NASA Astrophysics Data System (ADS)
Kaida, Yukiko; Murakami, Toshiyuki
A wheelchair is an important apparatus of mobility for people with disability. Power-assist motion in an electric wheelchair is to expand the operator's field of activities. This paper describes force sensorless detection of human input torque. Reaction torque estimation observer calculates the total disturbance torque first. Then, the human input torque is extracted from the estimated disturbance. In power-assist motion, assist torque is synthesized according to the product of assist gain and the average torque of the right and left input torque. Finally, the proposed method is verified through the experiments of power-assist motion.
Sensorless Load Torque Estimation and Passivity Based Control of Buck Converter Fed DC Motor
Kumar, S. Ganesh; Thilagar, S. Hosimin
2015-01-01
Passivity based control of DC motor in sensorless configuration is proposed in this paper. Exact tracking error dynamics passive output feedback control is used for stabilizing the speed of Buck converter fed DC motor under various load torques such as constant type, fan type, propeller type, and unknown load torques. Under load conditions, sensorless online algebraic approach is proposed, and it is compared with sensorless reduced order observer approach. The former produces better response in estimating the load torque. Sensitivity analysis is also performed to select the appropriate control variables. Simulation and experimental results fully confirm the superiority of the proposed approach suggested in this paper. PMID:25893208
Electric propulsion using the permanent magnet synchronous motor without rotor position transducers
NASA Astrophysics Data System (ADS)
Batzel, Todd Douglas
The permanent magnet synchronous motor (PMSM) is increasingly playing an important role in electric propulsion systems due to its many advantages over competing technologies. For successful operation of the PMSM, rotor position and speed information is required. A resolver or encoder attached to the shaft of the machine usually provides this information. Many applications, however, cannot tolerate the use of the position sensor because of space and weight limitations, reliability concerns, or packaging issues. Thus, there has been an intense interest in the development of a so-called position sensorless drive, where the PMSM stator itself is used as the rotor position sensor. In this work, a sensorless electric drive is developed for various undersea propulsion applications, where the rotor position sensor is often undesirable due to the harsh operating environment as well as space and weight limitations. In this work, an observer is developed which enables sensorless operation of the PMSM over a wide speed range. In addition, a method is presented for estimating the standstill rotor angle, an operating condition at which the rotor position observers are typically ill conditioned. In this work two design methodologies are applied to the sensorless electric drive application, including a model-based and a neural network-based approach. Implementation issues for the sensorless electric drive are discussed, and experimental results are presented in order to demonstrate the effectiveness of the proposed techniques to the sensorless PMSM.
Wavefront sensorless adaptive optics ophthalmoscopy in the human eye
Hofer, Heidi; Sredar, Nripun; Queener, Hope; Li, Chaohong; Porter, Jason
2011-01-01
Wavefront sensor noise and fidelity place a fundamental limit on achievable image quality in current adaptive optics ophthalmoscopes. Additionally, the wavefront sensor ‘beacon’ can interfere with visual experiments. We demonstrate real-time (25 Hz), wavefront sensorless adaptive optics imaging in the living human eye with image quality rivaling that of wavefront sensor based control in the same system. A stochastic parallel gradient descent algorithm directly optimized the mean intensity in retinal image frames acquired with a confocal adaptive optics scanning laser ophthalmoscope (AOSLO). When imaging through natural, undilated pupils, both control methods resulted in comparable mean image intensities. However, when imaging through dilated pupils, image intensity was generally higher following wavefront sensor-based control. Despite the typically reduced intensity, image contrast was higher, on average, with sensorless control. Wavefront sensorless control is a viable option for imaging the living human eye and future refinements of this technique may result in even greater optical gains. PMID:21934779
Speed Sensorless Induction Motor Drives for Electrical Actuators: Schemes, Trends and Tradeoffs
NASA Technical Reports Server (NTRS)
Elbuluk, Malik E.; Kankam, M. David
1997-01-01
For a decade, induction motor drive-based electrical actuators have been under investigation as potential replacement for the conventional hydraulic and pneumatic actuators in aircraft. Advantages of electric actuator include lower weight and size, reduced maintenance and operating costs, improved safety due to the elimination of hazardous fluids and high pressure hydraulic and pneumatic actuators, and increased efficiency. Recently, the emphasis of research on induction motor drives has been on sensorless vector control which eliminates flux and speed sensors mounted on the motor. Also, the development of effective speed and flux estimators has allowed good rotor flux-oriented (RFO) performance at all speeds except those close to zero. Sensorless control has improved the motor performance, compared to the Volts/Hertz (or constant flux) controls. This report evaluates documented schemes for speed sensorless drives, and discusses the trends and tradeoffs involved in selecting a particular scheme. These schemes combine the attributes of the direct and indirect field-oriented control (FOC) or use model adaptive reference systems (MRAS) with a speed-dependent current model for flux estimation which tracks the voltage model-based flux estimator. Many factors are important in comparing the effectiveness of a speed sensorless scheme. Among them are the wide speed range capability, motor parameter insensitivity and noise reduction. Although a number of schemes have been proposed for solving the speed estimation, zero-speed FOC with robustness against parameter variations still remains an area of research for speed sensorless control.
NASA Astrophysics Data System (ADS)
Li, Zhaokun; Zhao, Xiaohui
2017-02-01
The sensor-less adaptive optics (AO) is one of the most promising methods to compensate strong wave front disturbance in free space optics communication (FSO). The back propagation (BP) artificial neural network is applied for the sensor-less AO system to design a distortion correction scheme in this study. This method only needs one or a few online measurements to correct the wave front distortion compared with other model-based approaches, by which the real-time capacity of the system is enhanced and the Strehl Ratio (SR) is largely improved. Necessary comparisons in numerical simulation with other model-based and model-free correction methods proposed in Refs. [6,8,9,10] are given to show the validity and advantage of the proposed method.
Gamazo-Real, José Carlos; Vázquez-Sánchez, Ernesto; Gómez-Gil, Jaime
2010-01-01
This paper provides a technical review of position and speed sensorless methods for controlling Brushless Direct Current (BLDC) motor drives, including the background analysis using sensors, limitations and advances. The performance and reliability of BLDC motor drivers have been improved because the conventional control and sensing techniques have been improved through sensorless technology. Then, in this paper sensorless advances are reviewed and recent developments in this area are introduced with their inherent advantages and drawbacks, including the analysis of practical implementation issues and applications. The study includes a deep overview of state-of-the-art back-EMF sensing methods, which includes Terminal Voltage Sensing, Third Harmonic Voltage Integration, Terminal Current Sensing, Back-EMF Integration and PWM strategies. Also, the most relevant techniques based on estimation and models are briefly analysed, such as Sliding-mode Observer, Extended Kalman Filter, Model Reference Adaptive System, Adaptive observers (Full-order and Pseudoreduced-order) and Artificial Neural Networks.
Chi, Wen-Chun; Cheng, Ming-Yang
2014-03-01
Due to issues such as limited space, it is difficult if it is not impossible to employ a position sensor in the drive control of high-speed micro PMSMs. In order to alleviate this problem, this paper analyzes and implements a simple and robust position sensorless field-oriented control method of high-speed micro PMSMs based on the sliding-mode observer. In particular, the angular position and velocity of the rotor of the high-speed micro PMSM are estimated using the sliding-mode observer. This observer is able to accurately estimate rotor position in the low speed region and guarantee fast convergence of the observer in the high speed region. The proposed position sensorless control method is suitable for electric dental handpiece motor drives where a wide speed range operation is essential. The proposed sensorless FOC method is implemented using a cost-effective 16-bit microcontroller and tested in a prototype electric dental handpiece motor. Several experiments are performed to verify the effectiveness of the proposed method. © 2013 ISA. Published by Elsevier Ltd. All rights reserved.
Position and Speed Control of Brushless DC Motors Using Sensorless Techniques and Application Trends
Gamazo-Real, José Carlos; Vázquez-Sánchez, Ernesto; Gómez-Gil, Jaime
2010-01-01
This paper provides a technical review of position and speed sensorless methods for controlling Brushless Direct Current (BLDC) motor drives, including the background analysis using sensors, limitations and advances. The performance and reliability of BLDC motor drivers have been improved because the conventional control and sensing techniques have been improved through sensorless technology. Then, in this paper sensorless advances are reviewed and recent developments in this area are introduced with their inherent advantages and drawbacks, including the analysis of practical implementation issues and applications. The study includes a deep overview of state-of-the-art back-EMF sensing methods, which includes Terminal Voltage Sensing, Third Harmonic Voltage Integration, Terminal Current Sensing, Back-EMF Integration and PWM strategies. Also, the most relevant techniques based on estimation and models are briefly analysed, such as Sliding-mode Observer, Extended Kalman Filter, Model Reference Adaptive System, Adaptive observers (Full-order and Pseudoreduced-order) and Artificial Neural Networks. PMID:22163582
Sensorless Modeling of Varying Pulse Width Modulator Resolutions in Three-Phase Induction Motors
Marko, Matthew David; Shevach, Glenn
2017-01-01
A sensorless algorithm was developed to predict rotor speeds in an electric three-phase induction motor. This sensorless model requires a measurement of the stator currents and voltages, and the rotor speed is predicted accurately without any mechanical measurement of the rotor speed. A model of an electric vehicle undergoing acceleration was built, and the sensorless prediction of the simulation rotor speed was determined to be robust even in the presence of fluctuating motor parameters and significant sensor errors. Studies were conducted for varying pulse width modulator resolutions, and the sensorless model was accurate for all resolutions of sinusoidal voltage functions. PMID:28076418
Sensorless Modeling of Varying Pulse Width Modulator Resolutions in Three-Phase Induction Motors.
Marko, Matthew David; Shevach, Glenn
2017-01-01
A sensorless algorithm was developed to predict rotor speeds in an electric three-phase induction motor. This sensorless model requires a measurement of the stator currents and voltages, and the rotor speed is predicted accurately without any mechanical measurement of the rotor speed. A model of an electric vehicle undergoing acceleration was built, and the sensorless prediction of the simulation rotor speed was determined to be robust even in the presence of fluctuating motor parameters and significant sensor errors. Studies were conducted for varying pulse width modulator resolutions, and the sensorless model was accurate for all resolutions of sinusoidal voltage functions.
Ramesh, Tejavathu; Kumar Panda, Anup; Shiva Kumar, S
2015-07-01
In this research study, a model reference adaptive system (MRAS) speed estimator for speed sensorless direct torque and flux control (DTFC) of an induction motor drive (IMD) using two adaptation mechanism schemes are proposed to replace the conventional proportional integral controller (PIC). The first adaptation mechanism scheme is based on Type-1 fuzzy logic controller (T1FLC), which is used to achieve high performance sensorless drive in both transient as well as steady state conditions. However, the Type-1 fuzzy sets are certain and unable to work effectively when higher degree of uncertainties presents in the system which can be caused by sudden change in speed or different load disturbances, process noise etc. Therefore, a new Type-2 fuzzy logic controller (T2FLC) based adaptation mechanism scheme is proposed to better handle the higher degree of uncertainties and improves the performance and also robust to various load torque and sudden change in speed conditions, respectively. The detailed performances of various adaptation mechanism schemes are carried out in a MATLAB/Simulink environment with a speed sensor and speed sensorless modes of operation when an IMD is operating under different operating conditions, such as, no-load, load and sudden change in speed, respectively. To validate the different control approaches, the system also implemented on real-time system and adequate results are reported for its validation. Copyright © 2015 ISA. Published by Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Ohara, Masaki; Noguchi, Toshihiko
This paper describes a new method for a rotor position sensorless control of a surface permanent magnet synchronous motor based on a model reference adaptive system (MRAS). This method features the MRAS in a current control loop to estimate a rotor speed and position by using only current sensors. This method as well as almost all the conventional methods incorporates a mathematical model of the motor, which consists of parameters such as winding resistances, inductances, and an induced voltage constant. Hence, the important thing is to investigate how the deviation of these parameters affects the estimated rotor position. First, this paper proposes a structure of the sensorless control applied in the current control loop. Next, it proves the stability of the proposed method when motor parameters deviate from the nominal values, and derives the relationship between the estimated position and the deviation of the parameters in a steady state. Finally, some experimental results are presented to show performance and effectiveness of the proposed method.
NASA Astrophysics Data System (ADS)
Verstraete, Hans R. G. W.; Heisler, Morgan; Ju, Myeong Jin; Wahl, Daniel J.; Bliek, Laurens; Kalkman, Jeroen; Bonora, Stefano; Sarunic, Marinko V.; Verhaegen, Michel; Jian, Yifan
2017-02-01
Optical Coherence Tomography (OCT) has revolutionized modern ophthalmology, providing depth resolved images of the retinal layers in a system that is suited to a clinical environment. A limitation of the performance and utilization of the OCT systems has been the lateral resolution. Through the combination of wavefront sensorless adaptive optics with dual variable optical elements, we present a compact lens based OCT system that is capable of imaging the photoreceptor mosaic. We utilized a commercially available variable focal length lens to correct for a wide range of defocus commonly found in patient eyes, and a multi-actuator adaptive lens after linearization of the hysteresis in the piezoelectric actuators for aberration correction to obtain near diffraction limited imaging at the retina. A parallel processing computational platform permitted real-time image acquisition and display. The Data-based Online Nonlinear Extremum seeker (DONE) algorithm was used for real time optimization of the wavefront sensorless adaptive optics OCT, and the performance was compared with a coordinate search algorithm. Cross sectional images of the retinal layers and en face images of the cone photoreceptor mosaic acquired in vivo from research volunteers before and after WSAO optimization are presented. Applying the DONE algorithm in vivo for wavefront sensorless AO-OCT demonstrates that the DONE algorithm succeeds in drastically improving the signal while achieving a computational time of 1 ms per iteration, making it applicable for high speed real time applications.
Wong, Kevin S K; Jian, Yifan; Cua, Michelle; Bonora, Stefano; Zawadzki, Robert J; Sarunic, Marinko V
2015-02-01
Wavefront sensorless adaptive optics optical coherence tomography (WSAO-OCT) is a novel imaging technique for in vivo high-resolution depth-resolved imaging that mitigates some of the challenges encountered with the use of sensor-based adaptive optics designs. This technique replaces the Hartmann Shack wavefront sensor used to measure aberrations with a depth-resolved image-driven optimization algorithm, with the metric based on the OCT volumes acquired in real-time. The custom-built ultrahigh-speed GPU processing platform and fast modal optimization algorithm presented in this paper was essential in enabling real-time, in vivo imaging of human retinas with wavefront sensorless AO correction. WSAO-OCT is especially advantageous for developing a clinical high-resolution retinal imaging system as it enables the use of a compact, low-cost and robust lens-based adaptive optics design. In this report, we describe our WSAO-OCT system for imaging the human photoreceptor mosaic in vivo. We validated our system performance by imaging the retina at several eccentricities, and demonstrated the improvement in photoreceptor visibility with WSAO compensation.
Model-based sensor-less wavefront aberration correction in optical coherence tomography.
Verstraete, Hans R G W; Wahls, Sander; Kalkman, Jeroen; Verhaegen, Michel
2015-12-15
Several sensor-less wavefront aberration correction methods that correct nonlinear wavefront aberrations by maximizing the optical coherence tomography (OCT) signal are tested on an OCT setup. A conventional coordinate search method is compared to two model-based optimization methods. The first model-based method takes advantage of the well-known optimization algorithm (NEWUOA) and utilizes a quadratic model. The second model-based method (DONE) is new and utilizes a random multidimensional Fourier-basis expansion. The model-based algorithms achieve lower wavefront errors with up to ten times fewer measurements. Furthermore, the newly proposed DONE method outperforms the NEWUOA method significantly. The DONE algorithm is tested on OCT images and shows a significantly improved image quality.
Sensor-less pseudo-sinusoidal drive for a permanent-magnet brushless ac motor
NASA Astrophysics Data System (ADS)
Liu, Li-Hsiang; Chern, Tzuen-Lih; Pan, Ping-Lung; Huang, Tsung-Mou; Tsay, Der-Min; Kuang, Jao-Hwa
2012-04-01
The precise rotor-position information is required for a permanent-magnet brushless ac motor (BLACM) drive. In the conventional sinusoidal drive method, either an encoder or a resolver is usually employed. For position sensor-less vector control schemes, the rotor flux estimation and torque components are obtained by complicated coordinate transformations. These computational intensive methods are susceptible to current distortions and parameter variations. To simplify the method complexity, this work presents a sensor-less pseudo-sinusoidal drive scheme with speed control for a three-phase BLACM. Based on the sinusoidal drive scheme, a floating period of each phase current is inserted for back electromotive force detection. The zero-crossing point is determined directly by the proposed scheme, and the rotor magnetic position and rotor speed can be estimated simultaneously. Several experiments for various active angle periods are undertaken. Furthermore, a current feedback control is included to minimize and compensate the torque fluctuation. The experimental results show that the proposed method has a competitive performance compared with the conventional drive manners for BLACM. The proposed scheme is straightforward, bringing the benefits of sensor-less drive and negating the need for coordinate transformations in the operating process.
Field-programmable analogue arrays for the sensorless control of DC motors
NASA Astrophysics Data System (ADS)
Rivera, J.; Dueñas, I.; Ortega, S.; Del Valle, J. L.
2018-02-01
This work presents the analogue implementation of a sensorless controller for direct current motors based on the super-twisting (ST) sliding mode technique, by means of field programmable analogue arrays (FPAA). The novelty of this work is twofold, first is the use of the ST algorithm in a sensorless scheme for DC motors, and the implementation method of this type of sliding mode controllers in FPAAs. The ST algorithm reduces the chattering problem produced with the deliberate use of the sign function in classical sliding mode approaches. On the other hand, the advantages of the implementation method over a digital one are that the controller is not digitally approximated, the controller gains are not fine tuned and the implementation does not require the use of analogue-to-digital and digital-to-analogue converter circuits. In addition to this, the FPAA is a reconfigurable, lower cost and power consumption technology. Simulation and experimentation results were registered, where a more accurate transient response and lower power consumption were obtained by the proposed implementation method when compared to a digital implementation. Also, a more accurate performance by the DC motor is obtained with proposed sensorless ST technique when compared with a classical sliding mode approach.
Optimal model-based sensorless adaptive optics for epifluorescence microscopy.
Pozzi, Paolo; Soloviev, Oleg; Wilding, Dean; Vdovin, Gleb; Verhaegen, Michel
2018-01-01
We report on a universal sample-independent sensorless adaptive optics method, based on modal optimization of the second moment of the fluorescence emission from a point-like excitation. Our method employs a sample-independent precalibration, performed only once for the particular system, to establish the direct relation between the image quality and the aberration. The method is potentially applicable to any form of microscopy with epifluorescence detection, including the practically important case of incoherent fluorescence emission from a three dimensional object, through minor hardware modifications. We have applied the technique successfully to a widefield epifluorescence microscope and to a multiaperture confocal microscope.
Contrast-based sensorless adaptive optics for retinal imaging.
Zhou, Xiaolin; Bedggood, Phillip; Bui, Bang; Nguyen, Christine T O; He, Zheng; Metha, Andrew
2015-09-01
Conventional adaptive optics ophthalmoscopes use wavefront sensing methods to characterize ocular aberrations for real-time correction. However, there are important situations in which the wavefront sensing step is susceptible to difficulties that affect the accuracy of the correction. To circumvent these, wavefront sensorless adaptive optics (or non-wavefront sensing AO; NS-AO) imaging has recently been developed and has been applied to point-scanning based retinal imaging modalities. In this study we show, for the first time, contrast-based NS-AO ophthalmoscopy for full-frame in vivo imaging of human and animal eyes. We suggest a robust image quality metric that could be used for any imaging modality, and test its performance against other metrics using (physical) model eyes.
A new technique to control brushless motor for blood pump application.
Fonseca, Jeison; Andrade, Aron; Nicolosi, Denys E C; Biscegli, José F; Legendre, Daniel; Bock, Eduardo; Lucchi, Júlio César
2008-04-01
This article presents a back-electromotive force (BEMF)-based technique of detection for sensorless brushless direct current motor (BLDCM) drivers. The BLDCM has been chosen as the energy converter in rotary or pulsatile blood pumps that use electrical motors for pumping. However, in order to operate properly, the BLDCM driver needs to know the shaft position. Usually, that information is obtained through a set of Hall sensors assembled close to the rotor and connected to the electronic controller by wires. Sometimes, a large distance between the motor and controller makes the system susceptible to interference on the sensor signal because of winding current switching. Thus, the goal of the sensorless technique presented in this study is to avoid this problem. First, the operation of BLDCM was evaluated on the electronic simulator PSpice. Then, a BEMF detector circuitry was assembled in our laboratories. For the tests, a sensor-dependent system was assembled where the direct comparison between the Hall sensors signals and the detected signals was performed. The obtained results showed that the output sensorless detector signals are very similar to the Hall signals at speeds of more than 2500 rpm. Therefore, the sensorless technique is recommended as a responsible or redundant system to be used in rotary blood pumps.
NASA Astrophysics Data System (ADS)
Yamamoto, Shu; Ara, Takahiro
Recently, induction motors (IMs) and permanent-magnet synchronous motors (PMSMs) have been used in various industrial drive systems. The features of the hardware device used for controlling the adjustable-speed drive in these motors are almost identical. Despite this, different techniques are generally used for parameter measurement and speed-sensorless control of these motors. If the same technique can be used for parameter measurement and sensorless control, a highly versatile adjustable-speed-drive system can be realized. In this paper, the authors describe a new universal sensorless control technique for both IMs and PMSMs (including salient pole and nonsalient pole machines). A mathematical model applicable for IMs and PMSMs is discussed. Using this model, the authors derive the proposed universal sensorless vector control algorithm on the basis of estimation of the stator flux linkage vector. All the electrical motor parameters are determined by a unified test procedure. The proposed method is implemented on three test machines. The actual driving test results demonstrate the validity of the proposed method.
Stator and Rotor Flux Based Deadbeat Direct Torque Control of Induction Machines
NASA Technical Reports Server (NTRS)
Kenny, Barbara H.; Lorenz, Robert D.
2001-01-01
A new, deadbeat type of direct torque control is proposed, analyzed, and experimentally verified in this paper. The control is based on stator and rotor flux as state variables. This choice of state variables allows a graphical representation which is transparent and insightful. The graphical solution shows the effects of realistic considerations such as voltage and current limits. A position and speed sensorless implementation of the control, based on the self-sensing signal injection technique, is also demonstrated experimentally for low speed operation. The paper first develops the new, deadbeat DTC methodology and graphical representation of the new algorithm. It then evaluates feasibility via simulation and experimentally demonstrates performance of the new method with a laboratory prototype including the sensorless methods.
Contrast-based sensorless adaptive optics for retinal imaging
Zhou, Xiaolin; Bedggood, Phillip; Bui, Bang; Nguyen, Christine T.O.; He, Zheng; Metha, Andrew
2015-01-01
Conventional adaptive optics ophthalmoscopes use wavefront sensing methods to characterize ocular aberrations for real-time correction. However, there are important situations in which the wavefront sensing step is susceptible to difficulties that affect the accuracy of the correction. To circumvent these, wavefront sensorless adaptive optics (or non-wavefront sensing AO; NS-AO) imaging has recently been developed and has been applied to point-scanning based retinal imaging modalities. In this study we show, for the first time, contrast-based NS-AO ophthalmoscopy for full-frame in vivo imaging of human and animal eyes. We suggest a robust image quality metric that could be used for any imaging modality, and test its performance against other metrics using (physical) model eyes. PMID:26417525
Stator and Rotor Flux Based Deadbeat Direct Torque Control of Induction Machines
NASA Technical Reports Server (NTRS)
Kenny, Barbara H.; Lorenz, Robert D.
2003-01-01
A new, deadbeat type of direct torque control is proposed, analyzed and experimentally verified in this paper. The control is based on stator and rotor flux as state variables. This choice of state variables allows a graphical representation which is transparent and insightful. The graphical solution shows the effects of realistic considerations such as voltage and current limits. A position and speed sensorless implementation of the control, based on the self-sensing signal injection technique, is also demonstrated experimentally for low speed operation. The paper first develops the new, deadbeat DTC methodology and graphical representation of the new algorithm. It then evaluates feasibility via simulation and experimentally demonstrates performance of the new method with a laboratory prototype including the sensorless methods.
Stator and Rotor Flux Based Deadbeat Direct Torque Control of Induction Machines. Revision 1
NASA Technical Reports Server (NTRS)
Kenny, Barbara H.; Lorenz, Robert D.
2002-01-01
A new, deadbeat type of direct torque control is proposed, analyzed, and experimentally verified in this paper. The control is based on stator and rotor flux as state variables. This choice of state variables allows a graphical representation which is transparent and insightful. The graphical solution shows the effects of realistic considerations such as voltage and current limits. A position and speed sensorless implementation of the control, based on the self-sensing signal injection technique, is also demonstrated experimentally for low speed operation. The paper first develops the new, deadbeat DTC methodology and graphical representation of the new algorithm. It then evaluates feasibility via simulation and experimentally demonstrates performance of the new method with a laboratory prototype including the sensorless methods.
Novel Observer Scheme of Fuzzy-MRAS Sensorless Speed Control of Induction Motor Drive
NASA Astrophysics Data System (ADS)
Chekroun, S.; Zerikat, M.; Mechernene, A.; Benharir, N.
2017-01-01
This paper presents a novel approach Fuzzy-MRAS conception for robust accurate tracking of induction motor drive operating in a high-performance drives environment. Of the different methods for sensorless control of induction motor drive the model reference adaptive system (MRAS) finds lot of attention due to its good performance. The analysis of the sensorless vector control system using MRAS is presented and the resistance parameters variations and speed observer using new Fuzzy Self-Tuning adaptive IP Controller is proposed. In fact, fuzzy logic is reminiscent of human thinking processes and natural language enabling decisions to be made based on vague information. The present approach helps to achieve a good dynamic response, disturbance rejection and low to plant parameter variations of the induction motor. In order to verify the performances of the proposed observer and control algorithms and to test behaviour of the controlled system, numerical simulation is achieved. Simulation results are presented and discussed to shown the validity and the performance of the proposed observer.
NASA Astrophysics Data System (ADS)
Kassem Jebai, Al; Malrait, François; Martin, Philippe; Rouchon, Pierre
2016-03-01
Sensorless control of permanent-magnet synchronous motors at low velocity remains a challenging task. A now well-established method consists of injecting a high-frequency signal and using the rotor saliency, both geometric and magnetic-saturation induced. This paper proposes a clear and original analysis based on second-order averaging of how to recover the position information from signal injection; this analysis blends well with a general model of magnetic saturation. It also proposes a simple parametric model of the saturated motor, based on an energy function which simply encompasses saturation and cross-saturation effects. Experimental results on a surface-mounted motor and an interior magnet motor illustrate the relevance of the approach.
NASA Astrophysics Data System (ADS)
Cao, Jingtai; Zhao, Xiaohui; Li, Zhaokun; Liu, Wei; Gu, Haijun
2017-11-01
The performance of free space optical (FSO) communication system is limited by atmospheric turbulent extremely. Adaptive optics (AO) is the significant method to overcome the atmosphere disturbance. Especially, for the strong scintillation effect, the sensor-less AO system plays a major role for compensation. In this paper, a modified artificial fish school (MAFS) algorithm is proposed to compensate the aberrations in the sensor-less AO system. Both the static and dynamic aberrations compensations are analyzed and the performance of FSO communication before and after aberrations compensations is compared. In addition, MAFS algorithm is compared with artificial fish school (AFS) algorithm, stochastic parallel gradient descent (SPGD) algorithm and simulated annealing (SA) algorithm. It is shown that the MAFS algorithm has a higher convergence speed than SPGD algorithm and SA algorithm, and reaches the better convergence value than AFS algorithm, SPGD algorithm and SA algorithm. The sensor-less AO system with MAFS algorithm effectively increases the coupling efficiency at the receiving terminal with fewer numbers of iterations. In conclusion, the MAFS algorithm has great significance for sensor-less AO system to compensate atmospheric turbulence in FSO communication system.
A high speed model-based approach for wavefront sensorless adaptive optics systems
NASA Astrophysics Data System (ADS)
Lianghua, Wen; Yang, Ping; Shuai, Wang; Wenjing, Liu; Shanqiu, Chen; Xu, Bing
2018-02-01
To improve temporal-frequency property of wavefront sensorless adaptive optics (AO) systems, a fast general model-based aberration correction algorithm is presented. The fast general model-based approach is based on the approximately linear relation between the mean square of the aberration gradients and the second moment of far-field intensity distribution. The presented model-based method is capable of completing a mode aberration effective correction just applying one disturbing onto the deformable mirror(one correction by one disturbing), which is reconstructed by the singular value decomposing the correlation matrix of the Zernike functions' gradients. Numerical simulations of AO corrections under the various random and dynamic aberrations are implemented. The simulation results indicate that the equivalent control bandwidth is 2-3 times than that of the previous method with one aberration correction after applying N times disturbing onto the deformable mirror (one correction by N disturbing).
Sensorless sliding mode observer for a five-phase permanent magnet synchronous motor drive.
Hosseyni, Anissa; Trabelsi, Ramzi; Mimouni, Med Faouzi; Iqbal, Atif; Alammari, Rashid
2015-09-01
This paper deals with the sensorless vector controlled five-phase permanent magnet synchronous motor (PMSM) drive based on a sliding mode observer (SMO). The observer is designed considering the back electromotive force (EMF) of five-phase permanent magnet synchronous motor. The SMO structure and design are illustrated. Stability of the proposed observer is demonstrated using Lyapunov stability criteria. The proposed strategy is asymptotically stable in the context of Lyapunov theory. Simulated results on a five-phase PMSM drive are displayed to validate the feasibility and the effectiveness of the proposed control strategy. Copyright © 2015 ISA. Published by Elsevier Ltd. All rights reserved.
A sensorless method for measuring the point mobility of mechanical structures
NASA Astrophysics Data System (ADS)
Boulandet, R.; Michau, M.; Herzog, P.; Micheau, P.; Berry, A.
2016-09-01
This paper presents a convenient and cost-effective experimental tool for measuring the mobility characteristics of a mechanical structure. The objective is to demonstrate that the point mobility measurement can be performed using only an electrodynamic inertial exciter. Unlike previous work based on voice coil actuators, no load cell or accelerometer is needed. Instead, it is theoretically shown that the mobility characteristics of the structure can be estimated from variations in the electrical input impedance of the actuator fixed onto it, provided that the electromechanical parameters of the actuator are known. The proof of concept is made experimentally using a cheap commercially available actuator on a simply supported plate, leading to a good dynamic range from 100 Hz to 1 kHz. The methodology to assess the basic parameters of the actuator is also given. Measured data are compared to a standard shaker testing and the strengths and weaknesses of the sensorless mobility measuring device are discussed. It is believed that this sensorless mobility measuring device can be a convenient experimental tool to determine the dynamic characteristics of a wide range of mechanical structures.
Constant Switching Frequency DTC for Matrix Converter Fed Speed Sensorless Induction Motor Drive
NASA Astrophysics Data System (ADS)
Mir, Tabish Nazir; Singh, Bhim; Bhat, Abdul Hamid
2018-05-01
The paper presents a constant switching frequency scheme for speed sensorless Direct Torque Control (DTC) of Matrix Converter fed Induction Motor Drive. The use of matrix converter facilitates improved power quality on input as well as motor side, along with Input Power Factor control, besides eliminating the need for heavy passive elements. Moreover, DTC through Space Vector Modulation helps in achieving a fast control over the torque and flux of the motor, with added benefit of constant switching frequency. A constant switching frequency aids in maintaining desired power quality of AC mains current even at low motor speeds, and simplifies input filter design of the matrix converter, as compared to conventional hysteresis based DTC. Further, stator voltage estimation from sensed input voltage, and subsequent stator (and rotor) flux estimation is done. For speed sensorless operation, a Model Reference Adaptive System is used, which emulates the speed dependent rotor flux equations of the induction motor. The error between conventionally estimated rotor flux (reference model) and the rotor flux estimated through the adaptive observer is processed through PI controller to generate the rotor speed estimate.
Zorgani, Youssef Agrebi; Koubaa, Yassine; Boussak, Mohamed
2016-03-01
This paper presents a novel method for estimating the load torque of a sensorless indirect stator flux oriented controlled (ISFOC) induction motor drive based on the model reference adaptive system (MRAS) scheme. As a matter of fact, this method is meant to inter-connect a speed estimator with the load torque observer. For this purpose, a MRAS has been applied to estimate the rotor speed with tuned load torque in order to obtain a high performance ISFOC induction motor drive. The reference and adjustable models, developed in the stationary stator reference frame, are used in the MRAS scheme in an attempt to estimate the speed of the measured terminal voltages and currents. The load torque is estimated by means of a Luenberger observer defined throughout the mechanical equation. Every observer state matrix depends on the mechanical characteristics of the machine taking into account the vicious friction coefficient and inertia moment. Accordingly, some simulation results are presented to validate the proposed method and to highlight the influence of the variation of the inertia moment and the friction coefficient on the speed and the estimated load torque. The experimental results, concerning to the sensorless speed with a load torque estimation, are elaborated in order to validate the effectiveness of the proposed method. The complete sensorless ISFOC with load torque estimation is successfully implemented in real time using a digital signal processor board DSpace DS1104 for a laboratory 3 kW induction motor. Copyright © 2016 ISA. Published by Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Petrovic, Goran; Kilic, Tomislav; Terzic, Bozo
2009-04-01
In this paper a sensorless speed detection method of induction squirrel-cage machines is presented. This method is based on frequency determination of the stator neutral point voltage primary slot harmonic, which is dependent on rotor speed. In order to prove method in steady state and dynamic conditions the simulation and experimental study was carried out. For theoretical investigation the mathematical model of squirrel cage induction machines, which takes into consideration actual geometry and windings layout, is used. Speed-related harmonics that arise from rotor slotting are analyzed using digital signal processing and DFT algorithm with Hanning window. The performance of the method is demonstrated over a wide range of load conditions.
Li, Haitao; Ning, Xin; Li, Wenzhuo
2017-03-01
In order to improve the reliability and reduce power consumption of the high speed BLDC motor system, this paper presents a model free adaptive control (MFAC) based position sensorless drive with only a dc-link current sensor. The initial commutation points are obtained by detecting the phase of EMF zero-crossing point and then delaying 30 electrical degrees. According to the commutation error caused by the low pass filter (LPF) and other factors, the relationship between commutation error angle and dc-link current is analyzed, a corresponding MFAC based control method is proposed, and the commutation error can be corrected by the controller in real time. Both the simulation and experimental results show that the proposed correction method can achieve ideal commutation effect within the entire operating speed range. Copyright © 2016 ISA. Published by Elsevier Ltd. All rights reserved.
Design and realization of adaptive optical principle system without wavefront sensing
NASA Astrophysics Data System (ADS)
Wang, Xiaobin; Niu, Chaojun; Guo, Yaxing; Han, Xiang'e.
2018-02-01
In this paper, we focus on the performance improvement of the free space optical communication system and carry out the research on wavefront-sensorless adaptive optics. We use a phase only liquid crystal spatial light modulator (SLM) as the wavefront corrector. The optical intensity distribution of the distorted wavefront is detected by a CCD. We develop a wavefront controller based on ARM and a software based on the Linux operating system. The wavefront controller can control the CCD camera and the wavefront corrector. There being two SLMs in the experimental system, one simulates atmospheric turbulence and the other is used to compensate the wavefront distortion. The experimental results show that the performance quality metric (the total gray value of 25 pixels) increases from 3037 to 4863 after 200 iterations. Besides, it is demonstrated that our wavefront-sensorless adaptive optics system based on SPGD algorithm has a good performance in compensating wavefront distortion.
Sensorless position estimator applied to nonlinear IPMC model
NASA Astrophysics Data System (ADS)
Bernat, Jakub; Kolota, Jakub
2016-11-01
This paper addresses the issue of estimating position for an ionic polymer metal composite (IPMC) known as electro active polymer (EAP). The key step is the construction of a sensorless mode considering only current feedback. This work takes into account nonlinearities caused by electrochemical effects in the material. Owing to the recent observer design technique, the authors obtained both Lyapunov function based estimation law as well as sliding mode observer. To accomplish the observer design, the IPMC model was identified through a series of experiments. The research comprises time domain measurements. The identification process was completed by means of geometric scaling of three test samples. In the proposed design, the estimated position accurately tracks the polymer position, which is illustrated by the experiments.
Model-based wavefront sensorless adaptive optics system for large aberrations and extended objects.
Yang, Huizhen; Soloviev, Oleg; Verhaegen, Michel
2015-09-21
A model-based wavefront sensorless (WFSless) adaptive optics (AO) system with a 61-element deformable mirror is simulated to correct the imaging of a turbulence-degraded extended object. A fast closed-loop control algorithm, which is based on the linear relation between the mean square of the aberration gradients and the second moment of the image intensity distribution, is used to generate the control signals for the actuators of the deformable mirror (DM). The restoration capability and the convergence rate of the AO system are investigated with different turbulence strength wave-front aberrations. Simulation results show the model-based WFSless AO system can restore those images degraded by different turbulence strengths successfully and obtain the correction very close to the achievable capability of the given DM. Compared with the ideal correction of 61-element DM, the averaged relative error of RMS value is 6%. The convergence rate of AO system is independent of the turbulence strength and only depends on the number of actuators of DM.
Verstraete, Hans R. G. W.; Heisler, Morgan; Ju, Myeong Jin; Wahl, Daniel; Bliek, Laurens; Kalkman, Jeroen; Bonora, Stefano; Jian, Yifan; Verhaegen, Michel; Sarunic, Marinko V.
2017-01-01
In this report, which is an international collaboration of OCT, adaptive optics, and control research, we demonstrate the Data-based Online Nonlinear Extremum-seeker (DONE) algorithm to guide the image based optimization for wavefront sensorless adaptive optics (WFSL-AO) OCT for in vivo human retinal imaging. The ocular aberrations were corrected using a multi-actuator adaptive lens after linearization of the hysteresis in the piezoelectric actuators. The DONE algorithm succeeded in drastically improving image quality and the OCT signal intensity, up to a factor seven, while achieving a computational time of 1 ms per iteration, making it applicable for many high speed applications. We demonstrate the correction of five aberrations using 70 iterations of the DONE algorithm performed over 2.8 s of continuous volumetric OCT acquisition. Data acquired from an imaging phantom and in vivo from human research volunteers are presented. PMID:28736670
Verstraete, Hans R G W; Heisler, Morgan; Ju, Myeong Jin; Wahl, Daniel; Bliek, Laurens; Kalkman, Jeroen; Bonora, Stefano; Jian, Yifan; Verhaegen, Michel; Sarunic, Marinko V
2017-04-01
In this report, which is an international collaboration of OCT, adaptive optics, and control research, we demonstrate the Data-based Online Nonlinear Extremum-seeker (DONE) algorithm to guide the image based optimization for wavefront sensorless adaptive optics (WFSL-AO) OCT for in vivo human retinal imaging. The ocular aberrations were corrected using a multi-actuator adaptive lens after linearization of the hysteresis in the piezoelectric actuators. The DONE algorithm succeeded in drastically improving image quality and the OCT signal intensity, up to a factor seven, while achieving a computational time of 1 ms per iteration, making it applicable for many high speed applications. We demonstrate the correction of five aberrations using 70 iterations of the DONE algorithm performed over 2.8 s of continuous volumetric OCT acquisition. Data acquired from an imaging phantom and in vivo from human research volunteers are presented.
Ren, Jun-Jie; Liu, Yan-Cheng; Wang, Ning; Liu, Si-Yuan
2015-01-01
This paper proposes a sensorless speed control strategy for ship propulsion interior permanent magnet synchronous motor (IPMSM) based on a new sliding-mode observer (SMO). In the SMO the low-pass filter and the method of arc-tangent calculation of extended electromotive force (EMF) or phase-locked loop (PLL) technique are not used. The calculation of the rotor speed is deduced from the Lyapunov function stability analysis. In order to reduce system chattering, sigmoid functions with switching gains being adaptively updated by fuzzy logic systems are innovatively incorporated into the SMO. Finally, simulation results for a 4.088 MW ship propulsion IPMSM and experimental results from a 7.5 kW IPMSM drive are provided to verify the effectiveness of the proposed SMO method. Copyright © 2014 ISA. Published by Elsevier Ltd. All rights reserved.
Wavefront sensorless adaptive optics temporal focusing-based multiphoton microscopy
Chang, Chia-Yuan; Cheng, Li-Chung; Su, Hung-Wei; Hu, Yvonne Yuling; Cho, Keng-Chi; Yen, Wei-Chung; Xu, Chris; Dong, Chen Yuan; Chen, Shean-Jen
2014-01-01
Temporal profile distortions reduce excitation efficiency and image quality in temporal focusing-based multiphoton microscopy. In order to compensate the distortions, a wavefront sensorless adaptive optics system (AOS) was integrated into the microscope. The feedback control signal of the AOS was acquired from local image intensity maximization via a hill-climbing algorithm. The control signal was then utilized to drive a deformable mirror in such a way as to eliminate the distortions. With the AOS correction, not only is the axial excitation symmetrically refocused, but the axial resolution with full two-photon excited fluorescence (TPEF) intensity is also maintained. Hence, the contrast of the TPEF image of a R6G-doped PMMA thin film is enhanced along with a 3.7-fold increase in intensity. Furthermore, the TPEF image quality of 1μm fluorescent beads sealed in agarose gel at different depths is improved. PMID:24940539
Method and apparatus for sensorless operation of brushless permanent magnet motors
Sriram, Tillasthanam V.
1998-01-01
A sensorless method and apparatus for providing commutation timing signals for a brushless permanent magnet motor extracts the third harmonic back-emf of a three-phase stator winding and independently cyclically integrates the positive and negative half-cycles thereof and compares the results to a reference level associated with a desired commutation angle.
Method and apparatus for sensorless operation of brushless permanent magnet motors
Sriram, T.V.
1998-04-14
A sensorless method and apparatus for providing commutation timing signals for a brushless permanent magnet motor extracts the third harmonic back-emf of a three-phase stator winding and independently cyclically integrates the positive and negative half-cycles thereof and compares the results to a reference level associated with a desired commutation angle. 23 figs.
NASA Astrophysics Data System (ADS)
Chang, C. L.; Chen, C. Y.; Sung, C. C.; Liou, D. H.
This study presents a novel fuel sensor-less control scheme for a liquid feed fuel cell system that does not rely on a fuel concentration sensor. The proposed approach simplifies the design and reduces the cost and complexity of a liquid feed fuel cell system, and is especially suited to portable power sources, of which the volume and weight are important. During the reaction of a fuel cell, the cell's operating characteristics, such as potential, current and power are measured to control the supply of fuel and regulate its concentration to optimize performance. Experiments were conducted to verify that the fuel sensor-less control algorithm is effective in the liquid feed fuel cell system.
Yue, Dan; Nie, Haitao; Li, Ye; Ying, Changsheng
2018-03-01
Wavefront sensorless (WFSless) adaptive optics (AO) systems have been widely studied in recent years. To reach optimum results, such systems require an efficient correction method. This paper presents a fast wavefront correction approach for a WFSless AO system mainly based on the linear phase diversity (PD) technique. The fast closed-loop control algorithm is set up based on the linear relationship between the drive voltage of the deformable mirror (DM) and the far-field images of the system, which is obtained through the linear PD algorithm combined with the influence function of the DM. A large number of phase screens under different turbulence strengths are simulated to test the performance of the proposed method. The numerical simulation results show that the method has fast convergence rate and strong correction ability, a few correction times can achieve good correction results, and can effectively improve the imaging quality of the system while needing fewer measurements of CCD data.
Portable DMFC system with methanol sensor-less control
NASA Astrophysics Data System (ADS)
Chen, C. Y.; Liu, D. H.; Huang, C. L.; Chang, C. L.
This work develops a prototype 20 W portable DMFC by system integration of stack, condenser, methanol sensor-less control and start-up characteristics. The effects of these key components and control schemes on the performance are also discussed. To expedite the use of portable DMFC in electronic applications, the system utilizes a novel methanol sensor-less control method, providing improved fuel efficiency, durability, miniaturization and cost reduction. The operating characteristics of the DMFC stack are applied to control the fuel ejection time and period, enabling the system to continue operating even when the MEAs of the stack are deteriorated. The portable system is also designed with several features including water balance and quick start-up (in 5 min). Notably, the proposed system using methanol sensor-less control with injection of pure methanol can power the DVD player and notebook PC. The system specific energy and energy density following three days of operation are 362 Wh kg -1 and 335 Wh L -1, respectively, which are better than those of lithium batteries (∼150 Wh kg -1 and ∼250 Wh L -). This good energy storage feature demonstrates that the portable DMFC is likely to be valuable in computer, communication and consumer electronic (3C) markets.
Control algorithms and applications of the wavefront sensorless adaptive optics
NASA Astrophysics Data System (ADS)
Ma, Liang; Wang, Bin; Zhou, Yuanshen; Yang, Huizhen
2017-10-01
Compared with the conventional adaptive optics (AO) system, the wavefront sensorless (WFSless) AO system need not to measure the wavefront and reconstruct it. It is simpler than the conventional AO in system architecture and can be applied to the complex conditions. Based on the analysis of principle and system model of the WFSless AO system, wavefront correction methods of the WFSless AO system were divided into two categories: model-free-based and model-based control algorithms. The WFSless AO system based on model-free-based control algorithms commonly considers the performance metric as a function of the control parameters and then uses certain control algorithm to improve the performance metric. The model-based control algorithms include modal control algorithms, nonlinear control algorithms and control algorithms based on geometrical optics. Based on the brief description of above typical control algorithms, hybrid methods combining the model-free-based control algorithm with the model-based control algorithm were generalized. Additionally, characteristics of various control algorithms were compared and analyzed. We also discussed the extensive applications of WFSless AO system in free space optical communication (FSO), retinal imaging in the human eye, confocal microscope, coherent beam combination (CBC) techniques and extended objects.
Sensorless H∞ speed-tracking synthesis for surface-mount permanent magnet synchronous motor.
Ramírez-Villalobos, Ramón; Aguilar, Luis T; Coria, Luis N
2017-03-01
In this paper, a sensorless speed tracking control is proposed for a surface-mount permanent magnet synchronous motor by using a nonlinear H ∞ -controller via stator currents measurements for feedback. An output feedback nonlinear H ∞ -controller was designed such that the undisturbed system is uniformly asymptotically stable around the desired speed reference, while also the effects of external vanishing and non-vanishing disturbances, noise, and input backlash were attenuated locally. The rotor position was calculated from the causal dynamic output feedback compensator and from the desired speed reference. The existence of the proper solutions of the perturbed differential Riccati equations ensures stabilizability and detectability of the control system. The efficiency of the proposed sensorless controller was supported by numerical simulations. Copyright © 2017 ISA. Published by Elsevier Ltd. All rights reserved.
Sensorless Estimation and Nonlinear Control of a Rotational Energy Harvester
NASA Astrophysics Data System (ADS)
Nunna, Kameswarie; Toh, Tzern T.; Mitcheson, Paul D.; Astolfi, Alessandro
2013-12-01
It is important to perform sensorless monitoring of parameters in energy harvesting devices in order to determine the operating states of the system. However, physical measurements of these parameters is often a challenging task due to the unavailability of access points. This paper presents, as an example application, the design of a nonlinear observer and a nonlinear feedback controller for a rotational energy harvester. A dynamic model of a rotational energy harvester with its power electronic interface is derived and validated. This model is then used to design a nonlinear observer and a nonlinear feedback controller which yield a sensorless closed-loop system. The observer estimates the mechancial quantities from the measured electrical quantities while the control law sustains power generation across a range of source rotation speeds. The proposed scheme is assessed through simulations and experiments.
Sensorless optimal sinusoidal brushless direct current for hard disk drives
NASA Astrophysics Data System (ADS)
Soh, C. S.; Bi, C.
2009-04-01
Initiated by the availability of digital signal processors and emergence of new applications, market demands for permanent magnet synchronous motors have been surging. As its back-emf is sinusoidal, the drive current should also be sinusoidal for reducing the torque ripple. However, in applications like hard disk drives, brushless direct current (BLDC) drive is adopted instead of sinusoidal drive for simplification. The adoption, however, comes at the expense of increased harmonics, losses, torque pulsations, and acoustics. In this paper, we propose a sensorless optimal sinusoidal BLDC drive. First and foremost, the derivation for an optimal sinusoidal drive is presented, and a power angle control scheme is proposed to achieve an optimal sinusoidal BLDC. The scheme maintains linear relationship between the motor speed and drive voltage. In an attempt to execute the sensorless drive, an innovative power angle measurement scheme is devised, which takes advantage of the freewheeling diodes and measures the power angle through the detection of diode voltage drops. The objectives as laid out will be presented and discussed in this paper, supported by derivations, simulations, and experimental results. The proposed scheme is straightforward, brings about the benefits of sensorless sinusoidal drive, negates the need for current sensors by utilizing the freewheeling diodes, and does not incur additional cost.
New Technique of High-Performance Torque Control Developed for Induction Machines
NASA Technical Reports Server (NTRS)
Kenny, Barbara H.
2003-01-01
Two forms of high-performance torque control for motor drives have been described in the literature: field orientation control and direct torque control. Field orientation control has been the method of choice for previous NASA electromechanical actuator research efforts with induction motors. Direct torque control has the potential to offer some advantages over field orientation, including ease of implementation and faster response. However, the most common form of direct torque control is not suitable for the highspeed, low-stator-flux linkage induction machines designed for electromechanical actuators with the presently available sample rates of digital control systems (higher sample rates are required). In addition, this form of direct torque control is not suitable for the addition of a high-frequency carrier signal necessary for the "self-sensing" (sensorless) position estimation technique. This technique enables low- and zero-speed position sensorless operation of the machine. Sensorless operation is desirable to reduce the number of necessary feedback signals and transducers, thus improving the reliability and reducing the mass and volume of the system. This research was directed at developing an alternative form of direct torque control known as a "deadbeat," or inverse model, solution. This form uses pulse-width modulation of the voltage applied to the machine, thus reducing the necessary sample and switching frequency for the high-speed NASA motor. In addition, the structure of the deadbeat form allows the addition of the high-frequency carrier signal so that low- and zero-speed sensorless operation is possible. The new deadbeat solution is based on using the stator and rotor flux as state variables. This choice of state variables leads to a simple graphical representation of the solution as the intersection of a constant torque line with a constant stator flux circle. Previous solutions have been expressed only in complex mathematical terms without a method to clearly visualize the solution. The graphical technique allows a more insightful understanding of the operation of the machine under various conditions.
Fuzzy crane control with sensorless payload deflection feedback for vibration reduction
NASA Astrophysics Data System (ADS)
Smoczek, Jaroslaw
2014-05-01
Different types of cranes are widely used for shifting cargoes in building sites, shipping yards, container terminals and many manufacturing segments where the problem of fast and precise transferring a payload suspended on the ropes with oscillations reduction is frequently important to enhance the productivity, efficiency and safety. The paper presents the fuzzy logic-based robust feedback anti-sway control system which can be applicable either with or without a sensor of sway angle of a payload. The discrete-time control approach is based on the fuzzy interpolation of the controllers and crane dynamic model's parameters with respect to the varying rope length and mass of a payload. The iterative procedure combining a pole placement method and interval analysis of closed-loop characteristic polynomial coefficients is proposed to design the robust control scheme. The sensorless anti-sway control application developed with using PAC system with RX3i controller was verified on the laboratory scaled overhead crane.
Proposition for sensorless self-excitation by a piezoelectric device
NASA Astrophysics Data System (ADS)
Tanaka, Y.; Kokubun, Y.; Yabuno, H.
2018-04-01
In this paper, we propose a method to realize self-excitation in an oscillator actuated by a piezoelectric device without a sensor. In general, the positive feedback associated with the oscillator velocity causes the self-excitation. Instead of measuring the velocity with a sensor, we utilize the electro-mechanical coupling effect in the oscillator and piezoelectric device. We drive the piezoelectric device with a current proportional to the linear combination of the voltage across the terminals of the piezoelectric device and its differential voltage signal. Then, the oscillator with the piezoelectric device behaves like a third-order system, which has three eigenvalues. The self-excitation can be realized because appropriate feedback gains can set two of the eigenvalues to be conjugate complex roots with a positive real part and the other eigenvalue to be a negative real root. To confirm the validity of the proposed method, we experimentally demonstrated the sensorless self-excitation and, as an application example, carried out mass sensing in a sensorless self-excited macrocantilever.
NASA Astrophysics Data System (ADS)
Astik, Mitesh B.; Bhatt, Praghnesh; Bhalja, Bhavesh R.
2017-03-01
A sensorless control scheme based on an unknown input observer is presented in this paper in which back EMF of the Brushless DC Motor (BLDC) is continuously estimated from available line voltages and currents. During negative rotation of motor, actual and estimated speed fail to track the reference speed and if the corrective action is not taken by the observer, the motor goes into saturation. To overcome this problem, the speed estimation algorithm has been implemented in this paper to control the dynamic behavior of the motor during negative rotation. The Ackermans method was used to calculate the gains of an unknown input observer which is based on the appropriate choice of the eigenvalues in advance. The criteria to choose eigenvalue is to obtain a balance between faster convergence rate and the least noise level. Simulations have been carried out for different disturbances such as step changes in motor reference speed and load torque. The comparative simulation results clearly depict that the disturbance effects in actual and estimated responses minimizes as observer gain setting increases.
Sensor-less force-reflecting macro-micro telemanipulation systems by piezoelectric actuators.
Amini, H; Farzaneh, B; Azimifar, F; Sarhan, A A D
2016-09-01
This paper establishes a novel control strategy for a nonlinear bilateral macro-micro teleoperation system with time delay. Besides position and velocity signals, force signals are additionally utilized in the control scheme. This modification significantly improves the poor transparency during contact with the environment. To eliminate external force measurement, a force estimation algorithm is proposed for the master and slave robots. The closed loop stability of the nonlinear micro-micro teleoperation system with the proposed control scheme is investigated employing the Lyapunov theory. Consequently, the experimental results verify the efficiency of the new control scheme in free motion and during collision between the slave robot and the environment of slave robot with environment, and the efficiency of the force estimation algorithm. Copyright © 2016 ISA. Published by Elsevier Ltd. All rights reserved.
Sensorless battery temperature measurements based on electrochemical impedance spectroscopy
NASA Astrophysics Data System (ADS)
Raijmakers, L. H. J.; Danilov, D. L.; van Lammeren, J. P. M.; Lammers, M. J. G.; Notten, P. H. L.
2014-02-01
A new method is proposed to measure the internal temperature of (Li-ion) batteries. Based on electrochemical impedance spectroscopy measurements, an intercept frequency (f0) can be determined which is exclusively related to the internal battery temperature. The intercept frequency is defined as the frequency at which the imaginary part of the impedance is zero (Zim = 0), i.e. where the phase shift between the battery current and voltage is absent. The advantage of the proposed method is twofold: (i) no hardware temperature sensors are required anymore to monitor the battery temperature and (ii) the method does not suffer from heat transfer delays. Mathematical analysis of the equivalent electrical-circuit, representing the battery performance, confirms that the intercept frequency decreases with rising temperatures. Impedance measurements on rechargeable Li-ion cells of various chemistries were conducted to verify the proposed method. These experiments reveal that the intercept frequency is clearly dependent on the temperature and does not depend on State-of-Charge (SoC) and aging. These impedance-based sensorless temperature measurements are therefore simple and convenient for application in a wide range of stationary, mobile and high-power devices, such as hybrid- and full electric vehicles.
Wind Velocity and Position Sensor-less Operation for PMSG Wind Generator
NASA Astrophysics Data System (ADS)
Senjyu, Tomonobu; Tamaki, Satoshi; Urasaki, Naomitsu; Uezato, Katsumi; Funabashi, Toshihisa; Fujita, Hideki
Electric power generation using non-conventional sources is receiving considerable attention throughout the world. Wind energy is one of the available non-conventional energy sources. Electrical power generation using wind energy is possible in two ways, viz. constant speed operation and variable speed operation using power electronic converters. Variable speed power generation is attractive, because maximum electric power can be generated at all wind velocities. However, this system requires a rotor speed sensor, for vector control purpose, which increases the cost of the system. To alleviate the need of rotor speed sensor in vector control, we propose a new sensor-less control of PMSG (Permanent Magnet Synchronous Generator) based on the flux linkage. We can estimate the rotor position using the estimated flux linkage. We use a first-order lag compensator to obtain the flux linkage. Furthermore‚we estimate wind velocity and rotation speed using a observer. The effectiveness of the proposed method is demonstrated thorough simulation results.
