to mean algorithm. Experimental results show that the classification method for high-spatial-resolution remote sensing images based on the spatial mapping mechanism and reclassification strategy can make use of both panchromatic and multispectral information, integrate the pixel- and object-based classification methods, and improve classification accuracy. PMID:24453808

The Better Mousetrap...Can Be Built by Engineers.

ERIC Educational Resources Information Center

McBride, Matthew

2003-01-01

Describes the growth of the INSPEC database developed by the Institution of Electrical Engineers. Highlights include an historical background of its growth from "Science Abstracts"; production methods, including computerization; indexing, including controlled (thesaurus-based), uncontrolled, chemical, and numerical indexing; and the…

Visual attention capacity: a review of TVA-based patient studies.

PubMed

Habekost, Thomas; Starrfelt, Randi

2009-02-01

Psychophysical studies have identified two distinct limitations of visual attention capacity: processing speed and apprehension span. Using a simple test, these cognitive factors can be analyzed by Bundesen's Theory of Visual Attention (TVA). The method has strong specificity and sensitivity, and measurements are highly reliable. As the method is theoretically founded, it also has high validity. TVA-based assessment has recently been used to investigate a broad range of neuropsychological and neurological conditions. We present the method, including the experimental paradigm and practical guidelines to patient testing, and review existing TVA-based patient studies organized by lesion anatomy. Lesions in three anatomical regions affect visual capacity: The parietal lobes, frontal cortex and basal ganglia, and extrastriate cortex. Visual capacity thus depends on large, bilaterally distributed anatomical networks that include several regions outside the visual system. The two visual capacity parameters are functionally separable, but seem to rely on largely overlapping brain areas.

Nitrate removal from drinking water with a focus on biological methods: a review.

PubMed

Rezvani, Fariba; Sarrafzadeh, Mohammad-Hossein; Ebrahimi, Sirous; Oh, Hee-Mock

2017-05-31

This article summarizes several developed and industrial technologies for nitrate removal from drinking water, including physicochemical and biological techniques, with a focus on autotrophic nitrate removal. Approaches are primarily classified into separation-based and elimination-based methods according to the fate of the nitrate in water treatment. Biological denitrification as a cost-effective and promising method of biological nitrate elimination is reviewed in terms of its removal process, applicability, efficiency, and associated disadvantages. The various pathways during biological nitrate removal, including assimilatory and dissimilatory nitrate reduction, are also explained. A comparative study was carried out to provide a better understanding of the advantages and disadvantages of autotrophic and heterotrophic denitrification. Sulfur-based and hydrogen-based denitrifications, which are the most common autotrophic processes of nitrate removal, are reviewed with the aim of presenting the salient features of hydrogenotrophic denitrification along with some drawbacks of the technology and research areas in which it could be used but currently is not. The application of algae-based water treatment is also introduced as a nature-inspired approach that may broaden future horizons of nitrate removal technology.

Case-based Long-term Professional Development of Science Teachers

NASA Astrophysics Data System (ADS)

Dori, Yehudit J.; Herscovitz, Orit

2005-10-01

Reform efforts are often unsuccessful because they failed to understand that teachers play a key role in making educational reforms successful. This paper describes a long-term teacher professional development (PD) program aimed at educating and training teachers to teach interdisciplinary topics using case-based method in science. The research objective was to identify, follow and document the processes that science teachers went through as they assimilated the interdisciplinary, case-based science teaching approach. The research accompanied the PD program throughout its 3-year period. About 50 teachers, who took part in the PD program, were exposed to an interdisciplinary case-based teaching method. The research instruments included teacher portfolios, which contained projects and reflection questionnaires, classroom observations, teacher interviews, and student feedback questionnaires. The portfolios contained the projects that the teachers had carried out during the PD program, which included case studies and accompanying student activities. We found that the teachers gradually moved from exposure to new teaching methods and subject matter, through active learning and preparing case-based team projects, to interdisciplinary, active classroom teaching using the case studies they developed.

A Profilometry-Based Dentifrice Abrasion Method for V8 Brushing Machines Part II: Comparison of RDA-PE and Radiotracer RDA Measures.

PubMed

Schneiderman, Eva; Colón, Ellen; White, Donald J; St John, Samuel

2015-01-01

The purpose of this study was to compare the abrasivity of commercial dentifrices by two techniques: the conventional gold standard radiotracer-based Radioactive Dentin Abrasivity (RDA) method; and a newly validated technique based on V8 brushing that included a profilometry-based evaluation of dentin wear. This profilometry-based method is referred to as RDA-Profilometry Equivalent, or RDA-PE. A total of 36 dentifrices were sourced from four global dentifrice markets (Asia Pacific [including China], Europe, Latin America, and North America) and tested blindly using both the standard radiotracer (RDA) method and the new profilometry method (RDA-PE), taking care to follow specific details related to specimen preparation and treatment. Commercial dentifrices tested exhibited a wide range of abrasivity, with virtually all falling well under the industry accepted upper limit of 250; that is, 2.5 times the level of abrasion measured using an ISO 11609 abrasivity reference calcium pyrophosphate as the reference control. RDA and RDA-PE comparisons were linear across the entire range of abrasivity (r2 = 0.7102) and both measures exhibited similar reproducibility with replicate assessments. RDA-PE assessments were not just linearly correlated, but were also proportional to conventional RDA measures. The linearity and proportionality of the results of the current study support that both methods (RDA or RDA-PE) provide similar results and justify a rationale for making the upper abrasivity limit of 250 apply to both RDA and RDA-PE.

[Problem-based learning, a comparison in the acquisition of transversal competencies].

PubMed

González Pascual, Juan Luis; López Martin, Inmaculada; Toledo Gómez, David

2009-01-01

In the European Higher Education Area (EEES in Spanish reference), a change in the pedagogical model has occurred: from teaching centered on the figure of the professor to learning centered on students, from an integral perspective. This learning must bring together the full set of competencies included in the program requirements necessary to obtain a degree. The specific competencies characterize a profession and distinguish one from others. The transversal competencies surpass the limits of one particular discipline to be potentially developed in all; these are subdivided in three types: instrumental, interpersonal and systemic. The authors describe and compare the acquisition of transversal competencies connected to students' portfolios and Problem-based Learning as pedagogical methods from the perspective of second year nursing students at the European University in Madrid during the 2007-8 academic year To do so, the authors carried out a transversal descriptive study; data was collected by a purpose-made questionnaire the authors developed which they based on the transversal competencies of the Tuning Nursing Project. Variables included age, sex, pedagogical method, perception on acquisition of those 24 competencies by means of a Likert Scale. U de Mann-Whitney descriptive and analytical statistics. The authors conclude that the portfolio and Problem-based Learning are useful pedagogical methods for acquiring transversal competencies; these results coincide with those of other studies. Comparing both methods, the authors share the opinion that the Problem-based Learning method could stimulate the search for information better than the portfolio method.

Comparison of liver volumetry on contrast‐enhanced CT images: one semiautomatic and two automatic approaches

PubMed Central

Cai, Wei; He, Baochun; Fang, Chihua

2016-01-01

This study was to evaluate the accuracy, consistency, and efficiency of three liver volumetry methods— one interactive method, an in‐house‐developed 3D medical Image Analysis (3DMIA) system, one automatic active shape model (ASM)‐based segmentation, and one automatic probabilistic atlas (PA)‐guided segmentation method on clinical contrast‐enhanced CT images. Forty‐two datasets, including 27 normal liver and 15 space‐occupying liver lesion patients, were retrospectively included in this study. The three methods — one semiautomatic 3DMIA, one automatic ASM‐based, and one automatic PA‐based liver volumetry — achieved an accuracy with VD (volume difference) of −1.69%,−2.75%, and 3.06% in the normal group, respectively, and with VD of −3.20%,−3.35%, and 4.14% in the space‐occupying lesion group, respectively. However, the three methods achieved an efficiency of 27.63 mins, 1.26 mins, 1.18 mins on average, respectively, compared with the manual volumetry, which took 43.98 mins. The high intraclass correlation coefficient between the three methods and the manual method indicated an excellent agreement on liver volumetry. Significant differences in segmentation time were observed between the three methods (3DMIA, ASM, and PA) and the manual volumetry (p<0.001), as well as between the automatic volumetries (ASM and PA) and the semiautomatic volumetry (3DMIA) (p<0.001). The semiautomatic interactive 3DMIA, automatic ASM‐based, and automatic PA‐based liver volumetry agreed well with manual gold standard in both the normal liver group and the space‐occupying lesion group. The ASM‐ and PA‐based automatic segmentation have better efficiency in clinical use. PACS number(s): 87.55.‐x PMID:27929487

Surface modification of high temperature iron alloys

DOEpatents

Park, Jong-Hee

1995-01-01

A method and article of manufacture of a coated iron based alloy. The method includes providing an iron based alloy substrate, depositing a silicon containing layer on the alloy surface while maintaining the alloy at a temperature of about 700.degree. C.-1200.degree. C. to diffuse silicon into the alloy surface and exposing the alloy surface to an ammonia atmosphere to form a silicon/oxygen/nitrogen containing protective layer on the iron based alloy.

Surface modification of high temperature iron alloys

DOEpatents

Park, J.H.

1995-06-06

A method and article of manufacture of a coated iron based alloy are disclosed. The method includes providing an iron based alloy substrate, depositing a silicon containing layer on the alloy surface while maintaining the alloy at a temperature of about 700--1200 C to diffuse silicon into the alloy surface and exposing the alloy surface to an ammonia atmosphere to form a silicon/oxygen/nitrogen containing protective layer on the iron based alloy. 13 figs.

Electronic-projecting Moire method applying CBR-technology

NASA Astrophysics Data System (ADS)

Kuzyakov, O. N.; Lapteva, U. V.; Andreeva, M. A.

2018-01-01

Electronic-projecting method based on Moire effect for examining surface topology is suggested. Conditions of forming Moire fringes and their parameters’ dependence on reference parameters of object and virtual grids are analyzed. Control system structure and decision-making subsystem are elaborated. Subsystem execution includes CBR-technology, based on applying case base. The approach related to analysing and forming decision for each separate local area with consequent formation of common topology map is applied.

Forecasting hotspots using predictive visual analytics approach

DOEpatents

Maciejewski, Ross; Hafen, Ryan; Rudolph, Stephen; Cleveland, William; Ebert, David

2014-12-30

A method for forecasting hotspots is provided. The method may include the steps of receiving input data at an input of the computational device, generating a temporal prediction based on the input data, generating a geospatial prediction based on the input data, and generating output data based on the time series and geospatial predictions. The output data may be configured to display at least one user interface at an output of the computational device.

Evaluation of methods for measuring particulate matter emissions from gas turbines.

PubMed

Petzold, Andreas; Marsh, Richard; Johnson, Mark; Miller, Michael; Sevcenco, Yura; Delhaye, David; Ibrahim, Amir; Williams, Paul; Bauer, Heidi; Crayford, Andrew; Bachalo, William D; Raper, David

2011-04-15

The project SAMPLE evaluated methods for measuring particle properties in the exhaust of aircraft engines with respect to the development of standardized operation procedures for particulate matter measurement in aviation industry. Filter-based off-line mass methods included gravimetry and chemical analysis of carbonaceous species by combustion methods. Online mass methods were based on light absorption measurement or used size distribution measurements obtained from an electrical mobility analyzer approach. Number concentrations were determined using different condensation particle counters (CPC). Total mass from filter-based methods balanced gravimetric mass within 8% error. Carbonaceous matter accounted for 70% of gravimetric mass while the remaining 30% were attributed to hydrated sulfate and noncarbonaceous organic matter fractions. Online methods were closely correlated over the entire range of emission levels studied in the tests. Elemental carbon from combustion methods and black carbon from optical methods deviated by maximum 5% with respect to mass for low to medium emission levels, whereas for high emission levels a systematic deviation between online methods and filter based methods was found which is attributed to sampling effects. CPC based instruments proved highly reproducible for number concentration measurements with a maximum interinstrument standard deviation of 7.5%.

Costs and Efficiency of Online and Offline Recruitment Methods: A Web-Based Cohort Study.

PubMed

Christensen, Tina; Riis, Anders H; Hatch, Elizabeth E; Wise, Lauren A; Nielsen, Marie G; Rothman, Kenneth J; Toft Sørensen, Henrik; Mikkelsen, Ellen M

2017-03-01

The Internet is widely used to conduct research studies on health issues. Many different methods are used to recruit participants for such studies, but little is known about how various recruitment methods compare in terms of efficiency and costs. The aim of our study was to compare online and offline recruitment methods for Internet-based studies in terms of efficiency (number of recruited participants) and costs per participant. We employed several online and offline recruitment methods to enroll 18- to 45-year-old women in an Internet-based Danish prospective cohort study on fertility. Offline methods included press releases, posters, and flyers. Online methods comprised advertisements placed on five different websites, including Facebook and Netdoktor.dk. We defined seven categories of mutually exclusive recruitment methods and used electronic tracking via unique Uniform Resource Locator (URL) and self-reported data to identify the recruitment method for each participant. For each method, we calculated the average cost per participant and efficiency, that is, the total number of recruited participants. We recruited 8252 study participants. Of these, 534 were excluded as they could not be assigned to a specific recruitment method. The final study population included 7724 participants, of whom 803 (10.4%) were recruited by offline methods, 3985 (51.6%) by online methods, 2382 (30.8%) by online methods not initiated by us, and 554 (7.2%) by other methods. Overall, the average cost per participant was €6.22 for online methods initiated by us versus €9.06 for offline methods. Costs per participant ranged from €2.74 to €105.53 for online methods and from €0 to €67.50 for offline methods. Lowest average costs per participant were for those recruited from Netdoktor.dk (€2.99) and from Facebook (€3.44). In our Internet-based cohort study, online recruitment methods were superior to offline methods in terms of efficiency (total number of participants enrolled). The average cost per recruited participant was also lower for online than for offline methods, although costs varied greatly among both online and offline recruitment methods. We observed a decrease in the efficiency of some online recruitment methods over time, suggesting that it may be optimal to adopt multiple online methods. ©Tina Christensen, Anders H Riis, Elizabeth E Hatch, Lauren A Wise, Marie G Nielsen, Kenneth J Rothman, Henrik Toft Sørensen, Ellen M Mikkelsen. Originally published in the Journal of Medical Internet Research (http://www.jmir.org), 01.03.2017.

Impervious surface mapping with Quickbird imagery

PubMed Central

Lu, Dengsheng; Hetrick, Scott; Moran, Emilio

2010-01-01

This research selects two study areas with different urban developments, sizes, and spatial patterns to explore the suitable methods for mapping impervious surface distribution using Quickbird imagery. The selected methods include per-pixel based supervised classification, segmentation-based classification, and a hybrid method. A comparative analysis of the results indicates that per-pixel based supervised classification produces a large number of “salt-and-pepper” pixels, and segmentation based methods can significantly reduce this problem. However, neither method can effectively solve the spectral confusion of impervious surfaces with water/wetland and bare soils and the impacts of shadows. In order to accurately map impervious surface distribution from Quickbird images, manual editing is necessary and may be the only way to extract impervious surfaces from the confused land covers and the shadow problem. This research indicates that the hybrid method consisting of thresholding techniques, unsupervised classification and limited manual editing provides the best performance. PMID:21643434

General imaging of advanced 3D mask objects based on the fully-vectorial extended Nijboer-Zernike (ENZ) theory

NASA Astrophysics Data System (ADS)

van Haver, Sven; Janssen, Olaf T. A.; Braat, Joseph J. M.; Janssen, Augustus J. E. M.; Urbach, H. Paul; Pereira, Silvania F.

2008-03-01

In this paper we introduce a new mask imaging algorithm that is based on the source point integration method (or Abbe method). The method presented here distinguishes itself from existing methods by exploiting the through-focus imaging feature of the Extended Nijboer-Zernike (ENZ) theory of diffraction. An introduction to ENZ-theory and its application in general imaging is provided after which we describe the mask imaging scheme that can be derived from it. The remainder of the paper is devoted to illustrating the advantages of the new method over existing methods (Hopkins-based). To this extent several simulation results are included that illustrate advantages arising from: the accurate incorporation of isolated structures, the rigorous treatment of the object (mask topography) and the fully vectorial through-focus image formation of the ENZ-based algorithm.

Method for non-referential defect characterization using fractal encoding and active contours

DOEpatents

Gleason, Shaun S [Knoxville, TN; Sari-Sarraf, Hamed [Lubbock, TX

2007-05-15

A method for identification of anomalous structures, such as defects, includes the steps of providing a digital image and applying fractal encoding to identify a location of at least one anomalous portion of the image. The method does not require a reference image to identify the location of the anomalous portion. The method can further include the step of initializing an active contour based on the location information obtained from the fractal encoding step and deforming an active contour to enhance the boundary delineation of the anomalous portion.

Newly qualified teachers' visions of science learning and teaching

NASA Astrophysics Data System (ADS)

Roberts, Deborah L.

2011-12-01

This study investigated newly qualified teachers' visions of science learning and teaching. The study also documented their preparation in an elementary science methods course. The research questions were: What educational and professional experiences influenced the instructor's visions of science learning and teaching? What visions of science learning and teaching were promoted in the participants' science methods course? What visions of science learning and teaching did these newly qualified teachers bring with them as they graduated from their teacher preparation program? How did these visions compare with those advocated by reform documents? Data sources included participants' assignments, weekly reflections, and multi-media portfolio finals. Semi-structured interviews provided the emic voice of participants, after graduation but before they had begun to teach. These data were interpreted via a combination of qualitative methodologies. Vignettes described class activities. Assertions supported by excerpts from participants' writings emerged from repeated review of their assignments. A case study of a typical participant characterized weekly reflections and final multi-media portfolio. Four strands of science proficiency articulated in a national reform document provided a framework for interpreting activities, assignments, and interview responses. Prior experiences that influenced design of the methods course included an inquiry-based undergraduate physics course, participation in a reform-based teacher preparation program, undergraduate and graduate inquiry-based science teaching methods courses, participation in a teacher research group, continued connection to the university as a beginning teacher, teaching in diverse Title 1 schools, service as the county and state elementary science specialist, participation in the Carnegie Academy for the Scholarship of Teaching and Learning, service on a National Research Council committee, and experience teaching a science methods course. The methods course studied here emphasized reform-based practices, science as inquiry, culturally responsive teaching, scientific discourse, and integration of science with technology and other disciplines. Participants' writings and interview responses articulated visions of science learning and teaching that included aspects of reform-based practices. Some participants intentionally incorporated and implemented reform-based strategies in field placements during the methods course and student teaching. The strands of scientific proficiency were evident in activities, assignments and participants' interviews in varying degrees.

Noise Suppression Based on Multi-Model Compositions Using Multi-Pass Search with Multi-Label N-gram Models

NASA Astrophysics Data System (ADS)

Jitsuhiro, Takatoshi; Toriyama, Tomoji; Kogure, Kiyoshi

We propose a noise suppression method based on multi-model compositions and multi-pass search. In real environments, input speech for speech recognition includes many kinds of noise signals. To obtain good recognized candidates, suppressing many kinds of noise signals at once and finding target speech is important. Before noise suppression, to find speech and noise label sequences, we introduce multi-pass search with acoustic models including many kinds of noise models and their compositions, their n-gram models, and their lexicon. Noise suppression is frame-synchronously performed using the multiple models selected by recognized label sequences with time alignments. We evaluated this method using the E-Nightingale task, which contains voice memoranda spoken by nurses during actual work at hospitals. The proposed method obtained higher performance than the conventional method.

Three-dimensional compound comparison methods and their application in drug discovery.

PubMed

Shin, Woong-Hee; Zhu, Xiaolei; Bures, Mark Gregory; Kihara, Daisuke

2015-07-16

Virtual screening has been widely used in the drug discovery process. Ligand-based virtual screening (LBVS) methods compare a library of compounds with a known active ligand. Two notable advantages of LBVS methods are that they do not require structural information of a target receptor and that they are faster than structure-based methods. LBVS methods can be classified based on the complexity of ligand structure information utilized: one-dimensional (1D), two-dimensional (2D), and three-dimensional (3D). Unlike 1D and 2D methods, 3D methods can have enhanced performance since they treat the conformational flexibility of compounds. In this paper, a number of 3D methods will be reviewed. In addition, four representative 3D methods were benchmarked to understand their performance in virtual screening. Specifically, we tested overall performance in key aspects including the ability to find dissimilar active compounds, and computational speed.

Method and apparatus to selectively reduce NO.sub.x in an exhaust gas feedstream

DOEpatents

Schmieg, Steven J [Troy, MI; Blint, Richard J [Shelby Township, MI; Den, Ling [Sterling Heights, MI; Viola, Michael B [Macomb Township, MI; Lee, Jong-Hwan [Rochester Hills, MI

2011-08-30

A method and apparatus are described to selectively reduce NO.sub.x emissions of an internal combustion engine. An exhaust aftertreatment system includes an injection device operative to dispense a hydrocarbon reductant upstream of a silver-alumina catalytic reactor device. A control system determines a NO.sub.x concentration and hydrocarbon/NOx ratio based upon selected parameters of the exhaust gas feedstream and dispenses hydrocarbon reductant during lean engine operation. Included is a method to control elements of the feedstream during lean operation. The hydrocarbon reductant may include engine fuel.

A Novel Method to Identify Differential Pathways in Hippocampus Alzheimer's Disease.

PubMed

Liu, Chun-Han; Liu, Lian

2017-05-08

BACKGROUND Alzheimer's disease (AD) is the most common type of dementia. The objective of this paper is to propose a novel method to identify differential pathways in hippocampus AD. MATERIAL AND METHODS We proposed a combined method by merging existed methods. Firstly, pathways were identified by four known methods (DAVID, the neaGUI package, the pathway-based co-expressed method, and the pathway network approach), and differential pathways were evaluated through setting weight thresholds. Subsequently, we combined all pathways by a rank-based algorithm and called the method the combined method. Finally, common differential pathways across two or more of five methods were selected. RESULTS Pathways obtained from different methods were also different. The combined method obtained 1639 pathways and 596 differential pathways, which included all pathways gained from the four existing methods; hence, the novel method solved the problem of inconsistent results. Besides, a total of 13 common pathways were identified, such as metabolism, immune system, and cell cycle. CONCLUSIONS We have proposed a novel method by combining four existing methods based on a rank product algorithm, and identified 13 significant differential pathways based on it. These differential pathways might provide insight into treatment and diagnosis of hippocampus AD.

Analysis of digital communication signals and extraction of parameters

NASA Astrophysics Data System (ADS)

Al-Jowder, Anwar

1994-12-01

The signal classification performance of four types of electronics support measure (ESM) communications detection systems is compared from the standpoint of the unintended receiver (interceptor). Typical digital communication signals considered include binary phase shift keying (BPSK), quadrature phase shift keying (QPSK), frequency shift keying (FSK), and on-off keying (OOK). The analysis emphasizes the use of available signal processing software. Detection methods compared include broadband energy detection, FFT-based narrowband energy detection, and two correlation methods which employ the fast Fourier transform (FFT). The correlation methods utilize modified time-frequency distributions, where one of these is based on the Wigner-Ville distribution (WVD). Gaussian white noise is added to the signal to simulate various signal-to-noise ratios (SNR's).

A new artefacts resistant method for automatic lineament extraction using Multi-Hillshade Hierarchic Clustering (MHHC)

NASA Astrophysics Data System (ADS)

Šilhavý, Jakub; Minár, Jozef; Mentlík, Pavel; Sládek, Ján

2016-07-01

This paper presents a new method of automatic lineament extraction which includes the removal of the 'artefacts effect' which is associated with the process of raster based analysis. The core of the proposed Multi-Hillshade Hierarchic Clustering (MHHC) method incorporates a set of variously illuminated and rotated hillshades in combination with hierarchic clustering of derived 'protolineaments'. The algorithm also includes classification into positive and negative lineaments. MHHC was tested in two different territories in Bohemian Forest and Central Western Carpathians. The original vector-based algorithm was developed for comparison of the individual lineaments proximity. Its use confirms the compatibility of manual and automatic extraction and their similar relationships to structural data in the study areas.

Control-based method to identify underlying delays of a nonlinear dynamical system.

PubMed

Yu, Dongchuan; Frasca, Mattia; Liu, Fang

2008-10-01

We suggest several stationary state control-based delay identification methods which do not require any structural information about the controlled systems and are applicable to systems described by delayed ordinary differential equations. This proposed technique includes three steps: (i) driving a system to a steady state; (ii) perturbing the control signal for shifting the steady state; and (iii) identifying all delays by detecting the time that the system is abruptly drawn out of stationarity. Some aspects especially important for applications are discussed as well, including interaction delay identification, stationary state convergence speed, performance comparison, and the influence of noise on delay identification. Several examples are presented to illustrate the reliability and robustness of all delay identification methods suggested.

Contribution of formative research to design an environmental program for obesity prevention in schools in Mexico City.

PubMed

Bonvecchio, Anabelle; Théodore, Florence L; Safdie, Margarita; Duque, Tiffany; Villanueva, María Ángeles; Torres, Catalina; Rivera, Juan

2014-01-01

This paper describes the methods and key findings of formative research conducted to design a school-based program for obesity prevention. Formative research was based on the ecological model and the principles of social marketing. A mixed method approach was used. Qualitative (direct observation, indepth interviews, focus group discussions and photo-voice) and quantitative (closed ended surveys, checklists, anthropometry) methods were employed. Formative research key findings, including barriers by levels of the ecological model, were used for designing a program including environmental strategies to discourage the consumption of energy dense foods and sugar beverages. Formative research was fundamental to developing a context specific obesity prevention program in schools that seeks environment modification and behavior change.

User’s Guide for T.E.S.T. (version 4.2) (Toxicity Estimation Software Tool) A Program to Estimate Toxicity from Molecular Structure

EPA Science Inventory

The user's guide describes the methods used by TEST to predict toxicity and physical properties (including the new mode of action based method used to predict acute aquatic toxicity). It describes all of the experimental data sets included in the tool. It gives the prediction res...

Method and apparatus for assembling a permanent magnet pole assembly

DOEpatents

Carl, Jr., Ralph James; Bagepalli, Bharat Sampathkumaran [Niskayuna, NY; Jansen, Patrick Lee [Scotia, NY; Dawson, Richard Nils [Voorheesville, NY; Qu, Ronghai [Clifton Park, NY; Avanesov, Mikhail Avramovich [Moscow, RU

2009-08-11

A pole assembly for a rotor, the pole assembly includes a permanent magnet pole including at least one permanent magnet block, a plurality of laminations including a pole cap mechanically coupled to the pole, and a plurality of laminations including a base plate mechanically coupled to the pole.

Neural networks: Application to medical imaging

NASA Technical Reports Server (NTRS)

Clarke, Laurence P.

1994-01-01

The research mission is the development of computer assisted diagnostic (CAD) methods for improved diagnosis of medical images including digital x-ray sensors and tomographic imaging modalities. The CAD algorithms include advanced methods for adaptive nonlinear filters for image noise suppression, hybrid wavelet methods for feature segmentation and enhancement, and high convergence neural networks for feature detection and VLSI implementation of neural networks for real time analysis. Other missions include (1) implementation of CAD methods on hospital based picture archiving computer systems (PACS) and information networks for central and remote diagnosis and (2) collaboration with defense and medical industry, NASA, and federal laboratories in the area of dual use technology conversion from defense or aerospace to medicine.

Analytical and experimental study of axisymmetric truncated plug nozzle flow fields

NASA Technical Reports Server (NTRS)

Muller, T. J.; Sule, W. P.; Fanning, A. E.; Giel, T. V.; Galanga, F. L.

1972-01-01

Experimental and analytical investigation of the flow field and base pressure of internal-external-expansion truncated plug nozzles are discussed. Experimental results for two axisymmetric, conical plug-cylindrical shroud, truncated plug nozzles are presented for both open and closed wake operations. These results include extensive optical and pressure data covering nozzle flow field and base pressure characteristics, diffuser effects, lip shock strength, Mach disc behaviour, and the recompression and reverse flow regions. Transonic experiments for a special planar transonic section are presented. An extension of the analytical method of Hall and Mueller to include the internal shock wave from the shroud exit is presented for closed wake operation. Results of this analysis include effects on the flow field and base pressure of ambient pressure ratio, nozzle geometry, and the ratio of specific heats. Static thrust is presented as a function of ambient pressure ratio and nozzle geometry. A new transonic solution method is also presented.

The biometric-based module of smart grid system

NASA Astrophysics Data System (ADS)

Engel, E.; Kovalev, I. V.; Ermoshkina, A.

2015-10-01

Within Smart Grid concept the flexible biometric-based module base on Principal Component Analysis (PCA) and selective Neural Network is developed. The formation of the selective Neural Network the biometric-based module uses the method which includes three main stages: preliminary processing of the image, face localization and face recognition. Experiments on the Yale face database show that (i) selective Neural Network exhibits promising classification capability for face detection, recognition problems; and (ii) the proposed biometric-based module achieves near real-time face detection, recognition speed and the competitive performance, as compared to some existing subspaces-based methods.

Motion analysis report

NASA Technical Reports Server (NTRS)

Badler, N. I.

1985-01-01

Human motion analysis is the task of converting actual human movements into computer readable data. Such movement information may be obtained though active or passive sensing methods. Active methods include physical measuring devices such as goniometers on joints of the body, force plates, and manually operated sensors such as a Cybex dynamometer. Passive sensing de-couples the position measuring device from actual human contact. Passive sensors include Selspot scanning systems (since there is no mechanical connection between the subject's attached LEDs and the infrared sensing cameras), sonic (spark-based) three-dimensional digitizers, Polhemus six-dimensional tracking systems, and image processing systems based on multiple views and photogrammetric calculations.

Beyond maximum entropy: Fractal pixon-based image reconstruction

NASA Technical Reports Server (NTRS)

Puetter, R. C.; Pina, R. K.

1994-01-01

We have developed a new Bayesian image reconstruction method that has been shown to be superior to the best implementations of other methods, including Goodness-of-Fit (e.g. Least-Squares and Lucy-Richardson) and Maximum Entropy (ME). Our new method is based on the concept of the pixon, the fundamental, indivisible unit of picture information. Use of the pixon concept provides an improved image model, resulting in an image prior which is superior to that of standard ME.

WORKSHOP ON APPLICATION OF STATISTICAL METHODS TO BIOLOGICALLY-BASED PHARMACOKINETIC MODELING FOR RISK ASSESSMENT

EPA Science Inventory

Biologically-based pharmacokinetic models are being increasingly used in the risk assessment of environmental chemicals. These models are based on biological, mathematical, statistical and engineering principles. Their potential uses in risk assessment include extrapolation betwe...

Fish genome manipulation and directional breeding.

PubMed

Ye, Ding; Zhu, ZuoYan; Sun, YongHua

2015-02-01

Aquaculture is one of the fastest developing agricultural industries worldwide. One of the most important factors for sustainable aquaculture is the development of high performing culture strains. Genome manipulation offers a powerful method to achieve rapid and directional breeding in fish. We review the history of fish breeding methods based on classical genome manipulation, including polyploidy breeding and nuclear transfer. Then, we discuss the advances and applications of fish directional breeding based on transgenic technology and recently developed genome editing technologies. These methods offer increased efficiency, precision and predictability in genetic improvement over traditional methods.

Multiplex analysis of DNA

DOEpatents

Church, George M.; Kieffer-Higgins, Stephen

1992-01-01

This invention features vectors and a method for sequencing DNA. The method includes the steps of: a) ligating the DNA into a vector comprising a tag sequence, the tag sequence includes at least 15 bases, wherein the tag sequence will not hybridize to the DNA under stringent hybridization conditions and is unique in the vector, to form a hybrid vector, b) treating the hybrid vector in a plurality of vessels to produce fragments comprising the tag sequence, wherein the fragments differ in length and terminate at a fixed known base or bases, wherein the fixed known base or bases differs in each vessel, c) separating the fragments from each vessel according to their size, d) hybridizing the fragments with an oligonucleotide able to hybridize specifically with the tag sequence, and e) detecting the pattern of hybridization of the tag sequence, wherein the pattern reflects the nucleotide sequence of the DNA.