A sensor-less LED dimming system based on daylight harvesting with BIPV systems.
Yoo, Seunghwan; Kim, Jonghun; Jang, Cheol-Yong; Jeong, Hakgeun
2014-01-13
Artificial lighting in office buildings typically requires 30% of the total energy consumption of the building, providing a substantial opportunity for energy savings. To reduce the energy consumed by indoor lighting, we propose a sensor-less light-emitting diode (LED) dimming system using daylight harvesting. In this study, we used light simulation software to quantify and visualize daylight, and analyzed the correlation between photovoltaic (PV) power generation and indoor illumination in an office with an integrated PV system. In addition, we calculated the distribution of daylight illumination into the office and dimming ratios for the individual control of LED lights. Also, we were able directly to use the electric power generated by PV system. As a result, power consumption for electric lighting was reduced by 40 - 70% depending on the season and the weather conditions. Thus, the dimming system proposed in this study can be used to control electric lighting to reduce energy use cost-effectively and simply.
Holakooie, Mohammad Hosein; Ojaghi, Mansour; Taheri, Asghar
2016-01-01
This paper investigates sensorless indirect field oriented control (IFOC) of SLIM with full-order Luenberger observer. The dynamic equations of SLIM are first elaborated to draw full-order Luenberger observer with some simplifying assumption. The observer gain matrix is derived from conventional procedure so that observer poles are proportional to SLIM poles to ensure the stability of system for wide range of linear speed. The operation of observer is significantly impressed by adaptive scheme. A fuzzy logic control (FLC) is proposed as adaptive scheme to estimate linear speed using speed tuning signal. The parameters of FLC are tuned using an off-line method through chaotic optimization algorithm (COA). The performance of the proposed observer is verified by both numerical simulation and real-time hardware-in-the-loop (HIL) implementation. Moreover, a detailed comparative study among proposed and other speed observers is obtained under different operation conditions. Copyright © 2015 ISA. Published by Elsevier Ltd. All rights reserved.
Wang, Shun-Yuan; Tseng, Chwan-Lu; Lin, Shou-Chuang; Chiu, Chun-Jung; Chou, Jen-Hsiang
2015-01-01
This paper presents the implementation of an adaptive supervisory sliding fuzzy cerebellar model articulation controller (FCMAC) in the speed sensorless vector control of an induction motor (IM) drive system. The proposed adaptive supervisory sliding FCMAC comprised a supervisory controller, integral sliding surface, and an adaptive FCMAC. The integral sliding surface was employed to eliminate steady-state errors and enhance the responsiveness of the system. The adaptive FCMAC incorporated an FCMAC with a compensating controller to perform a desired control action. The proposed controller was derived using the Lyapunov approach, which guarantees learning-error convergence. The implementation of three intelligent control schemes—the adaptive supervisory sliding FCMAC, adaptive sliding FCMAC, and adaptive sliding CMAC—were experimentally investigated under various conditions in a realistic sensorless vector-controlled IM drive system. The root mean square error (RMSE) was used as a performance index to evaluate the experimental results of each control scheme. The analysis results indicated that the proposed adaptive supervisory sliding FCMAC substantially improved the system performance compared with the other control schemes. PMID:25815450
Wang, Shun-Yuan; Tseng, Chwan-Lu; Lin, Shou-Chuang; Chiu, Chun-Jung; Chou, Jen-Hsiang
2015-03-25
This paper presents the implementation of an adaptive supervisory sliding fuzzy cerebellar model articulation controller (FCMAC) in the speed sensorless vector control of an induction motor (IM) drive system. The proposed adaptive supervisory sliding FCMAC comprised a supervisory controller, integral sliding surface, and an adaptive FCMAC. The integral sliding surface was employed to eliminate steady-state errors and enhance the responsiveness of the system. The adaptive FCMAC incorporated an FCMAC with a compensating controller to perform a desired control action. The proposed controller was derived using the Lyapunov approach, which guarantees learning-error convergence. The implementation of three intelligent control schemes--the adaptive supervisory sliding FCMAC, adaptive sliding FCMAC, and adaptive sliding CMAC--were experimentally investigated under various conditions in a realistic sensorless vector-controlled IM drive system. The root mean square error (RMSE) was used as a performance index to evaluate the experimental results of each control scheme. The analysis results indicated that the proposed adaptive supervisory sliding FCMAC substantially improved the system performance compared with the other control schemes.
Sensorless Control of Permanent Magnet Machine for NASA Flywheel Technology Development
NASA Technical Reports Server (NTRS)
Kenny, Barbara H.; Kascak, Peter E.
2002-01-01
This paper describes the position sensorless algorithms presently used in the motor control for the NASA "in-house" development work of the flywheel energy storage system. At zero and low speeds a signal injection technique, the self-sensing method, is used to determine rotor position. At higher speeds, an open loop estimate of the back EMF of the machine is made to determine the rotor position. At start up, the rotor is set to a known position by commanding dc into one of the phase windings. Experimental results up to 52,000 rpm are presented.
Alert management for home healthcare based on home automation analysis.
Truong, T T; de Lamotte, F; Diguet, J-Ph; Said-Hocine, F
2010-01-01
Rising healthcare for elder and disabled people can be controlled by offering people autonomy at home by means of information technology. In this paper, we present an original and sensorless alert management solution which performs multimedia and home automation service discrimination and extracts highly regular home activities as sensors for alert management. The results of simulation data, based on real context, allow us to evaluate our approach before application to real data.
Lens-based wavefront sensorless adaptive optics swept source OCT
NASA Astrophysics Data System (ADS)
Jian, Yifan; Lee, Sujin; Ju, Myeong Jin; Heisler, Morgan; Ding, Weiguang; Zawadzki, Robert J.; Bonora, Stefano; Sarunic, Marinko V.
2016-06-01
Optical coherence tomography (OCT) has revolutionized modern ophthalmology, providing depth resolved images of the retinal layers in a system that is suited to a clinical environment. Although the axial resolution of OCT system, which is a function of the light source bandwidth, is sufficient to resolve retinal features at a micrometer scale, the lateral resolution is dependent on the delivery optics and is limited by ocular aberrations. Through the combination of wavefront sensorless adaptive optics and the use of dual deformable transmissive optical elements, we present a compact lens-based OCT system at an imaging wavelength of 1060 nm for high resolution retinal imaging. We utilized a commercially available variable focal length lens to correct for a wide range of defocus commonly found in patient’s eyes, and a novel multi-actuator adaptive lens for aberration correction to achieve near diffraction limited imaging performance at the retina. With a parallel processing computational platform, high resolution cross-sectional and en face retinal image acquisition and display was performed in real time. In order to demonstrate the system functionality and clinical utility, we present images of the photoreceptor cone mosaic and other retinal layers acquired in vivo from research subjects.
Dong, Bing; Li, Yan; Han, Xin-Li; Hu, Bin
2016-09-02
For high-speed aircraft, a conformal window is used to optimize the aerodynamic performance. However, the local shape of the conformal window leads to large amounts of dynamic aberrations varying with look angle. In this paper, deformable mirror (DM) and model-based wavefront sensorless adaptive optics (WSLAO) are used for dynamic aberration correction of an infrared remote sensor equipped with a conformal window and scanning mirror. In model-based WSLAO, aberration is captured using Lukosz mode, and we use the low spatial frequency content of the image spectral density as the metric function. Simulations show that aberrations induced by the conformal window are dominated by some low-order Lukosz modes. To optimize the dynamic correction, we can only correct dominant Lukosz modes and the image size can be minimized to reduce the time required to compute the metric function. In our experiment, a 37-channel DM is used to mimic the dynamic aberration of conformal window with scanning rate of 10 degrees per second. A 52-channel DM is used for correction. For a 128 × 128 image, the mean value of image sharpness during dynamic correction is 1.436 × 10(-5) in optimized correction and is 1.427 × 10(-5) in un-optimized correction. We also demonstrated that model-based WSLAO can achieve convergence two times faster than traditional stochastic parallel gradient descent (SPGD) method.
NASA Astrophysics Data System (ADS)
Pozzi, Paolo; Wilding, Dean; Soloviev, Oleg; Vdovin, Gleb; Verhaegen, Michel
2018-02-01
In this work, we present a new confocal laser scanning microscope capable to perform sensorless wavefront optimization in real time. The device is a parallelized laser scanning microscope in which the excitation light is structured in a lattice of spots by a spatial light modulator, while a deformable mirror provides aberration correction and scanning. A binary DMD is positioned in an image plane of the detection optical path, acting as a dynamic array of reflective confocal pinholes, images by a high performance cmos camera. A second camera detects images of the light rejected by the pinholes for sensorless aberration correction.
NASA Astrophysics Data System (ADS)
Yoneda, Makoto; Dohmeki, Hideo
The position control system with the advantage large torque, low vibration, and high resolution can be obtained by the constant current micro step drive applied to hybrid stepping motor. However loss is large, in order not to be concerned with load torque but to control current uniformly. As the one technique of a position control system in which high efficiency is realizable, the same sensorless control as a permanent magnet motor is effective. But, it was the purpose that the control method proposed until now controls speed. Then, this paper proposed changing the drive method of micro step drive and sensorless drive. The change of the drive method was verified from the simulation and the experiment. On no load, it was checked not producing change of a large speed at the time of a change by making electrical angle and carrying out zero reset of the integrator. On load, it was checked that a large speed change arose. The proposed system could change drive method by setting up the initial value of an integrator using the estimated result, without producing speed change. With this technique, the low loss position control system, which employed the advantage of the hybrid stepping motor, has been built.
Dong, Bing; Li, Yan; Han, Xin-li; Hu, Bin
2016-01-01
For high-speed aircraft, a conformal window is used to optimize the aerodynamic performance. However, the local shape of the conformal window leads to large amounts of dynamic aberrations varying with look angle. In this paper, deformable mirror (DM) and model-based wavefront sensorless adaptive optics (WSLAO) are used for dynamic aberration correction of an infrared remote sensor equipped with a conformal window and scanning mirror. In model-based WSLAO, aberration is captured using Lukosz mode, and we use the low spatial frequency content of the image spectral density as the metric function. Simulations show that aberrations induced by the conformal window are dominated by some low-order Lukosz modes. To optimize the dynamic correction, we can only correct dominant Lukosz modes and the image size can be minimized to reduce the time required to compute the metric function. In our experiment, a 37-channel DM is used to mimic the dynamic aberration of conformal window with scanning rate of 10 degrees per second. A 52-channel DM is used for correction. For a 128 × 128 image, the mean value of image sharpness during dynamic correction is 1.436 × 10−5 in optimized correction and is 1.427 × 10−5 in un-optimized correction. We also demonstrated that model-based WSLAO can achieve convergence two times faster than traditional stochastic parallel gradient descent (SPGD) method. PMID:27598161
Jian, Yifan; Xu, Jing; Gradowski, Martin A.; Bonora, Stefano; Zawadzki, Robert J.; Sarunic, Marinko V.
2014-01-01
We present wavefront sensorless adaptive optics (WSAO) Fourier domain optical coherence tomography (FD-OCT) for in vivo small animal retinal imaging. WSAO is attractive especially for mouse retinal imaging because it simplifies optical design and eliminates the need for wavefront sensing, which is difficult in the small animal eye. GPU accelerated processing of the OCT data permitted real-time extraction of image quality metrics (intensity) for arbitrarily selected retinal layers to be optimized. Modal control of a commercially available segmented deformable mirror (IrisAO Inc.) provided rapid convergence using a sequential search algorithm. Image quality improvements with WSAO OCT are presented for both pigmented and albino mouse retinal data, acquired in vivo. PMID:24575347
Position Estimation for Switched Reluctance Motor Based on the Single Threshold Angle
NASA Astrophysics Data System (ADS)
Zhang, Lei; Li, Pang; Yu, Yue
2017-05-01
This paper presents a position estimate model of switched reluctance motor based on the single threshold angle. In view of the relationship of between the inductance and rotor position, the position is estimated by comparing the real-time dynamic flux linkage with the threshold angle position flux linkage (7.5° threshold angle, 12/8SRM). The sensorless model is built by Maltab/Simulink, the simulation are implemented under the steady state and transient state different condition, and verified its validity and feasibility of the method..
NASA Astrophysics Data System (ADS)
Wahl, Daniel J.; Zhang, Pengfei; Jian, Yifan; Bonora, Stefano; Sarunic, Marinko V.; Zawadzki, Robert J.
2017-02-01
Adaptive optics (AO) is essential for achieving diffraction limited resolution in large numerical aperture (NA) in-vivo retinal imaging in small animals. Cellular-resolution in-vivo imaging of fluorescently labeled cells is highly desirable for studying pathophysiology in animal models of retina diseases in pre-clinical vision research. Currently, wavefront sensor-based (WFS-based) AO is widely used for retinal imaging and has demonstrated great success. However, the performance can be limited by several factors including common path errors, wavefront reconstruction errors and an ill-defined reference plane on the retina. Wavefront sensorless (WFS-less) AO has the advantage of avoiding these issues at the cost of algorithmic execution time. We have investigated WFS-less AO on a fluorescence scanning laser ophthalmoscopy (fSLO) system that was originally designed for WFS-based AO. The WFS-based AO uses a Shack-Hartmann WFS and a continuous surface deformable mirror in a closed-loop control system to measure and correct for aberrations induced by the mouse eye. The WFS-less AO performs an open-loop modal optimization with an image quality metric. After WFS-less AO aberration correction, the WFS was used as a control of the closed-loop WFS-less AO operation. We can easily switch between WFS-based and WFS-less control of the deformable mirror multiple times within an imaging session for the same mouse. This allows for a direct comparison between these two types of AO correction for fSLO. Our results demonstrate volumetric AO-fSLO imaging of mouse retinal cells labeled with GFP. Most significantly, we have analyzed and compared the aberration correction results for WFS-based and WFS-less AO imaging.
NASA Astrophysics Data System (ADS)
Reddikumar, Maddipatla; Tanabe, Ayano; Hashimoto, Nobuyuki; Cense, Barry
2017-02-01
An optical coherence tomography (OCT) system with a 2.8-mm beam diameter is presented. Sensorless defocus correction can be performed with a Badal optometer and astigmatism correction with a liquid crystal device. OCT B-scans were used in an image-based optimization algorithm for aberration correction. Defocus can be corrected from -4.3 D to +4.3 D and vertical and oblique astigmatism from -2.5 D to +2.5 D. A contrast gain of 6.9 times was measured after aberration correction. In comparison with a 1.3-mm beam diameter OCT system, this concept achieved a 3.7-dB gain in dynamic range on a model retina. Both systems were used to image the retina of a human subject. As the correction of the liquid crystal device can take more than 60 s, the subject's spectacle prescription was adopted instead. This resulted in a 2.5 times smaller speckle size compared with the standard OCT system. The liquid crystal device for astigmatism correction does not need a high-voltage amplifier and can be operated at 5 V. The correction device is small (9 mm×30 mm×38 mm) and can easily be implemented in existing designs for OCT.
Fault tolerant operation of switched reluctance machine
NASA Astrophysics Data System (ADS)
Wang, Wei
The energy crisis and environmental challenges have driven industry towards more energy efficient solutions. With nearly 60% of electricity consumed by various electric machines in industry sector, advancement in the efficiency of the electric drive system is of vital importance. Adjustable speed drive system (ASDS) provides excellent speed regulation and dynamic performance as well as dramatically improved system efficiency compared with conventional motors without electronics drives. Industry has witnessed tremendous grow in ASDS applications not only as a driving force but also as an electric auxiliary system for replacing bulky and low efficiency auxiliary hydraulic and mechanical systems. With the vast penetration of ASDS, its fault tolerant operation capability is more widely recognized as an important feature of drive performance especially for aerospace, automotive applications and other industrial drive applications demanding high reliability. The Switched Reluctance Machine (SRM), a low cost, highly reliable electric machine with fault tolerant operation capability, has drawn substantial attention in the past three decades. Nevertheless, SRM is not free of fault. Certain faults such as converter faults, sensor faults, winding shorts, eccentricity and position sensor faults are commonly shared among all ASDS. In this dissertation, a thorough understanding of various faults and their influence on transient and steady state performance of SRM is developed via simulation and experimental study, providing necessary knowledge for fault detection and post fault management. Lumped parameter models are established for fast real time simulation and drive control. Based on the behavior of the faults, a fault detection scheme is developed for the purpose of fast and reliable fault diagnosis. In order to improve the SRM power and torque capacity under faults, the maximum torque per ampere excitation are conceptualized and validated through theoretical analysis and experiments. With the proposed optimal waveform, torque production is greatly improved under the same Root Mean Square (RMS) current constraint. Additionally, position sensorless operation methods under phase faults are investigated to account for the combination of physical position sensor and phase winding faults. A comprehensive solution for position sensorless operation under single and multiple phases fault are proposed and validated through experiments. Continuous position sensorless operation with seamless transition between various numbers of phase fault is achieved.
NASA Astrophysics Data System (ADS)
Shinnaka, Shinji
This paper presents a new unified analysis of estimate errors by model-matching extended-back-EMF estimation methods for sensorless drive of permanent-magnet synchronous motors. Analytical solutions about estimate errors, whose validity is confirmed by numerical experiments, are rich in universality and applicability. As an example of universality and applicability, a new trajectory-oriented vector control method is proposed, which can realize directly quasi-optimal strategy minimizing total losses with no additional computational loads by simply orienting one of vector-control coordinates to the associated quasi-optimal trajectory. The coordinate orientation rule, which is analytically derived, is surprisingly simple. Consequently the trajectory-oriented vector control method can be applied to a number of conventional vector control systems using model-matching extended-back-EMF estimation methods.
Study on Stability of High Speed Traction Drive CVT for Aircraft Generator
NASA Astrophysics Data System (ADS)
Goi, Tatsuhiko; Tanaka, Hirohisa; Nakashima, Kenichi; Watanabe, Koji
A half-toroidal traction drive CVT has a feature of small spin at traction pitch in whole speed ratio range of 1:4, which suits to transmit high rotational speed with minimum temperature increase of traction surface. Research activity on traction drive CVT has commenced in 1996 for applying it to an aircraft 24,000rpm constant-speed generator instead of a hydro-static transmission. This paper shows fundamental design of 90kW traction drive integrated drive generator, ``T-IDG", and stability analysis on a sensor-less electro-hydraulic speed control servo-mechanism by bond graphs. The performance test of T-IDG mounted on a test bench and an actual jet engine proved that the control system using sensor-less servomechanism can keep the generator speed within MIL-STD-704E allowable limit against steep changes of speed and load.
Coherence-Gated Sensorless Adaptive Optics Multiphoton Retinal Imaging
Cua, Michelle; Wahl, Daniel J.; Zhao, Yuan; Lee, Sujin; Bonora, Stefano; Zawadzki, Robert J.; Jian, Yifan; Sarunic, Marinko V.
2016-01-01
Multiphoton microscopy enables imaging deep into scattering tissues. The efficient generation of non-linear optical effects is related to both the pulse duration (typically on the order of femtoseconds) and the size of the focused spot. Aberrations introduced by refractive index inhomogeneity in the sample distort the wavefront and enlarge the focal spot, which reduces the multiphoton signal. Traditional approaches to adaptive optics wavefront correction are not effective in thick or multi-layered scattering media. In this report, we present sensorless adaptive optics (SAO) using low-coherence interferometric detection of the excitation light for depth-resolved aberration correction of two-photon excited fluorescence (TPEF) in biological tissue. We demonstrate coherence-gated SAO TPEF using a transmissive multi-actuator adaptive lens for in vivo imaging in a mouse retina. This configuration has significant potential for reducing the laser power required for adaptive optics multiphoton imaging, and for facilitating integration with existing systems. PMID:27599635
Arun Dominic, D; Chelliah, Thanga Raj
2014-09-01
To obtain high dynamic performance on induction motor drives (IMD), variable voltage and variable frequency operation has to be performed by measuring speed of rotation and stator currents through sensors and fed back them to the controllers. When the sensors are undergone a fault, the stability of control system, may be designed for an industrial process, is disturbed. This paper studies the negative effects on a 12.5 hp induction motor drives when the field oriented control system is subjected to sensor faults. To illustrate the importance of this study mine hoist load diagram is considered as shaft load of the tested machine. The methods to recover the system from sensor faults are discussed. In addition, the various speed sensorless schemes are reviewed comprehensively. Copyright © 2014 ISA. Published by Elsevier Ltd. All rights reserved.
Talhaoui, Hicham; Menacer, Arezki; Kessal, Abdelhalim; Kechida, Ridha
2014-09-01
This paper presents new techniques to evaluate faults in case of broken rotor bars of induction motors. Procedures are applied with closed-loop control. Electrical and mechanical variables are treated using fast Fourier transform (FFT), and discrete wavelet transform (DWT) at start-up and steady state. The wavelet transform has proven to be an excellent mathematical tool for the detection of the faults particularly broken rotor bars type. As a performance, DWT can provide a local representation of the non-stationary current signals for the healthy machine and with fault. For sensorless control, a Luenberger observer is applied; the estimation rotor speed is analyzed; the effect of the faults in the speed pulsation is compensated; a quadratic current appears and used for fault detection. Copyright © 2014 ISA. Published by Elsevier Ltd. All rights reserved.
Coherence-Gated Sensorless Adaptive Optics Multiphoton Retinal Imaging.
Cua, Michelle; Wahl, Daniel J; Zhao, Yuan; Lee, Sujin; Bonora, Stefano; Zawadzki, Robert J; Jian, Yifan; Sarunic, Marinko V
2016-09-07
Multiphoton microscopy enables imaging deep into scattering tissues. The efficient generation of non-linear optical effects is related to both the pulse duration (typically on the order of femtoseconds) and the size of the focused spot. Aberrations introduced by refractive index inhomogeneity in the sample distort the wavefront and enlarge the focal spot, which reduces the multiphoton signal. Traditional approaches to adaptive optics wavefront correction are not effective in thick or multi-layered scattering media. In this report, we present sensorless adaptive optics (SAO) using low-coherence interferometric detection of the excitation light for depth-resolved aberration correction of two-photon excited fluorescence (TPEF) in biological tissue. We demonstrate coherence-gated SAO TPEF using a transmissive multi-actuator adaptive lens for in vivo imaging in a mouse retina. This configuration has significant potential for reducing the laser power required for adaptive optics multiphoton imaging, and for facilitating integration with existing systems.
NASA Astrophysics Data System (ADS)
Jiao Ling, LIn; Xiaoli, Yin; Huan, Chang; Xiaozhou, Cui; Yi-Lin, Guo; Huan-Yu, Liao; Chun-YU, Gao; Guohua, Wu; Guang-Yao, Liu; Jin-KUn, Jiang; Qing-Hua, Tian
2018-02-01
Atmospheric turbulence limits the performance of orbital angular momentum-based free-space optical communication (FSO-OAM) system. In order to compensate phase distortion induced by atmospheric turbulence, wavefront sensorless adaptive optics (WSAO) has been proposed and studied in recent years. In this paper a new version of SPGD called MZ-SPGD, which combines the Z-SPGD based on the deformable mirror influence function and the M-SPGD based on the Zernike polynomials, is proposed. Numerical simulations show that the hybrid method decreases convergence times markedly but can achieve the same compensated effect compared to Z-SPGD and M-SPGD.
Advanced simulation model for IPM motor drive with considering phase voltage and stator inductance
NASA Astrophysics Data System (ADS)
Lee, Dong-Myung; Park, Hyun-Jong; Lee, Ju
2016-10-01
This paper proposes an advanced simulation model of driving system for Interior Permanent Magnet (IPM) BrushLess Direct Current (BLDC) motors driven by 120-degree conduction method (two-phase conduction method, TPCM) that is widely used for sensorless control of BLDC motors. BLDC motors can be classified as SPM (Surface mounted Permanent Magnet) and IPM motors. Simulation model of driving system with SPM motors is simple due to the constant stator inductance regardless of the rotor position. Simulation models of SPM motor driving system have been proposed in many researches. On the other hand, simulation models for IPM driving system by graphic-based simulation tool such as Matlab/Simulink have not been proposed. Simulation study about driving system of IPMs with TPCM is complex because stator inductances of IPM vary with the rotor position, as permanent magnets are embedded in the rotor. To develop sensorless scheme or improve control performance, development of control algorithm through simulation study is essential, and the simulation model that accurately reflects the characteristic of IPM is required. Therefore, this paper presents the advanced simulation model of IPM driving system, which takes into account the unique characteristic of IPM due to the position-dependent inductances. The validity of the proposed simulation model is validated by comparison to experimental and simulation results using IPM with TPCM control scheme.
Sensorless adaptive optics for isoSTED nanoscopy
NASA Astrophysics Data System (ADS)
Antonello, Jacopo; Hao, Xiang; Allgeyer, Edward S.; Bewersdorf, Joerg; Rittscher, Jens; Booth, Martin J.
2018-02-01
The presence of aberrations is a major concern when using fluorescence microscopy to image deep inside tissue. Aberrations due to refractive index mismatch and heterogeneity of the specimen under investigation cause severe reduction in the amount of fluorescence emission that is collected by the microscope. Furthermore, aberrations adversely affect the resolution, leading to loss of fine detail in the acquired images. These phenomena are particularly troublesome for super-resolution microscopy techniques such as isotropic stimulated-emission-depletion microscopy (isoSTED), which relies on accurate control of the shape and co-alignment of multiple excitation and depletion foci to operate as expected and to achieve the super-resolution effect. Aberrations can be suppressed by implementing sensorless adaptive optics techniques, whereby aberration correction is achieved by maximising a certain image quality metric. In confocal microscopy for example, one can employ the total image brightness as an image quality metric. Aberration correction is subsequently achieved by iteratively changing the settings of a wavefront corrector device until the metric is maximised. This simplistic approach has limited applicability to isoSTED microscopy where, due to the complex interplay between the excitation and depletion foci, maximising the total image brightness can lead to introducing aberrations in the depletion foci. In this work we first consider the effects that different aberration modes have on isoSTED microscopes. We then propose an iterative, wavelet-based aberration correction algorithm and evaluate its benefits.
Motor Control and Regulation for a Flywheel Energy Storage System
NASA Technical Reports Server (NTRS)
Kenny, Barbara; Lyons, Valerie
2003-01-01
This talk will focus on the motor control algorithms used to regulate the flywheel system at the NASA Glenn Research Center. First a discussion of the inner loop torque control technique will be given. It is based on the principle of field orientation and is implemented without a position or speed sensor (sensorless control). Then the outer loop charge and discharge algorithm will be presented. This algorithm controls the acceleration of the flywheel during charging and the deceleration while discharging. The algorithm also allows the flywheel system to regulate the DC bus voltage during the discharge cycle.
Design of BLDCM emulator for transmission control units
NASA Astrophysics Data System (ADS)
Liu, Chang; He, Yongyi; Zhang, Bodong
2018-04-01
According to the testing requirements of the transmission control unit, a brushless DC motor emulating system is designed based on motor simulation and power hardware-in-the-loop. The discrete motor model is established and a real-time numerical method is designed to solve the motor states. The motor emulator directly interacts with power stage of the transmission control unit using a power-efficient circuit topology and is compatible with sensor-less control. Experiments on a laboratory prototype help to verify that the system can emulate the real motor currents and voltages whenever the motor is starting up or suddenly loaded.
EFFICIENCY OPTIMIZATIN CONTROL OF AC INDUCTION MOTORS: INITIAL LABORATORY RESULTS
The report discusses the development of a fuzzy logic, energy-optimizing controller to improve the efficiency of motor/drive combinations that operate at varying loads and speeds. This energy optimizer is complemented by a sensorless speed controller that maintains motor shaft re...
Sensorless Sinusoidal Drives for Fan and Pump Motors by V/f Control
NASA Astrophysics Data System (ADS)
Kiuchi, Mitsuyuki; Ohnishi, Tokuo
This paper proposes sensorless sinusoidal driving methods of permanent magnet synchronous motors for fans and pumps by V/f control. The proposed methods are simple methods that control the motor peak current constant by voltage or frequency control, and are characterized by DC link current detection using a single shunt resistor at carrier wave signal bottom timing. As a result of the dumping factor from square torque load characteristics of fan and pump motors, it is possible to control stable starting and stable steady state by V/f control. In general, pressure losses as a result of the fluid pass of fan and pump systems are nearly constant; therefore, the flow rate and motor torque are determined by revolutions. Accordingly, high efficiency driving is possible by setting corresponding currents to q-axis currents (torque currents) at target revolutions. Because of the simple current detection and motor control methods, the proposed methods are optimum for fan and pump motor driving systems of home appliances.
NASA Astrophysics Data System (ADS)
Shinnaka, Shinji; Sano, Kousuke
This paper presents a new unified analysis of estimate errors by model-matching phase-estimation methods such as rotor-flux state-observers, back EMF state-observers, and back EMF disturbance-observers, for sensorless drive of permanent-magnet synchronous motors. Analytical solutions about estimate errors, whose validity is confirmed by numerical experiments, are rich in universality and applicability. As an example of universality and applicability, a new trajectory-oriented vector control method is proposed, which can realize directly quasi-optimal strategy minimizing total losses with no additional computational loads by simply orienting one of vector-control coordinates to the associated quasi-optimal trajectory. The coordinate orientation rule, which is analytically derived, is surprisingly simple. Consequently the trajectory-oriented vector control method can be applied to a number of conventional vector control systems using one of the model-matching phase-estimation methods.
Polans, James; Cunefare, David; Cole, Eli; Keller, Brenton; Mettu, Priyatham S.; Cousins, Scott W.; Allingham, Michael J.; Izatt, Joseph A.; Farsiu, Sina
2017-01-01
Optical coherence tomography angiography (OCTA) is a promising technique for non-invasive visualization of vessel networks in the human eye. We debut a system capable of acquiring wide field-of-view (>70°) OCT angiograms without mosaicking. Additionally, we report on enhancing the visualization of peripheral microvasculature using wavefront sensorless adaptive optics (WSAO). We employed a fast WSAO algorithm that enabled wavefront correction in <2 seconds by iterating the mirror shape at the speed of OCT B-scans rather than volumes. Also, we contrasted ~7° field-of-view OCTA angiograms acquired in the periphery with and without WSAO correction. On average, WSAO improved the sharpness of microvasculature by 65% in healthy and 38% in diseased eyes. Preliminary observations demonstrated that the location of 7° images could be identified directly from the wide field-of-view angiogram. A pilot study on a normal subject and patients with diabetic retinopathy showed the impact of utilizing WSAO for OCTA when visualizing peripheral vasculature pathologies. PMID:28059209
Gregory, Shaun D; Stevens, Michael C; Pauls, Jo P; Schummy, Emma; Diab, Sara; Thomson, Bruce; Anderson, Ben; Tansley, Geoff; Salamonsen, Robert; Fraser, John F; Timms, Daniel
2016-09-01
Preventing ventricular suction and venous congestion through balancing flow rates and circulatory volumes with dual rotary ventricular assist devices (VADs) configured for biventricular support is clinically challenging due to their low preload and high afterload sensitivities relative to the natural heart. This study presents the in vivo evaluation of several physiological control systems, which aim to prevent ventricular suction and venous congestion. The control systems included a sensor-based, master/slave (MS) controller that altered left and right VAD speed based on pressure and flow; a sensor-less compliant inflow cannula (IC), which altered inlet resistance and, therefore, pump flow based on preload; a sensor-less compliant outflow cannula (OC) on the right VAD, which altered outlet resistance and thus pump flow based on afterload; and a combined controller, which incorporated the MS controller, compliant IC, and compliant OC. Each control system was evaluated in vivo under step increases in systemic (SVR ∼1400-2400 dyne/s/cm(5) ) and pulmonary (PVR ∼200-1000 dyne/s/cm(5) ) vascular resistances in four sheep supported by dual rotary VADs in a biventricular assist configuration. Constant speed support was also evaluated for comparison and resulted in suction events during all resistance increases and pulmonary congestion during SVR increases. The MS controller reduced suction events and prevented congestion through an initial sharp reduction in pump flow followed by a gradual return to baseline (5.0 L/min). The compliant IC prevented suction events; however, reduced pump flows and pulmonary congestion were noted during the SVR increase. The compliant OC maintained pump flow close to baseline (5.0 L/min) and prevented suction and congestion during PVR increases. The combined controller responded similarly to the MS controller to prevent suction and congestion events in all cases while providing a backup system in the event of single controller failure. © 2016 International Center for Artificial Organs and Transplantation and Wiley Periodicals, Inc.
NASA Astrophysics Data System (ADS)
Chang, Huan; Yin, Xiao-li; Cui, Xiao-zhou; Zhang, Zhi-chao; Ma, Jian-xin; Wu, Guo-hua; Zhang, Li-jia; Xin, Xiang-jun
2017-12-01
Practical orbital angular momentum (OAM)-based free-space optical (FSO) communications commonly experience serious performance degradation and crosstalk due to atmospheric turbulence. In this paper, we propose a wave-front sensorless adaptive optics (WSAO) system with a modified Gerchberg-Saxton (GS)-based phase retrieval algorithm to correct distorted OAM beams. We use the spatial phase perturbation (SPP) GS algorithm with a distorted probe Gaussian beam as the only input. The principle and parameter selections of the algorithm are analyzed, and the performance of the algorithm is discussed. The simulation results show that the proposed adaptive optics (AO) system can significantly compensate for distorted OAM beams in single-channel or multiplexed OAM systems, which provides new insights into adaptive correction systems using OAM beams.
NASA Astrophysics Data System (ADS)
Chang, C. L.; Chen, C. Y.; Sung, C. C.; Liou, D. H.; Chang, C. Y.; Cha, H. C.
This work presents a new fuel sensor-less control scheme for liquid feed fuel cells that is able to control the supply to a fuel cell system for operation under dynamic loading conditions. The control scheme uses cell-operating characteristics, such as potential, current, and power, to regulate the fuel concentration of a liquid feed fuel cell without the need for a fuel concentration sensor. A current integral technique has been developed to calculate the quantity of fuel required at each monitoring cycle, which can be combined with the concentration regulating process to control the fuel supply for stable operation. As verified by systematic experiments, this scheme can effectively control the fuel supply of a liquid feed fuel cell with reduced response time, even under conditions where the membrane electrolyte assembly (MEA) deteriorates gradually. This advance will aid the commercialization of liquid feed fuel cells and make them more adaptable for use in portable and automotive power units such as laptops, e-bikes, and handicap cars.
New sensorless, efficient optimized and stabilized v/f control for pmsm machines
NASA Astrophysics Data System (ADS)
Jafari, Seyed Hesam
With the rapid advances in power electronics and motor drive technologies in recent decades, permanent magnet synchronous machines (PMSM) have found extensive applications in a variety of industrial systems due to its many desirable features such as high power density, high efficiency, and high torque to current ratio, low noise, and robustness. In low dynamic applications like pumps, fans and compressors where the motor speed is nearly constant, usage of a simple control algorithm that can be implemented with least number of the costly external hardware can be highly desirable for industry. In recent published works, for low power PMSMs, a new sensorless volts-per-hertz (V/f) controlling method has been proposed which can be used for PMSM drive applications where the motor speed is constant. Moreover, to minimize the cost of motor implementation, the expensive rotor damper winding was eliminated. By removing the damper winding, however, instability problems normally occur inside of the motor which in some cases can be harmful for a PMSM drive. As a result, to address the instability issue, a stabilizing loop was developed and added to the conventional V/f. By further studying the proposed sensorless stabilized V/f, and calculating power loss, it became known that overall motor efficiency still is needed to be improved and optimized. This thesis suggests a new V/f control method for PMSMs, where both efficiency and stability problems are addressed. Also, although in nearly all recent related research, methods have been applied to low power PMSM, for the first time, in this thesis, the suggested method is implemented for a medium power 15 kW PMSM. A C2000 F2833x Digital Signal Processor (DSP) is used as controller part for the student custom built PMSM drive, but instead of programming the DSP in Assembly or C, the main control algorithm was developed in a rapid prototype software environment which here Matlab Simulink embedded code library is used.
Smart sensorless prediction diagnosis of electric drives
NASA Astrophysics Data System (ADS)
Kruglova, TN; Glebov, NA; Shoshiashvili, ME
2017-10-01
In this paper, the discuss diagnostic method and prediction of the technical condition of an electrical motor using artificial intelligent method, based on the combination of fuzzy logic and neural networks, are discussed. The fuzzy sub-model determines the degree of development of each fault. The neural network determines the state of the object as a whole and the number of serviceable work periods for motors actuator. The combination of advanced techniques reduces the learning time and increases the forecasting accuracy. The experimental implementation of the method for electric drive diagnosis and associated equipment is carried out at different speeds. As a result, it was found that this method allows troubleshooting the drive at any given speed.
Adjustable Speed Drive Project for Teaching a Servo Systems Course Laboratory
ERIC Educational Resources Information Center
Rodriguez-Resendiz, J.; Herrera-Ruiz, G.; Rivas-Araiza, E. A.
2011-01-01
This paper describes an adjustable speed drive for a three-phase motor, which has been implemented as a design for a servo system laboratory course in an engineering curriculum. The platform is controlled and analyzed in a LabVIEW environment and run on a PC. Theory is introduced in order to show the sensorless algorithms. These are computed by…
Haptograph Representation of Real-World Haptic Information by Wideband Force Control
NASA Astrophysics Data System (ADS)
Katsura, Seiichiro; Irie, Kouhei; Ohishi, Kiyoshi
Artificial acquisition and reproduction of human sensations are basic technologies of communication engineering. For example, auditory information is obtained by a microphone, and a speaker reproduces it by artificial means. Furthermore, a video camera and a television make it possible to transmit visual sensation by broadcasting. On the contrary, since tactile or haptic information is subject to the Newton's “law of action and reaction” in the real world, a device which acquires, transmits, and reproduces the information has not been established. From the point of view, real-world haptics is the key technology for future haptic communication engineering. This paper proposes a novel acquisition method of haptic information named “haptograph”. The haptograph visualizes the haptic information like photograph. The proposed haptograph is applied to haptic recognition of the contact environment. A linear motor contacts to the surface of the environment and its reaction force is used to make a haptograph. A robust contact motion and sensor-less sensing of the reaction force are attained by using a disturbance observer. As a result, an encyclopedia of contact environment is attained. Since temporal and spatial analyses are conducted to represent haptic information as the haptograph, it is possible to be recognized and to be evaluated intuitively.
NASA Astrophysics Data System (ADS)
Kwon, Chung-Jin; Kim, Sung-Joong; Han, Woo-Young; Min, Won-Kyoung
2005-12-01
The rotor position and speed estimation of permanent-magnet synchronous motor(PMSM) was dealt with. By measuring the phase voltages and currents of the PMSM drive, two diagonally recurrent neural network(DRNN) based observers, a neural current observer and a neural velocity observer were developed. DRNN which has self-feedback of the hidden neurons ensures that the outputs of DRNN contain the whole past information of the system even if the inputs of DRNN are only the present states and inputs of the system. Thus the structure of DRNN may be simpler than that of feedforward and fully recurrent neural networks. If the backpropagation method was used for the training of the DRNN the problem of slow convergence arise. In order to reduce this problem, recursive prediction error(RPE) based learning method for the DRNN was presented. The simulation results show that the proposed approach gives a good estimation of rotor speed and position, and RPE based training has requires a shorter computation time compared to backpropagation based training.
Multiscale sensorless adaptive optics OCT angiography system for in vivo human retinal imaging.
Ju, Myeong Jin; Heisler, Morgan; Wahl, Daniel; Jian, Yifan; Sarunic, Marinko V
2017-11-01
We present a multiscale sensorless adaptive optics (SAO) OCT system capable of imaging retinal structure and vasculature with various fields-of-view (FOV) and resolutions. Using a single deformable mirror and exploiting the polarization properties of light, the SAO-OCT-A was implemented in a compact and easy to operate system. With the ability to adjust the beam diameter at the pupil, retinal imaging was demonstrated at two different numerical apertures with the same system. The general morphological structure and retinal vasculature could be observed with a few tens of micrometer-scale lateral resolution with conventional OCT and OCT-A scanning protocols with a 1.7-mm-diameter beam incident at the pupil and a large FOV (15 deg× 15 deg). Changing the system to a higher numerical aperture with a 5.0-mm-diameter beam incident at the pupil and the SAO aberration correction, the FOV was reduced to 3 deg× 3 deg for fine detailed imaging of morphological structure and microvasculature such as the photoreceptor mosaic and capillaries. Multiscale functional SAO-OCT imaging was performed on four healthy subjects, demonstrating its functionality and potential for clinical utility. (2017) COPYRIGHT Society of Photo-Optical Instrumentation Engineers (SPIE).
Gutierrez-Villalobos, Jose M.; Rodriguez-Resendiz, Juvenal; Rivas-Araiza, Edgar A.; Martínez-Hernández, Moisés A.
2015-01-01
Three-phase induction motor drive requires high accuracy in high performance processes in industrial applications. Field oriented control, which is one of the most employed control schemes for induction motors, bases its function on the electrical parameter estimation coming from the motor. These parameters make an electrical machine driver work improperly, since these electrical parameter values change at low speeds, temperature changes, and especially with load and duty changes. The focus of this paper is the real-time and on-line electrical parameters with a CMAC-ADALINE block added in the standard FOC scheme to improve the IM driver performance and endure the driver and the induction motor lifetime. Two kinds of neural network structures are used; one to estimate rotor speed and the other one to estimate rotor resistance of an induction motor. PMID:26131677
Gutierrez-Villalobos, Jose M; Rodriguez-Resendiz, Juvenal; Rivas-Araiza, Edgar A; Martínez-Hernández, Moisés A
2015-06-29
Three-phase induction motor drive requires high accuracy in high performance processes in industrial applications. Field oriented control, which is one of the most employed control schemes for induction motors, bases its function on the electrical parameter estimation coming from the motor. These parameters make an electrical machine driver work improperly, since these electrical parameter values change at low speeds, temperature changes, and especially with load and duty changes. The focus of this paper is the real-time and on-line electrical parameters with a CMAC-ADALINE block added in the standard FOC scheme to improve the IM driver performance and endure the driver and the induction motor lifetime. Two kinds of neural network structures are used; one to estimate rotor speed and the other one to estimate rotor resistance of an induction motor.
Zaafouri, Abderrahmen; Regaya, Chiheb Ben; Azza, Hechmi Ben; Châari, Abdelkader
2016-01-01
This paper presents a modified structure of the backstepping nonlinear control of the induction motor (IM) fitted with an adaptive backstepping speed observer. The control design is based on the backstepping technique complemented by the introduction of integral tracking errors action to improve its robustness. Unlike other research performed on backstepping control with integral action, the control law developed in this paper does not propose the increase of the number of system state so as not increase the complexity of differential equations resolution. The digital simulation and experimental results show the effectiveness of the proposed control compared to the conventional PI control. The results analysis shows the characteristic robustness of the adaptive control to disturbances of the load, the speed variation and low speed. Copyright © 2015 ISA. Published by Elsevier Ltd. All rights reserved.
Bearingless Flywheel Systems, Winding and Control Schemes, and Sensorless Control
NASA Technical Reports Server (NTRS)
Kascak, Peter E (Inventor); Jansen, Ralph H (Inventor); Trase, Larry M (Inventor); Dever, Timothy P (Inventor); Kraft, Thomas G (Inventor)
2016-01-01
Flywheel systems are disclosed that provide increased energy density and operational effectiveness. A first bearingless motor and a second bearingless motor may be configured to simultaneously suspend the central rotor in a radial direction and to rotate the central rotor. However, certain implementations may have one motor or more than two motors, depending on the design. A plurality of the flywheel systems may be collectively controlled to perform community energy storage with higher storage capacities than individual flywheel systems.
A Flywheel Energy Storage System Demonstration for Space Applications
NASA Technical Reports Server (NTRS)
Kenny, Barbara H.; Kascak, Peter E.; Jansen, Ralph; Dever, Timothy
2003-01-01
A novel control algorithm for the charge and discharge modes of operation of a flywheel energy storage system for space applications is presented. The motor control portion of the algorithm uses sensorless field oriented control with position and speed estimates determined from a signal injection technique at low speeds and a back EMF technique at higher speeds. The charge and discharge portion of the algorithm use command feed-forward and disturbance decoupling, respectively, to achieve fast response with low gains. Simulation and experimental results are presented.
Feasibility Study of Jupiter Icy Moons Orbiter Permanent Magnet Alternator Start Sequence
NASA Technical Reports Server (NTRS)
Kenny, Barbara H.; Tokars, Roger P.
2006-01-01
The Jupiter Icy Moons Orbiter (JIMO) mission was a proposed, (recently cancelled) long duration science mission to study three moons of Jupiter: Callisto, Ganymede, and Europa. One design of the JIMO spacecraft used a nuclear heat source in conjunction with a Brayton rotating machine to generate electrical power for the electric thrusters and the spacecraft bus. The basic operation of the closed cycle Brayton system was as follows. The working fluid, a heliumxenon gas mixture, first entered a compressor, then went through a recuperator and hot-side heat exchanger, then expanded across a turbine that drove an alternator, then entered the cold-side of the recuperator and heat exchanger and finally returned to the compressor. The spacecraft was to be launched with the Brayton system off-line and the nuclear reactor shut down. Once the system was started, the helium-xenon gas would be circulated into the heat exchangers as the nuclear reactors were activated. Initially, the alternator unit would operate as a motor so as to drive the turbine and compressor to get the cycle started. This report investigated the feasibility of the start up sequence of a permanent magnet (PM) machine, similar in operation to the alternator unit, without any position or speed feedback sensors ("sensorless") and with a variable load torque. It is found that the permanent magnet machine can start with sensorless control and a load torque of up to 30 percent of the rated value.
Tong, Qiaoling; Chen, Chen; Zhang, Qiao; Zou, Xuecheng
2015-01-01
To realize accurate current control for a boost converter, a precise measurement of the inductor current is required to achieve high resolution current regulating. Current sensors are widely used to measure the inductor current. However, the current sensors and their processing circuits significantly contribute extra hardware cost, delay and noise to the system. They can also harm the system reliability. Therefore, current sensorless control techniques can bring cost effective and reliable solutions for various boost converter applications. According to the derived accurate model, which contains a number of parasitics, the boost converter is a nonlinear system. An Extended Kalman Filter (EKF) is proposed for inductor current estimation and output voltage filtering. With this approach, the system can have the same advantages as sensored current control mode. To implement EKF, the load value is necessary. However, the load may vary from time to time. This can lead to errors of current estimation and filtered output voltage. To solve this issue, a load variation elimination effect elimination (LVEE) module is added. In addition, a predictive average current controller is used to regulate the current. Compared with conventional voltage controlled system, the transient response is greatly improved since it only takes two switching cycles for the current to reach its reference. Finally, experimental results are presented to verify the stable operation and output tracking capability for large-signal transients of the proposed algorithm. PMID:25928061
Indirect rotor position sensing in real time for brushless permanent magnet motor drives
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ertugrul, N.; Acarnley, P.P.
1998-07-01
This paper describes a modern solution to real-time rotor position estimation of brushless permanent magnet (PM) motor drives. The position estimation scheme, based on flux linkage and line-current estimation, is implemented in real time by using the abc reference frame, and it is tested dynamically. The position estimation model of the test motor, development of hardware, and basic operation of the digital signal processor (DSP) are discussed. The overall position estimation strategy is accomplished with a fast DSP (TMS320C30). The method is a shaft position sensorless method that is applicable to a wide range of excitation types in brushless PMmore » motors without any restriction on the motor model and the current excitation. Both rectangular and sinewave-excited brushless PM motor drives are examined, and the results are given to demonstrate the effectiveness of the method with dynamic loads in closed estimated position loop.« less
Mohamaddoust, Reza; Haghighat, Abolfazl Toroghi; Sharif, Mohamad Javad Motahari; Capanni, Niccolo
2011-01-01
Wireless sensor networks (WSN) are currently being applied to energy conservation applications such as light control. We propose a design for such a system called a Lighting Automatic Control System (LACS). The LACS system contains a centralized or distributed architecture determined by application requirements and space usage. The system optimizes the calculations and communications for lighting intensity, incorporates user illumination requirements according to their activities and performs adjustments based on external lighting effects in external sensor and external sensor-less architectures. Methods are proposed for reducing the number of sensors required and increasing the lifetime of those used, for considerably reduced energy consumption. Additionally we suggest methods for improving uniformity of illuminance distribution on a workplane’s surface, which improves user satisfaction. Finally simulation results are presented to verify the effectiveness of our design. PMID:22164114
Mohamaddoust, Reza; Haghighat, Abolfazl Toroghi; Sharif, Mohamad Javad Motahari; Capanni, Niccolo
2011-01-01
Wireless sensor networks (WSN) are currently being applied to energy conservation applications such as light control. We propose a design for such a system called a lighting automatic control system (LACS). The LACS system contains a centralized or distributed architecture determined by application requirements and space usage. The system optimizes the calculations and communications for lighting intensity, incorporates user illumination requirements according to their activities and performs adjustments based on external lighting effects in external sensor and external sensor-less architectures. Methods are proposed for reducing the number of sensors required and increasing the lifetime of those used, for considerably reduced energy consumption. Additionally we suggest methods for improving uniformity of illuminance distribution on a workplane's surface, which improves user satisfaction. Finally simulation results are presented to verify the effectiveness of our design.
Jun Kang, Yang; Yeom, Eunseop; Lee, Sang-Joon
2013-01-01
Blood viscosity has been considered as one of important biophysical parameters for effectively monitoring variations in physiological and pathological conditions of circulatory disorders. Standard previous methods make it difficult to evaluate variations of blood viscosity under cardiopulmonary bypass procedures or hemodialysis. In this study, we proposed a unique microfluidic device for simultaneously measuring viscosity and flow rate of whole blood circulating in a complex fluidic network including a rat, a reservoir, a pinch valve, and a peristaltic pump. To demonstrate the proposed method, a twin-shaped microfluidic device, which is composed of two half-circular chambers, two side channels with multiple indicating channels, and one bridge channel, was carefully designed. Based on the microfluidic device, three sequential flow controls were applied to identify viscosity and flow rate of blood, with label-free and sensorless detection. The half-circular chamber was employed to achieve mechanical membrane compliance for flow stabilization in the microfluidic device. To quantify the effect of flow stabilization on flow fluctuations, a formula of pulsation index (PI) was analytically derived using a discrete fluidic circuit model. Using the PI formula, the time constant contributed by the half-circular chamber is estimated to be 8 s. Furthermore, flow fluctuations resulting from the peristaltic pumps are completely removed, especially under periodic flow conditions within short periods (T < 10 s). For performance demonstrations, the proposed method was applied to evaluate blood viscosity with respect to varying flow rate conditions [(a) known blood flow rate via a syringe pump, (b) unknown blood flow rate via a peristaltic pump]. As a result, the flow rate and viscosity of blood can be simultaneously measured with satisfactory accuracy. In addition, the proposed method was successfully applied to identify the viscosity of rat blood, which circulates in a complex fluidic network. These observations confirm that the proposed method can be used for simultaneous measurement of viscosity and flow rate of whole blood circulating in the complex fluid network, with sensorless and label-free detection. Furthermore, the proposed method will be used in evaluating variations in the viscosity of human blood during cardiopulmonary bypass procedures or hemodialysis. PMID:24404074
Jun Kang, Yang; Yeom, Eunseop; Lee, Sang-Joon
2013-01-01
Blood viscosity has been considered as one of important biophysical parameters for effectively monitoring variations in physiological and pathological conditions of circulatory disorders. Standard previous methods make it difficult to evaluate variations of blood viscosity under cardiopulmonary bypass procedures or hemodialysis. In this study, we proposed a unique microfluidic device for simultaneously measuring viscosity and flow rate of whole blood circulating in a complex fluidic network including a rat, a reservoir, a pinch valve, and a peristaltic pump. To demonstrate the proposed method, a twin-shaped microfluidic device, which is composed of two half-circular chambers, two side channels with multiple indicating channels, and one bridge channel, was carefully designed. Based on the microfluidic device, three sequential flow controls were applied to identify viscosity and flow rate of blood, with label-free and sensorless detection. The half-circular chamber was employed to achieve mechanical membrane compliance for flow stabilization in the microfluidic device. To quantify the effect of flow stabilization on flow fluctuations, a formula of pulsation index (PI) was analytically derived using a discrete fluidic circuit model. Using the PI formula, the time constant contributed by the half-circular chamber is estimated to be 8 s. Furthermore, flow fluctuations resulting from the peristaltic pumps are completely removed, especially under periodic flow conditions within short periods (T < 10 s). For performance demonstrations, the proposed method was applied to evaluate blood viscosity with respect to varying flow rate conditions [(a) known blood flow rate via a syringe pump, (b) unknown blood flow rate via a peristaltic pump]. As a result, the flow rate and viscosity of blood can be simultaneously measured with satisfactory accuracy. In addition, the proposed method was successfully applied to identify the viscosity of rat blood, which circulates in a complex fluidic network. These observations confirm that the proposed method can be used for simultaneous measurement of viscosity and flow rate of whole blood circulating in the complex fluid network, with sensorless and label-free detection. Furthermore, the proposed method will be used in evaluating variations in the viscosity of human blood during cardiopulmonary bypass procedures or hemodialysis.
NASA Technical Reports Server (NTRS)
Fehrmann, Elizabeth A.; Kenny, Barbara H.
2004-01-01
The NASA Glenn Research Center (GRC) has been working to advance the technology necessary for a flywheel energy storage system for the past several years. Flywheels offer high efficiency, durability, and near-complete discharge capabilities not produced by typical chemical batteries. These characteristics show flywheels to be an attractive alternative to the more typical energy storage solutions. Flywheels also offer the possibility of combining what are now two separate systems in space applications into one: energy storage, which is currently provided by batteries, and attitude control, which is currently provided by control moment gyroscopes (CMGs) or reaction wheels. To date, NASA Glenn research effort has produced the control algorithms necessary to demonstrate flywheel operation up to a rated speed of 60,000 RPM and the combined operation of two flywheel machines to simultaneously provide energy storage and single axis attitude control. Two position-sensorless algorithms are used to control the motor/generator, one for low (0 to 1200 RPM) speeds and one for high speeds. The algorithm allows the transition from the low speed method to the high speed method, but the transition from the high to low speed method was not originally included. This leads to a limitation in the existing motor/generator control code that does not allow the flywheels to be commanded to zero speed (and back in the negative speed direction) after the initial startup. In a multi-flywheel system providing both energy storage and attitude control to a spacecraft, speed reversal may be necessary.
Bueno, Juan M; Skorsetz, Martin; Palacios, Raquel; Gualda, Emilio J; Artal, Pablo
2014-01-01
Despite the inherent confocality and optical sectioning capabilities of multiphoton microscopy, three-dimensional (3-D) imaging of thick samples is limited by the specimen-induced aberrations. The combination of immersion objectives and sensorless adaptive optics (AO) techniques has been suggested to overcome this difficulty. However, a complex plane-by-plane correction of aberrations is required, and its performance depends on a set of image-based merit functions. We propose here an alternative approach to increase penetration depth in 3-D multiphoton microscopy imaging. It is based on the manipulation of the spherical aberration (SA) of the incident beam with an AO device while performing fast tomographic multiphoton imaging. When inducing SA, the image quality at best focus is reduced; however, better quality images are obtained from deeper planes within the sample. This is a compromise that enables registration of improved 3-D multiphoton images using nonimmersion objectives. Examples on ocular tissues and nonbiological samples providing different types of nonlinear signal are presented. The implementation of this technique in a future clinical instrument might provide a better visualization of corneal structures in living eyes.