Promoting clinical competence: using scaffolded instruction for practice-based learning.

PubMed

Tilley, Donna Scott; Allen, Patricia; Collins, Cathie; Bridges, Ruth Ann; Francis, Patricia; Green, Alexia

2007-01-01

Competency-based education is essential for bridging the gap between education and practice. The attributes of competency-based education include an outcomes focus, allowance for increasing levels of competency, learner accountability, practice-based learning, self-assessment, and individualized learning experiences. One solution to this challenge is scaffolded instruction, where collaboration and knowledge facilitate learning. Collaboration refers to the role of clinical faculty who model desired clinical skills then gradually shift responsibility for nursing activity to the student. This article describes scaffolded instruction as applied in a Web-based second-degree bachelor of science in nursing (BSN) program. This second-degree BSN program uses innovative approaches to education, including a clinical component that relies on clinical coaches. Students in the program remain in their home community and complete their clinical hours with an assigned coach. The method will be described first, followed by a description of how the method was applied.

Human Body 3D Posture Estimation Using Significant Points and Two Cameras

PubMed Central

Juang, Chia-Feng; Chen, Teng-Chang; Du, Wei-Chin

2014-01-01

This paper proposes a three-dimensional (3D) human posture estimation system that locates 3D significant body points based on 2D body contours extracted from two cameras without using any depth sensors. The 3D significant body points that are located by this system include the head, the center of the body, the tips of the feet, the tips of the hands, the elbows, and the knees. First, a linear support vector machine- (SVM-) based segmentation method is proposed to distinguish the human body from the background in red, green, and blue (RGB) color space. The SVM-based segmentation method uses not only normalized color differences but also included angle between pixels in the current frame and the background in order to reduce shadow influence. After segmentation, 2D significant points in each of the two extracted images are located. A significant point volume matching (SPVM) method is then proposed to reconstruct the 3D significant body point locations by using 2D posture estimation results. Experimental results show that the proposed SVM-based segmentation method shows better performance than other gray level- and RGB-based segmentation approaches. This paper also shows the effectiveness of the 3D posture estimation results in different postures. PMID:24883422

Atmospheric Effects on InSAR Measurements and Their Mitigation

PubMed Central

Ding, Xiao-li; Li, Zhi-wei; Zhu, Jian-jun; Feng, Guang-cai; Long, Jiang-ping

2008-01-01

Interferometric Synthetic Aperture Radar (InSAR) is a powerful technology for observing the Earth surface, especially for mapping the Earth's topography and deformations. InSAR measurements are however often significantly affected by the atmosphere as the radar signals propagate through the atmosphere whose state varies both in space and in time. Great efforts have been made in recent years to better understand the properties of the atmospheric effects and to develop methods for mitigating the effects. This paper provides a systematic review of the work carried out in this area. The basic principles of atmospheric effects on repeat-pass InSAR are first introduced. The studies on the properties of the atmospheric effects, including the magnitudes of the effects determined in the various parts of the world, the spectra of the atmospheric effects, the isotropic properties and the statistical distributions of the effects, are then discussed. The various methods developed for mitigating the atmospheric effects are then reviewed, including the methods that are based on PSInSAR processing, the methods that are based on interferogram modeling, and those that are based on external data such as GPS observations, ground meteorological data, and satellite data including those from the MODIS and MERIS. Two examples that use MODIS and MERIS data respectively to calibrate atmospheric effects on InSAR are also given. PMID:27873822

Atmospheric Effects on InSAR Measurements and Their Mitigation.

PubMed

Ding, Xiao-Li; Li, Zhi-Wei; Zhu, Jian-Jun; Feng, Guang-Cai; Long, Jiang-Ping

2008-09-03

Interferometric Synthetic Aperture Radar (InSAR) is a powerful technology for observing the Earth surface, especially for mapping the Earth's topography and deformations. InSAR measurements are however often significantly affected by the atmosphere as the radar signals propagate through the atmosphere whose state varies both in space and in time. Great efforts have been made in recent years to better understand the properties of the atmospheric effects and to develop methods for mitigating the effects. This paper provides a systematic review of the work carried out in this area. The basic principles of atmospheric effects on repeat-pass InSAR are first introduced. The studies on the properties of the atmospheric effects, including the magnitudes of the effects determined in the various parts of the world, the spectra of the atmospheric effects, the isotropic properties and the statistical distributions of the effects, are then discussed. The various methods developed for mitigating the atmospheric effects are then reviewed, including the methods that are based on PSInSAR processing, the methods that are based on interferogram modeling, and those that are based on external data such as GPS observations, ground meteorological data, and satellite data including those from the MODIS and MERIS. Two examples that use MODIS and MERIS data respectively to calibrate atmospheric effects on InSAR are also given.

Systems and methods for controlling diesel engine emissions

DOEpatents

Webb, Cynthia Chaffin; Weber, Phillip Anthony; Khair, Magdi K.

2004-06-01

Systems and methods for controlling diesel engine emissions, including, for example, oxides of nitrogen emissions, particulate matter emissions, and the like. The emission control system according to this invention is provided in the exhaust passageway of a diesel engine and includes a catalyst-based particulate filter; and first and second lean NO.sub.x trap systems coupled to the catalyst-based particulate filter. The first and second lean NO.sub.x trap systems are arranged in a parallel flow configuration with each other. Each of the first and second lean NO.sub.x trap systems include a carbon monoxide generating catalyst device, a sulfur trap device, a lean NO.sub.x device, a supplemental fuel injector device, and a plurality of flow diverter devices.

Rapid deployable global sensing hazard alert system

DOEpatents

Cordaro, Joseph V; Tibrea, Steven L; Shull, Davis J; Coleman, Jerry T; Shuler, James M

2015-04-28

A rapid deployable global sensing hazard alert system and associated methods of operation are provided. An exemplary system includes a central command, a wireless backhaul network, and a remote monitoring unit. The remote monitoring unit can include a positioning system configured to determine a position of the remote monitoring unit based on one or more signals received from one or more satellites located in Low Earth Orbit. The wireless backhaul network can provide bidirectional communication capability independent of cellular telecommunication networks and the Internet. An exemplary method includes instructing at least one of a plurality of remote monitoring units to provide an alert based at least in part on a location of a hazard and a plurality of positions respectively associated with the plurality of remote monitoring units.

Cell Patterning for Liver Tissue Engineering via Dielectrophoretic Mechanisms

PubMed Central

Yahya, Wan Nurlina Wan; Kadri, Nahrizul Adib; Ibrahim, Fatimah

2014-01-01

Liver transplantation is the most common treatment for patients with end-stage liver failure. However, liver transplantation is greatly limited by a shortage of donors. Liver tissue engineering may offer an alternative by providing an implantable engineered liver. Currently, diverse types of engineering approaches for in vitro liver cell culture are available, including scaffold-based methods, microfluidic platforms, and micropatterning techniques. Active cell patterning via dielectrophoretic (DEP) force showed some advantages over other methods, including high speed, ease of handling, high precision and being label-free. This article summarizes liver function and regenerative mechanisms for better understanding in developing engineered liver. We then review recent advances in liver tissue engineering techniques and focus on DEP-based cell patterning, including microelectrode design and patterning configuration. PMID:24991941

Postgraduate Taught Portfolio Review--The Cluster Approach, Non-Subject-Based Grouping of Courses and Relevant Performance Indicators

ERIC Educational Resources Information Center

Konstantinidis-Pereira, Alicja

2018-01-01

This paper summarises a new method of grouping postgraduate taught (PGT) courses introduced at Oxford Brookes University as a part of a Portfolio Review. Instead of classifying courses by subject, the new cluster approach uses statistical methods to group the courses based on factors including flexibility of study options, level of specialisation,…

Methods of Suicide among Cancer Patients: A Nationwide Population-Based Study

ERIC Educational Resources Information Center

Chung, Kuo-Hsuan; Lin, Herng-Ching

2010-01-01

A 3-year nationwide population-based data set was used to explore methods of suicide (violent vs. nonviolent) and possible contributing factors among cancer patients in Taiwan. A total of 1,065 cancer inpatients who committed suicide were included as our study sample. The regression shows that those who had genitourinary cancer were 0.55 times (p…

Band excitation method applicable to scanning probe microscopy

DOEpatents

Jesse, Stephen; Kalinin, Sergei V.

2015-08-04

Scanning probe microscopy may include a method for generating a band excitation (BE) signal and simultaneously exciting a probe at a plurality of frequencies within a predetermined frequency band based on the excitation signal. A response of the probe is measured across a subset of frequencies of the predetermined frequency band and the excitation signal is adjusted based on the measured response.

Band excitation method applicable to scanning probe microscopy

DOEpatents

Jesse, Stephen; Kalinin, Sergei V.

2017-01-03

Scanning probe microscopy may include a method for generating a band excitation (BE) signal and simultaneously exciting a probe at a plurality of frequencies within a predetermined frequency band based on the excitation signal. A response of the probe is measured across a subset of frequencies of the predetermined frequency band and the excitation signal is adjusted based on the measured response.

FleCSPH - a parallel and distributed SPH implementation based on the FleCSI framework

DOE Office of Scientific and Technical Information (OSTI.GOV)

Junghans, Christoph; Loiseau, Julien

2017-06-20

FleCSPH is a multi-physics compact application that exercises FleCSI parallel data structures for tree-based particle methods. In particular, FleCSPH implements a smoothed-particle hydrodynamics (SPH) solver for the solution of Lagrangian problems in astrophysics and cosmology. FleCSPH includes support for gravitational forces using the fast multipole method (FMM).

Augmented reality building operations tool

DOEpatents

Brackney, Larry J.

2014-09-09

A method (700) for providing an augmented reality operations tool to a mobile client (642) positioned in a building (604). The method (700) includes, with a server (660), receiving (720) from the client (642) an augmented reality request for building system equipment (612) managed by an energy management system (EMS) (620). The method (700) includes transmitting (740) a data request for the equipment (612) to the EMS (620) and receiving (750) building management data (634) for the equipment (612). The method (700) includes generating (760) an overlay (656) with an object created based on the building management data (634), which may be sensor data, diagnostic procedures, or the like. The overlay (656) is configured for concurrent display on a display screen (652) of the client (642) with a real-time image of the building equipment (612). The method (700) includes transmitting (770) the overlay (656) to the client (642).

Method and system for laser-based formation of micro-shapes in surfaces of optical elements

DOEpatents

Bass, Isaac Louis; Guss, Gabriel Mark

2013-03-05

A method of forming a surface feature extending into a sample includes providing a laser operable to emit an output beam and modulating the output beam to form a pulse train having a plurality of pulses. The method also includes a) directing the pulse train along an optical path intersecting an exposed portion of the sample at a position i and b) focusing a first portion of the plurality of pulses to impinge on the sample at the position i. Each of the plurality of pulses is characterized by a spot size at the sample. The method further includes c) ablating at least a portion of the sample at the position i to form a portion of the surface feature and d) incrementing counter i. The method includes e) repeating steps a) through d) to form the surface feature. The sample is free of a rim surrounding the surface feature.

Using liquid desiccant as a regenerable filter for capturing and deactivating contaminants

DOEpatents

Slayzak, Steven J.; Anderson, Ren S.; Judkoff, Ronald D.; Blake, Daniel M.; Vinzant, Todd B.; Ryan, Joseph P.

2007-12-11

A method, and systems for implementing such method, for purifying and conditioning air of weaponized contaminants. The method includes wetting a filter packing media with a salt-based liquid desiccant, such as water with a high concentration of lithium chloride. Air is passed through the wetted filter packing media and the contaminants in are captured with the liquid desiccant while the liquid desiccant dehumidifies the air. The captured contaminants are then deactivated in the liquid desiccant, which may include heating the liquid desiccant. The liquid desiccant is regenerated by applying heat to the liquid desiccant and then removing moisture. The method includes repeating the wetting with the regenerated liquid desiccant which provides a regenerable filtering process that captures and deactivates contaminants on an ongoing basis while also conditioning the air. The method may include filtration effectiveness enhancement by electrostatic or inertial means.

Systems and methods for analyzing building operations sensor data

DOEpatents

Mezic, Igor; Eisenhower, Bryan A.

2015-05-26

Systems and methods are disclosed for analyzing building sensor information and decomposing the information therein to a more manageable and more useful form. Certain embodiments integrate energy-based and spectral-based analysis methods with parameter sampling and uncertainty/sensitivity analysis to achieve a more comprehensive perspective of building behavior. The results of this analysis may be presented to a user via a plurality of visualizations and/or used to automatically adjust certain building operations. In certain embodiments, advanced spectral techniques, including Koopman-based operations, are employed to discern features from the collected building sensor data.

Methods and compositions for chromosome-specific staining

DOEpatents

Gray, Joe W.; Pinkel, Daniel

2003-07-22

Methods and compositions for chromosome-specific staining are provided. Compositions comprise heterogenous mixtures of labeled nucleic acid fragments having substantially complementary base sequences to unique sequence regions of the chromosomal DNA for which their associated staining reagent is specific. Methods include methods for making the chromosome-specific staining compositions of the invention, and methods for applying the staining compositions to chromosomes.

Development of a Late-Life Dementia Prediction Index with Supervised Machine Learning in the Population-Based CAIDE Study

PubMed Central

Pekkala, Timo; Hall, Anette; Lötjönen, Jyrki; Mattila, Jussi; Soininen, Hilkka; Ngandu, Tiia; Laatikainen, Tiina; Kivipelto, Miia; Solomon, Alina

2016-01-01

Background and objective: This study aimed to develop a late-life dementia prediction model using a novel validated supervised machine learning method, the Disease State Index (DSI), in the Finnish population-based CAIDE study. Methods: The CAIDE study was based on previous population-based midlife surveys. CAIDE participants were re-examined twice in late-life, and the first late-life re-examination was used as baseline for the present study. The main study population included 709 cognitively normal subjects at first re-examination who returned to the second re-examination up to 10 years later (incident dementia n = 39). An extended population (n = 1009, incident dementia 151) included non-participants/non-survivors (national registers data). DSI was used to develop a dementia index based on first re-examination assessments. Performance in predicting dementia was assessed as area under the ROC curve (AUC). Results: AUCs for DSI were 0.79 and 0.75 for main and extended populations. Included predictors were cognition, vascular factors, age, subjective memory complaints, and APOE genotype. Conclusion: The supervised machine learning method performed well in identifying comprehensive profiles for predicting dementia development up to 10 years later. DSI could thus be useful for identifying individuals who are most at risk and may benefit from dementia prevention interventions. PMID:27802228

Microfabricated instruments and methods to treat recurrent corneal erosions

DOEpatents

Britton, Jr., Charles L.; D'urso, Brian R.; Chaum, Edward; Simpson, John T.; Baba, Justin S.; Ericson, M. Nance; Warmack, Robert J.

2015-06-02

In one embodiment, the present invention provides a device and method for treating recurrent corneal erosion. In one embodiment, the method includes the steps of contacting an epithelium layer of a cornea with an array of glass micro-rods including a plurality of sharp features having a length that penetrates a Bowman's layer of the eye, wherein the plurality of sharp features of the array of glass micro-rods produces a plurality of punctures in the Bowman's layer of the eye that are of micro-scale or less. In another embodiment, the present invention provides a method and device for drug delivery. In one embodiment, the device includes an array of glass micro-rods, wherein at least one glass micro-rod of the array of glass micro-rods includes a sharp feature opposite a base of the array of glass micro-rods, wherein the sharp feature includes a treated surface for delivering a chemical compound to the eye.

Microfabricated instruments and methods to treat recurrent corneal erosion

DOEpatents

Britton, Charles L; D& #x27; Urso, Brian R; Chaum, Edward; Simpson, John T; Baba, Justin S; Ericson, M. Nance; Warmack, Robert J

2013-11-26

In one embodiment, the present invention provides a device and method for treating recurrent corneal erosion. In one embodiment, the method includes the steps of contacting an epithelium layer of a cornea with an array of glass micro-rods including a plurality of sharp features having a length that penetrates a Bowman's layer of the eye, wherein the plurality of sharp features of the array of glass micro-rods produces a plurality of punctures in the Bowman's layer of the eye that are of micro-scale or less. In another embodiment, the present invention provides a method and device for drug delivery. In one embodiment, the device includes an array of glass micro-rods, wherein at least one glass micro-rod of the array of glass micro-rods includes a sharp feature opposite a base of the array of glass micro-rods, wherein the sharp feature includes a treated surface for delivering a chemical compound to the eye.

Method for fabricating beryllium-based multilayer structures

DOEpatents

Skulina, Kenneth M.; Bionta, Richard M.; Makowiecki, Daniel M.; Alford, Craig S.

2003-02-18

Beryllium-based multilayer structures and a process for fabricating beryllium-based multilayer mirrors, useful in the wavelength region greater than the beryllium K-edge (111 .ANG. or 11.1 nm). The process includes alternating sputter deposition of beryllium and a metal, typically from the fifth row of the periodic table, such as niobium (Nb), molybdenum (Mo), ruthenium (Ru), and rhodium (Rh). The process includes not only the method of sputtering the materials, but the industrial hygiene controls for safe handling of beryllium. The mirrors made in accordance with the process may be utilized in soft x-ray and extreme-ultraviolet projection lithography, which requires mirrors of high reflectivity (>60%) for x-rays in the range of 60-140 .ANG. (60-14.0 nm).

Development of a time-dependent incompressible Navier-Stokes solver based on a fractional-step method

NASA Technical Reports Server (NTRS)

Rosenfeld, Moshe

1990-01-01

The main goals are the development, validation, and application of a fractional step solution method of the time-dependent incompressible Navier-Stokes equations in generalized coordinate systems. A solution method that combines a finite volume discretization with a novel choice of the dependent variables and a fractional step splitting to obtain accurate solutions in arbitrary geometries is extended to include more general situations, including cases with moving grids. The numerical techniques are enhanced to gain efficiency and generality.

Evaluation and integration of existing methods for computational prediction of allergens

PubMed Central

2013-01-01

Background Allergy involves a series of complex reactions and factors that contribute to the development of the disease and triggering of the symptoms, including rhinitis, asthma, atopic eczema, skin sensitivity, even acute and fatal anaphylactic shock. Prediction and evaluation of the potential allergenicity is of importance for safety evaluation of foods and other environment factors. Although several computational approaches for assessing the potential allergenicity of proteins have been developed, their performance and relative merits and shortcomings have not been compared systematically. Results To evaluate and improve the existing methods for allergen prediction, we collected an up-to-date definitive dataset consisting of 989 known allergens and massive putative non-allergens. The three most widely used allergen computational prediction approaches including sequence-, motif- and SVM-based (Support Vector Machine) methods were systematically compared using the defined parameters and we found that SVM-based method outperformed the other two methods with higher accuracy and specificity. The sequence-based method with the criteria defined by FAO/WHO (FAO: Food and Agriculture Organization of the United Nations; WHO: World Health Organization) has higher sensitivity of over 98%, but having a low specificity. The advantage of motif-based method is the ability to visualize the key motif within the allergen. Notably, the performances of the sequence-based method defined by FAO/WHO and motif eliciting strategy could be improved by the optimization of parameters. To facilitate the allergen prediction, we integrated these three methods in a web-based application proAP, which provides the global search of the known allergens and a powerful tool for allergen predication. Flexible parameter setting and batch prediction were also implemented. The proAP can be accessed at http://gmobl.sjtu.edu.cn/proAP/main.html. Conclusions This study comprehensively evaluated sequence-, motif- and SVM-based computational prediction approaches for allergens and optimized their parameters to obtain better performance. These findings may provide helpful guidance for the researchers in allergen-prediction. Furthermore, we integrated these methods into a web application proAP, greatly facilitating users to do customizable allergen search and prediction. PMID:23514097

Evaluation and integration of existing methods for computational prediction of allergens.

PubMed

Wang, Jing; Yu, Yabin; Zhao, Yunan; Zhang, Dabing; Li, Jing

2013-01-01

Allergy involves a series of complex reactions and factors that contribute to the development of the disease and triggering of the symptoms, including rhinitis, asthma, atopic eczema, skin sensitivity, even acute and fatal anaphylactic shock. Prediction and evaluation of the potential allergenicity is of importance for safety evaluation of foods and other environment factors. Although several computational approaches for assessing the potential allergenicity of proteins have been developed, their performance and relative merits and shortcomings have not been compared systematically. To evaluate and improve the existing methods for allergen prediction, we collected an up-to-date definitive dataset consisting of 989 known allergens and massive putative non-allergens. The three most widely used allergen computational prediction approaches including sequence-, motif- and SVM-based (Support Vector Machine) methods were systematically compared using the defined parameters and we found that SVM-based method outperformed the other two methods with higher accuracy and specificity. The sequence-based method with the criteria defined by FAO/WHO (FAO: Food and Agriculture Organization of the United Nations; WHO: World Health Organization) has higher sensitivity of over 98%, but having a low specificity. The advantage of motif-based method is the ability to visualize the key motif within the allergen. Notably, the performances of the sequence-based method defined by FAO/WHO and motif eliciting strategy could be improved by the optimization of parameters. To facilitate the allergen prediction, we integrated these three methods in a web-based application proAP, which provides the global search of the known allergens and a powerful tool for allergen predication. Flexible parameter setting and batch prediction were also implemented. The proAP can be accessed at http://gmobl.sjtu.edu.cn/proAP/main.html. This study comprehensively evaluated sequence-, motif- and SVM-based computational prediction approaches for allergens and optimized their parameters to obtain better performance. These findings may provide helpful guidance for the researchers in allergen-prediction. Furthermore, we integrated these methods into a web application proAP, greatly facilitating users to do customizable allergen search and prediction.

Artificial Intelligence Methods in Computer-Based Instructional Design. The Minnesota Adaptive Instructional System.

ERIC Educational Resources Information Center

Tennyson, Robert

1984-01-01

Reviews educational applications of artificial intelligence and presents empirically-based design variables for developing a computer-based instruction management system. Taken from a programmatic research effort based on the Minnesota Adaptive Instructional System, variables include amount and sequence of instruction, display time, advisement,…

A two-phase copula entropy-based multiobjective optimization approach to hydrometeorological gauge network design

NASA Astrophysics Data System (ADS)

Xu, Pengcheng; Wang, Dong; Singh, Vijay P.; Wang, Yuankun; Wu, Jichun; Wang, Lachun; Zou, Xinqing; Chen, Yuanfang; Chen, Xi; Liu, Jiufu; Zou, Ying; He, Ruimin

2017-12-01

Hydrometeorological data are needed for obtaining point and areal mean, quantifying the spatial variability of hydrometeorological variables, and calibration and verification of hydrometeorological models. Hydrometeorological networks are utilized to collect such data. Since data collection is expensive, it is essential to design an optimal network based on the minimal number of hydrometeorological stations in order to reduce costs. This study proposes a two-phase copula entropy- based multiobjective optimization approach that includes: (1) copula entropy-based directional information transfer (CDIT) for clustering the potential hydrometeorological gauges into several groups, and (2) multiobjective method for selecting the optimal combination of gauges for regionalized groups. Although entropy theory has been employed for network design before, the joint histogram method used for mutual information estimation has several limitations. The copula entropy-based mutual information (MI) estimation method is shown to be more effective for quantifying the uncertainty of redundant information than the joint histogram (JH) method. The effectiveness of this approach is verified by applying to one type of hydrometeorological gauge network, with the use of three model evaluation measures, including Nash-Sutcliffe Coefficient (NSC), arithmetic mean of the negative copula entropy (MNCE), and MNCE/NSC. Results indicate that the two-phase copula entropy-based multiobjective technique is capable of evaluating the performance of regional hydrometeorological networks and can enable decision makers to develop strategies for water resources management.

On the estimation of jet-induced fountain lift and additional suckdown in hover for two-jet configurations

NASA Technical Reports Server (NTRS)

Kuhn, Richard E.; Bellavia, David C.; Corsiglia, Victor R.; Wardwell, Douglas A.

1991-01-01

Currently available methods for estimating the net suckdown induced on jet V/STOL aircraft hovering in ground effect are based on a correlation of available force data and are, therefore, limited to configurations similar to those in the data base. Experience with some of these configurations has shown that both the fountain lift and additional suckdown are overestimated but these effects cancel each other for configurations within the data base. For other configurations, these effects may not cancel and the net suckdown could be grossly overestimated or underestimated. Also, present methods do not include the prediction of the pitching moments associated with the suckdown induced in ground effect. An attempt to develop a more logically based method for estimating the fountain lift and suckdown based on the jet-induced pressures is initiated. The analysis is based primarily on the data from a related family of three two-jet configurations (all using the same jet spacing) and limited data from two other two-jet configurations. The current status of the method, which includes expressions for estimating the maximum pressure induced in the fountain regions, and the sizes of the fountain and suckdown regions is presented. Correlating factors are developed to be used with these areas and pressures to estimate the fountain lift, the suckdown, and the related pitching moment increments.

Adopting exergy analysis for use in aerospace

NASA Astrophysics Data System (ADS)

Hayes, David; Lone, Mudassir; Whidborne, James F.; Camberos, José; Coetzee, Etienne

2017-08-01

Thermodynamic analysis methods, based on an exergy metric, have been developed to improve system efficiency of traditional heat driven systems such as ground based power plants and aircraft propulsion systems. However, in more recent years interest in the topic has broadened to include applying these second law methods to the field of aerodynamics and complete aerospace vehicles. Work to date is based on highly simplified structures, but such a method could be shown to have benefit to the highly conservative and risk averse commercial aerospace sector. This review justifies how thermodynamic exergy analysis has the potential to facilitate a breakthrough in the optimization of aerospace vehicles based on a system of energy systems, through studying the exergy-based multidisciplinary design of future flight vehicles.

Multifidelity Analysis and Optimization for Supersonic Design

NASA Technical Reports Server (NTRS)

Kroo, Ilan; Willcox, Karen; March, Andrew; Haas, Alex; Rajnarayan, Dev; Kays, Cory

2010-01-01

Supersonic aircraft design is a computationally expensive optimization problem and multifidelity approaches over a significant opportunity to reduce design time and computational cost. This report presents tools developed to improve supersonic aircraft design capabilities including: aerodynamic tools for supersonic aircraft configurations; a systematic way to manage model uncertainty; and multifidelity model management concepts that incorporate uncertainty. The aerodynamic analysis tools developed are appropriate for use in a multifidelity optimization framework, and include four analysis routines to estimate the lift and drag of a supersonic airfoil, a multifidelity supersonic drag code that estimates the drag of aircraft configurations with three different methods: an area rule method, a panel method, and an Euler solver. In addition, five multifidelity optimization methods are developed, which include local and global methods as well as gradient-based and gradient-free techniques.

Measurement of Solution Viscosity via Diffusion-Ordered NMR Spectroscopy (DOSY)

ERIC Educational Resources Information Center

Li, Weibin; Kagan, Gerald; Hopson, Russell; Williard, Paul G.

2011-01-01

Increasingly, the undergraduate chemistry curriculum includes nuclear magnetic resonance (NMR) spectroscopy. Advanced NMR techniques are often taught including two-dimensional gradient-based experiments. An investigation of intermolecular forces including viscosity, by a variety of methods, is often integrated in the undergraduate physical and…

Maslow and Motherboards: Taking a Hierarchical View of Technology Planning.

ERIC Educational Resources Information Center

Johnson, Doug

2003-01-01

Presents a planning model for educational uses of technology that is based on Maslow's hierarchy of needs. Topics include established infrastructure; effective administration; extensive resources; enhanced teaching, including creating distance learning opportunities; empowered students, including evaluation methods and information literacy skills;…

Culturally Adaptive Walking Intervention for Korean-Chinese Female Migrant Workers.

PubMed

Cho, Sunghye; Lee, Hyeonkyeong; Kim, Jung Hee; Lee, Meenhye; Lee, Young-Me

2017-05-01

Although the literature has commonly cited that development of culturally adaptive interventions is key to improving the health outcomes of culturally and linguistically diverse populations, there have been limited culturally adaptive walking interventions specific to Korean-Chinese (KC) migrants. The objective of this study is to describe the process in development of culturally adaptive walking interventions for KC female migrant workers, using the intervention mapping (IM) method. The culturally adaptive walking intervention was developed using the IM method, which is a stepwise theory and evidence-based approach for planning interventions. The IM method process has six steps, including needs assessment, formulation of change objectives, selection of theory-based methods and practical strategies, development of an intervention program, development of an adoption and implementation plan, and development of an evaluation design. The determinants of walking behavior, including knowledge, self-efficacy, social support, and acculturation, were identified through an extensive literature review, community leader interviews, and a survey of female KC migrant workers. Appropriate intervention methods and strategies were identified based on relevant theories. Acculturation was a determinant of exercise behavior, and various methods to improve cultural adaptation were identified in the context of the lifestyles and working environments of the target population. The IM method provided a foundation for creating a health intervention for KC female migrant workers. This method could easily be useful for health care providers working with other groups.

Ultrasonic power measurement system based on acousto-optic interaction.

PubMed

He, Liping; Zhu, Fulong; Chen, Yanming; Duan, Ke; Lin, Xinxin; Pan, Yongjun; Tao, Jiaquan

2016-05-01

Ultrasonic waves are widely used, with applications including the medical, military, and chemical fields. However, there are currently no effective methods for ultrasonic power measurement. Previously, ultrasonic power measurement has been reliant on mechanical methods such as hydrophones and radiation force balances. This paper deals with ultrasonic power measurement based on an unconventional method: acousto-optic interaction. Compared with mechanical methods, the optical method has a greater ability to resist interference and also has reduced environmental requirements. Therefore, this paper begins with an experimental determination of the acoustic power in water contained in a glass tank using a set of optical devices. Because the light intensity of the diffraction image generated by acousto-optic interaction contains the required ultrasonic power information, specific software was written to extract the light intensity information from the image through a combination of filtering, binarization, contour extraction, and other image processing operations. The power value can then be obtained rapidly by processing the diffraction image using a computer. The results of this work show that the optical method offers advantages that include accuracy, speed, and a noncontact measurement method.

Ultrasonic power measurement system based on acousto-optic interaction

NASA Astrophysics Data System (ADS)

He, Liping; Zhu, Fulong; Chen, Yanming; Duan, Ke; Lin, Xinxin; Pan, Yongjun; Tao, Jiaquan

2016-05-01

Ultrasonic waves are widely used, with applications including the medical, military, and chemical fields. However, there are currently no effective methods for ultrasonic power measurement. Previously, ultrasonic power measurement has been reliant on mechanical methods such as hydrophones and radiation force balances. This paper deals with ultrasonic power measurement based on an unconventional method: acousto-optic interaction. Compared with mechanical methods, the optical method has a greater ability to resist interference and also has reduced environmental requirements. Therefore, this paper begins with an experimental determination of the acoustic power in water contained in a glass tank using a set of optical devices. Because the light intensity of the diffraction image generated by acousto-optic interaction contains the required ultrasonic power information, specific software was written to extract the light intensity information from the image through a combination of filtering, binarization, contour extraction, and other image processing operations. The power value can then be obtained rapidly by processing the diffraction image using a computer. The results of this work show that the optical method offers advantages that include accuracy, speed, and a noncontact measurement method.

Analysis and development of adjoint-based h-adaptive direct discontinuous Galerkin method for the compressible Navier-Stokes equations

NASA Astrophysics Data System (ADS)

Cheng, Jian; Yue, Huiqiang; Yu, Shengjiao; Liu, Tiegang

2018-06-01

In this paper, an adjoint-based high-order h-adaptive direct discontinuous Galerkin method is developed and analyzed for the two dimensional steady state compressible Navier-Stokes equations. Particular emphasis is devoted to the analysis of the adjoint consistency for three different direct discontinuous Galerkin discretizations: including the original direct discontinuous Galerkin method (DDG), the direct discontinuous Galerkin method with interface correction (DDG(IC)) and the symmetric direct discontinuous Galerkin method (SDDG). Theoretical analysis shows the extra interface correction term adopted in the DDG(IC) method and the SDDG method plays a key role in preserving the adjoint consistency. To be specific, for the model problem considered in this work, we prove that the original DDG method is not adjoint consistent, while the DDG(IC) method and the SDDG method can be adjoint consistent with appropriate treatment of boundary conditions and correct modifications towards the underlying output functionals. The performance of those three DDG methods is carefully investigated and evaluated through typical test cases. Based on the theoretical analysis, an adjoint-based h-adaptive DDG(IC) method is further developed and evaluated, numerical experiment shows its potential in the applications of adjoint-based adaptation for simulating compressible flows.

Introducing Postphenomenological Research: A Brief and Selective Sketch of Phenomenological Research Methods

ERIC Educational Resources Information Center

Aagaard, Jesper

2017-01-01

In time, phenomenology has become a viable approach to conducting qualitative studies in education. Popular and well-established methods include descriptive and hermeneutic phenomenology. Based on critiques of the essentialism and receptivity of these two methods, however, this article offers a third variation of empirical phenomenology:…

75 FR 13745 - Office of Innovation and Improvement Overview Information; Ready To Teach Program-General...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-03-23

... on rigorous, scientifically based research methods to assess the effectiveness of a particular... and programs; and (B) Includes research that-- (i) Employs systematic, empirical methods that draw on... hypotheses and justify the general conclusions drawn; (iii) Relies on measurements or observational methods...

75 FR 13515 - Office of Innovation and Improvement (OII); Overview Information; Ready-to-Learn Television...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-03-22

... on rigorous scientifically based research methods to assess the effectiveness of a particular... activities and programs; and (B) Includes research that-- (i) Employs systematic, empirical methods that draw... or observational methods that provide reliable and valid data across evaluators and observers, across...

MEASUREMENT OF VOLATILE ORGANIC COMPOUNDS BY THE US ENVIRONMENTAL PROTECTION AGENCY COMPENDIUM METHOD TO-17 - EVALUATION OF PERFORMANCE CRITERIA

EPA Science Inventory

An evaluation of performance criteria for US Environmental Protection Agency Compendium Method TO-17 for monitoring volatile organic compounds (VOCs) in air has been accomplished. The method is a solid adsorbent-based sampling and analytical procedure including performance crit...

Methods for Probing Magnetic Films with Neutrons

NASA Astrophysics Data System (ADS)

Kozhevnikov, S. V.; Ott, F.; Radu, F.

2018-03-01

We review various methods in the investigation of magnetic films with neutrons, including those based on the effects of Larmor precession, Zeeman spatial splitting of the beam, neutron spin resonance, and polarized neutron channeling. The underlying principles, examples of the investigated systems, specific features, applications, and perspectives of these methods are discussed.

78 FR 77679 - Agency Information Collection Activities: Submission for OMB Review; Comment Request Re...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-12-24

... providers through qualitative research methods such as focus groups, in-depth interviews, and/or qualitative... qualitative research methods will also contribute to the FDIC's understanding of how consumers, including... collection method based on the objectives of each qualitative research effort. It is likely that each...

Mixed Methods in Intervention Research: Theory to Adaptation

ERIC Educational Resources Information Center

Nastasi, Bonnie K.; Hitchcock, John; Sarkar, Sreeroopa; Burkholder, Gary; Varjas, Kristen; Jayasena, Asoka

2007-01-01

The purpose of this article is to demonstrate the application of mixed methods research designs to multiyear programmatic research and development projects whose goals include integration of cultural specificity when generating or translating evidence-based practices. The authors propose a set of five mixed methods designs related to different…

Quality data collection and management technology of aerospace complex product assembly process

NASA Astrophysics Data System (ADS)

Weng, Gang; Liu, Jianhua; He, Yongxi; Zhuang, Cunbo

2017-04-01

Aiming at solving problems of difficult management and poor traceability for discrete assembly process quality data, a data collection and management method is proposed which take the assembly process and BOM as the core. Data collection method base on workflow technology, data model base on BOM and quality traceability of assembly process is included in the method. Finally, assembly process quality data management system is developed and effective control and management of quality information for complex product assembly process is realized.

Structure of Hybrid Polyhedral Oligomeric Silsesquioxane Polymethacrylate Oligomers Using Ion Mobility Mass Spectrometry and Molecular Mechanics

DTIC Science & Technology

2004-12-01

Jones interaction potential is included45 better results are obtained but this method at times overestimates cross-sections in the intermediate 1500 to...utilized to generate sodiated [(PMA)Cp7T8]xNa+ ions, and their collision cross-sections were measured in helium using ion mobility based methods...were measured in helium using ion mobility based methods. Results for x = 1, 2, and 3 were consistent with only one conformer occurring for the Na+1

Method and system for environmentally adaptive fault tolerant computing

NASA Technical Reports Server (NTRS)

Copenhaver, Jason L. (Inventor); Jeremy, Ramos (Inventor); Wolfe, Jeffrey M. (Inventor); Brenner, Dean (Inventor)

2010-01-01

A method and system for adapting fault tolerant computing. The method includes the steps of measuring an environmental condition representative of an environment. An on-board processing system's sensitivity to the measured environmental condition is measured. It is determined whether to reconfigure a fault tolerance of the on-board processing system based in part on the measured environmental condition. The fault tolerance of the on-board processing system may be reconfigured based in part on the measured environmental condition.

Pre-form ceramic matrix composite cavity and a ceramic matrix composite component

DOE Office of Scientific and Technical Information (OSTI.GOV)

Monaghan, Philip Harold; Delvaux, John McConnell; Taxacher, Glenn Curtis

A pre-form CMC cavity and method of forming pre-form CMC cavity for a ceramic matrix component includes providing a mandrel, applying a base ply to the mandrel, laying-up at least one CMC ply on the base ply, removing the mandrel, and densifying the base ply and the at least one CMC ply. The remaining densified base ply and at least one CMC ply form a ceramic matrix component having a desired geometry and a cavity formed therein. Also provided is a method of forming a CMC component.

Nanofluids and a method of making nanofluids for ground source heat pumps and other applications

DOEpatents

Olson, John Melvin

2013-11-12

This invention covers nanofluids. Nanofluids are a combination of particles between 1 and 100 nanometers, a surfactant and the base fluid. The nanoparticles for this invention are either pyrogenic nanoparticles or carbon nanotubes. These nanofluids improve the heat transfer of the base fluids. The base fluid can be ethylene glycol, or propylene glycol, or an aliphatic-hydrocarbon based heat transfer fluid. This invention also includes a method of making nanofluids. No surfactant is used to suspend the pyrogenic nanoparticles in glycols.

Fuzzy Set Methods for Object Recognition in Space Applications

NASA Technical Reports Server (NTRS)

Keller, James M. (Editor)

1992-01-01

Progress on the following four tasks is described: (1) fuzzy set based decision methodologies; (2) membership calculation; (3) clustering methods (including derivation of pose estimation parameters), and (4) acquisition of images and testing of algorithms.

Cut set-based risk and reliability analysis for arbitrarily interconnected networks

DOEpatents

Wyss, Gregory D.

2000-01-01

Method for computing all-terminal reliability for arbitrarily interconnected networks such as the United States public switched telephone network. The method includes an efficient search algorithm to generate minimal cut sets for nonhierarchical networks directly from the network connectivity diagram. Efficiency of the search algorithm stems in part from its basis on only link failures. The method also includes a novel quantification scheme that likewise reduces computational effort associated with assessing network reliability based on traditional risk importance measures. Vast reductions in computational effort are realized since combinatorial expansion and subsequent Boolean reduction steps are eliminated through analysis of network segmentations using a technique of assuming node failures to occur on only one side of a break in the network, and repeating the technique for all minimal cut sets generated with the search algorithm. The method functions equally well for planar and non-planar networks.

Systems for column-based separations, methods of forming packed columns, and methods of purifying sample components

DOEpatents

Egorov, Oleg B.; O'Hara, Matthew J.; Grate, Jay W.; Chandler, Darrell P.; Brockman, Fred J.; Bruckner-Lea, Cynthia J.

2000-01-01

The invention encompasses systems for column-based separations, methods of packing and unpacking columns and methods of separating components of samples. In one aspect, the invention includes a method of packing and unpacking a column chamber, comprising: a) packing a matrix material within a column chamber to form a packed column; and b) after the packing, unpacking the matrix material from the column chamber without moving the column chamber. In another aspect, the invention includes a system for column-based separations, comprising: a) a fluid passageway, the fluid passageway comprising a column chamber and a flow path in fluid communication with the column chamber, the flow path being obstructed by a retaining material permeable to a carrier fluid and impermeable to a column matrix material suspended in the carrier fluid, the flow path extending through the column chamber and through the retaining material, the flow path being configured to form a packed column within the column chamber when a suspension of the fluid and the column matrix material is flowed along the flow path; and b) the fluid passageway extending through a valve intermediate the column chamber and the retaining material.

Systems For Column-Based Separations, Methods Of Forming Packed Columns, And Methods Of Purifying Sample Components

DOEpatents

Egorov, Oleg B.; O'Hara, Matthew J.; Grate, Jay W.; Chandler, Darrell P.; Brockman, Fred J.; Bruckner-Lea, Cynthia J.

2006-02-21

The invention encompasses systems for column-based separations, methods of packing and unpacking columns and methods of separating components of samples. In one aspect, the invention includes a method of packing and unpacking a column chamber, comprising: a) packing a matrix material within a column chamber to form a packed column; and b) after the packing, unpacking the matrix material from the column chamber without moving the column chamber. In another aspect, the invention includes a system for column-based separations, comprising: a) a fluid passageway, the fluid passageway comprising a column chamber and a flow path in fluid communication with the column chamber, the flow path being obstructed by a retaining material permeable to a carrier fluid and impermeable to a column matrix material suspended in the carrier fluid, the flow path extending through the column chamber and through the retaining material, the flow path being configured to form a packed column within the column chamber when a suspension of the fluid and the column matrix material is flowed along the flow path; and b) the fluid passageway extending through a valve intermediate the column chamber and the retaining material.

Systems For Column-Based Separations, Methods Of Forming Packed Columns, And Methods Of Purifying Sample Components.

DOEpatents

Egorov, Oleg B.; O'Hara, Matthew J.; Grate, Jay W.; Chandler, Darrell P.; Brockman, Fred J.; Bruckner-Lea, Cynthia J.

2004-08-24

The invention encompasses systems for column-based separations, methods of packing and unpacking columns and methods of separating components of samples. In one aspect, the invention includes a method of packing and unpacking a column chamber, comprising: a) packing a matrix material within a column chamber to form a packed column; and b) after the packing, unpacking the matrix material from the column chamber without moving the column chamber. In another aspect, the invention includes a system for column-based separations, comprising: a) a fluid passageway, the fluid passageway comprising a column chamber and a flow path in fluid communication with the column chamber, the flow path being obstructed by a retaining material permeable to a carrier fluid and impermeable to a column matrix material suspended in the carrier fluid, the flow path extending through the column chamber and through the retaining material, the flow path being configured to form a packed column within the column chamber when a suspension of the fluid and the column matrix material is flowed along the flow path; and b) the fluid passageway extending through a valve intermediate the column chamber and the retaining material.

Construction Material And Method

DOEpatents

Wagh, Arun S.; Antink, Allison L.

2006-02-21

A structural material of a polystyrene base and the reaction product of the polystyrene base and a solid phosphate ceramic. The ceramic is applied as a slurry which includes one or more of a metal oxide or a metal hydroxide with a source of phosphate to produce a phosphate ceramic and a poly (acrylic acid or acrylate) or combinations or salts thereof and polystyrene or MgO applied to the polystyrene base and allowed to cure so that the dried aqueous slurry chemically bonds to the polystyrene base. A method is also disclosed of applying the slurry to the polystyrene base.

Method of binding structural material

DOEpatents

Wagh, Arun S.; Antink, Allison L.

2007-12-25

A structural material of a polystyrene base and the reaction product of the polystyrene base and a solid phosphate ceramic. The ceramic is applied as a slurry which includes one or more of a metal oxide or a metal hydroxide with a source of phosphate to produce a phosphate ceramic and a poly (acrylic acid or acrylate) or combinations or salts thereof and polystyrene or MgO applied to the polystyrene base and allowed to cure so that the dried aqueous slurry chemically bonds to the polystyrene base. A method is also disclosed of applying the slurry to the polystyrene base.

Electrochemical Polishing Applications and EIS of a Vitamin B{sub 4}-Based Ionic Liquid

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wixtrom, Alex I.; Buhler, Jessica E.; Reece, Charles E.

2013-01-01

Modern particle accelerators require minimal interior surface roughness for Niobium superconducting radio frequency (SRF) cavities. Polishing of the Nb is currently achieved via electrochemical polishing with concentrated mixtures of sulfuric and hydrofluoric acids. This acid-based approach is effective at reducing the surface roughness to acceptable levels for SRF use, but due to acid-related hazards and extra costs (including safe disposal of used polishing solutions), an acid-free method would be preferable. This study focuses on an alternative electrochemical polishing method for Nb, using a novel ionic liquid solution containing choline chloride, also known as Vitamin B{sub 4} (VB{sub 4}). Potentiostatic electrochemicalmore » impedance spectroscopy (EIS) was also performed on the VB4-based system. Nb polished using the VB4-based method was found to have a final surface roughness comparable to that achieved via the acid-based method, as assessed by atomic force microscopy (AFM). These findings indicate that acid-free VB{sub 4}-based electrochemical polishing of Nb represents a promising replacement for acid-based methods of SRF cavity preparation.« less

A Simulation Study of Methods for Selecting Subgroup-Specific Doses in Phase I Trials

PubMed Central

Morita, Satoshi; Thall, Peter F.; Takeda, Kentaro

2016-01-01

Summary Patient heterogeneity may complicate dose-finding in phase I clinical trials if the dose-toxicity curves differ between subgroups. Conducting separate trials within subgroups may lead to infeasibly small sample sizes in subgroups having low prevalence. Alternatively, it is not obvious how to conduct a single trial while accounting for heterogeneity. To address this problem, we consider a generalization of the continual reassessment method (O’Quigley, et al., 1990) based on a hierarchical Bayesian dose-toxicity model that borrows strength between subgroups under the assumption that the subgroups are exchangeable. We evaluate a design using this model that includes subgroup-specific dose selection and safety rules. A simulation study is presented that includes comparison of this method to three alternative approaches, based on non-hierarchical models, that make different types of assumptions about within-subgroup dose-toxicity curves. The simulations show that the hierarchical model-based method is recommended in settings where the dose-toxicity curves are exchangeable between subgroups. We present practical guidelines for application, and provide computer programs for trial simulation and conduct. PMID:28111916

Evaluation of viral removal by nanofiltration using real-time quantitative polymerase chain reaction.

PubMed

Zhao, Xiaowen; Bailey, Mark R; Emery, Warren R; Lambooy, Peter K; Chen, Dayue

2007-06-01

Nanofiltration is commonly introduced into purification processes of biologics produced in mammalian cells to serve as a designated step for removal of potential exogenous viral contaminants and endogenous retrovirus-like particles. The LRV (log reduction value) achieved by nanofiltration is often determined by cell-based infectivity assay, which is time-consuming and labour-intensive. We have explored the possibility of employing QPCR (quantitative PCR) to evaluate LRV achieved by nanofiltration in scaled-down studies using two model viruses, namely xenotropic murine leukemia virus and murine minute virus. We report here the successful development of a QPCR-based method suitable for quantification of virus removal by nanofiltration. The method includes a nuclease treatment step to remove free viral nucleic acids, while viral genome associated with intact virus particles is shielded from the nuclease. In addition, HIV Armored RNA was included as an internal control to ensure the accuracy and reliability of the method. The QPCRbased method described here provides several advantages such as better sensitivity, faster turnaround time, reduced cost and higher throughput over the traditional cell-based infectivity assays.

Automatic pole-like object modeling via 3D part-based analysis of point cloud

NASA Astrophysics Data System (ADS)

He, Liu; Yang, Haoxiang; Huang, Yuchun

2016-10-01

Pole-like objects, including trees, lampposts and traffic signs, are indispensable part of urban infrastructure. With the advance of vehicle-based laser scanning (VLS), massive point cloud of roadside urban areas becomes applied in 3D digital city modeling. Based on the property that different pole-like objects have various canopy parts and similar trunk parts, this paper proposed the 3D part-based shape analysis to robustly extract, identify and model the pole-like objects. The proposed method includes: 3D clustering and recognition of trunks, voxel growing and part-based 3D modeling. After preprocessing, the trunk center is identified as the point that has local density peak and the largest minimum inter-cluster distance. Starting from the trunk centers, the remaining points are iteratively clustered to the same centers of their nearest point with higher density. To eliminate the noisy points, cluster border is refined by trimming boundary outliers. Then, candidate trunks are extracted based on the clustering results in three orthogonal planes by shape analysis. Voxel growing obtains the completed pole-like objects regardless of overlaying. Finally, entire trunk, branch and crown part are analyzed to obtain seven feature parameters. These parameters are utilized to model three parts respectively and get signal part-assembled 3D model. The proposed method is tested using the VLS-based point cloud of Wuhan University, China. The point cloud includes many kinds of trees, lampposts and other pole-like posters under different occlusions and overlaying. Experimental results show that the proposed method can extract the exact attributes and model the roadside pole-like objects efficiently.

Similarity indices based on link weight assignment for link prediction of unweighted complex networks

NASA Astrophysics Data System (ADS)

Liu, Shuxin; Ji, Xinsheng; Liu, Caixia; Bai, Yi

2017-01-01

Many link prediction methods have been proposed for predicting the likelihood that a link exists between two nodes in complex networks. Among these methods, similarity indices are receiving close attention. Most similarity-based methods assume that the contribution of links with different topological structures is the same in the similarity calculations. This paper proposes a local weighted method, which weights the strength of connection between each pair of nodes. Based on the local weighted method, six local weighted similarity indices extended from unweighted similarity indices (including Common Neighbor (CN), Adamic-Adar (AA), Resource Allocation (RA), Salton, Jaccard and Local Path (LP) index) are proposed. Empirical study has shown that the local weighted method can significantly improve the prediction accuracy of these unweighted similarity indices and that in sparse and weakly clustered networks, the indices perform even better.

Prediction of protein secondary structure content for the twilight zone sequences.

PubMed

Homaeian, Leila; Kurgan, Lukasz A; Ruan, Jishou; Cios, Krzysztof J; Chen, Ke

2007-11-15

Secondary protein structure carries information about local structural arrangements, which include three major conformations: alpha-helices, beta-strands, and coils. Significant majority of successful methods for prediction of the secondary structure is based on multiple sequence alignment. However, multiple alignment fails to provide accurate results when a sequence comes from the twilight zone, that is, it is characterized by low (<30%) homology. To this end, we propose a novel method for prediction of secondary structure content through comprehensive sequence representation, called PSSC-core. The method uses a multiple linear regression model and introduces a comprehensive feature-based sequence representation to predict amount of helices and strands for sequences from the twilight zone. The PSSC-core method was tested and compared with two other state-of-the-art prediction methods on a set of 2187 twilight zone sequences. The results indicate that our method provides better predictions for both helix and strand content. The PSSC-core is shown to provide statistically significantly better results when compared with the competing methods, reducing the prediction error by 5-7% for helix and 7-9% for strand content predictions. The proposed feature-based sequence representation uses a comprehensive set of physicochemical properties that are custom-designed for each of the helix and strand content predictions. It includes composition and composition moment vectors, frequency of tetra-peptides associated with helical and strand conformations, various property-based groups like exchange groups, chemical groups of the side chains and hydrophobic group, auto-correlations based on hydrophobicity, side-chain masses, hydropathy, and conformational patterns for beta-sheets. The PSSC-core method provides an alternative for predicting the secondary structure content that can be used to validate and constrain results of other structure prediction methods. At the same time, it also provides useful insight into design of successful protein sequence representations that can be used in developing new methods related to prediction of different aspects of the secondary protein structure. (c) 2007 Wiley-Liss, Inc.

Automatic peak selection by a Benjamini-Hochberg-based algorithm.

PubMed

Abbas, Ahmed; Kong, Xin-Bing; Liu, Zhi; Jing, Bing-Yi; Gao, Xin

2013-01-01

A common issue in bioinformatics is that computational methods often generate a large number of predictions sorted according to certain confidence scores. A key problem is then determining how many predictions must be selected to include most of the true predictions while maintaining reasonably high precision. In nuclear magnetic resonance (NMR)-based protein structure determination, for instance, computational peak picking methods are becoming more and more common, although expert-knowledge remains the method of choice to determine how many peaks among thousands of candidate peaks should be taken into consideration to capture the true peaks. Here, we propose a Benjamini-Hochberg (B-H)-based approach that automatically selects the number of peaks. We formulate the peak selection problem as a multiple testing problem. Given a candidate peak list sorted by either volumes or intensities, we first convert the peaks into [Formula: see text]-values and then apply the B-H-based algorithm to automatically select the number of peaks. The proposed approach is tested on the state-of-the-art peak picking methods, including WaVPeak [1] and PICKY [2]. Compared with the traditional fixed number-based approach, our approach returns significantly more true peaks. For instance, by combining WaVPeak or PICKY with the proposed method, the missing peak rates are on average reduced by 20% and 26%, respectively, in a benchmark set of 32 spectra extracted from eight proteins. The consensus of the B-H-selected peaks from both WaVPeak and PICKY achieves 88% recall and 83% precision, which significantly outperforms each individual method and the consensus method without using the B-H algorithm. The proposed method can be used as a standard procedure for any peak picking method and straightforwardly applied to some other prediction selection problems in bioinformatics. The source code, documentation and example data of the proposed method is available at http://sfb.kaust.edu.sa/pages/software.aspx.

Automatic Peak Selection by a Benjamini-Hochberg-Based Algorithm

PubMed Central

Abbas, Ahmed; Kong, Xin-Bing; Liu, Zhi; Jing, Bing-Yi; Gao, Xin

2013-01-01

A common issue in bioinformatics is that computational methods often generate a large number of predictions sorted according to certain confidence scores. A key problem is then determining how many predictions must be selected to include most of the true predictions while maintaining reasonably high precision. In nuclear magnetic resonance (NMR)-based protein structure determination, for instance, computational peak picking methods are becoming more and more common, although expert-knowledge remains the method of choice to determine how many peaks among thousands of candidate peaks should be taken into consideration to capture the true peaks. Here, we propose a Benjamini-Hochberg (B-H)-based approach that automatically selects the number of peaks. We formulate the peak selection problem as a multiple testing problem. Given a candidate peak list sorted by either volumes or intensities, we first convert the peaks into -values and then apply the B-H-based algorithm to automatically select the number of peaks. The proposed approach is tested on the state-of-the-art peak picking methods, including WaVPeak [1] and PICKY [2]. Compared with the traditional fixed number-based approach, our approach returns significantly more true peaks. For instance, by combining WaVPeak or PICKY with the proposed method, the missing peak rates are on average reduced by 20% and 26%, respectively, in a benchmark set of 32 spectra extracted from eight proteins. The consensus of the B-H-selected peaks from both WaVPeak and PICKY achieves 88% recall and 83% precision, which significantly outperforms each individual method and the consensus method without using the B-H algorithm. The proposed method can be used as a standard procedure for any peak picking method and straightforwardly applied to some other prediction selection problems in bioinformatics. The source code, documentation and example data of the proposed method is available at http://sfb.kaust.edu.sa/pages/software.aspx. PMID:23308147

K-nearest neighbors based methods for identification of different gear crack levels under different motor speeds and loads: Revisited

NASA Astrophysics Data System (ADS)

Wang, Dong

2016-03-01

Gears are the most commonly used components in mechanical transmission systems. Their failures may cause transmission system breakdown and result in economic loss. Identification of different gear crack levels is important to prevent any unexpected gear failure because gear cracks lead to gear tooth breakage. Signal processing based methods mainly require expertize to explain gear fault signatures which is usually not easy to be achieved by ordinary users. In order to automatically identify different gear crack levels, intelligent gear crack identification methods should be developed. The previous case studies experimentally proved that K-nearest neighbors based methods exhibit high prediction accuracies for identification of 3 different gear crack levels under different motor speeds and loads. In this short communication, to further enhance prediction accuracies of existing K-nearest neighbors based methods and extend identification of 3 different gear crack levels to identification of 5 different gear crack levels, redundant statistical features are constructed by using Daubechies 44 (db44) binary wavelet packet transform at different wavelet decomposition levels, prior to the use of a K-nearest neighbors method. The dimensionality of redundant statistical features is 620, which provides richer gear fault signatures. Since many of these statistical features are redundant and highly correlated with each other, dimensionality reduction of redundant statistical features is conducted to obtain new significant statistical features. At last, the K-nearest neighbors method is used to identify 5 different gear crack levels under different motor speeds and loads. A case study including 3 experiments is investigated to demonstrate that the developed method provides higher prediction accuracies than the existing K-nearest neighbors based methods for recognizing different gear crack levels under different motor speeds and loads. Based on the new significant statistical features, some other popular statistical models including linear discriminant analysis, quadratic discriminant analysis, classification and regression tree and naive Bayes classifier, are compared with the developed method. The results show that the developed method has the highest prediction accuracies among these statistical models. Additionally, selection of the number of new significant features and parameter selection of K-nearest neighbors are thoroughly investigated.

Detection of Tree Crowns Based on Reclassification Using Aerial Images and LIDAR Data

NASA Astrophysics Data System (ADS)

Talebi, S.; Zarea, A.; Sadeghian, S.; Arefi, H.

2013-09-01

Tree detection using aerial sensors in early decades was focused by many researchers in different fields including Remote Sensing and Photogrammetry. This paper is intended to detect trees in complex city areas using aerial imagery and laser scanning data. Our methodology is a hierarchal unsupervised method consists of some primitive operations. This method could be divided into three sections, in which, first section uses aerial imagery and both second and third sections use laser scanners data. In the first section a vegetation cover mask is created in both sunny and shadowed areas. In the second section Rate of Slope Change (RSC) is used to eliminate grasses. In the third section a Digital Terrain Model (DTM) is obtained from LiDAR data. By using DTM and Digital Surface Model (DSM) we would get to Normalized Digital Surface Model (nDSM). Then objects which are lower than a specific height are eliminated. Now there are three result layers from three sections. At the end multiplication operation is used to get final result layer. This layer will be smoothed by morphological operations. The result layer is sent to WG III/4 to evaluate. The evaluation result shows that our method has a good rank in comparing to other participants' methods in ISPRS WG III/4, when assessed in terms of 5 indices including area base completeness, area base correctness, object base completeness, object base correctness and boundary RMS. With regarding of being unsupervised and automatic, this method is improvable and could be integrate with other methods to get best results.

Triangular model integrating clinical teaching and assessment

PubMed Central

Abdelaziz, Adel; Koshak, Emad

2014-01-01

Structuring clinical teaching is a challenge facing medical education curriculum designers. A variety of instructional methods on different domains of learning are indicated to accommodate different learning styles. Conventional methods of clinical teaching, like training in ambulatory care settings, are prone to the factor of coincidence in having varieties of patient presentations. Accordingly, alternative methods of instruction are indicated to compensate for the deficiencies of these conventional methods. This paper presents an initiative that can be used to design a checklist as a blueprint to guide appropriate selection and implementation of teaching/learning and assessment methods in each of the educational courses and modules based on educational objectives. Three categories of instructional methods were identified, and within each a variety of methods were included. These categories are classroom-type settings, health services-based settings, and community service-based settings. Such categories have framed our triangular model of clinical teaching and assessment. PMID:24624002

Triangular model integrating clinical teaching and assessment.

PubMed

Abdelaziz, Adel; Koshak, Emad

2014-01-01

Structuring clinical teaching is a challenge facing medical education curriculum designers. A variety of instructional methods on different domains of learning are indicated to accommodate different learning styles. Conventional methods of clinical teaching, like training in ambulatory care settings, are prone to the factor of coincidence in having varieties of patient presentations. Accordingly, alternative methods of instruction are indicated to compensate for the deficiencies of these conventional methods. This paper presents an initiative that can be used to design a checklist as a blueprint to guide appropriate selection and implementation of teaching/learning and assessment methods in each of the educational courses and modules based on educational objectives. Three categories of instructional methods were identified, and within each a variety of methods were included. These categories are classroom-type settings, health services-based settings, and community service-based settings. Such categories have framed our triangular model of clinical teaching and assessment.

Development of a time-dependent incompressible Navier-Stokes solver based on a fractional-step method

NASA Technical Reports Server (NTRS)

Rosenfeld, Moshe

1990-01-01

The development, validation and application of a fractional step solution method of the time-dependent incompressible Navier-Stokes equations in generalized coordinate systems are discussed. A solution method that combines a finite-volume discretization with a novel choice of the dependent variables and a fractional step splitting to obtain accurate solutions in arbitrary geometries was previously developed for fixed-grids. In the present research effort, this solution method is extended to include more general situations, including cases with moving grids. The numerical techniques are enhanced to gain efficiency and generality.

Critical review of methods for risk ranking of food-related hazards, based on risks for human health.

PubMed

Van der Fels-Klerx, H J; Van Asselt, E D; Raley, M; Poulsen, M; Korsgaard, H; Bredsdorff, L; Nauta, M; D'agostino, M; Coles, D; Marvin, H J P; Frewer, L J

2018-01-22

This study aimed to critically review methods for ranking risks related to food safety and dietary hazards on the basis of their anticipated human health impacts. A literature review was performed to identify and characterize methods for risk ranking from the fields of food, environmental science and socio-economic sciences. The review used a predefined search protocol, and covered the bibliographic databases Scopus, CAB Abstracts, Web of Sciences, and PubMed over the period 1993-2013. All references deemed relevant, on the basis of predefined evaluation criteria, were included in the review, and the risk ranking method characterized. The methods were then clustered-based on their characteristics-into eleven method categories. These categories included: risk assessment, comparative risk assessment, risk ratio method, scoring method, cost of illness, health adjusted life years (HALY), multi-criteria decision analysis, risk matrix, flow charts/decision trees, stated preference techniques and expert synthesis. Method categories were described by their characteristics, weaknesses and strengths, data resources, and fields of applications. It was concluded there is no single best method for risk ranking. The method to be used should be selected on the basis of risk manager/assessor requirements, data availability, and the characteristics of the method. Recommendations for future use and application are provided.

Design and Test of a Hybrid Foot Force Sensing and GPS System for Richer User Mobility Activity Recognition

PubMed Central

Zhang, Zelun; Poslad, Stefan

2013-01-01

Wearable and accompanied sensors and devices are increasingly being used for user activity recognition. However, typical GPS-based and accelerometer-based (ACC) methods face three main challenges: a low recognition accuracy; a coarse recognition capability, i.e., they cannot recognise both human posture (during travelling) and transportation mode simultaneously, and a relatively high computational complexity. Here, a new GPS and Foot-Force (GPS + FF) sensor method is proposed to overcome these challenges that leverages a set of wearable FF sensors in combination with GPS, e.g., in a mobile phone. User mobility activities that can be recognised include both daily user postures and common transportation modes: sitting, standing, walking, cycling, bus passenger, car passenger (including private cars and taxis) and car driver. The novelty of this work is that our approach provides a more comprehensive recognition capability in terms of reliably recognising both human posture and transportation mode simultaneously during travel. In addition, by comparing the new GPS + FF method with both an ACC method (62% accuracy) and a GPS + ACC based method (70% accuracy) as baseline methods, it obtains a higher accuracy (95%) with less computational complexity, when tested on a dataset obtained from ten individuals. PMID:24189333

Pharmacoeconomics

PubMed Central

Hughes, Dyfrig A

2012-01-01

Pharmacoeconomics is an essential component of health technology assessment and the appraisal of medicines for use by UK National Health Service (NHS) patients. As a comparatively young discipline, its methods continue to evolve. Priority research areas for development include methods for synthesizing indirect comparisons when head-to-head trials have not been performed, synthesizing qualitative evidence (for example, stakeholder views), addressing the limitations of the EQ-5D tool for assessing quality of life, including benefits not captured in quality-adjusted life years (QALYs), ways of assessing valuation methods (for determining utility scores), extrapolation of costs and benefits beyond those observed in trials, early estimation of cost-effectiveness (including mechanism-based economic evaluation), methods for incorporating the impact of non-adherence and the role of behavioural economics in influencing patients and prescribers. PMID:22360714

The method of complex characteristics for design of transonic blade sections

NASA Technical Reports Server (NTRS)

Bledsoe, M. R.