Pozzi, P; Wilding, D; Soloviev, O; Verstraete, H; Bliek, L; Vdovin, G; Verhaegen, M
2017-01-23
The quality of fluorescence microscopy images is often impaired by the presence of sample induced optical aberrations. Adaptive optical elements such as deformable mirrors or spatial light modulators can be used to correct aberrations. However, previously reported techniques either require special sample preparation, or time consuming optimization procedures for the correction of static aberrations. This paper reports a technique for optical sectioning fluorescence microscopy capable of correcting dynamic aberrations in any fluorescent sample during the acquisition. This is achieved by implementing adaptive optics in a non conventional confocal microscopy setup, with multiple programmable confocal apertures, in which out of focus light can be separately detected, and used to optimize the correction performance with a sampling frequency an order of magnitude faster than the imaging rate of the system. The paper reports results comparing the correction performances to traditional image optimization algorithms, and demonstrates how the system can compensate for dynamic changes in the aberrations, such as those introduced during a focal stack acquisition though a thick sample.
Model for Sucker-Rod Pumping Unit Operating Modes Analysis Based on SimMechanics Library
NASA Astrophysics Data System (ADS)
Zyuzev, A. M.; Bubnov, M. V.
2018-01-01
The article provides basic information about the process of a sucker-rod pumping unit (SRPU) model developing by means of SimMechanics library in the MATLAB Simulink environment. The model is designed for the development of a pump productivity optimal management algorithms, sensorless diagnostics of the plunger pump and pumpjack, acquisition of the dynamometer card and determination of a dynamic fluid level in the well, normalization of the faulty unit operation before troubleshooting is performed by staff as well as equilibrium ratio determining by energy indicators and outputting of manual balancing recommendations to achieve optimal power consumption efficiency. Particular attention is given to the application of various blocks from SimMechanics library to take into account the pumpjack construction principal characteristic and to obtain an adequate model. The article explains in depth the developed tools features for collecting and analysis of simulated mechanism data. The conclusions were drawn about practical implementation possibility of the SRPU modelling results and areas for further development of investigation.
Polans, James; Keller, Brenton; Carrasco-Zevallos, Oscar M; LaRocca, Francesco; Cole, Elijah; Whitson, Heather E; Lad, Eleonora M; Farsiu, Sina; Izatt, Joseph A
2017-01-01
The peripheral retina of the human eye offers a unique opportunity for assessment and monitoring of ocular diseases. We have developed a novel wide-field (>70°) optical coherence tomography system (WF-OCT) equipped with wavefront sensorless adaptive optics (WSAO) for enhancing the visualization of smaller (<25°) targeted regions in the peripheral retina. We iterated the WSAO algorithm at the speed of individual OCT B-scans (~20 ms) by using raw spectral interferograms to calculate the optimization metric. Our WSAO approach with a 3 mm beam diameter permitted primarily low- but also high- order peripheral wavefront correction in less than 10 seconds. In preliminary imaging studies in five normal human subjects, we quantified statistically significant changes with WSAO correction, corresponding to a 10.4% improvement in average pixel brightness (signal) and 7.0% improvement in high frequency content (resolution) when visualizing 1 mm (~3.5°) B-scans of the peripheral (>23°) retina. We demonstrated the ability of our WF-OCT system to acquire non wavefront-corrected wide-field images rapidly, which could then be used to locate regions of interest, zoom into targeted features, and visualize the same region at different time points. A pilot clinical study was conducted on seven healthy volunteers and two subjects with prodromal Alzheimer's disease which illustrated the capability to image Drusen-like pathologies as far as 32.5° from the fovea in un-averaged volume scans. This work suggests that the proposed combination of WF-OCT and WSAO may find applications in the diagnosis and treatment of ocular, and potentially neurodegenerative, diseases of the peripheral retina, including diabetes and Alzheimer's disease.
Polans, James; Keller, Brenton; Carrasco-Zevallos, Oscar M.; LaRocca, Francesco; Cole, Elijah; Whitson, Heather E.; Lad, Eleonora M.; Farsiu, Sina; Izatt, Joseph A.
2016-01-01
The peripheral retina of the human eye offers a unique opportunity for assessment and monitoring of ocular diseases. We have developed a novel wide-field (>70°) optical coherence tomography system (WF-OCT) equipped with wavefront sensorless adaptive optics (WSAO) for enhancing the visualization of smaller (<25°) targeted regions in the peripheral retina. We iterated the WSAO algorithm at the speed of individual OCT B-scans (~20 ms) by using raw spectral interferograms to calculate the optimization metric. Our WSAO approach with a 3 mm beam diameter permitted primarily low- but also high- order peripheral wavefront correction in less than 10 seconds. In preliminary imaging studies in five normal human subjects, we quantified statistically significant changes with WSAO correction, corresponding to a 10.4% improvement in average pixel brightness (signal) and 7.0% improvement in high frequency content (resolution) when visualizing 1 mm (~3.5°) B-scans of the peripheral (>23°) retina. We demonstrated the ability of our WF-OCT system to acquire non wavefront-corrected wide-field images rapidly, which could then be used to locate regions of interest, zoom into targeted features, and visualize the same region at different time points. A pilot clinical study was conducted on seven healthy volunteers and two subjects with prodromal Alzheimer’s disease which illustrated the capability to image Drusen-like pathologies as far as 32.5° from the fovea in un-averaged volume scans. This work suggests that the proposed combination of WF-OCT and WSAO may find applications in the diagnosis and treatment of ocular, and potentially neurodegenerative, diseases of the peripheral retina, including diabetes and Alzheimer’s disease. PMID:28101398
Control of a High Speed Flywheel System for Energy Storage in Space Applications
NASA Technical Reports Server (NTRS)
Kenny, Barbara H.; Kascak, Peter E.; Jansen, Ralph; Dever, Timothy; Santiago, Walter
2004-01-01
A novel control algorithm for the charge and discharge modes of operation of a flywheel energy storage system for space applications is presented. The motor control portion of the algorithm uses sensorless field oriented control with position and speed estimates determined from a signal injection technique at low speeds and a back EMF technique at higher speeds. The charge and discharge portion of the algorithm use command feed-forward and disturbance decoupling, respectively, to achieve fast response with low gains. Simulation and experimental results are presented demonstrating the successful operation of the flywheel control up to the rated speed of 60,000 rpm.
NASA Astrophysics Data System (ADS)
Quintavalla, M.; Pozzi, P.; Verhaegen, Michelle; Bijlsma, Hielke; Verstraete, Hans; Bonora, S.
2018-02-01
Adaptive Optics (AO) has revealed as a very promising technique for high-resolution microscopy, where the presence of optical aberrations can easily compromise the image quality. Typical AO systems however, are almost impossible to implement on commercial microscopes. We propose a simple approach by using a Multi-actuator Adaptive Lens (MAL) that can be inserted right after the objective and works in conjunction with an image optimization software allowing for a wavefront sensorless correction. We presented the results obtained on several commercial microscopes among which a confocal microscope, a fluorescence microscope, a light sheet microscope and a multiphoton microscope.
Simulink-aided Design and Implementation of Sensorless BLDC Motor Digital Control System
NASA Astrophysics Data System (ADS)
Zhilenkov, A. A.; Tsvetkov, Y. N.; Chistov, V. B.; Nyrkov, A. P.; Sokolov, S. S.
2017-07-01
The paper describes the process of creating of brushless direct current motor’s digital control system. The target motor has no speed sensor, so back-EMF method is used for commutation control. Authors show how to model the control system in MatLab/Simulink and to test it onboard STM32F4 microcontroller.This technology allows to create the most flexible system, which will control possible with a personal computer by communication lines. It is possible to examine the signals in the circuit of the actuator without any external measuring instruments - testers, oscilloscopes, etc. - and output waveforms and measured values of signals directly on the host PC.
NASA Astrophysics Data System (ADS)
Lei, Meizhen; Wang, Liqiang
2018-01-01
The halbach-type linear oscillatory motor (HT-LOM) is multi-variable, highly coupled, nonlinear and uncertain, and difficult to get a satisfied result by conventional PID control. An incremental adaptive fuzzy controller (IAFC) for stroke tracking was presented, which combined the merits of PID control, the fuzzy inference mechanism and the adaptive algorithm. The integral-operation is added to the conventional fuzzy control algorithm. The fuzzy scale factor can be online tuned according to the load force and stroke command. The simulation results indicate that the proposed control scheme can achieve satisfied stroke tracking performance and is robust with respect to parameter variations and external disturbance.
Mekki, Hemza; Benzineb, Omar; Boukhetala, Djamel; Tadjine, Mohamed; Benbouzid, Mohamed
2015-07-01
The fault-tolerant control problem belongs to the domain of complex control systems in which inter-control-disciplinary information and expertise are required. This paper proposes an improved faults detection, reconstruction and fault-tolerant control (FTC) scheme for motor systems (MS) with typical faults. For this purpose, a sliding mode controller (SMC) with an integral sliding surface is adopted. This controller can make the output of system to track the desired position reference signal in finite-time and obtain a better dynamic response and anti-disturbance performance. But this controller cannot deal directly with total system failures. However an appropriate combination of the adopted SMC and sliding mode observer (SMO), later it is designed to on-line detect and reconstruct the faults and also to give a sensorless control strategy which can achieve tolerance to a wide class of total additive failures. The closed-loop stability is proved, using the Lyapunov stability theory. Simulation results in healthy and faulty conditions confirm the reliability of the suggested framework. Copyright © 2015 ISA. Published by Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Niu, Chaojun; Han, Xiang'e.
2015-10-01
Adaptive optics (AO) technology is an effective way to alleviate the effect of turbulence on free space optical communication (FSO). A new adaptive compensation method can be used without a wave-front sensor. Artificial bee colony algorithm (ABC) is a population-based heuristic evolutionary algorithm inspired by the intelligent foraging behaviour of the honeybee swarm with the advantage of simple, good convergence rate, robust and less parameter setting. In this paper, we simulate the application of the improved ABC to correct the distorted wavefront and proved its effectiveness. Then we simulate the application of ABC algorithm, differential evolution (DE) algorithm and stochastic parallel gradient descent (SPGD) algorithm to the FSO system and analyze the wavefront correction capabilities by comparison of the coupling efficiency, the error rate and the intensity fluctuation in different turbulence before and after the correction. The results show that the ABC algorithm has much faster correction speed than DE algorithm and better correct ability for strong turbulence than SPGD algorithm. Intensity fluctuation can be effectively reduced in strong turbulence, but not so effective in week turbulence.
A demonstration of motion base design alternatives for the National Advanced Driving Simulator
NASA Technical Reports Server (NTRS)
Mccauley, Michael E.; Sharkey, Thomas J.; Sinacori, John B.; Laforce, Soren; Miller, James C.; Cook, Anthony
1992-01-01
A demonstration of the capability of NASA's Vertical Motion Simulator to simulate two alternative motion base designs for the National Advanced Driving simulator (NADS) is reported. The VMS is located at ARC. The motion base conditions used in this demonstration were as follows: (1) a large translational motion base; and (2) a motion base design with limited translational capability. The latter had translational capability representative of a typical synergistic motion platform. These alternatives were selected to test the prediction that large amplitude translational motion would result in a lower incidence or severity of simulator induced sickness (SIS) than would a limited translational motion base. A total of 10 drivers performed two tasks, slaloms and quick-stops, using each of the motion bases. Physiological, objective, and subjective measures were collected. No reliable differences in SIS between the motion base conditions was found in this demonstration. However, in light of the cost considerations and engineering challenges associated with implementing a large translation motion base, performance of a formal study is recommended.
Gouta, Houssemeddine; Hadj Saïd, Salim; Barhoumi, Nabil; M'Sahli, Faouzi
2017-03-01
This paper deals with the problem of the observer based control design for a coupled four-tank liquid level system. For this MIMO system's dynamics, motivated by a desire to provide precise and sensorless liquid level control, a nonlinear predictive controller based on a continuous-discrete observer is presented. First, an analytical solution from the model predictive control (MPC) technique is developed for a particular class of nonlinear MIMO systems and its corresponding exponential stability is proven. Then, a high gain observer that runs in continuous-time with an output error correction time that is updated in a mixed continuous-discrete fashion is designed in order to estimate the liquid levels in the two upper tanks. The effectiveness of the designed control schemes are validated by two tests; The first one is maintaining a constant level in the first bottom tank while making the level in the second bottom tank to follow a sinusoidal reference signal. The second test is more difficult and it is made using two trapezoidal reference signals in order to see the decoupling performance of the system's outputs. Simulation and experimental results validate the objective of the paper. Copyright © 2016 ISA. Published by Elsevier Ltd. All rights reserved.
Device-Free Passive Identity Identification via WiFi Signals.
Lv, Jiguang; Yang, Wu; Man, Dapeng
2017-11-02
Device-free passive identity identification attracts much attention in recent years, and it is a representative application in sensorless sensing. It can be used in many applications such as intrusion detection and smart building. Previous studies show the sensing potential of WiFi signals in a device-free passive manner. It is confirmed that human's gait is unique from each other similar to fingerprint and iris. However, the identification accuracy of existing approaches is not satisfactory in practice. In this paper, we present Wii, a device-free WiFi-based Identity Identification approach utilizing human's gait based on Channel State Information (CSI) of WiFi signals. Principle Component Analysis (PCA) and low pass filter are applied to remove the noises in the signals. We then extract several entities' gait features from both time and frequency domain, and select the most effective features according to information gain. Based on these features, Wii realizes stranger recognition through Gaussian Mixture Model (GMM) and identity identification through a Support Vector Machine (SVM) with Radial Basis Function (RBF) kernel. It is implemented using commercial WiFi devices and evaluated on a dataset with more than 1500 gait instances collected from eight subjects walking in a room. The results indicate that Wii can effectively recognize strangers and can achieves high identification accuracy with low computational cost. As a result, Wii has the potential to work in typical home security systems.
Device-Free Passive Identity Identification via WiFi Signals
Yang, Wu; Man, Dapeng
2017-01-01
Device-free passive identity identification attracts much attention in recent years, and it is a representative application in sensorless sensing. It can be used in many applications such as intrusion detection and smart building. Previous studies show the sensing potential of WiFi signals in a device-free passive manner. It is confirmed that human’s gait is unique from each other similar to fingerprint and iris. However, the identification accuracy of existing approaches is not satisfactory in practice. In this paper, we present Wii, a device-free WiFi-based Identity Identification approach utilizing human’s gait based on Channel State Information (CSI) of WiFi signals. Principle Component Analysis (PCA) and low pass filter are applied to remove the noises in the signals. We then extract several entities’ gait features from both time and frequency domain, and select the most effective features according to information gain. Based on these features, Wii realizes stranger recognition through Gaussian Mixture Model (GMM) and identity identification through a Support Vector Machine (SVM) with Radial Basis Function (RBF) kernel. It is implemented using commercial WiFi devices and evaluated on a dataset with more than 1500 gait instances collected from eight subjects walking in a room. The results indicate that Wii can effectively recognize strangers and can achieves high identification accuracy with low computational cost. As a result, Wii has the potential to work in typical home security systems. PMID:29099091
Survey of Motion Tracking Methods Based on Inertial Sensors: A Focus on Upper Limb Human Motion
Filippeschi, Alessandro; Schmitz, Norbert; Miezal, Markus; Bleser, Gabriele; Ruffaldi, Emanuele; Stricker, Didier
2017-01-01
Motion tracking based on commercial inertial measurements units (IMUs) has been widely studied in the latter years as it is a cost-effective enabling technology for those applications in which motion tracking based on optical technologies is unsuitable. This measurement method has a high impact in human performance assessment and human-robot interaction. IMU motion tracking systems are indeed self-contained and wearable, allowing for long-lasting tracking of the user motion in situated environments. After a survey on IMU-based human tracking, five techniques for motion reconstruction were selected and compared to reconstruct a human arm motion. IMU based estimation was matched against motion tracking based on the Vicon marker-based motion tracking system considered as ground truth. Results show that all but one of the selected models perform similarly (about 35 mm average position estimation error). PMID:28587178
NASA Astrophysics Data System (ADS)
Okuzawa, Yuki; Kato, Shohei; Kanoh, Masayoshi; Itoh, Hidenori
A knowledge-based approach to imitation learning of motion generation for humanoid robots and an imitative motion generation system based on motion knowledge learning and modification are described. The system has three parts: recognizing, learning, and modifying parts. The first part recognizes an instructed motion distinguishing it from the motion knowledge database by the continuous hidden markov model. When the motion is recognized as being unfamiliar, the second part learns it using locally weighted regression and acquires a knowledge of the motion. When a robot recognizes the instructed motion as familiar or judges that its acquired knowledge is applicable to the motion generation, the third part imitates the instructed motion by modifying a learned motion. This paper reports some performance results: the motion imitation of several radio gymnastics motions.
Modal-Power-Based Haptic Motion Recognition
NASA Astrophysics Data System (ADS)
Kasahara, Yusuke; Shimono, Tomoyuki; Kuwahara, Hiroaki; Sato, Masataka; Ohnishi, Kouhei
Motion recognition based on sensory information is important for providing assistance to human using robots. Several studies have been carried out on motion recognition based on image information. However, in the motion of humans contact with an object can not be evaluated precisely by image-based recognition. This is because the considering force information is very important for describing contact motion. In this paper, a modal-power-based haptic motion recognition is proposed; modal power is considered to reveal information on both position and force. Modal power is considered to be one of the defining features of human motion. A motion recognition algorithm based on linear discriminant analysis is proposed to distinguish between similar motions. Haptic information is extracted using a bilateral master-slave system. Then, the observed motion is decomposed in terms of primitive functions in a modal space. The experimental results show the effectiveness of the proposed method.
NASA Astrophysics Data System (ADS)
Yang, Huizhen; Ma, Liang; Wang, Bin
2018-01-01
In contrast to the conventional adaptive optics (AO) system, the wavefront sensorless (WFSless) AO system doesn't need a WFS to measure the wavefront aberrations. It is simpler than the conventional AO in system architecture and can be applied to the complex conditions. The model-based WFSless system has a great potential in real-time correction applications because of its fast convergence. The control algorithm of the model-based WFSless system is based on an important theory result that is the linear relation between the Mean-Square Gradient (MSG) magnitude of the wavefront aberration and the second moment of the masked intensity distribution in the focal plane (also called as Masked Detector Signal-MDS). The linear dependence between MSG and MDS for the point source imaging with a CCD sensor will be discussed from theory and simulation in this paper. The theory relationship between MSG and MDS is given based on our previous work. To verify the linear relation for the point source, we set up an imaging model under atmospheric turbulence. Additionally, the value of MDS will be deviate from that of theory because of the noise of detector and further the deviation will affect the correction effect. The theory results under noise will be obtained through theoretical derivation and then the linear relation between MDS and MDS under noise will be discussed through the imaging model. Results show the linear relation between MDS and MDS under noise is also maintained well, which provides a theoretical support to applications of the model-based WFSless system.
NASA Astrophysics Data System (ADS)
Tanaka, Takuro; Takahashi, Hisashi
In some motor applications, it is very difficult to attach a position sensor to the motor in housing. One of the examples of such applications is the dental handpiece-motor. In those designs, it is necessary to drive highly efficiency at low speed and variable load condition without a position sensor. We developed a method to control a motor high-efficient and smoothly at low speed without a position sensor. In this paper, the method in which permanent magnet synchronous motor is controlled smoothly and high-efficient by using torque angle control in synchronized operation is shown. The usefulness is confirmed by experimental results. In conclusion, the proposed sensor-less control method has been achieved to be very efficiently and smoothly.
2013-05-01
an 18 inch gap diameter has roughly a 2 foot outer diameter 2 “ Brushless Permanent...require PMs include wound rotor DC (brush and brushless ), Variable or Switched reluctance (VR or SR) machines and squirrel cage induction motors...Trades have identified Brushless DC PM and SR machines are of primary interest. Both motors can use sensorless commutation methods. A VR resolver can
Two-character motion analysis and synthesis.
Kwon, Taesoo; Cho, Young-Sang; Park, Sang Il; Shin, Sung Yong
2008-01-01
In this paper, we deal with the problem of synthesizing novel motions of standing-up martial arts such as Kickboxing, Karate, and Taekwondo performed by a pair of human-like characters while reflecting their interactions. Adopting an example-based paradigm, we address three non-trivial issues embedded in this problem: motion modeling, interaction modeling, and motion synthesis. For the first issue, we present a semi-automatic motion labeling scheme based on force-based motion segmentation and learning-based action classification. We also construct a pair of motion transition graphs each of which represents an individual motion stream. For the second issue, we propose a scheme for capturing the interactions between two players. A dynamic Bayesian network is adopted to build a motion transition model on top of the coupled motion transition graph that is constructed from an example motion stream. For the last issue, we provide a scheme for synthesizing a novel sequence of coupled motions, guided by the motion transition model. Although the focus of the present work is on martial arts, we believe that the framework of the proposed approach can be conveyed to other two-player motions as well.
Ocular tracking responses to background motion gated by feature-based attention.
Souto, David; Kerzel, Dirk
2014-09-01
Involuntary ocular tracking responses to background motion offer a window on the dynamics of motion computations. In contrast to spatial attention, we know little about the role of feature-based attention in determining this ocular response. To probe feature-based effects of background motion on involuntary eye movements, we presented human observers with a balanced background perturbation. Two clouds of dots moved in opposite vertical directions while observers tracked a target moving in horizontal direction. Additionally, they had to discriminate a change in the direction of motion (±10° from vertical) of one of the clouds. A vertical ocular following response occurred in response to the motion of the attended cloud. When motion selection was based on motion direction and color of the dots, the peak velocity of the tracking response was 30% of the tracking response elicited in a single task with only one direction of background motion. In two other experiments, we tested the effect of the perturbation when motion selection was based on color, by having motion direction vary unpredictably, or on motion direction alone. Although the gain of pursuit in the horizontal direction was significantly reduced in all experiments, indicating a trade-off between perceptual and oculomotor tasks, ocular responses to perturbations were only observed when selection was based on both motion direction and color. It appears that selection by motion direction can only be effective for driving ocular tracking when the relevant elements can be segregated before motion onset. Copyright © 2014 the American Physiological Society.
MTPA control of mechanical sensorless IPMSM based on adaptive nonlinear control.
Najjar-Khodabakhsh, Abbas; Soltani, Jafar
2016-03-01
In this paper, an adaptive nonlinear control scheme has been proposed for implementing maximum torque per ampere (MTPA) control strategy corresponding to interior permanent magnet synchronous motor (IPMSM) drive. This control scheme is developed in the rotor d-q axis reference frame using adaptive input-output state feedback linearization (AIOFL) method. The drive system control stability is supported by Lyapunov theory. The motor inductances are online estimated by an estimation law obtained by AIOFL. The estimation errors of these parameters are proved to be asymptotically converged to zero. Based on minimizing the motor current amplitude, the MTPA control strategy is performed by using the nonlinear optimization technique while considering the online reference torque. The motor reference torque is generated by a conventional rotor speed PI controller. By performing MTPA control strategy, the generated online motor d-q reference currents were used in AIOFL controller to obtain the SV-PWM reference voltages and the online estimation of the motor d-q inductances. In addition, the stator resistance is online estimated using a conventional PI controller. Moreover, the rotor position is detected using the online estimation of the stator flux and online estimation of the motor q-axis inductance. Simulation and experimental results obtained prove the effectiveness and the capability of the proposed control method. Copyright © 2016 ISA. Published by Elsevier Ltd. All rights reserved.
Bonora, Stefano; Jian, Yifan; Zhang, Pengfei; Zam, Azhar; Pugh, Edward N; Zawadzki, Robert J; Sarunic, Marinko V
2015-08-24
Adaptive optics is rapidly transforming microscopy and high-resolution ophthalmic imaging. The adaptive elements commonly used to control optical wavefronts are liquid crystal spatial light modulators and deformable mirrors. We introduce a novel Multi-actuator Adaptive Lens that can correct aberrations to high order, and which has the potential to increase the spread of adaptive optics to many new applications by simplifying its integration with existing systems. Our method combines an adaptive lens with an imaged-based optimization control that allows the correction of images to the diffraction limit, and provides a reduction of hardware complexity with respect to existing state-of-the-art adaptive optics systems. The Multi-actuator Adaptive Lens design that we present can correct wavefront aberrations up to the 4th order of the Zernike polynomial characterization. The performance of the Multi-actuator Adaptive Lens is demonstrated in a wide field microscope, using a Shack-Hartmann wavefront sensor for closed loop control. The Multi-actuator Adaptive Lens and image-based wavefront-sensorless control were also integrated into the objective of a Fourier Domain Optical Coherence Tomography system for in vivo imaging of mouse retinal structures. The experimental results demonstrate that the insertion of the Multi-actuator Objective Lens can generate arbitrary wavefronts to correct aberrations down to the diffraction limit, and can be easily integrated into optical systems to improve the quality of aberrated images.
Motion Pattern Encapsulation for Data-Driven Constraint-Based Motion Editing
NASA Astrophysics Data System (ADS)
Carvalho, Schubert R.; Boulic, Ronan; Thalmann, Daniel
The growth of motion capture systems have contributed to the proliferation of human motion database, mainly because human motion is important in many applications, ranging from games entertainment and films to sports and medicine. However, the captured motions normally attend specific needs. As an effort for adapting and reusing captured human motions in new tasks and environments and improving the animator's work, we present and discuss a new data-driven constraint-based animation system for interactive human motion editing. This method offers the compelling advantage that it provides faster deformations and more natural-looking motion results compared to goal-directed constraint-based methods found in the literature.
Hybrid Motion Planning with Multiple Destinations
NASA Technical Reports Server (NTRS)
Clouse, Jeffery
1998-01-01
In our initial proposal, we laid plans for developing a hybrid motion planning system that combines the concepts of visibility-based motion planning, artificial potential field based motion planning, evolutionary constrained optimization, and reinforcement learning. Our goal was, and still is, to produce a hybrid motion planning system that outperforms the best traditional motion planning systems on problems with dynamic environments. The proposed hybrid system will be in two parts the first is a global motion planning system and the second is a local motion planning system. The global system will take global information about the environment, such as the placement of the obstacles and goals, and produce feasible paths through those obstacles. We envision a system that combines the evolutionary-based optimization and visibility-based motion planning to achieve this end.
Huang, Ai-Mei; Nguyen, Truong
2009-04-01
In this paper, we address the problems of unreliable motion vectors that cause visual artifacts but cannot be detected by high residual energy or bidirectional prediction difference in motion-compensated frame interpolation. A correlation-based motion vector processing method is proposed to detect and correct those unreliable motion vectors by explicitly considering motion vector correlation in the motion vector reliability classification, motion vector correction, and frame interpolation stages. Since our method gradually corrects unreliable motion vectors based on their reliability, we can effectively discover the areas where no motion is reliable to be used, such as occlusions and deformed structures. We also propose an adaptive frame interpolation scheme for the occlusion areas based on the analysis of their surrounding motion distribution. As a result, the interpolated frames using the proposed scheme have clearer structure edges and ghost artifacts are also greatly reduced. Experimental results show that our interpolated results have better visual quality than other methods. In addition, the proposed scheme is robust even for those video sequences that contain multiple and fast motions.
Software Tools for Developing and Simulating the NASA LaRC CMF Motion Base
NASA Technical Reports Server (NTRS)
Bryant, Richard B., Jr.; Carrelli, David J.
2006-01-01
The NASA Langley Research Center (LaRC) Cockpit Motion Facility (CMF) motion base has provided many design and analysis challenges. In the process of addressing these challenges, a comprehensive suite of software tools was developed. The software tools development began with a detailed MATLAB/Simulink model of the motion base which was used primarily for safety loads prediction, design of the closed loop compensator and development of the motion base safety systems1. A Simulink model of the digital control law, from which a portion of the embedded code is directly generated, was later added to this model to form a closed loop system model. Concurrently, software that runs on a PC was created to display and record motion base parameters. It includes a user interface for controlling time history displays, strip chart displays, data storage, and initializing of function generators used during motion base testing. Finally, a software tool was developed for kinematic analysis and prediction of mechanical clearances for the motion system. These tools work together in an integrated package to support normal operations of the motion base, simulate the end to end operation of the motion base system providing facilities for software-in-the-loop testing, mechanical geometry and sensor data visualizations, and function generator setup and evaluation.
NASA Astrophysics Data System (ADS)
Ren, Silin; Jin, Xiao; Chan, Chung; Jian, Yiqiang; Mulnix, Tim; Liu, Chi; E Carson, Richard
2017-06-01
Data-driven respiratory gating techniques were developed to correct for respiratory motion in PET studies, without the help of external motion tracking systems. Due to the greatly increased image noise in gated reconstructions, it is desirable to develop a data-driven event-by-event respiratory motion correction method. In this study, using the Centroid-of-distribution (COD) algorithm, we established a data-driven event-by-event respiratory motion correction technique using TOF PET list-mode data, and investigated its performance by comparing with an external system-based correction method. Ten human scans with the pancreatic β-cell tracer 18F-FP-(+)-DTBZ were employed. Data-driven respiratory motions in superior-inferior (SI) and anterior-posterior (AP) directions were first determined by computing the centroid of all radioactive events during each short time frame with further processing. The Anzai belt system was employed to record respiratory motion in all studies. COD traces in both SI and AP directions were first compared with Anzai traces by computing the Pearson correlation coefficients. Then, respiratory gated reconstructions based on either COD or Anzai traces were performed to evaluate their relative performance in capturing respiratory motion. Finally, based on correlations of displacements of organ locations in all directions and COD information, continuous 3D internal organ motion in SI and AP directions was calculated based on COD traces to guide event-by-event respiratory motion correction in the MOLAR reconstruction framework. Continuous respiratory correction results based on COD were compared with that based on Anzai, and without motion correction. Data-driven COD traces showed a good correlation with Anzai in both SI and AP directions for the majority of studies, with correlation coefficients ranging from 63% to 89%. Based on the determined respiratory displacements of pancreas between end-expiration and end-inspiration from gated reconstructions, there was no significant difference between COD-based and Anzai-based methods. Finally, data-driven COD-based event-by-event respiratory motion correction yielded comparable results to that based on Anzai respiratory traces, in terms of contrast recovery and reduced motion-induced blur. Data-driven event-by-event respiratory motion correction using COD showed significant image quality improvement compared with reconstructions with no motion correction, and gave comparable results to the Anzai-based method.
Ren, Silin; Jin, Xiao; Chan, Chung; Jian, Yiqiang; Mulnix, Tim; Liu, Chi; Carson, Richard E
2017-06-21
Data-driven respiratory gating techniques were developed to correct for respiratory motion in PET studies, without the help of external motion tracking systems. Due to the greatly increased image noise in gated reconstructions, it is desirable to develop a data-driven event-by-event respiratory motion correction method. In this study, using the Centroid-of-distribution (COD) algorithm, we established a data-driven event-by-event respiratory motion correction technique using TOF PET list-mode data, and investigated its performance by comparing with an external system-based correction method. Ten human scans with the pancreatic β-cell tracer 18 F-FP-(+)-DTBZ were employed. Data-driven respiratory motions in superior-inferior (SI) and anterior-posterior (AP) directions were first determined by computing the centroid of all radioactive events during each short time frame with further processing. The Anzai belt system was employed to record respiratory motion in all studies. COD traces in both SI and AP directions were first compared with Anzai traces by computing the Pearson correlation coefficients. Then, respiratory gated reconstructions based on either COD or Anzai traces were performed to evaluate their relative performance in capturing respiratory motion. Finally, based on correlations of displacements of organ locations in all directions and COD information, continuous 3D internal organ motion in SI and AP directions was calculated based on COD traces to guide event-by-event respiratory motion correction in the MOLAR reconstruction framework. Continuous respiratory correction results based on COD were compared with that based on Anzai, and without motion correction. Data-driven COD traces showed a good correlation with Anzai in both SI and AP directions for the majority of studies, with correlation coefficients ranging from 63% to 89%. Based on the determined respiratory displacements of pancreas between end-expiration and end-inspiration from gated reconstructions, there was no significant difference between COD-based and Anzai-based methods. Finally, data-driven COD-based event-by-event respiratory motion correction yielded comparable results to that based on Anzai respiratory traces, in terms of contrast recovery and reduced motion-induced blur. Data-driven event-by-event respiratory motion correction using COD showed significant image quality improvement compared with reconstructions with no motion correction, and gave comparable results to the Anzai-based method.
General rigid motion correction for computed tomography imaging based on locally linear embedding
NASA Astrophysics Data System (ADS)
Chen, Mianyi; He, Peng; Feng, Peng; Liu, Baodong; Yang, Qingsong; Wei, Biao; Wang, Ge
2018-02-01
The patient motion can damage the quality of computed tomography images, which are typically acquired in cone-beam geometry. The rigid patient motion is characterized by six geometric parameters and are more challenging to correct than in fan-beam geometry. We extend our previous rigid patient motion correction method based on the principle of locally linear embedding (LLE) from fan-beam to cone-beam geometry and accelerate the computational procedure with the graphics processing unit (GPU)-based all scale tomographic reconstruction Antwerp toolbox. The major merit of our method is that we need neither fiducial markers nor motion-tracking devices. The numerical and experimental studies show that the LLE-based patient motion correction is capable of calibrating the six parameters of the patient motion simultaneously, reducing patient motion artifacts significantly.
Simulation of spatiotemporal CT data sets using a 4D MRI-based lung motion model.
Marx, Mirko; Ehrhardt, Jan; Werner, René; Schlemmer, Heinz-Peter; Handels, Heinz
2014-05-01
Four-dimensional CT imaging is widely used to account for motion-related effects during radiotherapy planning of lung cancer patients. However, 4D CT often contains motion artifacts, cannot be used to measure motion variability, and leads to higher dose exposure. In this article, we propose using 4D MRI to acquire motion information for the radiotherapy planning process. From the 4D MRI images, we derive a time-continuous model of the average patient-specific respiratory motion, which is then applied to simulate 4D CT data based on a static 3D CT. The idea of the motion model is to represent the average lung motion over a respiratory cycle by cyclic B-spline curves. The model generation consists of motion field estimation in the 4D MRI data by nonlinear registration, assigning respiratory phases to the motion fields, and applying a B-spline approximation on a voxel-by-voxel basis to describe the average voxel motion over a breathing cycle. To simulate a patient-specific 4D CT based on a static CT of the patient, a multi-modal registration strategy is introduced to transfer the motion model from MRI to the static CT coordinates. Differences between model-based estimated and measured motion vectors are on average 1.39 mm for amplitude-based binning of the 4D MRI data of three patients. In addition, the MRI-to-CT registration strategy is shown to be suitable for the model transformation. The application of our 4D MRI-based motion model for simulating 4D CT images provides advantages over standard 4D CT (less motion artifacts, radiation-free). This makes it interesting for radiotherapy planning.
A Novelty Design Of Minimization Of Electrical Losses In A Vector Controlled Induction Machine Drive
NASA Astrophysics Data System (ADS)
Aryza, Solly; Irwanto, M.; Lubis, Zulkarnain; Putera Utama Siahaan, Andysah; Rahim, Robbi; Furqan, Mhd.
2018-01-01
The induction motor has in the industry . More attention has been a focus to develop and design of induction motor drive. With the method of vector control novelty prove the efficiency of induction motor over their entire speed range. In this paper desirable to design a loss minimization controller which can improve the efficiency. Also, this research described Modeling of an induction motor with core loss included. Realization of methods vector control for an induction motor drive with loss element included. The case of the loss minimization condition. The procedure was successful to calculate the gains of a PI controller. Though the problem of obtaining a robust and sensorless induction motor drive is by no means completely solved, the results obtained as part of this work point in a promising direction.
Brillouin micro-spectroscopy through aberrations via sensorless adaptive optics
NASA Astrophysics Data System (ADS)
Edrei, Eitan; Scarcelli, Giuliano
2018-04-01
Brillouin spectroscopy is a powerful optical technique for non-contact viscoelastic characterizations which has recently found applications in three-dimensional mapping of biological samples. Brillouin spectroscopy performances are rapidly degraded by optical aberrations and have therefore been limited to homogenous transparent samples. In this work, we developed an adaptive optics (AO) configuration designed for Brillouin scattering spectroscopy to engineer the incident wavefront and correct for aberrations. Our configuration does not require direct wavefront sensing and the injection of a "guide-star"; hence, it can be implemented without the need for sample pre-treatment. We used our AO-Brillouin spectrometer in aberrated phantoms and biological samples and obtained improved precision and resolution of Brillouin spectral analysis; we demonstrated 2.5-fold enhancement in Brillouin signal strength and 1.4-fold improvement in axial resolution because of the correction of optical aberrations.
MotionExplorer: exploratory search in human motion capture data based on hierarchical aggregation.
Bernard, Jürgen; Wilhelm, Nils; Krüger, Björn; May, Thorsten; Schreck, Tobias; Kohlhammer, Jörn
2013-12-01
We present MotionExplorer, an exploratory search and analysis system for sequences of human motion in large motion capture data collections. This special type of multivariate time series data is relevant in many research fields including medicine, sports and animation. Key tasks in working with motion data include analysis of motion states and transitions, and synthesis of motion vectors by interpolation and combination. In the practice of research and application of human motion data, challenges exist in providing visual summaries and drill-down functionality for handling large motion data collections. We find that this domain can benefit from appropriate visual retrieval and analysis support to handle these tasks in presence of large motion data. To address this need, we developed MotionExplorer together with domain experts as an exploratory search system based on interactive aggregation and visualization of motion states as a basis for data navigation, exploration, and search. Based on an overview-first type visualization, users are able to search for interesting sub-sequences of motion based on a query-by-example metaphor, and explore search results by details on demand. We developed MotionExplorer in close collaboration with the targeted users who are researchers working on human motion synthesis and analysis, including a summative field study. Additionally, we conducted a laboratory design study to substantially improve MotionExplorer towards an intuitive, usable and robust design. MotionExplorer enables the search in human motion capture data with only a few mouse clicks. The researchers unanimously confirm that the system can efficiently support their work.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fogg, P; Aland, T; West, M
Purpose: To investigate the effects of external surrogate and tumour motion by observing the reconstructed phases and AveCT in an Amplitude and Time based 4DCT. Methods: Based on patient motion studies, Cos6 and sinusoidal motions were simulated as external surrogate and tumour motions in a motion phantom. The diaphragm and tumour motions may or may not display the same waveform therefore the same and different waveforms were programmed into the phantom, scanned and reconstructed based on Amplitude and Time. The AveCT and phases were investigated with these different scenarios. The AveCT phantom images were also compared with CBCT phantom imagesmore » programmed with the same motions. Results: For the same surrogate and tumour sin motions, the phases (Amplitude and Time) and AveCT indicated similar motions based on the position of the BB at the slice and displayed contrast values respectively. For cos6 motions, due to the varied time the tumour spends at each position, the Amplitude and Time based phases differed. The AveCT images represented the actual tumour motions and the Time and Amplitude based phases were represented by the surrogate with varied times. Conclusion: Different external surrogate and tumour motions may result in different displayed image motions when observing the AveCT and reconstructed phases. During the 4DCT, the surrogate motion is readily available for observation of the amplitude and time of the diaphragm position. Following image reconstruction, the user may need to observe the AveCT in addition to the reconstructed phases to comprehend the time weightings of the tumour motion during the scan. This may also apply to 3D CBCT images where the displayed tumour position in the images is influenced by the long duration of the CBCT. Knowledge of the tumour motion represented by the greyscale of the AveCT may also assist in CBCT treatment beam verification matching.« less
Key frame extraction based on spatiotemporal motion trajectory
NASA Astrophysics Data System (ADS)
Zhang, Yunzuo; Tao, Ran; Zhang, Feng
2015-05-01
Spatiotemporal motion trajectory can accurately reflect the changes of motion state. Motivated by this observation, this letter proposes a method for key frame extraction based on motion trajectory on the spatiotemporal slice. Different from the well-known motion related methods, the proposed method utilizes the inflexions of the motion trajectory on the spatiotemporal slice of all the moving objects. Experimental results show that although a similar performance is achieved in the single-objective screen, by comparing the proposed method to that achieved with the state-of-the-art methods based on motion energy or acceleration, the proposed method shows a better performance in a multiobjective video.
Quantication and analysis of respiratory motion from 4D MRI
NASA Astrophysics Data System (ADS)
Aizzuddin Abd Rahni, Ashrani; Lewis, Emma; Wells, Kevin
2014-11-01
It is well known that respiratory motion affects image acquisition and also external beam radiotherapy (EBRT) treatment planning and delivery. However often the existing approaches for respiratory motion management are based on a generic view of respiratory motion such as the general movement of organ, tissue or fiducials. This paper thus aims to present a more in depth analysis of respiratory motion based on 4D MRI for further integration into motion correction in image acquisition or image based EBRT. Internal and external motion was first analysed separately, on a per-organ basis for internal motion. Principal component analysis (PCA) was then performed on the internal and external motion vectors separately and the relationship between the two PCA spaces was analysed. The motion extracted from 4D MRI on general was found to be consistent with what has been reported in literature.
Werner, René; Ehrhardt, Jan; Schmidt-Richberg, Alexander; Heiss, Anabell; Handels, Heinz
2010-11-01
Motivated by radiotherapy of lung cancer non- linear registration is applied to estimate 3D motion fields for local lung motion analysis in thoracic 4D CT images. Reliability of analysis results depends on the registration accuracy. Therefore, our study consists of two parts: optimization and evaluation of a non-linear registration scheme for motion field estimation, followed by a registration-based analysis of lung motion patterns. The study is based on 4D CT data of 17 patients. Different distance measures and force terms for thoracic CT registration are implemented and compared: sum of squared differences versus a force term related to Thirion's demons registration; masked versus unmasked force computation. The most accurate approach is applied to local lung motion analysis. Masked Thirion forces outperform the other force terms. The mean target registration error is 1.3 ± 0.2 mm, which is in the order of voxel size. Based on resulting motion fields and inter-patient normalization of inner lung coordinates and breathing depths a non-linear dependency between inner lung position and corresponding strength of motion is identified. The dependency is observed for all patients without or with only small tumors. Quantitative evaluation of the estimated motion fields indicates high spatial registration accuracy. It allows for reliable registration-based local lung motion analysis. The large amount of information encoded in the motion fields makes it possible to draw detailed conclusions, e.g., to identify the dependency of inner lung localization and motion. Our examinations illustrate the potential of registration-based motion analysis.
Example-Based Automatic Music-Driven Conventional Dance Motion Synthesis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xu, Songhua; Fan, Rukun; Geng, Weidong
We introduce a novel method for synthesizing dance motions that follow the emotions and contents of a piece of music. Our method employs a learning-based approach to model the music to motion mapping relationship embodied in example dance motions along with those motions' accompanying background music. A key step in our method is to train a music to motion matching quality rating function through learning the music to motion mapping relationship exhibited in synchronized music and dance motion data, which were captured from professional human dance performance. To generate an optimal sequence of dance motion segments to match with amore » piece of music, we introduce a constraint-based dynamic programming procedure. This procedure considers both music to motion matching quality and visual smoothness of a resultant dance motion sequence. We also introduce a two-way evaluation strategy, coupled with a GPU-based implementation, through which we can execute the dynamic programming process in parallel, resulting in significant speedup. To evaluate the effectiveness of our method, we quantitatively compare the dance motions synthesized by our method with motion synthesis results by several peer methods using the motions captured from professional human dancers' performance as the gold standard. We also conducted several medium-scale user studies to explore how perceptually our dance motion synthesis method can outperform existing methods in synthesizing dance motions to match with a piece of music. These user studies produced very positive results on our music-driven dance motion synthesis experiments for several Asian dance genres, confirming the advantages of our method.« less
Real-time physics-based 3D biped character animation using an inverted pendulum model.
Tsai, Yao-Yang; Lin, Wen-Chieh; Cheng, Kuangyou B; Lee, Jehee; Lee, Tong-Yee
2010-01-01
We present a physics-based approach to generate 3D biped character animation that can react to dynamical environments in real time. Our approach utilizes an inverted pendulum model to online adjust the desired motion trajectory from the input motion capture data. This online adjustment produces a physically plausible motion trajectory adapted to dynamic environments, which is then used as the desired motion for the motion controllers to track in dynamics simulation. Rather than using Proportional-Derivative controllers whose parameters usually cannot be easily set, our motion tracking adopts a velocity-driven method which computes joint torques based on the desired joint angular velocities. Physically correct full-body motion of the 3D character is computed in dynamics simulation using the computed torques and dynamical model of the character. Our experiments demonstrate that tracking motion capture data with real-time response animation can be achieved easily. In addition, physically plausible motion style editing, automatic motion transition, and motion adaptation to different limb sizes can also be generated without difficulty.
A self-sensing active magnetic bearing based on a direct current measurement approach.
Niemann, Andries C; van Schoor, George; du Rand, Carel P
2013-09-11
Active magnetic bearings (AMBs) have become a key technology in various industrial applications. Self-sensing AMBs provide an integrated sensorless solution for position estimation, consolidating the sensing and actuating functions into a single electromagnetic transducer. The approach aims to reduce possible hardware failure points, production costs, and system complexity. Despite these advantages, self-sensing methods must address various technical challenges to maximize the performance thereof. This paper presents the direct current measurement (DCM) approach for self-sensing AMBs, denoting the direct measurement of the current ripple component. In AMB systems, switching power amplifiers (PAs) modulate the rotor position information onto the current waveform. Demodulation self-sensing techniques then use bandpass and lowpass filters to estimate the rotor position from the voltage and current signals. However, the additional phase-shift introduced by these filters results in lower stability margins. The DCM approach utilizes a novel PA switching method that directly measures the current ripple to obtain duty-cycle invariant position estimates. Demodulation filters are largely excluded to minimize additional phase-shift in the position estimates. Basic functionality and performance of the proposed self-sensing approach are demonstrated via a transient simulation model as well as a high current (10 A) experimental system. A digital implementation of amplitude modulation self-sensing serves as a comparative estimator.
Statistical prediction of space motion sickness
NASA Technical Reports Server (NTRS)
Reschke, Millard F.
1990-01-01
Studies designed to empirically examine the etiology of motion sickness to develop a foundation for enhancing its prediction are discussed. Topics addressed include early attempts to predict space motion sickness, multiple test data base that uses provocative and vestibular function tests, and data base subjects; reliability of provocative tests of motion sickness susceptibility; prediction of space motion sickness using linear discriminate analysis; and prediction of space motion sickness susceptibility using the logistic model.
The optional selection of micro-motion feature based on Support Vector Machine
NASA Astrophysics Data System (ADS)
Li, Bo; Ren, Hongmei; Xiao, Zhi-he; Sheng, Jing
2017-11-01
Micro-motion form of target is multiple, different micro-motion forms are apt to be modulated, which makes it difficult for feature extraction and recognition. Aiming at feature extraction of cone-shaped objects with different micro-motion forms, this paper proposes the best selection method of micro-motion feature based on support vector machine. After the time-frequency distribution of radar echoes, comparing the time-frequency spectrum of objects with different micro-motion forms, features are extracted based on the differences between the instantaneous frequency variations of different micro-motions. According to the methods based on SVM (Support Vector Machine) features are extracted, then the best features are acquired. Finally, the result shows the method proposed in this paper is feasible under the test condition of certain signal-to-noise ratio(SNR).
Bonora, Stefano; Jian, Yifan; Zhang, Pengfei; Zam, Azhar; Pugh, Edward N.; Zawadzki, Robert J.; Sarunic, Marinko V.
2015-01-01
Adaptive optics is rapidly transforming microscopy and high-resolution ophthalmic imaging. The adaptive elements commonly used to control optical wavefronts are liquid crystal spatial light modulators and deformable mirrors. We introduce a novel Multi-actuator Adaptive Lens that can correct aberrations to high order, and which has the potential to increase the spread of adaptive optics to many new applications by simplifying its integration with existing systems. Our method combines an adaptive lens with an imaged-based optimization control that allows the correction of images to the diffraction limit, and provides a reduction of hardware complexity with respect to existing state-of-the-art adaptive optics systems. The Multi-actuator Adaptive Lens design that we present can correct wavefront aberrations up to the 4th order of the Zernike polynomial characterization. The performance of the Multi-actuator Adaptive Lens is demonstrated in a wide field microscope, using a Shack-Hartmann wavefront sensor for closed loop control. The Multi-actuator Adaptive Lens and image-based wavefront-sensorless control were also integrated into the objective of a Fourier Domain Optical Coherence Tomography system for in vivo imaging of mouse retinal structures. The experimental results demonstrate that the insertion of the Multi-actuator Objective Lens can generate arbitrary wavefronts to correct aberrations down to the diffraction limit, and can be easily integrated into optical systems to improve the quality of aberrated images. PMID:26368169
Active contour-based visual tracking by integrating colors, shapes, and motions.
Hu, Weiming; Zhou, Xue; Li, Wei; Luo, Wenhan; Zhang, Xiaoqin; Maybank, Stephen
2013-05-01
In this paper, we present a framework for active contour-based visual tracking using level sets. The main components of our framework include contour-based tracking initialization, color-based contour evolution, adaptive shape-based contour evolution for non-periodic motions, dynamic shape-based contour evolution for periodic motions, and the handling of abrupt motions. For the initialization of contour-based tracking, we develop an optical flow-based algorithm for automatically initializing contours at the first frame. For the color-based contour evolution, Markov random field theory is used to measure correlations between values of neighboring pixels for posterior probability estimation. For adaptive shape-based contour evolution, the global shape information and the local color information are combined to hierarchically evolve the contour, and a flexible shape updating model is constructed. For the dynamic shape-based contour evolution, a shape mode transition matrix is learnt to characterize the temporal correlations of object shapes. For the handling of abrupt motions, particle swarm optimization is adopted to capture the global motion which is applied to the contour in the current frame to produce an initial contour in the next frame.
Analyzing locomotion synthesis with feature-based motion graphs.
Mahmudi, Mentar; Kallmann, Marcelo
2013-05-01
We propose feature-based motion graphs for realistic locomotion synthesis among obstacles. Among several advantages, feature-based motion graphs achieve improved results in search queries, eliminate the need of postprocessing for foot skating removal, and reduce the computational requirements in comparison to traditional motion graphs. Our contributions are threefold. First, we show that choosing transitions based on relevant features significantly reduces graph construction time and leads to improved search performances. Second, we employ a fast channel search method that confines the motion graph search to a free channel with guaranteed clearance among obstacles, achieving faster and improved results that avoid expensive collision checking. Lastly, we present a motion deformation model based on Inverse Kinematics applied over the transitions of a solution branch. Each transition is assigned a continuous deformation range that does not exceed the original transition cost threshold specified by the user for the graph construction. The obtained deformation improves the reachability of the feature-based motion graph and in turn also reduces the time spent during search. The results obtained by the proposed methods are evaluated and quantified, and they demonstrate significant improvements in comparison to traditional motion graph techniques.
Human motion analysis with detection of subpart deformations
NASA Astrophysics Data System (ADS)
Wang, Juhui; Lorette, Guy; Bouthemy, Patrick
1992-06-01
One essential constraint used in 3-D motion estimation from optical projections is the rigidity assumption. Because of muscle deformations in human motion, this rigidity requirement is often violated for some regions on the human body. Global methods usually fail to bring stable solutions. This paper presents a model-based approach to combating the effect of muscle deformations in human motion analysis. The approach developed is based on two main stages. In the first stage, the human body is partitioned into different areas, where each area is consistent with a general motion model (not necessarily corresponding to a physical existing motion pattern). In the second stage, the regions are eliminated under the hypothesis that they are not induced by a specific human motion pattern. Each hypothesis is generated by making use of specific knowledge about human motion. A global method is used to estimate the 3-D motion parameters in basis of valid segments. Experiments based on a cycling motion sequence are presented.
Linearized motion estimation for articulated planes.
Datta, Ankur; Sheikh, Yaser; Kanade, Takeo
2011-04-01
In this paper, we describe the explicit application of articulation constraints for estimating the motion of a system of articulated planes. We relate articulations to the relative homography between planes and show that these articulations translate into linearized equality constraints on a linear least-squares system, which can be solved efficiently using a Karush-Kuhn-Tucker system. The articulation constraints can be applied for both gradient-based and feature-based motion estimation algorithms and to illustrate this, we describe a gradient-based motion estimation algorithm for an affine camera and a feature-based motion estimation algorithm for a projective camera that explicitly enforces articulation constraints. We show that explicit application of articulation constraints leads to numerically stable estimates of motion. The simultaneous computation of motion estimates for all of the articulated planes in a scene allows us to handle scene areas where there is limited texture information and areas that leave the field of view. Our results demonstrate the wide applicability of the algorithm in a variety of challenging real-world cases such as human body tracking, motion estimation of rigid, piecewise planar scenes, and motion estimation of triangulated meshes.
MotionFlow: Visual Abstraction and Aggregation of Sequential Patterns in Human Motion Tracking Data.
Jang, Sujin; Elmqvist, Niklas; Ramani, Karthik
2016-01-01
Pattern analysis of human motions, which is useful in many research areas, requires understanding and comparison of different styles of motion patterns. However, working with human motion tracking data to support such analysis poses great challenges. In this paper, we propose MotionFlow, a visual analytics system that provides an effective overview of various motion patterns based on an interactive flow visualization. This visualization formulates a motion sequence as transitions between static poses, and aggregates these sequences into a tree diagram to construct a set of motion patterns. The system also allows the users to directly reflect the context of data and their perception of pose similarities in generating representative pose states. We provide local and global controls over the partition-based clustering process. To support the users in organizing unstructured motion data into pattern groups, we designed a set of interactions that enables searching for similar motion sequences from the data, detailed exploration of data subsets, and creating and modifying the group of motion patterns. To evaluate the usability of MotionFlow, we conducted a user study with six researchers with expertise in gesture-based interaction design. They used MotionFlow to explore and organize unstructured motion tracking data. Results show that the researchers were able to easily learn how to use MotionFlow, and the system effectively supported their pattern analysis activities, including leveraging their perception and domain knowledge.
On event-based optical flow detection
Brosch, Tobias; Tschechne, Stephan; Neumann, Heiko
2015-01-01
Event-based sensing, i.e., the asynchronous detection of luminance changes, promises low-energy, high dynamic range, and sparse sensing. This stands in contrast to whole image frame-wise acquisition by standard cameras. Here, we systematically investigate the implications of event-based sensing in the context of visual motion, or flow, estimation. Starting from a common theoretical foundation, we discuss different principal approaches for optical flow detection ranging from gradient-based methods over plane-fitting to filter based methods and identify strengths and weaknesses of each class. Gradient-based methods for local motion integration are shown to suffer from the sparse encoding in address-event representations (AER). Approaches exploiting the local plane like structure of the event cloud, on the other hand, are shown to be well suited. Within this class, filter based approaches are shown to define a proper detection scheme which can also deal with the problem of representing multiple motions at a single location (motion transparency). A novel biologically inspired efficient motion detector is proposed, analyzed and experimentally validated. Furthermore, a stage of surround normalization is incorporated. Together with the filtering this defines a canonical circuit for motion feature detection. The theoretical analysis shows that such an integrated circuit reduces motion ambiguity in addition to decorrelating the representation of motion related activations. PMID:25941470
Facial motion parameter estimation and error criteria in model-based image coding
NASA Astrophysics Data System (ADS)
Liu, Yunhai; Yu, Lu; Yao, Qingdong
2000-04-01
Model-based image coding has been given extensive attention due to its high subject image quality and low bit-rates. But the estimation of object motion parameter is still a difficult problem, and there is not a proper error criteria for the quality assessment that are consistent with visual properties. This paper presents an algorithm of the facial motion parameter estimation based on feature point correspondence and gives the motion parameter error criteria. The facial motion model comprises of three parts. The first part is the global 3-D rigid motion of the head, the second part is non-rigid translation motion in jaw area, and the third part consists of local non-rigid expression motion in eyes and mouth areas. The feature points are automatically selected by a function of edges, brightness and end-node outside the blocks of eyes and mouth. The numbers of feature point are adjusted adaptively. The jaw translation motion is tracked by the changes of the feature point position of jaw. The areas of non-rigid expression motion can be rebuilt by using block-pasting method. The estimation approach of motion parameter error based on the quality of reconstructed image is suggested, and area error function and the error function of contour transition-turn rate are used to be quality criteria. The criteria reflect the image geometric distortion caused by the error of estimated motion parameters properly.