1986-01-01

A variety of computational methods were developed to obtain shockless or near shockless flow past two-dimensional airfoils. The approach used was the method of complex characteristics, which determines smooth solutions to the transonic flow equations based on an input speed distribution. General results from fluid mechanics are presented. An account of the method of complex characteristics is given including a description of the particular spaces and coordinates, conformal transformations, and numerical procedures that are used. The operation of the computer program COMPRES is presented along with examples of blade sections designed with the code. A user manual is included with a glossary to provide additional information which may be helpful. The computer program in Fortran, including numerous comment cards is listed.

Development and Evaluation of an E-Learning Course for Deaf and Hard of Hearing Based on the Advanced Adapted Pedagogical Index Method

ERIC Educational Resources Information Center

Debevc, Matjaž; Stjepanovic, Zoran; Holzinger, Andreas

2014-01-01

Web-based and adapted e-learning materials provide alternative methods of learning to those used in a traditional classroom. Within the study described in this article, deaf and hard of hearing people used an adaptive e-learning environment to improve their computer literacy. This environment included streaming video with sign language interpreter…

A Safety Program that Integrated Behavior-Based Safety and Traditional Safety Methods and Its Effects on Injury Rates of Manufacturing Workers

ERIC Educational Resources Information Center

Hermann, Jaime A.; Ibarra, Guillermo V.; Hopkins, B. L.

2010-01-01

The present research examines the effects of a complex safety program that combined Behavior-Based Safety (BBS) and traditional safety methods. The study was conducted in an automobile parts plant in Mexico. Two sister plants served as comparison. Some of the components of the safety programs addressed behaviors of managers and included methods…

Combining heuristic and statistical techniques in landslide hazard assessments

NASA Astrophysics Data System (ADS)

Cepeda, Jose; Schwendtner, Barbara; Quan, Byron; Nadim, Farrokh; Diaz, Manuel; Molina, Giovanni

2014-05-01

As a contribution to the Global Assessment Report 2013 - GAR2013, coordinated by the United Nations International Strategy for Disaster Reduction - UNISDR, a drill-down exercise for landslide hazard assessment was carried out by entering the results of both heuristic and statistical techniques into a new but simple combination rule. The data available for this evaluation included landslide inventories, both historical and event-based. In addition to the application of a heuristic method used in the previous editions of GAR, the availability of inventories motivated the use of statistical methods. The heuristic technique is largely based on the Mora & Vahrson method, which estimates hazard as the product of susceptibility and triggering factors, where classes are weighted based on expert judgment and experience. Two statistical methods were also applied: the landslide index method, which estimates weights of the classes for the susceptibility and triggering factors based on the evidence provided by the density of landslides in each class of the factors; and the weights of evidence method, which extends the previous technique to include both positive and negative evidence of landslide occurrence in the estimation of weights for the classes. One key aspect during the hazard evaluation was the decision on the methodology to be chosen for the final assessment. Instead of opting for a single methodology, it was decided to combine the results of the three implemented techniques using a combination rule based on a normalization of the results of each method. The hazard evaluation was performed for both earthquake- and rainfall-induced landslides. The country chosen for the drill-down exercise was El Salvador. The results indicate that highest hazard levels are concentrated along the central volcanic chain and at the centre of the northern mountains.

Aorta modeling with the element-based zero-stress state and isogeometric discretization

NASA Astrophysics Data System (ADS)

Takizawa, Kenji; Tezduyar, Tayfun E.; Sasaki, Takafumi

2017-02-01

Patient-specific arterial fluid-structure interaction computations, including aorta computations, require an estimation of the zero-stress state (ZSS), because the image-based arterial geometries do not come from a ZSS. We have earlier introduced a method for estimation of the element-based ZSS (EBZSS) in the context of finite element discretization of the arterial wall. The method has three main components. 1. An iterative method, which starts with a calculated initial guess, is used for computing the EBZSS such that when a given pressure load is applied, the image-based target shape is matched. 2. A method for straight-tube segments is used for computing the EBZSS so that we match the given diameter and longitudinal stretch in the target configuration and the "opening angle." 3. An element-based mapping between the artery and straight-tube is extracted from the mapping between the artery and straight-tube segments. This provides the mapping from the arterial configuration to the straight-tube configuration, and from the estimated EBZSS of the straight-tube configuration back to the arterial configuration, to be used as the initial guess for the iterative method that matches the image-based target shape. Here we present the version of the EBZSS estimation method with isogeometric wall discretization. With isogeometric discretization, we can obtain the element-based mapping directly, instead of extracting it from the mapping between the artery and straight-tube segments. That is because all we need for the element-based mapping, including the curvatures, can be obtained within an element. With NURBS basis functions, we may be able to achieve a similar level of accuracy as with the linear basis functions, but using larger-size and much fewer elements. Higher-order NURBS basis functions allow representation of more complex shapes within an element. To show how the new EBZSS estimation method performs, we first present 2D test computations with straight-tube configurations. Then we show how the method can be used in a 3D computation where the target geometry is coming from medical image of a human aorta.

Knowledge information management toolkit and method

DOEpatents

Hempstead, Antoinette R.; Brown, Kenneth L.

2006-08-15

A system is provided for managing user entry and/or modification of knowledge information into a knowledge base file having an integrator support component and a data source access support component. The system includes processing circuitry, memory, a user interface, and a knowledge base toolkit. The memory communicates with the processing circuitry and is configured to store at least one knowledge base. The user interface communicates with the processing circuitry and is configured for user entry and/or modification of knowledge pieces within a knowledge base. The knowledge base toolkit is configured for converting knowledge in at least one knowledge base from a first knowledge base form into a second knowledge base form. A method is also provided.

Innovating Method of Existing Mechanical Product Based on TRIZ Theory

NASA Astrophysics Data System (ADS)

Zhao, Cunyou; Shi, Dongyan; Wu, Han

Main way of product development is adaptive design and variant design based on existing product. In this paper, conceptual design frame and its flow model of innovating products is put forward through combining the methods of conceptual design and TRIZ theory. Process system model of innovating design that includes requirement analysis, total function analysis and decomposing, engineering problem analysis, finding solution of engineering problem and primarily design is constructed and this establishes the base for innovating design of existing product.

Systems and methods for process and user driven dynamic voltage and frequency scaling

DOEpatents

Mallik, Arindam [Evanston, IL; Lin, Bin [Hillsboro, OR; Memik, Gokhan [Evanston, IL; Dinda, Peter [Evanston, IL; Dick, Robert [Evanston, IL

2011-03-22

Certain embodiments of the present invention provide a method for power management including determining at least one of an operating frequency and an operating voltage for a processor and configuring the processor based on the determined at least one of the operating frequency and the operating voltage. The operating frequency is determined based at least in part on direct user input. The operating voltage is determined based at least in part on an individual profile for processor.

Response Rates for Patient-Reported Outcomes Using Web-Based Versus Paper Questionnaires: Comparison of Two Invitational Methods in Older Colorectal Cancer Patients

PubMed Central

Vissers, Pauline AJ; Mols, Floortje; Thong, Melissa SY; van de Poll-Franse, Lonneke V

2015-01-01

Background Improving questionnaire response rates is an everlasting issue for research. Today, the Internet can easily be used to collect data quickly. However, collecting data on the Internet can lead to biased samples because not everyone is able to access or use the Internet. The older population, for example, is much less likely to use the Internet. The Patient-Reported Outcomes Following Initial Treatment and Long-Term Evaluation of Survivorship (PROFILES) registry offers a platform to collect Web-based and paper questionnaires and to try different measures to improve response rates. Objective In this study, our aim was to study the influence of two methods of invitation on the response rate. Our second aim was to examine the preference of questionnaire mode of administration (paper or Web-based) for the older patient in particular. Methods To test these two invitational methods, 3406 colorectal cancer patients between ages 18 and 85 years received an invitation containing an access code for the Web-based questionnaire. They could also request a paper questionnaire with an included reply card (paper-optional group). In contrast, 179 randomly selected colorectal cancer patients received a paper questionnaire with the invitation (paper-included group). They could also choose to fill out the Web-based questionnaire with the included access code. Results Response rates did not differ between the paper-optional and the paper-included groups (73.14%, 2491/3406 and 74.9%, 134/179, P=.57). In the paper-optional group, online response was significantly higher when compared to the paper-included group (41.23%, 1027/2491 vs 12.7%, 17/134, P<.001). The majority of online respondents responded after the first invitation (95.33%, 979/1027), which was significantly higher than the paper respondents (52.19%, 764/1464, P<.001). Respondents aged 70 years and older chose to fill out a paper questionnaire more often (71.0%, 677/954). In the oldest age group (≥80 years), 18.2% (61/336) of the respondents filled out a Web-based questionnaire. Conclusions The lack of difference in response rates between invitation modes implies that researchers can leave out a paper questionnaire at invitation without lowering response rates. It may be preferable not to include a paper questionnaire because more respondents then will fill out a Web-based questionnaire, which will lead to faster available data. However, due to respondent preference, it is not likely that paper questionnaires can be left out completely in the near future. PMID:25953059

An Investigation of Two Finite Element Modeling Solutions for Biomechanical Simulation Using a Case Study of a Mandibular Bone.

PubMed

Liu, Yun-Feng; Fan, Ying-Ying; Dong, Hui-Yue; Zhang, Jian-Xing

2017-12-01

The method used in biomechanical modeling for finite element method (FEM) analysis needs to deliver accurate results. There are currently two solutions used in FEM modeling for biomedical model of human bone from computerized tomography (CT) images: one is based on a triangular mesh and the other is based on the parametric surface model and is more popular in practice. The outline and modeling procedures for the two solutions are compared and analyzed. Using a mandibular bone as an example, several key modeling steps are then discussed in detail, and the FEM calculation was conducted. Numerical calculation results based on the models derived from the two methods, including stress, strain, and displacement, are compared and evaluated in relation to accuracy and validity. Moreover, a comprehensive comparison of the two solutions is listed. The parametric surface based method is more helpful when using powerful design tools in computer-aided design (CAD) software, but the triangular mesh based method is more robust and efficient.

Passive fetal heart rate monitoring apparatus and method with enhanced fetal heart beat discrimination

NASA Technical Reports Server (NTRS)

Zahorian, Stephen A. (Inventor); Livingston, David L. (Inventor); Pretlow, III, Robert A. (Inventor)

1996-01-01

An apparatus for acquiring signals emitted by a fetus, identifying fetal heart beats and determining a fetal heart rate. Multiple sensor signals are outputted by a passive fetal heart rate monitoring sensor. Multiple parallel nonlinear filters filter these multiple sensor signals to identify fetal heart beats in the signal data. A processor determines a fetal heart rate based on these identified fetal heart beats. The processor includes the use of a figure of merit weighting of heart rate estimates based on the identified heart beats from each filter for each signal. The fetal heart rate thus determined is outputted to a display, storage, or communications channel. A method for enhanced fetal heart beat discrimination includes acquiring signals from a fetus, identifying fetal heart beats from the signals by multiple parallel nonlinear filtering, and determining a fetal heart rate based on the identified fetal heart beats. A figure of merit operation in this method provides for weighting a plurality of fetal heart rate estimates based on the identified fetal heart beats and selecting the highest ranking fetal heart rate estimate.

Passive fetal heart rate monitoring apparatus and method with enhanced fetal heart beat discrimination

NASA Technical Reports Server (NTRS)

Zahorian, Stephen A. (Inventor); Livingston, David L. (Inventor); Pretlow, Robert A., III (Inventor)

1994-01-01

An apparatus for acquiring signals emitted by a fetus, identifying fetal heart beats and determining a fetal heart rate is presented. Multiple sensor signals are outputted by a passive fetal heart rate monitoring sensor. Multiple parallel nonlinear filters filter these multiple sensor signals to identify fetal heart beats in the signal data. A processor determines a fetal heart rate based on these identified fetal heart beats. The processor includes the use of a figure of merit weighting of heart rate estimates based on the identified heart beats from each filter for each signal. The fetal heart rate thus determined is outputted to a display, storage, or communications channel. A method for enhanced fetal heart beat discrimination includes acquiring signals from a fetus, identifying fetal heart beats from the signals by multiple parallel nonlinear filtering, and determining a fetal heart rate based on the identified fetal heart beats. A figure of merit operation in this method provides for weighting a plurality of fetal heart rate estimates based on the identified fetal heart beats and selecting the highest ranking fetal heart rate estimate.

Fabricating biomedical origami: a state-of-the-art review

PubMed Central

Johnson, Meredith; Chen, Yue; Hovet, Sierra; Xu, Sheng; Wood, Bradford; Ren, Hongliang; Tokuda, Junichi; Tse, Zion Tsz Ho

2018-01-01

Purpose Origami-based biomedical device design is an emerging technology due to its ability to be deployed from a minimal foldable pattern to a larger volume. This paper aims to review state-of-the-art origami structures applied in the medical device field. Methods Publications and reports of origami structure related to medical device design from the past 10 years are reviewed and categorized according to engineering specifications, including the application field, fabrication material, size/volume, deployment method, manufacturability, and advantages. Results This paper presents an overview of the biomedical applications of devices based on origami structures, including disposable sterilization covers, cardiac catheterization, stent grafts, encapsulation and microsurgery, gastrointestinal microsurgery, laparoscopic surgical grippers, microgrippers, microfluidic devices, and drug delivery. Challenges in terms of materials and fabrication, assembly, modeling and computation design, and clinical adoptability are discussed at the end of this paper to provide guidance for future origami-based design in the medical device field. Conclusion Concepts from origami can be used to design and develop novel medical devices. Origami-based medical device design is currently progressing, with researchers improving design methods, materials, fabrication techniques, and folding efficiency. PMID:28260164

Rethinking knowledge and pedagogy in dental education.

PubMed

Whipp, J L; Ferguson, D J; Wells, L M; Iacopino, A M

2000-12-01

Dentistry as a profession has often been considered both art and science. Traditional dental education has attempted to address both; however, in many places only the science of dentistry is emphasized. The move toward competency-based curricula in dental education requires an expansion of what constitutes meaningful knowledge in the curriculum and what pedagogies best support that curriculum. The scientific and technical knowledge considered foundational to clinical practice is not sufficient to teach competencies associated with the art of dentistry. Habermas, a social scientist, offers a way of looking beyond technical knowledge to consider two other forms of knowledge: practical and emancipatory. Pedagogy that supports development of practical and emancipatory knowledge includes problem-based learning and case methods, heuristics, reflective practica, journals, storytelling, and performance-based assessment methods. These important teaching strategies are being integrated into various dental curricula including a new competency-based dental curriculum at Marquette University's School of Dentistry. It will be critical for dental educators to continue developing these methods to provide efficient and effective education for future practitioners in both the art and science of dentistry.

Organized energetic composites based on micro and nanostructures and methods thereof

DOEpatents

Gash, Alexander E.; Han, Thomas Yong-Jin; Sirbuly, Donald J.

2012-09-04

An ordered energetic composite structure according to one embodiment includes an ordered array of metal fuel portions; and an oxidizer in gaps located between the metal fuel portions. An ordered energetic composite structure according to another embodiment includes at least one metal fuel portion having an ordered array of nanopores; and an oxidizer in the nanopores. A method for forming an ordered energetic composite structure according to one embodiment includes forming an ordered array of metal fuel portions; and depositing an oxidizer in gaps located between the metal fuel portions. A method for forming an ordered energetic composite structure according to another embodiment includes forming an ordered array of nanopores in at least one metal fuel portion; and depositing an oxidizer in the nanopores.

Protocol for Detection of Yersinia pestis in Environmental ...

EPA Pesticide Factsheets

Methods Report This is the first ever open-access and detailed protocol available to all government departments and agencies, and their contractors to detect Yersinia pestis, the pathogen that causes plague, from multiple environmental sample types including water. Each analytical method includes sample processing procedure for each sample type in a step-by-step manner. It includes real-time PCR, traditional microbiological culture, and the Rapid Viability PCR (RV-PCR) analytical methods. For large volume water samples it also includes an ultra-filtration-based sample concentration procedure. Because of such a non-restrictive availability of this protocol to all government departments and agencies, and their contractors, the nation will now have increased laboratory capacity to analyze large number of samples during a wide-area plague incident.

Precision mechanical structure of an ultra-high-resolution spectrometer for inelastic X-ray scattering instrument

DOEpatents

Shu, Deming; Shvydko, Yuri; Stoupin, Stanislav A.; Khachatryan, Ruben; Goetze, Kurt A.; Roberts, Timothy

2015-04-14

A method and an ultrahigh-resolution spectrometer including a precision mechanical structure for positioning inelastic X-ray scattering optics are provided. The spectrometer includes an X-ray monochromator and an X-ray analyzer, each including X-ray optics of a collimating (C) crystal, a pair of dispersing (D) element crystals, anomalous transmission filter (F) and a wavelength (W) selector crystal. A respective precision mechanical structure is provided with the X-ray monochromator and the X-ray analyzer. The precision mechanical structure includes a base plate, such as an aluminum base plate; positioning stages for D-crystal alignment; positioning stages with an incline sensor for C/F/W-crystal alignment, and the positioning stages including flexure-based high-stiffness structure.

Teaching Prevention in Pediatrics.

ERIC Educational Resources Information Center

Cheng, Tina L.; Greenberg, Larrie; Loeser, Helen; Keller, David

2000-01-01

Reviews methods of teaching preventive medicine in pediatrics and highlights innovative programs. Methods of teaching prevention in pediatrics include patient interactions, self-directed learning, case-based learning, small-group learning, standardized patients, computer-assisted instruction, the Internet, student-centered learning, and lectures.…

Different perspectives on economic base.

Treesearch

Lisa K. Crone; Richard W. Haynes; Nicholas E. Reyna

1999-01-01

Two general approaches for measuring the economic base are discussed. Each method is used to define the economic base for each of the counties included in the Interior Columbia Basin Ecosystem Management Project area. A more detailed look at four selected counties results in similar findings from different approaches. Limitations of economic base analysis also are...

SIERRA Multimechanics Module: Aria User Manual Version 4.44

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sierra Thermal /Fluid Team

2017-04-01

Aria is a Galerkin fnite element based program for solving coupled-physics problems described by systems of PDEs and is capable of solving nonlinear, implicit, transient and direct-to-steady state problems in two and three dimensions on parallel architectures. The suite of physics currently supported by Aria includes thermal energy transport, species transport, and electrostatics as well as generalized scalar, vector and tensor transport equations. Additionally, Aria includes support for manufacturing process fows via the incompressible Navier-Stokes equations specialized to a low Reynolds number ( %3C 1 ) regime. Enhanced modeling support of manufacturing processing is made possible through use of eithermore » arbitrary Lagrangian- Eulerian (ALE) and level set based free and moving boundary tracking in conjunction with quasi-static nonlinear elastic solid mechanics for mesh control. Coupled physics problems are solved in several ways including fully-coupled Newton's method with analytic or numerical sensitivities, fully-coupled Newton- Krylov methods and a loosely-coupled nonlinear iteration about subsets of the system that are solved using combinations of the aforementioned methods. Error estimation, uniform and dynamic h -adaptivity and dynamic load balancing are some of Aria's more advanced capabilities. Aria is based upon the Sierra Framework.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sierra Thermal/Fluid Team

Aria is a Galerkin fnite element based program for solving coupled-physics problems described by systems of PDEs and is capable of solving nonlinear, implicit, transient and direct-to-steady state problems in two and three dimensions on parallel architectures. The suite of physics currently supported by Aria includes thermal energy transport, species transport, and electrostatics as well as generalized scalar, vector and tensor transport equations. Additionally, Aria includes support for manufacturing process fows via the incompressible Navier-Stokes equations specialized to a low Reynolds number ( %3C 1 ) regime. Enhanced modeling support of manufacturing processing is made possible through use of eithermore » arbitrary Lagrangian- Eulerian (ALE) and level set based free and moving boundary tracking in conjunction with quasi-static nonlinear elastic solid mechanics for mesh control. Coupled physics problems are solved in several ways including fully-coupled Newton's method with analytic or numerical sensitivities, fully-coupled Newton- Krylov methods and a loosely-coupled nonlinear iteration about subsets of the system that are solved using combinations of the aforementioned methods. Error estimation, uniform and dynamic h -adaptivity and dynamic load balancing are some of Aria's more advanced capabilities. Aria is based upon the Sierra Framework.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sierra Thermal /Fluid Team

Aria is a Galerkin finite element based program for solving coupled-physics problems described by systems of PDEs and is capable of solving nonlinear, implicit, transient and direct-to-steady state problems in two and three dimensions on parallel architectures. The suite of physics currently supported by Aria includes thermal energy transport, species transport, and electrostatics as well as generalized scalar, vector and tensor transport equations. Additionally, Aria includes support for manufacturing process flows via the incompressible Navier-Stokes equations specialized to a low Reynolds number (Re %3C 1) regime. Enhanced modeling support of manufacturing processing is made possible through use of either arbitrarymore » Lagrangian- Eulerian (ALE) and level set based free and moving boundary tracking in conjunction with quasi-static nonlinear elastic solid mechanics for mesh control. Coupled physics problems are solved in several ways including fully-coupled Newton's method with analytic or numerical sensitivities, fully-coupled Newton- Krylov methods and a loosely-coupled nonlinear iteration about subsets of the system that are solved using combinations of the aforementioned methods. Error estimation, uniform and dynamic h-adaptivity and dynamic load balancing are some of Aria's more advanced capabilities. Aria is based upon the Sierra Framework.« less

The microwave-assisted ionic-liquid method: a promising methodology in nanomaterials.

PubMed

Ma, Ming-Guo; Zhu, Jie-Fang; Zhu, Ying-Jie; Sun, Run-Cang

2014-09-01

In recent years, the microwave-assisted ionic-liquid method has been accepted as a promising methodology for the preparation of nanomaterials and cellulose-based nanocomposites. Applications of this method in the preparation of cellulose-based nanocomposites comply with the major principles of green chemistry, that is, they use an environmentally friendly method in environmentally preferable solvents to make use of renewable materials. This minireview focuses on the recent development of the synthesis of nanomaterials and cellulose-based nanocomposites by means of the microwave-assisted ionic-liquid method. We first discuss the preparation of nanomaterials including noble metals, metal oxides, complex metal oxides, metal sulfides, and other nanomaterials by means of this method. Then we provide an overview of the synthesis of cellulose-based nanocomposites by using this method. The emphasis is on the synthesis, microstructure, and properties of nanostructured materials obtained through this methodology. Our recent research on nanomaterials and cellulose-based nanocomposites by this rapid method is summarized. In addition, the formation mechanisms involved in the microwave-assisted ionic-liquid synthesis of nanostructured materials are discussed briefly. Finally, the future perspectives of this methodology in the synthesis of nanostructured materials are proposed. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Deterministic and fuzzy-based methods to evaluate community resilience

NASA Astrophysics Data System (ADS)

Kammouh, Omar; Noori, Ali Zamani; Taurino, Veronica; Mahin, Stephen A.; Cimellaro, Gian Paolo

2018-04-01

Community resilience is becoming a growing concern for authorities and decision makers. This paper introduces two indicator-based methods to evaluate the resilience of communities based on the PEOPLES framework. PEOPLES is a multi-layered framework that defines community resilience using seven dimensions. Each of the dimensions is described through a set of resilience indicators collected from literature and they are linked to a measure allowing the analytical computation of the indicator's performance. The first method proposed in this paper requires data on previous disasters as an input and returns as output a performance function for each indicator and a performance function for the whole community. The second method exploits a knowledge-based fuzzy modeling for its implementation. This method allows a quantitative evaluation of the PEOPLES indicators using descriptive knowledge rather than deterministic data including the uncertainty involved in the analysis. The output of the fuzzy-based method is a resilience index for each indicator as well as a resilience index for the community. The paper also introduces an open source online tool in which the first method is implemented. A case study illustrating the application of the first method and the usage of the tool is also provided in the paper.

Methodological considerations in region of interest definitions for paraspinal muscles in axial MRIs of the lumbar spine.

PubMed

Berry, David B; Padwal, Jennifer; Johnson, Seth; Parra, Callan L; Ward, Samuel R; Shahidi, Bahar

2018-05-07

Magnetic Resonance Imaging (MRI) is commonly used to assess the health of the lumbar spine and supporting structures. Studies have suggested that fatty infiltration of the posterior lumbar muscles is important in predicting responses to treatment for low back pain. However, methodological differences exist in defining the region of interest (ROI) of a muscle, which limits the ability to compare data between studies. The purpose of this study was to determine reliability and systematic differences within and between two commonly utilized methodologies for ROI definitions of lumbar paraspinal muscle. T2-weighted MRIs of the mid-L4 vertebrae from 37 patients with low back pain who were scheduled for lumbar spine surgery were included from a hospital database. Fatty infiltration for these patients ranged from low to high, based on Kjaer criteria. Two methods were used to define ROI: 1) segmentation of the multifidus and erector spinae based on fascial planes including epimuscular fat, and 2) segmentation of the multifidus and erector spinae based on visible muscle boundaries, which did not include epimuscular fat. Total cross sectional area (tCSA), fat signal fraction (FSF), muscle cross sectional area, and fat cross sectional area were measured. Degree of agreement between raters for each parameter was assessed using intra-class correlation coefficients (ICC) and area fraction of overlapping voxels. Excellent inter-rater agreement (ICC > 0.75) was observed for all measures for both methods. There was no significant difference between area fraction overlap of ROIs between methods. Method 1 demonstrated a greater tCSA for both the erector spinae (14-15%, p < 0.001) and multifidus (4%, p < 0.016) but a greater FSF only for the erector spinae (11-13%, p < 0.001). The two methods of defining lumbar spine muscle ROIs demonstrated excellent inter-rater reliability, although significant differences exist as method 1 showed larger CSA and FSF values compared to method 2. The results of this study confirm the validity of using either method to measure lumbar paraspinal musculature, and that method should be selected based on the primary outcome variables of interest.

A comparison of web-based and paper-based survey methods: testing assumptions of survey mode and response cost.

PubMed

Greenlaw, Corey; Brown-Welty, Sharon

2009-10-01

Web-based surveys have become more prevalent in areas such as evaluation, research, and marketing research to name a few. The proliferation of these online surveys raises the question, how do response rates compare with traditional surveys and at what cost? This research explored response rates and costs for Web-based surveys, paper surveys, and mixed-mode surveys. The participants included evaluators from the American Evaluation Association (AEA). Results included that mixed-mode, while more expensive, had higher response rates.

[A research on real-time ventricular QRS classification methods for single-chip-microcomputers].

PubMed

Peng, L; Yang, Z; Li, L; Chen, H; Chen, E; Lin, J

1997-05-01

Ventricular QRS classification is key technique of ventricular arrhythmias detection in single-chip-microcomputer based dynamic electrocardiogram real-time analyser. This paper adopts morphological feature vector including QRS amplitude, interval information to reveal QRS morphology. After studying the distribution of QRS morphology feature vector of MIT/BIH DB ventricular arrhythmia files, we use morphological feature vector cluster to classify multi-morphology QRS. Based on the method, morphological feature parameters changing method which is suitable to catch occasional ventricular arrhythmias is presented. Clinical experiments verify missed ventricular arrhythmia is less than 1% by this method.

A real-time TV logo tracking method using template matching

NASA Astrophysics Data System (ADS)

Li, Zhi; Sang, Xinzhu; Yan, Binbin; Leng, Junmin

2012-11-01

A fast and accurate TV Logo detection method is presented based on real-time image filtering, noise eliminating and recognition of image features including edge and gray level information. It is important to accurately extract the optical template using the time averaging method from the sample video stream, and then different templates are used to match different logos in separated video streams with different resolution based on the topology features of logos. 12 video streams with different logos are used to verify the proposed method, and the experimental result demonstrates that the achieved accuracy can be up to 99%.

Operational Retrievals of Evapotranspiration: Are we there yet?

NASA Astrophysics Data System (ADS)

Neale, C. M. U.; Anderson, M. C.; Hain, C.; Schull, M.; Isidro, C., Sr.; Goncalves, I. Z.

2017-12-01

Remote sensing based retrievals of evapotranspiration (ET) have progressed significantly over the last two decades with the improvement of methods and algorithms and the availability of multiple satellite sensors with shortwave and thermal infrared bands on polar orbiting platforms. The modeling approaches include simpler vegetation index (VI) based methods such as the reflectance-based crop coefficient approach coupled with surface reference evapotranspiration estimates to derive actual evapotranspiration of crops or, direct inputs to the Penman-Monteith equation through VI relationships with certain input variables. Methods that are more complex include one-layer or two-layer energy balance approaches that make use of both shortwave and longwave spectral band information to estimate different inputs to the energy balance equation. These models mostly differ in the estimation of sensible heat fluxes. For continental and global scale applications, other satellite-based products such as solar radiation, vegetation leaf area and cover are used as inputs, along with gridded re-analysis weather information. This presentation will review the state-of-the-art in satellite-based evapotranspiration estimation, giving examples of existing efforts to obtain operational ET retrievals over continental and global scales and discussing difficulties and challenges.

Method and system for progressive mesh storage and reconstruction using wavelet-encoded height fields

NASA Technical Reports Server (NTRS)

Baxes, Gregory A. (Inventor); Linger, Timothy C. (Inventor)

2011-01-01

Systems and methods are provided for progressive mesh storage and reconstruction using wavelet-encoded height fields. A method for progressive mesh storage includes reading raster height field data, and processing the raster height field data with a discrete wavelet transform to generate wavelet-encoded height fields. In another embodiment, a method for progressive mesh storage includes reading texture map data, and processing the texture map data with a discrete wavelet transform to generate wavelet-encoded texture map fields. A method for reconstructing a progressive mesh from wavelet-encoded height field data includes determining terrain blocks, and a level of detail required for each terrain block, based upon a viewpoint. Triangle strip constructs are generated from vertices of the terrain blocks, and an image is rendered utilizing the triangle strip constructs. Software products that implement these methods are provided.

Method and system for progressive mesh storage and reconstruction using wavelet-encoded height fields

NASA Technical Reports Server (NTRS)

Baxes, Gregory A. (Inventor)

2010-01-01

Systems and methods are provided for progressive mesh storage and reconstruction using wavelet-encoded height fields. A method for progressive mesh storage includes reading raster height field data, and processing the raster height field data with a discrete wavelet transform to generate wavelet-encoded height fields. In another embodiment, a method for progressive mesh storage includes reading texture map data, and processing the texture map data with a discrete wavelet transform to generate wavelet-encoded texture map fields. A method for reconstructing a progressive mesh from wavelet-encoded height field data includes determining terrain blocks, and a level of detail required for each terrain block, based upon a viewpoint. Triangle strip constructs are generated from vertices of the terrain blocks, and an image is rendered utilizing the triangle strip constructs. Software products that implement these methods are provided.

Using community-based participatory research and organizational diagnosis to characterize relationships between community leaders and academic researchers.

PubMed

Wang, Karen H; Ray, Natasha J; Berg, David N; Greene, Ann T; Lucas, Georgina; Harris, Kenn; Carroll-Scott, Amy; Tinney, Barbara; Rosenthal, Marjorie S

2017-09-01

Sustaining collaborations between community-based organization leaders and academic researchers in community-engaged research (CEnR) in the service of decreasing health inequities necessitates understanding the collaborations from an inter-organizational perspective. We assessed the perspectives of community leaders and university-based researchers conducting community-engaged research in a medium-sized city with a history of community-university tension. Our research team, included experts in CEnR and organizational theory, used qualitative methods and purposeful, snowball sampling to recruit local participants and performed key informant interviews from July 2011-May 2012. A community-based researcher interviewed 11 community leaders, a university-based researcher interviewed 12 university-based researchers. We interviewed participants until we reached thematic saturation and performed analyses using the constant comparative method. Unifying themes characterizing community leaders and university-based researchers' relationships on the inter-organizational level include: 1) Both groups described that community-engaged university-based researchers are exceptions to typical university culture; 2) Both groups described that the interpersonal skills university-based researchers need for CEnR require a change in organizational culture and training; 3) Both groups described skepticism about the sustainability of a meaningful institutional commitment to community-engaged research 4) Both groups described the historical impact on research relationships of race, power, and privilege, but only community leaders described its persistent role and relevance in research relationships. Challenges to community-academic research partnerships include researcher interpersonal skills and different perceptions of the importance of organizational history. Solutions to improve research partnerships may include transforming university culture and community-university discussions on race, power, and privilege.

Policy-based secure communication with automatic key management for industrial control and automation systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chernoguzov, Alexander; Markham, Thomas R.; Haridas, Harshal S.

A method includes generating at least one access vector associated with a specified device in an industrial process control and automation system. The specified device has one of multiple device roles. The at least one access vector is generated based on one or more communication policies defining communications between one or more pairs of devices roles in the industrial process control and automation system, where each pair of device roles includes the device role of the specified device. The method also includes providing the at least one access vector to at least one of the specified device and one ormore » more other devices in the industrial process control and automation system in order to control communications to or from the specified device.« less

A voxel-based investigation for MRI-only radiotherapy of the brain using ultra short echo times

NASA Astrophysics Data System (ADS)

Edmund, Jens M.; Kjer, Hans M.; Van Leemput, Koen; Hansen, Rasmus H.; Andersen, Jon AL; Andreasen, Daniel

2014-12-01

Radiotherapy (RT) based on magnetic resonance imaging (MRI) as the only modality, so-called MRI-only RT, would remove the systematic registration error between MR and computed tomography (CT), and provide co-registered MRI for assessment of treatment response and adaptive RT. Electron densities, however, need to be assigned to the MRI images for dose calculation and patient setup based on digitally reconstructed radiographs (DRRs). Here, we investigate the geometric and dosimetric performance for a number of popular voxel-based methods to generate a so-called pseudo CT (pCT). Five patients receiving cranial irradiation, each containing a co-registered MRI and CT scan, were included. An ultra short echo time MRI sequence for bone visualization was used. Six methods were investigated for three popular types of voxel-based approaches; (1) threshold-based segmentation, (2) Bayesian segmentation and (3) statistical regression. Each approach contained two methods. Approach 1 used bulk density assignment of MRI voxels into air, soft tissue and bone based on logical masks and the transverse relaxation time T2 of the bone. Approach 2 used similar bulk density assignments with Bayesian statistics including or excluding additional spatial information. Approach 3 used a statistical regression correlating MRI voxels with their corresponding CT voxels. A similar photon and proton treatment plan was generated for a target positioned between the nasal cavity and the brainstem for all patients. The CT agreement with the pCT of each method was quantified and compared with the other methods geometrically and dosimetrically using both a number of reported metrics and introducing some novel metrics. The best geometrical agreement with CT was obtained with the statistical regression methods which performed significantly better than the threshold and Bayesian segmentation methods (excluding spatial information). All methods agreed significantly better with CT than a reference water MRI comparison. The mean dosimetric deviation for photons and protons compared to the CT was about 2% and highest in the gradient dose region of the brainstem. Both the threshold based method and the statistical regression methods showed the highest dosimetrical agreement. Generation of pCTs using statistical regression seems to be the most promising candidate for MRI-only RT of the brain. Further, the total amount of different tissues needs to be taken into account for dosimetric considerations regardless of their correct geometrical position.

Evaluation of dysphagia in early stroke patients by bedside, endoscopic, and electrophysiological methods.

PubMed

Umay, Ebru Karaca; Unlu, Ece; Saylam, Guleser Kılıc; Cakci, Aytul; Korkmaz, Hakan

2013-09-01

We aimed in this study to evaluate dysphagia in early stroke patients using a bedside screening test and flexible fiberoptic endoscopic evaluation of swallowing (FFEES) and electrophysiological evaluation (EE) methods and to compare the effectiveness of these methods. Twenty-four patients who were hospitalized in our clinic within the first 3 months after stroke were included in this study. Patients were evaluated using a bedside screening test [including bedside dysphagia score (BDS), neurological examination dysphagia score (NEDS), and total dysphagia score (TDS)] and FFEES and EE methods. Patients were divided into normal-swallowing and dysphagia groups according to the results of the evaluation methods. Patients with dysphagia as determined by any of these methods were compared to the patients with normal swallowing based on the results of the other two methods. Based on the results of our study, a high BDS was positively correlated with dysphagia identified by FFEES and EE methods. Moreover, the FFEES and EE methods were positively correlated. There was no significant correlation between NEDS and TDS levels and either EE or FFEES method. Bedside screening tests should be used mainly as an initial screening test; then FFEES and EE methods should be combined in patients who show risks. This diagnostic algorithm may provide a practical and fast solution for selected stroke patients.

Combining and Comparing Coalescent, Distance and Character-Based Approaches for Barcoding Microalgaes: A Test with Chlorella-Like Species (Chlorophyta).

PubMed

Zou, Shanmei; Fei, Cong; Song, Jiameng; Bao, Yachao; He, Meilin; Wang, Changhai

2016-01-01

Several different barcoding methods of distinguishing species have been advanced, but which method is the best is still controversial. Chlorella is becoming particularly promising in the development of second-generation biofuels. However, the taxonomy of Chlorella-like organisms is easily confused. Here we report a comprehensive barcoding analysis of Chlorella-like species from Chlorella, Chloroidium, Dictyosphaerium and Actinastrum based on rbcL, ITS, tufA and 16S sequences to test the efficiency of traditional barcoding, GMYC, ABGD, PTP, P ID and character-based barcoding methods. First of all, the barcoding results gave new insights into the taxonomic assessment of Chlorella-like organisms studied, including the clear species discrimination and resolution of potentially cryptic species complexes in C. sorokiniana, D. ehrenbergianum and C. Vulgaris. The tufA proved to be the most efficient barcoding locus, which thus could be as potential "specific barcode" for Chlorella-like species. The 16S failed in discriminating most closely related species. The resolution of GMYC, PTP, P ID, ABGD and character-based barcoding methods were variable among rbcL, ITS and tufA genes. The best resolution for species differentiation appeared in tufA analysis where GMYC, PTP, ABGD and character-based approaches produced consistent groups while the PTP method over-split the taxa. The character analysis of rbcL, ITS and tufA sequences could clearly distinguish all taxonomic groups respectively, including the potentially cryptic lineages, with many character attributes. Thus, the character-based barcoding provides an attractive complement to coalescent and distance-based barcoding. Our study represents the test that proves the efficiency of multiple DNA barcoding in species discrimination of microalgaes.

Combining and Comparing Coalescent, Distance and Character-Based Approaches for Barcoding Microalgaes: A Test with Chlorella-Like Species (Chlorophyta)

PubMed Central

Zou, Shanmei; Fei, Cong; Song, Jiameng; Bao, Yachao; He, Meilin; Wang, Changhai

2016-01-01

Several different barcoding methods of distinguishing species have been advanced, but which method is the best is still controversial. Chlorella is becoming particularly promising in the development of second-generation biofuels. However, the taxonomy of Chlorella–like organisms is easily confused. Here we report a comprehensive barcoding analysis of Chlorella-like species from Chlorella, Chloroidium, Dictyosphaerium and Actinastrum based on rbcL, ITS, tufA and 16S sequences to test the efficiency of traditional barcoding, GMYC, ABGD, PTP, P ID and character-based barcoding methods. First of all, the barcoding results gave new insights into the taxonomic assessment of Chlorella-like organisms studied, including the clear species discrimination and resolution of potentially cryptic species complexes in C. sorokiniana, D. ehrenbergianum and C. Vulgaris. The tufA proved to be the most efficient barcoding locus, which thus could be as potential “specific barcode” for Chlorella-like species. The 16S failed in discriminating most closely related species. The resolution of GMYC, PTP, P ID, ABGD and character-based barcoding methods were variable among rbcL, ITS and tufA genes. The best resolution for species differentiation appeared in tufA analysis where GMYC, PTP, ABGD and character-based approaches produced consistent groups while the PTP method over-split the taxa. The character analysis of rbcL, ITS and tufA sequences could clearly distinguish all taxonomic groups respectively, including the potentially cryptic lineages, with many character attributes. Thus, the character-based barcoding provides an attractive complement to coalescent and distance-based barcoding. Our study represents the test that proves the efficiency of multiple DNA barcoding in species discrimination of microalgaes. PMID:27092945

Influence of stem temperature changes on heat pulse sap flux density measurements.

PubMed

Vandegehuchte, Maurits W; Burgess, Stephen S O; Downey, Alec; Steppe, Kathy

2015-04-01

While natural spatial temperature gradients between measurement needles have been thoroughly investigated for continuous heat-based sap flow methods, little attention has been given to how natural changes in stem temperature impact heat pulse-based methods through temporal rather than spatial effects. By modelling the theoretical equation for both an ideal instantaneous pulse and a step pulse and applying a finite element model which included actual needle dimensions and wound effects, the influence of a varying stem temperature on heat pulse-based methods was investigated. It was shown that the heat ratio (HR) method was influenced, while for the compensation heat pulse and Tmax methods changes in stem temperatures of up to 0.002 °C s(-1) did not lead to significantly different results. For the HR method, rising stem temperatures during measurements led to lower heat pulse velocity values, while decreasing stem temperatures led to both higher and lower heat pulse velocities, and to imaginary results for high flows. These errors of up to 40% can easily be prevented by including a temperature correction in the data analysis procedure, calculating the slope of the natural temperature change based on the measured temperatures before application of the heat pulse. Results of a greenhouse and outdoor experiment on Pinus pinea L. show the influence of this correction on low and average sap flux densities. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

NNAlign: A Web-Based Prediction Method Allowing Non-Expert End-User Discovery of Sequence Motifs in Quantitative Peptide Data

PubMed Central

Andreatta, Massimo; Schafer-Nielsen, Claus; Lund, Ole; Buus, Søren; Nielsen, Morten

2011-01-01

Recent advances in high-throughput technologies have made it possible to generate both gene and protein sequence data at an unprecedented rate and scale thereby enabling entirely new “omics”-based approaches towards the analysis of complex biological processes. However, the amount and complexity of data that even a single experiment can produce seriously challenges researchers with limited bioinformatics expertise, who need to handle, analyze and interpret the data before it can be understood in a biological context. Thus, there is an unmet need for tools allowing non-bioinformatics users to interpret large data sets. We have recently developed a method, NNAlign, which is generally applicable to any biological problem where quantitative peptide data is available. This method efficiently identifies underlying sequence patterns by simultaneously aligning peptide sequences and identifying motifs associated with quantitative readouts. Here, we provide a web-based implementation of NNAlign allowing non-expert end-users to submit their data (optionally adjusting method parameters), and in return receive a trained method (including a visual representation of the identified motif) that subsequently can be used as prediction method and applied to unknown proteins/peptides. We have successfully applied this method to several different data sets including peptide microarray-derived sets containing more than 100,000 data points. NNAlign is available online at http://www.cbs.dtu.dk/services/NNAlign. PMID:22073191

NNAlign: a web-based prediction method allowing non-expert end-user discovery of sequence motifs in quantitative peptide data.

PubMed

Andreatta, Massimo; Schafer-Nielsen, Claus; Lund, Ole; Buus, Søren; Nielsen, Morten

2011-01-01

Recent advances in high-throughput technologies have made it possible to generate both gene and protein sequence data at an unprecedented rate and scale thereby enabling entirely new "omics"-based approaches towards the analysis of complex biological processes. However, the amount and complexity of data that even a single experiment can produce seriously challenges researchers with limited bioinformatics expertise, who need to handle, analyze and interpret the data before it can be understood in a biological context. Thus, there is an unmet need for tools allowing non-bioinformatics users to interpret large data sets. We have recently developed a method, NNAlign, which is generally applicable to any biological problem where quantitative peptide data is available. This method efficiently identifies underlying sequence patterns by simultaneously aligning peptide sequences and identifying motifs associated with quantitative readouts. Here, we provide a web-based implementation of NNAlign allowing non-expert end-users to submit their data (optionally adjusting method parameters), and in return receive a trained method (including a visual representation of the identified motif) that subsequently can be used as prediction method and applied to unknown proteins/peptides. We have successfully applied this method to several different data sets including peptide microarray-derived sets containing more than 100,000 data points. NNAlign is available online at http://www.cbs.dtu.dk/services/NNAlign.

A Review on Methods of Risk Adjustment and their Use in Integrated Healthcare Systems

PubMed Central

Juhnke, Christin; Bethge, Susanne

2016-01-01

Introduction: Effective risk adjustment is an aspect that is more and more given weight on the background of competitive health insurance systems and vital healthcare systems. The objective of this review was to obtain an overview of existing models of risk adjustment as well as on crucial weights in risk adjustment. Moreover, the predictive performance of selected methods in international healthcare systems should be analysed. Theory and methods: A comprehensive, systematic literature review on methods of risk adjustment was conducted in terms of an encompassing, interdisciplinary examination of the related disciplines. Results: In general, several distinctions can be made: in terms of risk horizons, in terms of risk factors or in terms of the combination of indicators included. Within these, another differentiation by three levels seems reasonable: methods based on mortality risks, methods based on morbidity risks as well as those based on information on (self-reported) health status. Conclusions and discussion: After the final examination of different methods of risk adjustment it was shown that the methodology used to adjust risks varies. The models differ greatly in terms of their included morbidity indicators. The findings of this review can be used in the evaluation of integrated healthcare delivery systems and can be integrated into quality- and patient-oriented reimbursement of care providers in the design of healthcare contracts. PMID:28316544

The International College of Neuropsychopharmacology (CINP) Treatment Guidelines for Bipolar Disorder in Adults (CINP-BD-2017), Part 1: Background and Methods of the Development of Guidelines.

PubMed

Fountoulakis, Konstantinos N; Young, Allan; Yatham, Lakshmi; Grunze, Heinz; Vieta, Eduard; Blier, Pierre; Moeller, Hans Jurgen; Kasper, Siegfried

2017-02-01

This paper includes a short description of the important clinical aspects of Bipolar Disorder with emphasis on issues that are important for the therapeutic considerations, including mixed and psychotic features, predominant polarity, and rapid cycling as well as comorbidity. The workgroup performed a review and critical analysis of the literature concerning grading methods and methods for the development of guidelines. The workgroup arrived at a consensus to base the development of the guideline on randomized controlled trials and related meta-analyses alone in order to follow a strict evidence-based approach. A critical analysis of the existing methods for the grading of treatment options was followed by the development of a new grading method to arrive at efficacy and recommendation levels after the analysis of 32 distinct scenarios of available data for a given treatment option. The current paper reports details on the design, method, and process for the development of CINP guidelines for the treatment of Bipolar Disorder. The rationale and the method with which all data and opinions are combined in order to produce an evidence-based operationalized but also user-friendly guideline and a specific algorithm are described in detail in this paper. © The Author 2016. Published by Oxford University Press on behalf of CINP.

2D Transition-Metal-Dichalcogenide-Nanosheet-Based Composites for Photocatalytic and Electrocatalytic Hydrogen Evolution Reactions.

PubMed

Lu, Qipeng; Yu, Yifu; Ma, Qinglang; Chen, Bo; Zhang, Hua

2016-03-09

Hydrogen (H2) is one of the most important clean and renewable energy sources for future energy sustainability. Nowadays, photocatalytic and electrocatalytic hydrogen evolution reactions (HERs) from water splitting are considered as two of the most efficient methods to convert sustainable energy to the clean energy carrier, H2. Catalysts based on transition metal dichalcogenides (TMDs) are recognized as greatly promising substitutes for noble-metal-based catalysts for HER. The photocatalytic and electrocatalytic activities of TMD nanosheets for the HER can be further improved after hybridization with many kinds of nanomaterials, such as metals, oxides, sulfides, and carbon materials, through different methods including the in situ reduction method, the hot-injection method, the heating-up method, the hydro(solvo)thermal method, chemical vapor deposition (CVD), and thermal annealing. Here, recent progress in photocatalytic and electrocatalytic HERs using 2D TMD-based composites as catalysts is discussed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Lung lobe segmentation based on statistical atlas and graph cuts

NASA Astrophysics Data System (ADS)

Nimura, Yukitaka; Kitasaka, Takayuki; Honma, Hirotoshi; Takabatake, Hirotsugu; Mori, Masaki; Natori, Hiroshi; Mori, Kensaku

2012-03-01

This paper presents a novel method that can extract lung lobes by utilizing probability atlas and multilabel graph cuts. Information about pulmonary structures plays very important role for decision of the treatment strategy and surgical planning. The human lungs are divided into five anatomical regions, the lung lobes. Precise segmentation and recognition of lung lobes are indispensable tasks in computer aided diagnosis systems and computer aided surgery systems. A lot of methods for lung lobe segmentation are proposed. However, these methods only target the normal cases. Therefore, these methods cannot extract the lung lobes in abnormal cases, such as COPD cases. To extract lung lobes in abnormal cases, this paper propose a lung lobe segmentation method based on probability atlas of lobe location and multilabel graph cuts. The process consists of three components; normalization based on the patient's physique, probability atlas generation, and segmentation based on graph cuts. We apply this method to six cases of chest CT images including COPD cases. Jaccard index was 79.1%.

48 CFR 252.204-7014 - Limitations on the Use or Disclosure of Information by Litigation Support Contractors.

Code of Federal Regulations, 2014 CFR

2014-10-01

.... Computer software does not include computer data bases or computer software documentation. Litigation... includes technical data and computer software, but does not include information that is lawfully, publicly available without restriction. Technical data means recorded information, regardless of the form or method...

Continental-scale Validation of MODIS-based and LEDAPS Landsat ETM+ Atmospheric Correction Methods

NASA Technical Reports Server (NTRS)

Ju, Junchang; Roy, David P.; Vermote, Eric; Masek, Jeffrey; Kovalskyy, Valeriy

2012-01-01

The potential of Landsat data processing to provide systematic continental scale products has been demonstrated by several projects including the NASA Web-enabled Landsat Data (WELD) project. The recent free availability of Landsat data increases the need for robust and efficient atmospheric correction algorithms applicable to large volume Landsat data sets. This paper compares the accuracy of two Landsat atmospheric correction methods: a MODIS-based method and the Landsat Ecosystem Disturbance Adaptive Processing System (LEDAPS) method. Both methods are based on the 6SV radiative transfer code but have different atmospheric characterization approaches. The MODIS-based method uses the MODIS Terra derived dynamic aerosol type, aerosol optical thickness, and water vapor to atmospherically correct ETM+ acquisitions in each coincident orbit. The LEDAPS method uses aerosol characterizations derived independently from each Landsat acquisition and assumes a fixed continental aerosol type and uses ancillary water vapor. Validation results are presented comparing ETM+ atmospherically corrected data generated using these two methods with AERONET corrected ETM+ data for 95 10 km×10 km 30 m subsets, a total of nearly 8 million 30 m pixels, located across the conterminous United States. The results indicate that the MODIS-based method has better accuracy than the LEDAPS method for the ETM+ red and longer wavelength bands.

Preliminary Study on Appearance-Based Detection of Anatomical Point Landmarks in Body Trunk CT Images

NASA Astrophysics Data System (ADS)

Nemoto, Mitsutaka; Nomura, Yukihiro; Hanaoka, Shohei; Masutani, Yoshitaka; Yoshikawa, Takeharu; Hayashi, Naoto; Yoshioka, Naoki; Ohtomo, Kuni

Anatomical point landmarks as most primitive anatomical knowledge are useful for medical image understanding. In this study, we propose a detection method for anatomical point landmark based on appearance models, which include gray-level statistical variations at point landmarks and their surrounding area. The models are built based on results of Principal Component Analysis (PCA) of sample data sets. In addition, we employed generative learning method by transforming ROI of sample data. In this study, we evaluated our method with 24 data sets of body trunk CT images and obtained 95.8 ± 7.3 % of the average sensitivity in 28 landmarks.

Development, history, and future of automated cell counters.

PubMed

Green, Ralph; Wachsmann-Hogiu, Sebastian

2015-03-01

Modern automated hematology instruments use either optical methods (light scatter), impedance-based methods based on the Coulter principle (changes in electrical current induced by blood cells flowing through an electrically charged opening), or a combination of both optical and impedance-based methods. Progressive improvement in these instruments has allowed the enumeration and evaluation of blood cells with great accuracy, precision, and speed at very low cost. Future directions of hematology instrumentation include the addition of new parameters and the development of point-of-care instrumentation. In the future, in-vivo analysis of blood cells may allow noninvasive and near-continuous measurements. Copyright © 2015 Elsevier Inc. All rights reserved.

Low Field Squid MRI Devices, Components and Methods

NASA Technical Reports Server (NTRS)

Hahn, Inseob (Inventor); Penanen, Konstantin I. (Inventor); Eom, Byeong H. (Inventor)

2013-01-01

Low field SQUID MRI devices, components and methods are disclosed. They include a portable low field (SQUID)-based MRI instrument and a portable low field SQUID-based MRI system to be operated under a bed where a subject is adapted to be located. Also disclosed is a method of distributing wires on an image encoding coil system adapted to be used with an NMR or MRI device for analyzing a sample or subject and a second order superconducting gradiometer adapted to be used with a low field SQUID-based MRI device as a sensing component for an MRI signal related to a subject or sample.

Low Field Squid MRI Devices, Components and Methods

NASA Technical Reports Server (NTRS)

Penanen, Konstantin I. (Inventor); Eom, Byeong H. (Inventor); Hahn, Inseob (Inventor)

2014-01-01

Low field SQUID MRI devices, components and methods are disclosed. They include a portable low field (SQUID)-based MRI instrument and a portable low field SQUID-based MRI system to be operated under a bed where a subject is adapted to be located. Also disclosed is a method of distributing wires on an image encoding coil system adapted to be used with an NMR or MRI device for analyzing a sample or subject and a second order superconducting gradiometer adapted to be used with a low field SQUID-based MRI device as a sensing component for an MRI signal related to a subject or sample.

Low field SQUID MRI devices, components and methods

NASA Technical Reports Server (NTRS)

Penanen, Konstantin I. (Inventor); Eom, Byeong H. (Inventor); Hahn, Inseob (Inventor)

2011-01-01

Low field SQUID MRI devices, components and methods are disclosed. They include a portable low field (SQUID)-based MRI instrument and a portable low field SQUID-based MRI system to be operated under a bed where a subject is adapted to be located. Also disclosed is a method of distributing wires on an image encoding coil system adapted to be used with an NMR or MRI device for analyzing a sample or subject and a second order superconducting gradiometer adapted to be used with a low field SQUID-based MRI device as a sensing component for an MRI signal related to a subject or sample.

Low field SQUID MRI devices, components and methods

NASA Technical Reports Server (NTRS)

Penanen, Konstantin I. (Inventor); Eom, Byeong H (Inventor); Hahn, Inseob (Inventor)

2010-01-01

Low field SQUID MRI devices, components and methods are disclosed. They include a portable low field (SQUID)-based MRI instrument and a portable low field SQUID-based MRI system to be operated under a bed where a subject is adapted to be located. Also disclosed is a method of distributing wires on an image encoding coil system adapted to be used with an NMR or MRI device for analyzing a sample or subject and a second order superconducting gradiometer adapted to be used with a low field SQUID-based MRI device as a sensing component for an MRI signal related to a subject or sample.

Methods for chromosome-specific staining

DOEpatents

Gray, J.W.; Pinkel, D.

1995-09-05

Methods and compositions for chromosome-specific staining are provided. Compositions comprise heterogeneous mixtures of labeled nucleic acid fragments having substantially complementary base sequences to unique sequence regions of the chromosomal DNA for which their associated staining reagent is specific. Methods include ways for making the chromosome-specific staining compositions of the invention, and methods for applying the staining compositions to chromosomes. 3 figs.

Modelling Coastal Cliff Recession Based on the GIM-DDD Method

NASA Astrophysics Data System (ADS)

Gong, Bin; Wang, Shanyong; Sloan, Scott William; Sheng, Daichao; Tang, Chun'an

2018-04-01

The unpredictable and instantaneous collapse behaviour of coastal rocky cliffs may cause damage that extends significantly beyond the area of failure. Gravitational movements that occur during coastal cliff recession involve two major stages: the small deformation stage and the large displacement stage. In this paper, a method of simulating the entire progressive failure process of coastal rocky cliffs is developed based on the gravity increase method (GIM), the rock failure process analysis method and the discontinuous deformation analysis method, and it is referred to as the GIM-DDD method. The small deformation stage, which includes crack initiation, propagation and coalescence processes, and the large displacement stage, which includes block translation and rotation processes during the rocky cliff collapse, are modelled using the GIM-DDD method. In addition, acoustic emissions, stress field variations, crack propagation and failure mode characteristics are further analysed to provide insights that can be used to predict, prevent and minimize potential economic losses and casualties. The calculation and analytical results are consistent with previous studies, which indicate that the developed method provides an effective and reliable approach for performing rocky cliff stability evaluations and coastal cliff recession analyses and has considerable potential for improving the safety and protection of seaside cliff areas.

Laser direct writing of micro- and nano-scale medical devices

PubMed Central

Gittard, Shaun D; Narayan, Roger J

2010-01-01

Laser-based direct writing of materials has undergone significant development in recent years. The ability to modify a variety of materials at small length scales and using short production times provides laser direct writing with unique capabilities for fabrication of medical devices. In many laser-based rapid prototyping methods, microscale and submicroscale structuring of materials is controlled by computer-generated models. Various laser-based direct write methods, including selective laser sintering/melting, laser machining, matrix-assisted pulsed-laser evaporation direct write, stereolithography and two-photon polymerization, are described. Their use in fabrication of microstructured and nanostructured medical devices is discussed. Laser direct writing may be used for processing a wide variety of advanced medical devices, including patient-specific prostheses, drug delivery devices, biosensors, stents and tissue-engineering scaffolds. PMID:20420557

Schedulers with load-store queue awareness

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Tong; Eichenberger, Alexandre E.; Jacob, Arpith C.

2017-02-07

In one embodiment, a computer-implemented method includes tracking a size of a load-store queue (LSQ) during compile time of a program. The size of the LSQ is time-varying and indicates how many memory access instructions of the program are on the LSQ. The method further includes scheduling, by a computer processor, a plurality of memory access instructions of the program based on the size of the LSQ.

Schedulers with load-store queue awareness

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Tong; Eichenberger, Alexandre E.; Jacob, Arpith C.

2017-01-24

In one embodiment, a computer-implemented method includes tracking a size of a load-store queue (LSQ) during compile time of a program. The size of the LSQ is time-varying and indicates how many memory access instructions of the program are on the LSQ. The method further includes scheduling, by a computer processor, a plurality of memory access instructions of the program based on the size of the LSQ.

Particle Swarm-Based Translation Control for Immersed Tunnel Element in the Hong Kong-Zhuhai-Macao Bridge Project

NASA Astrophysics Data System (ADS)

Li, Jun-jun; Yang, Xiao-jun; Xiao, Ying-jie; Xu, Bo-wei; Wu, Hua-feng

2018-03-01

Immersed tunnel is an important part of the Hong Kong-Zhuhai-Macao Bridge (HZMB) project. In immersed tunnel floating, translation which includes straight and transverse movements is the main working mode. To decide the magnitude and direction of the towing force for each tug, a particle swarm-based translation control method is presented for non-power immersed tunnel element. A sort of linear weighted logarithmic function is exploited to avoid weak subgoals. In simulation, the particle swarm-based control method is evaluated and compared with traditional empirical method in the case of the HZMB project. Simulation results show that the presented method delivers performance improvement in terms of the enhanced surplus towing force.

Advanced mass spectrometry-based methods for the analysis of conformational integrity of biopharmaceutical products

PubMed Central

Bobst, Cedric E.; Kaltashov, Igor A.

2012-01-01

Mass spectrometry has already become an indispensable tool in the analytical armamentarium of the biopharmaceutical industry, although its current uses are limited to characterization of covalent structure of recombinant protein drugs. However, the scope of applications of mass spectrometry-based methods is beginning to expand to include characterization of the higher order structure and dynamics of biopharmaceutical products, a development which is catalyzed by the recent progress in mass spectrometry-based methods to study higher order protein structure. The two particularly promising methods that are likely to have the most significant and lasting impact in many areas of biopharmaceutical analysis, direct ESI MS and hydrogen/deuterium exchange, are focus of this article. PMID:21542797

New Multigrid Method Including Elimination Algolithm Based on High-Order Vector Finite Elements in Three Dimensional Magnetostatic Field Analysis

NASA Astrophysics Data System (ADS)

Hano, Mitsuo; Hotta, Masashi

A new multigrid method based on high-order vector finite elements is proposed in this paper. Low level discretizations in this method are obtained by using low-order vector finite elements for the same mesh. Gauss-Seidel method is used as a smoother, and a linear equation of lowest level is solved by ICCG method. But it is often found that multigrid solutions do not converge into ICCG solutions. An elimination algolithm of constant term using a null space of the coefficient matrix is also described. In three dimensional magnetostatic field analysis, convergence time and number of iteration of this multigrid method are discussed with the convectional ICCG method.

QUALITY ASSESSMENT OF CONFOCAL MICROSCOPY SLIDE-BASED SYSTEMS: INSTABLITY

EPA Science Inventory

Background: All slide-based fluorescence cytometry detections systems basically include an excitation light source, intermediate optics, and a detection device (CCD or PMT). Occasionally, this equipment becomes unstable, generating unreliable and inferior data. Methods: A num...

Development of a speech autocuer

NASA Astrophysics Data System (ADS)

Bedles, R. L.; Kizakvich, P. N.; Lawson, D. T.; McCartney, M. L.

1980-12-01

A wearable, visually based prosthesis for the deaf based upon the proven method for removing lipreading ambiguity known as cued speech was fabricated and tested. Both software and hardware developments are described, including a microcomputer, display, and speech preprocessor.

Development of a speech autocuer

NASA Technical Reports Server (NTRS)

Bedles, R. L.; Kizakvich, P. N.; Lawson, D. T.; Mccartney, M. L.

1980-01-01

A wearable, visually based prosthesis for the deaf based upon the proven method for removing lipreading ambiguity known as cued speech was fabricated and tested. Both software and hardware developments are described, including a microcomputer, display, and speech preprocessor.

Multi-frame knowledge based text enhancement for mobile phone captured videos

NASA Astrophysics Data System (ADS)

Ozarslan, Suleyman; Eren, P. Erhan

2014-02-01

In this study, we explore automated text recognition and enhancement using mobile phone captured videos of store receipts. We propose a method which includes Optical Character Resolution (OCR) enhanced by our proposed Row Based Multiple Frame Integration (RB-MFI), and Knowledge Based Correction (KBC) algorithms. In this method, first, the trained OCR engine is used for recognition; then, the RB-MFI algorithm is applied to the output of the OCR. The RB-MFI algorithm determines and combines the most accurate rows of the text outputs extracted by using OCR from multiple frames of the video. After RB-MFI, KBC algorithm is applied to these rows to correct erroneous characters. Results of the experiments show that the proposed video-based approach which includes the RB-MFI and the KBC algorithm increases the word character recognition rate to 95%, and the character recognition rate to 98%.

Epitaxial growth of CZT(S,Se) on silicon

DOEpatents

Bojarczuk, Nestor A.; Gershon, Talia S.; Guha, Supratik; Shin, Byungha; Zhu, Yu

2016-03-15

Techniques for epitaxial growth of CZT(S,Se) materials on Si are provided. In one aspect, a method of forming an epitaxial kesterite material is provided which includes the steps of: selecting a Si substrate based on a crystallographic orientation of the Si substrate; forming an epitaxial oxide interlayer on the Si substrate to enhance wettability of the epitaxial kesterite material on the Si substrate, wherein the epitaxial oxide interlayer is formed from a material that is lattice-matched to Si; and forming the epitaxial kesterite material on a side of the epitaxial oxide interlayer opposite the Si substrate, wherein the epitaxial kesterite material includes Cu, Zn, Sn, and at least one of S and Se, and wherein a crystallographic orientation of the epitaxial kesterite material is based on the crystallographic orientation of the Si substrate. A method of forming an epitaxial kesterite-based photovoltaic device and an epitaxial kesterite-based device are also provided.