PROMO – Real-time Prospective Motion Correction in MRI using Image-based Tracking
White, Nathan; Roddey, Cooper; Shankaranarayanan, Ajit; Han, Eric; Rettmann, Dan; Santos, Juan; Kuperman, Josh; Dale, Anders
2010-01-01
Artifacts caused by patient motion during scanning remain a serious problem in most MRI applications. The prospective motion correction technique attempts to address this problem at its source by keeping the measurement coordinate system fixed with respect to the patient throughout the entire scan process. In this study, a new image-based approach for prospective motion correction is described, which utilizes three orthogonal 2D spiral navigator acquisitions (SP-Navs) along with a flexible image-based tracking method based on the Extended Kalman Filter (EKF) algorithm for online motion measurement. The SP-Nav/EKF framework offers the advantages of image-domain tracking within patient-specific regions-of-interest and reduced sensitivity to off-resonance-induced corruption of rigid-body motion estimates. The performance of the method was tested using offline computer simulations and online in vivo head motion experiments. In vivo validation results covering a broad range of staged head motions indicate a steady-state error of the SP-Nav/EKF motion estimates of less than 10 % of the motion magnitude, even for large compound motions that included rotations over 15 degrees. A preliminary in vivo application in 3D inversion recovery spoiled gradient echo (IR-SPGR) and 3D fast spin echo (FSE) sequences demonstrates the effectiveness of the SP-Nav/EKF framework for correcting 3D rigid-body head motion artifacts prospectively in high-resolution 3D MRI scans. PMID:20027635
Methods to detect, characterize, and remove motion artifact in resting state fMRI
Power, Jonathan D; Mitra, Anish; Laumann, Timothy O; Snyder, Abraham Z; Schlaggar, Bradley L; Petersen, Steven E
2013-01-01
Head motion systematically alters correlations in resting state functional connectivity fMRI (RSFC). In this report we examine impact of motion on signal intensity and RSFC correlations. We find that motion-induced signal changes (1) are often complex and variable waveforms, (2) are often shared across nearly all brain voxels, and (3) often persist more than 10 seconds after motion ceases. These signal changes, both during and after motion, increase observed RSFC correlations in a distance-dependent manner. Motion-related signal changes are not removed by a variety of motion-based regressors, but are effectively reduced by global signal regression. We link several measures of data quality to motion, changes in signal intensity, and changes in RSFC correlations. We demonstrate that improvements in data quality measures during processing may represent cosmetic improvements rather than true correction of the data. We demonstrate a within-subject, censoring-based artifact removal strategy based on volume censoring that reduces group differences due to motion to chance levels. We note conditions under which group-level regressions do and do not correct motion-related effects. PMID:23994314
Estimation of bio-signal based on human motion for integrated visualization of daily-life.
Umetani, Tomohiro; Matsukawa, Tsuyoshi; Yokoyama, Kiyoko
2007-01-01
This paper describes a method for the estimation of bio-signals based on human motion in daily life for an integrated visualization system. The recent advancement of computers and measurement technology has facilitated the integrated visualization of bio-signals and human motion data. It is desirable to obtain a method to understand the activities of muscles based on human motion data and evaluate the change in physiological parameters according to human motion for visualization applications. We suppose that human motion is generated by the activities of muscles reflected from the brain to bio-signals such as electromyograms. This paper introduces a method for the estimation of bio-signals based on neural networks. This method can estimate the other physiological parameters based on the same procedure. The experimental results show the feasibility of the proposed method.
Motor Control of Two Flywheels Enabling Combined Attitude Control and Bus Regulation
NASA Technical Reports Server (NTRS)
Kenny, Barbara H.
2004-01-01
This presentation discussed the flywheel technology development work that is ongoing at NASA GRC with a particular emphasis on the flywheel system control. The "field orientation" motor/generator control algorithm was discussed and explained. The position-sensorless angle and speed estimation algorithm was presented. The motor current response to a step change in command at low (10 kRPM) and high (60 kRPM) was discussed. The flywheel DC bus regulation control was explained and experimental results presented. Finally, the combined attitude control and energy storage algorithm that controls two flywheels simultaneously was presented. Experimental results were shown that verified the operational capability of the algorithm. shows high speed flywheel energy storage (60,000 RPM) and the successful implementation of an algorithm to simultaneously control both energy storage and a single axis of attitude with two flywheels. Overall, the presentation demonstrated that GRC has an operational facility that
NASA Astrophysics Data System (ADS)
Morimoto, Shigeo; Nakamura, Tomohiko; Takeda, Yoji
This paper proposes the sensorless output power maximization control of the wind generation system. A permanent magnet synchronous generator (PMSG) is used as a variable speed generator in the proposed system. The generator torque is suitably controlled according to the generator speed and thus the power from a wind turbine settles down on the maximum power point by the proposed MPPT control method, where the information of wind velocity is not required. Moreover, the maximum available generated power is obtained by the optimum current vector control. The current vector of PMSG is optimally controlled according to the generator speed and the required torque in order to minimize the losses of PMSG considering the voltage and current constraints. The proposed wind power generation system can be achieved without mechanical sensors such as a wind velocity detector and a position sensor. Several experimental results show the effectiveness of the proposed control method.
Signal injection as a fault detection technique.
Cusidó, Jordi; Romeral, Luis; Ortega, Juan Antonio; Garcia, Antoni; Riba, Jordi
2011-01-01
Double frequency tests are used for evaluating stator windings and analyzing the temperature. Likewise, signal injection on induction machines is used on sensorless motor control fields to find out the rotor position. Motor Current Signature Analysis (MCSA), which focuses on the spectral analysis of stator current, is the most widely used method for identifying faults in induction motors. Motor faults such as broken rotor bars, bearing damage and eccentricity of the rotor axis can be detected. However, the method presents some problems at low speed and low torque, mainly due to the proximity between the frequencies to be detected and the small amplitude of the resulting harmonics. This paper proposes the injection of an additional voltage into the machine being tested at a frequency different from the fundamental one, and then studying the resulting harmonics around the new frequencies appearing due to the composition between injected and main frequencies.
Signal Injection as a Fault Detection Technique
Cusidó, Jordi; Romeral, Luis; Ortega, Juan Antonio; Garcia, Antoni; Riba, Jordi
2011-01-01
Double frequency tests are used for evaluating stator windings and analyzing the temperature. Likewise, signal injection on induction machines is used on sensorless motor control fields to find out the rotor position. Motor Current Signature Analysis (MCSA), which focuses on the spectral analysis of stator current, is the most widely used method for identifying faults in induction motors. Motor faults such as broken rotor bars, bearing damage and eccentricity of the rotor axis can be detected. However, the method presents some problems at low speed and low torque, mainly due to the proximity between the frequencies to be detected and the small amplitude of the resulting harmonics. This paper proposes the injection of an additional voltage into the machine being tested at a frequency different from the fundamental one, and then studying the resulting harmonics around the new frequencies appearing due to the composition between injected and main frequencies. PMID:22163801
Scaling earthquake ground motions for performance-based assessment of buildings
Huang, Y.-N.; Whittaker, A.S.; Luco, N.; Hamburger, R.O.
2011-01-01
The impact of alternate ground-motion scaling procedures on the distribution of displacement responses in simplified structural systems is investigated. Recommendations are provided for selecting and scaling ground motions for performance-based assessment of buildings. Four scaling methods are studied, namely, (1)geometric-mean scaling of pairs of ground motions, (2)spectrum matching of ground motions, (3)first-mode-period scaling to a target spectral acceleration, and (4)scaling of ground motions per the distribution of spectral demands. Data were developed by nonlinear response-history analysis of a large family of nonlinear single degree-of-freedom (SDOF) oscillators that could represent fixed-base and base-isolated structures. The advantages and disadvantages of each scaling method are discussed. The relationship between spectral shape and a ground-motion randomness parameter, is presented. A scaling procedure that explicitly considers spectral shape is proposed. ?? 2011 American Society of Civil Engineers.
Velocity-based motion categorization by pigeons.
Cook, Robert G; Beale, Kevin; Koban, Angie
2011-04-01
To examine if animals could learn action-like categorizations in a manner similar to noun-based categories, eight pigeons were trained to categorize rates of object motion. Testing 40 different objects in a go/no-go discrimination, pigeons were first trained to discriminate between fast and slow rates of object rotation around their central y-axis. They easily learned this velocity discrimination and transferred it to novel objects and rates. This discrimination also transferred to novel types of motions including the other two axes of rotation and two new translations around the display. Comparable tests with rapid and slow changes in the objects' size, color, and shape failed to support comparable transfer. This difference in discrimination transfer between motion-based and property-based changes suggests the pigeons had learned motion concept rather than one based on change per se. The results provide evidence that pigeons can acquire an understanding of motion-based actions, at least with regard to the property of object velocity. This may be similar to our use of verbs and adverbs to categorize different classes of behavior or motion (e.g., walking, jogging, or running slow vs. fast).
Galashan, Daniela; Wittfoth, Matthias; Fehr, Thorsten; Herrmann, Manfred
2008-07-01
Behavioral and electrophysiological correlates of two Simon tasks were examined using comparable stimuli but different task-irrelevant and conflict-inducing stimulus features. Whereas target shape was always the task-relevant stimulus attribute, either target location (location-based task) or motion direction within the target stimuli (motion-based task) was used as a source of conflict. Data from ten healthy participants who performed both tasks are presented. In the motion-based task the incompatible condition showed smaller P300 amplitudes at Pz than the compatible condition and the location-based task yielded a trend towards a reduced P300 amplitude in the incompatible condition. For both tasks, no P300 latency differences between the conditions were found at Pz. The results suggest that the motion-based task elicits behavioral and electrophysiological effects comparable with regular Simon tasks. As all stimuli in the motion-based Simon task were presented centrally the present data strongly argue against the attention-shifting account as an explanatory approach.
Real-time intra-fraction-motion tracking using the treatment couch: a feasibility study
NASA Astrophysics Data System (ADS)
D'Souza, Warren D.; Naqvi, Shahid A.; Yu, Cedric X.
2005-09-01
Significant differences between planned and delivered treatments may occur due to respiration-induced tumour motion, leading to underdosing of parts of the tumour and overdosing of parts of the surrounding critical structures. Existing methods proposed to counter tumour motion include breath-holds, gating and MLC-based tracking. Breath-holds and gating techniques increase treatment time considerably, whereas MLC-based tracking is limited to two dimensions. We present an alternative solution in which a robotic couch moves in real time in response to organ motion. To demonstrate proof-of-principle, we constructed a miniature adaptive couch model consisting of two movable platforms that simulate tumour motion and couch motion, respectively. These platforms were connected via an electronic feedback loop so that the bottom platform responded to the motion of the top platform. We tested our model with a seven-field step-and-shoot delivery case in which we performed three film-based experiments: (1) static geometry, (2) phantom-only motion and (3) phantom motion with simulated couch motion. Our measurements demonstrate that the miniature couch was able to compensate for phantom motion to the extent that the dose distributions were practically indistinguishable from those in static geometry. Motivated by this initial success, we investigated a real-time couch compensation system consisting of a stereoscopic infra-red camera system interfaced to a robotic couch known as the Hexapod™, which responds in real time to any change in position detected by the cameras. Optical reflectors placed on a solid water phantom were used as surrogates for motion. We tested the effectiveness of couch-based motion compensation for fixed fields and a dynamic arc delivery cases. Due to hardware limitations, we performed film-based experiments (1), (2) and (3), with the robotic couch at a phantom motion period and dose rate of 16 s and 100 MU min-1, respectively. Analysis of film measurements showed near-equivalent dose distributions (<=2 mm agreement of corresponding isodose lines) for static geometry and motion-synchronized real-time robotic couch tracking-based radiation delivery.
Autogenic feedback training experiment: A preventative method for space motion sickness
NASA Technical Reports Server (NTRS)
Cowings, Patricia S.
1993-01-01
Space motion sickness is a disorder which produces symptoms similar to those of motion sickness on Earth. This syndrome has affected approximately 50 percent of all astronauts and cosmonauts exposed to microgravity in space, but it differs from what is commonly known as motion sickness in a number of critical ways. There is currently no ground-based method for predicting susceptibility to motion sickness in space. Antimotion sickness drugs have had limited success in preventing or counteracting symptoms in space, and frequently caused debilitating side effects. The objectives were: (1) to evaluate the effectiveness of Autogenic-Feedback Training as a countermeasure for space motion sickness; (2) to compare physiological data and in-flight symptom reports to ground-based motion sickness data; and (3) to predict susceptibility to space motion sickness based on pre-flight data of each treatment group crew member.
Scene-based nonuniformity correction and enhancement: pixel statistics and subpixel motion.
Zhao, Wenyi; Zhang, Chao
2008-07-01
We propose a framework for scene-based nonuniformity correction (NUC) and nonuniformity correction and enhancement (NUCE) that is required for focal-plane array-like sensors to obtain clean and enhanced-quality images. The core of the proposed framework is a novel registration-based nonuniformity correction super-resolution (NUCSR) method that is bootstrapped by statistical scene-based NUC methods. Based on a comprehensive imaging model and an accurate parametric motion estimation, we are able to remove severe/structured nonuniformity and in the presence of subpixel motion to simultaneously improve image resolution. One important feature of our NUCSR method is the adoption of a parametric motion model that allows us to (1) handle many practical scenarios where parametric motions are present and (2) carry out perfect super-resolution in principle by exploring available subpixel motions. Experiments with real data demonstrate the efficiency of the proposed NUCE framework and the effectiveness of the NUCSR method.
Separate Perceptual and Neural Processing of Velocity- and Disparity-Based 3D Motion Signals
Czuba, Thaddeus B.; Cormack, Lawrence K.; Huk, Alexander C.
2016-01-01
Although the visual system uses both velocity- and disparity-based binocular information for computing 3D motion, it is unknown whether (and how) these two signals interact. We found that these two binocular signals are processed distinctly at the levels of both cortical activity in human MT and perception. In human MT, adaptation to both velocity-based and disparity-based 3D motions demonstrated direction-selective neuroimaging responses. However, when adaptation to one cue was probed using the other cue, there was no evidence of interaction between them (i.e., there was no “cross-cue” adaptation). Analogous psychophysical measurements yielded correspondingly weak cross-cue motion aftereffects (MAEs) in the face of very strong within-cue adaptation. In a direct test of perceptual independence, adapting to opposite 3D directions generated by different binocular cues resulted in simultaneous, superimposed, opposite-direction MAEs. These findings suggest that velocity- and disparity-based 3D motion signals may both flow through area MT but constitute distinct signals and pathways. SIGNIFICANCE STATEMENT Recent human neuroimaging and monkey electrophysiology have revealed 3D motion selectivity in area MT, which is driven by both velocity-based and disparity-based 3D motion signals. However, to elucidate the neural mechanisms by which the brain extracts 3D motion given these binocular signals, it is essential to understand how—or indeed if—these two binocular cues interact. We show that velocity-based and disparity-based signals are mostly separate at the levels of both fMRI responses in area MT and perception. Our findings suggest that the two binocular cues for 3D motion might be processed by separate specialized mechanisms. PMID:27798134
Separate Perceptual and Neural Processing of Velocity- and Disparity-Based 3D Motion Signals.
Joo, Sung Jun; Czuba, Thaddeus B; Cormack, Lawrence K; Huk, Alexander C
2016-10-19
Although the visual system uses both velocity- and disparity-based binocular information for computing 3D motion, it is unknown whether (and how) these two signals interact. We found that these two binocular signals are processed distinctly at the levels of both cortical activity in human MT and perception. In human MT, adaptation to both velocity-based and disparity-based 3D motions demonstrated direction-selective neuroimaging responses. However, when adaptation to one cue was probed using the other cue, there was no evidence of interaction between them (i.e., there was no "cross-cue" adaptation). Analogous psychophysical measurements yielded correspondingly weak cross-cue motion aftereffects (MAEs) in the face of very strong within-cue adaptation. In a direct test of perceptual independence, adapting to opposite 3D directions generated by different binocular cues resulted in simultaneous, superimposed, opposite-direction MAEs. These findings suggest that velocity- and disparity-based 3D motion signals may both flow through area MT but constitute distinct signals and pathways. Recent human neuroimaging and monkey electrophysiology have revealed 3D motion selectivity in area MT, which is driven by both velocity-based and disparity-based 3D motion signals. However, to elucidate the neural mechanisms by which the brain extracts 3D motion given these binocular signals, it is essential to understand how-or indeed if-these two binocular cues interact. We show that velocity-based and disparity-based signals are mostly separate at the levels of both fMRI responses in area MT and perception. Our findings suggest that the two binocular cues for 3D motion might be processed by separate specialized mechanisms. Copyright © 2016 the authors 0270-6474/16/3610791-12$15.00/0.
NASA Astrophysics Data System (ADS)
Baka, N.; Lelieveldt, B. P. F.; Schultz, C.; Niessen, W.; van Walsum, T.
2015-05-01
During percutaneous coronary interventions (PCI) catheters and arteries are visualized by x-ray angiography (XA) sequences, using brief contrast injections to show the coronary arteries. If we could continue visualizing the coronary arteries after the contrast agent passed (thus in non-contrast XA frames), we could potentially lower contrast use, which is advantageous due to the toxicity of the contrast agent. This paper explores the possibility of such visualization in mono-plane XA acquisitions with a special focus on respiratory based coronary artery motion estimation. We use the patient specific coronary artery centerlines from pre-interventional 3D CTA images to project on the XA sequence for artery visualization. To achieve this, a framework for registering the 3D centerlines with the mono-plane 2D + time XA sequences is presented. During the registration the patient specific cardiac and respiratory motion is learned. We investigate several respiratory motion estimation strategies with respect to accuracy, plausibility and ease of use for motion prediction in XA frames with and without contrast. The investigated strategies include diaphragm motion based prediction, and respiratory motion extraction from the guiding catheter tip motion. We furthermore compare translational and rigid respiratory based heart motion. We validated the accuracy of the 2D/3D registration and the respiratory and cardiac motion estimations on XA sequences of 12 interventions. The diaphragm based motion model and the catheter tip derived motion achieved 1.58 mm and 1.83 mm median 2D accuracy, respectively. On a subset of four interventions we evaluated the artery visualization accuracy for non-contrast cases. Both diaphragm, and catheter tip based prediction performed similarly, with about half of the cases providing satisfactory accuracy (median error < 2 mm).
Oculometric indices of simulator and aircraft motion
NASA Technical Reports Server (NTRS)
Comstock, J. R.
1984-01-01
The effects on eye scan behavior of both simulator and aircraft motion and sensitivity of an oculometric measure to motion effects was demonstrated. It was found that fixation time is sensitive to motion effects. Differences between simulator motion and no motion conditions during a series of simulated ILS approaches were studied. The mean fixation time for the no motion condition was found to be significantly longer than for the motion conditions. Eye scan parameters based on data collected in flight, and in fixed base simulation were investigated. Motion effects were evident when the subject was viewing a display supplying attitude and flight path information. The nature of the information provided by motion was examined. The mean fixation times for the no motion condition were significantly longer than for either motion condition, while the two motion conditions did not differ. It is shown that motion serves an alerting function, providing a cue or clue to the pilot that something happened. It is suggested that simulation without motion cues may represent an understatement of the true capacity of the pilot.
Robust object tracking techniques for vision-based 3D motion analysis applications
NASA Astrophysics Data System (ADS)
Knyaz, Vladimir A.; Zheltov, Sergey Y.; Vishnyakov, Boris V.
2016-04-01
Automated and accurate spatial motion capturing of an object is necessary for a wide variety of applications including industry and science, virtual reality and movie, medicine and sports. For the most part of applications a reliability and an accuracy of the data obtained as well as convenience for a user are the main characteristics defining the quality of the motion capture system. Among the existing systems for 3D data acquisition, based on different physical principles (accelerometry, magnetometry, time-of-flight, vision-based), optical motion capture systems have a set of advantages such as high speed of acquisition, potential for high accuracy and automation based on advanced image processing algorithms. For vision-based motion capture accurate and robust object features detecting and tracking through the video sequence are the key elements along with a level of automation of capturing process. So for providing high accuracy of obtained spatial data the developed vision-based motion capture system "Mosca" is based on photogrammetric principles of 3D measurements and supports high speed image acquisition in synchronized mode. It includes from 2 to 4 technical vision cameras for capturing video sequences of object motion. The original camera calibration and external orientation procedures provide the basis for high accuracy of 3D measurements. A set of algorithms as for detecting, identifying and tracking of similar targets, so for marker-less object motion capture is developed and tested. The results of algorithms' evaluation show high robustness and high reliability for various motion analysis tasks in technical and biomechanics applications.
TU-F-BRB-03: Clinical Implementation of MR-Based Motion Management
DOE Office of Scientific and Technical Information (OSTI.GOV)
Glide-Hurst, C.
The current clinical standard of organ respiratory imaging, 4D-CT, is fundamentally limited by poor soft-tissue contrast and imaging dose. These limitations are potential barriers to beneficial “4D” radiotherapy methods which optimize the target and OAR dose-volume considering breathing motion but rely on a robust motion characterization. Conversely, MRI imparts no known radiation risk and has excellent soft-tissue contrast. MRI-based motion management is therefore highly desirable and holds great promise to improve radiotherapy of moving cancers, particularly in the abdomen. Over the past decade, MRI techniques have improved significantly, making MR-based motion management clinically feasible. For example, cine MRI has highmore » temporal resolution up to 10 f/s and has been used to track and/or characterize tumor motion, study correlation between external and internal motions. New MR technologies, such as 4D-MRI and MRI hybrid treatment machines (i.e. MR-linac or MR-Co60), have been recently developed. These technologies can lead to more accurate target volume determination and more precise radiation dose delivery via direct tumor gating or tracking. Despite all these promises, great challenges exist and the achievable clinical benefit of MRI-based tumor motion management has yet to be fully explored, much less realized. In this proposal, we will review novel MR-based motion management methods and technologies, the state-of-the-art concerning MRI development and clinical application and the barriers to more widespread adoption. Learning Objectives: Discuss the need of MR-based motion management for improving patient care in radiotherapy. Understand MR techniques for motion imaging and tumor motion characterization. Understand the current state of the art and future steps for clinical integration. Henry Ford Health System holds research agreements with Philips Healthcare. Research sponsored in part by a Henry Ford Health System Internal Mentored Grant.« less
TU-F-BRB-00: MRI-Based Motion Management for RT
DOE Office of Scientific and Technical Information (OSTI.GOV)
NONE
The current clinical standard of organ respiratory imaging, 4D-CT, is fundamentally limited by poor soft-tissue contrast and imaging dose. These limitations are potential barriers to beneficial “4D” radiotherapy methods which optimize the target and OAR dose-volume considering breathing motion but rely on a robust motion characterization. Conversely, MRI imparts no known radiation risk and has excellent soft-tissue contrast. MRI-based motion management is therefore highly desirable and holds great promise to improve radiotherapy of moving cancers, particularly in the abdomen. Over the past decade, MRI techniques have improved significantly, making MR-based motion management clinically feasible. For example, cine MRI has highmore » temporal resolution up to 10 f/s and has been used to track and/or characterize tumor motion, study correlation between external and internal motions. New MR technologies, such as 4D-MRI and MRI hybrid treatment machines (i.e. MR-linac or MR-Co60), have been recently developed. These technologies can lead to more accurate target volume determination and more precise radiation dose delivery via direct tumor gating or tracking. Despite all these promises, great challenges exist and the achievable clinical benefit of MRI-based tumor motion management has yet to be fully explored, much less realized. In this proposal, we will review novel MR-based motion management methods and technologies, the state-of-the-art concerning MRI development and clinical application and the barriers to more widespread adoption. Learning Objectives: Discuss the need of MR-based motion management for improving patient care in radiotherapy. Understand MR techniques for motion imaging and tumor motion characterization. Understand the current state of the art and future steps for clinical integration. Henry Ford Health System holds research agreements with Philips Healthcare. Research sponsored in part by a Henry Ford Health System Internal Mentored Grant.« less
Miyajima, Saori; Tanaka, Takayuki; Imamura, Yumeko; Kusaka, Takashi
2015-01-01
We estimate lumbar torque based on motion measurement using only three inertial sensors. First, human motion is measured by a 6-axis motion tracking device that combines a 3-axis accelerometer and a 3-axis gyroscope placed on the shank, thigh, and back. Next, the lumbar joint torque during the motion is estimated by kinematic musculoskeletal simulation. The conventional method for estimating joint torque uses full body motion data measured by an optical motion capture system. However, in this research, joint torque is estimated by using only three link angles of the body, thigh, and shank. The utility of our method was verified by experiments. We measured motion of bendung knee and waist simultaneously. As the result, we were able to estimate the lumbar joint torque from measured motion.
NASA Astrophysics Data System (ADS)
Pritykin, F. N.; Nebritov, V. I.
2018-01-01
The paper presents the configuration of knowledge base necessary for intelligent control of android arm mechanism motion with different positions of certain forbidden regions taken into account. The present structure of the knowledge base characterizes the past experience of arm motion synthesis in the vector of velocities with due regard for the known obstacles. This structure also specifies its intrinsic properties. Knowledge base generation is based on the study of the arm mechanism instantaneous states implementations. Computational experiments connected with the virtual control of android arm motion with known forbidden regions using the developed knowledge base are introduced. Using the developed knowledge base to control virtually the arm motion reduces the time of test assignments calculation. The results of the research can be used in developing control systems of autonomous android robots in the known in advance environment.
Example-based human motion denoising.
Lou, Hui; Chai, Jinxiang
2010-01-01
With the proliferation of motion capture data, interest in removing noise and outliers from motion capture data has increased. In this paper, we introduce an efficient human motion denoising technique for the simultaneous removal of noise and outliers from input human motion data. The key idea of our approach is to learn a series of filter bases from precaptured motion data and use them along with robust statistics techniques to filter noisy motion data. Mathematically, we formulate the motion denoising process in a nonlinear optimization framework. The objective function measures the distance between the noisy input and the filtered motion in addition to how well the filtered motion preserves spatial-temporal patterns embedded in captured human motion data. Optimizing the objective function produces an optimal filtered motion that keeps spatial-temporal patterns in captured motion data. We also extend the algorithm to fill in the missing values in input motion data. We demonstrate the effectiveness of our system by experimenting with both real and simulated motion data. We also show the superior performance of our algorithm by comparing it with three baseline algorithms and to those in state-of-art motion capture data processing software such as Vicon Blade.
Vestibular models for design and evaluation of flight simulator motion
NASA Technical Reports Server (NTRS)
Bussolari, S. R.; Sullivan, R. B.; Young, L. R.
1986-01-01
The use of spatial orientation models in the design and evaluation of control systems for motion-base flight simulators is investigated experimentally. The development of a high-fidelity motion drive controller using an optimal control approach based on human vestibular models is described. The formulation and implementation of the optimal washout system are discussed. The effectiveness of the motion washout system was evaluated by studying the response of six motion washout systems to the NASA/AMES Vertical Motion Simulator for a single dash-quick-stop maneuver. The effects of the motion washout system on pilot performance and simulator acceptability are examined. The data reveal that human spatial orientation models are useful for the design and evaluation of flight simulator motion fidelity.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Iliopoulos, AS; Sun, X; Pitsianis, N
Purpose: To address and lift the limited degree of freedom (DoF) of globally bilinear motion components such as those based on principal components analysis (PCA), for encoding and modeling volumetric deformation motion. Methods: We provide a systematic approach to obtaining a multi-linear decomposition (MLD) and associated motion model from deformation vector field (DVF) data. We had previously introduced MLD for capturing multi-way relationships between DVF variables, without being restricted by the bilinear component format of PCA-based models. PCA-based modeling is commonly used for encoding patient-specific deformation as per planning 4D-CT images, and aiding on-board motion estimation during radiotherapy. However, themore » bilinear space-time decomposition inherently limits the DoF of such models by the small number of respiratory phases. While this limit is not reached in model studies using analytical or digital phantoms with low-rank motion, it compromises modeling power in the presence of relative motion, asymmetries and hysteresis, etc, which are often observed in patient data. Specifically, a low-DoF model will spuriously couple incoherent motion components, compromising its adaptability to on-board deformation changes. By the multi-linear format of extracted motion components, MLD-based models can encode higher-DoF deformation structure. Results: We conduct mathematical and experimental comparisons between PCA- and MLD-based models. A set of temporally-sampled analytical trajectories provides a synthetic, high-rank DVF; trajectories correspond to respiratory and cardiac motion factors, including different relative frequencies and spatial variations. Additionally, a digital XCAT phantom is used to simulate a lung lesion deforming incoherently with respect to the body, which adheres to a simple respiratory trend. In both cases, coupling of incoherent motion components due to a low model DoF is clearly demonstrated. Conclusion: Multi-linear decomposition can enable decoupling of distinct motion factors in high-rank DVF measurements. This may improve motion model expressiveness and adaptability to on-board deformation, aiding model-based image reconstruction for target verification. NIH Grant No. R01-184173.« less
Optimisation of reconstruction--reprojection-based motion correction for cardiac SPECT.
Kangasmaa, Tuija S; Sohlberg, Antti O
2014-07-01
Cardiac motion is a challenging cause of image artefacts in myocardial perfusion SPECT. A wide range of motion correction methods have been developed over the years, and so far automatic algorithms based on the reconstruction--reprojection principle have proved to be the most effective. However, these methods have not been fully optimised in terms of their free parameters and implementational details. Two slightly different implementations of reconstruction--reprojection-based motion correction techniques were optimised for effective, good-quality motion correction and then compared with each other. The first of these methods (Method 1) was the traditional reconstruction-reprojection motion correction algorithm, where the motion correction is done in projection space, whereas the second algorithm (Method 2) performed motion correction in reconstruction space. The parameters that were optimised include the type of cost function (squared difference, normalised cross-correlation and mutual information) that was used to compare measured and reprojected projections, and the number of iterations needed. The methods were tested with motion-corrupt projection datasets, which were generated by adding three different types of motion (lateral shift, vertical shift and vertical creep) to motion-free cardiac perfusion SPECT studies. Method 2 performed slightly better overall than Method 1, but the difference between the two implementations was small. The execution time for Method 2 was much longer than for Method 1, which limits its clinical usefulness. The mutual information cost function gave clearly the best results for all three motion sets for both correction methods. Three iterations were sufficient for a good quality correction using Method 1. The traditional reconstruction--reprojection-based method with three update iterations and mutual information cost function is a good option for motion correction in clinical myocardial perfusion SPECT.
Clustering Of Left Ventricular Wall Motion Patterns
NASA Astrophysics Data System (ADS)
Bjelogrlic, Z.; Jakopin, J.; Gyergyek, L.
1982-11-01
A method for detection of wall regions with similar motion was presented. A model based on local direction information was used to measure the left ventricular wall motion from cineangiographic sequence. Three time functions were used to define segmental motion patterns: distance of a ventricular contour segment from the mean contour, the velocity of a segment and its acceleration. Motion patterns were clustered by the UPGMA algorithm and by an algorithm based on K-nearest neighboor classification rule.
NASA Astrophysics Data System (ADS)
Schäfer, D.; Lin, M.; Rao, P. P.; Loffroy, R.; Liapi, E.; Noordhoek, N.; Eshuis, P.; Radaelli, A.; Grass, M.; Geschwind, J.-F. H.
2012-03-01
C-arm based tomographic 3D imaging is applied in an increasing number of minimal invasive procedures. Due to the limited acquisition speed for a complete projection data set required for tomographic reconstruction, breathing motion is a potential source of artifacts. This is the case for patients who cannot comply breathing commands (e.g. due to anesthesia). Intra-scan motion estimation and compensation is required. Here, a scheme for projection based local breathing motion estimation is combined with an anatomy adapted interpolation strategy and subsequent motion compensated filtered back projection. The breathing motion vector is measured as a displacement vector on the projections of a tomographic short scan acquisition using the diaphragm as a landmark. Scaling of the displacement to the acquisition iso-center and anatomy adapted volumetric motion vector field interpolation delivers a 3D motion vector per voxel. Motion compensated filtered back projection incorporates this motion vector field in the image reconstruction process. This approach is applied in animal experiments on a flat panel C-arm system delivering improved image quality (lower artifact levels, improved tumor delineation) in 3D liver tumor imaging.
Bi, Sheng; Zeng, Xiao; Tang, Xin; Qin, Shujia; Lai, King Wai Chiu
2016-01-01
Compressive sensing (CS) theory has opened up new paths for the development of signal processing applications. Based on this theory, a novel single pixel camera architecture has been introduced to overcome the current limitations and challenges of traditional focal plane arrays. However, video quality based on this method is limited by existing acquisition and recovery methods, and the method also suffers from being time-consuming. In this paper, a multi-frame motion estimation algorithm is proposed in CS video to enhance the video quality. The proposed algorithm uses multiple frames to implement motion estimation. Experimental results show that using multi-frame motion estimation can improve the quality of recovered videos. To further reduce the motion estimation time, a block match algorithm is used to process motion estimation. Experiments demonstrate that using the block match algorithm can reduce motion estimation time by 30%. PMID:26950127
The Influence of Motion Cues on Driver-Vehicle Performance in a Simulator
NASA Technical Reports Server (NTRS)
Repa, B. S.; Leucht, P. M.; Wierwille, W. W.
1981-01-01
Four different motion base configurations were studied on driving simulator. Differently responding vehicles were simulated on each motion configurations and the effects of the vehicle characteristics on driver vehicle system performance, driver control activity, and driver opinion ratings of vehicle performance during driving are compared for different motion configurations. Data show that: (1)) the effects of changes in vehicle characteristics on the different objective and subjective measures of driver vehicle performance are not disguised by the lack of physical motion; (2) fixed base simulator can be used to draw inferences despite the lack of motion; (3) the presence of motion tends to reduce path keeping errors and driver control activity; (4) roll and yaw motions are recommended because of their marked influence on driver vehicle performance (5) the importance of motion increases as the driving maneuvers become more extreme.
NASA Technical Reports Server (NTRS)
Parrish, R. V.; Houck, J. A.; Martin, D. J., Jr.
1977-01-01
Combined visual, motion, and aural cues for a helicopter engaged in visually conducted slalom runs at low altitude were studied. The evaluation of the visual and aural cues was subjective, whereas the motion cues were evaluated both subjectively and objectively. Subjective and objective results coincided in the area of control activity. Generally, less control activity is present under motion conditions than under fixed-base conditions, a fact attributed subjectively to the feeling of realistic limitations of a machine (helicopter) given by the addition of motion cues. The objective data also revealed that the slalom runs were conducted at significantly higher altitudes under motion conditions than under fixed-base conditions.
Hertanto, Agung; Zhang, Qinghui; Hu, Yu-Chi; Dzyubak, Oleksandr; Rimner, Andreas; Mageras, Gig S
2012-06-01
Respiration-correlated CT (RCCT) images produced with commonly used phase-based sorting of CT slices often exhibit discontinuity artifacts between CT slices, caused by cycle-to-cycle amplitude variations in respiration. Sorting based on the displacement of the respiratory signal yields slices at more consistent respiratory motion states and hence reduces artifacts, but missing image data (gaps) may occur. The authors report on the application of a respiratory motion model to produce an RCCT image set with reduced artifacts and without missing data. Input data consist of CT slices from a cine CT scan acquired while recording respiration by monitoring abdominal displacement. The model-based generation of RCCT images consists of four processing steps: (1) displacement-based sorting of CT slices to form volume images at 10 motion states over the cycle; (2) selection of a reference image without gaps and deformable registration between the reference image and each of the remaining images; (3) generation of the motion model by applying a principal component analysis to establish a relationship between displacement field and respiration signal at each motion state; (4) application of the motion model to deform the reference image into images at the 9 other motion states. Deformable image registration uses a modified fast free-form algorithm that excludes zero-intensity voxels, caused by missing data, from the image similarity term in the minimization function. In each iteration of the minimization, the displacement field in the gap regions is linearly interpolated from nearest neighbor nonzero intensity slices. Evaluation of the model-based RCCT examines three types of image sets: cine scans of a physical phantom programmed to move according to a patient respiratory signal, NURBS-based cardiac torso (NCAT) software phantom, and patient thoracic scans. Comparison in physical motion phantom shows that object distortion caused by variable motion amplitude in phase-based sorting is visibly reduced with model-based RCCT. Comparison of model-based RCCT to original NCAT images as ground truth shows best agreement at motion states whose displacement-sorted images have no missing slices, with mean and maximum discrepancies in lung of 1 and 3 mm, respectively. Larger discrepancies correlate with motion states having a larger number of missing slices in the displacement-sorted images. Artifacts in patient images at different motion states are also reduced. Comparison with displacement-sorted patient images as a ground truth shows that the model-based images closely reproduce the ground truth geometry at different motion states. Results in phantom and patient images indicate that the proposed method can produce RCCT image sets with reduced artifacts relative to phase-sorted images, without the gaps inherent in displacement-sorted images. The method requires a reference image at one motion state that has no missing data. Highly irregular breathing patterns can affect the method's performance, by introducing artifacts in the reference image (although reduced relative to phase-sorted images), or in decreased accuracy in the image prediction of motion states containing large regions of missing data. © 2012 American Association of Physicists in Medicine.
NASA Technical Reports Server (NTRS)
Bigler, W. B., II
1977-01-01
The NASA passenger ride quality apparatus (PRQA), a ground based motion simulator, was compared to the total in flight simulator (TIFS). Tests were made on PRQA with varying stimuli: motions only; motions and noise; motions, noise, and visual; and motions and visual. Regression equations for the tests were obtained and subsequent t-testing of the slopes indicated that ground based simulator tests produced comfort change rates similar to actual flight data. It was recommended that PRQA be used in the ride quality program for aircraft and that it be validated for other transportation modes.
A video-based system for hand-driven stop-motion animation.
Han, Xiaoguang; Fu, Hongbo; Zheng, Hanlin; Liu, Ligang; Wang, Jue
2013-01-01
Stop-motion is a well-established animation technique but is often laborious and requires craft skills. A new video-based system can animate the vast majority of everyday objects in stop-motion style, more flexibly and intuitively. Animators can perform and capture motions continuously instead of breaking them into increments and shooting one still picture per increment. More important, the system permits direct hand manipulation without resorting to rigs, achieving more natural object control for beginners. The system's key component is two-phase keyframe-based capturing and processing, assisted by computer vision techniques. With this system, even amateurs can generate high-quality stop-motion animations.
Federal Register 2010, 2011, 2012, 2013, 2014
2012-02-01
... presiding administrative law judge (``ALJ'') granting a joint motion to terminate the investigation based on... Motion To Terminate Based on Settlement Agreement; Termination of the Investigation AGENCY: U.S... parties filed a joint motion to terminate the investigation based on a settlement agreement. On July 21...
Yan, Chao-Gan; Cheung, Brian; Kelly, Clare; Colcombe, Stan; Craddock, R. Cameron; Di Martino, Adriana; Li, Qingyang; Zuo, Xi-Nian; Castellanos, F. Xavier; Milham, Michael P.
2014-01-01
Functional connectomics is one of the most rapidly expanding areas of neuroimaging research. Yet, concerns remain regarding the use of resting-state fMRI (R-fMRI) to characterize inter-individual variation in the functional connectome. In particular, recent findings that “micro” head movements can introduce artifactual inter-individual and group-related differences in R-fMRI metrics have raised concerns. Here, we first build on prior demonstrations of regional variation in the magnitude of framewise displacements associated with a given head movement, by providing a comprehensive voxel-based examination of the impact of motion on the BOLD signal (i.e., motion-BOLD relationships). Positive motion-BOLD relationships were detected in primary and supplementary motor areas, particularly in low motion datasets. Negative motion-BOLD relationships were most prominent in prefrontal regions, and expanded throughout the brain in high motion datasets (e.g., children). Scrubbing of volumes with FD > 0.2 effectively removed negative but not positive correlations; these findings suggest that positive relationships may reflect neural origins of motion while negative relationships are likely to originate from motion artifact. We also examined the ability of motion correction strategies to eliminate artifactual differences related to motion among individuals and between groups for a broad array of voxel-wise R-fMRI metrics. Residual relationships between motion and the examined R-fMRI metrics remained for all correction approaches, underscoring the need to covary motion effects at the group-level. Notably, global signal regression reduced relationships between motion and inter-individual differences in correlation-based R-fMRI metrics; Z-standardization (mean-centering and variance normalization) of subject-level maps for R-fMRI metrics prior to group-level analyses demonstrated similar advantages. Finally, our test-retest (TRT) analyses revealed significant motion effects on TRT reliability for R-fMRI metrics. Generally, motion compromised reliability of R-fMRI metrics, with the exception of those based on frequency characteristics – particularly, amplitude of low frequency fluctuations (ALFF). The implications of our findings for decision-making regarding the assessment and correction of motion are discussed, as are insights into potential differences among volume-based metrics of motion. PMID:23499792
Wei, Xiang; Camino, Acner; Pi, Shaohua; Cepurna, William; Huang, David; Morrison, John C; Jia, Yali
2018-05-01
Phase-based optical coherence tomography (OCT), such as OCT angiography (OCTA) and Doppler OCT, is sensitive to the confounding phase shift introduced by subject bulk motion. Traditional bulk motion compensation methods are limited by their accuracy and computing cost-effectiveness. In this Letter, to the best of our knowledge, we present a novel bulk motion compensation method for phase-based functional OCT. Bulk motion associated phase shift can be directly derived by solving its equation using a standard deviation of phase-based OCTA and Doppler OCT flow signals. This method was evaluated on rodent retinal images acquired by a prototype visible light OCT and human retinal images acquired by a commercial system. The image quality and computational speed were significantly improved, compared to two conventional phase compensation methods.
Sandow, M J; Fisher, T J; Howard, C Q; Papas, S
2014-05-01
This study was part of a larger project to develop a (kinetic) theory of carpal motion based on computationally derived isometric constraints. Three-dimensional models were created from computed tomography scans of the wrists of ten normal subjects and carpal spatial relationships at physiological motion extremes were assessed. Specific points on the surface of the various carpal bones and the radius that remained isometric through range of movement were identified. Analysis of the isometric constraints and intercarpal motion suggests that the carpus functions as a stable central column (lunate-capitate-hamate-trapezoid-trapezium) with a supporting lateral column (scaphoid), which behaves as a 'two gear four bar linkage'. The triquetrum functions as an ulnar translation restraint, as well as controlling lunate flexion. The 'trapezoid'-shaped trapezoid places the trapezium anterior to the transverse plane of the radius and ulna, and thus rotates the principal axis of the central column to correspond to that used in the 'dart thrower's motion'. This study presents a forward kinematic analysis of the carpus that provides the basis for the development of a unifying kinetic theory of wrist motion based on isometric constraints and rules-based motion.
A Motion Detection Algorithm Using Local Phase Information
Lazar, Aurel A.; Ukani, Nikul H.; Zhou, Yiyin
2016-01-01
Previous research demonstrated that global phase alone can be used to faithfully represent visual scenes. Here we provide a reconstruction algorithm by using only local phase information. We also demonstrate that local phase alone can be effectively used to detect local motion. The local phase-based motion detector is akin to models employed to detect motion in biological vision, for example, the Reichardt detector. The local phase-based motion detection algorithm introduced here consists of two building blocks. The first building block measures/evaluates the temporal change of the local phase. The temporal derivative of the local phase is shown to exhibit the structure of a second order Volterra kernel with two normalized inputs. We provide an efficient, FFT-based algorithm for implementing the change of the local phase. The second processing building block implements the detector; it compares the maximum of the Radon transform of the local phase derivative with a chosen threshold. We demonstrate examples of applying the local phase-based motion detection algorithm on several video sequences. We also show how the locally detected motion can be used for segmenting moving objects in video scenes and compare our local phase-based algorithm to segmentation achieved with a widely used optic flow algorithm. PMID:26880882
Motion Analysis System for Instruction of Nihon Buyo using Motion Capture
NASA Astrophysics Data System (ADS)
Shinoda, Yukitaka; Murakami, Shingo; Watanabe, Yuta; Mito, Yuki; Watanuma, Reishi; Marumo, Mieko
The passing on and preserving of advanced technical skills has become an important issue in a variety of fields, and motion analysis using motion capture has recently become popular in the research of advanced physical skills. This research aims to construct a system having a high on-site instructional effect on dancers learning Nihon Buyo, a traditional dance in Japan, and to classify Nihon Buyo dancing according to style, school, and dancer's proficiency by motion analysis. We have been able to study motion analysis systems for teaching Nihon Buyo now that body-motion data can be digitized and stored by motion capture systems using high-performance computers. Thus, with the aim of developing a user-friendly instruction-support system, we have constructed a motion analysis system that displays a dancer's time series of body motions and center of gravity for instructional purposes. In this paper, we outline this instructional motion analysis system based on three-dimensional position data obtained by motion capture. We also describe motion analysis that we performed based on center-of-gravity data obtained by this system and motion analysis focusing on school and age group using this system.
TU-F-BRB-02: Motion Artifacts and Suppression in MRI
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhong, X.
The current clinical standard of organ respiratory imaging, 4D-CT, is fundamentally limited by poor soft-tissue contrast and imaging dose. These limitations are potential barriers to beneficial “4D” radiotherapy methods which optimize the target and OAR dose-volume considering breathing motion but rely on a robust motion characterization. Conversely, MRI imparts no known radiation risk and has excellent soft-tissue contrast. MRI-based motion management is therefore highly desirable and holds great promise to improve radiotherapy of moving cancers, particularly in the abdomen. Over the past decade, MRI techniques have improved significantly, making MR-based motion management clinically feasible. For example, cine MRI has highmore » temporal resolution up to 10 f/s and has been used to track and/or characterize tumor motion, study correlation between external and internal motions. New MR technologies, such as 4D-MRI and MRI hybrid treatment machines (i.e. MR-linac or MR-Co60), have been recently developed. These technologies can lead to more accurate target volume determination and more precise radiation dose delivery via direct tumor gating or tracking. Despite all these promises, great challenges exist and the achievable clinical benefit of MRI-based tumor motion management has yet to be fully explored, much less realized. In this proposal, we will review novel MR-based motion management methods and technologies, the state-of-the-art concerning MRI development and clinical application and the barriers to more widespread adoption. Learning Objectives: Discuss the need of MR-based motion management for improving patient care in radiotherapy. Understand MR techniques for motion imaging and tumor motion characterization. Understand the current state of the art and future steps for clinical integration. Henry Ford Health System holds research agreements with Philips Healthcare. Research sponsored in part by a Henry Ford Health System Internal Mentored Grant.« less
TU-F-BRB-01: Resolving and Characterizing Breathing Motion for Radiotherapy with MRI
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tryggestad, E.
The current clinical standard of organ respiratory imaging, 4D-CT, is fundamentally limited by poor soft-tissue contrast and imaging dose. These limitations are potential barriers to beneficial “4D” radiotherapy methods which optimize the target and OAR dose-volume considering breathing motion but rely on a robust motion characterization. Conversely, MRI imparts no known radiation risk and has excellent soft-tissue contrast. MRI-based motion management is therefore highly desirable and holds great promise to improve radiotherapy of moving cancers, particularly in the abdomen. Over the past decade, MRI techniques have improved significantly, making MR-based motion management clinically feasible. For example, cine MRI has highmore » temporal resolution up to 10 f/s and has been used to track and/or characterize tumor motion, study correlation between external and internal motions. New MR technologies, such as 4D-MRI and MRI hybrid treatment machines (i.e. MR-linac or MR-Co60), have been recently developed. These technologies can lead to more accurate target volume determination and more precise radiation dose delivery via direct tumor gating or tracking. Despite all these promises, great challenges exist and the achievable clinical benefit of MRI-based tumor motion management has yet to be fully explored, much less realized. In this proposal, we will review novel MR-based motion management methods and technologies, the state-of-the-art concerning MRI development and clinical application and the barriers to more widespread adoption. Learning Objectives: Discuss the need of MR-based motion management for improving patient care in radiotherapy. Understand MR techniques for motion imaging and tumor motion characterization. Understand the current state of the art and future steps for clinical integration. Henry Ford Health System holds research agreements with Philips Healthcare. Research sponsored in part by a Henry Ford Health System Internal Mentored Grant.« less
Respiratory motion resolved, self-gated 4D-MRI using Rotating Cartesian K-space (ROCK)
Han, Fei; Zhou, Ziwu; Cao, Minsong; Yang, Yingli; Sheng, Ke; Hu, Peng
2017-01-01
Purpose To propose and validate a respiratory motion resolved, self-gated (SG) 4D-MRI technique to assess patient-specific breathing motion of abdominal organs for radiation treatment planning. Methods The proposed 4D-MRI technique was based on the balanced steady-state free-precession (bSSFP) technique and 3D k-space encoding. A novel ROtating Cartesian K-space (ROCK) reordering method was designed that incorporates repeatedly sampled k-space centerline as the SG motion surrogate and allows for retrospective k-space data binning into different respiratory positions based on the amplitude of the surrogate. The multiple respiratory-resolved 3D k-space data were subsequently reconstructed using a joint parallel imaging and compressed sensing method with spatial and temporal regularization. The proposed 4D-MRI technique was validated using a custom-made dynamic motion phantom and was tested in 6 healthy volunteers, in whom quantitative diaphragm and kidney motion measurements based on 4D-MRI images were compared with those based on 2D-CINE images. Results The 5-minute 4D-MRI scan offers high-quality volumetric images in 1.2×1.2×1.6mm3 and 8 respiratory positions, with good soft-tissue contrast. In phantom experiments with triangular motion waveform, the motion amplitude measurements based on 4D-MRI were 11.89% smaller than the ground truth, whereas a −12.5% difference was expected due to data binning effects. In healthy volunteers, the difference between the measurements based on 4D-MRI and the ones based on 2D-CINE were 6.2±4.5% for the diaphragm, 8.2±4.9% and 8.9±5.1% for the right and left kidney. Conclusion The proposed 4D-MRI technique could provide high resolution, high quality, respiratory motion resolved 4D images with good soft-tissue contrast and are free of the “stitching” artifacts usually seen on 4D-CT and 4D-MRI based on resorting 2D-CINE. It could be used to visualize and quantify abdominal organ motion for MRI-based radiation treatment planning. PMID:28133752
Respiratory motion-resolved, self-gated 4D-MRI using rotating cartesian k-space (ROCK).
Han, Fei; Zhou, Ziwu; Cao, Minsong; Yang, Yingli; Sheng, Ke; Hu, Peng
2017-04-01
To propose and validate a respiratory motion resolved, self-gated (SG) 4D-MRI technique to assess patient-specific breathing motion of abdominal organs for radiation treatment planning. The proposed 4D-MRI technique was based on the balanced steady-state free-precession (bSSFP) technique and 3D k-space encoding. A novel rotating cartesian k-space (ROCK) reordering method was designed which incorporates repeatedly sampled k-space centerline as the SG motion surrogate and allows for retrospective k-space data binning into different respiratory positions based on the amplitude of the surrogate. The multiple respiratory-resolved 3D k-space data were subsequently reconstructed using a joint parallel imaging and compressed sensing method with spatial and temporal regularization. The proposed 4D-MRI technique was validated using a custom-made dynamic motion phantom and was tested in six healthy volunteers, in whom quantitative diaphragm and kidney motion measurements based on 4D-MRI images were compared with those based on 2D-CINE images. The 5-minute 4D-MRI scan offers high-quality volumetric images in 1.2 × 1.2 × 1.6 mm 3 and eight respiratory positions, with good soft-tissue contrast. In phantom experiments with triangular motion waveform, the motion amplitude measurements based on 4D-MRI were 11.89% smaller than the ground truth, whereas a -12.5% difference was expected due to data binning effects. In healthy volunteers, the difference between the measurements based on 4D-MRI and the ones based on 2D-CINE were 6.2 ± 4.5% for the diaphragm, 8.2 ± 4.9% and 8.9 ± 5.1% for the right and left kidney. The proposed 4D-MRI technique could provide high-resolution, high-quality, respiratory motion-resolved 4D images with good soft-tissue contrast and are free of the "stitching" artifacts usually seen on 4D-CT and 4D-MRI based on resorting 2D-CINE. It could be used to visualize and quantify abdominal organ motion for MRI-based radiation treatment planning. © 2017 American Association of Physicists in Medicine.
Thoracic respiratory motion estimation from MRI using a statistical model and a 2-D image navigator.
King, A P; Buerger, C; Tsoumpas, C; Marsden, P K; Schaeffter, T
2012-01-01
Respiratory motion models have potential application for estimating and correcting the effects of motion in a wide range of applications, for example in PET-MR imaging. Given that motion cycles caused by breathing are only approximately repeatable, an important quality of such models is their ability to capture and estimate the intra- and inter-cycle variability of the motion. In this paper we propose and describe a technique for free-form nonrigid respiratory motion correction in the thorax. Our model is based on a principal component analysis of the motion states encountered during different breathing patterns, and is formed from motion estimates made from dynamic 3-D MRI data. We apply our model using a data-driven technique based on a 2-D MRI image navigator. Unlike most previously reported work in the literature, our approach is able to capture both intra- and inter-cycle motion variability. In addition, the 2-D image navigator can be used to estimate how applicable the current motion model is, and hence report when more imaging data is required to update the model. We also use the motion model to decide on the best positioning for the image navigator. We validate our approach using MRI data acquired from 10 volunteers and demonstrate improvements of up to 40.5% over other reported motion modelling approaches, which corresponds to 61% of the overall respiratory motion present. Finally we demonstrate one potential application of our technique: MRI-based motion correction of real-time PET data for simultaneous PET-MRI acquisition. Copyright © 2011 Elsevier B.V. All rights reserved.
Inertial Sensor-Based Touch and Shake Metaphor for Expressive Control of 3D Virtual Avatars
Patil, Shashidhar; Chintalapalli, Harinadha Reddy; Kim, Dubeom; Chai, Youngho
2015-01-01
In this paper, we present an inertial sensor-based touch and shake metaphor for expressive control of a 3D virtual avatar in a virtual environment. An intuitive six degrees-of-freedom wireless inertial motion sensor is used as a gesture and motion control input device with a sensor fusion algorithm. The algorithm enables user hand motions to be tracked in 3D space via magnetic, angular rate, and gravity sensors. A quaternion-based complementary filter is implemented to reduce noise and drift. An algorithm based on dynamic time-warping is developed for efficient recognition of dynamic hand gestures with real-time automatic hand gesture segmentation. Our approach enables the recognition of gestures and estimates gesture variations for continuous interaction. We demonstrate the gesture expressivity using an interactive flexible gesture mapping interface for authoring and controlling a 3D virtual avatar and its motion by tracking user dynamic hand gestures. This synthesizes stylistic variations in a 3D virtual avatar, producing motions that are not present in the motion database using hand gesture sequences from a single inertial motion sensor. PMID:26094629
Learning Motion Features for Example-Based Finger Motion Estimation for Virtual Characters
NASA Astrophysics Data System (ADS)
Mousas, Christos; Anagnostopoulos, Christos-Nikolaos
2017-09-01
This paper presents a methodology for estimating the motion of a character's fingers based on the use of motion features provided by a virtual character's hand. In the presented methodology, firstly, the motion data is segmented into discrete phases. Then, a number of motion features are computed for each motion segment of a character's hand. The motion features are pre-processed using restricted Boltzmann machines, and by using the different variations of semantically similar finger gestures in a support vector machine learning mechanism, the optimal weights for each feature assigned to a metric are computed. The advantages of the presented methodology in comparison to previous solutions are the following: First, we automate the computation of optimal weights that are assigned to each motion feature counted in our metric. Second, the presented methodology achieves an increase (about 17%) in correctly estimated finger gestures in comparison to a previous method.
Improving best-phase image quality in cardiac CT by motion correction with MAM optimization
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rohkohl, Christopher; Bruder, Herbert; Stierstorfer, Karl
2013-03-15
Purpose: Research in image reconstruction for cardiac CT aims at using motion correction algorithms to improve the image quality of the coronary arteries. The key to those algorithms is motion estimation, which is currently based on 3-D/3-D registration to align the structures of interest in images acquired in multiple heart phases. The need for an extended scan data range covering several heart phases is critical in terms of radiation dose to the patient and limits the clinical potential of the method. Furthermore, literature reports only slight quality improvements of the motion corrected images when compared to the most quiet phasemore » (best-phase) that was actually used for motion estimation. In this paper a motion estimation algorithm is proposed which does not require an extended scan range but works with a short scan data interval, and which markedly improves the best-phase image quality. Methods: Motion estimation is based on the definition of motion artifact metrics (MAM) to quantify motion artifacts in a 3-D reconstructed image volume. The authors use two different MAMs, entropy, and positivity. By adjusting the motion field parameters, the MAM of the resulting motion-compensated reconstruction is optimized using a gradient descent procedure. In this way motion artifacts are minimized. For a fast and practical implementation, only analytical methods are used for motion estimation and compensation. Both the MAM-optimization and a 3-D/3-D registration-based motion estimation algorithm were investigated by means of a computer-simulated vessel with a cardiac motion profile. Image quality was evaluated using normalized cross-correlation (NCC) with the ground truth template and root-mean-square deviation (RMSD). Four coronary CT angiography patient cases were reconstructed to evaluate the clinical performance of the proposed method. Results: For the MAM-approach, the best-phase image quality could be improved for all investigated heart phases, with a maximum improvement of the NCC value by 100% and of the RMSD value by 81%. The corresponding maximum improvements for the registration-based approach were 20% and 40%. In phases with very rapid motion the registration-based algorithm obtained better image quality, while the image quality of the MAM algorithm was superior in phases with less motion. The image quality improvement of the MAM optimization was visually confirmed for the different clinical cases. Conclusions: The proposed method allows a software-based best-phase image quality improvement in coronary CT angiography. A short scan data interval at the target heart phase is sufficient, no additional scan data in other cardiac phases are required. The algorithm is therefore directly applicable to any standard cardiac CT acquisition protocol.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Myronakis, M; Cai, W; Dhou, S
Purpose: To determine if 4DCT-based motion modeling and external surrogate motion measured during treatment simulation can enhance prediction of residual tumor motion and duty cycle during treatment delivery. Methods: This experiment was conducted using simultaneously recorded tumor and external surrogate motion acquired over multiple fractions of lung cancer radiotherapy. These breathing traces were combined with the XCAT phantom to simulate CT images. Data from the first day was used to estimate the residual tumor motion and duty cycle both directly from the 4DCT (the current clinical standard), and from external-surrogate based motion modeling. The accuracy of these estimated residual tumormore » motions and duty cycles are evaluated by comparing to the measured internal/external motions from other treatment days. Results: All calculations were done for 25% and 50% duty cycles. The results indicated that duty cycle derived from 4DCT information alone is not enough to accurately predict duty cycles during treatment. Residual tumor motion was determined from the recorded data and compared with the estimated residual tumor motion from 4DCT. Relative differences in residual tumor motion varied from −30% to 55%, suggesting that more information is required to properly predict residual tumor motion. Compared to estimations made from 4DCT, in three out of four patients examined, the 30 seconds of motion modeling data was able to predict the duty cycle with better accuracy than 4DCT. No improvement was observed in prediction of residual tumor motion for this dataset. Conclusion: Motion modeling during simulation has the potential to enhance 4DCT and provide more information about target motion, duty cycles, and delivered dose. Based on these four patients, 30 seconds of motion modeling data produced improve duty cycle estimations but showed no measurable improvement in residual tumor motion prediction. More patient data is needed to verify this Result. I would like to acknowledge funding from MRA, VARIAN Medical Systems, Inc.« less
Human motion planning based on recursive dynamics and optimal control techniques
NASA Technical Reports Server (NTRS)
Lo, Janzen; Huang, Gang; Metaxas, Dimitris
2002-01-01
This paper presents an efficient optimal control and recursive dynamics-based computer animation system for simulating and controlling the motion of articulated figures. A quasi-Newton nonlinear programming technique (super-linear convergence) is implemented to solve minimum torque-based human motion-planning problems. The explicit analytical gradients needed in the dynamics are derived using a matrix exponential formulation and Lie algebra. Cubic spline functions are used to make the search space for an optimal solution finite. Based on our formulations, our method is well conditioned and robust, in addition to being computationally efficient. To better illustrate the efficiency of our method, we present results of natural looking and physically correct human motions for a variety of human motion tasks involving open and closed loop kinematic chains.
van Dijk, Joris D; van Dalen, Jorn A; Mouden, Mohamed; Ottervanger, Jan Paul; Knollema, Siert; Slump, Cornelis H; Jager, Pieter L
2018-04-01
Correction of motion has become feasible on cadmium-zinc-telluride (CZT)-based SPECT cameras during myocardial perfusion imaging (MPI). Our aim was to quantify the motion and to determine the value of automatic correction using commercially available software. We retrospectively included 83 consecutive patients who underwent stress-rest MPI CZT-SPECT and invasive fractional flow reserve (FFR) measurement. Eight-minute stress acquisitions were reformatted into 1.0- and 20-second bins to detect respiratory motion (RM) and patient motion (PM), respectively. RM and PM were quantified and scans were automatically corrected. Total perfusion deficit (TPD) and SPECT interpretation-normal, equivocal, or abnormal-were compared between the noncorrected and corrected scans. Scans with a changed SPECT interpretation were compared with FFR, the reference standard. Average RM was 2.5 ± 0.4 mm and maximal PM was 4.5 ± 1.3 mm. RM correction influenced the diagnostic outcomes in two patients based on TPD changes ≥7% and in nine patients based on changed visual interpretation. In only four of these patients, the changed SPECT interpretation corresponded with FFR measurements. Correction for PM did not influence the diagnostic outcomes. Respiratory motion and patient motion were small. Motion correction did not appear to improve the diagnostic outcome and, hence, the added value seems limited in MPI using CZT-based SPECT cameras.
Passive control of a biventricular assist device with compliant inflow cannulae.
Gregory, Shaun David; Pearcy, Mark John; Timms, Daniel
2012-08-01
Rotary ventricular assist device (VAD) support of the cardiovascular system is susceptible to suction events due to the limited preload sensitivity of these devices. This may be of particular concern with rotary biventricular support (BiVAD) where the native, flow balancing Starling response is diminished in both ventricles. The reliability of sensor and sensorless-based control systems which aim to control VAD flow based on preload has limitations, and, thus, an alternative solution is desired. This study introduces a compliant inflow cannula (CIC) which could improve the preload sensitivity of a rotary VAD by passively altering VAD flow depending on preload. To evaluate the design, both the CIC and a standard rigid inflow cannula were inserted into a mock circulation loop to enable biventricular heart failure support using configurations of atrial and ventricular inflow, and arterial outflow cannulation. A range of left (LVAD) and right VAD (RVAD) rotational speeds were tested as well as step changes in systemic/pulmonary vascular resistance to alter relative preloads, with resulting flow rates recorded. Simulated suction events were observed, particularly at higher VAD speeds, during support with the rigid inflow cannula, while the CIC prevented suction events under all circumstances. The compliant section passively restricted its internal diameter as preload was reduced, which increased the VAD circuit resistance and thus reduced VAD flow. Therefore, a CIC could potentially be used as a passive control system to prevent suction events in rotary left, right, and biventricular support. © 2012, Copyright the Authors. Artificial Organs © 2012, International Center for Artificial Organs and Transplantation and Wiley Periodicals, Inc.
Genetic Algorithm-Based Motion Estimation Method using Orientations and EMGs for Robot Controls
Chae, Jeongsook; Jin, Yong; Sung, Yunsick
2018-01-01
Demand for interactive wearable devices is rapidly increasing with the development of smart devices. To accurately utilize wearable devices for remote robot controls, limited data should be analyzed and utilized efficiently. For example, the motions by a wearable device, called Myo device, can be estimated by measuring its orientation, and calculating a Bayesian probability based on these orientation data. Given that Myo device can measure various types of data, the accuracy of its motion estimation can be increased by utilizing these additional types of data. This paper proposes a motion estimation method based on weighted Bayesian probability and concurrently measured data, orientations and electromyograms (EMG). The most probable motion among estimated is treated as a final estimated motion. Thus, recognition accuracy can be improved when compared to the traditional methods that employ only a single type of data. In our experiments, seven subjects perform five predefined motions. When orientation is measured by the traditional methods, the sum of the motion estimation errors is 37.3%; likewise, when only EMG data are used, the error in motion estimation by the proposed method was also 37.3%. The proposed combined method has an error of 25%. Therefore, the proposed method reduces motion estimation errors by 12%. PMID:29324641
NASA Astrophysics Data System (ADS)
Zheng, Taixiong
2005-12-01
A neuro-fuzzy network based approach for robot motion in an unknown environment was proposed. In order to control the robot motion in an unknown environment, the behavior of the robot was classified into moving to the goal and avoiding obstacles. Then, according to the dynamics of the robot and the behavior character of the robot in an unknown environment, fuzzy control rules were introduced to control the robot motion. At last, a 6-layer neuro-fuzzy network was designed to merge from what the robot sensed to robot motion control. After being trained, the network may be used for robot motion control. Simulation results show that the proposed approach is effective for robot motion control in unknown environment.
Motion-based prediction explains the role of tracking in motion extrapolation.
Khoei, Mina A; Masson, Guillaume S; Perrinet, Laurent U
2013-11-01
During normal viewing, the continuous stream of visual input is regularly interrupted, for instance by blinks of the eye. Despite these frequents blanks (that is the transient absence of a raw sensory source), the visual system is most often able to maintain a continuous representation of motion. For instance, it maintains the movement of the eye such as to stabilize the image of an object. This ability suggests the existence of a generic neural mechanism of motion extrapolation to deal with fragmented inputs. In this paper, we have modeled how the visual system may extrapolate the trajectory of an object during a blank using motion-based prediction. This implies that using a prior on the coherency of motion, the system may integrate previous motion information even in the absence of a stimulus. In order to compare with experimental results, we simulated tracking velocity responses. We found that the response of the motion integration process to a blanked trajectory pauses at the onset of the blank, but that it quickly recovers the information on the trajectory after reappearance. This is compatible with behavioral and neural observations on motion extrapolation. To understand these mechanisms, we have recorded the response of the model to a noisy stimulus. Crucially, we found that motion-based prediction acted at the global level as a gain control mechanism and that we could switch from a smooth regime to a binary tracking behavior where the dot is tracked or lost. Our results imply that a local prior implementing motion-based prediction is sufficient to explain a large range of neural and behavioral results at a more global level. We show that the tracking behavior deteriorates for sensory noise levels higher than a certain value, where motion coherency and predictability fail to hold longer. In particular, we found that motion-based prediction leads to the emergence of a tracking behavior only when enough information from the trajectory has been accumulated. Then, during tracking, trajectory estimation is robust to blanks even in the presence of relatively high levels of noise. Moreover, we found that tracking is necessary for motion extrapolation, this calls for further experimental work exploring the role of noise in motion extrapolation. Copyright © 2013 Elsevier Ltd. All rights reserved.
Hybrid Co-Evolutionary Motion Planning via Visibility-Based Repair
NASA Technical Reports Server (NTRS)
Dozier, Gerry; McCullough, Shaun; Brown, Edward, Jr.; Homaifar, Abdollah; Bikdash, Mar-wan
1997-01-01
This paper introduces a hybrid co-evolutionary system for global motion planning within unstructured environments. This system combines the concept of co-evolutionary search along with a concept that we refer to as the visibility-based repair to form a hybrid which quickly transforms infeasible motions into feasible ones. Also, this system makes use of a novel representation scheme for the obstacles within an environment. Our hybrid evolutionary system differs from other evolutionary motion planners in that (1) more emphasis is placed on repairing infeasible motions to develop feasible motions rather than using simulated evolution exclusively as a means of discovering feasible motions, (2) a continuous map of the environment is used rather than a discretized map, and (3) it develops global motion plans for multiple mobile destinations by co-evolving populations of sub-global motion plans. In this paper, we demonstrate the effectiveness of this system by using it to solve two challenging motion planning problems where multiple targets try to move away from a point robot.
Safford, Ashley S; Hussey, Elizabeth A; Parasuraman, Raja; Thompson, James C
2010-07-07
Although it is well documented that the ability to perceive biological motion is mediated by the lateral temporal cortex, whether and when neural activity in this brain region is modulated by attention is unknown. In particular, it is unclear whether the processing of biological motion requires attention or whether such stimuli are processed preattentively. Here, we used functional magnetic resonance imaging, high-density electroencephalography, and cortically constrained source estimation methods to investigate the spatiotemporal effects of attention on the processing of biological motion. Directing attention to tool motion in overlapping movies of biological motion and tool motion suppressed the blood oxygenation level-dependent (BOLD) response of the right superior temporal sulcus (STS)/middle temporal gyrus (MTG), while directing attention to biological motion suppressed the BOLD response of the left inferior temporal sulcus (ITS)/MTG. Similarly, category-based modulation of the cortical current source density estimates from the right STS/MTG and left ITS was observed beginning at approximately 450 ms following stimulus onset. Our results indicate that the cortical processing of biological motion is strongly modulated by attention. These findings argue against preattentive processing of biological motion in the presence of stimuli that compete for attention. Our findings also suggest that the attention-based segregation of motion category-specific responses only emerges relatively late (several hundred milliseconds) in processing.
Baghaie, Ahmadreza; Yu, Zeyun; D'Souza, Roshan M
2017-04-01
In this paper, we review state-of-the-art techniques to correct eye motion artifacts in Optical Coherence Tomography (OCT) imaging. The methods for eye motion artifact reduction can be categorized into two major classes: (1) hardware-based techniques and (2) software-based techniques. In the first class, additional hardware is mounted onto the OCT scanner to gather information about the eye motion patterns during OCT data acquisition. This information is later processed and applied to the OCT data for creating an anatomically correct representation of the retina, either in an offline or online manner. In software based techniques, the motion patterns are approximated either by comparing the acquired data to a reference image, or by considering some prior assumptions about the nature of the eye motion. Careful investigations done on the most common methods in the field provides invaluable insight regarding future directions of the research in this area. The challenge in hardware-based techniques lies in the implementation aspects of particular devices. However, the results of these techniques are superior to those obtained from software-based techniques because they are capable of capturing secondary data related to eye motion during OCT acquisition. Software-based techniques on the other hand, achieve moderate success and their performance is highly dependent on the quality of the OCT data in terms of the amount of motion artifacts contained in them. However, they are still relevant to the field since they are the sole class of techniques with the ability to be applied to legacy data acquired using systems that do not have extra hardware to track eye motion. Copyright © 2017 Elsevier B.V. All rights reserved.
Efficient low-bit-rate adaptive mesh-based motion compensation technique
NASA Astrophysics Data System (ADS)
Mahmoud, Hanan A.; Bayoumi, Magdy A.
2001-08-01
This paper proposes a two-stage global motion estimation method using a novel quadtree block-based motion estimation technique and an active mesh model. In the first stage, motion parameters are estimated by fitting block-based motion vectors computed using a new efficient quadtree technique, that divides a frame into equilateral triangle blocks using the quad-tree structure. Arbitrary partition shapes are achieved by allowing 4-to-1, 3-to-1 and 2-1 merge/combine of sibling blocks having the same motion vector . In the second stage, the mesh is constructed using an adaptive triangulation procedure that places more triangles over areas with high motion content, these areas are estimated during the first stage. finally the motion compensation is achieved by using a novel algorithm that is carried by both the encoder and the decoder to determine the optimal triangulation of the resultant partitions followed by affine mapping at the encoder. Computer simulation results show that the proposed method gives better performance that the conventional ones in terms of the peak signal-to-noise ration (PSNR) and the compression ratio (CR).
An octahedral shear strain-based measure of SNR for 3D MR elastography
NASA Astrophysics Data System (ADS)
McGarry, M. D. J.; Van Houten, E. E. W.; Perriñez, P. R.; Pattison, A. J.; Weaver, J. B.; Paulsen, K. D.
2011-07-01
A signal-to-noise ratio (SNR) measure based on the octahedral shear strain (the maximum shear strain in any plane for a 3D state of strain) is presented for magnetic resonance elastography (MRE), where motion-based SNR measures are commonly used. The shear strain, γ, is directly related to the shear modulus, μ, through the definition of shear stress, τ = μγ. Therefore, noise in the strain is the important factor in determining the quality of motion data, rather than the noise in the motion. Motion and strain SNR measures were found to be correlated for MRE of gelatin phantoms and the human breast. Analysis of the stiffness distributions of phantoms reconstructed from the measured motion data revealed a threshold for both strain and motion SNR where MRE stiffness estimates match independent mechanical testing. MRE of the feline brain showed significantly less correlation between the two SNR measures. The strain SNR measure had a threshold above which the reconstructed stiffness values were consistent between cases, whereas the motion SNR measure did not provide a useful threshold, primarily due to rigid body motion effects.
Optical and Acoustic Sensor-Based 3D Ball Motion Estimation for Ball Sport Simulators †.
Seo, Sang-Woo; Kim, Myunggyu; Kim, Yejin
2018-04-25
Estimation of the motion of ball-shaped objects is essential for the operation of ball sport simulators. In this paper, we propose an estimation system for 3D ball motion, including speed and angle of projection, by using acoustic vector and infrared (IR) scanning sensors. Our system is comprised of three steps to estimate a ball motion: sound-based ball firing detection, sound source localization, and IR scanning for motion analysis. First, an impulsive sound classification based on the mel-frequency cepstrum and feed-forward neural network is introduced to detect the ball launch sound. An impulsive sound source localization using a 2D microelectromechanical system (MEMS) microphones and delay-and-sum beamforming is presented to estimate the firing position. The time and position of a ball in 3D space is determined from a high-speed infrared scanning method. Our experimental results demonstrate that the estimation of ball motion based on sound allows a wider activity area than similar camera-based methods. Thus, it can be practically applied to various simulations in sports such as soccer and baseball.
The fate of task-irrelevant visual motion: perceptual load versus feature-based attention.
Taya, Shuichiro; Adams, Wendy J; Graf, Erich W; Lavie, Nilli
2009-11-18
We tested contrasting predictions derived from perceptual load theory and from recent feature-based selection accounts. Observers viewed moving, colored stimuli and performed low or high load tasks associated with one stimulus feature, either color or motion. The resultant motion aftereffect (MAE) was used to evaluate attentional allocation. We found that task-irrelevant visual features received less attention than co-localized task-relevant features of the same objects. Moreover, when color and motion features were co-localized yet perceived to belong to two distinct surfaces, feature-based selection was further increased at the expense of object-based co-selection. Load theory predicts that the MAE for task-irrelevant motion would be reduced with a higher load color task. However, this was not seen for co-localized features; perceptual load only modulated the MAE for task-irrelevant motion when this was spatially separated from the attended color location. Our results suggest that perceptual load effects are mediated by spatial selection and do not generalize to the feature domain. Feature-based selection operates to suppress processing of task-irrelevant, co-localized features, irrespective of perceptual load.
Seismic fragility curves of bridge piers accounting for ground motions in Korea
NASA Astrophysics Data System (ADS)
Nguyen, Duy-Duan; Lee, Tae-Hyung
2018-04-01
Korea is located in a slight-to-moderate seismic zone. Nevertheless, several studies pointed that the peak earthquake magnitude in the region can be reached to approximately 6.5. Accordingly, a seismic vulnerability evaluation of the existing structures accounting for ground motions in Korea is momentous. The purpose of this paper is to develop seismic fragility curves for bridge piers of a steel box girder bridge equipped with and without base isolators based on a set of ground motions recorded in Korea. A finite element simulation platform, OpenSees, is utilized to perform nonlinear time history analyses of the bridges. A series of damage states is defined based on a damage index which is expressed in terms of the column displacement ductility ratio. The fragility curves based on Korean motions were thereafter compared with the fragility curves generated using worldwide earthquakes to assess the effect of the two ground motion groups on the seismic fragility curves of the bridge piers. The results reveal that both non- and base-isolated bridge piers are less vulnerable during the Korean ground motions than that under worldwide earthquakes.
Motion-based nearest vector metric for reference frame selection in the perception of motion.
Agaoglu, Mehmet N; Clarke, Aaron M; Herzog, Michael H; Ögmen, Haluk
2016-05-01
We investigated how the visual system selects a reference frame for the perception of motion. Two concentric arcs underwent circular motion around the center of the display, where observers fixated. The outer (target) arc's angular velocity profile was modulated by a sine wave midflight whereas the inner (reference) arc moved at a constant angular speed. The task was to report whether the target reversed its direction of motion at any point during its motion. We investigated the effects of spatial and figural factors by systematically varying the radial and angular distances between the arcs, and their relative sizes. We found that the effectiveness of the reference frame decreases with increasing radial- and angular-distance measures. Drastic changes in the relative sizes of the arcs did not influence motion reversal thresholds, suggesting no influence of stimulus form on perceived motion. We also investigated the effect of common velocity by introducing velocity fluctuations to the reference arc as well. We found no effect of whether or not a reference frame has a constant motion. We examined several form- and motion-based metrics, which could potentially unify our findings. We found that a motion-based nearest vector metric can fully account for all the data reported here. These findings suggest that the selection of reference frames for motion processing does not result from a winner-take-all process, but instead, can be explained by a field whose strength decreases with the distance between the nearest motion vectors regardless of the form of the moving objects.
Using the Graphing Calculator--in Two-Dimensional Motion Plots.
ERIC Educational Resources Information Center
Brueningsen, Chris; Bower, William
1995-01-01
Presents a series of simple activities involving generalized two-dimensional motion topics to prepare students to study projectile motion. Uses a pair of motion detectors, each connected to a calculator-based-laboratory (CBL) unit interfaced with a standard graphics calculator, to explore two-dimensional motion. (JRH)
Vienola, Kari V; Damodaran, Mathi; Braaf, Boy; Vermeer, Koenraad A; de Boer, Johannes F
2018-02-01
Retinal motion detection with an accuracy of 0.77 arcmin corresponding to 3.7 µm on the retina is demonstrated with a novel digital micromirror device based ophthalmoscope. By generating a confocal image as a reference, eye motion could be measured from consecutively measured subsampled frames. The subsampled frames provide 7.7 millisecond snapshots of the retina without motion artifacts between the image points of the subsampled frame, distributed over the full field of view. An ophthalmoscope pattern projection speed of 130 Hz enabled a motion detection bandwidth of 65 Hz. A model eye with a scanning mirror was built to test the performance of the motion detection algorithm. Furthermore, an in vivo motion trace was obtained from a healthy volunteer. The obtained eye motion trace clearly shows the three main types of fixational eye movements. Lastly, the obtained eye motion trace was used to correct for the eye motion in consecutively obtained subsampled frames to produce an averaged confocal image correct for motion artefacts.
Vienola, Kari V.; Damodaran, Mathi; Braaf, Boy; Vermeer, Koenraad A.; de Boer, Johannes F.
2018-01-01
Retinal motion detection with an accuracy of 0.77 arcmin corresponding to 3.7 µm on the retina is demonstrated with a novel digital micromirror device based ophthalmoscope. By generating a confocal image as a reference, eye motion could be measured from consecutively measured subsampled frames. The subsampled frames provide 7.7 millisecond snapshots of the retina without motion artifacts between the image points of the subsampled frame, distributed over the full field of view. An ophthalmoscope pattern projection speed of 130 Hz enabled a motion detection bandwidth of 65 Hz. A model eye with a scanning mirror was built to test the performance of the motion detection algorithm. Furthermore, an in vivo motion trace was obtained from a healthy volunteer. The obtained eye motion trace clearly shows the three main types of fixational eye movements. Lastly, the obtained eye motion trace was used to correct for the eye motion in consecutively obtained subsampled frames to produce an averaged confocal image correct for motion artefacts. PMID:29552396
Blind retrospective motion correction of MR images.
Loktyushin, Alexander; Nickisch, Hannes; Pohmann, Rolf; Schölkopf, Bernhard
2013-12-01
Subject motion can severely degrade MR images. A retrospective motion correction algorithm, Gradient-based motion correction, which significantly reduces ghosting and blurring artifacts due to subject motion was proposed. The technique uses the raw data of standard imaging sequences; no sequence modifications or additional equipment such as tracking devices are required. Rigid motion is assumed. The approach iteratively searches for the motion trajectory yielding the sharpest image as measured by the entropy of spatial gradients. The vast space of motion parameters is efficiently explored by gradient-based optimization with a convergence guarantee. The method has been evaluated on both synthetic and real data in two and three dimensions using standard imaging techniques. MR images are consistently improved over different kinds of motion trajectories. Using a graphics processing unit implementation, computation times are in the order of a few minutes for a full three-dimensional volume. The presented technique can be an alternative or a complement to prospective motion correction methods and is able to improve images with strong motion artifacts from standard imaging sequences without requiring additional data. Copyright © 2013 Wiley Periodicals, Inc., a Wiley company.
Self-evaluation on Motion Adaptation for Service Robots
NASA Astrophysics Data System (ADS)
Funabora, Yuki; Yano, Yoshikazu; Doki, Shinji; Okuma, Shigeru
We suggest self motion evaluation method to adapt to environmental changes for service robots. Several motions such as walking, dancing, demonstration and so on are described with time series patterns. These motions are optimized with the architecture of the robot and under certain surrounding environment. Under unknown operating environment, robots cannot accomplish their tasks. We propose autonomous motion generation techniques based on heuristic search with histories of internal sensor values. New motion patterns are explored under unknown operating environment based on self-evaluation. Robot has some prepared motions which realize the tasks under the designed environment. Internal sensor values observed under the designed environment with prepared motions show the interaction results with the environment. Self-evaluation is composed of difference of internal sensor values between designed environment and unknown operating environment. Proposed method modifies the motions to synchronize the interaction results on both environment. New motion patterns are generated to maximize self-evaluation function without external information, such as run length, global position of robot, human observation and so on. Experimental results show that the possibility to adapt autonomously patterned motions to environmental changes.
Efficient physics-based tracking of heart surface motion for beating heart surgery robotic systems.
Bogatyrenko, Evgeniya; Pompey, Pascal; Hanebeck, Uwe D
2011-05-01
Tracking of beating heart motion in a robotic surgery system is required for complex cardiovascular interventions. A heart surface motion tracking method is developed, including a stochastic physics-based heart surface model and an efficient reconstruction algorithm. The algorithm uses the constraints provided by the model that exploits the physical characteristics of the heart. The main advantage of the model is that it is more realistic than most standard heart models. Additionally, no explicit matching between the measurements and the model is required. The application of meshless methods significantly reduces the complexity of physics-based tracking. Based on the stochastic physical model of the heart surface, this approach considers the motion of the intervention area and is robust to occlusions and reflections. The tracking algorithm is evaluated in simulations and experiments on an artificial heart. Providing higher accuracy than the standard model-based methods, it successfully copes with occlusions and provides high performance even when all measurements are not available. Combining the physical and stochastic description of the heart surface motion ensures physically correct and accurate prediction. Automatic initialization of the physics-based cardiac motion tracking enables system evaluation in a clinical environment.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Huang, Chuan; Brady, Thomas J.; El Fakhri, Georges
2014-04-15
Purpose: Artifacts caused by head motion present a major challenge in brain positron emission tomography (PET) imaging. The authors investigated the feasibility of using wired active MR microcoils to track head motion and incorporate the measured rigid motion fields into iterative PET reconstruction. Methods: Several wired active MR microcoils and a dedicated MR coil-tracking sequence were developed. The microcoils were attached to the outer surface of an anthropomorphic{sup 18}F-filled Hoffman phantom to mimic a brain PET scan. Complex rotation/translation motion of the phantom was induced by a balloon, which was connected to a ventilator. PET list-mode and MR tracking datamore » were acquired simultaneously on a PET-MR scanner. The acquired dynamic PET data were reconstructed iteratively with and without motion correction. Additionally, static phantom data were acquired and used as the gold standard. Results: Motion artifacts in PET images were effectively removed by wired active MR microcoil based motion correction. Motion correction yielded an activity concentration bias ranging from −0.6% to 3.4% as compared to a bias ranging from −25.0% to 16.6% if no motion correction was applied. The contrast recovery values were improved by 37%–156% with motion correction as compared to no motion correction. The image correlation (mean ± standard deviation) between the motion corrected (uncorrected) images of 20 independent noise realizations and static reference was R{sup 2} = 0.978 ± 0.007 (0.588 ± 0.010, respectively). Conclusions: Wired active MR microcoil based motion correction significantly improves brain PET quantitative accuracy and image contrast.« less
Huang, Chuan; Ackerman, Jerome L.; Petibon, Yoann; Brady, Thomas J.; El Fakhri, Georges; Ouyang, Jinsong
2014-01-01
Purpose: Artifacts caused by head motion present a major challenge in brain positron emission tomography (PET) imaging. The authors investigated the feasibility of using wired active MR microcoils to track head motion and incorporate the measured rigid motion fields into iterative PET reconstruction. Methods: Several wired active MR microcoils and a dedicated MR coil-tracking sequence were developed. The microcoils were attached to the outer surface of an anthropomorphic 18F-filled Hoffman phantom to mimic a brain PET scan. Complex rotation/translation motion of the phantom was induced by a balloon, which was connected to a ventilator. PET list-mode and MR tracking data were acquired simultaneously on a PET-MR scanner. The acquired dynamic PET data were reconstructed iteratively with and without motion correction. Additionally, static phantom data were acquired and used as the gold standard. Results: Motion artifacts in PET images were effectively removed by wired active MR microcoil based motion correction. Motion correction yielded an activity concentration bias ranging from −0.6% to 3.4% as compared to a bias ranging from −25.0% to 16.6% if no motion correction was applied. The contrast recovery values were improved by 37%–156% with motion correction as compared to no motion correction. The image correlation (mean ± standard deviation) between the motion corrected (uncorrected) images of 20 independent noise realizations and static reference was R2 = 0.978 ± 0.007 (0.588 ± 0.010, respectively). Conclusions: Wired active MR microcoil based motion correction significantly improves brain PET quantitative accuracy and image contrast. PMID:24694141
4D dose simulation in volumetric arc therapy: Accuracy and affecting parameters
Werner, René
2017-01-01
Radiotherapy of lung and liver lesions has changed from normofractioned 3D-CRT to stereotactic treatment in a single or few fractions, often employing volumetric arc therapy (VMAT)-based techniques. Potential unintended interference of respiratory target motion and dynamically changing beam parameters during VMAT dose delivery motivates establishing 4D quality assurance (4D QA) procedures to assess appropriateness of generated VMAT treatment plans when taking into account patient-specific motion characteristics. Current approaches are motion phantom-based 4D QA and image-based 4D VMAT dose simulation. Whereas phantom-based 4D QA is usually restricted to a small number of measurements, the computational approaches allow simulating many motion scenarios. However, 4D VMAT dose simulation depends on various input parameters, influencing estimated doses along with mitigating simulation reliability. Thus, aiming at routine use of simulation-based 4D VMAT QA, the impact of such parameters as well as the overall accuracy of the 4D VMAT dose simulation has to be studied in detail–which is the topic of the present work. In detail, we introduce the principles of 4D VMAT dose simulation, identify influencing parameters and assess their impact on 4D dose simulation accuracy by comparison of simulated motion-affected dose distributions to corresponding dosimetric motion phantom measurements. Exploiting an ITV-based treatment planning approach, VMAT treatment plans were generated for a motion phantom and different motion scenarios (sinusoidal motion of different period/direction; regular/irregular motion). 4D VMAT dose simulation results and dose measurements were compared by local 3% / 3 mm γ-evaluation, with the measured dose distributions serving as ground truth. Overall γ-passing rates of simulations and dynamic measurements ranged from 97% to 100% (mean across all motion scenarios: 98% ± 1%); corresponding values for comparison of different day repeat measurements were between 98% and 100%. Parameters of major influence on 4D VMAT dose simulation accuracy were the degree of temporal discretization of the dose delivery process (the higher, the better) and correct alignment of the assumed breathing phases at the beginning of the dose measurements and simulations. Given the high γ-passing rates between simulated motion-affected doses and dynamic measurements, we consider the simulations to provide a reliable basis for assessment of VMAT motion effects that–in the sense of 4D QA of VMAT treatment plans–allows to verify target coverage in hypofractioned VMAT-based radiotherapy of moving targets. Remaining differences between measurements and simulations motivate, however, further detailed studies. PMID:28231337
4D dose simulation in volumetric arc therapy: Accuracy and affecting parameters.
Sothmann, Thilo; Gauer, Tobias; Werner, René
2017-01-01
Radiotherapy of lung and liver lesions has changed from normofractioned 3D-CRT to stereotactic treatment in a single or few fractions, often employing volumetric arc therapy (VMAT)-based techniques. Potential unintended interference of respiratory target motion and dynamically changing beam parameters during VMAT dose delivery motivates establishing 4D quality assurance (4D QA) procedures to assess appropriateness of generated VMAT treatment plans when taking into account patient-specific motion characteristics. Current approaches are motion phantom-based 4D QA and image-based 4D VMAT dose simulation. Whereas phantom-based 4D QA is usually restricted to a small number of measurements, the computational approaches allow simulating many motion scenarios. However, 4D VMAT dose simulation depends on various input parameters, influencing estimated doses along with mitigating simulation reliability. Thus, aiming at routine use of simulation-based 4D VMAT QA, the impact of such parameters as well as the overall accuracy of the 4D VMAT dose simulation has to be studied in detail-which is the topic of the present work. In detail, we introduce the principles of 4D VMAT dose simulation, identify influencing parameters and assess their impact on 4D dose simulation accuracy by comparison of simulated motion-affected dose distributions to corresponding dosimetric motion phantom measurements. Exploiting an ITV-based treatment planning approach, VMAT treatment plans were generated for a motion phantom and different motion scenarios (sinusoidal motion of different period/direction; regular/irregular motion). 4D VMAT dose simulation results and dose measurements were compared by local 3% / 3 mm γ-evaluation, with the measured dose distributions serving as ground truth. Overall γ-passing rates of simulations and dynamic measurements ranged from 97% to 100% (mean across all motion scenarios: 98% ± 1%); corresponding values for comparison of different day repeat measurements were between 98% and 100%. Parameters of major influence on 4D VMAT dose simulation accuracy were the degree of temporal discretization of the dose delivery process (the higher, the better) and correct alignment of the assumed breathing phases at the beginning of the dose measurements and simulations. Given the high γ-passing rates between simulated motion-affected doses and dynamic measurements, we consider the simulations to provide a reliable basis for assessment of VMAT motion effects that-in the sense of 4D QA of VMAT treatment plans-allows to verify target coverage in hypofractioned VMAT-based radiotherapy of moving targets. Remaining differences between measurements and simulations motivate, however, further detailed studies.
TU-PIS-Exhibit Hall-2: How to Move Beyond Dose Monitoring to Imaging Performance Utilization
DOE Office of Scientific and Technical Information (OSTI.GOV)
Valencia, D.
The current clinical standard of organ respiratory imaging, 4D-CT, is fundamentally limited by poor soft-tissue contrast and imaging dose. These limitations are potential barriers to beneficial “4D” radiotherapy methods which optimize the target and OAR dose-volume considering breathing motion but rely on a robust motion characterization. Conversely, MRI imparts no known radiation risk and has excellent soft-tissue contrast. MRI-based motion management is therefore highly desirable and holds great promise to improve radiotherapy of moving cancers, particularly in the abdomen. Over the past decade, MRI techniques have improved significantly, making MR-based motion management clinically feasible. For example, cine MRI has highmore » temporal resolution up to 10 f/s and has been used to track and/or characterize tumor motion, study correlation between external and internal motions. New MR technologies, such as 4D-MRI and MRI hybrid treatment machines (i.e. MR-linac or MR-Co60), have been recently developed. These technologies can lead to more accurate target volume determination and more precise radiation dose delivery via direct tumor gating or tracking. Despite all these promises, great challenges exist and the achievable clinical benefit of MRI-based tumor motion management has yet to be fully explored, much less realized. In this proposal, we will review novel MR-based motion management methods and technologies, the state-of-the-art concerning MRI development and clinical application and the barriers to more widespread adoption. Learning Objectives: Discuss the need of MR-based motion management for improving patient care in radiotherapy. Understand MR techniques for motion imaging and tumor motion characterization. Understand the current state of the art and future steps for clinical integration. Henry Ford Health System holds research agreements with Philips Healthcare. Research sponsored in part by a Henry Ford Health System Internal Mentored Grant.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Massey, S.
The current clinical standard of organ respiratory imaging, 4D-CT, is fundamentally limited by poor soft-tissue contrast and imaging dose. These limitations are potential barriers to beneficial “4D” radiotherapy methods which optimize the target and OAR dose-volume considering breathing motion but rely on a robust motion characterization. Conversely, MRI imparts no known radiation risk and has excellent soft-tissue contrast. MRI-based motion management is therefore highly desirable and holds great promise to improve radiotherapy of moving cancers, particularly in the abdomen. Over the past decade, MRI techniques have improved significantly, making MR-based motion management clinically feasible. For example, cine MRI has highmore » temporal resolution up to 10 f/s and has been used to track and/or characterize tumor motion, study correlation between external and internal motions. New MR technologies, such as 4D-MRI and MRI hybrid treatment machines (i.e. MR-linac or MR-Co60), have been recently developed. These technologies can lead to more accurate target volume determination and more precise radiation dose delivery via direct tumor gating or tracking. Despite all these promises, great challenges exist and the achievable clinical benefit of MRI-based tumor motion management has yet to be fully explored, much less realized. In this proposal, we will review novel MR-based motion management methods and technologies, the state-of-the-art concerning MRI development and clinical application and the barriers to more widespread adoption. Learning Objectives: Discuss the need of MR-based motion management for improving patient care in radiotherapy. Understand MR techniques for motion imaging and tumor motion characterization. Understand the current state of the art and future steps for clinical integration. Henry Ford Health System holds research agreements with Philips Healthcare. Research sponsored in part by a Henry Ford Health System Internal Mentored Grant.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, J.; Stanford University: Introduction
The current clinical standard of organ respiratory imaging, 4D-CT, is fundamentally limited by poor soft-tissue contrast and imaging dose. These limitations are potential barriers to beneficial “4D” radiotherapy methods which optimize the target and OAR dose-volume considering breathing motion but rely on a robust motion characterization. Conversely, MRI imparts no known radiation risk and has excellent soft-tissue contrast. MRI-based motion management is therefore highly desirable and holds great promise to improve radiotherapy of moving cancers, particularly in the abdomen. Over the past decade, MRI techniques have improved significantly, making MR-based motion management clinically feasible. For example, cine MRI has highmore » temporal resolution up to 10 f/s and has been used to track and/or characterize tumor motion, study correlation between external and internal motions. New MR technologies, such as 4D-MRI and MRI hybrid treatment machines (i.e. MR-linac or MR-Co60), have been recently developed. These technologies can lead to more accurate target volume determination and more precise radiation dose delivery via direct tumor gating or tracking. Despite all these promises, great challenges exist and the achievable clinical benefit of MRI-based tumor motion management has yet to be fully explored, much less realized. In this proposal, we will review novel MR-based motion management methods and technologies, the state-of-the-art concerning MRI development and clinical application and the barriers to more widespread adoption. Learning Objectives: Discuss the need of MR-based motion management for improving patient care in radiotherapy. Understand MR techniques for motion imaging and tumor motion characterization. Understand the current state of the art and future steps for clinical integration. Henry Ford Health System holds research agreements with Philips Healthcare. Research sponsored in part by a Henry Ford Health System Internal Mentored Grant.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Goode, A.
The current clinical standard of organ respiratory imaging, 4D-CT, is fundamentally limited by poor soft-tissue contrast and imaging dose. These limitations are potential barriers to beneficial “4D” radiotherapy methods which optimize the target and OAR dose-volume considering breathing motion but rely on a robust motion characterization. Conversely, MRI imparts no known radiation risk and has excellent soft-tissue contrast. MRI-based motion management is therefore highly desirable and holds great promise to improve radiotherapy of moving cancers, particularly in the abdomen. Over the past decade, MRI techniques have improved significantly, making MR-based motion management clinically feasible. For example, cine MRI has highmore » temporal resolution up to 10 f/s and has been used to track and/or characterize tumor motion, study correlation between external and internal motions. New MR technologies, such as 4D-MRI and MRI hybrid treatment machines (i.e. MR-linac or MR-Co60), have been recently developed. These technologies can lead to more accurate target volume determination and more precise radiation dose delivery via direct tumor gating or tracking. Despite all these promises, great challenges exist and the achievable clinical benefit of MRI-based tumor motion management has yet to be fully explored, much less realized. In this proposal, we will review novel MR-based motion management methods and technologies, the state-of-the-art concerning MRI development and clinical application and the barriers to more widespread adoption. Learning Objectives: Discuss the need of MR-based motion management for improving patient care in radiotherapy. Understand MR techniques for motion imaging and tumor motion characterization. Understand the current state of the art and future steps for clinical integration. Henry Ford Health System holds research agreements with Philips Healthcare. Research sponsored in part by a Henry Ford Health System Internal Mentored Grant.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Boon, S.
The current clinical standard of organ respiratory imaging, 4D-CT, is fundamentally limited by poor soft-tissue contrast and imaging dose. These limitations are potential barriers to beneficial “4D” radiotherapy methods which optimize the target and OAR dose-volume considering breathing motion but rely on a robust motion characterization. Conversely, MRI imparts no known radiation risk and has excellent soft-tissue contrast. MRI-based motion management is therefore highly desirable and holds great promise to improve radiotherapy of moving cancers, particularly in the abdomen. Over the past decade, MRI techniques have improved significantly, making MR-based motion management clinically feasible. For example, cine MRI has highmore » temporal resolution up to 10 f/s and has been used to track and/or characterize tumor motion, study correlation between external and internal motions. New MR technologies, such as 4D-MRI and MRI hybrid treatment machines (i.e. MR-linac or MR-Co60), have been recently developed. These technologies can lead to more accurate target volume determination and more precise radiation dose delivery via direct tumor gating or tracking. Despite all these promises, great challenges exist and the achievable clinical benefit of MRI-based tumor motion management has yet to be fully explored, much less realized. In this proposal, we will review novel MR-based motion management methods and technologies, the state-of-the-art concerning MRI development and clinical application and the barriers to more widespread adoption. Learning Objectives: Discuss the need of MR-based motion management for improving patient care in radiotherapy. Understand MR techniques for motion imaging and tumor motion characterization. Understand the current state of the art and future steps for clinical integration. Henry Ford Health System holds research agreements with Philips Healthcare. Research sponsored in part by a Henry Ford Health System Internal Mentored Grant.« less
The instantaneous linear motion information measurement method based on inertial sensors for ships
NASA Astrophysics Data System (ADS)
Yang, Xu; Huang, Jing; Gao, Chen; Quan, Wei; Li, Ming; Zhang, Yanshun
2018-05-01
Ship instantaneous line motion information is the important foundation for ship control, which needs to be measured accurately. For this purpose, an instantaneous line motion measurement method based on inertial sensors is put forward for ships. By introducing a half-fixed coordinate system to realize the separation between instantaneous line motion and ship master movement, the instantaneous line motion acceleration of ships can be obtained with higher accuracy. Then, the digital high-pass filter is applied to suppress the velocity error caused by the low frequency signal such as schuler period. Finally, the instantaneous linear motion displacement of ships can be measured accurately. Simulation experimental results show that the method is reliable and effective, and can realize the precise measurement of velocity and displacement of instantaneous line motion for ships.
Magnetic Resonance-based Motion Correction for Quantitative PET in Simultaneous PET-MR Imaging.
Rakvongthai, Yothin; El Fakhri, Georges
2017-07-01
Motion degrades image quality and quantitation of PET images, and is an obstacle to quantitative PET imaging. Simultaneous PET-MR offers a tool that can be used for correcting the motion in PET images by using anatomic information from MR imaging acquired concurrently. Motion correction can be performed by transforming a set of reconstructed PET images into the same frame or by incorporating the transformation into the system model and reconstructing the motion-corrected image. Several phantom and patient studies have validated that MR-based motion correction strategies have great promise for quantitative PET imaging in simultaneous PET-MR. Copyright © 2017 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Paganelli, Chiara, E-mail: chiara.paganelli@polimi.it; Seregni, Matteo; Fattori, Giovanni
Purpose: This study applied automatic feature detection on cine–magnetic resonance imaging (MRI) liver images in order to provide a prospective comparison between MRI-guided and surrogate-based tracking methods for motion-compensated liver radiation therapy. Methods and Materials: In a population of 30 subjects (5 volunteers plus 25 patients), 2 oblique sagittal slices were acquired across the liver at high temporal resolution. An algorithm based on scale invariant feature transform (SIFT) was used to extract and track multiple features throughout the image sequence. The position of abdominal markers was also measured directly from the image series, and the internal motion of each featuremore » was quantified through multiparametric analysis. Surrogate-based tumor tracking with a state-of-the-art external/internal correlation model was simulated. The geometrical tracking error was measured, and its correlation with external motion parameters was also investigated. Finally, the potential gain in tracking accuracy relying on MRI guidance was quantified as a function of the maximum allowed tracking error. Results: An average of 45 features was extracted for each subject across the whole liver. The multi-parametric motion analysis reported relevant inter- and intrasubject variability, highlighting the value of patient-specific and spatially-distributed measurements. Surrogate-based tracking errors (relative to the motion amplitude) were were in the range 7% to 23% (1.02-3.57mm) and were significantly influenced by external motion parameters. The gain of MRI guidance compared to surrogate-based motion tracking was larger than 30% in 50% of the subjects when considering a 1.5-mm tracking error tolerance. Conclusions: Automatic feature detection applied to cine-MRI allows detailed liver motion description to be obtained. Such information was used to quantify the performance of surrogate-based tracking methods and to provide a prospective comparison with respect to MRI-guided radiation therapy, which could support the definition of patient-specific optimal treatment strategies.« less
Informed Decision Making for In-Home Use of Motion Sensor-Based Monitoring Technologies
ERIC Educational Resources Information Center
Bruce, Courtenay R.
2012-01-01
Motion sensor-based monitoring technologies are designed to maintain independence and safety of older individuals living alone. These technologies use motion sensors that are placed throughout older individuals' homes in order to derive information about eating, sleeping, and leaving/returning home habits. Deviations from normal behavioral…
MR-assisted PET motion correction in simultaneous PET/MRI studies of dementia subjects.
Chen, Kevin T; Salcedo, Stephanie; Chonde, Daniel B; Izquierdo-Garcia, David; Levine, Michael A; Price, Julie C; Dickerson, Bradford C; Catana, Ciprian
2018-03-08
Subject motion in positron emission tomography (PET) studies leads to image blurring and artifacts; simultaneously acquired magnetic resonance imaging (MRI) data provides a means for motion correction (MC) in integrated PET/MRI scanners. To assess the effect of realistic head motion and MR-based MC on static [ 18 F]-fluorodeoxyglucose (FDG) PET images in dementia patients. Observational study. Thirty dementia subjects were recruited. 3T hybrid PET/MR scanner where EPI-based and T 1 -weighted sequences were acquired simultaneously with the PET data. Head motion parameters estimated from high temporal resolution MR volumes were used for PET MC. The MR-based MC method was compared to PET frame-based MC methods in which motion parameters were estimated by coregistering 5-minute frames before and after accounting for the attenuation-emission mismatch. The relative changes in standardized uptake value ratios (SUVRs) between the PET volumes processed with the various MC methods, without MC, and the PET volumes with simulated motion were compared in relevant brain regions. The absolute value of the regional SUVR relative change was assessed with pairwise paired t-tests testing at the P = 0.05 level, comparing the values obtained through different MR-based MC processing methods as well as across different motion groups. The intraregion voxelwise variability of regional SUVRs obtained through different MR-based MC processing methods was also assessed with pairwise paired t-tests testing at the P = 0.05 level. MC had a greater impact on PET data quantification in subjects with larger amplitude motion (higher than 18% in the medial orbitofrontal cortex) and greater changes were generally observed for the MR-based MC method compared to the frame-based methods. Furthermore, a mean relative change of ∼4% was observed after MC even at the group level, suggesting the importance of routinely applying this correction. The intraregion voxelwise variability of regional SUVRs was also decreased using MR-based MC. All comparisons were significant at the P = 0.05 level. Incorporating temporally correlated MR data to account for intraframe motion has a positive impact on the FDG PET image quality and data quantification in dementia patients. 3 Technical Efficacy: Stage 1 J. Magn. Reson. Imaging 2018. © 2018 International Society for Magnetic Resonance in Medicine.
Dynamical simulation priors for human motion tracking.
Vondrak, Marek; Sigal, Leonid; Jenkins, Odest Chadwicke
2013-01-01
We propose a simulation-based dynamical motion prior for tracking human motion from video in presence of physical ground-person interactions. Most tracking approaches to date have focused on efficient inference algorithms and/or learning of prior kinematic motion models; however, few can explicitly account for the physical plausibility of recovered motion. Here, we aim to recover physically plausible motion of a single articulated human subject. Toward this end, we propose a full-body 3D physical simulation-based prior that explicitly incorporates a model of human dynamics into the Bayesian filtering framework. We consider the motion of the subject to be generated by a feedback “control loop” in which Newtonian physics approximates the rigid-body motion dynamics of the human and the environment through the application and integration of interaction forces, motor forces, and gravity. Interaction forces prevent physically impossible hypotheses, enable more appropriate reactions to the environment (e.g., ground contacts), and are produced from detected human-environment collisions. Motor forces actuate the body, ensure that proposed pose transitions are physically feasible, and are generated using a motion controller. For efficient inference in the resulting high-dimensional state space, we utilize an exemplar-based control strategy that reduces the effective search space of motor forces. As a result, we are able to recover physically plausible motion of human subjects from monocular and multiview video. We show, both quantitatively and qualitatively, that our approach performs favorably with respect to Bayesian filtering methods with standard motion priors.
The statistics of local motion signals in naturalistic movies
Nitzany, Eyal I.; Victor, Jonathan D.
2014-01-01
Extraction of motion from visual input plays an important role in many visual tasks, such as separation of figure from ground and navigation through space. Several kinds of local motion signals have been distinguished based on mathematical and computational considerations (e.g., motion based on spatiotemporal correlation of luminance, and motion based on spatiotemporal correlation of flicker), but little is known about the prevalence of these different kinds of signals in the real world. To address this question, we first note that different kinds of local motion signals (e.g., Fourier, non-Fourier, and glider) are characterized by second- and higher-order correlations in slanted spatiotemporal regions. The prevalence of local motion signals in natural scenes can thus be estimated by measuring the extent to which each of these correlations are present in space-time patches and whether they are coherent across spatiotemporal scales. We apply this technique to several popular movies. The results show that all three kinds of local motion signals are present in natural movies. While the balance of the different kinds of motion signals varies from segment to segment during the course of each movie, the overall pattern of prevalence of the different kinds of motion and their subtypes, and the correlations between them, is strikingly similar across movies (but is absent from white noise movies). In sum, naturalistic movies contain a diversity of local motion signals that occur with a consistent prevalence and pattern of covariation, indicating a substantial regularity of their high-order spatiotemporal image statistics. PMID:24732243
The statistics of local motion signals in naturalistic movies.
Nitzany, Eyal I; Victor, Jonathan D
2014-04-14
Extraction of motion from visual input plays an important role in many visual tasks, such as separation of figure from ground and navigation through space. Several kinds of local motion signals have been distinguished based on mathematical and computational considerations (e.g., motion based on spatiotemporal correlation of luminance, and motion based on spatiotemporal correlation of flicker), but little is known about the prevalence of these different kinds of signals in the real world. To address this question, we first note that different kinds of local motion signals (e.g., Fourier, non-Fourier, and glider) are characterized by second- and higher-order correlations in slanted spatiotemporal regions. The prevalence of local motion signals in natural scenes can thus be estimated by measuring the extent to which each of these correlations are present in space-time patches and whether they are coherent across spatiotemporal scales. We apply this technique to several popular movies. The results show that all three kinds of local motion signals are present in natural movies. While the balance of the different kinds of motion signals varies from segment to segment during the course of each movie, the overall pattern of prevalence of the different kinds of motion and their subtypes, and the correlations between them, is strikingly similar across movies (but is absent from white noise movies). In sum, naturalistic movies contain a diversity of local motion signals that occur with a consistent prevalence and pattern of covariation, indicating a substantial regularity of their high-order spatiotemporal image statistics.
Human joint motion estimation for electromyography (EMG)-based dynamic motion control.
Zhang, Qin; Hosoda, Ryo; Venture, Gentiane
2013-01-01
This study aims to investigate a joint motion estimation method from Electromyography (EMG) signals during dynamic movement. In most EMG-based humanoid or prosthetics control systems, EMG features were directly or indirectly used to trigger intended motions. However, both physiological and nonphysiological factors can influence EMG characteristics during dynamic movements, resulting in subject-specific, non-stationary and crosstalk problems. Particularly, when motion velocity and/or joint torque are not constrained, joint motion estimation from EMG signals are more challenging. In this paper, we propose a joint motion estimation method based on muscle activation recorded from a pair of agonist and antagonist muscles of the joint. A linear state-space model with multi input single output is proposed to map the muscle activity to joint motion. An adaptive estimation method is proposed to train the model. The estimation performance is evaluated in performing a single elbow flexion-extension movement in two subjects. All the results in two subjects at two load levels indicate the feasibility and suitability of the proposed method in joint motion estimation. The estimation root-mean-square error is within 8.3% ∼ 10.6%, which is lower than that being reported in several previous studies. Moreover, this method is able to overcome subject-specific problem and compensate non-stationary EMG properties.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Huang, Chuan, E-mail: chuan.huang@stonybrookmedicine.edu; Department of Radiology, Harvard Medical School, Boston, Massachusetts 02115; Departments of Radiology, Psychiatry, Stony Brook Medicine, Stony Brook, New York 11794
2015-02-15
Purpose: Degradation of image quality caused by cardiac and respiratory motions hampers the diagnostic quality of cardiac PET. It has been shown that improved diagnostic accuracy of myocardial defect can be achieved by tagged MR (tMR) based PET motion correction using simultaneous PET-MR. However, one major hurdle for the adoption of tMR-based PET motion correction in the PET-MR routine is the long acquisition time needed for the collection of fully sampled tMR data. In this work, the authors propose an accelerated tMR acquisition strategy using parallel imaging and/or compressed sensing and assess the impact on the tMR-based motion corrected PETmore » using phantom and patient data. Methods: Fully sampled tMR data were acquired simultaneously with PET list-mode data on two simultaneous PET-MR scanners for a cardiac phantom and a patient. Parallel imaging and compressed sensing were retrospectively performed by GRAPPA and kt-FOCUSS algorithms with various acceleration factors. Motion fields were estimated using nonrigid B-spline image registration from both the accelerated and fully sampled tMR images. The motion fields were incorporated into a motion corrected ordered subset expectation maximization reconstruction algorithm with motion-dependent attenuation correction. Results: Although tMR acceleration introduced image artifacts into the tMR images for both phantom and patient data, motion corrected PET images yielded similar image quality as those obtained using the fully sampled tMR images for low to moderate acceleration factors (<4). Quantitative analysis of myocardial defect contrast over ten independent noise realizations showed similar results. It was further observed that although the image quality of the motion corrected PET images deteriorates for high acceleration factors, the images were still superior to the images reconstructed without motion correction. Conclusions: Accelerated tMR images obtained with more than 4 times acceleration can still provide relatively accurate motion fields and yield tMR-based motion corrected PET images with similar image quality as those reconstructed using fully sampled tMR data. The reduction of tMR acquisition time makes it more compatible with routine clinical cardiac PET-MR studies.« less
NASA Astrophysics Data System (ADS)
Suzuki, Yuki; Fung, George S. K.; Shen, Zeyang; Otake, Yoshito; Lee, Okkyun; Ciuffo, Luisa; Ashikaga, Hiroshi; Sato, Yoshinobu; Taguchi, Katsuyuki
2017-03-01
Cardiac motion (or functional) analysis has shown promise not only for non-invasive diagnosis of cardiovascular diseases but also for prediction of cardiac future events. Current imaging modalities has limitations that could degrade the accuracy of the analysis indices. In this paper, we present a projection-based motion estimation method for x-ray CT that estimates cardiac motion with high spatio-temporal resolution using projection data and a reference 3D volume image. The experiment using a synthesized digital phantom showed promising results for motion analysis.