A diffusion tensor imaging tractography algorithm based on Navier-Stokes fluid mechanics.

PubMed

Hageman, Nathan S; Toga, Arthur W; Narr, Katherine L; Shattuck, David W

2009-03-01

We introduce a fluid mechanics based tractography method for estimating the most likely connection paths between points in diffusion tensor imaging (DTI) volumes. We customize the Navier-Stokes equations to include information from the diffusion tensor and simulate an artificial fluid flow through the DTI image volume. We then estimate the most likely connection paths between points in the DTI volume using a metric derived from the fluid velocity vector field. We validate our algorithm using digital DTI phantoms based on a helical shape. Our method segmented the structure of the phantom with less distortion than was produced using implementations of heat-based partial differential equation (PDE) and streamline based methods. In addition, our method was able to successfully segment divergent and crossing fiber geometries, closely following the ideal path through a digital helical phantom in the presence of multiple crossing tracts. To assess the performance of our algorithm on anatomical data, we applied our method to DTI volumes from normal human subjects. Our method produced paths that were consistent with both known anatomy and directionally encoded color images of the DTI dataset.

A Diffusion Tensor Imaging Tractography Algorithm Based on Navier-Stokes Fluid Mechanics

PubMed Central

Hageman, Nathan S.; Toga, Arthur W.; Narr, Katherine; Shattuck, David W.

2009-01-01

We introduce a fluid mechanics based tractography method for estimating the most likely connection paths between points in diffusion tensor imaging (DTI) volumes. We customize the Navier-Stokes equations to include information from the diffusion tensor and simulate an artificial fluid flow through the DTI image volume. We then estimate the most likely connection paths between points in the DTI volume using a metric derived from the fluid velocity vector field. We validate our algorithm using digital DTI phantoms based on a helical shape. Our method segmented the structure of the phantom with less distortion than was produced using implementations of heat-based partial differential equation (PDE) and streamline based methods. In addition, our method was able to successfully segment divergent and crossing fiber geometries, closely following the ideal path through a digital helical phantom in the presence of multiple crossing tracts. To assess the performance of our algorithm on anatomical data, we applied our method to DTI volumes from normal human subjects. Our method produced paths that were consistent with both known anatomy and directionally encoded color (DEC) images of the DTI dataset. PMID:19244007

Optimization to reduce fuel consumption in charge depleting mode

DOEpatents

Roos, Bryan Nathaniel; Martini, Ryan D.

2014-08-26

A powertrain includes an internal combustion engine, a motor utilizing electrical energy from an energy storage device, and a plug-in connection. A Method for controlling the powertrain includes monitoring a fuel cut mode, ceasing a fuel flow to the engine based upon the fuel cut mode, and through a period of operation including acceleration of the powertrain, providing an entirety of propelling torque to the powertrain with the electrical energy from the energy storage device based upon the fuel cut mode.

A Method for Establishing a Depreciated Monetary Value for Print Collections.

ERIC Educational Resources Information Center

Marman, Edward

1995-01-01

Outlines a method for establishing a depreciated value of a library collection and includes an example of applying the formula for calculating depreciation. The method is based on the useful life of books, other print, and audio visual materials; their original cost; and on sampling subsets or sections of the collection. (JKP)

Biologically Based Methods for Control of Fumonisin-Producing Fusarium Species and Reduction of the Fumonisins.

PubMed

Alberts, Johanna F; van Zyl, Willem H; Gelderblom, Wentzel C A

2016-01-01

Infection by the fumonisin-producing Fusarium spp. and subsequent fumonisin contamination of maize adversely affect international trade and economy with deleterious effects on human and animal health. In developed countries high standards of the major food suppliers and retailers are upheld and regulatory controls deter the importation and local marketing of fumonisin-contaminated food products. In developing countries regulatory measures are either lacking or poorly enforced, due to food insecurity, resulting in an increased mycotoxin exposure. The lack and poor accessibility of effective and environmentally safe control methods have led to an increased interest in practical and biological alternatives to reduce fumonisin intake. These include the application of natural resources, including plants, microbial cultures, genetic material thereof, or clay minerals pre- and post-harvest. Pre-harvest approaches include breeding for resistant maize cultivars, introduction of biocontrol microorganisms, application of phenolic plant extracts, and expression of antifungal proteins and fumonisin degrading enzymes in transgenic maize cultivars. Post-harvest approaches include the removal of fumonisins by natural clay adsorbents and enzymatic degradation of fumonisins through decarboxylation and deamination by recombinant carboxylesterase and aminotransferase enzymes. Although, the knowledge base on biological control methods has expanded, only a limited number of authorized decontamination products and methods are commercially available. As many studies detailed the use of natural compounds in vitro, concepts in reducing fumonisin contamination should be developed further for application in planta and in the field pre-harvest, post-harvest, and during storage and food-processing. In developed countries an integrated approach, involving good agricultural management practices, hazard analysis and critical control point (HACCP) production, and storage management, together with selected biologically based treatments, mild chemical and physical treatments could reduce fumonisin contamination effectively. In rural subsistence farming communities, simple, practical, and culturally acceptable hand-sorting, maize kernel washing, and dehulling intervention methods proved to be effective as a last line of defense for reducing fumonisin exposure. Biologically based methods for control of fumonisin-producing Fusarium spp. and decontamination of the fumonisins could have potential commercial application, while simple and practical intervention strategies could also impact positively on food safety and security, especially in rural populations reliant on maize as a dietary staple.

Device for hydrogen separation and method

DOEpatents

Paglieri, Stephen N [White Rock, NM; Anderson, Iver E [Ames, IA; Terpstra, Robert L [Ames, IA

2009-11-03

A device for hydrogen separation has a porous support and hydrogen separation material on the support. The support is prepared by heat treatment of metal microparticles, preferably of iron-based or nickel-based alloys that also include aluminum and/or yttrium. The hydrogen separation material is then deposited on the support. Preferred hydrogen separation materials include metals such as palladium, alloys, platinum, refractory metals, and alloys.

Array magnetics modal analysis for the DIII-D tokamak based on localized time-series modelling

DOE PAGES

Olofsson, K. Erik J.; Hanson, Jeremy M.; Shiraki, Daisuke; ...

2014-07-14

Here, time-series analysis of magnetics data in tokamaks is typically done using block-based fast Fourier transform methods. This work presents the development and deployment of a new set of algorithms for magnetic probe array analysis. The method is based on an estimation technique known as stochastic subspace identification (SSI). Compared with the standard coherence approach or the direct singular value decomposition approach, the new technique exhibits several beneficial properties. For example, the SSI method does not require that frequencies are orthogonal with respect to the timeframe used in the analysis. Frequencies are obtained directly as parameters of localized time-series models.more » The parameters are extracted by solving small-scale eigenvalue problems. Applications include maximum-likelihood regularized eigenmode pattern estimation, detection of neoclassical tearing modes, including locked mode precursors, and automatic clustering of modes, and magnetics-pattern characterization of sawtooth pre- and postcursors, edge harmonic oscillations and fishbones.« less

A Microcontroller-Based Device for Monitoring Blood Pressure in the Field

DTIC Science & Technology

1993-12-01

Service de sant6 des Forces armies canadiennes. On a mis au point un appareil de mesure des signes vitaux, qui peut mesurer la fr~quence cardiaque et...methods for taking systolic and diastolic pressure readings include the auscultation method, the oscillometric method, and the ultrasonic method...pressures are determined from its output, are the best ways of distinguishing between the three main methods previously listed. The auscultation method

Modelling of capillary-driven flow for closed paper-based microfluidic channels

NASA Astrophysics Data System (ADS)

Songok, Joel; Toivakka, Martti

2017-06-01

Paper-based microfluidics is an emerging field focused on creating inexpensive devices, with simple fabrication methods for applications in various fields including healthcare, environmental monitoring and veterinary medicine. Understanding the flow of liquid is important in achieving consistent operation of the devices. This paper proposes capillary models to predict flow in paper-based microfluidic channels, which include a flow accelerating hydrophobic top cover. The models, which consider both non-absorbing and absorbing substrates, are in good agreement with the experimental results.

Model-based Clustering of High-Dimensional Data in Astrophysics

NASA Astrophysics Data System (ADS)

Bouveyron, C.

2016-05-01

The nature of data in Astrophysics has changed, as in other scientific fields, in the past decades due to the increase of the measurement capabilities. As a consequence, data are nowadays frequently of high dimensionality and available in mass or stream. Model-based techniques for clustering are popular tools which are renowned for their probabilistic foundations and their flexibility. However, classical model-based techniques show a disappointing behavior in high-dimensional spaces which is mainly due to their dramatical over-parametrization. The recent developments in model-based classification overcome these drawbacks and allow to efficiently classify high-dimensional data, even in the "small n / large p" situation. This work presents a comprehensive review of these recent approaches, including regularization-based techniques, parsimonious modeling, subspace classification methods and classification methods based on variable selection. The use of these model-based methods is also illustrated on real-world classification problems in Astrophysics using R packages.

QUALITY ASSURANCE FOR PCR

EPA Science Inventory

The U.S. Environmental Protection Agency (EPA) held a workshop in January 2003 on the detection of viruses in water using polymerase chain reaction (PCR)-based methods. Speakers were asked to address a series of specific questions, including whether a single standard method coul...

Alkaline battery operational methodology

DOEpatents

Sholklapper, Tal; Gallaway, Joshua; Steingart, Daniel; Ingale, Nilesh; Nyce, Michael

2016-08-16

Methods of using specific operational charge and discharge parameters to extend the life of alkaline batteries are disclosed. The methods can be used with any commercial primary or secondary alkaline battery, as well as with newer alkaline battery designs, including batteries with flowing electrolyte. The methods include cycling batteries within a narrow operating voltage window, with minimum and maximum cut-off voltages that are set based on battery characteristics and environmental conditions. The narrow voltage window decreases available capacity but allows the batteries to be cycled for hundreds or thousands of times.

Scenario driven data modelling: a method for integrating diverse sources of data and data streams

DOEpatents

Brettin, Thomas S.; Cottingham, Robert W.; Griffith, Shelton D.; Quest, Daniel J.

2015-09-08

A system and method of integrating diverse sources of data and data streams is presented. The method can include selecting a scenario based on a topic, creating a multi-relational directed graph based on the scenario, identifying and converting resources in accordance with the scenario and updating the multi-directed graph based on the resources, identifying data feeds in accordance with the scenario and updating the multi-directed graph based on the data feeds, identifying analytical routines in accordance with the scenario and updating the multi-directed graph using the analytical routines and identifying data outputs in accordance with the scenario and defining queries to produce the data outputs from the multi-directed graph.

Friend suggestion in social network based on user log

NASA Astrophysics Data System (ADS)

Kaviya, R.; Vanitha, M.; Sumaiya Thaseen, I.; Mangaiyarkarasi, R.

2017-11-01

Simple friend recommendation algorithms such as similarity, popularity and social aspects is the basic requirement to be explored to methodically form high-performance social friend recommendation. Suggestion of friends is followed. No tags of character were followed. In the proposed system, we use an algorithm for network correlation-based social friend recommendation (NC-based SFR).It includes user activities like where one lives and works. A new friend recommendation method, based on network correlation, by considering the effect of different social roles. To model the correlation between different networks, we develop a method that aligns these networks through important feature selection. We consider by preserving the network structure for a more better recommendations so that it significantly improves the accuracy for better friend-recommendation.

Aircraft wing weight build-up methodology with modification for materials and construction techniques

NASA Technical Reports Server (NTRS)

York, P.; Labell, R. W.

1980-01-01

An aircraft wing weight estimating method based on a component buildup technique is described. A simplified analytically derived beam model, modified by a regression analysis, is used to estimate the wing box weight, utilizing a data base of 50 actual airplane wing weights. Factors representing materials and methods of construction were derived and incorporated into the basic wing box equations. Weight penalties to the wing box for fuel, engines, landing gear, stores and fold or pivot are also included. Methods for estimating the weight of additional items (secondary structure, control surfaces) have the option of using details available at the design stage (i.e., wing box area, flap area) or default values based on actual aircraft from the data base.

High-speed engine/component performance assessment using exergy and thrust-based methods

NASA Technical Reports Server (NTRS)

Riggins, D. W.

1996-01-01

This investigation summarizes a comparative study of two high-speed engine performance assessment techniques based on energy (available work) and thrust-potential (thrust availability). Simple flow-fields utilizing Rayleigh heat addition and one-dimensional flow with friction are used to demonstrate the fundamental inability of conventional energy techniques to predict engine component performance, aid in component design, or accurately assess flow losses. The use of the thrust-based method on these same examples demonstrates its ability to yield useful information in all these categories. Energy and thrust are related and discussed from the stand-point of their fundamental thermodynamic and fluid dynamic definitions in order to explain the differences in information obtained using the two methods. The conventional definition of energy is shown to include work which is inherently unavailable to an aerospace Brayton engine. An engine-based energy is then developed which accurately accounts for this inherently unavailable work; performance parameters based on this quantity are then shown to yield design and loss information equivalent to the thrust-based method.

Ordering of the O-O stretching vibrational frequencies in ozone

NASA Technical Reports Server (NTRS)

Scuseria, Gustavo E.; Lee, Timothy J.; Scheiner, Andrew C.; Schaefer, Henry F., III

1989-01-01

The ordering of nu1 and nu3 for O3 is incorrectly predicted by most theoretical methods, including some very high level methods. The first systematic electron correlation method based on one-reference configuration to solve this problem is the coupled cluster single and double excitation method. However, a relatively large basis set, triple zeta plus double polarization is required. Comparison with other theoretical methods is made.

Photogrammetric Modeling and Image-Based Rendering for Rapid Virtual Environment Creation

DTIC Science & Technology

2004-12-01

area and different methods have been proposed. Pertinent methods include: Camera Calibration , Structure from Motion, Stereo Correspondence, and Image...Based Rendering 1.1.1 Camera Calibration Determining the 3D structure of a model from multiple views becomes simpler if the intrinsic (or internal...can introduce significant nonlinearities into the image. We have found that camera calibration is a straightforward process which can simplify the

Computer Program for Thin Wire Antenna over a Perfectly Conducting Ground Plane. [using Galerkins method and sinusoidal bases

NASA Technical Reports Server (NTRS)

Richmond, J. H.

1974-01-01

A computer program is presented for a thin-wire antenna over a perfect ground plane. The analysis is performed in the frequency domain, and the exterior medium is free space. The antenna may have finite conductivity and lumped loads. The output data includes the current distribution, impedance, radiation efficiency, and gain. The program uses sinusoidal bases and Galerkin's method.

Methods for removing contaminant matter from a porous material

DOEpatents

Fox, Robert V [Idaho Falls, ID; Avci, Recep [Bozeman, MT; Groenewold, Gary S [Idaho Falls, ID

2010-11-16

Methods of removing contaminant matter from porous materials include applying a polymer material to a contaminated surface, irradiating the contaminated surface to cause redistribution of contaminant matter, and removing at least a portion of the polymer material from the surface. Systems for decontaminating a contaminated structure comprising porous material include a radiation device configured to emit electromagnetic radiation toward a surface of a structure, and at least one spray device configured to apply a capture material onto the surface of the structure. Polymer materials that can be used in such methods and systems include polyphosphazine-based polymer materials having polyphosphazine backbone segments and side chain groups that include selected functional groups. The selected functional groups may include iminos, oximes, carboxylates, sulfonates, .beta.-diketones, phosphine sulfides, phosphates, phosphites, phosphonates, phosphinates, phosphine oxides, monothio phosphinic acids, and dithio phosphinic acids.

Prognostic score–based balance measures for propensity score methods in comparative effectiveness research

PubMed Central

Stuart, Elizabeth A.; Lee, Brian K.; Leacy, Finbarr P.

2013-01-01

Objective Examining covariate balance is the prescribed method for determining when propensity score methods are successful at reducing bias. This study assessed the performance of various balance measures, including a proposed balance measure based on the prognostic score (also known as the disease-risk score), to determine which balance measures best correlate with bias in the treatment effect estimate. Study Design and Setting The correlations of multiple common balance measures with bias in the treatment effect estimate produced by weighting by the odds, subclassification on the propensity score, and full matching on the propensity score were calculated. Simulated data were used, based on realistic data settings. Settings included both continuous and binary covariates and continuous covariates only. Results The standardized mean difference in prognostic scores, the mean standardized mean difference, and the mean t-statistic all had high correlations with bias in the effect estimate. Overall, prognostic scores displayed the highest correlations of all the balance measures considered. Prognostic score measure performance was generally not affected by model misspecification and performed well under a variety of scenarios. Conclusion Researchers should consider using prognostic score–based balance measures for assessing the performance of propensity score methods for reducing bias in non-experimental studies. PMID:23849158

Taking risks with a growth mindset: long-term influence of an elementary pre-service after school science practicum

NASA Astrophysics Data System (ADS)

Cartwright, T. J.; Hallar, B.

2018-02-01

In this study, we present the long-term influence of an after school science practicum associated with an elementary science methods course. The practicum or field experience could be considered a community-based service learning programme as it is situated both within and for the community. Study participants included eight third- and fifth-grade teachers who had participated in elementary science methods courses; four of these teachers participated in the after school teaching practicum while four participants experienced a more traditional observation-based elementary science practicum. All of these teachers were in their second or third year teaching which was 3-4 years after taking the methods course. Investigation methods included questionnaires, field observations and semi-structured, individual interviews. Teachers more regularly utilised reform-based teaching strategies and cited the after school teaching practicum as preparing them to use these strategies in their own classrooms. All teachers exhibited a growth mindset to some degree, but the after school practicum participants did demonstrate a wider use of reformed-based teaching strategies and a higher growth mindset. Elementary teachers perceive risk associated with these key aspects of instruction: (1) managing instruction and classroom management, (2) teaching science through guided inquiry, and (3) overcoming adoptions in other 'mandated' curriculum like math and reading.

An improved method based on wavelet coefficient correlation to filter noise in Doppler ultrasound blood flow signals

NASA Astrophysics Data System (ADS)

Wan, Renzhi; Zu, Yunxiao; Shao, Lin

2018-04-01

The blood echo signal maintained through Medical ultrasound Doppler devices would always include vascular wall pulsation signal .The traditional method to de-noise wall signal is using high-pass filter, which will also remove the lowfrequency part of the blood flow signal. Some scholars put forward a method based on region selective reduction, which at first estimates of the wall pulsation signals and then removes the wall signal from the mixed signal. Apparently, this method uses the correlation between wavelet coefficients to distinguish blood signal from wall signal, but in fact it is a kind of wavelet threshold de-noising method, whose effect is not so much ideal. In order to maintain a better effect, this paper proposes an improved method based on wavelet coefficient correlation to separate blood signal and wall signal, and simulates the algorithm by computer to verify its validity.

Effect of Surveillance Method on Reported Characteristics of Lyme Disease, Connecticut, 1996–2007

PubMed Central

Nelson, Randall S.; Cartter, Matthew L.

2012-01-01

To determine the effect of changing public health surveillance methods on the reported epidemiology of Lyme disease, we analyzed Connecticut data for 1996–2007. Data were stratified by 4 surveillance methods and compared. A total of 87,174 reports were received that included 79,896 potential cases. Variations based on surveillance methods were seen. Cases reported through physician-based surveillance were significantly more likely to be classified as confirmed; such case-patients were significantly more likely to have symptoms of erythema migrans only and to have illness onset during summer months. Case-patients reported through laboratory-based surveillance were significantly more likely to have late manifestations only and to be older. Use of multiple surveillance methods provided a more complete clinical and demographic description of cases but lacked efficiency. When interpreting data, changes in surveillance method must be considered. PMID:22304873

Full extraction methods to retrieve effective refractive index and parameters of a bianisotropic metamaterial based on material dispersion models

NASA Astrophysics Data System (ADS)

Hsieh, Feng-Ju; Wang, Wei-Chih

2012-09-01

This paper discusses two improved methods in retrieving effective refractive indices, impedances, and material properties, such as permittivity (ɛ) and permeability (μ), of metamaterials. The first method modified from Kong's retrieval method allows effective constitutive parameters over all frequencies including the anti-resonant band, where imaginary parts of ɛ or μ are negative, to be solved. The second method is based on genetic algorithms and optimization of properly defined goal functions to retrieve parameters of the Drude and Lorentz dispersion models. Equations of effective refractive index and impedance at any reference planes are derived. Split ring resonator-rod based metamaterials operating in terahertz frequencies are designed and investigated with proposed methods. Retrieved material properties and parameters are used to regenerate S-parameters and compared with simulation results generated by cst microwave studio software.

Apparatus and method for controlling autotroph cultivation

DOEpatents

Fuxman, Adrian M; Tixier, Sebastien; Stewart, Gregory E; Haran, Frank M; Backstrom, Johan U; Gerbrandt, Kelsey

2013-07-02

A method includes receiving at least one measurement of a dissolved carbon dioxide concentration of a mixture of fluid containing an autotrophic organism. The method also includes determining an adjustment to one or more manipulated variables using the at least one measurement. The method further includes generating one or more signals to modify the one or more manipulated variables based on the determined adjustment. The one or more manipulated variables could include a carbon dioxide flow rate, an air flow rate, a water temperature, and an agitation level for the mixture. At least one model relates the dissolved carbon dioxide concentration to one or more manipulated variables, and the adjustment could be determined by using the at least one model to drive the dissolved carbon dioxide concentration to at least one target that optimize a goal function. The goal function could be to optimize biomass growth rate, nutrient removal and/or lipid production.

False alarm recognition in hyperspectral gas plume identification

DOEpatents

Conger, James L [San Ramon, CA; Lawson, Janice K [Tracy, CA; Aimonetti, William D [Livermore, CA

2011-03-29

According to one embodiment, a method for analyzing hyperspectral data includes collecting first hyperspectral data of a scene using a hyperspectral imager during a no-gas period and analyzing the first hyperspectral data using one or more gas plume detection logics. The gas plume detection logic is executed using a low detection threshold, and detects each occurrence of an observed hyperspectral signature. The method also includes generating a histogram for all occurrences of each observed hyperspectral signature which is detected using the gas plume detection logic, and determining a probability of false alarm (PFA) for all occurrences of each observed hyperspectral signature based on the histogram. Possibly at some other time, the method includes collecting second hyperspectral data, and analyzing the second hyperspectral data using the one or more gas plume detection logics and the PFA to determine if any gas is present. Other systems and methods are also included.

The Navigation Guide Systematic Review Methodology: A Rigorous and Transparent Method for Translating Environmental Health Science into Better Health Outcomes

PubMed Central

Sutton, Patrice

2014-01-01

Background: Synthesizing what is known about the environmental drivers of health is instrumental to taking prevention-oriented action. Methods of research synthesis commonly used in environmental health lag behind systematic review methods developed in the clinical sciences over the past 20 years. Objectives: We sought to develop a proof of concept of the “Navigation Guide,” a systematic and transparent method of research synthesis in environmental health. Discussion: The Navigation Guide methodology builds on best practices in research synthesis in evidence-based medicine and environmental health. Key points of departure from current methods of expert-based narrative review prevalent in environmental health include a prespecified protocol, standardized and transparent documentation including expert judgment, a comprehensive search strategy, assessment of “risk of bias,” and separation of the science from values and preferences. Key points of departure from evidence-based medicine include assigning a “moderate” quality rating to human observational studies and combining diverse evidence streams. Conclusions: The Navigation Guide methodology is a systematic and rigorous approach to research synthesis that has been developed to reduce bias and maximize transparency in the evaluation of environmental health information. Although novel aspects of the method will require further development and validation, our findings demonstrated that improved methods of research synthesis under development at the National Toxicology Program and under consideration by the U.S. Environmental Protection Agency are fully achievable. The institutionalization of robust methods of systematic and transparent review would provide a concrete mechanism for linking science to timely action to prevent harm. Citation: Woodruff TJ, Sutton P. 2014. The Navigation Guide systematic review methodology: a rigorous and transparent method for translating environmental health science into better health outcomes. Environ Health Perspect 122:1007–1014; http://dx.doi.org/10.1289/ehp.1307175 PMID:24968373

Incorporating Trauma-Informed Care into School-Based Programs

ERIC Educational Resources Information Center

Martin, Sandra L.; Ashley, Olivia Silber; White, LeBretia; Axelson, Sarah; Clark, Marc; Burrus, Barri

2017-01-01

Background: This article provides an overview of the rationale and process for incorporating trauma-informed approaches into US school-based programs, using school-based adolescent pregnancy prevention programs as an example. Methods: Research literature is reviewed on the prevalence and outcomes of childhood trauma, including the links between…

A Review of Research Ethics in Internet-Based Research

ERIC Educational Resources Information Center

Convery, Ian; Cox, Diane

2012-01-01

Internet-based research methods can include: online surveys, web page content analysis, videoconferencing for online focus groups and/or interviews, analysis of "e-conversations" through social networking sites, email, chat rooms, discussion boards and/or blogs. Over the last ten years, an upsurge in internet-based research (IBR) has led…

Vanadium based materials as electrode materials for high performance supercapacitors

NASA Astrophysics Data System (ADS)

Yan, Yan; Li, Bing; Guo, Wei; Pang, Huan; Xue, Huaiguo

2016-10-01

As a kind of supercapacitors, pseudocapacitors have attracted wide attention in recent years. The capacitance of the electrochemical capacitors based on pseudocapacitance arises mainly from redox reactions between electrolytes and active materials. These materials usually have several oxidation states for oxidation and reduction. Many research teams have focused on the development of an alternative material for electrochemical capacitors. Many transition metal oxides have been shown to be suitable as electrode materials of electrochemical capacitors. Among them, vanadium based materials are being developed for this purpose. Vanadium based materials are known as one of the best active materials for high power/energy density electrochemical capacitors due to its outstanding specific capacitance and long cycle life, high conductivity and good electrochemical reversibility. There are different kinds of synthetic methods such as sol-gel hydrothermal/solvothermal method, template method, electrospinning method, atomic layer deposition, and electrodeposition method that have been successfully applied to prepare vanadium based electrode materials. In our review, we give an overall summary and evaluation of the recent progress in the research of vanadium based materials for electrochemical capacitors that include synthesis methods, the electrochemical performances of the electrode materials and the devices.

Zirconium-based alloys, nuclear fuel rods and nuclear reactors including such alloys, and related methods

DOEpatents

Mariani, Robert Dominick

2014-09-09

Zirconium-based metal alloy compositions comprise zirconium, a first additive in which the permeability of hydrogen decreases with increasing temperatures at least over a temperature range extending from 350.degree. C. to 750.degree. C., and a second additive having a solubility in zirconium over the temperature range extending from 350.degree. C. to 750.degree. C. At least one of a solubility of the first additive in the second additive over the temperature range extending from 350.degree. C. to 750.degree. C. and a solubility of the second additive in the first additive over the temperature range extending from 350.degree. C. to 750.degree. C. is higher than the solubility of the second additive in zirconium over the temperature range extending from 350.degree. C. to 750.degree. C. Nuclear fuel rods include a cladding material comprising such metal alloy compositions, and nuclear reactors include such fuel rods. Methods are used to fabricate such zirconium-based metal alloy compositions.

Membranes, methods of making membranes, and methods of separating gases using membranes

DOEpatents

Ho, W. S. Winston

2012-10-02

Membranes, methods of making membranes, and methods of separating gases using membranes are provided. The membranes can include at least one hydrophilic polymer, at least one cross-linking agent, at least one base, and at least one amino compound. The methods of separating gases using membranes can include contacting a gas stream containing at least one of CO.sub.2, H.sub.2S, and HCl with one side of a nonporous and at least one of CO.sub.2, H.sub.2S, and HCl selectively permeable membrane such that at least one of CO.sub.2, H.sub.2S, and HCl is selectively transported through the membrane.

Assessing artificial neural networks and statistical methods for infilling missing soil moisture records

NASA Astrophysics Data System (ADS)

Dumedah, Gift; Walker, Jeffrey P.; Chik, Li

2014-07-01

Soil moisture information is critically important for water management operations including flood forecasting, drought monitoring, and groundwater recharge estimation. While an accurate and continuous record of soil moisture is required for these applications, the available soil moisture data, in practice, is typically fraught with missing values. There are a wide range of methods available to infilling hydrologic variables, but a thorough inter-comparison between statistical methods and artificial neural networks has not been made. This study examines 5 statistical methods including monthly averages, weighted Pearson correlation coefficient, a method based on temporal stability of soil moisture, and a weighted merging of the three methods, together with a method based on the concept of rough sets. Additionally, 9 artificial neural networks are examined, broadly categorized into feedforward, dynamic, and radial basis networks. These 14 infilling methods were used to estimate missing soil moisture records and subsequently validated against known values for 13 soil moisture monitoring stations for three different soil layer depths in the Yanco region in southeast Australia. The evaluation results show that the top three highest performing methods are the nonlinear autoregressive neural network, rough sets method, and monthly replacement. A high estimation accuracy (root mean square error (RMSE) of about 0.03 m/m) was found in the nonlinear autoregressive network, due to its regression based dynamic network which allows feedback connections through discrete-time estimation. An equally high accuracy (0.05 m/m RMSE) in the rough sets procedure illustrates the important role of temporal persistence of soil moisture, with the capability to account for different soil moisture conditions.

Calculation of acoustic field based on laser-measured vibration velocities on ultrasonic transducer surface

NASA Astrophysics Data System (ADS)

Hu, Liang; Zhao, Nannan; Gao, Zhijian; Mao, Kai; Chen, Wenyu; Fu, Xin

2018-05-01

Determination of the distribution of a generated acoustic field is valuable for studying ultrasonic transducers, including providing the guidance for transducer design and the basis for analyzing their performance, etc. A method calculating the acoustic field based on laser-measured vibration velocities on the ultrasonic transducer surface is proposed in this paper. Without knowing the inner structure of the transducer, the acoustic field outside it can be calculated by solving the governing partial differential equation (PDE) of the field based on the specified boundary conditions (BCs). In our study, the BC on the transducer surface, i.e. the distribution of the vibration velocity on the surface, is accurately determined by laser scanning measurement of discrete points and follows a data fitting computation. In addition, to ensure the calculation accuracy for the whole field even in an inhomogeneous medium, a finite element method is used to solve the governing PDE based on the mixed BCs, including the discretely measured velocity data and other specified BCs. The method is firstly validated on numerical piezoelectric transducer models. The acoustic pressure distributions generated by a transducer operating in an homogeneous and inhomogeneous medium, respectively, are both calculated by the proposed method and compared with the results from other existing methods. Then, the method is further experimentally validated with two actual ultrasonic transducers used for flow measurement in our lab. The amplitude change of the output voltage signal from the receiver transducer due to changing the relative position of the two transducers is calculated by the proposed method and compared with the experimental data. This method can also provide the basis for complex multi-physical coupling computations where the effect of the acoustic field should be taken into account.

Nonlinear dynamics based digital logic and circuits.

PubMed

Kia, Behnam; Lindner, John F; Ditto, William L

2015-01-01

We discuss the role and importance of dynamics in the brain and biological neural networks and argue that dynamics is one of the main missing elements in conventional Boolean logic and circuits. We summarize a simple dynamics based computing method, and categorize different techniques that we have introduced to realize logic, functionality, and programmability. We discuss the role and importance of coupled dynamics in networks of biological excitable cells, and then review our simple coupled dynamics based method for computing. In this paper, for the first time, we show how dynamics can be used and programmed to implement computation in any given base, including but not limited to base two.

[Molecular typing methods for Pasteurella multocida-A review].