14 CFR 13.226 - Public disclosure of evidence.
Code of Federal Regulations, 2014 CFR
2014-01-01
... law judge and serving a copy of the motion on each party. The party shall state the specific grounds for nondisclosure in the motion. (b) The administrative law judge shall grant the motion to withhold information in the record if, based on the motion and any response to the motion, the administrative law judge...
14 CFR 13.226 - Public disclosure of evidence.
Code of Federal Regulations, 2012 CFR
2012-01-01
... law judge and serving a copy of the motion on each party. The party shall state the specific grounds for nondisclosure in the motion. (b) The administrative law judge shall grant the motion to withhold information in the record if, based on the motion and any response to the motion, the administrative law judge...
14 CFR 13.226 - Public disclosure of evidence.
Code of Federal Regulations, 2013 CFR
2013-01-01
... law judge and serving a copy of the motion on each party. The party shall state the specific grounds for nondisclosure in the motion. (b) The administrative law judge shall grant the motion to withhold information in the record if, based on the motion and any response to the motion, the administrative law judge...
Motion video analysis using planar parallax
NASA Astrophysics Data System (ADS)
Sawhney, Harpreet S.
1994-04-01
Motion and structure analysis in video sequences can lead to efficient descriptions of objects and their motions. Interesting events in videos can be detected using such an analysis--for instance independent object motion when the camera itself is moving, figure-ground segregation based on the saliency of a structure compared to its surroundings. In this paper we present a method for 3D motion and structure analysis that uses a planar surface in the environment as a reference coordinate system to describe a video sequence. The motion in the video sequence is described as the motion of the reference plane, and the parallax motion of all the non-planar components of the scene. It is shown how this method simplifies the otherwise hard general 3D motion analysis problem. In addition, a natural coordinate system in the environment is used to describe the scene which can simplify motion based segmentation. This work is a part of an ongoing effort in our group towards video annotation and analysis for indexing and retrieval. Results from a demonstration system being developed are presented.
Prosthetic design directives: Low-cost hands within reach.
Jones, G K; Rosendo, A; Stopforth, R
2017-07-01
Although three million people around the world suffer from the lack of one or both upper limbs 80% of this number is located within developing countries. While prosthetic prices soar with technology 3D printing and low cost electronics present a sensible solution for those that cannot afford expensive prosthetics. The electronic and control design of a low-cost prosthetic hand, the Touch Hand II, is discussed. This paper shows that sensorless techniques can be used to reduce design complexities, costs, and provide easier access to the electronics. A closing and opening finite state machine (COFSM) was developed to handle the actuated digit joint control state and a supervisory switching control scheme, used for speed and grip strength control. Three torque and speed settings were created to be preset for specific grasps. The hand was able to replicate ten frequently used grasps and grip some common objects. Future work is necessary to enable a user to control it with myoelectric signals (MESs) and to solve operational problems related to electromagnetic interference (EMI).
500 Gb/s free-space optical transmission over strong atmospheric turbulence channels.
Qu, Zhen; Djordjevic, Ivan B
2016-07-15
We experimentally demonstrate a high-spectral-efficiency, large-capacity, featured free-space-optical (FSO) transmission system by using low-density, parity-check (LDPC) coded quadrature phase shift keying (QPSK) combined with orbital angular momentum (OAM) multiplexing. The strong atmospheric turbulence channel is emulated by two spatial light modulators on which four randomly generated azimuthal phase patterns yielding the Andrews spectrum are recorded. The validity of such an approach is verified by reproducing the intensity distribution and irradiance correlation function (ICF) from the full-scale simulator. Excellent agreement of experimental, numerical, and analytical results is found. To reduce the phase distortion induced by the turbulence emulator, the inexpensive wavefront sensorless adaptive optics (AO) is used. To deal with remaining channel impairments, a large-girth LDPC code is used. To further improve the aggregate data rate, the OAM multiplexing is combined with WDM, and 500 Gb/s optical transmission over the strong atmospheric turbulence channels is demonstrated.
Image motion environments: background noise for movement-based animal signals.
Peters, Richard; Hemmi, Jan; Zeil, Jochen
2008-05-01
Understanding the evolution of animal signals has to include consideration of the structure of signal and noise, and the sensory mechanisms that detect the signals. Considerable progress has been made in understanding sounds and colour signals, however, the degree to which movement-based signals are constrained by the particular patterns of environmental image motion is poorly understood. Here we have quantified the image motion generated by wind-blown plants at 12 sites in the coastal habitat of the Australian lizard Amphibolurus muricatus. Sampling across different plant communities and meteorological conditions revealed distinct image motion environments. At all locations, image motion became more directional and apparent speed increased as wind speeds increased. The magnitude of these changes and the spatial distribution of image motion, however, varied between locations probably as a function of plant structure and the topographic location. In addition, we show that the background motion noise depends strongly on the particular depth-structure of the environment and argue that such micro-habitat differences suggest specific strategies to preserve signal efficacy. Movement-based signals and motion processing mechanisms, therefore, may reveal the same type of habitat specific structural variation that we see for signals from other modalities.
4D cone-beam CT reconstruction using multi-organ meshes for sliding motion modeling
NASA Astrophysics Data System (ADS)
Zhong, Zichun; Gu, Xuejun; Mao, Weihua; Wang, Jing
2016-02-01
A simultaneous motion estimation and image reconstruction (SMEIR) strategy was proposed for 4D cone-beam CT (4D-CBCT) reconstruction and showed excellent results in both phantom and lung cancer patient studies. In the original SMEIR algorithm, the deformation vector field (DVF) was defined on voxel grid and estimated by enforcing a global smoothness regularization term on the motion fields. The objective of this work is to improve the computation efficiency and motion estimation accuracy of SMEIR for 4D-CBCT through developing a multi-organ meshing model. Feature-based adaptive meshes were generated to reduce the number of unknowns in the DVF estimation and accurately capture the organ shapes and motion. Additionally, the discontinuity in the motion fields between different organs during respiration was explicitly considered in the multi-organ mesh model. This will help with the accurate visualization and motion estimation of the tumor on the organ boundaries in 4D-CBCT. To further improve the computational efficiency, a GPU-based parallel implementation was designed. The performance of the proposed algorithm was evaluated on a synthetic sliding motion phantom, a 4D NCAT phantom, and four lung cancer patients. The proposed multi-organ mesh based strategy outperformed the conventional Feldkamp-Davis-Kress, iterative total variation minimization, original SMEIR and single meshing method based on both qualitative and quantitative evaluations.
4D cone-beam CT reconstruction using multi-organ meshes for sliding motion modeling.
Zhong, Zichun; Gu, Xuejun; Mao, Weihua; Wang, Jing
2016-02-07
A simultaneous motion estimation and image reconstruction (SMEIR) strategy was proposed for 4D cone-beam CT (4D-CBCT) reconstruction and showed excellent results in both phantom and lung cancer patient studies. In the original SMEIR algorithm, the deformation vector field (DVF) was defined on voxel grid and estimated by enforcing a global smoothness regularization term on the motion fields. The objective of this work is to improve the computation efficiency and motion estimation accuracy of SMEIR for 4D-CBCT through developing a multi-organ meshing model. Feature-based adaptive meshes were generated to reduce the number of unknowns in the DVF estimation and accurately capture the organ shapes and motion. Additionally, the discontinuity in the motion fields between different organs during respiration was explicitly considered in the multi-organ mesh model. This will help with the accurate visualization and motion estimation of the tumor on the organ boundaries in 4D-CBCT. To further improve the computational efficiency, a GPU-based parallel implementation was designed. The performance of the proposed algorithm was evaluated on a synthetic sliding motion phantom, a 4D NCAT phantom, and four lung cancer patients. The proposed multi-organ mesh based strategy outperformed the conventional Feldkamp-Davis-Kress, iterative total variation minimization, original SMEIR and single meshing method based on both qualitative and quantitative evaluations.
4D cone-beam CT reconstruction using multi-organ meshes for sliding motion modeling
Zhong, Zichun; Gu, Xuejun; Mao, Weihua; Wang, Jing
2016-01-01
A simultaneous motion estimation and image reconstruction (SMEIR) strategy was proposed for 4D cone-beam CT (4D-CBCT) reconstruction and showed excellent results in both phantom and lung cancer patient studies. In the original SMEIR algorithm, the deformation vector field (DVF) was defined on voxel grid and estimated by enforcing a global smoothness regularization term on the motion fields. The objective of this work is to improve the computation efficiency and motion estimation accuracy of SMEIR for 4D-CBCT through developing a multi-organ meshing model. Feature-based adaptive meshes were generated to reduce the number of unknowns in the DVF estimation and accurately capture the organ shapes and motion. Additionally, the discontinuity in the motion fields between different organs during respiration was explicitly considered in the multi-organ mesh model. This will help with the accurate visualization and motion estimation of the tumor on the organ boundaries in 4D-CBCT. To further improve the computational efficiency, a GPU-based parallel implementation was designed. The performance of the proposed algorithm was evaluated on a synthetic sliding motion phantom, a 4D NCAT phantom, and four lung cancer patients. The proposed multi-organ mesh based strategy outperformed the conventional Feldkamp–Davis–Kress, iterative total variation minimization, original SMEIR and single meshing method based on both qualitative and quantitative evaluations. PMID:26758496
Smart Sensor-Based Motion Detection System for Hand Movement Training in Open Surgery.
Sun, Xinyao; Byrns, Simon; Cheng, Irene; Zheng, Bin; Basu, Anup
2017-02-01
We introduce a smart sensor-based motion detection technique for objective measurement and assessment of surgical dexterity among users at different experience levels. The goal is to allow trainees to evaluate their performance based on a reference model shared through communication technology, e.g., the Internet, without the physical presence of an evaluating surgeon. While in the current implementation we used a Leap Motion Controller to obtain motion data for analysis, our technique can be applied to motion data captured by other smart sensors, e.g., OptiTrack. To differentiate motions captured from different participants, measurement and assessment in our approach are achieved using two strategies: (1) low level descriptive statistical analysis, and (2) Hidden Markov Model (HMM) classification. Based on our surgical knot tying task experiment, we can conclude that finger motions generated from users with different surgical dexterity, e.g., expert and novice performers, display differences in path length, number of movements and task completion time. In order to validate the discriminatory ability of HMM for classifying different movement patterns, a non-surgical task was included in our analysis. Experimental results demonstrate that our approach had 100 % accuracy in discriminating between expert and novice performances. Our proposed motion analysis technique applied to open surgical procedures is a promising step towards the development of objective computer-assisted assessment and training systems.
Motion Field Estimation for a Dynamic Scene Using a 3D LiDAR
Li, Qingquan; Zhang, Liang; Mao, Qingzhou; Zou, Qin; Zhang, Pin; Feng, Shaojun; Ochieng, Washington
2014-01-01
This paper proposes a novel motion field estimation method based on a 3D light detection and ranging (LiDAR) sensor for motion sensing for intelligent driverless vehicles and active collision avoidance systems. Unlike multiple target tracking methods, which estimate the motion state of detected targets, such as cars and pedestrians, motion field estimation regards the whole scene as a motion field in which each little element has its own motion state. Compared to multiple target tracking, segmentation errors and data association errors have much less significance in motion field estimation, making it more accurate and robust. This paper presents an intact 3D LiDAR-based motion field estimation method, including pre-processing, a theoretical framework for the motion field estimation problem and practical solutions. The 3D LiDAR measurements are first projected to small-scale polar grids, and then, after data association and Kalman filtering, the motion state of every moving grid is estimated. To reduce computing time, a fast data association algorithm is proposed. Furthermore, considering the spatial correlation of motion among neighboring grids, a novel spatial-smoothing algorithm is also presented to optimize the motion field. The experimental results using several data sets captured in different cities indicate that the proposed motion field estimation is able to run in real-time and performs robustly and effectively. PMID:25207868
Motion field estimation for a dynamic scene using a 3D LiDAR.
Li, Qingquan; Zhang, Liang; Mao, Qingzhou; Zou, Qin; Zhang, Pin; Feng, Shaojun; Ochieng, Washington
2014-09-09
This paper proposes a novel motion field estimation method based on a 3D light detection and ranging (LiDAR) sensor for motion sensing for intelligent driverless vehicles and active collision avoidance systems. Unlike multiple target tracking methods, which estimate the motion state of detected targets, such as cars and pedestrians, motion field estimation regards the whole scene as a motion field in which each little element has its own motion state. Compared to multiple target tracking, segmentation errors and data association errors have much less significance in motion field estimation, making it more accurate and robust. This paper presents an intact 3D LiDAR-based motion field estimation method, including pre-processing, a theoretical framework for the motion field estimation problem and practical solutions. The 3D LiDAR measurements are first projected to small-scale polar grids, and then, after data association and Kalman filtering, the motion state of every moving grid is estimated. To reduce computing time, a fast data association algorithm is proposed. Furthermore, considering the spatial correlation of motion among neighboring grids, a novel spatial-smoothing algorithm is also presented to optimize the motion field. The experimental results using several data sets captured in different cities indicate that the proposed motion field estimation is able to run in real-time and performs robustly and effectively.
Deblurring for spatial and temporal varying motion with optical computing
NASA Astrophysics Data System (ADS)
Xiao, Xiao; Xue, Dongfeng; Hui, Zhao
2016-05-01
A way to estimate and remove spatially and temporally varying motion blur is proposed, which is based on an optical computing system. The translation and rotation motion can be independently estimated from the joint transform correlator (JTC) system without iterative optimization. The inspiration comes from the fact that the JTC system is immune to rotation motion in a Cartesian coordinate system. The work scheme of the JTC system is designed to keep switching between the Cartesian coordinate system and polar coordinate system in different time intervals with the ping-pang handover. In the ping interval, the JTC system works in the Cartesian coordinate system to obtain a translation motion vector with optical computing speed. In the pang interval, the JTC system works in the polar coordinate system. The rotation motion is transformed to the translation motion through coordinate transformation. Then the rotation motion vector can also be obtained from JTC instantaneously. To deal with continuous spatially variant motion blur, submotion vectors based on the projective motion path blur model are proposed. The submotion vectors model is more effective and accurate at modeling spatially variant motion blur than conventional methods. The simulation and real experiment results demonstrate its overall effectiveness.
Multimodal Pilot Behavior in Multi-Axis Tracking Tasks with Time-Varying Motion Cueing Gains
NASA Technical Reports Server (NTRS)
Zaal, P. M. T; Pool, D. M.
2014-01-01
In a large number of motion-base simulators, adaptive motion filters are utilized to maximize the use of the available motion envelope of the motion system. However, not much is known about how the time-varying characteristics of such adaptive filters affect pilots when performing manual aircraft control. This paper presents the results of a study investigating the effects of time-varying motion filter gains on pilot control behavior and performance. An experiment was performed in a motion-base simulator where participants performed a simultaneous roll and pitch tracking task, while the roll and/or pitch motion filter gains changed over time. Results indicate that performance increases over time with increasing motion gains. This increase is a result of a time-varying adaptation of pilots' equalization dynamics, characterized by increased visual and motion response gains and decreased visual lead time constants. Opposite trends are found for decreasing motion filter gains. Even though the trends in both controlled axes are found to be largely the same, effects are less significant in roll. In addition, results indicate minor cross-coupling effects between pitch and roll, where a cueing variation in one axis affects the behavior adopted in the other axis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta
By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency.more » The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.« less
Wang, Xingjian; Liao, Rui; Shi, Cun; Wang, Shaoping
2017-10-25
Moving towards the more electric aircraft (MEA), a hybrid actuator configuration provides an opportunity to introduce electromechanical actuator (EMA) into primary flight control. In the hybrid actuation system (HAS), an electro-hydraulic servo actuator (EHSA) and an EMA operate on the same control surface. In order to solve force fighting problem in HAS, this paper proposes a novel linear extended state observer (LESO)-based motion synchronization control method. To cope with the problem of unavailability of the state signals required by the motion synchronization controller, LESO is designed for EHSA and EMA to observe the state variables. Based on the observed states of LESO, motion synchronization controllers could enable EHSA and EMA to simultaneously track the desired motion trajectories. Additionally, nonlinearities, uncertainties and unknown disturbances as well as the coupling term between EHSA and EMA can be estimated and compensated by using the extended state of the proposed LESO. Finally, comparative simulation results indicate that the proposed LESO-based motion synchronization controller could reduce significant force fighting between EHSA and EMA.
Moving object detection using dynamic motion modelling from UAV aerial images.
Saif, A F M Saifuddin; Prabuwono, Anton Satria; Mahayuddin, Zainal Rasyid
2014-01-01
Motion analysis based moving object detection from UAV aerial image is still an unsolved issue due to inconsideration of proper motion estimation. Existing moving object detection approaches from UAV aerial images did not deal with motion based pixel intensity measurement to detect moving object robustly. Besides current research on moving object detection from UAV aerial images mostly depends on either frame difference or segmentation approach separately. There are two main purposes for this research: firstly to develop a new motion model called DMM (dynamic motion model) and secondly to apply the proposed segmentation approach SUED (segmentation using edge based dilation) using frame difference embedded together with DMM model. The proposed DMM model provides effective search windows based on the highest pixel intensity to segment only specific area for moving object rather than searching the whole area of the frame using SUED. At each stage of the proposed scheme, experimental fusion of the DMM and SUED produces extracted moving objects faithfully. Experimental result reveals that the proposed DMM and SUED have successfully demonstrated the validity of the proposed methodology.
Liao, Rui; Shi, Cun; Wang, Shaoping
2017-01-01
Moving towards the more electric aircraft (MEA), a hybrid actuator configuration provides an opportunity to introduce electromechanical actuator (EMA) into primary flight control. In the hybrid actuation system (HAS), an electro-hydraulic servo actuator (EHSA) and an EMA operate on the same control surface. In order to solve force fighting problem in HAS, this paper proposes a novel linear extended state observer (LESO)-based motion synchronization control method. To cope with the problem of unavailability of the state signals required by the motion synchronization controller, LESO is designed for EHSA and EMA to observe the state variables. Based on the observed states of LESO, motion synchronization controllers could enable EHSA and EMA to simultaneously track the desired motion trajectories. Additionally, nonlinearities, uncertainties and unknown disturbances as well as the coupling term between EHSA and EMA can be estimated and compensated by using the extended state of the proposed LESO. Finally, comparative simulation results indicate that the proposed LESO-based motion synchronization controller could reduce significant force fighting between EHSA and EMA. PMID:29068392
Global form and motion processing in healthy ageing.
Agnew, Hannah C; Phillips, Louise H; Pilz, Karin S
2016-05-01
The ability to perceive biological motion has been shown to deteriorate with age, and it is assumed that older adults rely more on the global form than local motion information when processing point-light walkers. Further, it has been suggested that biological motion processing in ageing is related to a form-based global processing bias. Here, we investigated the relationship between older adults' preference for form information when processing point-light actions and an age-related form-based global processing bias. In a first task, we asked older (>60years) and younger adults (19-23years) to sequentially match three different point-light actions; normal actions that contained local motion and global form information, scrambled actions that contained primarily local motion information, and random-position actions that contained primarily global form information. Both age groups overall performed above chance in all three conditions, and were more accurate for actions that contained global form information. For random-position actions, older adults were less accurate than younger adults but there was no age-difference for normal or scrambled actions. These results indicate that both age groups rely more on global form than local motion to match point-light actions, but can use local motion on its own to match point-light actions. In a second task, we investigated form-based global processing biases using the Navon task. In general, participants were better at discriminating the local letters but faster at discriminating global letters. Correlations showed that there was no significant linear relationship between performance in the Navon task and biological motion processing, which suggests that processing biases in form- and motion-based tasks are unrelated. Copyright © 2016. Published by Elsevier B.V.
Precise Image-Based Motion Estimation for Autonomous Small Body Exploration
NASA Technical Reports Server (NTRS)
Johnson, Andrew E.; Matthies, Larry H.
1998-01-01
Space science and solar system exploration are driving NASA to develop an array of small body missions ranging in scope from near body flybys to complete sample return. This paper presents an algorithm for onboard motion estimation that will enable the precision guidance necessary for autonomous small body landing. Our techniques are based on automatic feature tracking between a pair of descent camera images followed by two frame motion estimation and scale recovery using laser altimetry data. The output of our algorithm is an estimate of rigid motion (attitude and position) and motion covariance between frames. This motion estimate can be passed directly to the spacecraft guidance and control system to enable rapid execution of safe and precise trajectories.
Kim, Young-Keun; Kim, Kyung-Soo
2014-10-01
Maritime transportation demands an accurate measurement system to track the motion of oscillating container boxes in real time. However, it is a challenge to design a sensor system that can provide both reliable and non-contact methods of 6-DOF motion measurements of a remote object for outdoor applications. In the paper, a sensor system based on two 2D laser scanners is proposed for detecting the relative 6-DOF motion of a crane load in real time. Even without implementing a camera, the proposed system can detect the motion of a remote object using four laser beam points. Because it is a laser-based sensor, the system is expected to be highly robust to sea weather conditions.
NASA Astrophysics Data System (ADS)
Kim, Young-Keun; Kim, Kyung-Soo
2014-10-01
Maritime transportation demands an accurate measurement system to track the motion of oscillating container boxes in real time. However, it is a challenge to design a sensor system that can provide both reliable and non-contact methods of 6-DOF motion measurements of a remote object for outdoor applications. In the paper, a sensor system based on two 2D laser scanners is proposed for detecting the relative 6-DOF motion of a crane load in real time. Even without implementing a camera, the proposed system can detect the motion of a remote object using four laser beam points. Because it is a laser-based sensor, the system is expected to be highly robust to sea weather conditions.
Complex motion measurement using genetic algorithm
NASA Astrophysics Data System (ADS)
Shen, Jianjun; Tu, Dan; Shen, Zhenkang
1997-12-01
Genetic algorithm (GA) is an optimization technique that provides an untraditional approach to deal with many nonlinear, complicated problems. The notion of motion measurement using genetic algorithm arises from the fact that the motion measurement is virtually an optimization process based on some criterions. In the paper, we propose a complex motion measurement method using genetic algorithm based on block-matching criterion. The following three problems are mainly discussed and solved in the paper: (1) apply an adaptive method to modify the control parameters of GA that are critical to itself, and offer an elitism strategy at the same time (2) derive an evaluate function of motion measurement for GA based on block-matching technique (3) employ hill-climbing (HC) method hybridly to assist GA's search for the global optimal solution. Some other related problems are also discussed. At the end of paper, experiments result is listed. We employ six motion parameters for measurement in our experiments. Experiments result shows that the performance of our GA is good. The GA can find the object motion accurately and rapidly.
Mitigating Motion Base Safety Issues: The NASA LaRC CMF Implementation
NASA Technical Reports Server (NTRS)
Bryant, Richard B., Jr.; Grupton, Lawrence E.; Martinez, Debbie; Carrelli, David J.
2005-01-01
The NASA Langley Research Center (LaRC), Cockpit Motion Facility (CMF) motion base design has taken advantage of inherent hydraulic characteristics to implement safety features using hardware solutions only. Motion system safety has always been a concern and its implementation is addressed differently by each organization. Some approaches rely heavily on software safety features. Software which performs safety functions is subject to more scrutiny making its approval, modification, and development time consuming and expensive. The NASA LaRC's CMF motion system is used for research and, as such, requires that the software be updated or modified frequently. The CMF's customers need the ability to update the simulation software frequently without the associated cost incurred with safety critical software. This paper describes the CMF engineering team's approach to achieving motion base safety by designing and implementing all safety features in hardware, resulting in applications software (including motion cueing and actuator dynamic control) being completely independent of the safety devices. This allows the CMF safety systems to remain intact and unaffected by frequent research system modifications.
Human motion retrieval from hand-drawn sketch.
Chao, Min-Wen; Lin, Chao-Hung; Assa, Jackie; Lee, Tong-Yee
2012-05-01
The rapid growth of motion capture data increases the importance of motion retrieval. The majority of the existing motion retrieval approaches are based on a labor-intensive step in which the user browses and selects a desired query motion clip from the large motion clip database. In this work, a novel sketching interface for defining the query is presented. This simple approach allows users to define the required motion by sketching several motion strokes over a drawn character, which requires less effort and extends the users’ expressiveness. To support the real-time interface, a specialized encoding of the motions and the hand-drawn query is required. Here, we introduce a novel hierarchical encoding scheme based on a set of orthonormal spherical harmonic (SH) basis functions, which provides a compact representation, and avoids the CPU/processing intensive stage of temporal alignment used by previous solutions. Experimental results show that the proposed approach can well retrieve the motions, and is capable of retrieve logically and numerically similar motions, which is superior to previous approaches. The user study shows that the proposed system can be a useful tool to input motion query if the users are familiar with it. Finally, an application of generating a 3D animation from a hand-drawn comics strip is demonstrated.
3D fluoroscopic image estimation using patient-specific 4DCBCT-based motion models
Dhou, Salam; Hurwitz, Martina; Mishra, Pankaj; Cai, Weixing; Rottmann, Joerg; Li, Ruijiang; Williams, Christopher; Wagar, Matthew; Berbeco, Ross; Ionascu, Dan; Lewis, John H.
2015-01-01
3D fluoroscopic images represent volumetric patient anatomy during treatment with high spatial and temporal resolution. 3D fluoroscopic images estimated using motion models built using 4DCT images, taken days or weeks prior to treatment, do not reliably represent patient anatomy during treatment. In this study we develop and perform initial evaluation of techniques to develop patient-specific motion models from 4D cone-beam CT (4DCBCT) images, taken immediately before treatment, and use these models to estimate 3D fluoroscopic images based on 2D kV projections captured during treatment. We evaluate the accuracy of 3D fluoroscopic images by comparing to ground truth digital and physical phantom images. The performance of 4DCBCT- and 4DCT- based motion models are compared in simulated clinical situations representing tumor baseline shift or initial patient positioning errors. The results of this study demonstrate the ability for 4DCBCT imaging to generate motion models that can account for changes that cannot be accounted for with 4DCT-based motion models. When simulating tumor baseline shift and patient positioning errors of up to 5 mm, the average tumor localization error and the 95th percentile error in six datasets were 1.20 and 2.2 mm, respectively, for 4DCBCT-based motion models. 4DCT-based motion models applied to the same six datasets resulted in average tumor localization error and the 95th percentile error of 4.18 and 5.4 mm, respectively. Analysis of voxel-wise intensity differences was also conducted for all experiments. In summary, this study demonstrates the feasibility of 4DCBCT-based 3D fluoroscopic image generation in digital and physical phantoms, and shows the potential advantage of 4DCBCT-based 3D fluoroscopic image estimation when there are changes in anatomy between the time of 4DCT imaging and the time of treatment delivery. PMID:25905722
A Typological Approach to Translation of English and Chinese Motion Events
ERIC Educational Resources Information Center
Deng, Yu; Chen, Huifang
2012-01-01
English and Chinese are satellite-framed languages in which Manner is usually incorporated with Motion in the verb and Path is denoted by the satellite. Based on Talmy's theory of motion event and typology, the research probes into translation of English and Chinese motion events and finds that: (1) Translation of motion events in English and…
Spering, Miriam; Carrasco, Marisa
2012-01-01
Feature-based attention enhances visual processing and improves perception, even for visual features that we are not aware of. Does feature-based attention also modulate motor behavior in response to visual information that does or does not reach awareness? Here we compare the effect of feature-based attention on motion perception and smooth pursuit eye movements in response to moving dichoptic plaids–stimuli composed of two orthogonally-drifting gratings, presented separately to each eye–in human observers. Monocular adaptation to one grating prior to the presentation of both gratings renders the adapted grating perceptually weaker than the unadapted grating and decreases the level of awareness. Feature-based attention was directed to either the adapted or the unadapted grating’s motion direction or to both (neutral condition). We show that observers were better in detecting a speed change in the attended than the unattended motion direction, indicating that they had successfully attended to one grating. Speed change detection was also better when the change occurred in the unadapted than the adapted grating, indicating that the adapted grating was perceptually weaker. In neutral conditions, perception and pursuit in response to plaid motion were dissociated: While perception followed one grating’s motion direction almost exclusively (component motion), the eyes tracked the average of both gratings (pattern motion). In attention conditions, perception and pursuit were shifted towards the attended component. These results suggest that attention affects perception and pursuit similarly even though only the former reflects awareness. The eyes can track an attended feature even if observers do not perceive it. PMID:22649238
Spering, Miriam; Carrasco, Marisa
2012-05-30
Feature-based attention enhances visual processing and improves perception, even for visual features that we are not aware of. Does feature-based attention also modulate motor behavior in response to visual information that does or does not reach awareness? Here we compare the effect of feature-based attention on motion perception and smooth-pursuit eye movements in response to moving dichoptic plaids--stimuli composed of two orthogonally drifting gratings, presented separately to each eye--in human observers. Monocular adaptation to one grating before the presentation of both gratings renders the adapted grating perceptually weaker than the unadapted grating and decreases the level of awareness. Feature-based attention was directed to either the adapted or the unadapted grating's motion direction or to both (neutral condition). We show that observers were better at detecting a speed change in the attended than the unattended motion direction, indicating that they had successfully attended to one grating. Speed change detection was also better when the change occurred in the unadapted than the adapted grating, indicating that the adapted grating was perceptually weaker. In neutral conditions, perception and pursuit in response to plaid motion were dissociated: While perception followed one grating's motion direction almost exclusively (component motion), the eyes tracked the average of both gratings (pattern motion). In attention conditions, perception and pursuit were shifted toward the attended component. These results suggest that attention affects perception and pursuit similarly even though only the former reflects awareness. The eyes can track an attended feature even if observers do not perceive it.
NASA Astrophysics Data System (ADS)
Song, S. G.
2016-12-01
Simulation-based ground motion prediction approaches have several benefits over empirical ground motion prediction equations (GMPEs). For instance, full 3-component waveforms can be produced and site-specific hazard analysis is also possible. However, it is important to validate them against observed ground motion data to confirm their efficiency and validity before practical uses. There have been community efforts for these purposes, which are supported by the Broadband Platform (BBP) project at the Southern California Earthquake Center (SCEC). In the simulation-based ground motion prediction approaches, it is a critical element to prepare a possible range of scenario rupture models. I developed a pseudo-dynamic source model for Mw 6.5-7.0 by analyzing a number of dynamic rupture models, based on 1-point and 2-point statistics of earthquake source parameters (Song et al. 2014; Song 2016). In this study, the developed pseudo-dynamic source models were tested against observed ground motion data at the SCEC BBP, Ver 16.5. The validation was performed at two stages. At the first stage, simulated ground motions were validated against observed ground motion data for past events such as the 1992 Landers and 1994 Northridge, California, earthquakes. At the second stage, they were validated against the latest version of empirical GMPEs, i.e., NGA-West2. The validation results show that the simulated ground motions produce ground motion intensities compatible with observed ground motion data at both stages. The compatibility of the pseudo-dynamic source models with the omega-square spectral decay and the standard deviation of the simulated ground motion intensities are also discussed in the study
The 3D Human Motion Control Through Refined Video Gesture Annotation
NASA Astrophysics Data System (ADS)
Jin, Yohan; Suk, Myunghoon; Prabhakaran, B.
In the beginning of computer and video game industry, simple game controllers consisting of buttons and joysticks were employed, but recently game consoles are replacing joystick buttons with novel interfaces such as the remote controllers with motion sensing technology on the Nintendo Wii [1] Especially video-based human computer interaction (HCI) technique has been applied to games, and the representative game is 'Eyetoy' on the Sony PlayStation 2. Video-based HCI technique has great benefit to release players from the intractable game controller. Moreover, in order to communicate between humans and computers, video-based HCI is very crucial since it is intuitive, easy to get, and inexpensive. On the one hand, extracting semantic low-level features from video human motion data is still a major challenge. The level of accuracy is really dependent on each subject's characteristic and environmental noises. Of late, people have been using 3D motion-capture data for visualizing real human motions in 3D space (e.g, 'Tiger Woods' in EA Sports, 'Angelina Jolie' in Bear-Wolf movie) and analyzing motions for specific performance (e.g, 'golf swing' and 'walking'). 3D motion-capture system ('VICON') generates a matrix for each motion clip. Here, a column is corresponding to a human's sub-body part and row represents time frames of data capture. Thus, we can extract sub-body part's motion only by selecting specific columns. Different from low-level feature values of video human motion, 3D human motion-capture data matrix are not pixel values, but is closer to human level of semantics.
Klén, Riku; Noponen, Tommi; Koikkalainen, Juha; Lötjönen, Jyrki; Thielemans, Kris; Hoppela, Erika; Sipilä, Hannu; Teräs, Mika; Knuuti, Juhani
2016-09-01
Dual gating is a method of dividing the data of a cardiac PET scan into smaller bins according to the respiratory motion and the ECG of the patient. It reduces the undesirable motion artefacts in images, but produces several images for interpretation and decreases the quality of single images. By using motion-correction techniques, the motion artefacts in the dual-gated images can be corrected and the images can be combined into a single motion-free image with good statistics. The aim of the present study is to develop and evaluate motion-correction methods for cardiac PET studies. We have developed and compared two different methods: computed tomography (CT)/PET-based and CT-only methods. The methods were implemented and tested with a cardiac phantom and three patient datasets. In both methods, anatomical information of CT images is used to create models for the cardiac motion. In the patient study, the CT-only method reduced motion (measured as the centre of mass of the myocardium) on average 43%, increased the contrast-to-noise ratio on average 6.0% and reduced the target size on average 10%. Slightly better figures (51, 6.9 and 28%) were obtained with the CT/PET-based method. Even better results were obtained in the phantom study for both the CT-only method (57, 68 and 43%) and the CT/PET-based method (61, 74 and 52%). We conclude that using anatomical information of CT for motion correction of cardiac PET images, both respiratory and pulsatile motions can be corrected with good accuracy.
Neuroimaging Evidence for 2 Types of Plasticity in Association with Visual Perceptual Learning.
Shibata, Kazuhisa; Sasaki, Yuka; Kawato, Mitsuo; Watanabe, Takeo
2016-09-01
Visual perceptual learning (VPL) is long-term performance improvement as a result of perceptual experience. It is unclear whether VPL is associated with refinement in representations of the trained feature (feature-based plasticity), improvement in processing of the trained task (task-based plasticity), or both. Here, we provide empirical evidence that VPL of motion detection is associated with both types of plasticity which occur predominantly in different brain areas. Before and after training on a motion detection task, subjects' neural responses to the trained motion stimuli were measured using functional magnetic resonance imaging. In V3A, significant response changes after training were observed specifically to the trained motion stimulus but independently of whether subjects performed the trained task. This suggests that the response changes in V3A represent feature-based plasticity in VPL of motion detection. In V1 and the intraparietal sulcus, significant response changes were found only when subjects performed the trained task on the trained motion stimulus. This suggests that the response changes in these areas reflect task-based plasticity. These results collectively suggest that VPL of motion detection is associated with the 2 types of plasticity, which occur in different areas and therefore have separate mechanisms at least to some degree. © The Author 2016. Published by Oxford University Press.
NASA Technical Reports Server (NTRS)
Park, Brian Vandellyn
1993-01-01
The Neutral Body Posture experienced in microgravity creates a biomechanical equilibrium by enabling the internal forces within the body to find their own balance. A patented reclining chair based on this posture provides a minimal stress environment for interfacing with computer systems for extended periods. When the chair is mounted on a 3 or 6 axis motion platform, a generic motion simulator for simulated digital environments is created. The Personal Motion Platform provides motional feedback to the occupant in synchronization with their movements inside the digital world which enhances the simulation experience. Existing HMD based simulation systems can be integrated to the turnkey system. Future developments are discussed.
SU-G-BRA-03: PCA Based Imaging Angle Optimization for 2D Cine MRI Based Radiotherapy Guidance
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, T; Yue, N; Jabbour, S
2016-06-15
Purpose: To develop an imaging angle optimization methodology for orthogonal 2D cine MRI based radiotherapy guidance using Principal Component Analysis (PCA) of target motion retrieved from 4DCT. Methods: We retrospectively analyzed 4DCT of 6 patients with lung tumor. A radiation oncologist manually contoured the target volume at the maximal inhalation phase of the respiratory cycle. An object constrained deformable image registration (DIR) method has been developed to track the target motion along the respiration at ten phases. The motion of the center of the target mass has been analyzed using the PCA to find out the principal motion components thatmore » were uncorrelated with each other. Two orthogonal image planes for cineMRI have been determined using this method to minimize the through plane motion during MRI based radiotherapy guidance. Results: 3D target respiratory motion for all 6 patients has been efficiently retrieved from 4DCT. In this process, the object constrained DIR demonstrated satisfactory accuracy and efficiency to enable the automatic motion tracking for clinical application. The average motion amplitude in the AP, lateral, and longitudinal directions were 3.6mm (min: 1.6mm, max: 5.6mm), 1.7mm (min: 0.6mm, max: 2.7mm), and 5.6mm (min: 1.8mm, max: 16.1mm), respectively. Based on PCA, the optimal orthogonal imaging planes were determined for cineMRI. The average angular difference between the PCA determined imaging planes and the traditional AP and lateral imaging planes were 47 and 31 degrees, respectively. After optimization, the average amplitude of through plane motion reduced from 3.6mm in AP images to 2.5mm (min:1.3mm, max:3.9mm); and from 1.7mm in lateral images to 0.6mm (min: 0.2mm, max:1.5mm), while the principal in plane motion amplitude increased from 5.6mm to 6.5mm (min: 2.8mm, max: 17mm). Conclusion: DIR and PCA can be used to optimize the orthogonal image planes of cineMRI to minimize the through plane motion during radiotherapy guidance.« less
A high bandwidth three-axis out-of-plane motion measurement system based on optical beam deflection
NASA Astrophysics Data System (ADS)
Piyush, P.; Giridhar, M. S.; Jayanth, G. R.
2018-03-01
Multi-axis measurement of motion is indispensable for characterization of dynamic systems and control of motion stages. This paper presents an optical beam deflection-based measurement system to simultaneously measure three-axis out-of-plane motion of both micro- and macro-scale targets. Novel strategies are proposed to calibrate the sensitivities of the measurement system. Subsequently the measurement system is experimentally realized and calibrated. The system is employed to characterize coupled linear and angular motion of a piezo-actuated stage. The measured motion is shown to be in agreement with theoretical expectation. Next, the high bandwidth of the measurement system has been showcased by utilizing it to measure coupled two-axis transient motion of a Radio Frequency Micro-Electro-Mechanical System switch with a rise time of about 60 μs. Finally, the ability of the system to measure out-of-plane angular motion about the second axis has been demonstrated by measuring the deformation of a micro-cantilever beam.
Dosimetric evaluation of intrafractional tumor motion by means of a robot driven phantom
DOE Office of Scientific and Technical Information (OSTI.GOV)
Richter, Anne; Wilbert, Juergen; Flentje, Michael
2011-10-15
Purpose: The aim of the work was to investigate the influence of intrafractional tumor motion to the accumulated (absorbed) dose. The accumulated dose was determined by means of calculations and measurements with a robot driven motion phantom. Methods: Different motion scenarios and compensation techniques were realized in a phantom study to investigate the influence of motion on image acquisition, dose calculation, and dose measurement. The influence of motion on the accumulated dose was calculated by employing two methods (a model based and a voxel based method). Results: Tumor motion resulted in a blurring of steep dose gradients and a reductionmore » of dose at the periphery of the target. A systematic variation of motion parameters allowed the determination of the main influence parameters on the accumulated dose. The key parameters with the greatest influence on dose were the mean amplitude and the pattern of motion. Investigations on necessary safety margins to compensate for dose reduction have shown that smaller safety margins are sufficient, if the developed concept with optimized margins (OPT concept) was used instead of the standard internal target volume (ITV) concept. Both calculation methods were a reasonable approximation of the measured dose with the voxel based method being in better agreement with the measurements. Conclusions: Further evaluation of available systems and algorithms for dose accumulation are needed to create guidelines for the verification of the accumulated dose.« less
On Integral Invariants for Effective 3-D Motion Trajectory Matching and Recognition.
Shao, Zhanpeng; Li, Youfu
2016-02-01
Motion trajectories tracked from the motions of human, robots, and moving objects can provide an important clue for motion analysis, classification, and recognition. This paper defines some new integral invariants for a 3-D motion trajectory. Based on two typical kernel functions, we design two integral invariants, the distance and area integral invariants. The area integral invariants are estimated based on the blurred segment of noisy discrete curve to avoid the computation of high-order derivatives. Such integral invariants for a motion trajectory enjoy some desirable properties, such as computational locality, uniqueness of representation, and noise insensitivity. Moreover, our formulation allows the analysis of motion trajectories at a range of scales by varying the scale of kernel function. The features of motion trajectories can thus be perceived at multiscale levels in a coarse-to-fine manner. Finally, we define a distance function to measure the trajectory similarity to find similar trajectories. Through the experiments, we examine the robustness and effectiveness of the proposed integral invariants and find that they can capture the motion cues in trajectory matching and sign recognition satisfactorily.
Feasibility of Measuring Mean Vertical Motion for Estimating Advection. Chapter 6
NASA Technical Reports Server (NTRS)
Vickers, Dean; Mahrt, L.
2005-01-01
Numerous recent studies calculate horizontal and vertical advection terms for budget studies of net ecosystem exchange of carbon. One potential uncertainty in such studies is the estimate of mean vertical motion. This work addresses the reliability of vertical advection estimates by contrasting the vertical motion obtained from the standard practise of measuring the vertical velocity and applying a tilt correction, to the vertical motion calculated from measurements of the horizontal divergence of the flow using a network of towers. Results are compared for three different tilt correction methods. Estimates of mean vertical motion are sensitive to the choice of tilt correction method. The short-term mean (10 to 60 minutes) vertical motion based on the horizontal divergence is more realistic compared to the estimates derived from the standard practise. The divergence shows long-term mean (days to months) sinking motion at the site, apparently due to the surface roughness change. Because all the tilt correction methods rely on the assumption that the long-term mean vertical motion is zero for a given wind direction, they fail to reproduce the vertical motion based on the divergence.
Evaluation of a linear washout for simulator motion cue presentation during landing approach
NASA Technical Reports Server (NTRS)
Parrish, R. V.; Martin, D. J., Jr.
1975-01-01
The comparison of a fixed-base versus a five-degree-of-freedom motion base simulation of a 737 conventional take-off and landing (CTOL) aircraft performing instrument landing system (ILS) landing approaches was used to evaluate a linear motion washout technique. The fact that the pilots felt that the addition of motion increased the pilot workload and this increase was not reflected in the objective data results, indicates that motion cues, as presented, are not a contributing factor to root-mean-square (rms) performance during the landing approach task. Subjective results from standard maneuvering about straight-and-level flight for specific motion cue evaluation revealed that the longitudinal channels (pitch and surge) possibly the yaw channel produce acceptable motions. The roll cue representation, involving both roll and sway channels, was found to be inadequate for large roll inputs, as used for example, in turn entries.
Cache-Aware Asymptotically-Optimal Sampling-Based Motion Planning
Ichnowski, Jeffrey; Prins, Jan F.; Alterovitz, Ron
2014-01-01
We present CARRT* (Cache-Aware Rapidly Exploring Random Tree*), an asymptotically optimal sampling-based motion planner that significantly reduces motion planning computation time by effectively utilizing the cache memory hierarchy of modern central processing units (CPUs). CARRT* can account for the CPU’s cache size in a manner that keeps its working dataset in the cache. The motion planner progressively subdivides the robot’s configuration space into smaller regions as the number of configuration samples rises. By focusing configuration exploration in a region for periods of time, nearest neighbor searching is accelerated since the working dataset is small enough to fit in the cache. CARRT* also rewires the motion planning graph in a manner that complements the cache-aware subdivision strategy to more quickly refine the motion planning graph toward optimality. We demonstrate the performance benefit of our cache-aware motion planning approach for scenarios involving a point robot as well as the Rethink Robotics Baxter robot. PMID:25419474
Cache-Aware Asymptotically-Optimal Sampling-Based Motion Planning.
Ichnowski, Jeffrey; Prins, Jan F; Alterovitz, Ron
2014-05-01
We present CARRT* (Cache-Aware Rapidly Exploring Random Tree*), an asymptotically optimal sampling-based motion planner that significantly reduces motion planning computation time by effectively utilizing the cache memory hierarchy of modern central processing units (CPUs). CARRT* can account for the CPU's cache size in a manner that keeps its working dataset in the cache. The motion planner progressively subdivides the robot's configuration space into smaller regions as the number of configuration samples rises. By focusing configuration exploration in a region for periods of time, nearest neighbor searching is accelerated since the working dataset is small enough to fit in the cache. CARRT* also rewires the motion planning graph in a manner that complements the cache-aware subdivision strategy to more quickly refine the motion planning graph toward optimality. We demonstrate the performance benefit of our cache-aware motion planning approach for scenarios involving a point robot as well as the Rethink Robotics Baxter robot.
1988-11-17
NOTATION 17. COSATI CODES 18. SUBJECT TERMS (Continue on reverse if ntcestary and identify by block number) FIELD GROUP SUB-GROUP ,-.:image...ambiguity in the recognition of partially occluded objects. V 1 , t : ., , ’ -, L: \\ : _ 20. DISTRIBUTION/AVAILABILITY OF ABSTRACT 21. ABSTRACT...constraints involved in the problem. More information can be found in [ 1 ]. Motion-based segmentation. Edge detection algorithms based on visual motion
Integration of visual and motion cues for simulator requirements and ride quality investigation
NASA Technical Reports Server (NTRS)
Young, L. R.
1976-01-01
Practical tools which can extend the state of the art of moving base flight simulation for research and training are developed. Main approaches to this research effort include: (1) application of the vestibular model for perception of orientation based on motion cues: optimum simulator motion controls; and (2) visual cues in landing.
Federal Register 2010, 2011, 2012, 2013, 2014
2011-05-09
...) issued by the presiding administrative law judge (``ALJ'') granting a joint motion to terminate the above... Granting a Joint Motion To Terminate the Investigation Based on a Settlement Agreement and Consent Order... 31, 2011, Invacare and the respondents filed a joint motion to terminate the investigation based on a...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kurz, Christopher, E-mail: christopher.kurz@physik.uni-muenchen.de; Bauer, Julia; Unholtz, Daniel
2016-02-15
Purpose: Intrafractional organ motion imposes considerable challenges to scanned ion beam therapy and demands for a thorough verification of the applied treatment. At the Heidelberg Ion-Beam Therapy Center (HIT), the scanned ion beam delivery is verified by means of postirradiation positron-emission-tomography (PET) imaging. This work presents a first clinical evaluation of PET-based treatment monitoring in ion beam therapy under consideration of target motion. Methods: Three patients with mobile liver lesions underwent scanned carbon ion irradiation at HIT and postirradiation PET/CT (x-ray-computed-tomography) imaging with a commercial scanner. Respiratory motion was recorded during irradiation and subsequent image acquisition. This enabled a time-resolvedmore » (4D) calculation of the expected irradiation-induced activity pattern and, for one patient where an additional 4D CT was acquired at the PET/CT scanner after treatment, a motion-compensated PET image reconstruction. For the other patients, PET data were reconstructed statically. To verify the treatment, calculated prediction and reconstructed measurement were compared with a focus on the ion beam range. Results: Results in the current three patients suggest that for motion amplitudes in the order of 2 mm there is no benefit from incorporating respiratory motion information into PET-based treatment monitoring. For a target motion in the order of 10 mm, motion-related effects become more severe and a time-resolved modeling of the expected activity distribution can lead to an improved data interpretation if a sufficient number of true coincidences is detected. Benefits from motion-compensated PET image reconstruction could not be shown conclusively at the current stage. Conclusions: The feasibility of clinical PET-based treatment verification under consideration of organ motion has been shown for the first time. Improvements in noise-robust 4D PET image reconstruction are deemed necessary to enhance the clinical potential.« less
Effect of a Near Fault on the Seismic Response of a Base-Isolated Structure with a Soft Storey
NASA Astrophysics Data System (ADS)
Athamnia, B.; Ounis, A.; Abdeddaim, M.
2017-12-01
This study focuses on the soft-storey behavior of RC structures with lead core rubber bearing (LRB) isolation systems under near and far-fault motions. Under near-fault ground motions, seismic isolation devices might perform poorly because of large isolator displacements caused by large velocity and displacement pulses associated with such strong motions. In this study, four different structural models have been designed to study the effect of soft-storey behavior under near-fault and far-fault motions. The seismic analysis for isolated reinforced concrete buildings is carried out using a nonlinear time history analysis method. Inter-story drifts, absolute acceleration, displacement, base shear forces, hysteretic loops and the distribution of plastic hinges are examined as a result of the analysis. These results show that the performance of a base isolated RC structure is more affected by increasing the height of a story under nearfault motion than under far-fault motion.
Yubo Wang; Tatinati, Sivanagaraja; Liyu Huang; Kim Jeong Hong; Shafiq, Ghufran; Veluvolu, Kalyana C; Khong, Andy W H
2017-07-01
Extracranial robotic radiotherapy employs external markers and a correlation model to trace the tumor motion caused by the respiration. The real-time tracking of tumor motion however requires a prediction model to compensate the latencies induced by the software (image data acquisition and processing) and hardware (mechanical and kinematic) limitations of the treatment system. A new prediction algorithm based on local receptive fields extreme learning machines (pLRF-ELM) is proposed for respiratory motion prediction. All the existing respiratory motion prediction methods model the non-stationary respiratory motion traces directly to predict the future values. Unlike these existing methods, the pLRF-ELM performs prediction by modeling the higher-level features obtained by mapping the raw respiratory motion into the random feature space of ELM instead of directly modeling the raw respiratory motion. The developed method is evaluated using the dataset acquired from 31 patients for two horizons in-line with the latencies of treatment systems like CyberKnife. Results showed that pLRF-ELM is superior to that of existing prediction methods. Results further highlight that the abstracted higher-level features are suitable to approximate the nonlinear and non-stationary characteristics of respiratory motion for accurate prediction.
User-Independent Motion State Recognition Using Smartphone Sensors
Gu, Fuqiang; Kealy, Allison; Khoshelham, Kourosh; Shang, Jianga
2015-01-01
The recognition of locomotion activities (e.g., walking, running, still) is important for a wide range of applications like indoor positioning, navigation, location-based services, and health monitoring. Recently, there has been a growing interest in activity recognition using accelerometer data. However, when utilizing only acceleration-based features, it is difficult to differentiate varying vertical motion states from horizontal motion states especially when conducting user-independent classification. In this paper, we also make use of the newly emerging barometer built in modern smartphones, and propose a novel feature called pressure derivative from the barometer readings for user motion state recognition, which is proven to be effective for distinguishing vertical motion states and does not depend on specific users’ data. Seven types of motion states are defined and six commonly-used classifiers are compared. In addition, we utilize the motion state history and the characteristics of people’s motion to improve the classification accuracies of those classifiers. Experimental results show that by using the historical information and human’s motion characteristics, we can achieve user-independent motion state classification with an accuracy of up to 90.7%. In addition, we analyze the influence of the window size and smartphone pose on the accuracy. PMID:26690163
User-Independent Motion State Recognition Using Smartphone Sensors.
Gu, Fuqiang; Kealy, Allison; Khoshelham, Kourosh; Shang, Jianga
2015-12-04
The recognition of locomotion activities (e.g., walking, running, still) is important for a wide range of applications like indoor positioning, navigation, location-based services, and health monitoring. Recently, there has been a growing interest in activity recognition using accelerometer data. However, when utilizing only acceleration-based features, it is difficult to differentiate varying vertical motion states from horizontal motion states especially when conducting user-independent classification. In this paper, we also make use of the newly emerging barometer built in modern smartphones, and propose a novel feature called pressure derivative from the barometer readings for user motion state recognition, which is proven to be effective for distinguishing vertical motion states and does not depend on specific users' data. Seven types of motion states are defined and six commonly-used classifiers are compared. In addition, we utilize the motion state history and the characteristics of people's motion to improve the classification accuracies of those classifiers. Experimental results show that by using the historical information and human's motion characteristics, we can achieve user-independent motion state classification with an accuracy of up to 90.7%. In addition, we analyze the influence of the window size and smartphone pose on the accuracy.
Automatic motion correction of clinical shoulder MR images
NASA Astrophysics Data System (ADS)
Manduca, Armando; McGee, Kiaran P.; Welch, Edward B.; Felmlee, Joel P.; Ehman, Richard L.
1999-05-01
A technique for the automatic correction of motion artifacts in MR images was developed. The algorithm uses only the raw (complex) data from the MR scanner, and requires no knowledge of the patient motion during the acquisition. It operates by searching over the space of possible patient motions and determining the motion which, when used to correct the image, optimizes the image quality. The performance of this algorithm was tested in coronal images of the rotator cuff in a series of 144 patients. A four observer comparison of the autocorrelated images with the uncorrected images demonstrated that motion artifacts were significantly reduced in 48% of the cases. The improvements in image quality were similar to those achieved with a previously reported navigator echo-based adaptive motion correction. The results demonstrate that autocorrelation is a practical technique for retrospectively reducing motion artifacts in a demanding clinical MRI application. It achieves performance comparable to a navigator based correction technique, which is significant because autocorrection does not require an imaging sequence that has been modified to explicitly track motion during acquisition. The approach is flexible and should be readily extensible to other types of MR acquisitions that are corrupted by global motion.
NASA Astrophysics Data System (ADS)
Huang, Duruo; Du, Wenqi; Zhu, Hong
2017-10-01
In performance-based seismic design, ground-motion time histories are needed for analyzing dynamic responses of nonlinear structural systems. However, the number of ground-motion data at design level is often limited. In order to analyze seismic performance of structures, ground-motion time histories need to be either selected from recorded strong-motion database or numerically simulated using stochastic approaches. In this paper, a detailed procedure to select proper acceleration time histories from the Next Generation Attenuation (NGA) database for several cities in Taiwan is presented. Target response spectra are initially determined based on a local ground-motion prediction equation under representative deterministic seismic hazard analyses. Then several suites of ground motions are selected for these cities using the Design Ground Motion Library (DGML), a recently proposed interactive ground-motion selection tool. The selected time histories are representatives of the regional seismic hazard and should be beneficial to earthquake studies when comprehensive seismic hazard assessments and site investigations are unavailable. Note that this method is also applicable to site-specific motion selections with the target spectra near the ground surface considering the site effect.
Mukherjee, Joyeeta Mitra; Hutton, Brian F; Johnson, Karen L; Pretorius, P Hendrik; King, Michael A
2014-01-01
Motion estimation methods in single photon emission computed tomography (SPECT) can be classified into methods which depend on just the emission data (data-driven), or those that use some other source of information such as an external surrogate. The surrogate-based methods estimate the motion exhibited externally which may not correlate exactly with the movement of organs inside the body. The accuracy of data-driven strategies on the other hand is affected by the type and timing of motion occurrence during acquisition, the source distribution, and various degrading factors such as attenuation, scatter, and system spatial resolution. The goal of this paper is to investigate the performance of two data-driven motion estimation schemes based on the rigid-body registration of projections of motion-transformed source distributions to the acquired projection data for cardiac SPECT studies. Comparison is also made of six intensity based registration metrics to an external surrogate-based method. In the data-driven schemes, a partially reconstructed heart is used as the initial source distribution. The partially-reconstructed heart has inaccuracies due to limited angle artifacts resulting from using only a part of the SPECT projections acquired while the patient maintained the same pose. The performance of different cost functions in quantifying consistency with the SPECT projection data in the data-driven schemes was compared for clinically realistic patient motion occurring as discrete pose changes, one or two times during acquisition. The six intensity-based metrics studied were mean-squared difference (MSD), mutual information (MI), normalized mutual information (NMI), pattern intensity (PI), normalized cross-correlation (NCC) and entropy of the difference (EDI). Quantitative and qualitative analysis of the performance is reported using Monte-Carlo simulations of a realistic heart phantom including degradation factors such as attenuation, scatter and system spatial resolution. Further the visual appearance of motion-corrected images using data-driven motion estimates was compared to that obtained using the external motion-tracking system in patient studies. Pattern intensity and normalized mutual information cost functions were observed to have the best performance in terms of lowest average position error and stability with degradation of image quality of the partial reconstruction in simulations. In all patients, the visual quality of PI-based estimation was either significantly better or comparable to NMI-based estimation. Best visual quality was obtained with PI-based estimation in 1 of the 5 patient studies, and with external-surrogate based correction in 3 out of 5 patients. In the remaining patient study there was little motion and all methods yielded similar visual image quality. PMID:24107647
Motion compensation for cone-beam CT using Fourier consistency conditions
NASA Astrophysics Data System (ADS)
Berger, M.; Xia, Y.; Aichinger, W.; Mentl, K.; Unberath, M.; Aichert, A.; Riess, C.; Hornegger, J.; Fahrig, R.; Maier, A.
2017-09-01
In cone-beam CT, involuntary patient motion and inaccurate or irreproducible scanner motion substantially degrades image quality. To avoid artifacts this motion needs to be estimated and compensated during image reconstruction. In previous work we showed that Fourier consistency conditions (FCC) can be used in fan-beam CT to estimate motion in the sinogram domain. This work extends the FCC to 3\\text{D} cone-beam CT. We derive an efficient cost function to compensate for 3\\text{D} motion using 2\\text{D} detector translations. The extended FCC method have been tested with five translational motion patterns, using a challenging numerical phantom. We evaluated the root-mean-square-error and the structural-similarity-index between motion corrected and motion-free reconstructions. Additionally, we computed the mean-absolute-difference (MAD) between the estimated and the ground-truth motion. The practical applicability of the method is demonstrated by application to respiratory motion estimation in rotational angiography, but also to motion correction for weight-bearing imaging of knees. Where the latter makes use of a specifically modified FCC version which is robust to axial truncation. The results show a great reduction of motion artifacts. Accurate estimation results were achieved with a maximum MAD value of 708 μm and 1184 μm for motion along the vertical and horizontal detector direction, respectively. The image quality of reconstructions obtained with the proposed method is close to that of motion corrected reconstructions based on the ground-truth motion. Simulations using noise-free and noisy data demonstrate that FCC are robust to noise. Even high-frequency motion was accurately estimated leading to a considerable reduction of streaking artifacts. The method is purely image-based and therefore independent of any auxiliary data.
NASA Astrophysics Data System (ADS)
Wang, Dong; Zhao, Yang; Yang, Fangfang; Tsui, Kwok-Leung
2017-09-01
Brownian motion with adaptive drift has attracted much attention in prognostics because its first hitting time is highly relevant to remaining useful life prediction and it follows the inverse Gaussian distribution. Besides linear degradation modeling, nonlinear-drifted Brownian motion has been developed to model nonlinear degradation. Moreover, the first hitting time distribution of the nonlinear-drifted Brownian motion has been approximated by time-space transformation. In the previous studies, the drift coefficient is the only hidden state used in state space modeling of the nonlinear-drifted Brownian motion. Besides the drift coefficient, parameters of a nonlinear function used in the nonlinear-drifted Brownian motion should be treated as additional hidden states of state space modeling to make the nonlinear-drifted Brownian motion more flexible. In this paper, a prognostic method based on nonlinear-drifted Brownian motion with multiple hidden states is proposed and then it is applied to predict remaining useful life of rechargeable batteries. 26 sets of rechargeable battery degradation samples are analyzed to validate the effectiveness of the proposed prognostic method. Moreover, some comparisons with a standard particle filter based prognostic method, a spherical cubature particle filter based prognostic method and two classic Bayesian prognostic methods are conducted to highlight the superiority of the proposed prognostic method. Results show that the proposed prognostic method has lower average prediction errors than the particle filter based prognostic methods and the classic Bayesian prognostic methods for battery remaining useful life prediction.
Model Predictive Control Based Motion Drive Algorithm for a Driving Simulator
NASA Astrophysics Data System (ADS)
Rehmatullah, Faizan
In this research, we develop a model predictive control based motion drive algorithm for the driving simulator at Toronto Rehabilitation Institute. Motion drive algorithms exploit the limitations of the human vestibular system to formulate a perception of motion within the constrained workspace of a simulator. In the absence of visual cues, the human perception system is unable to distinguish between acceleration and the force of gravity. The motion drive algorithm determines control inputs to displace the simulator platform, and by using the resulting inertial forces and angular rates, creates the perception of motion. By using model predictive control, we can optimize the use of simulator workspace for every maneuver while simulating the vehicle perception. With the ability to handle nonlinear constraints, the model predictive control allows us to incorporate workspace limitations.
Model-based control strategies for systems with constraints of the program type
NASA Astrophysics Data System (ADS)
Jarzębowska, Elżbieta
2006-08-01
The paper presents a model-based tracking control strategy for constrained mechanical systems. Constraints we consider can be material and non-material ones referred to as program constraints. The program constraint equations represent tasks put upon system motions and they can be differential equations of orders higher than one or two, and be non-integrable. The tracking control strategy relies upon two dynamic models: a reference model, which is a dynamic model of a system with arbitrary order differential constraints and a dynamic control model. The reference model serves as a motion planner, which generates inputs to the dynamic control model. It is based upon a generalized program motion equations (GPME) method. The method enables to combine material and program constraints and merge them both into the motion equations. Lagrange's equations with multipliers are the peculiar case of the GPME, since they can be applied to systems with constraints of first orders. Our tracking strategy referred to as a model reference program motion tracking control strategy enables tracking of any program motion predefined by the program constraints. It extends the "trajectory tracking" to the "program motion tracking". We also demonstrate that our tracking strategy can be extended to a hybrid program motion/force tracking.
A Web-Based Video Digitizing System for the Study of Projectile Motion.
ERIC Educational Resources Information Center
Chow, John W.; Carlton, Les G.; Ekkekakis, Panteleimon; Hay, James G.
2000-01-01
Discusses advantages of a video-based, digitized image system for the study and analysis of projectile motion in the physics laboratory. Describes the implementation of a web-based digitized video system. (WRM)
Knowledge-Based Motion Control of AN Intelligent Mobile Autonomous System
NASA Astrophysics Data System (ADS)
Isik, Can
An Intelligent Mobile Autonomous System (IMAS), which is equipped with vision and low level sensors to cope with unknown obstacles, is modeled as a hierarchy of path planning and motion control. This dissertation concentrates on the lower level of this hierarchy (Pilot) with a knowledge-based controller. The basis of a theory of knowledge-based controllers is established, using the example of the Pilot level motion control of IMAS. In this context, the knowledge-based controller with a linguistic world concept is shown to be adequate for the minimum time control of an autonomous mobile robot motion. The Pilot level motion control of IMAS is approached in the framework of production systems. The three major components of the knowledge-based control that are included here are the hierarchies of the database, the rule base and the rule evaluator. The database, which is the representation of the state of the world, is organized as a semantic network, using a concept of minimal admissible vocabulary. The hierarchy of rule base is derived from the analytical formulation of minimum-time control of IMAS motion. The procedure introduced for rule derivation, which is called analytical model verbalization, utilizes the concept of causalities to describe the system behavior. A realistic analytical system model is developed and the minimum-time motion control in an obstacle strewn environment is decomposed to a hierarchy of motion planning and control. The conditions for the validity of the hierarchical problem decomposition are established, and the consistency of operation is maintained by detecting the long term conflicting decisions of the levels of the hierarchy. The imprecision in the world description is modeled using the theory of fuzzy sets. The method developed for the choice of the rule that prescribes the minimum-time motion control among the redundant set of applicable rules is explained and the usage of fuzzy set operators is justified. Also included in the dissertation are the description of the computer simulation of Pilot within the hierarchy of IMAS control and the simulated experiments that demonstrate the theoretical work.
A motion-constraint logic for moving-base simulators based on variable filter parameters
NASA Technical Reports Server (NTRS)
Miller, G. K., Jr.
1974-01-01
A motion-constraint logic for moving-base simulators has been developed that is a modification to the linear second-order filters generally employed in conventional constraints. In the modified constraint logic, the filter parameters are not constant but vary with the instantaneous motion-base position to increase the constraint as the system approaches the positional limits. With the modified constraint logic, accelerations larger than originally expected are limited while conventional linear filters would result in automatic shutdown of the motion base. In addition, the modified washout logic has frequency-response characteristics that are an improvement over conventional linear filters with braking for low-frequency pilot inputs. During simulated landing approaches of an externally blown flap short take-off and landing (STOL) transport using decoupled longitudinal controls, the pilots were unable to detect much difference between the modified constraint logic and the logic based on linear filters with braking.
NASA Astrophysics Data System (ADS)
Bhagat, Satish; Wijeyewickrema, Anil C.
2017-04-01
This paper reports on an investigation of the seismic response of base-isolated reinforced concrete buildings, which considers various isolation system parameters under bidirectional near-fault and far-fault motions. Three-dimensional models of 4-, 8-, and 12-story base-isolated buildings with nonlinear effects in the isolation system and the superstructure are investigated, and nonlinear response history analysis is carried out. The bounding values of isolation system properties that incorporate the aging effect of isolators are also taken into account, as is the current state of practice in the design and analysis of base-isolated buildings. The response indicators of the buildings are studied for near-fault and far-fault motions weight-scaled to represent the design earthquake (DE) level and the risk-targeted maximum considered earthquake (MCER) level. Results of the nonlinear response history analyses indicate no structural damage under DE-level motions for near-fault and far-fault motions and for MCER-level far-fault motions, whereas minor structural damage is observed under MCER-level near-fault motions. Results of the base-isolated buildings are compared with their fixed-base counterparts. Significant reduction of the superstructure response of the 12-story base-isolated building compared to the fixed-base condition indicates that base isolation can be effectively used in taller buildings to enhance performance. Additionally, the applicability of a rigid superstructure to predict the isolator displacement demand is also investigated. It is found that the isolator displacements can be estimated accurately using a rigid body model for the superstructure for the buildings considered.
NASA Technical Reports Server (NTRS)
Parrish, R. V.; Bowles, R. L.
1983-01-01
This paper addresses the issues of motion/visual cueing fidelity requirements for vortex encounters during simulated transport visual approaches and landings. Four simulator configurations were utilized to provide objective performance measures during simulated vortex penetrations, and subjective comments from pilots were collected. The configurations used were as follows: fixed base with visual degradation (delay), fixed base with no visual degradation, moving base with visual degradation (delay), and moving base with no visual degradation. The statistical comparisons of the objective measures and the subjective pilot opinions indicated that although both minimum visual delay and motion cueing are recommended for the vortex penetration task, the visual-scene delay characteristics were not as significant a fidelity factor as was the presence of motion cues. However, this indication was applicable to a restricted task, and to transport aircraft. Although they were statistically significant, the effects of visual delay and motion cueing on the touchdown-related measures were considered to be of no practical consequence.
Wasza, Jakob; Bauer, Sebastian; Hornegger, Joachim
2012-01-01
Over the last years, range imaging (RI) techniques have been proposed for patient positioning and respiration analysis in motion compensation. Yet, current RI based approaches for patient positioning employ rigid-body transformations, thus neglecting free-form deformations induced by respiratory motion. Furthermore, RI based respiration analysis relies on non-rigid registration techniques with run-times of several seconds. In this paper we propose a real-time framework based on RI to perform respiratory motion compensated positioning and non-rigid surface deformation estimation in a joint manner. The core of our method are pre-procedurally obtained 4-D shape priors that drive the intra-procedural alignment of the patient to the reference state, simultaneously yielding a rigid-body table transformation and a free-form deformation accounting for respiratory motion. We show that our method outperforms conventional alignment strategies by a factor of 3.0 and 2.3 in the rotation and translation accuracy, respectively. Using a GPU based implementation, we achieve run-times of 40 ms.
38 CFR 51.120 - Quality of care.
Code of Federal Regulations, 2010 CFR
2010-07-01
... as much normal bowel function as possible. (f) Range of motion. Based on the comprehensive assessment... without a limited range of motion does not experience reduction in range of motion unless the resident's clinical condition demonstrates that a reduction in range of motion is unavoidable; and (2) A resident with...
38 CFR 51.120 - Quality of care.
Code of Federal Regulations, 2011 CFR
2011-07-01
... as much normal bowel function as possible. (f) Range of motion. Based on the comprehensive assessment... without a limited range of motion does not experience reduction in range of motion unless the resident's clinical condition demonstrates that a reduction in range of motion is unavoidable; and (2) A resident with...
Boore, David M.
2000-01-01
A simple and powerful method for simulating ground motions is based on the assumption that the amplitude of ground motion at a site can be specified in a deterministic way, with a random phase spectrum modified such that the motion is distributed over a duration related to the earthquake magnitude and to distance from the source. This method of simulating ground motions often goes by the name "the stochastic method." It is particularly useful for simulating the higher-frequency ground motions of most interest to engineers, and it is widely used to predict ground motions for regions of the world in which recordings of motion from damaging earthquakes are not available. This simple method has been successful in matching a variety of ground-motion measures for earthquakes with seismic moments spanning more than 12 orders of magnitude. One of the essential characteristics of the method is that it distills what is known about the various factors affecting ground motions (source, path, and site) into simple functional forms that can be used to predict ground motions. SMSIM is a set of programs for simulating ground motions based on the stochastic method. This Open-File Report is a revision of an earlier report (Boore, 1996) describing a set of programs for simulating ground motions from earthquakes. The programs are based on modifications I have made to the stochastic method first introduced by Hanks and McGuire (1981). The report contains source codes, written in Fortran, and executables that can be used on a PC. Programs are included both for time-domain and for random vibration simulations. In addition, programs are included to produce Fourier amplitude spectra for the models used in the simulations and to convert shear velocity vs. depth into frequency-dependent amplification. The revision to the previous report is needed because the input and output files have changed significantly, and a number of new programs have been included in the set.
NASA Astrophysics Data System (ADS)
Dalguer, L. A.; Baumann, C.; Cauzzi, C.
2013-12-01
Empirical ground motion prediction in the very near-field and for large magnitudes is often based on extrapolation of ground motion prediction equations (GMPEs) outside the range where they are well constrained by recorded data. With empirical GMPEs it is also difficult to capture source-dominated ground motion patterns, such as the effects of velocity pulses induced by subshear and supershear rupture directivity, buried and surface-rupturing, hanging-wall and foot-wall, weak shallow layers, complex geometry faults and stress drop. A way to cope at least in part with these shortcomings is to augment the calibration datasets with synthetic ground motions. To this aim, physics-based dynamic rupture models - where the physical bases involved in the fault rupture are explicitly considered - appear to be a suitable approach to produce synthetic ground motions. In this contribution, we first perform an assessment of a database of synthetic ground motions generated by a suite of dynamic rupture simulations to verify compatibility of the peak ground amplitudes with current GMPEs. The synthetic data-set is composed by 360 earthquake scenarios with moment magnitudes in the range of 5.5-7, for three mechanisms of faulting (reverse, normal and strike-slip) and for both buried faults and surface rupturing faults. Second, we parameterise the synthetic dataset through a GMPE. For this purpose, we identify the basic functional forms by analyzing the variation of the synthetic peak ground motions and spectral ordinates as a function of different explanatory variables related to the earthquake source characteristics, in order to account for some of the source effects listed above. We argue that this study provides basic guidelines for the developments of future GMPEs including data from physics-based numerical simulations.
ERIC Educational Resources Information Center
Li, Kun-Hsien; Lou, Shi-Jer; Tsai, Huei-Yin; Shih, Ru-Chu
2012-01-01
This study aims to explore the effects of applying game-based learning to webcam motion sensor games for autistic students' sensory integration training for autistic students. The research participants were three autistic students aged from six to ten. Webcam camera as the research tool wad connected internet games to engage in motion sensor…
Statistical modeling of 4D respiratory lung motion using diffeomorphic image registration.
Ehrhardt, Jan; Werner, René; Schmidt-Richberg, Alexander; Handels, Heinz
2011-02-01
Modeling of respiratory motion has become increasingly important in various applications of medical imaging (e.g., radiation therapy of lung cancer). Current modeling approaches are usually confined to intra-patient registration of 3D image data representing the individual patient's anatomy at different breathing phases. We propose an approach to generate a mean motion model of the lung based on thoracic 4D computed tomography (CT) data of different patients to extend the motion modeling capabilities. Our modeling process consists of three steps: an intra-subject registration to generate subject-specific motion models, the generation of an average shape and intensity atlas of the lung as anatomical reference frame, and the registration of the subject-specific motion models to the atlas in order to build a statistical 4D mean motion model (4D-MMM). Furthermore, we present methods to adapt the 4D mean motion model to a patient-specific lung geometry. In all steps, a symmetric diffeomorphic nonlinear intensity-based registration method was employed. The Log-Euclidean framework was used to compute statistics on the diffeomorphic transformations. The presented methods are then used to build a mean motion model of respiratory lung motion using thoracic 4D CT data sets of 17 patients. We evaluate the model by applying it for estimating respiratory motion of ten lung cancer patients. The prediction is evaluated with respect to landmark and tumor motion, and the quantitative analysis results in a mean target registration error (TRE) of 3.3 ±1.6 mm if lung dynamics are not impaired by large lung tumors or other lung disorders (e.g., emphysema). With regard to lung tumor motion, we show that prediction accuracy is independent of tumor size and tumor motion amplitude in the considered data set. However, tumors adhering to non-lung structures degrade local lung dynamics significantly and the model-based prediction accuracy is lower in these cases. The statistical respiratory motion model is capable of providing valuable prior knowledge in many fields of applications. We present two examples of possible applications in radiation therapy and image guided diagnosis.
Boore, D.M.
2001-01-01
This article has the modest goal of comparing the ground motions recorded during the 1999 Chi-Chi, Taiwan, mainshock with predictions from four empirical-based equations commonly used for western North America; these empirical predictions are largely based on data from California. Comparisons are made for peak acceleration and 5%-damped response spectra at periods between 0.1 and 4 sec. The general finding is that the Chi-Chi ground motions are smaller than those predicted from the empirically based equations for periods less than about 1 sec by factors averaging about 0.4 but as small as 0.26 (depending on period, on which equation is used, and on whether the sites are assumed to be rock or soil). There is a trend for the observed motions to approach or even exceed the predicted motions for longer periods. Motions at similar distances (30-60 km) to the east and to the west of the fault differ dramatically at periods between about 2 and 20 sec: Long-duration wave trains are present on the motions to the west, and when normalized to similar amplitudes at short periods, the response spectra of the motions at the western stations are as much as five times larger than those of motions from eastern stations. The explanation for the difference is probably related to site and propagation effects; the western stations are on the Coastal Plain, whereas the eastern stations are at the foot of young and steep mountains, either in the relatively narrow Longitudinal Valley or along the eastern coast-the sediments underlying the eastern stations are probably shallower and have higher velocity than those under the western stations.
Scene-aware joint global and local homographic video coding
NASA Astrophysics Data System (ADS)
Peng, Xiulian; Xu, Jizheng; Sullivan, Gary J.
2016-09-01
Perspective motion is commonly represented in video content that is captured and compressed for various applications including cloud gaming, vehicle and aerial monitoring, etc. Existing approaches based on an eight-parameter homography motion model cannot deal with this efficiently, either due to low prediction accuracy or excessive bit rate overhead. In this paper, we consider the camera motion model and scene structure in such video content and propose a joint global and local homography motion coding approach for video with perspective motion. The camera motion is estimated by a computer vision approach, and camera intrinsic and extrinsic parameters are globally coded at the frame level. The scene is modeled as piece-wise planes, and three plane parameters are coded at the block level. Fast gradient-based approaches are employed to search for the plane parameters for each block region. In this way, improved prediction accuracy and low bit costs are achieved. Experimental results based on the HEVC test model show that up to 9.1% bit rate savings can be achieved (with equal PSNR quality) on test video content with perspective motion. Test sequences for the example applications showed a bit rate savings ranging from 3.7 to 9.1%.
Oguntosin, Victoria W; Mori, Yoshiki; Kim, Hyejong; Nasuto, Slawomir J; Kawamura, Sadao; Hayashi, Yoshikatsu
2017-01-01
We demonstrated the design, production, and functional properties of the Exoskeleton Actuated by the Soft Modules (EAsoftM). Integrating the 3D printed exoskeleton with passive joints to compensate gravity and with active joints to rotate the shoulder and elbow joints resulted in ultra-light system that could assist planar reaching motion by using the vision-based control law. The EAsoftM can support the reaching motion with compliance realized by the soft materials and pneumatic actuation. In addition, the vision-based control law has been proposed for the precise control over the target reaching motion within the millimeter scale. Aiming at rehabilitation exercise for individuals, typically soft actuators have been developed for relatively small motions, such as grasping motion, and one of the challenges has been to extend their use for a wider range reaching motion. The proposed EAsoftM presented one possible solution for this challenge by transmitting the torque effectively along the anatomically aligned with a human body exoskeleton. The proposed integrated systems will be an ideal solution for neurorehabilitation where affordable, wearable, and portable systems are required to be customized for individuals with specific motor impairments.
Oguntosin, Victoria W.; Mori, Yoshiki; Kim, Hyejong; Nasuto, Slawomir J.; Kawamura, Sadao; Hayashi, Yoshikatsu
2017-01-01
We demonstrated the design, production, and functional properties of the Exoskeleton Actuated by the Soft Modules (EAsoftM). Integrating the 3D printed exoskeleton with passive joints to compensate gravity and with active joints to rotate the shoulder and elbow joints resulted in ultra-light system that could assist planar reaching motion by using the vision-based control law. The EAsoftM can support the reaching motion with compliance realized by the soft materials and pneumatic actuation. In addition, the vision-based control law has been proposed for the precise control over the target reaching motion within the millimeter scale. Aiming at rehabilitation exercise for individuals, typically soft actuators have been developed for relatively small motions, such as grasping motion, and one of the challenges has been to extend their use for a wider range reaching motion. The proposed EAsoftM presented one possible solution for this challenge by transmitting the torque effectively along the anatomically aligned with a human body exoskeleton. The proposed integrated systems will be an ideal solution for neurorehabilitation where affordable, wearable, and portable systems are required to be customized for individuals with specific motor impairments. PMID:28736514
NASA Technical Reports Server (NTRS)
Sinacori, J. B.
1980-01-01
A conceptual design of a visual system for a rotorcraft flight simulator is presented. Also, drive logic elements for a coupled motion base for such a simulator are given. The design is the result of an assessment of many potential arrangements of electro-optical elements and is a concept considered feasible for the application. The motion drive elements represent an example logic for a coupled motion base and is essentially an appeal to the designers of such logic to combine their washout and braking functions.
Inertial navigation sensor integrated motion analysis for autonomous vehicle navigation
NASA Technical Reports Server (NTRS)
Roberts, Barry; Bhanu, Bir
1992-01-01
Recent work on INS integrated motion analysis is described. Results were obtained with a maximally passive system of obstacle detection (OD) for ground-based vehicles and rotorcraft. The OD approach involves motion analysis of imagery acquired by a passive sensor in the course of vehicle travel to generate range measurements to world points within the sensor FOV. INS data and scene analysis results are used to enhance interest point selection, the matching of the interest points, and the subsequent motion-based computations, tracking, and OD. The most important lesson learned from the research described here is that the incorporation of inertial data into the motion analysis program greatly improves the analysis and makes the process more robust.
Wittfoth, Matthias; Buck, Daniela; Fahle, Manfred; Herrmann, Manfred
2006-08-15
The present study aimed at characterizing the neural correlates of conflict resolution in two variations of the Simon effect. We introduced two different Simon tasks where subjects had to identify shapes on the basis of form-from-motion perception (FFMo) within a randomly moving dot field, while (1) motion direction (motion-based Simon task) or (2) stimulus location (location-based Simon task) had to be ignored. Behavioral data revealed that both types of Simon tasks induced highly significant interference effects. Using event-related fMRI, we could demonstrate that both tasks share a common cluster of activated brain regions during conflict resolution (pre-supplementary motor area (pre-SMA), superior parietal lobule (SPL), and cuneus) but also show task-specific activation patterns (left superior temporal cortex in the motion-based, and the left fusiform gyrus in the location-based Simon task). Although motion-based and location-based Simon tasks are conceptually very similar (Type 3 stimulus-response ensembles according to the taxonomy of [Kornblum, S., Stevens, G. (2002). Sequential effects of dimensional overlap: findings and issues. In: Prinz, W., Hommel., B. (Eds.), Common mechanism in perception and action. Oxford University Press, Oxford, pp. 9-54]) conflict resolution in both tasks results in the activation of different task-specific regions probably related to the different sources of task-irrelevant information. Furthermore, the present data give evidence those task-specific regions are most likely to detect the relationship between task-relevant and task-irrelevant information.
Wilms, M; Werner, R; Blendowski, M; Ortmüller, J; Handels, H
2014-01-01
A major problem associated with the irradiation of thoracic and abdominal tumors is respiratory motion. In clinical practice, motion compensation approaches are frequently steered by low-dimensional breathing signals (e.g., spirometry) and patient-specific correspondence models, which are used to estimate the sought internal motion given a signal measurement. Recently, the use of multidimensional signals derived from range images of the moving skin surface has been proposed to better account for complex motion patterns. In this work, a simulation study is carried out to investigate the motion estimation accuracy of such multidimensional signals and the influence of noise, the signal dimensionality, and different sampling patterns (points, lines, regions). A diffeomorphic correspondence modeling framework is employed to relate multidimensional breathing signals derived from simulated range images to internal motion patterns represented by diffeomorphic non-linear transformations. Furthermore, an automatic approach for the selection of optimal signal combinations/patterns within this framework is presented. This simulation study focuses on lung motion estimation and is based on 28 4D CT data sets. The results show that the use of multidimensional signals instead of one-dimensional signals significantly improves the motion estimation accuracy, which is, however, highly affected by noise. Only small differences exist between different multidimensional sampling patterns (lines and regions). Automatically determined optimal combinations of points and lines do not lead to accuracy improvements compared to results obtained by using all points or lines. Our results show the potential of multidimensional breathing signals derived from range images for the model-based estimation of respiratory motion in radiation therapy.
Baumer, Timothy G; Giles, Joshua W; Drake, Anne; Zauel, Roger; Bey, Michael J
2016-01-01
Measures of scapulothoracic motion are dependent on accurate imaging of the scapula and thorax. Advanced radiographic techniques can provide accurate measures of scapular motion, but the limited 3D imaging volume of these techniques often precludes measurement of thorax motion. To overcome this, a thorax coordinate system was defined based on the position of rib pairs and then compared to a conventional sternum/spine-based thorax coordinate system. Alignment of the rib-based coordinate system was dependent on the rib pairs used, with the rib3:rib4 pairing aligned to within 4.4 ± 2.1 deg of the conventional thorax coordinate system.
DOE Office of Scientific and Technical Information (OSTI.GOV)
O’Shea, Tuathan P., E-mail: tuathan.oshea@icr.ac.uk; Bamber, Jeffrey C.; Harris, Emma J.
Purpose: Ultrasound-based motion estimation is an expanding subfield of image-guided radiation therapy. Although ultrasound can detect tissue motion that is a fraction of a millimeter, its accuracy is variable. For controlling linear accelerator tracking and gating, ultrasound motion estimates must remain highly accurate throughout the imaging sequence. This study presents a temporal regularization method for correlation-based template matching which aims to improve the accuracy of motion estimates. Methods: Liver ultrasound sequences (15–23 Hz imaging rate, 2.5–5.5 min length) from ten healthy volunteers under free breathing were used. Anatomical features (blood vessels) in each sequence were manually annotated for comparison withmore » normalized cross-correlation based template matching. Five sequences from a Siemens Acuson™ scanner were used for algorithm development (training set). Results from incremental tracking (IT) were compared with a temporal regularization method, which included a highly specific similarity metric and state observer, known as the α–β filter/similarity threshold (ABST). A further five sequences from an Elekta Clarity™ system were used for validation, without alteration of the tracking algorithm (validation set). Results: Overall, the ABST method produced marked improvements in vessel tracking accuracy. For the training set, the mean and 95th percentile (95%) errors (defined as the difference from manual annotations) were 1.6 and 1.4 mm, respectively (compared to 6.2 and 9.1 mm, respectively, for IT). For each sequence, the use of the state observer leads to improvement in the 95% error. For the validation set, the mean and 95% errors for the ABST method were 0.8 and 1.5 mm, respectively. Conclusions: Ultrasound-based motion estimation has potential to monitor liver translation over long time periods with high accuracy. Nonrigid motion (strain) and the quality of the ultrasound data are likely to have an impact on tracking performance. A future study will investigate spatial uniformity of motion and its effect on the motion estimation errors.« less
Optimization of yttrium-90 PET for simultaneous PET/MR imaging: A phantom study
DOE Office of Scientific and Technical Information (OSTI.GOV)
Eldib, Mootaz
2016-08-15
Purpose: Positron emission tomography (PET) imaging of yttrium-90 in the liver post radioembolization has been shown useful for personalized dosimetry calculations and evaluation of extrahepatic deposition. The purpose of this study was to quantify the benefits of several MR-based data correction approaches offered by using a combined PET/MR system to improve Y-90 PET imaging. In particular, the feasibility of motion and partial volume corrections were investigated in a controlled phantom study. Methods: The ACR phantom was filled with an initial concentration of 8 GBq of Y-90 solution resulting in a contrast of 10:1 between the hot cylinders and the background.more » Y-90 PET motion correction through motion estimates from MR navigators was evaluated by using a custom-built motion stage that simulated realistic amplitudes of respiration-induced liver motion. Finally, the feasibility of an MR-based partial volume correction method was evaluated using a wavelet decomposition approach. Results: Motion resulted in a large (∼40%) loss of contrast recovery for the 8 mm cylinder in the phantom, but was corrected for after MR-based motion correction was applied. Partial volume correction improved contrast recovery by 13% for the 8 mm cylinder. Conclusions: MR-based data correction improves Y-90 PET imaging on simultaneous PET/MR systems. Assessment of these methods must be studied further in the clinical setting.« less
Two novel motion-based algorithms for surveillance video analysis on embedded platforms
NASA Astrophysics Data System (ADS)
Vijverberg, Julien A.; Loomans, Marijn J. H.; Koeleman, Cornelis J.; de With, Peter H. N.
2010-05-01
This paper proposes two novel motion-vector based techniques for target detection and target tracking in surveillance videos. The algorithms are designed to operate on a resource-constrained device, such as a surveillance camera, and to reuse the motion vectors generated by the video encoder. The first novel algorithm for target detection uses motion vectors to construct a consistent motion mask, which is combined with a simple background segmentation technique to obtain a segmentation mask. The second proposed algorithm aims at multi-target tracking and uses motion vectors to assign blocks to targets employing five features. The weights of these features are adapted based on the interaction between targets. These algorithms are combined in one complete analysis application. The performance of this application for target detection has been evaluated for the i-LIDS sterile zone dataset and achieves an F1-score of 0.40-0.69. The performance of the analysis algorithm for multi-target tracking has been evaluated using the CAVIAR dataset and achieves an MOTP of around 9.7 and MOTA of 0.17-0.25. On a selection of targets in videos from other datasets, the achieved MOTP and MOTA are 8.8-10.5 and 0.32-0.49 respectively. The execution time on a PC-based platform is 36 ms. This includes the 20 ms for generating motion vectors, which are also required by the video encoder.
TH-CD-207A-04: Optimized Respiratory Gating for Abnormal Breathers in Pancreatic SBRT
DOE Office of Scientific and Technical Information (OSTI.GOV)
Campbell, W; Miften, M; Schefter, T
Purpose: Pancreatic SBRT is uniquely challenging due to both the erratic/unstable motion of the pancreas and the close proximity of the radiosensitive small bowel. Respiratory gating can mitigate this effect, but the irregularity of motion severely affects traditional phase-based gating. The purpose of this study was to analyze real-time motion data of pancreatic tumors to optimize the efficacy and accuracy of respiratory gating, with the overall goal of enabling dose escalated pancreatic SBRT. Methods: Fifteen pancreatic SBRT patients received 30–33 Gy in 5 fractions on a Varian TrueBeam STx unit. Abdominal compression was used to reduce the amplitude of tumormore » motion, and daily cone-beam computed tomography (CBCT) scans were acquired prior to each treatment for target localization purposes. For this study, breathing data (phase and amplitude) were collected during each CBCT scan using Varian’s Real-Time Position Management system. An in-house template matching technique was used to track the superior-inferior motion of implanted fiducial markers in CBCT projection images. Using tumor motion and breathing data, phase-based or amplitude-based respiratory gating was simulated for all 75 fractions, targeting either end-exhalation or end-inhalation phases of breathing. Results: For the average patient, gating at end-exhalation offered the best reductions in effective motion for equal duty cycles. However, optimal central phase angle varied widely (range: 0–92%, mean±SD: 49±12%), and phase-based gating windows typically associated with end-exhalation (i.e., “30–70%”) were rarely ideal. Amplitude-based gating significantly outperformed phase-based gating, with average effective ranges for amplitude-based gating 25% lower than phase-based gating ranges (as much as 73% lower). Amplitude-based gating was consistently better suited to accommodate abnormal breathing patterns. For both phase-based and amplitude-based gating, end-exhalation provided significantly better results than end-inhalation. Conclusion: Amplitude-based gating reliably outperformed phase-based gating, and end-exhalation was more suitable than end-inhalation. These results will be used to guide future dose-escalation trials. Research funding provided by Varian Medical Systems to Miften and Jones.« less
Computational adaptive optics for broadband interferometric tomography of tissues and cells
NASA Astrophysics Data System (ADS)
Adie, Steven G.; Mulligan, Jeffrey A.
2016-03-01
Adaptive optics (AO) can shape aberrated optical wavefronts to physically restore the constructive interference needed for high-resolution imaging. With access to the complex optical field, however, many functions of optical hardware can be achieved computationally, including focusing and the compensation of optical aberrations to restore the constructive interference required for diffraction-limited imaging performance. Holography, which employs interferometric detection of the complex optical field, was developed based on this connection between hardware and computational image formation, although this link has only recently been exploited for 3D tomographic imaging in scattering biological tissues. This talk will present the underlying imaging science behind computational image formation with optical coherence tomography (OCT) -- a beam-scanned version of broadband digital holography. Analogous to hardware AO (HAO), we demonstrate computational adaptive optics (CAO) and optimization of the computed pupil correction in 'sensorless mode' (Zernike polynomial corrections with feedback from image metrics) or with the use of 'guide-stars' in the sample. We discuss the concept of an 'isotomic volume' as the volumetric extension of the 'isoplanatic patch' introduced in astronomical AO. Recent CAO results and ongoing work is highlighted to point to the potential biomedical impact of computed broadband interferometric tomography. We also discuss the advantages and disadvantages of HAO vs. CAO for the effective shaping of optical wavefronts, and highlight opportunities for hybrid approaches that synergistically combine the unique advantages of hardware and computational methods for rapid volumetric tomography with cellular resolution.
TU-F-17A-03: An Analytical Respiratory Perturbation Model for Lung Motion Prediction
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, G; Yuan, A; Wei, J
2014-06-15
Purpose: Breathing irregularity is common, causing unreliable prediction in tumor motion for correlation-based surrogates. Both tidal volume (TV) and breathing pattern (BP=ΔVthorax/TV, where TV=ΔVthorax+ΔVabdomen) affect lung motion in anterior-posterior and superior-inferior directions. We developed a novel respiratory motion perturbation (RMP) model in analytical form to account for changes in TV and BP in motion prediction from simulation to treatment. Methods: The RMP model is an analytical function of patient-specific anatomic and physiologic parameters. It contains a base-motion trajectory d(x,y,z) derived from a 4-dimensional computed tomography (4DCT) at simulation and a perturbation term Δd(ΔTV,ΔBP) accounting for deviation at treatment from simulation.more » The perturbation is dependent on tumor-specific location and patient-specific anatomy. Eleven patients with simulation and treatment 4DCT images were used to assess the RMP method in motion prediction from 4DCT1 to 4DCT2, and vice versa. For each patient, ten motion trajectories of corresponding points in the lower lobes were measured in both 4DCTs: one served as the base-motion trajectory and the other as the ground truth for comparison. In total, 220 motion trajectory predictions were assessed. The motion discrepancy between two 4DCTs for each patient served as a control. An established 5D motion model was used for comparison. Results: The average absolute error of RMP model prediction in superior-inferior direction is 1.6±1.8 mm, similar to 1.7±1.6 mm from the 5D model (p=0.98). Some uncertainty is associated with limited spatial resolution (2.5mm slice thickness) and temporal resolution (10-phases). Non-corrected motion discrepancy between two 4DCTs is 2.6±2.7mm, with the maximum of ±20mm, and correction is necessary (p=0.01). Conclusion: The analytical motion model predicts lung motion with accuracy similar to the 5D model. The analytical model is based on physical relationships, requires no training, and therefore is potentially more resilient to breathing irregularities. On-going investigation introduces airflow into the RMP model for improvement. This research is in part supported by NIH (U54CA137788/132378). AY would like to thank MSKCC summer medical student research program supported by National Cancer Institute and hosted by Department of Medical Physics at MSKCC.« less
Abouei, Elham; Lee, Anthony M D; Pahlevaninezhad, Hamid; Hohert, Geoffrey; Cua, Michelle; Lane, Pierre; Lam, Stephen; MacAulay, Calum
2018-01-01
We present a method for the correction of motion artifacts present in two- and three-dimensional in vivo endoscopic images produced by rotary-pullback catheters. This method can correct for cardiac/breathing-based motion artifacts and catheter-based motion artifacts such as nonuniform rotational distortion (NURD). This method assumes that en face tissue imaging contains slowly varying structures that are roughly parallel to the pullback axis. The method reduces motion artifacts using a dynamic time warping solution through a cost matrix that measures similarities between adjacent frames in en face images. We optimize and demonstrate the suitability of this method using a real and simulated NURD phantom and in vivo endoscopic pulmonary optical coherence tomography and autofluorescence images. Qualitative and quantitative evaluations of the method show an enhancement of the image quality. (2018) COPYRIGHT Society of Photo-Optical Instrumentation Engineers (SPIE).
Chen, Ting; Zhang, Miao; Jabbour, Salma; Wang, Hesheng; Barbee, David; Das, Indra J; Yue, Ning
2018-04-10
Through-plane motion introduces uncertainty in three-dimensional (3D) motion monitoring when using single-slice on-board imaging (OBI) modalities such as cine MRI. We propose a principal component analysis (PCA)-based framework to determine the optimal imaging plane to minimize the through-plane motion for single-slice imaging-based motion monitoring. Four-dimensional computed tomography (4DCT) images of eight thoracic cancer patients were retrospectively analyzed. The target volumes were manually delineated at different respiratory phases of 4DCT. We performed automated image registration to establish the 4D respiratory target motion trajectories for all patients. PCA was conducted using the motion information to define the three principal components of the respiratory motion trajectories. Two imaging planes were determined perpendicular to the second and third principal component, respectively, to avoid imaging with the primary principal component of the through-plane motion. Single-slice images were reconstructed from 4DCT in the PCA-derived orthogonal imaging planes and were compared against the traditional AP/Lateral image pairs on through-plane motion, residual error in motion monitoring, absolute motion amplitude error and the similarity between target segmentations at different phases. We evaluated the significance of the proposed motion monitoring improvement using paired t test analysis. The PCA-determined imaging planes had overall less through-plane motion compared against the AP/Lateral image pairs. For all patients, the average through-plane motion was 3.6 mm (range: 1.6-5.6 mm) for the AP view and 1.7 mm (range: 0.6-2.7 mm) for the Lateral view. With PCA optimization, the average through-plane motion was 2.5 mm (range: 1.3-3.9 mm) and 0.6 mm (range: 0.2-1.5 mm) for the two imaging planes, respectively. The absolute residual error of the reconstructed max-exhale-to-inhale motion averaged 0.7 mm (range: 0.4-1.3 mm, 95% CI: 0.4-1.1 mm) using optimized imaging planes, averaged 0.5 mm (range: 0.3-1.0 mm, 95% CI: 0.2-0.8 mm) using an imaging plane perpendicular to the minimal motion component only and averaged 1.3 mm (range: 0.4-2.8 mm, 95% CI: 0.4-2.3 mm) in AP/Lateral orthogonal image pairs. The root-mean-square error of reconstructed displacement was 0.8 mm for optimized imaging planes, 0.6 mm for imaging plane perpendicular to the minimal motion component only, and 1.6 mm for AP/Lateral orthogonal image pairs. When using the optimized imaging planes for motion monitoring, there was no significant absolute amplitude error of the reconstructed motion (P = 0.0988), while AP/Lateral images had significant error (P = 0.0097) with a paired t test. The average surface distance (ASD) between overlaid two-dimensional (2D) tumor segmentation at end-of-inhale and end-of-exhale for all eight patients was 0.6 ± 0.2 mm in optimized imaging planes and 1.4 ± 0.8 mm in AP/Lateral images. The Dice similarity coefficient (DSC) between overlaid 2D tumor segmentation at end-of-inhale and end-of-exhale for all eight patients was 0.96 ± 0.03 in optimized imaging planes and 0.89 ± 0.05 in AP/Lateral images. Both ASD (P = 0.034) and DSC (P = 0.022) were significantly improved in the optimized imaging planes. Motion monitoring using imaging planes determined by the proposed PCA-based framework had significantly improved performance. Single-slice image-based motion tracking can be used for clinical implementations such as MR image-guided radiation therapy (MR-IGRT). © 2018 American Association of Physicists in Medicine.
Robust object tacking based on self-adaptive search area
NASA Astrophysics Data System (ADS)
Dong, Taihang; Zhong, Sheng
2018-02-01
Discriminative correlation filter (DCF) based trackers have recently achieved excellent performance with great computational efficiency. However, DCF based trackers suffer boundary effects, which result in the unstable performance in challenging situations exhibiting fast motion. In this paper, we propose a novel method to mitigate this side-effect in DCF based trackers. We change the search area according to the prediction of target motion. When the object moves fast, broad search area could alleviate boundary effects and reserve the probability of locating object. When the object moves slowly, narrow search area could prevent effect of useless background information and improve computational efficiency to attain real-time performance. This strategy can impressively soothe boundary effects in situations exhibiting fast motion and motion blur, and it can be used in almost all DCF based trackers. The experiments on OTB benchmark show that the proposed framework improves the performance compared with the baseline trackers.
The Shuttle Mission Simulator computer generated imagery
NASA Technical Reports Server (NTRS)
Henderson, T. H.
1984-01-01
Equipment available in the primary training facility for the Space Transportation System (STS) flight crews includes the Fixed Base Simulator, the Motion Base Simulator, the Spacelab Simulator, and the Guidance and Navigation Simulator. The Shuttle Mission Simulator (SMS) consists of the Fixed Base Simulator and the Motion Base Simulator. The SMS utilizes four visual Computer Generated Image (CGI) systems. The Motion Base Simulator has a forward crew station with six-degrees of freedom motion simulation. Operation of the Spacelab Simulator is planned for the spring of 1983. The Guidance and Navigation Simulator went into operation in 1982. Aspects of orbital visual simulation are discussed, taking into account the earth scene, payload simulation, the generation and display of 1079 stars, the simulation of sun glare, and Reaction Control System jet firing plumes. Attention is also given to landing site visual simulation, and night launch and landing simulation.
TH-EF-BRB-08: Robotic Motion Compensation for Radiation Therapy: A 6DOF Phantom Study
DOE Office of Scientific and Technical Information (OSTI.GOV)
Belcher, AH; Liu, X; Wiersma, R
Purpose: The high accuracy of frame-based stereotactic radiosurgery (SRS), which uses a rigid frame fixed to the patient’s skull, is offset by potential drawbacks of poor patient compliance and clinical workflow restrictions. Recent research into frameless SRS has so far resulted in reduced accuracy. In this study, we investigate the use of a novel 6 degree-of-freedom (6DOF) robotic head motion cancellation system that continuously detects and compensates for patient head motions during a SRS delivery. This approach has the potential to reduce invasiveness while still achieving accuracies better or equal to traditional frame-based SRS. Methods: A 6DOF parallel kinematics roboticsmore » stage was constructed, and controlled using an inverse kinematics-based motion compensation algorithm. A 6DOF stereoscopic infrared (IR) marker tracking system was used to monitor real-time motions at sub-millimeter and sub-degree levels. A novel 6DOF calibration technique was first applied to properly orient the camera coordinate frame to match that of the LINAC and robotic control frames. Simulated head motions were measured by the system, and the robotic stage responded to these 6DOF motions automatically, returning the reflective marker coordinate frame to its original position. Results: After the motions were introduced to the system in the phantom-based study, the robotic stage automatically and rapidly returned the phantom to LINAC isocenter. When errors exceeded the compensation lower threshold of 0.25 mm or 0.25 degrees, the system registered the 6DOF error and generated a cancellation trajectory. The system responded in less than 0.5 seconds and returned all axes to less than 0.1 mm and 0.1 degree after the 6DOF compensation was performed. Conclusion: The 6DOF real-time motion cancellation system was found to be effective at compensating for translational and rotational motions to current SRS requirements. This system can improve frameless SRS by automatically returning patients to isocenter with high 6DOF accuracy.« less
MRI-assisted PET motion correction for neurologic studies in an integrated MR-PET scanner.
Catana, Ciprian; Benner, Thomas; van der Kouwe, Andre; Byars, Larry; Hamm, Michael; Chonde, Daniel B; Michel, Christian J; El Fakhri, Georges; Schmand, Matthias; Sorensen, A Gregory
2011-01-01
Head motion is difficult to avoid in long PET studies, degrading the image quality and offsetting the benefit of using a high-resolution scanner. As a potential solution in an integrated MR-PET scanner, the simultaneously acquired MRI data can be used for motion tracking. In this work, a novel algorithm for data processing and rigid-body motion correction (MC) for the MRI-compatible BrainPET prototype scanner is described, and proof-of-principle phantom and human studies are presented. To account for motion, the PET prompt and random coincidences and sensitivity data for postnormalization were processed in the line-of-response (LOR) space according to the MRI-derived motion estimates. The processing time on the standard BrainPET workstation is approximately 16 s for each motion estimate. After rebinning in the sinogram space, the motion corrected data were summed, and the PET volume was reconstructed using the attenuation and scatter sinograms in the reference position. The accuracy of the MC algorithm was first tested using a Hoffman phantom. Next, human volunteer studies were performed, and motion estimates were obtained using 2 high-temporal-resolution MRI-based motion-tracking techniques. After accounting for the misalignment between the 2 scanners, perfectly coregistered MRI and PET volumes were reproducibly obtained. The MRI output gates inserted into the PET list-mode allow the temporal correlation of the 2 datasets within 0.2 ms. The Hoffman phantom volume reconstructed by processing the PET data in the LOR space was similar to the one obtained by processing the data using the standard methods and applying the MC in the image space, demonstrating the quantitative accuracy of the procedure. In human volunteer studies, motion estimates were obtained from echo planar imaging and cloverleaf navigator sequences every 3 s and 20 ms, respectively. Motion-deblurred PET images, with excellent delineation of specific brain structures, were obtained using these 2 MRI-based estimates. An MRI-based MC algorithm was implemented for an integrated MR-PET scanner. High-temporal-resolution MRI-derived motion estimates (obtained while simultaneously acquiring anatomic or functional MRI data) can be used for PET MC. An MRI-based MC method has the potential to improve PET image quality, increasing its reliability, reproducibility, and quantitative accuracy, and to benefit many neurologic applications.
Physics-Based Hazard Assessment for Critical Structures Near Large Earthquake Sources
NASA Astrophysics Data System (ADS)
Hutchings, L.; Mert, A.; Fahjan, Y.; Novikova, T.; Golara, A.; Miah, M.; Fergany, E.; Foxall, W.
2017-09-01
We argue that for critical structures near large earthquake sources: (1) the ergodic assumption, recent history, and simplified descriptions of the hazard are not appropriate to rely on for earthquake ground motion prediction and can lead to a mis-estimation of the hazard and risk to structures; (2) a physics-based approach can address these issues; (3) a physics-based source model must be provided to generate realistic phasing effects from finite rupture and model near-source ground motion correctly; (4) wave propagations and site response should be site specific; (5) a much wider search of possible sources of ground motion can be achieved computationally with a physics-based approach; (6) unless one utilizes a physics-based approach, the hazard and risk to structures has unknown uncertainties; (7) uncertainties can be reduced with a physics-based approach, but not with an ergodic approach; (8) computational power and computer codes have advanced to the point that risk to structures can be calculated directly from source and site-specific ground motions. Spanning the variability of potential ground motion in a predictive situation is especially difficult for near-source areas, but that is the distance at which the hazard is the greatest. The basis of a "physical-based" approach is ground-motion syntheses derived from physics and an understanding of the earthquake process. This is an overview paper and results from previous studies are used to make the case for these conclusions. Our premise is that 50 years of strong motion records is insufficient to capture all possible ranges of site and propagation path conditions, rupture processes, and spatial geometric relationships between source and site. Predicting future earthquake scenarios is necessary; models that have little or no physical basis but have been tested and adjusted to fit available observations can only "predict" what happened in the past, which should be considered description as opposed to prediction. We have developed a methodology for synthesizing physics-based broadband ground motion that incorporates the effects of realistic earthquake rupture along specific faults and the actual geology between the source and site.
ERIC Educational Resources Information Center
Grable-Wallace, Lisa; And Others
1989-01-01
Evaluates 5 courseware packages covering the topics of simple harmonic motion, 7 packages for wave motion, and 10 packages for sound. Discusses the price range, sub-topics, program type, interaction, time, calculus required, graphics, and comments of each courseware. Selects several packages based on the criteria. (YP)
Software for Project-Based Learning of Robot Motion Planning
ERIC Educational Resources Information Center
Moll, Mark; Bordeaux, Janice; Kavraki, Lydia E.
2013-01-01
Motion planning is a core problem in robotics concerned with finding feasible paths for a given robot. Motion planning algorithms perform a search in the high-dimensional continuous space of robot configurations and exemplify many of the core algorithmic concepts of search algorithms and associated data structures. Motion planning algorithms can…
Robotic Prostate Biopsy in Closed MRI Scanner
2009-02-01
radioactive seeds or diagnosis by harvesting tissue samples inside the mag- net bore, under remote control of the physician without mov- ing the patient out...and allows fast removal for reloading brachytherapy needles or col- lecting harvested biopsy tissue. The primary actuated motions of the robot...include two prismatic motions and two rotational motions for aligning the needle axis. In addition to these base motions, application-specific motions are
Master of Puppets: An Animation-by-Demonstration Computer Puppetry Authoring Framework
NASA Astrophysics Data System (ADS)
Cui, Yaoyuan; Mousas, Christos
2018-03-01
This paper presents Master of Puppets (MOP), an animation-by-demonstration framework that allows users to control the motion of virtual characters (puppets) in real time. In the first step, the user is asked to perform the necessary actions that correspond to the character's motions. The user's actions are recorded, and a hidden Markov model is used to learn the temporal profile of the actions. During the runtime of the framework, the user controls the motions of the virtual character based on the specified activities. The advantage of the MOP framework is that it recognizes and follows the progress of the user's actions in real time. Based on the forward algorithm, the method predicts the evolution of the user's actions, which corresponds to the evolution of the character's motion. This method treats characters as puppets that can perform only one motion at a time. This means that combinations of motion segments (motion synthesis), as well as the interpolation of individual motion sequences, are not provided as functionalities. By implementing the framework and presenting several computer puppetry scenarios, its efficiency and flexibility in animating virtual characters is demonstrated.
Gleeson, Fergus V.; Brady, Michael; Schnabel, Julia A.
2018-01-01
Abstract. Deformable image registration, a key component of motion correction in medical imaging, needs to be efficient and provides plausible spatial transformations that reliably approximate biological aspects of complex human organ motion. Standard approaches, such as Demons registration, mostly use Gaussian regularization for organ motion, which, though computationally efficient, rule out their application to intrinsically more complex organ motions, such as sliding interfaces. We propose regularization of motion based on supervoxels, which provides an integrated discontinuity preserving prior for motions, such as sliding. More precisely, we replace Gaussian smoothing by fast, structure-preserving, guided filtering to provide efficient, locally adaptive regularization of the estimated displacement field. We illustrate the approach by applying it to estimate sliding motions at lung and liver interfaces on challenging four-dimensional computed tomography (CT) and dynamic contrast-enhanced magnetic resonance imaging datasets. The results show that guided filter-based regularization improves the accuracy of lung and liver motion correction as compared to Gaussian smoothing. Furthermore, our framework achieves state-of-the-art results on a publicly available CT liver dataset. PMID:29662918
Papież, Bartłomiej W; Franklin, James M; Heinrich, Mattias P; Gleeson, Fergus V; Brady, Michael; Schnabel, Julia A
2018-04-01
Deformable image registration, a key component of motion correction in medical imaging, needs to be efficient and provides plausible spatial transformations that reliably approximate biological aspects of complex human organ motion. Standard approaches, such as Demons registration, mostly use Gaussian regularization for organ motion, which, though computationally efficient, rule out their application to intrinsically more complex organ motions, such as sliding interfaces. We propose regularization of motion based on supervoxels, which provides an integrated discontinuity preserving prior for motions, such as sliding. More precisely, we replace Gaussian smoothing by fast, structure-preserving, guided filtering to provide efficient, locally adaptive regularization of the estimated displacement field. We illustrate the approach by applying it to estimate sliding motions at lung and liver interfaces on challenging four-dimensional computed tomography (CT) and dynamic contrast-enhanced magnetic resonance imaging datasets. The results show that guided filter-based regularization improves the accuracy of lung and liver motion correction as compared to Gaussian smoothing. Furthermore, our framework achieves state-of-the-art results on a publicly available CT liver dataset.
Pengpen, T; Soleimani, M
2015-06-13
Cone beam computed tomography (CBCT) is an imaging modality that has been used in image-guided radiation therapy (IGRT). For applications such as lung radiation therapy, CBCT images are greatly affected by the motion artefacts. This is mainly due to low temporal resolution of CBCT. Recently, a dual modality of electrical impedance tomography (EIT) and CBCT has been proposed, in which the high temporal resolution EIT imaging system provides motion data to a motion-compensated algebraic reconstruction technique (ART)-based CBCT reconstruction software. High computational time associated with ART and indeed other variations of ART make it less practical for real applications. This paper develops a motion-compensated conjugate gradient least-squares (CGLS) algorithm for CBCT. A motion-compensated CGLS offers several advantages over ART-based methods, including possibilities for explicit regularization, rapid convergence and parallel computations. This paper for the first time demonstrates motion-compensated CBCT reconstruction using CGLS and reconstruction results are shown in limited data CBCT considering only a quarter of the full dataset. The proposed algorithm is tested using simulated motion data in generic motion-compensated CBCT as well as measured EIT data in dual EIT-CBCT imaging. © 2015 The Author(s) Published by the Royal Society. All rights reserved.
Video-Based Method of Quantifying Performance and Instrument Motion During Simulated Phonosurgery
Conroy, Ellen; Surender, Ketan; Geng, Zhixian; Chen, Ting; Dailey, Seth; Jiang, Jack
2015-01-01
Objectives/Hypothesis To investigate the use of the Video-Based Phonomicrosurgery Instrument Tracking System to collect instrument position data during simulated phonomicrosurgery and calculate motion metrics using these data. We used this system to determine if novice subject motion metrics improved over 1 week of training. Study Design Prospective cohort study. Methods Ten subjects performed simulated surgical tasks once per day for 5 days. Instrument position data were collected and used to compute motion metrics (path length, depth perception, and motion smoothness). Data were analyzed to determine if motion metrics improved with practice time. Task outcome was also determined each day, and relationships between task outcome and motion metrics were used to evaluate the validity of motion metrics as indicators of surgical performance. Results Significant decreases over time were observed for path length (P <.001), depth perception (P <.001), and task outcome (P <.001). No significant change was observed for motion smoothness. Significant relationships were observed between task outcome and path length (P <.001), depth perception (P <.001), and motion smoothness (P <.001). Conclusions Our system can estimate instrument trajectory and provide quantitative descriptions of surgical performance. It may be useful for evaluating phonomicrosurgery performance. Path length and depth perception may be particularly useful indicators. PMID:24737286
Modeling repetitive motions using structured light.