PubMed

Peng, Zhong; Liang, Wan; Wu, Bin

2016-10-04

Pasteurella multocida is an important gram-negative pathogenic bacterium that could infect wide ranges of animals. Humans could also be infected by P. multocida via animal bite or scratching. Current typing methods for P. multocida include serological typing methods and molecular typing methods. Of them, serological typing methods are based on immunological assays, which are too complicated for clinical bacteriological studies. However, the molecular methods including multiple PCRs and multilocus sequence typing (MLST) methods are more suitable for bacteriological studies of P. multocida in clinic, with their simple operation, high efficiency and accurate detection compared to the traditional serological typing methods, they are therefore widely used. In the current review, we briefly describe the molecular typing methods for P. multocida. Our aim is to provide a knowledge-foundation for clinical bacteriological investigation especially the molecular investigation for P. multocida.

WATERSHED AND OTHER PLACE-BASED RISK ASSESSMENTS

EPA Science Inventory

Place-based assessments include regional, watershed and other geographically focused assessments.

Watershed Assessments and Methods

Estimation of Comfort/Disconfort Based on EEG in Massage by Use of Clustering according to Correration and Incremental Learning type NN

NASA Astrophysics Data System (ADS)

Teramae, Tatsuya; Kushida, Daisuke; Takemori, Fumiaki; Kitamura, Akira

Authors proposed the estimation method combining k-means algorithm and NN for evaluating massage. However, this estimation method has a problem that discrimination ratio is decreased to new user. There are two causes of this problem. One is that generalization of NN is bad. Another one is that clustering result by k-means algorithm has not high correlation coefficient in a class. Then, this research proposes k-means algorithm according to correlation coefficient and incremental learning for NN. The proposed k-means algorithm is method included evaluation function based on correlation coefficient. Incremental learning is method that NN is learned by new data and initialized weight based on the existing data. The effect of proposed methods are verified by estimation result using EEG data when testee is given massage.

Laser-based standoff detection of explosives: a critical review.

PubMed

Wallin, Sara; Pettersson, Anna; Ostmark, Henric; Hobro, Alison

2009-09-01

A review of standoff detection technologies for explosives has been made. The review is focused on trace detection methods (methods aiming to detect traces from handling explosives or the vapours surrounding an explosive charge due to the vapour pressure of the explosive) rather than bulk detection methods (methods aiming to detect the bulk explosive charge). The requirements for standoff detection technologies are discussed. The technologies discussed are mostly laser-based trace detection technologies, such as laser-induced-breakdown spectroscopy, Raman spectroscopy, laser-induced-fluorescence spectroscopy and IR spectroscopy but the bulk detection technologies millimetre wave imaging and terahertz spectroscopy are also discussed as a complement to the laser-based methods. The review includes novel techniques, not yet tested in realistic environments, more mature technologies which have been tested outdoors in realistic environments as well as the most mature millimetre wave imaging technique.

Palladium and platinum-based nanoparticle functional sensor layers for selective H2 sensing

DOEpatents

Ohodnicki, Jr., Paul R.; Baltrus, John P.; Brown, Thomas D.

2017-07-04

The disclosure relates to a plasmon resonance-based method for H.sub.2 sensing in a gas stream utilizing a hydrogen sensing material. The hydrogen sensing material is comprises Pd-based or Pt-based nanoparticles having an average nanoparticle diameter of less than about 100 nanometers dispersed in an inert matrix having a bandgap greater than or equal to 5 eV, and an oxygen ion conductivity less than approximately 10.sup.-7 S/cm at a temperature of 700.degree. C. Exemplary inert matrix materials include SiO.sub.2, Al.sub.2O.sub.3, and Si.sub.3N.sub.4 as well as modifications to modify the effective refractive indices through combinations and/or doping of such materials. The hydrogen sensing material utilized in the method of this disclosure may be prepared using means known in the art for the production of nanoparticles dispersed within a supporting matrix including sol-gel based wet chemistry techniques, impregnation techniques, implantation techniques, sputtering techniques, and others.

Semiautomatic segmentation of the heart from CT images based on intensity and morphological features

NASA Astrophysics Data System (ADS)

Redwood, Abena B.; Camp, Jon J.; Robb, Richard A.

2005-04-01

The incidence of certain types of cardiac arrhythmias is increasing. Effective, minimally invasive treatment has remained elusive. Pharmacologic treatment has been limited by drug intolerance and recurrence of disease. Catheter based ablation has been moderately successful in treating certain types of cardiac arrhythmias, including typical atrial flutter and fibrillation, but there remains a relatively high rate of recurrence. Additional side effects associated with cardiac ablation procedures include stroke, perivascular lung damage, and skin burns caused by x-ray fluoroscopy. Access to patient specific 3-D cardiac images has potential to significantly improve the process of cardiac ablation by providing the physician with a volume visualization of the heart. This would facilitate more effective guidance of the catheter, increase the accuracy of the ablative process, and eliminate or minimize the damage to surrounding tissue. In this study, a semiautomatic method for faithful cardiac segmentation was investigated using Analyze - a comprehensive processing software package developed at the Biomedical Imaging Resource, Mayo Clinic. This method included use of interactive segmentation based on math morphology and separation of the chambers based on morphological connections. The external surfaces of the hearts were readily segmented, while accurate separation of individual chambers was a challenge. Nonetheless, a skilled operator could manage the task in a few minutes. Useful improvements suggested in this paper would give this method a promising future.

Reliability-based trajectory optimization using nonintrusive polynomial chaos for Mars entry mission

NASA Astrophysics Data System (ADS)

Huang, Yuechen; Li, Haiyang

2018-06-01

This paper presents the reliability-based sequential optimization (RBSO) method to settle the trajectory optimization problem with parametric uncertainties in entry dynamics for Mars entry mission. First, the deterministic entry trajectory optimization model is reviewed, and then the reliability-based optimization model is formulated. In addition, the modified sequential optimization method, in which the nonintrusive polynomial chaos expansion (PCE) method and the most probable point (MPP) searching method are employed, is proposed to solve the reliability-based optimization problem efficiently. The nonintrusive PCE method contributes to the transformation between the stochastic optimization (SO) and the deterministic optimization (DO) and to the approximation of trajectory solution efficiently. The MPP method, which is used for assessing the reliability of constraints satisfaction only up to the necessary level, is employed to further improve the computational efficiency. The cycle including SO, reliability assessment and constraints update is repeated in the RBSO until the reliability requirements of constraints satisfaction are satisfied. Finally, the RBSO is compared with the traditional DO and the traditional sequential optimization based on Monte Carlo (MC) simulation in a specific Mars entry mission to demonstrate the effectiveness and the efficiency of the proposed method.

Continental-Scale Validation of Modis-Based and LEDAPS Landsat ETM + Atmospheric Correction Methods

NASA Technical Reports Server (NTRS)

Ju, Junchang; Roy, David P.; Vermote, Eric; Masek, Jeffrey; Kovalskyy, Valeriy

2012-01-01

The potential of Landsat data processing to provide systematic continental scale products has been demonstratedby several projects including the NASA Web-enabled Landsat Data (WELD) project. The recent freeavailability of Landsat data increases the need for robust and efficient atmospheric correction algorithms applicableto large volume Landsat data sets. This paper compares the accuracy of two Landsat atmospheric correctionmethods: a MODIS-based method and the Landsat Ecosystem Disturbance Adaptive ProcessingSystem (LEDAPS) method. Both methods are based on the 6SV radiative transfer code but have different atmosphericcharacterization approaches. The MODIS-based method uses the MODIS Terra derived dynamicaerosol type, aerosol optical thickness, and water vapor to atmospherically correct ETM+ acquisitions ineach coincident orbit. The LEDAPS method uses aerosol characterizations derived independently from eachLandsat acquisition and assumes a fixed continental aerosol type and uses ancillary water vapor. Validationresults are presented comparing ETM+ atmospherically corrected data generated using these two methodswith AERONET corrected ETM+ data for 95 10 km10 km 30 m subsets, a total of nearly 8 million 30 mpixels, located across the conterminous United States. The results indicate that the MODIS-based methodhas better accuracy than the LEDAPS method for the ETM+ red and longer wavelength bands.

Methods of developing core collections based on the predicted genotypic value of rice ( Oryza sativa L.).

PubMed

Li, C T; Shi, C H; Wu, J G; Xu, H M; Zhang, H Z; Ren, Y L

2004-04-01

The selection of an appropriate sampling strategy and a clustering method is important in the construction of core collections based on predicted genotypic values in order to retain the greatest degree of genetic diversity of the initial collection. In this study, methods of developing rice core collections were evaluated based on the predicted genotypic values for 992 rice varieties with 13 quantitative traits. The genotypic values of the traits were predicted by the adjusted unbiased prediction (AUP) method. Based on the predicted genotypic values, Mahalanobis distances were calculated and employed to measure the genetic similarities among the rice varieties. Six hierarchical clustering methods, including the single linkage, median linkage, centroid, unweighted pair-group average, weighted pair-group average and flexible-beta methods, were combined with random, preferred and deviation sampling to develop 18 core collections of rice germplasm. The results show that the deviation sampling strategy in combination with the unweighted pair-group average method of hierarchical clustering retains the greatest degree of genetic diversities of the initial collection. The core collections sampled using predicted genotypic values had more genetic diversity than those based on phenotypic values.

Active treatments for amblyopia: a review of the methods and evidence base.

PubMed

Suttle, Catherine M

2010-09-01

Treatment for amblyopia commonly involves passive methods such as occlusion of the non-amblyopic eye. An evidence base for these methods is provided by animal models of visual deprivation and plasticity in early life and randomised controlled studies in humans with amblyopia. Other treatments of amblyopia, intended to be used instead of or in conjunction with passive methods, are known as 'active' because they require some activity on the part of the patient. Active methods are intended to enhance treatment of amblyopia in a number of ways, including increased compliance and attention during the treatment periods (due to activities that are interesting for the patient) and the use of stimuli designed to activate and to encourage connectivity between certain cortical cell types. Active methods of amblyopia treatment are widely available and are discussed to some extent in the literature, but in many cases the evidence base is unclear, and effectiveness has not been thoroughly tested. This review looks at the techniques and evidence base for a range of these methods and discusses the need for an evidence-based approach to the acceptance and use of active amblyopia treatments.

A fast button surface defects detection method based on convolutional neural network

NASA Astrophysics Data System (ADS)

Liu, Lizhe; Cao, Danhua; Wu, Songlin; Wu, Yubin; Wei, Taoran

2018-01-01

Considering the complexity of the button surface texture and the variety of buttons and defects, we propose a fast visual method for button surface defect detection, based on convolutional neural network (CNN). CNN has the ability to extract the essential features by training, avoiding designing complex feature operators adapted to different kinds of buttons, textures and defects. Firstly, we obtain the normalized button region and then use HOG-SVM method to identify the front and back side of the button. Finally, a convolutional neural network is developed to recognize the defects. Aiming at detecting the subtle defects, we propose a network structure with multiple feature channels input. To deal with the defects of different scales, we take a strategy of multi-scale image block detection. The experimental results show that our method is valid for a variety of buttons and able to recognize all kinds of defects that have occurred, including dent, crack, stain, hole, wrong paint and uneven. The detection rate exceeds 96%, which is much better than traditional methods based on SVM and methods based on template match. Our method can reach the speed of 5 fps on DSP based smart camera with 600 MHz frequency.

Control system health test system and method

DOEpatents

Hoff, Brian D.; Johnson, Kris W.; Akasam, Sivaprasad; Baker, Thomas M.

2006-08-15

A method is provided for testing multiple elements of a work machine, including a control system, a component, a sub-component that is influenced by operations of the component, and a sensor that monitors a characteristic of the sub-component. In one embodiment, the method is performed by the control system and includes sending a command to the component to adjust a first parameter associated with an operation of the component. Also, the method includes detecting a sensor signal from the sensor reflecting a second parameter associated with a characteristic of the sub-component and determining whether the second parameter is acceptable based on the command. The control system may diagnose at least one of the elements of the work machine when the second parameter of the sub-component is not acceptable.

Position Papers for the First Workshop on Principles and Practice of Constraint Programming Held in Newport, Rhode Island on April 28-30, 1993

DTIC Science & Technology

1993-04-30

There are alternative methods to MBB’s, based on decomposition of space into disjoint cells. These include uniform grid method [Fr84], quadtree-based...space. The IIn grid and quadtree methods there is a trade off between the resolution of the cells (and thus quantity of the cells) and the effectiveness...Mathematics, 13, pp. 221-229, 1983. 9 IFr84] W.R. Franklin, Adaptive grids for geometric operations, Cartographica 21, 2 g 3, pp. 160-167, 1984. (Gun87

Systems and Methods for Implementing Robust Carbon Nanotube-Based Field Emitters

NASA Technical Reports Server (NTRS)

Kristof, Valerie (Inventor); Manohara, Harish (Inventor); Toda, Risaku (Inventor)

2015-01-01

Systems and methods in accordance with embodiments of the invention implement carbon nanotube-based field emitters. In one embodiment, a method of fabricating a carbon nanotube field emitter includes: patterning a substrate with a catalyst, where the substrate has thereon disposed a diffusion barrier layer; growing a plurality of carbon nanotubes on at least a portion of the patterned catalyst; and heating the substrate to an extent where it begins to soften such that at least a portion of at least one carbon nanotube becomes enveloped by the softened substrate.

A Novel Secure IoT-Based Smart Home Automation System Using a Wireless Sensor Network.

PubMed

Pirbhulal, Sandeep; Zhang, Heye; E Alahi, Md Eshrat; Ghayvat, Hemant; Mukhopadhyay, Subhas Chandra; Zhang, Yuan-Ting; Wu, Wanqing

2016-12-30

Wireless sensor networks (WSNs) provide noteworthy benefits over traditional approaches for several applications, including smart homes, healthcare, environmental monitoring, and homeland security. WSNs are integrated with the Internet Protocol (IP) to develop the Internet of Things (IoT) for connecting everyday life objects to the internet. Hence, major challenges of WSNs include: (i) how to efficiently utilize small size and low-power nodes to implement security during data transmission among several sensor nodes; (ii) how to resolve security issues associated with the harsh and complex environmental conditions during data transmission over a long coverage range. In this study, a secure IoT-based smart home automation system was developed. To facilitate energy-efficient data encryption, a method namely Triangle Based Security Algorithm (TBSA) based on efficient key generation mechanism was proposed. The proposed TBSA in integration of the low power Wi-Fi were included in WSNs with the Internet to develop a novel IoT-based smart home which could provide secure data transmission among several associated sensor nodes in the network over a long converge range. The developed IoT based system has outstanding performance by fulfilling all the necessary security requirements. The experimental results showed that the proposed TBSA algorithm consumed less energy in comparison with some existing methods.

A Novel Secure IoT-Based Smart Home Automation System Using a Wireless Sensor Network

PubMed Central

Pirbhulal, Sandeep; Zhang, Heye; E Alahi, Md Eshrat; Ghayvat, Hemant; Mukhopadhyay, Subhas Chandra; Zhang, Yuan-Ting; Wu, Wanqing

2016-01-01

Wireless sensor networks (WSNs) provide noteworthy benefits over traditional approaches for several applications, including smart homes, healthcare, environmental monitoring, and homeland security. WSNs are integrated with the Internet Protocol (IP) to develop the Internet of Things (IoT) for connecting everyday life objects to the internet. Hence, major challenges of WSNs include: (i) how to efficiently utilize small size and low-power nodes to implement security during data transmission among several sensor nodes; (ii) how to resolve security issues associated with the harsh and complex environmental conditions during data transmission over a long coverage range. In this study, a secure IoT-based smart home automation system was developed. To facilitate energy-efficient data encryption, a method namely Triangle Based Security Algorithm (TBSA) based on efficient key generation mechanism was proposed. The proposed TBSA in integration of the low power Wi-Fi were included in WSNs with the Internet to develop a novel IoT-based smart home which could provide secure data transmission among several associated sensor nodes in the network over a long converge range. The developed IoT based system has outstanding performance by fulfilling all the necessary security requirements. The experimental results showed that the proposed TBSA algorithm consumed less energy in comparison with some existing methods. PMID:28042831

Method for analyzing the chemical composition of liquid effluent from a direct contact condenser

DOEpatents

Bharathan, Desikan; Parent, Yves; Hassani, A. Vahab

2001-01-01

A computational modeling method for predicting the chemical, physical, and thermodynamic performance of a condenser using calculations based on equations of physics for heat, momentum and mass transfer and equations of equilibrium thermodynamics to determine steady state profiles of parameters throughout the condenser. The method includes providing a set of input values relating to a condenser including liquid loading, vapor loading, and geometric characteristics of the contact medium in the condenser. The geometric and packing characteristics of the contact medium include the dimensions and orientation of a channel in the contact medium. The method further includes simulating performance of the condenser using the set of input values to determine a related set of output values such as outlet liquid temperature, outlet flow rates, pressures, and the concentration(s) of one or more dissolved noncondensable gas species in the outlet liquid. The method may also include iteratively performing the above computation steps using a plurality of sets of input values and then determining whether each of the resulting output values and performance profiles satisfies acceptance criteria.

Enabling skin vaccination using new delivery technologies

PubMed Central

Kim, Yeu-Chun; Prausnitz, Mark R.

2011-01-01

The skin is known to be a highly immunogenic site for vaccination, but few vaccines in clinical use target skin largely because conventional intradermal injection is difficult and unreliable to perform. Now, a number of new or newly adapted delivery technologies have been shown to administer vaccine to the skin either by non-invasive or minimally invasive methods. Non-invasive methods include high-velocity powder and liquid jet injection, as well as diffusion-based patches in combination with skin abrasion, thermal ablation, ultrasound, electroporation, and chemical enhancers. Minimally invasive methods are generally based on small needles, including solid microneedle patches, hollow microneedle injections, and tattoo guns. The introduction of these advanced delivery technologies can make the skin a site for simple, reliable vaccination that increases vaccine immunogenicity and offers logistical advantages to improve the speed and coverage of vaccination. PMID:21799951

Enabling skin vaccination using new delivery technologies

PubMed Central

Kim, Yeu-Chun; Prausnitz, Mark R.

2011-01-01

The skin is known to be a highly immunogenic site for vaccination, but few vaccines in clinical use target skin largely because conventional intradermal injection is difficult and unreliable to perform. Now, a number of new or newly adapted delivery technologies have been shown to administer vaccine to the skin either by non-invasive or minimally invasive methods. Non-invasive methods include high-velocity powder and liquid jet injection, as well as diffusion-based patches in combination with skin abrasion, thermal ablation, ultrasound, electroporation, and chemical enhancers. Minimally invasive methods are generally based on small needles, including solid microneedle patches, hollow microneedle injections and tattoo guns. The introduction of these advanced delivery technologies can make the skin a site for simple, reliable vaccination that increases vaccine immunogenicity and offers logistical advantages to improve the speed and coverage of vaccination. PMID:21472533

System and method for generating a deselect mapping for a focal plane array

DOEpatents

Bixler, Jay V; Brandt, Timothy G; Conger, James L; Lawson, Janice K

2013-05-21

A method for generating a deselect mapping for a focal plane array according to one embodiment includes gathering a data set for a focal plane array when exposed to light or radiation from a first known target; analyzing the data set for determining which pixels or subpixels of the focal plane array to add to a deselect mapping; adding the pixels or subpixels to the deselect mapping based on the analysis; and storing the deselect mapping. A method for gathering data using a focal plane array according to another embodiment includes deselecting pixels or subpixels based on a deselect mapping; gathering a data set using pixels or subpixels in a focal plane array that are not deselected upon exposure thereof to light or radiation from a target of interest; and outputting the data set.

Fully automatic assignment of small molecules' NMR spectra without relying on chemical shift predictions.

PubMed

Castillo, Andrés M; Bernal, Andrés; Patiny, Luc; Wist, Julien

2015-08-01

We present a method for the automatic assignment of small molecules' NMR spectra. The method includes an automatic and novel self-consistent peak-picking routine that validates NMR peaks in each spectrum against peaks in the same or other spectra that are due to the same resonances. The auto-assignment routine used is based on branch-and-bound optimization and relies predominantly on integration and correlation data; chemical shift information may be included when available to fasten the search and shorten the list of viable assignments, but in most cases tested, it is not required in order to find the correct assignment. This automatic assignment method is implemented as a web-based tool that runs without any user input other than the acquired spectra. Copyright © 2015 John Wiley & Sons, Ltd.

Surface and allied studies in silicon solar cells

NASA Technical Reports Server (NTRS)

Lindholm, F. A.

1984-01-01

Significant improvements were made in the short-circuit current-decay method of measuring the recombination lifetime tau and the back surface recombination velocity S of the quasineutral base of silicon solar cells. The improvements include a circuit implementation that increases the speed of switching from the forward-voltage to the short-circuit conditions. They also include a supplementation of this method by some newly developed techniques employing small-signal admittance as a function of frequency omega. This supplementation is highly effective for determining tau for cases in which the diffusion length L greatly exceeds the base thickness W. Representative results on different solar cells are reported. Some advances made in the understanding of passivation provided by the polysilicon/silicon heterojunction are outlined. Recent measurements demonstrate that S 10,000 cm/s derive from this method of passivation.

The NASA/Industry Design Analysis Methods for Vibrations (DAMVIBS) Program - A government overview. [of rotorcraft technology development using finite element method

NASA Technical Reports Server (NTRS)

Kvaternik, Raymond G.

1992-01-01

An overview is presented of government contributions to the program called Design Analysis Methods for Vibrations (DAMV) which attempted to develop finite-element-based analyses of rotorcraft vibrations. NASA initiated the program with a finite-element modeling program for the CH-47D tandem-rotor helicopter. The DAMV program emphasized four areas including: airframe finite-element modeling, difficult components studies, coupled rotor-airframe vibrations, and airframe structural optimization. Key accomplishments of the program include industrywide standards for modeling metal and composite airframes, improved industrial designs for vibrations, and the identification of critical structural contributors to airframe vibratory responses. The program also demonstrated the value of incorporating secondary modeling details to improving correlation, and the findings provide the basis for an improved finite-element-based dynamics design-analysis capability.

Approximate error conjugation gradient minimization methods

DOEpatents

Kallman, Jeffrey S

2013-05-21

In one embodiment, a method includes selecting a subset of rays from a set of all rays to use in an error calculation for a constrained conjugate gradient minimization problem, calculating an approximate error using the subset of rays, and calculating a minimum in a conjugate gradient direction based on the approximate error. In another embodiment, a system includes a processor for executing logic, logic for selecting a subset of rays from a set of all rays to use in an error calculation for a constrained conjugate gradient minimization problem, logic for calculating an approximate error using the subset of rays, and logic for calculating a minimum in a conjugate gradient direction based on the approximate error. In other embodiments, computer program products, methods, and systems are described capable of using approximate error in constrained conjugate gradient minimization problems.

System and method for deriving a process-based specification

NASA Technical Reports Server (NTRS)

Hinchey, Michael Gerard (Inventor); Rouff, Christopher A. (Inventor); Rash, James Larry (Inventor)

2009-01-01

A system and method for deriving a process-based specification for a system is disclosed. The process-based specification is mathematically inferred from a trace-based specification. The trace-based specification is derived from a non-empty set of traces or natural language scenarios. The process-based specification is mathematically equivalent to the trace-based specification. Code is generated, if applicable, from the process-based specification. A process, or phases of a process, using the features disclosed can be reversed and repeated to allow for an interactive development and modification of legacy systems. The process is applicable to any class of system, including, but not limited to, biological and physical systems, electrical and electro-mechanical systems in addition to software, hardware and hybrid hardware-software systems.

Chemometrics-enhanced high performance liquid chromatography-diode array detection strategy for simultaneous determination of eight co-eluted compounds in ten kinds of Chinese teas using second-order calibration method based on alternating trilinear decomposition algorithm.

PubMed

Yin, Xiao-Li; Wu, Hai-Long; Gu, Hui-Wen; Zhang, Xiao-Hua; Sun, Yan-Mei; Hu, Yong; Liu, Lu; Rong, Qi-Ming; Yu, Ru-Qin

2014-10-17

In this work, an attractive chemometrics-enhanced high performance liquid chromatography-diode array detection (HPLC-DAD) strategy was proposed for simultaneous and fast determination of eight co-eluted compounds including gallic acid, caffeine and six catechins in ten kinds of Chinese teas by using second-order calibration method based on alternating trilinear decomposition (ATLD) algorithm. This new strategy proved to be a useful tool for handling the co-eluted peaks, uncalibrated interferences and baseline drifts existing in the process of chromatographic separation, which benefited from the "second-order advantages", making the determination of gallic acid, caffeine and six catechins in tea infusions within 8 min under a simple mobile phase condition. The average recoveries of the analytes on two selected tea samples ranged from 91.7 to 103.1% with standard deviations (SD) ranged from 1.9 to 11.9%. Figures of merit including sensitivity (SEN), selectivity (SEL), root-mean-square error of prediction (RMSEP) and limit of detection (LOD) have been calculated to validate the accuracy of the proposed method. To further confirm the reliability of the method, a multiple reaction monitoring (MRM) method based on LC-MS/MS was employed for comparison and the obtained results of both methods were consistent with each other. Furthermore, as a universal strategy, this new proposed analytical method was applied for the determination of gallic acid, caffeine and catechins in several other kinds of Chinese teas, including different levels and varieties. Finally, based on the quantitative results, principal component analysis (PCA) was used to conduct a cluster analysis for these Chinese teas. The green tea, Oolong tea and Pu-erh raw tea samples were classified successfully. All results demonstrated that the proposed method is accurate, sensitive, fast, universal and ideal for the rapid, routine analysis and discrimination of gallic acid, caffeine and catechins in Chinese tea samples. Copyright © 2014 Elsevier B.V. All rights reserved.

Epidemiology of diabetic retinopathy and maculopathy in Africa: a systematic review

PubMed Central

Burgess, P I; MacCormick, I J C; Harding, S P; Bastawrous, A; Beare, N A V; Garner, P

2013-01-01

Abstract Aim To summarize findings from studies reporting the prevalence and incidence of diabetic retinopathy and diabetic maculopathy in African countries in light of the rising prevalence of diabetes mellitus. Methods Using a predefined search strategy, we systematically searched MEDLINE, EMBASE, Science Citation index and Conference Proceedings Citation index, African Index Medicus and the grey literature database ‘OpenSIGLE’ for studies published between January 1990 and February 2011. Included studies reported prevalence or incidence of diabetic retinopathy or diabetic maculopathy of subjects with diabetes resident in African countries. Results Sixty-two studies from 21 countries were included: three population-based surveys; two cohort studies; five case–control studies; 32 diabetes clinic-based, nine eye clinic-based and 11 other hospital-based surveys. Included studies varied considerably in terms of patient selection, method of assessing the eye and retinopathy classification. In population-based studies, the reported prevalence range in patients with diabetes for diabetic retinopathy was 30.2 to 31.6%, proliferative diabetic retinopathy 0.9 to 1.3%, and any maculopathy 1.2 to 4.5%. In diabetes clinic-based surveys, the reported prevalence range for diabetic retinopathy was 7.0 to 62.4%, proliferative diabetic retinopathy 0 to 6.9%, and any maculopathy 1.2 to 31.1%. No obvious association between prevalence and income level of the country was detected. Conclusions Large, community-based cross-sectional and cohort studies are needed to investigate rates and determinants of prevalence of diabetic retinopathy, incidence and progression in Africa. Consensus is needed on the most appropriate methods of identification and classification of retinopathy for research and clinical practice. Estimates of prevalence of diabetic retinopathy, proliferative diabetic retinopathy and maculopathy are comparable with recent European and American studies. PMID:22817387

Mediating the Cognitive Walkthrough with Patient Groups to achieve Personalized Health in Chronic Disease Self-Management System Evaluation.

PubMed

Georgsson, Mattias; Kushniruk, Andre

2016-01-01

The cognitive walkthrough (CW) is a task-based, expert inspection usability evaluation method involving benefits such as cost effectiveness and efficiency. A drawback of the method is that it doesn't involve the user perspective from real users but instead is based on experts' predictions about the usability of the system and how users interact. In this paper, we propose a way of involving the user in an expert evaluation method by modifying the CW with patient groups as mediators. This along with other modifications include a dual domain session facilitator, specific patient groups and three different phases: 1) a preparation phase where suitable tasks are developed by a panel of experts and patients, validated through the content validity index 2) a patient user evaluation phase including an individual and collaborative process part 3) an analysis and coding phase where all data is digitalized and synthesized making use of Qualitative Data Analysis Software (QDAS) to determine usability deficiencies. We predict that this way of evaluating will utilize the benefits of the expert methods, also providing a way of including the patient user of these self-management systems. Results from this prospective study should provide evidence of the usefulness of this method modification.

Scalable parallel elastic-plastic finite element analysis using a quasi-Newton method with a balancing domain decomposition preconditioner

NASA Astrophysics Data System (ADS)

Yusa, Yasunori; Okada, Hiroshi; Yamada, Tomonori; Yoshimura, Shinobu

2018-04-01

A domain decomposition method for large-scale elastic-plastic problems is proposed. The proposed method is based on a quasi-Newton method in conjunction with a balancing domain decomposition preconditioner. The use of a quasi-Newton method overcomes two problems associated with the conventional domain decomposition method based on the Newton-Raphson method: (1) avoidance of a double-loop iteration algorithm, which generally has large computational complexity, and (2) consideration of the local concentration of nonlinear deformation, which is observed in elastic-plastic problems with stress concentration. Moreover, the application of a balancing domain decomposition preconditioner ensures scalability. Using the conventional and proposed domain decomposition methods, several numerical tests, including weak scaling tests, were performed. The convergence performance of the proposed method is comparable to that of the conventional method. In particular, in elastic-plastic analysis, the proposed method exhibits better convergence performance than the conventional method.

Deep data fusion method for missile-borne inertial/celestial system

NASA Astrophysics Data System (ADS)

Zhang, Chunxi; Chen, Xiaofei; Lu, Jiazhen; Zhang, Hao

2018-05-01

Strap-down inertial-celestial integrated navigation system has the advantages of autonomy and high precision and is very useful for ballistic missiles. The star sensor installation error and inertial measurement error have a great influence for the system performance. Based on deep data fusion, this paper establishes measurement equations including star sensor installation error and proposes the deep fusion filter method. Simulations including misalignment error, star sensor installation error, IMU error are analyzed. Simulation results indicate that the deep fusion method can estimate the star sensor installation error and IMU error. Meanwhile, the method can restrain the misalignment errors caused by instrument errors.

Processing of Antenna-Array Signals on the Basis of the Interference Model Including a Rank-Deficient Correlation Matrix

NASA Astrophysics Data System (ADS)

Rodionov, A. A.; Turchin, V. I.

2017-06-01

We propose a new method of signal processing in antenna arrays, which is called the Maximum-Likelihood Signal Classification. The proposed method is based on the model in which interference includes a component with a rank-deficient correlation matrix. Using numerical simulation, we show that the proposed method allows one to ensure variance of the estimated arrival angle of the plane wave, which is close to the Cramer-Rao lower boundary and more efficient than the best-known MUSIC method. It is also shown that the proposed technique can be efficiently used for estimating the time dependence of the useful signal.

An inviscid-viscous interaction approach to the calculation of dynamic stall initiation on airfoils

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cebeci, T.; Platzer, M.F.; Jang, H.M.

An interactive boundary-layer method is described for computing unsteady incompressible flow over airfoils, including the initiation of dynamic stall. The inviscid unsteady panel method developed by Platzer and Teng is extended to include viscous effects. The solutions of the boundary-layer equations are obtained with an inverse finite-difference method employing an interaction law based on the Hilbert integral, and the algebraic eddy-viscosity formulation of Cebeci and Smith. The method is applied to airfoils subject to periodic and ramp-type motions and its abilities are examined for a range of angles of attack, reduced frequency, and pitch rate.

Statistical methods for analysis of radiation effects with tumor and dose location-specific information with application to the WECARE study of asynchronous contralateral breast cancer

PubMed Central

Langholz, Bryan; Thomas, Duncan C.; Stovall, Marilyn; Smith, Susan A.; Boice, John D.; Shore, Roy E.; Bernstein, Leslie; Lynch, Charles F.; Zhang, Xinbo; Bernstein, Jonine L.

2009-01-01

Summary Methods for the analysis of individually matched case-control studies with location-specific radiation dose and tumor location information are described. These include likelihood methods for analyses that just use cases with precise location of tumor information and methods that also include cases with imprecise tumor location information. The theory establishes that each of these likelihood based methods estimates the same radiation rate ratio parameters, within the context of the appropriate model for location and subject level covariate effects. The underlying assumptions are characterized and the potential strengths and limitations of each method are described. The methods are illustrated and compared using the WECARE study of radiation and asynchronous contralateral breast cancer. PMID:18647297

7 CFR 3430.201 - Purpose.

Code of Federal Regulations, 2013 CFR

2013-01-01

... address the critical needs of the specialty crop industry by developing and disseminating science-based... over the long term (including specialty crop policy and marketing). (4) New innovations and technology, including improved mechanization and technologies that delay or inhibit ripening. (5) Methods to prevent...

7 CFR 3430.201 - Purpose.

Code of Federal Regulations, 2012 CFR

2012-01-01

... address the critical needs of the specialty crop industry by developing and disseminating science-based... over the long term (including specialty crop policy and marketing). (4) New innovations and technology, including improved mechanization and technologies that delay or inhibit ripening. (5) Methods to prevent...

7 CFR 3430.201 - Purpose.

Code of Federal Regulations, 2014 CFR

2014-01-01

... address the critical needs of the specialty crop industry by developing and disseminating science-based... over the long term (including specialty crop policy and marketing). (4) New innovations and technology, including improved mechanization and technologies that delay or inhibit ripening. (5) Methods to prevent...

Low-Resolution Raman-Spectroscopy Combustion Thermometry

NASA Technical Reports Server (NTRS)

Nguyen, Quang-Viet; Kojima, Jun

2008-01-01

A method of optical thermometry, now undergoing development, involves low-resolution measurement of the spectrum of spontaneous Raman scattering (SRS) from N2 and O2 molecules. The method is especially suitable for measuring temperatures in high pressure combustion environments that contain N2, O2, or N2/O2 mixtures (including air). Methods based on SRS (in which scattered light is shifted in wavelength by amounts that depend on vibrational and rotational energy levels of laser-illuminated molecules) have been popular means of probing flames because they are almost the only methods that provide spatially and temporally resolved concentrations and temperatures of multiple molecular species in turbulent combustion. The present SRS-based method differs from prior SRS-based methods that have various drawbacks, a description of which would exceed the scope of this article. Two main differences between this and prior SRS-based methods are that it involves analysis in the frequency (equivalently, wavelength) domain, in contradistinction to analysis in the intensity domain in prior methods; and it involves low-resolution measurement of what amounts to predominantly the rotational Raman spectra of N2 and O2, in contradistinction to higher-resolution measurement of the vibrational Raman spectrum of N2 only in prior methods.

Efficient l1 -norm-based low-rank matrix approximations for large-scale problems using alternating rectified gradient method.

PubMed

Kim, Eunwoo; Lee, Minsik; Choi, Chong-Ho; Kwak, Nojun; Oh, Songhwai

2015-02-01

Low-rank matrix approximation plays an important role in the area of computer vision and image processing. Most of the conventional low-rank matrix approximation methods are based on the l2 -norm (Frobenius norm) with principal component analysis (PCA) being the most popular among them. However, this can give a poor approximation for data contaminated by outliers (including missing data), because the l2 -norm exaggerates the negative effect of outliers. Recently, to overcome this problem, various methods based on the l1 -norm, such as robust PCA methods, have been proposed for low-rank matrix approximation. Despite the robustness of the methods, they require heavy computational effort and substantial memory for high-dimensional data, which is impractical for real-world problems. In this paper, we propose two efficient low-rank factorization methods based on the l1 -norm that find proper projection and coefficient matrices using the alternating rectified gradient method. The proposed methods are applied to a number of low-rank matrix approximation problems to demonstrate their efficiency and robustness. The experimental results show that our proposals are efficient in both execution time and reconstruction performance unlike other state-of-the-art methods.

A highly precise frequency-based method for estimating the tension of an inclined cable with unknown boundary conditions

NASA Astrophysics Data System (ADS)

Ma, Lin

2017-11-01

This paper develops a method for precisely determining the tension of an inclined cable with unknown boundary conditions. First, the nonlinear motion equation of an inclined cable is derived, and a numerical model of the motion of the cable is proposed using the finite difference method. The proposed numerical model includes the sag-extensibility, flexural stiffness, inclination angle and rotational stiffness at two ends of the cable. Second, the influence of the dynamic parameters of the cable on its frequencies is discussed in detail, and a method for precisely determining the tension of an inclined cable is proposed based on the derivatives of the eigenvalues of the matrices. Finally, a multiparameter identification method is developed that can simultaneously identify multiple parameters, including the rotational stiffness at two ends. This scheme is applicable to inclined cables with varying sag, varying flexural stiffness and unknown boundary conditions. Numerical examples indicate that the method provides good precision. Because the parameters of cables other than tension (e.g., the flexural stiffness and rotational stiffness at the ends) are not accurately known in practical engineering, the multiparameter identification method could further improve the accuracy of cable tension measurements.

Design of a rotary dielectric elastomer actuator using a topology optimization method based on pairs of curves

NASA Astrophysics Data System (ADS)

Wang, Nianfeng; Guo, Hao; Chen, Bicheng; Cui, Chaoyu; Zhang, Xianmin

2018-05-01

Dielectric elastomers (DE), known as electromechanical transducers, have been widely used in the field of sensors, generators, actuators and energy harvesting for decades. A large number of DE actuators including bending actuators, linear actuators and rotational actuators have been designed utilizing an experience design method. This paper proposes a new method for the design of DE actuators by using a topology optimization method based on pairs of curves. First, theoretical modeling and optimization design are discussed, after which a rotary dielectric elastomer actuator has been designed using this optimization method. Finally, experiments and comparisons between several DE actuators have been made to verify the optimized result.

Towards discrete wavelet transform-based human activity recognition

NASA Astrophysics Data System (ADS)

Khare, Manish; Jeon, Moongu

2017-06-01

Providing accurate recognition of human activities is a challenging problem for visual surveillance applications. In this paper, we present a simple and efficient algorithm for human activity recognition based on a wavelet transform. We adopt discrete wavelet transform (DWT) coefficients as a feature of human objects to obtain advantages of its multiresolution approach. The proposed method is tested on multiple levels of DWT. Experiments are carried out on different standard action datasets including KTH and i3D Post. The proposed method is compared with other state-of-the-art methods in terms of different quantitative performance measures. The proposed method is found to have better recognition accuracy in comparison to the state-of-the-art methods.

[Investigation on pattern and methods of quality control for Chinese materia medica based on dao-di herbs and bioassay - bioassay for Coptis chinensis].

PubMed

Yan, Dan; Xiao, Xiao-he

2011-05-01

Establishment of bioassay methods is the technical issues to be faced with in the bioassay of Chinese materia medica. Taking the bioassay of Coptis chinensis Franch. as an example, the establishment process and application of the bioassay methods (including bio-potency and bio-activity fingerprint) were explained from the aspects of methodology, principle of selection, experimental design, method confirmation and data analysis. The common technologies were extracted and formed with the above aspects, so as to provide technical support for constructing pattern and method of the quality control for Chinese materia medica based on the dao-di herbs and bioassay.

Quantifying Vegetation Biophysical Variables from Imaging Spectroscopy Data: A Review on Retrieval Methods

NASA Astrophysics Data System (ADS)

Verrelst, Jochem; Malenovský, Zbyněk; Van der Tol, Christiaan; Camps-Valls, Gustau; Gastellu-Etchegorry, Jean-Philippe; Lewis, Philip; North, Peter; Moreno, Jose

2018-06-01

An unprecedented spectroscopic data stream will soon become available with forthcoming Earth-observing satellite missions equipped with imaging spectroradiometers. This data stream will open up a vast array of opportunities to quantify a diversity of biochemical and structural vegetation properties. The processing requirements for such large data streams require reliable retrieval techniques enabling the spatiotemporally explicit quantification of biophysical variables. With the aim of preparing for this new era of Earth observation, this review summarizes the state-of-the-art retrieval methods that have been applied in experimental imaging spectroscopy studies inferring all kinds of vegetation biophysical variables. Identified retrieval methods are categorized into: (1) parametric regression, including vegetation indices, shape indices and spectral transformations; (2) nonparametric regression, including linear and nonlinear machine learning regression algorithms; (3) physically based, including inversion of radiative transfer models (RTMs) using numerical optimization and look-up table approaches; and (4) hybrid regression methods, which combine RTM simulations with machine learning regression methods. For each of these categories, an overview of widely applied methods with application to mapping vegetation properties is given. In view of processing imaging spectroscopy data, a critical aspect involves the challenge of dealing with spectral multicollinearity. The ability to provide robust estimates, retrieval uncertainties and acceptable retrieval processing speed are other important aspects in view of operational processing. Recommendations towards new-generation spectroscopy-based processing chains for operational production of biophysical variables are given.

A Methodical Approach to the Creation, Operation, and Enhancement of a General-use Microcomputer Laboratory.

ERIC Educational Resources Information Center

Seilheimer, Steven D.

1988-01-01

Outlines procedures for developing a microcomputer laboratory for use by students in an academic organization, based on experiences at Niagara University. The four phases described include: (1) needs assessment; (2) establishment, including software and hardware selection and physical facilities; (3) operation, including staffing, maintenance,…

Commonality of drug-associated adverse events detected by 4 commonly used data mining algorithms.

PubMed

Sakaeda, Toshiyuki; Kadoyama, Kaori; Minami, Keiko; Okuno, Yasushi

2014-01-01

Data mining algorithms have been developed for the quantitative detection of drug-associated adverse events (signals) from a large database on spontaneously reported adverse events. In the present study, the commonality of signals detected by 4 commonly used data mining algorithms was examined. A total of 2,231,029 reports were retrieved from the public release of the US Food and Drug Administration Adverse Event Reporting System database between 2004 and 2009. The deletion of duplicated submissions and revision of arbitrary drug names resulted in a reduction in the number of reports to 1,644,220. Associations with adverse events were analyzed for 16 unrelated drugs, using the proportional reporting ratio (PRR), reporting odds ratio (ROR), information component (IC), and empirical Bayes geometric mean (EBGM). All EBGM-based signals were included in the PRR-based signals as well as IC- or ROR-based ones, and PRR- and IC-based signals were included in ROR-based ones. The PRR scores of PRR-based signals were significantly larger for 15 of 16 drugs when adverse events were also detected as signals by the EBGM method, as were the IC scores of IC-based signals for all drugs; however, no such effect was observed in the ROR scores of ROR-based signals. The EBGM method was the most conservative among the 4 methods examined, which suggested its better suitability for pharmacoepidemiological studies. Further examinations should be performed on the reproducibility of clinical observations, especially for EBGM-based signals.

Jaccard distance based weighted sparse representation for coarse-to-fine plant species recognition.

PubMed

Zhang, Shanwen; Wu, Xiaowei; You, Zhuhong

2017-01-01

Leaf based plant species recognition plays an important role in ecological protection, however its application to large and modern leaf databases has been a long-standing obstacle due to the computational cost and feasibility. Recognizing such limitations, we propose a Jaccard distance based sparse representation (JDSR) method which adopts a two-stage, coarse to fine strategy for plant species recognition. In the first stage, we use the Jaccard distance between the test sample and each training sample to coarsely determine the candidate classes of the test sample. The second stage includes a Jaccard distance based weighted sparse representation based classification(WSRC), which aims to approximately represent the test sample in the training space, and classify it by the approximation residuals. Since the training model of our JDSR method involves much fewer but more informative representatives, this method is expected to overcome the limitation of high computational and memory costs in traditional sparse representation based classification. Comparative experimental results on a public leaf image database demonstrate that the proposed method outperforms other existing feature extraction and SRC based plant recognition methods in terms of both accuracy and computational speed.

Light-leaking region segmentation of FOG fiber based on quality evaluation of infrared image

NASA Astrophysics Data System (ADS)

Liu, Haoting; Wang, Wei; Gao, Feng; Shan, Lianjie; Ma, Yuzhou; Ge, Wenqian

2014-07-01

To improve the assembly reliability of Fiber Optic Gyroscope (FOG), a light leakage detection system and method is developed. First, an agile movement control platform is designed to implement the pose control of FOG optical path component in 6 Degrees of Freedom (DOF). Second, an infrared camera is employed to capture the working state images of corresponding fibers in optical path component after the manual assembly of FOG; therefore the entire light transmission process of key sections in light-path can be recorded. Third, an image quality evaluation based region segmentation method is developed for the light leakage images. In contrast to the traditional methods, the image quality metrics, including the region contrast, the edge blur, and the image noise level, are firstly considered to distinguish the image characters of infrared image; then the robust segmentation algorithms, including graph cut and flood fill, are all developed for region segmentation according to the specific image quality. Finally, after the image segmentation of light leakage region, the typical light-leaking type, such as the point defect, the wedge defect, and the surface defect can be identified. By using the image quality based method, the applicability of our proposed system can be improved dramatically. Many experiment results have proved the validity and effectiveness of this method.

PBL and beyond: trends in collaborative learning.

PubMed

Pluta, William J; Richards, Boyd F; Mutnick, Andrew

2013-01-01

Building upon the disruption to lecture-based methods triggered by the introduction of problem-based learning, approaches to promote collaborative learning are becoming increasingly diverse, widespread and generally well accepted within medical education. Examples of relatively new, structured collaborative learning methods include team-based learning and just-in-time teaching. Examples of less structured approaches include think-pair share, case discussions, and the flipped classroom. It is now common practice in medical education to employ a range of instructional approaches to support collaborative learning. We believe that the adoption of such approaches is entering a new and challenging era. We define collaborate learning by drawing on the broader literature, including Chi's ICAP framework that emphasizes the importance of sustained, interactive explanation and elaboration by learners. We distinguish collaborate learning from constructive, active, and passive learning and provide preliminary evidence documenting the growth of methods that support collaborative learning. We argue that the rate of adoption of collaborative learning methods will accelerate due to a growing emphasis on the development of team competencies and the increasing availability of digital media. At the same time, the adoption collaborative learning strategies face persistent challenges, stemming from an overdependence on comparative-effectiveness research and a lack of useful guidelines about how best to adapt collaborative learning methods to given learning contexts. The medical education community has struggled to consistently demonstrate superior outcomes when using collaborative learning methods and strategies. Despite this, support for their use will continue to expand. To select approaches with the greatest utility, instructors must carefully align conditions of the learning context with the learning approaches under consideration. Further, it is critical that modifications are made with caution and that instructors verify that modifications do not impede the desired cognitive activities needed to support meaningful collaborative learning.

Segmentation of organs at risk in CT volumes of head, thorax, abdomen, and pelvis

NASA Astrophysics Data System (ADS)

Han, Miaofei; Ma, Jinfeng; Li, Yan; Li, Meiling; Song, Yanli; Li, Qiang

2015-03-01

Accurate segmentation of organs at risk (OARs) is a key step in treatment planning system (TPS) of image guided radiation therapy. We are developing three classes of methods to segment 17 organs at risk throughout the whole body, including brain, brain stem, eyes, mandible, temporomandibular joints, parotid glands, spinal cord, lungs, trachea, heart, livers, kidneys, spleen, prostate, rectum, femoral heads, and skin. The three classes of segmentation methods include (1) threshold-based methods for organs of large contrast with adjacent structures such as lungs, trachea, and skin; (2) context-driven Generalized Hough Transform-based methods combined with graph cut algorithm for robust localization and segmentation of liver, kidneys and spleen; and (3) atlas and registration-based methods for segmentation of heart and all organs in CT volumes of head and pelvis. The segmentation accuracy for the seventeen organs was subjectively evaluated by two medical experts in three levels of score: 0, poor (unusable in clinical practice); 1, acceptable (minor revision needed); and 2, good (nearly no revision needed). A database was collected from Ruijin Hospital, Huashan Hospital, and Xuhui Central Hospital in Shanghai, China, including 127 head scans, 203 thoracic scans, 154 abdominal scans, and 73 pelvic scans. The percentages of "good" segmentation results were 97.6%, 92.9%, 81.1%, 87.4%, 85.0%, 78.7%, 94.1%, 91.1%, 81.3%, 86.7%, 82.5%, 86.4%, 79.9%, 72.6%, 68.5%, 93.2%, 96.9% for brain, brain stem, eyes, mandible, temporomandibular joints, parotid glands, spinal cord, lungs, trachea, heart, livers, kidneys, spleen, prostate, rectum, femoral heads, and skin, respectively. Various organs at risk can be reliably segmented from CT scans by use of the three classes of segmentation methods.

Improvement of an algorithm for recognition of liveness using perspiration in fingerprint devices

NASA Astrophysics Data System (ADS)

Parthasaradhi, Sujan T.; Derakhshani, Reza; Hornak, Lawrence A.; Schuckers, Stephanie C.

2004-08-01

Previous work in our laboratory and others have demonstrated that spoof fingers made of a variety of materials including silicon, Play-Doh, clay, and gelatin (gummy finger) can be scanned and verified when compared to a live enrolled finger. Liveness, i.e. to determine whether the introduced biometric is coming from a live source, has been suggested as a means to circumvent attacks using spoof fingers. We developed a new liveness method based on perspiration changes in the fingerprint image. Recent results showed approximately 90% classification rate using different classification methods for various technologies including optical, electro-optical, and capacitive DC, a shorter time window and a diverse dataset. This paper focuses on improvement of the live classification rate by using a weight decay method during the training phase in order to improve the generalization and reduce the variance of the neural network based classifier. The dataset included fingerprint images from 33 live subjects, 33 spoofs created with dental impression material and Play-Doh, and fourteen cadaver fingers. 100% live classification was achieved with 81.8 to 100% spoof classification, depending on the device technology. The weight-decay method improves upon past reports by increasing the live and spoof classification rate.

Analysis of heavy oils: Method development and application to Cerro Negro heavy petroleum

DOE Office of Scientific and Technical Information (OSTI.GOV)

None

1989-12-01

On March 6, 1980, the US Department of Energy (DOE) and the Ministry of Energy and Mines of Venezuela (MEMV) entered into a joint agreement which included analysis of heavy crude oils from the Venezuelan Orinoco oil belt. The purpose of this report is to present compositional data and describe new analytical methods obtained from work on the Cerro Negro Orinoco belt crude oil since 1980. Most of the chapters focus on the methods rather than the resulting data on Cerro Negro oil, and results from other oils obtained during the verification of the method are included. In addition, publishedmore » work on analysis of heavy oils, tar sand bitumens, and like materials is reviewed, and the overall state of the art in analytical methodology for heavy fossil liquids is assessed. The various phases of the work included: distillation and determination of routine'' physical/chemical properties (Chapter 1); preliminary separation of >200{degrees} C distillates and the residue into acid, base, neutral, saturated hydrocarbon and neutral-aromatic concentrates (Chapter 2); further separation of acid, base, and neutral concentrates into subtypes (Chapters 3--5); and determination of the distribution of metal-containing compounds in all fractions (Chapter 6).« less

Landscape scale mapping of forest inventory data by nearest neighbor classification

Treesearch

Andrew Lister

2009-01-01

One of the goals of the Forest Service, U.S. Department of Agriculture's Forest Inventory and Analysis (FIA) program is large-area mapping. FIA scientists have tried many methods in the past, including geostatistical methods, linear modeling, nonlinear modeling, and simple choropleth and dot maps. Mapping methods that require individual model-based maps to be...

Die sokratische Lehrstrategie und ihre Relevanz fur die heutige Didaktik (The Socratic Method and Its Relevance for Modern Teaching).

ERIC Educational Resources Information Center

Kanakis, Ioannis

1997-01-01

Examines the Socratic method through a comparative analysis of early Platonic dialogs with theories of critical rationalism and cognitive theories based on achievement motivation. Presents details of the Socratic strategy of teaching and learning, including critical reflection, conversation, and intellectual honesty; asserts that these methods are…

Factor Retention in Exploratory Factor Analysis: A Comparison of Alternative Methods.

ERIC Educational Resources Information Center

Mumford, Karen R.; Ferron, John M.; Hines, Constance V.; Hogarty, Kristine Y.; Kromrey, Jeffery D.

This study compared the effectiveness of 10 methods of determining the number of factors to retain in exploratory common factor analysis. The 10 methods included the Kaiser rule and a modified Kaiser criterion, 3 variations of parallel analysis, 4 regression-based variations of the scree procedure, and the minimum average partial procedure. The…

Data center cooling method

DOEpatents

Chainer, Timothy J.; Dang, Hien P.; Parida, Pritish R.; Schultz, Mark D.; Sharma, Arun

2015-08-11

A method aspect for removing heat from a data center may use liquid coolant cooled without vapor compression refrigeration on a liquid cooled information technology equipment rack. The method may also include regulating liquid coolant flow to the data center through a range of liquid coolant flow values with a controller-apparatus based upon information technology equipment temperature threshold of the data center.

Piece-wise quadratic approximations of arbitrary error functions for fast and robust machine learning.

PubMed

Gorban, A N; Mirkes, E M; Zinovyev, A

2016-12-01

Most of machine learning approaches have stemmed from the application of minimizing the mean squared distance principle, based on the computationally efficient quadratic optimization methods. However, when faced with high-dimensional and noisy data, the quadratic error functionals demonstrated many weaknesses including high sensitivity to contaminating factors and dimensionality curse. Therefore, a lot of recent applications in machine learning exploited properties of non-quadratic error functionals based on L 1 norm or even sub-linear potentials corresponding to quasinorms L p (0

An exploration of the data collection methods utilised with children, teenagers and young people (CTYPs).

PubMed

Flanagan, Sarah M; Greenfield, Sheila; Coad, Jane; Neilson, Susan

2015-03-01

The impact of cancer upon children, teenagers and young people can be profound. Research has been undertaken to explore the impacts upon children, teenagers and young people with cancer, but little is known about how researchers can 'best' engage with this group to explore their experiences. This review paper provides an overview of the utility of data collection methods employed when undertaking research with children, teenagers and young people. A systematic review of relevant databases was undertaken utilising the search terms 'young people', 'young adult', 'adolescent' and 'data collection methods'. The full-text of the papers that were deemed eligible from the title and abstract were accessed and following discussion within the research team, thirty papers were included. Due to the heterogeneity in terms of the scope of the papers identified the following data collections methods were included in the results section. Three of the papers identified provided an overview of data collection methods utilised with this population and the remaining twenty seven papers covered the following data collection methods: Digital technologies; art based research; comparing the use of 'paper and pencil' research with web-based technologies, the use of games; the use of a specific communication tool; questionnaires and interviews; focus groups and telephone interviews/questionnaires. The strengths and limitations of the range of data collection methods included are discussed drawing upon such issues as of the appropriateness of particular methods for particular age groups, or the most appropriate method to employ when exploring a particularly sensitive topic area. There are a number of data collection methods utilised to undertaken research with children, teenagers and young adults. This review provides a summary of the current available evidence and an overview of the strengths and limitations of data collection methods employed.

Method for controlling powertrain pumps

DOEpatents

Sime, Karl Andrew; Spohn, Brian L; Demirovic, Besim; Martini, Ryan D; Miller, Jean Marie

2013-10-22

A method of controlling a pump supplying a fluid to a transmission includes sensing a requested power and an excess power for a powertrain. The requested power substantially meets the needs of the powertrain, while the excess power is not part of the requested power. The method includes sensing a triggering condition in response to the ability to convert the excess power into heat in the transmission, and determining that an operating temperature of the transmission is below a maximum. The method also includes determining a calibrated baseline and a dissipation command for the pump. The calibrated baseline command is configured to supply the fluid based upon the requested power, and the dissipation command is configured to supply additional fluid and consume the excess power with the pump. The method operates the pump at a combined command, which is equal to the calibrated baseline command plus the dissipation command.

A Method of DTM Construction Based on Quadrangular Irregular Networks and Related Error Analysis

PubMed Central

Kang, Mengjun

2015-01-01

A new method of DTM construction based on quadrangular irregular networks (QINs) that considers all the original data points and has a topological matrix is presented. A numerical test and a real-world example are used to comparatively analyse the accuracy of QINs against classical interpolation methods and other DTM representation methods, including SPLINE, KRIGING and triangulated irregular networks (TINs). The numerical test finds that the QIN method is the second-most accurate of the four methods. In the real-world example, DTMs are constructed using QINs and the three classical interpolation methods. The results indicate that the QIN method is the most accurate method tested. The difference in accuracy rank seems to be caused by the locations of the data points sampled. Although the QIN method has drawbacks, it is an alternative method for DTM construction. PMID:25996691

A Composite Model of Wound Segmentation Based on Traditional Methods and Deep Neural Networks

PubMed Central

Wang, Changjian; Liu, Xiaohui; Jin, Shiyao

2018-01-01

Wound segmentation plays an important supporting role in the wound observation and wound healing. Current methods of image segmentation include those based on traditional process of image and those based on deep neural networks. The traditional methods use the artificial image features to complete the task without large amounts of labeled data. Meanwhile, the methods based on deep neural networks can extract the image features effectively without the artificial design, but lots of training data are required. Combined with the advantages of them, this paper presents a composite model of wound segmentation. The model uses the skin with wound detection algorithm we designed in the paper to highlight image features. Then, the preprocessed images are segmented by deep neural networks. And semantic corrections are applied to the segmentation results at last. The model shows a good performance in our experiment. PMID:29955227

Survey of in-situ and remote sensing methods for soil moisture determination

NASA Technical Reports Server (NTRS)

Schmugge, T. J.; Jackson, T. J.; Mckim, H. L.

1981-01-01

General methods for determining the moisture content in the surface layers of the soil based on in situ or point measurements, soil water models and remote sensing observations are surveyed. In situ methods described include gravimetric techniques, nuclear techniques based on neutron scattering or gamma-ray attenuation, electromagnetic techniques, tensiometric techniques and hygrometric techniques. Soil water models based on column mass balance treat soil moisture contents as a result of meteorological inputs (precipitation, runoff, subsurface flow) and demands (evaporation, transpiration, percolation). The remote sensing approaches are based on measurements of the diurnal range of surface temperature and the crop canopy temperature in the thermal infrared, measurements of the radar backscattering coefficient in the microwave region, and measurements of microwave emission or brightness temperature. Advantages and disadvantages of the various methods are pointed out, and it is concluded that a successful monitoring system must incorporate all of the approaches considered.

Mass spectrometric-based stable isotopic 2-aminobenzoic acid glycan mapping for rapid glycan screening of biotherapeutics.

PubMed

Prien, Justin M; Prater, Bradley D; Qin, Qiang; Cockrill, Steven L

2010-02-15

Fast, sensitive, robust methods for "high-level" glycan screening are necessary during various stages of a biotherapeutic product's lifecycle, including clone selection, process changes, and quality control for lot release testing. Traditional glycan screening involves chromatographic or electrophoretic separation-based methods, and, although reproducible, these methods can be time-consuming. Even ultrahigh-performance chromatographic and microfluidic integrated LC/MS systems, which work on the tens of minute time scale, become lengthy when hundreds of samples are to be analyzed. Comparatively, a direct infusion mass spectrometry (MS)-based glycan screening method acquires data on a millisecond time scale, exhibits exquisite sensitivity and reproducibility, and is amenable to automated peak annotation. In addition, characterization of glycan species via sequential mass spectrometry can be performed simultaneously. Here, we demonstrate a quantitative high-throughput MS-based mapping approach using stable isotope 2-aminobenzoic acid (2-AA) for rapid "high-level" glycan screening.

Development of purely structure-based pharmacophores for the topoisomerase I-DNA-ligand binding pocket

NASA Astrophysics Data System (ADS)

Drwal, Malgorzata N.; Agama, Keli; Pommier, Yves; Griffith, Renate

2013-12-01

Purely structure-based pharmacophores (SBPs) are an alternative method to ligand-based approaches and have the advantage of describing the entire interaction capability of a binding pocket. Here, we present the development of SBPs for topoisomerase I, an anticancer target with an unusual ligand binding pocket consisting of protein and DNA atoms. Different approaches to cluster and select pharmacophore features are investigated, including hierarchical clustering and energy calculations. In addition, the performance of SBPs is evaluated retrospectively and compared to the performance of ligand- and complex-based pharmacophores. SBPs emerge as a valid method in virtual screening and a complementary approach to ligand-focussed methods. The study further reveals that the choice of pharmacophore feature clustering and selection methods has a large impact on the virtual screening hit lists. A prospective application of the SBPs in virtual screening reveals that they can be used successfully to identify novel topoisomerase inhibitors.

Beyond Blood Culture and Gram Stain Analysis: A Review of Molecular Techniques for the Early Detection of Bacteremia in Surgical Patients.

PubMed

Scerbo, Michelle H; Kaplan, Heidi B; Dua, Anahita; Litwin, Douglas B; Ambrose, Catherine G; Moore, Laura J; Murray, Col Clinton K; Wade, Charles E; Holcomb, John B

2016-06-01

Sepsis from bacteremia occurs in 250,000 cases annually in the United States, has a mortality rate as high as 60%, and is associated with a poorer prognosis than localized infection. Because of these high figures, empiric antibiotic administration for patients with systemic inflammatory response syndrome (SIRS) and suspected infection is the second most common indication for antibiotic administration in intensive care units (ICU)s. However, overuse of empiric antibiotics contributes to the development of opportunistic infections, antibiotic resistance, and the increase in multi-drug-resistant bacterial strains. The current method of diagnosing and ruling out bacteremia is via blood culture (BC) and Gram stain (GS) analysis. Conventional and molecular methods for diagnosing bacteremia were reviewed and compared. The clinical implications, use, and current clinical trials of polymerase chain reaction (PCR)-based methods to detect bacterial pathogens in the blood stream were detailed. BC/GS has several disadvantages. These include: some bacteria do not grow in culture media; others do not GS appropriately; and cultures can require up to 5 d to guide or discontinue antibiotic treatment. PCR-based methods can be potentially applied to detect rapidly, accurately, and directly microbes in human blood samples. Compared with the conventional BC/GS, particular advantages to molecular methods (specifically, PCR-based methods) include faster results, leading to possible improved antibiotic stewardship when bacteremia is not present.

Liquid carbon dioxide absorbents, methods of using the same, and related system

DOE Office of Scientific and Technical Information (OSTI.GOV)

Perry, Robert James; Soloveichik, Grigorii Lev; Rubinsztajn, Malgorzata Iwona

A carbon dioxide absorbent composition is described, including (i) a liquid, nonaqueous silicon-based material, functionalized with one or more groups that either reversibly react with CO 2 or have a high-affinity for CO 2, and (ii) a hydroxy-containing solvent that is capable of dissolving both the silicon-based material and a reaction product of the silicon-based material and CO 2. The absorbent may be utilized in methods to reduce carbon dioxide in an exhaust gas, and finds particular utility in power plants.

Intra-generational Redistribution under Public Pension Planning Based on Generation-based Funding Scheme

NASA Astrophysics Data System (ADS)

Banjo, Daisuke; Tamura, Hiroyuki; Murata, Tadahiko

In this paper, we propose a method of determining the pension in the generation-based funding scheme. In this proposal, we include two types of pensions in the scheme. One is the payment-amount related pension and the other is the payment-frequency related pension. We set the ratio of the total amount of payment-amount related pension to the total amount of both pensions, and simulate income gaps and the relationship between contributions and benefits for each individual when the proposed method is applied.

Liquid carbon dioxide absorbents, methods of using the same, and related systems

DOEpatents

O'Brien, Michael Joseph; Perry, Robert James; Lam, Tunchiao Hubert; Soloveichik, Grigorii Lev; Kniajanski, Sergei; Lewis, Larry Neil; Rubinsztajn, Malgorzata Iwona; Hancu, Dan

2016-09-13

A carbon dioxide absorbent composition is described, including (i) a liquid, nonaqueous silicon-based material, functionalized with one or more groups that either reversibly react with CO.sub.2 or have a high-affinity for CO.sub.2; and (ii) a hydroxy-containing solvent that is capable of dissolving both the silicon-based material and a reaction product of the silicon-based material and CO.sub.2. The absorbent may be utilized in methods to reduce carbon dioxide in an exhaust gas, and finds particular utility in power plants.