Xu, Yi; Aliaga, Daniel G
2010-01-01
Obtaining models of dynamic 3D objects is an important part of content generation for computer graphics. Numerous methods have been extended from static scenarios to model dynamic scenes. If the states or poses of the dynamic object repeat often during a sequence (but not necessarily periodically), we call such a repetitive motion. There are many objects, such as toys, machines, and humans, undergoing repetitive motions. Our key observation is that when a motion-state repeats, we can sample the scene under the same motion state again but using a different set of parameters; thus, providing more information of each motion state. This enables robustly acquiring dense 3D information difficult for objects with repetitive motions using only simple hardware. After the motion sequence, we group temporally disjoint observations of the same motion state together and produce a smooth space-time reconstruction of the scene. Effectively, the dynamic scene modeling problem is converted to a series of static scene reconstructions, which are easier to tackle. The varying sampling parameters can be, for example, structured-light patterns, illumination directions, and viewpoints resulting in different modeling techniques. Based on this observation, we present an image-based motion-state framework and demonstrate our paradigm using either a synchronized or an unsynchronized structured-light acquisition method.
Trained neurons-based motion detection in optical camera communications
NASA Astrophysics Data System (ADS)
Teli, Shivani; Cahyadi, Willy Anugrah; Chung, Yeon Ho
2018-04-01
A concept of trained neurons-based motion detection (TNMD) in optical camera communications (OCC) is proposed. The proposed TNMD is based on neurons present in a neural network that perform repetitive analysis in order to provide efficient and reliable motion detection in OCC. This efficient motion detection can be considered another functionality of OCC in addition to two traditional functionalities of illumination and communication. To verify the proposed TNMD, the experiments were conducted in an indoor static downlink OCC, where a mobile phone front camera is employed as the receiver and an 8 × 8 red, green, and blue (RGB) light-emitting diode array as the transmitter. The motion is detected by observing the user's finger movement in the form of centroid through the OCC link via a camera. Unlike conventional trained neurons approaches, the proposed TNMD is trained not with motion itself but with centroid data samples, thus providing more accurate detection and far less complex detection algorithm. The experiment results demonstrate that the TNMD can detect all considered motions accurately with acceptable bit error rate (BER) performances at a transmission distance of up to 175 cm. In addition, while the TNMD is performed, a maximum data rate of 3.759 kbps over the OCC link is obtained. The OCC with the proposed TNMD combined can be considered an efficient indoor OCC system that provides illumination, communication, and motion detection in a convenient smart home environment.
Model and parametric uncertainty in source-based kinematic models of earthquake ground motion
Hartzell, Stephen; Frankel, Arthur; Liu, Pengcheng; Zeng, Yuehua; Rahman, Shariftur
2011-01-01
Four independent ground-motion simulation codes are used to model the strong ground motion for three earthquakes: 1994 Mw 6.7 Northridge, 1989 Mw 6.9 Loma Prieta, and 1999 Mw 7.5 Izmit. These 12 sets of synthetics are used to make estimates of the variability in ground-motion predictions. In addition, ground-motion predictions over a grid of sites are used to estimate parametric uncertainty for changes in rupture velocity. We find that the combined model uncertainty and random variability of the simulations is in the same range as the variability of regional empirical ground-motion data sets. The majority of the standard deviations lie between 0.5 and 0.7 natural-log units for response spectra and 0.5 and 0.8 for Fourier spectra. The estimate of model epistemic uncertainty, based on the different model predictions, lies between 0.2 and 0.4, which is about one-half of the estimates for the standard deviation of the combined model uncertainty and random variability. Parametric uncertainty, based on variation of just the average rupture velocity, is shown to be consistent in amplitude with previous estimates, showing percentage changes in ground motion from 50% to 300% when rupture velocity changes from 2.5 to 2.9 km/s. In addition, there is some evidence that mean biases can be reduced by averaging ground-motion estimates from different methods.
Triboelectrification based motion sensor for human-machine interfacing.
Yang, Weiqing; Chen, Jun; Wen, Xiaonan; Jing, Qingshen; Yang, Jin; Su, Yuanjie; Zhu, Guang; Wu, Wenzuo; Wang, Zhong Lin
2014-05-28
We present triboelectrification based, flexible, reusable, and skin-friendly dry biopotential electrode arrays as motion sensors for tracking muscle motion and human-machine interfacing (HMI). The independently addressable, self-powered sensor arrays have been utilized to record the electric output signals as a mapping figure to accurately identify the degrees of freedom as well as directions and magnitude of muscle motions. A fast Fourier transform (FFT) technique was employed to analyse the frequency spectra of the obtained electric signals and thus to determine the motion angular velocities. Moreover, the motion sensor arrays produced a short-circuit current density up to 10.71 mA/m(2), and an open-circuit voltage as high as 42.6 V with a remarkable signal-to-noise ratio up to 1000, which enables the devices as sensors to accurately record and transform the motions of the human joints, such as elbow, knee, heel, and even fingers, and thus renders it a superior and unique invention in the field of HMI.
NASA Astrophysics Data System (ADS)
Zolfaghari, Abolfazl; Jeon, Seongkyul; Stepanick, Christopher K.; Lee, ChaBum
2017-06-01
This paper presents a novel method for measuring two-degree-of-freedom (DOF) motion of flexure-based nanopositioning systems based on optical knife-edge sensing (OKES) technology, which utilizes the interference of two superimposed waves: a geometrical wave from the primary source of light and a boundary diffraction wave from the secondary source. This technique allows for two-DOF motion measurement of the linear and pitch motions of nanopositioning systems. Two capacitive sensors (CSs) are used for a baseline comparison with the proposed sensor by simultaneously measuring the motions of the nanopositioning system. The experimental results show that the proposed sensor closely agrees with the fundamental linear motion of the CS. However, the two-DOF OKES technology was shown to be approximately three times more sensitive to the pitch motion than the CS. The discrepancy in the two sensor outputs is discussed in terms of measuring principle, linearity, bandwidth, control effectiveness, and resolution.
High-Frequency Replanning Under Uncertainty Using Parallel Sampling-Based Motion Planning
Sun, Wen; Patil, Sachin; Alterovitz, Ron
2015-01-01
As sampling-based motion planners become faster, they can be re-executed more frequently by a robot during task execution to react to uncertainty in robot motion, obstacle motion, sensing noise, and uncertainty in the robot’s kinematic model. We investigate and analyze high-frequency replanning (HFR), where, during each period, fast sampling-based motion planners are executed in parallel as the robot simultaneously executes the first action of the best motion plan from the previous period. We consider discrete-time systems with stochastic nonlinear (but linearizable) dynamics and observation models with noise drawn from zero mean Gaussian distributions. The objective is to maximize the probability of success (i.e., avoid collision with obstacles and reach the goal) or to minimize path length subject to a lower bound on the probability of success. We show that, as parallel computation power increases, HFR offers asymptotic optimality for these objectives during each period for goal-oriented problems. We then demonstrate the effectiveness of HFR for holonomic and nonholonomic robots including car-like vehicles and steerable medical needles. PMID:26279645
Human silhouette matching based on moment invariants
NASA Astrophysics Data System (ADS)
Sun, Yong-Chao; Qiu, Xian-Jie; Xia, Shi-Hong; Wang, Zhao-Qi
2005-07-01
This paper aims to apply the method of silhouette matching based on moment invariants to infer the human motion parameters from video sequences of single monocular uncalibrated camera. Currently, there are two ways of tracking human motion: Marker and Markerless. While a hybrid framework is introduced in this paper to recover the input video contents. A standard 3D motion database is built up by marker technique in advance. Given a video sequences, human silhouettes are extracted as well as the viewpoint information of the camera which would be utilized to project the standard 3D motion database onto the 2D one. Therefore, the video recovery problem is formulated as a matching issue of finding the most similar body pose in standard 2D library with the one in video image. The framework is applied to the special trampoline sport where we can obtain the complicated human motion parameters in the single camera video sequences, and a lot of experiments are demonstrated that this approach is feasible in the field of monocular video-based 3D motion reconstruction.
SU-E-J-163: A Biomechanical Lung Model for Respiratory Motion Study
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, X; Belcher, AH; Grelewicz, Z
2015-06-15
Purpose: This work presents a biomechanical model to investigate the complex respiratory motion for the lung tumor tracking in radiosurgery by computer simulation. Methods: The models include networked massspring-dampers to describe the tumor motion, different types of surrogate signals, and the force generated by the diaphragm. Each mass-springdamper has the same mechanical structure and each model can have different numbers of mass-spring-dampers. Both linear and nonlinear stiffness parameters were considered, and the damping ratio was tuned in a range so that the tumor motion was over-damped (no natural tumor oscillation occurs without force from the diaphragm). The simulation was runmore » by using ODE45 (ordinary differential equations by Runge-Kutta method) in MATLAB, and all time courses of motions and inputs (force) were generated and compared. Results: The curvature of the motion time courses around their peaks was sensitive to the damping ratio. Therefore, the damping ratio can be determined based on the clinical data of a high sampling rate. The peak values of different signals and the time the peaks occurred were compared, and it was found that the diaphragm force had a time lead over the tumor motion, and the lead time (0.1–0.4 seconds) depended on the distance between the tumor and the diaphragm. Conclusion: We reported a model based analysis approach for the spatial and temporal relation between the motion of the lung tumor and the surrogate signals. Due to the phase lead of the diaphragm in comparing with the lung tumor motion, the measurement of diaphragm motion (or its electromyography signal) can be used as a beam gating signal in radiosurgery, and it can also be an additional surrogate signal for better tumor motion tracking. The research is funded by the American Cancer Society (ACS) grant. The grant name is: Frameless SRS Based on Robotic Head Motion Cancellation. The grant number is: RSG-13-313-01-CCE.« less
Ramkumar, Prem N; Haeberle, Heather S; Navarro, Sergio M; Sultan, Assem A; Mont, Michael A; Ricchetti, Eric T; Schickendantz, Mark S; Iannotti, Joseph P
2018-03-07
Mobile technology offers the prospect of delivering high-value care with increased patient access and reduced costs. Advances in mobile health (mHealth) and telemedicine have been inhibited by the lack of interconnectivity between devices and software and inability to process consumer sensor data. The objective of this study was to preliminarily validate a motion-based machine learning software development kit (SDK) for the shoulder compared with a goniometer for 4 arcs of motion: (1) abduction, (2) forward flexion, (3) internal rotation, and (4) external rotation. A mobile application for the SDK was developed and "taught" 4 arcs of shoulder motion. Ten subjects without shoulder pain or prior shoulder surgery performed the arcs of motion for 5 repetitions. Each motion was measured by the SDK and compared with a physician-measured manual goniometer measurement. Angular differences between SDK and goniometer measurements were compared with univariate and power analyses. The comparison between the SDK and goniometer measurement detected a mean difference of less than 5° for all arcs of motion (P > .05), with a 94% chance of detecting a large effect size from a priori power analysis. Mean differences for the arcs of motion were: abduction, -3.7° ± 3.2°; forward flexion, -4.9° ± 2.5°; internal rotation, -2.4° ± 3.7°; and external rotation -2.6° ± 3.4°. The SDK has the potential to remotely substitute for a shoulder range of motion examination within 5° of goniometer measurements. An open-source motion-based SDK that can learn complex movements, including clinical shoulder range of motion, from consumer sensors offers promise for the future of mHealth, particularly in telemonitoring before and after orthopedic surgery. Copyright © 2018 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Elsevier Inc. All rights reserved.
Zanotti-Fregonara, Paolo; Liow, Jeih-San; Comtat, Claude; Zoghbi, Sami S; Zhang, Yi; Pike, Victor W; Fujita, Masahiro; Innis, Robert B
2012-09-01
Image-derived input function (IDIF) from carotid arteries is an elegant alternative to full arterial blood sampling for brain PET studies. However, a recent study using blood-free IDIFs found that this method is particularly vulnerable to patient motion. The present study used both simulated and clinical [11C](R)-rolipram data to assess the robustness of a blood-based IDIF method (a method that is ultimately normalized with blood samples) with regard to motion artifacts. The impact of motion on the accuracy of IDIF was first assessed with an analytical simulation of a high-resolution research tomograph using a numerical phantom of the human brain, equipped with internal carotids. Different degrees of translational (from 1 to 20 mm) and rotational (from 1 to 15°) motions were tested. The impact of motion was then tested on the high-resolution research tomograph dynamic scans of three healthy volunteers, reconstructed with and without an online motion correction system. IDIFs and Logan-distribution volume (VT) values derived from simulated and clinical scans with motion were compared with those obtained from the scans with motion correction. In the phantom scans, the difference in the area under the curve (AUC) for the carotid time-activity curves was up to 19% for rotations and up to 66% for translations compared with the motionless simulation. However, for the final IDIFs, which were fitted to blood samples, the AUC difference was 11% for rotations and 8% for translations. Logan-VT errors were always less than 10%, except for the maximum translation of 20 mm, in which the error was 18%. Errors in the clinical scans without motion correction appeared to be minor, with differences in AUC and Logan-VT always less than 10% compared with scans with motion correction. When a blood-based IDIF method is used for neurological PET studies, the motion of the patient affects IDIF estimation and kinetic modeling only minimally.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dhou, S; Cai, W; Hurwitz, M
2015-06-15
Purpose: Respiratory-correlated cone-beam CT (4DCBCT) images acquired immediately prior to treatment have the potential to represent patient motion patterns and anatomy during treatment, including both intra- and inter-fractional changes. We develop a method to generate patient-specific motion models based on 4DCBCT images acquired with existing clinical equipment and used to generate time varying volumetric images (3D fluoroscopic images) representing motion during treatment delivery. Methods: Motion models are derived by deformably registering each 4DCBCT phase to a reference phase, and performing principal component analysis (PCA) on the resulting displacement vector fields. 3D fluoroscopic images are estimated by optimizing the resulting PCAmore » coefficients iteratively through comparison of the cone-beam projections simulating kV treatment imaging and digitally reconstructed radiographs generated from the motion model. Patient and physical phantom datasets are used to evaluate the method in terms of tumor localization error compared to manually defined ground truth positions. Results: 4DCBCT-based motion models were derived and used to generate 3D fluoroscopic images at treatment time. For the patient datasets, the average tumor localization error and the 95th percentile were 1.57 and 3.13 respectively in subsets of four patient datasets. For the physical phantom datasets, the average tumor localization error and the 95th percentile were 1.14 and 2.78 respectively in two datasets. 4DCBCT motion models are shown to perform well in the context of generating 3D fluoroscopic images due to their ability to reproduce anatomical changes at treatment time. Conclusion: This study showed the feasibility of deriving 4DCBCT-based motion models and using them to generate 3D fluoroscopic images at treatment time in real clinical settings. 4DCBCT-based motion models were found to account for the 3D non-rigid motion of the patient anatomy during treatment and have the potential to localize tumor and other patient anatomical structures at treatment time even when inter-fractional changes occur. This project was supported, in part, through a Master Research Agreement with Varian Medical Systems, Inc., Palo Alto, CA. The project was also supported, in part, by Award Number R21CA156068 from the National Cancer Institute.« less
Identification of Piecewise Linear Uniform Motion Blur
NASA Astrophysics Data System (ADS)
Patanukhom, Karn; Nishihara, Akinori
A motion blur identification scheme is proposed for nonlinear uniform motion blurs approximated by piecewise linear models which consist of more than one linear motion component. The proposed scheme includes three modules that are a motion direction estimator, a motion length estimator and a motion combination selector. In order to identify the motion directions, the proposed scheme is based on a trial restoration by using directional forward ramp motion blurs along different directions and an analysis of directional information via frequency domain by using a Radon transform. Autocorrelation functions of image derivatives along several directions are employed for estimation of the motion lengths. A proper motion combination is identified by analyzing local autocorrelation functions of non-flat component of trial restored results. Experimental examples of simulated and real world blurred images are given to demonstrate a promising performance of the proposed scheme.
Head Motion Modeling for Human Behavior Analysis in Dyadic Interaction
Xiao, Bo; Georgiou, Panayiotis; Baucom, Brian; Narayanan, Shrikanth S.
2015-01-01
This paper presents a computational study of head motion in human interaction, notably of its role in conveying interlocutors’ behavioral characteristics. Head motion is physically complex and carries rich information; current modeling approaches based on visual signals, however, are still limited in their ability to adequately capture these important properties. Guided by the methodology of kinesics, we propose a data driven approach to identify typical head motion patterns. The approach follows the steps of first segmenting motion events, then parametrically representing the motion by linear predictive features, and finally generalizing the motion types using Gaussian mixture models. The proposed approach is experimentally validated using video recordings of communication sessions from real couples involved in a couples therapy study. In particular we use the head motion model to classify binarized expert judgments of the interactants’ specific behavioral characteristics where entrainment in head motion is hypothesized to play a role: Acceptance, Blame, Positive, and Negative behavior. We achieve accuracies in the range of 60% to 70% for the various experimental settings and conditions. In addition, we describe a measure of motion similarity between the interaction partners based on the proposed model. We show that the relative change of head motion similarity during the interaction significantly correlates with the expert judgments of the interactants’ behavioral characteristics. These findings demonstrate the effectiveness of the proposed head motion model, and underscore the promise of analyzing human behavioral characteristics through signal processing methods. PMID:26557047
Estimation of slipping organ motion by registration with direction-dependent regularization.
Schmidt-Richberg, Alexander; Werner, René; Handels, Heinz; Ehrhardt, Jan
2012-01-01
Accurate estimation of respiratory motion is essential for many applications in medical 4D imaging, for example for radiotherapy of thoracic and abdominal tumors. It is usually done by non-linear registration of image scans at different states of the breathing cycle but without further modeling of specific physiological motion properties. In this context, the accurate computation of respiration-driven lung motion is especially challenging because this organ is sliding along the surrounding tissue during the breathing cycle, leading to discontinuities in the motion field. Without considering this property in the registration model, common intensity-based algorithms cause incorrect estimation along the object boundaries. In this paper, we present a model for incorporating slipping motion in image registration. Extending the common diffusion registration by distinguishing between normal- and tangential-directed motion, we are able to estimate slipping motion at the organ boundaries while preventing gaps and ensuring smooth motion fields inside and outside. We further present an algorithm for a fully automatic detection of discontinuities in the motion field, which does not rely on a prior segmentation of the organ. We evaluate the approach for the estimation of lung motion based on 23 inspiration/expiration pairs of thoracic CT images. The results show a visually more plausible motion estimation. Moreover, the target registration error is quantified using manually defined landmarks and a significant improvement over the standard diffusion regularization is shown. Copyright © 2011 Elsevier B.V. All rights reserved.
Improved frame-based estimation of head motion in PET brain imaging.
Mukherjee, J M; Lindsay, C; Mukherjee, A; Olivier, P; Shao, L; King, M A; Licho, R
2016-05-01
Head motion during PET brain imaging can cause significant degradation of image quality. Several authors have proposed ways to compensate for PET brain motion to restore image quality and improve quantitation. Head restraints can reduce movement but are unreliable; thus the need for alternative strategies such as data-driven motion estimation or external motion tracking. Herein, the authors present a data-driven motion estimation method using a preprocessing technique that allows the usage of very short duration frames, thus reducing the intraframe motion problem commonly observed in the multiple frame acquisition method. The list mode data for PET acquisition is uniformly divided into 5-s frames and images are reconstructed without attenuation correction. Interframe motion is estimated using a 3D multiresolution registration algorithm and subsequently compensated for. For this study, the authors used 8 PET brain studies that used F-18 FDG as the tracer and contained minor or no initial motion. After reconstruction and prior to motion estimation, known motion was introduced to each frame to simulate head motion during a PET acquisition. To investigate the trade-off in motion estimation and compensation with respect to frames of different length, the authors summed 5-s frames accordingly to produce 10 and 60 s frames. Summed images generated from the motion-compensated reconstructed frames were then compared to the original PET image reconstruction without motion compensation. The authors found that our method is able to compensate for both gradual and step-like motions using frame times as short as 5 s with a spatial accuracy of 0.2 mm on average. Complex volunteer motion involving all six degrees of freedom was estimated with lower accuracy (0.3 mm on average) than the other types investigated. Preprocessing of 5-s images was necessary for successful image registration. Since their method utilizes nonattenuation corrected frames, it is not susceptible to motion introduced between CT and PET acquisitions. The authors have shown that they can estimate motion for frames with time intervals as short as 5 s using nonattenuation corrected reconstructed FDG PET brain images. Intraframe motion in 60-s frames causes degradation of accuracy to about 2 mm based on the motion type.
NASA Astrophysics Data System (ADS)
Tu, Rui; Wang, Rongjiang; Zhang, Yong; Walter, Thomas R.
2014-06-01
The description of static displacements associated with earthquakes is traditionally achieved using GPS, EDM or InSAR data. In addition, displacement histories can be derived from strong-motion records, allowing an improvement of geodetic networks at a high sampling rate and a better physical understanding of earthquake processes. Strong-motion records require a correction procedure appropriate for baseline shifts that may be caused by rotational motion, tilting and other instrumental effects. Common methods use an empirical bilinear correction on the velocity seismograms integrated from the strong-motion records. In this study, we overcome the weaknesses of an empirically based bilinear baseline correction scheme by using a net-based criterion to select the timing parameters. This idea is based on the physical principle that low-frequency seismic waveforms at neighbouring stations are coherent if the interstation distance is much smaller than the distance to the seismic source. For a dense strong-motion network, it is plausible to select the timing parameters so that the correlation coefficient between the velocity seismograms of two neighbouring stations is maximized after the baseline correction. We applied this new concept to the KiK-Net and K-Net strong-motion data available for the 2011 Mw 9.0 Tohoku earthquake. We compared the derived coseismic static displacement with high-quality GPS data, and with the results obtained using empirical methods. The results show that the proposed net-based approach is feasible and more robust than the individual empirical approaches. The outliers caused by unknown problems in the measurement system can be easily detected and quantified.
Reference geometry-based detection of (4D-)CT motion artifacts: a feasibility study
NASA Astrophysics Data System (ADS)
Werner, René; Gauer, Tobias
2015-03-01
Respiration-correlated computed tomography (4D or 3D+t CT) can be considered as standard of care in radiation therapy treatment planning for lung and liver lesions. The decision about an application of motion management devices and the estimation of patient-specific motion effects on the dose distribution relies on precise motion assessment in the planning 4D CT data { which is impeded in case of CT motion artifacts. The development of image-based/post-processing approaches to reduce motion artifacts would benefit from precise detection and localization of the artifacts. Simple slice-by-slice comparison of intensity values and threshold-based analysis of related metrics suffer from- depending on the threshold- high false-positive or -negative rates. In this work, we propose exploiting prior knowledge about `ideal' (= artifact free) reference geometries to stabilize metric-based artifact detection by transferring (multi-)atlas-based concepts to this specific task. Two variants are introduced and evaluated: (S1) analysis and comparison of warped atlas data obtained by repeated non-linear atlas-to-patient registration with different levels of regularization; (S2) direct analysis of vector field properties (divergence, curl magnitude) of the atlas-to-patient transformation. Feasibility of approaches (S1) and (S2) is evaluated by motion-phantom data and intra-subject experiments (four patients) as well as - adopting a multi-atlas strategy- inter-subject investigations (twelve patients involved). It is demonstrated that especially sorting/double structure artifacts can be precisely detected and localized by (S1). In contrast, (S2) suffers from high false positive rates.
Trouble with diffusion: Reassessing hillslope erosion laws with a particle-based model
NASA Astrophysics Data System (ADS)
Tucker, Gregory E.; Bradley, D. Nathan
2010-03-01
Many geomorphic systems involve a broad distribution of grain motion length scales, ranging from a few particle diameters to the length of an entire hillslope or stream. Studies of analogous physical systems have revealed that such broad motion distributions can have a significant impact on macroscale dynamics and can violate the assumptions behind standard, local gradient flux laws. Here, a simple particle-based model of sediment transport on a hillslope is used to study the relationship between grain motion statistics and macroscopic landform evolution. Surface grains are dislodged by random disturbance events with probabilities and distances that depend on local microtopography. Despite its simplicity, the particle model reproduces a surprisingly broad range of slope forms, including asymmetric degrading scarps and cinder cone profiles. At low slope angles the dynamics are diffusion like, with a short-range, thin-tailed hop length distribution, a parabolic, convex upward equilibrium slope form, and a linear relationship between transport rate and gradient. As slope angle steepens, the characteristic grain motion length scale begins to approach the length of the slope, leading to planar equilibrium forms that show a strongly nonlinear correlation between transport rate and gradient. These high-probability, long-distance motions violate the locality assumption embedded in many common gradient-based geomorphic transport laws. The example of a degrading scarp illustrates the potential for grain motion dynamics to vary in space and time as topography evolves. This characteristic renders models based on independent, stationary statistics inapplicable. An accompanying analytical framework based on treating grain motion as a survival process is briefly outlined.
On-Line Detection and Segmentation of Sports Motions Using a Wearable Sensor.
Kim, Woosuk; Kim, Myunggyu
2018-03-19
In sports motion analysis, observation is a prerequisite for understanding the quality of motions. This paper introduces a novel approach to detect and segment sports motions using a wearable sensor for supporting systematic observation. The main goal is, for convenient analysis, to automatically provide motion data, which are temporally classified according to the phase definition. For explicit segmentation, a motion model is defined as a sequence of sub-motions with boundary states. A sequence classifier based on deep neural networks is designed to detect sports motions from continuous sensor inputs. The evaluation on two types of motions (soccer kicking and two-handed ball throwing) verifies that the proposed method is successful for the accurate detection and segmentation of sports motions. By developing a sports motion analysis system using the motion model and the sequence classifier, we show that the proposed method is useful for observation of sports motions by automatically providing relevant motion data for analysis.
Unsupervised motion-based object segmentation refined by color
NASA Astrophysics Data System (ADS)
Piek, Matthijs C.; Braspenning, Ralph; Varekamp, Chris
2003-06-01
For various applications, such as data compression, structure from motion, medical imaging and video enhancement, there is a need for an algorithm that divides video sequences into independently moving objects. Because our focus is on video enhancement and structure from motion for consumer electronics, we strive for a low complexity solution. For still images, several approaches exist based on colour, but these lack in both speed and segmentation quality. For instance, colour-based watershed algorithms produce a so-called oversegmentation with many segments covering each single physical object. Other colour segmentation approaches exist which somehow limit the number of segments to reduce this oversegmentation problem. However, this often results in inaccurate edges or even missed objects. Most likely, colour is an inherently insufficient cue for real world object segmentation, because real world objects can display complex combinations of colours. For video sequences, however, an additional cue is available, namely the motion of objects. When different objects in a scene have different motion, the motion cue alone is often enough to reliably distinguish objects from one another and the background. However, because of the lack of sufficient resolution of efficient motion estimators, like the 3DRS block matcher, the resulting segmentation is not at pixel resolution, but at block resolution. Existing pixel resolution motion estimators are more sensitive to noise, suffer more from aperture problems or have less correspondence to the true motion of objects when compared to block-based approaches or are too computationally expensive. From its tendency to oversegmentation it is apparent that colour segmentation is particularly effective near edges of homogeneously coloured areas. On the other hand, block-based true motion estimation is particularly effective in heterogeneous areas, because heterogeneous areas improve the chance a block is unique and thus decrease the chance of the wrong position producing a good match. Consequently, a number of methods exist which combine motion and colour segmentation. These methods use colour segmentation as a base for the motion segmentation and estimation or perform an independent colour segmentation in parallel which is in some way combined with the motion segmentation. The presented method uses both techniques to complement each other by first segmenting on motion cues and then refining the segmentation with colour. To our knowledge few methods exist which adopt this approach. One example is te{meshrefine}. This method uses an irregular mesh, which hinders its efficient implementation in consumer electronics devices. Furthermore, the method produces a foreground/background segmentation, while our applications call for the segmentation of multiple objects. NEW METHOD As mentioned above we start with motion segmentation and refine the edges of this segmentation with a pixel resolution colour segmentation method afterwards. There are several reasons for this approach: + Motion segmentation does not produce the oversegmentation which colour segmentation methods normally produce, because objects are more likely to have colour discontinuities than motion discontinuities. In this way, the colour segmentation only has to be done at the edges of segments, confining the colour segmentation to a smaller part of the image. In such a part, it is more likely that the colour of an object is homogeneous. + This approach restricts the computationally expensive pixel resolution colour segmentation to a subset of the image. Together with the very efficient 3DRS motion estimation algorithm, this helps to reduce the computational complexity. + The motion cue alone is often enough to reliably distinguish objects from one another and the background. To obtain the motion vector fields, a variant of the 3DRS block-based motion estimator which analyses three frames of input was used. The 3DRS motion estimator is known for its ability to estimate motion vectors which closely resemble the true motion. BLOCK-BASED MOTION SEGMENTATION As mentioned above we start with a block-resolution segmentation based on motion vectors. The presented method is inspired by the well-known K-means segmentation method te{K-means}. Several other methods (e.g. te{kmeansc}) adapt K-means for connectedness by adding a weighted shape-error. This adds the additional difficulty of finding the correct weights for the shape-parameters. Also, these methods often bias one particular pre-defined shape. The presented method, which we call K-regions, encourages connectedness because only blocks at the edges of segments may be assigned to another segment. This constrains the segmentation method to such a degree that it allows the method to use least squares for the robust fitting of affine motion models for each segment. Contrary to te{parmkm}, the segmentation step still operates on vectors instead of model parameters. To make sure the segmentation is temporally consistent, the segmentation of the previous frame will be used as initialisation for every new frame. We also present a scheme which makes the algorithm independent of the initially chosen amount of segments. COLOUR-BASED INTRA-BLOCK SEGMENTATION The block resolution motion-based segmentation forms the starting point for the pixel resolution segmentation. The pixel resolution segmentation is obtained from the block resolution segmentation by reclassifying pixels only at the edges of clusters. We assume that an edge between two objects can be found in either one of two neighbouring blocks that belong to different clusters. This assumption allows us to do the pixel resolution segmentation on each pair of such neighbouring blocks separately. Because of the local nature of the segmentation, it largely avoids problems with heterogeneously coloured areas. Because no new segments are introduced in this step, it also does not suffer from oversegmentation problems. The presented method has no problems with bifurcations. For the pixel resolution segmentation itself we reclassify pixels such that we optimize an error norm which favour similarly coloured regions and straight edges. SEGMENTATION MEASURE To assist in the evaluation of the proposed algorithm we developed a quality metric. Because the problem does not have an exact specification, we decided to define a ground truth output which we find desirable for a given input. We define the measure for the segmentation quality as being how different the segmentation is from the ground truth. Our measure enables us to evaluate oversegmentation and undersegmentation seperately. Also, it allows us to evaluate which parts of a frame suffer from oversegmentation or undersegmentation. The proposed algorithm has been tested on several typical sequences. CONCLUSIONS In this abstract we presented a new video segmentation method which performs well in the segmentation of multiple independently moving foreground objects from each other and the background. It combines the strong points of both colour and motion segmentation in the way we expected. One of the weak points is that the segmentation method suffers from undersegmentation when adjacent objects display similar motion. In sequences with detailed backgrounds the segmentation will sometimes display noisy edges. Apart from these results, we think that some of the techniques, and in particular the K-regions technique, may be useful for other two-dimensional data segmentation problems.
Mode extraction on wind turbine blades via phase-based video motion estimation
NASA Astrophysics Data System (ADS)
Sarrafi, Aral; Poozesh, Peyman; Niezrecki, Christopher; Mao, Zhu
2017-04-01
In recent years, image processing techniques are being applied more often for structural dynamics identification, characterization, and structural health monitoring. Although as a non-contact and full-field measurement method, image processing still has a long way to go to outperform other conventional sensing instruments (i.e. accelerometers, strain gauges, laser vibrometers, etc.,). However, the technologies associated with image processing are developing rapidly and gaining more attention in a variety of engineering applications including structural dynamics identification and modal analysis. Among numerous motion estimation and image-processing methods, phase-based video motion estimation is considered as one of the most efficient methods regarding computation consumption and noise robustness. In this paper, phase-based video motion estimation is adopted for structural dynamics characterization on a 2.3-meter long Skystream wind turbine blade, and the modal parameters (natural frequencies, operating deflection shapes) are extracted. Phase-based video processing adopted in this paper provides reliable full-field 2-D motion information, which is beneficial for manufacturing certification and model updating at the design stage. The phase-based video motion estimation approach is demonstrated through processing data on a full-scale commercial structure (i.e. a wind turbine blade) with complex geometry and properties, and the results obtained have a good correlation with the modal parameters extracted from accelerometer measurements, especially for the first four bending modes, which have significant importance in blade characterization.
Motion-based prediction is sufficient to solve the aperture problem
Perrinet, Laurent U; Masson, Guillaume S
2012-01-01
In low-level sensory systems, it is still unclear how the noisy information collected locally by neurons may give rise to a coherent global percept. This is well demonstrated for the detection of motion in the aperture problem: as luminance of an elongated line is symmetrical along its axis, tangential velocity is ambiguous when measured locally. Here, we develop the hypothesis that motion-based predictive coding is sufficient to infer global motion. Our implementation is based on a context-dependent diffusion of a probabilistic representation of motion. We observe in simulations a progressive solution to the aperture problem similar to physiology and behavior. We demonstrate that this solution is the result of two underlying mechanisms. First, we demonstrate the formation of a tracking behavior favoring temporally coherent features independently of their texture. Second, we observe that incoherent features are explained away while coherent information diffuses progressively to the global scale. Most previous models included ad-hoc mechanisms such as end-stopped cells or a selection layer to track specific luminance-based features as necessary conditions to solve the aperture problem. Here, we have proved that motion-based predictive coding, as it is implemented in this functional model, is sufficient to solve the aperture problem. This solution may give insights in the role of prediction underlying a large class of sensory computations. PMID:22734489
Simulative design in macroscale for prospective application to micro-catheters.
Ha, Cheol Woo
2018-02-09
In this paper, a motion-transforming element is applied to the development of a new catheter device. The motion-transforming element structure allows a reduction of linear movement and converts linear movement to rotational movement. The simulative design of micro-catheters is based on a proposed structure called the Operating Mini Station (OMS). OMS is operated by movement of a motion-transforming element. A new motion-transforming element is designed using multiple links that are connected by hinged joints based on an elastic design. The design of the links and the hinges are optimized for precise and reliable movement of the motion-transforming element. Because of the elastic design, it is possible to realize a catheter that allows various movements in small spaces like capillaries.
Geometric Brownian Motion with Tempered Stable Waiting Times
NASA Astrophysics Data System (ADS)
Gajda, Janusz; Wyłomańska, Agnieszka
2012-08-01
One of the earliest system that was used to asset prices description is Black-Scholes model. It is based on geometric Brownian motion and was used as a tool for pricing various financial instruments. However, when it comes to data description, geometric Brownian motion is not capable to capture many properties of present financial markets. One can name here for instance periods of constant values. Therefore we propose an alternative approach based on subordinated tempered stable geometric Brownian motion which is a combination of the popular geometric Brownian motion and inverse tempered stable subordinator. In this paper we introduce the mentioned process and present its main properties. We propose also the estimation procedure and calibrate the analyzed system to real data.
Effects of motion base and g-seat cueing of simulator pilot performance
NASA Technical Reports Server (NTRS)
Ashworth, B. R.; Mckissick, B. T.; Parrish, R. V.
1984-01-01
In order to measure and analyze the effects of a motion plus g-seat cueing system, a manned-flight-simulation experiment was conducted utilizing a pursuit tracking task and an F-16 simulation model in the NASA Langley visual/motion simulator. This experiment provided the information necessary to determine whether motion and g-seat cues have an additive effect on the performance of this task. With respect to the lateral tracking error and roll-control stick force, the answer is affirmative. It is shown that presenting the two cues simultaneously caused significant reductions in lateral tracking error and that using the g-seat and motion base separately provided essentially equal reductions in the pilot's lateral tracking error.
High-level, but not low-level, motion perception is impaired in patients with schizophrenia.
Kandil, Farid I; Pedersen, Anya; Wehnes, Jana; Ohrmann, Patricia
2013-01-01
Smooth pursuit eye movements are compromised in patients with schizophrenia and their first-degree relatives. Although research has demonstrated that the motor components of smooth pursuit eye movements are intact, motion perception has been shown to be impaired. In particular, studies have consistently revealed deficits in performance on tasks specific to the high-order motion area V5 (middle temporal area, MT) in patients with schizophrenia. In contrast, data from low-level motion detectors in the primary visual cortex (V1) have been inconsistent. To differentiate between low-level and high-level visual motion processing, we applied a temporal-order judgment task for motion events and a motion-defined figure-ground segregation task using patients with schizophrenia and healthy controls. Successful judgments in both tasks rely on the same low-level motion detectors in the V1; however, the first task is further processed in the higher-order motion area MT in the magnocellular (dorsal) pathway, whereas the second task requires subsequent computations in the parvocellular (ventral) pathway in visual area V4 and the inferotemporal cortex (IT). These latter structures are supposed to be intact in schizophrenia. Patients with schizophrenia revealed a significantly impaired temporal resolution on the motion-based temporal-order judgment task but only mild impairment in the motion-based segregation task. These results imply that low-level motion detection in V1 is not, or is only slightly, compromised; furthermore, our data restrain the locus of the well-known deficit in motion detection to areas beyond the primary visual cortex.
Effect of motion inputs on the wear prediction of artificial hip joints
Liu, Feng; Fisher, John; Jin, Zhongmin
2013-01-01
Hip joint simulators have been largely used to assess the wear performance of joint implants. Due to the complexity of joint movement, the motion mechanism adopted in simulators varies. The motion condition is particularly important for ultra-high molecular weight polyethylene (UHMWPE) since polyethylene wear can be substantially increased by the bearing cross-shear motion. Computational wear modelling has been improved recently for the conventional UHMWPE used in total hip joint replacements. A new polyethylene wear law is an explicit function of the contact area of the bearing and the sliding distance, and the effect of multidirectional motion on wear has been quantified by a factor, cross-shear ratio. In this study, the full simulated walking cycle condition based on a walking measurement and two simplified motions, including the ISO standard motion and a simplified ProSim hip simulator motion, were considered as the inputs for wear modelling based on the improved wear model. Both the full simulation and simplified motions generated the comparable multidirectional motion required to reproduce the physiological wear of the bearing in vivo. The predicted volumetric wear of the ProSim simulator motion and the ISO motion conditions for the walking cycle were 13% and 4% lower, respectively, than that of the measured walking condition. The maximum linear wear depths were almost the same, and the areas of the wear depth distribution were 13% and 7% lower for the ProSim simulator and the ISO condition, respectively, compared with that of the measured walking cycle motion condition. PMID:25540472
NASA Astrophysics Data System (ADS)
Zhang, Chao; Zhang, Qian; Zheng, Chi; Qiu, Guoping
2018-04-01
Video foreground segmentation is one of the key problems in video processing. In this paper, we proposed a novel and fully unsupervised approach for foreground object co-localization and segmentation of unconstrained videos. We firstly compute both the actual edges and motion boundaries of the video frames, and then align them by their HOG feature maps. Then, by filling the occlusions generated by the aligned edges, we obtained more precise masks about the foreground object. Such motion-based masks could be derived as the motion-based likelihood. Moreover, the color-base likelihood is adopted for the segmentation process. Experimental Results show that our approach outperforms most of the State-of-the-art algorithms.
NASA Astrophysics Data System (ADS)
Chen, Yuan-Liu; Niu, Zengyuan; Matsuura, Daiki; Lee, Jung Chul; Shimizu, Yuki; Gao, Wei; Oh, Jeong Seok; Park, Chun Hong
2017-10-01
In this paper, a four-probe measurement system is implemented and verified for the carriage slide motion error measurement of a large-scale roll lathe used in hybrid manufacturing where a laser machining probe and a diamond cutting tool are placed on two sides of a roll workpiece for manufacturing. The motion error of the carriage slide of the roll lathe is composed of two straightness motion error components and two parallelism motion error components in the vertical and horizontal planes. Four displacement measurement probes, which are mounted on the carriage slide with respect to four opposing sides of the roll workpiece, are employed for the measurement. Firstly, based on the reversal technique, the four probes are moved by the carriage slide to scan the roll workpiece before and after a 180-degree rotation of the roll workpiece. Taking into consideration the fact that the machining accuracy of the lathe is influenced by not only the carriage slide motion error but also the gravity deformation of the large-scale roll workpiece due to its heavy weight, the vertical motion error is thus characterized relating to the deformed axis of the roll workpiece. The horizontal straightness motion error can also be synchronously obtained based on the reversal technique. In addition, based on an error separation algorithm, the vertical and horizontal parallelism motion error components are identified by scanning the rotating roll workpiece at the start and the end positions of the carriage slide, respectively. The feasibility and reliability of the proposed motion error measurement system are demonstrated by the experimental results and the measurement uncertainty analysis.
A Programmable System for Motion Control
NASA Technical Reports Server (NTRS)
Nowlin, Brent C.
2003-01-01
The need for improved flow measurements in the flow path of aeronautics testing facilities has led the NASA Glenn Research Center to develop a new motion control system. The new system is programmable, offering a flexibility unheard of in previous systems. The motion control system is PLC-based, which leads to highly accurate positioning ability, as well as reliability. The user interface is a software-based HMI package, which also adds flexibility to the overall system. The system also has the ability to create and execute motion profiles. This paper discusses the system's operation, control implementation, and experiences.
User manual for the NTS ground motion data base retrieval program: ntsgm
DOE Office of Scientific and Technical Information (OSTI.GOV)
App, F.N.; Tunnell, T.W.
1994-05-01
The NTS (Nevada Test Site) Ground Motion Data Base is composed of strong motion data recorded during the normal execution of the US underground test program. It contains surface, subsurface, and structure motion data as digitized waveforms. Currently the data base contains information from 148 underground explosions. This represents about 4,200 measurements and nearly 12,000 individual digitized waveforms. Most of the data was acquired by Los Alamos National Laboratory (LANL) in connection with LANL sponsored underground tests. Some was acquired by Los Alamos on tests conducted by the Defense Nuclear Agency (DNA) and Lawrence Livermore National Laboratory (LLNL), and theremore » are some measurements that were acquired by the other test sponsors on their events and provided for inclusion in this data base. Data acquisition, creation of the data base, and development of the data base retrieval program (ntsgm) are the result of work in support of the Los Alamos Field Test Office and the Office of Nonproliferation and Arms Control.« less
An ice-motion tracking system at the Alaska SAR facility
NASA Technical Reports Server (NTRS)
Kwok, Ronald; Curlander, John C.; Pang, Shirley S.; Mcconnell, Ross
1990-01-01
An operational system for extracting ice-motion information from synthetic aperture radar (SAR) imagery is being developed as part of the Alaska SAR Facility. This geophysical processing system (GPS) will derive ice-motion information by automated analysis of image sequences acquired by radars on the European ERS-1, Japanese ERS-1, and Canadian RADARSAT remote sensing satellites. The algorithm consists of a novel combination of feature-based and area-based techniques for the tracking of ice floes that undergo translation and rotation between imaging passes. The system performs automatic selection of the image pairs for input to the matching routines using an ice-motion estimator. It is designed to have a daily throughput of ten image pairs. A description is given of the GPS system, including an overview of the ice-motion-tracking algorithm, the system architecture, and the ice-motion products that will be available for distribution to geophysical data users.
Use of the computer for research on student thinking in physics
NASA Astrophysics Data System (ADS)
Grayson, Diane J.; McDermott, Lillian C.
1996-05-01
This paper describes the use of the computer-based interview as a research technique for investigating how students think about physics. Two computer programs provide the context: one intended for instruction, the other for research. The one designed for use as an instructional aid displays the motion of a ball rolling along a track that has level and inclined segments. The associated motion graphs are also shown. The other program, which was expressly designed for use in research, is based on the simulated motion of a modified Atwood's machine. The programs require students to predict the effect of the initial conditions and system parameters on the motion or on a graph of the motion. The motion that would actually occur is then displayed. The investigation focuses on the reasoning used by the students as they try to resolve discrepancies between their predictions and observations.
Sample-Based Motion Planning in High-Dimensional and Differentially-Constrained Systems
2010-02-01
Reachable Set . . . 88 6-1 LittleDog Robot . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 94 6-2 Dog bounding up stairs ...planning algorithm implemented on LittleDog, a quadruped robot . The motion planning algorithm successfully planned bounding trajectories over extremely...a motion planning algorithm implemented on LittleDog, a quadruped robot . The motion planning algorithm successfully planned bounding trajectories
Analytical evaluation of two motion washout techniques
NASA Technical Reports Server (NTRS)
Young, L. R.
1977-01-01
Practical tools were developed which extend the state of the art of moving base flight simulation for research and training purposes. The use of visual and vestibular cues to minimize the actual motion of the simulator itself was a primary consideration. The investigation consisted of optimum programming of motion cues based on a physiological model of the vestibular system to yield 'ideal washout logic' for any given simulator constraints.
1982-12-01
1Muter.Te Motions Based on Ana lyzed Winds and wind-driven December 1982 Currents from. a Primitive Squat ion General a.OW -love"*..* Oean Circulation...mew se"$ (comeS.... do oISN..u am ae~ 00do OWaor NUN Fourier and Rotary Spc , Analysis Modeled Inertial and Subinrtial Motion 4 Primitive Equation
Kim, Seung-Cheol; Dong, Xiao-Bin; Kwon, Min-Woo; Kim, Eun-Soo
2013-05-06
A novel approach for fast generation of video holograms of three-dimensional (3-D) moving objects using a motion compensation-based novel-look-up-table (MC-N-LUT) method is proposed. Motion compensation has been widely employed in compression of conventional 2-D video data because of its ability to exploit high temporal correlation between successive video frames. Here, this concept of motion-compensation is firstly applied to the N-LUT based on its inherent property of shift-invariance. That is, motion vectors of 3-D moving objects are extracted between the two consecutive video frames, and with them motions of the 3-D objects at each frame are compensated. Then, through this process, 3-D object data to be calculated for its video holograms are massively reduced, which results in a dramatic increase of the computational speed of the proposed method. Experimental results with three kinds of 3-D video scenarios reveal that the average number of calculated object points and the average calculation time for one object point of the proposed method, have found to be reduced down to 86.95%, 86.53% and 34.99%, 32.30%, respectively compared to those of the conventional N-LUT and temporal redundancy-based N-LUT (TR-N-LUT) methods.
Ground Motion in Central Mexico: A Comprehensive Analysis
NASA Astrophysics Data System (ADS)
Ramirez-Guzman, L.; Juarez, A.; Rábade, S.; Aguirre, J.; Bielak, J.
2015-12-01
This study presents a detailed analysis of the ground motion in Central Mexico based on numerical simulations, as well as broadband and strong ground motion records. We describe and evaluate a velocity model for Central Mexico derived from noise and regional earthquake cross-correlations, which is used throughout this research to estimate the ground motion in the region. The 3D crustal model includes a geotechnical structure of the Valley of Mexico (VM), subduction zone geometry, and 3D velocity distributions. The latter are based on more than 200 low magnitude (Mw < 4.5) earthquakes and two years of noise recordings. We emphasize the analysis on the ground motion in the Valley of Mexico originating from intra-slab deep events and temblors located along the Pacific coast. Also, we quantify the effects Trans-Mexican Volcanic Belt (TMVB) and the low-velocity deposits on the ground motion. The 3D octree-based finite element wave propagation computations, valid up to 1 Hz, reveal that the inclusion of a basin with a structure as complex as the Valley of Mexico dramatically enhances the regional effects induced by the TMVB. Moreover, the basin not only produces ground motion amplification and anomalous duration, but it also favors the energy focusing into zones of Mexico City where structures typically undergo high levels of damage.
Structured Kernel Subspace Learning for Autonomous Robot Navigation.
Kim, Eunwoo; Choi, Sungjoon; Oh, Songhwai
2018-02-14
This paper considers two important problems for autonomous robot navigation in a dynamic environment, where the goal is to predict pedestrian motion and control a robot with the prediction for safe navigation. While there are several methods for predicting the motion of a pedestrian and controlling a robot to avoid incoming pedestrians, it is still difficult to safely navigate in a dynamic environment due to challenges, such as the varying quality and complexity of training data with unwanted noises. This paper addresses these challenges simultaneously by proposing a robust kernel subspace learning algorithm based on the recent advances in nuclear-norm and l 1 -norm minimization. We model the motion of a pedestrian and the robot controller using Gaussian processes. The proposed method efficiently approximates a kernel matrix used in Gaussian process regression by learning low-rank structured matrix (with symmetric positive semi-definiteness) to find an orthogonal basis, which eliminates the effects of erroneous and inconsistent data. Based on structured kernel subspace learning, we propose a robust motion model and motion controller for safe navigation in dynamic environments. We evaluate the proposed robust kernel learning in various tasks, including regression, motion prediction, and motion control problems, and demonstrate that the proposed learning-based systems are robust against outliers and outperform existing regression and navigation methods.
NASA Technical Reports Server (NTRS)
Lee, A. T.; Bussolari, S. R.
1986-01-01
The effect of motion platform systems on pilot behavior is considered with emphasis placed on civil aviation applications. A dynamic model for human spatial orientation based on the physiological structure and function of the human vestibular system is presented. Motion platform alternatives were evaluated on the basis of the following motion platform conditions: motion with six degrees-of-freedom required for Phase II simulators and two limited motion conditions. Consideration was given to engine flameout, airwork, and approach and landing scenarios.
Evaluating the Performance of the NASA LaRC CMF Motion Base Safety Devices
NASA Technical Reports Server (NTRS)
Gupton, Lawrence E.; Bryant, Richard B., Jr.; Carrelli, David J.
2006-01-01
This paper describes the initial measured performance results of the previously documented NASA Langley Research Center (LaRC) Cockpit Motion Facility (CMF) motion base hardware safety devices. These safety systems are required to prevent excessive accelerations that could injure personnel and damage simulator cockpits or the motion base structure. Excessive accelerations may be caused by erroneous commands or hardware failures driving an actuator to the end of its travel at high velocity, stepping a servo valve, or instantly reversing servo direction. Such commands may result from single order failures of electrical or hydraulic components within the control system itself, or from aggressive or improper cueing commands from the host simulation computer. The safety systems must mitigate these high acceleration events while minimizing the negative performance impacts. The system accomplishes this by controlling the rate of change of valve signals to limit excessive commanded accelerations. It also aids hydraulic cushion performance by limiting valve command authority as the actuator approaches its end of travel. The design takes advantage of inherent motion base hydraulic characteristics to implement all safety features using hardware only solutions.
Daouk, Joël; Bailly, Pascal; Kamimura, Mitsuhiro; Sacksick, David; Jounieaux, Vincent; Meyer, Marc-Etienne
2015-05-01
Chronic obstructive pulmonary disease (COPD) is characterized by low vital capacity and tidal volume, which translate into smaller respiratory motions. We sought to demonstrate the limited respiratory motion in COPD by comparing respiratory-gated and free-breathing positron emission tomography (PET) images of lung nodules ("CT-based" and "Ungated" images) in patients with and without COPD. We studied 74 lung lesions (37 malignant) in 60 patients (23 patients with COPD; 37 without). An Ungated PET examination was followed by a CT-based acquisition. Maximum standard uptake value (SUVmax) for each lesion on PET images was measured. On CT images, we checked for the presence of emphysema and pleural adhesions or indentations associated with the nodules. Lastly, we used univariate and then multivariate analyses to determine the lung function parameters possibly affecting respiratory motion in patients with and without COPD. The mean "CT-based" vs. "Ungated" difference in SUVmax was 0.3 and 0.6 for patients with and without COPD, respectively. Statistical analysis revealed that lesion site, hyperinflation and pleural indentation were independently associated with a difference in SUVmax. PET lung lesion images in patients with COPD are barely influenced by respiratory motion. Thoracic hyperinflation in patients with COPD was found to be independently associated with an effect of respiratory motion on PET images. Moreover, pleural indentation limits the respiratory motion of lung nodules, regardless of the presence or absence of COPD.
Schwaab, Julia; Kurz, Christopher; Sarti, Cristina; Bongers, André; Schoenahl, Frédéric; Bert, Christoph; Debus, Jürgen; Parodi, Katia; Jenne, Jürgen Walter
2015-01-01
Target motion, particularly in the abdomen, due to respiration or patient movement is still a challenge in many diagnostic and therapeutic processes. Hence, methods to detect and compensate this motion are required. Diagnostic ultrasound (US) represents a non-invasive and dose-free alternative to fluoroscopy, providing more information about internal target motion than respiration belt or optical tracking. The goal of this project is to develop an US-based motion tracking for real-time motion correction in radiation therapy and diagnostic imaging, notably in 4D positron emission tomography (PET). In this work, a workflow is established to enable the transformation of US tracking data to the coordinates of the treatment delivery or imaging system – even if the US probe is moving due to respiration. It is shown that the US tracking signal is equally adequate for 4D PET image reconstruction as the clinically used respiration belt and provides additional opportunities in this concern. Furthermore, it is demonstrated that the US probe being within the PET field of view generally has no relevant influence on the image quality. The accuracy and precision of all the steps in the calibration workflow for US tracking-based 4D PET imaging are found to be in an acceptable range for clinical implementation. Eventually, we show in vitro that an US-based motion tracking in absolute room coordinates with a moving US transducer is feasible. PMID:26649277
Figure-ground segregation can rely on differences in motion direction.
Kandil, Farid I; Fahle, Manfred
2004-12-01
If the elements within a figure move synchronously while those in the surround move at a different time, the figure is easily segregated from the surround and thus perceived. Lee and Blake (1999) [Visual form created solely from temporal structure. Science, 284, 1165-1168] demonstrated that this figure-ground separation may be based not only on time differences between motion onsets, but also on the differences between reversals of motion direction. However, Farid and Adelson (2001) [Synchrony does not promote grouping in temporally structured displays. Nature Neuroscience, 4, 875-876] argued that figure-ground segregation in the motion-reversal experiment might have been based on a contrast artefact and concluded that (a)synchrony as such was 'not responsible for the perception of form in these or earlier displays'. Here, we present experiments that avoid contrast artefacts but still produce figure-ground segregation based on purely temporal cues. Our results show that subjects can segregate figure from ground even though being unable to use motion reversals as such. Subjects detect the figure when either (i) motion stops (leading to contrast artefacts), or (ii) motion directions differ between figure and ground. Segregation requires minimum delays of about 15 ms. We argue that whatever the underlying cues and mechanisms, a second stage beyond motion detection is required to globally compare the outputs of local motion detectors and to segregate figure from ground. Since analogous changes take place in both figure and ground in rapid succession, this second stage has to detect the asynchrony with high temporal precision.
Graizer, V.
2006-01-01
Most instruments used in seismological practice to record ground motion are pendulum seismographs, velocigraphs, or accelerographs. In most cases it is assumed that seismic instruments are only sensitive to the translational motion of the instrument's base. In this study the full equation of pendulum motion, including the inputs of rotations and tilts, is considered. It is shown that tilting the accelerograph's base can severely impact its response to the ground motion. The method of tilt evaluation using uncorrected strong-motion accelerograms was first suggested by Graizer (1989), and later tested in several laboratory experiments with different strong-motion instruments. The method is based on the difference in the tilt sensitivity of the horizontal and vertical pendulums. The method was applied to many of the strongest records of the Mw 6.7 Northridge earthquake of 1994. Examples are shown when relatively large tilts of up to a few degrees occurred during strong earthquake ground motion. Residual tilt extracted from the strong-motion record at the Pacoima Dam-Upper Left Abutment reached 3.1?? in N45??E direction, and was a result of local earthquake-induced tilting due to high-amplitude shaking. This value is in agreement with the residual tilt measured by using electronic level a few days after the earthquake. The method was applied to the building records from the Northridge earthquake. According to the estimates, residual tilt reached 2.6?? on the ground floor of the 12-story Hotel in Ventura. Processing of most of the strongest records of the Northridge earthquake shows that tilts, if happened, were within the error of the method, or less than about 0.5??.
Advanced Respiratory Motion Compensation for Coronary MR Angiography
Henningsson, Markus; Botnar, Rene M.
2013-01-01
Despite technical advances, respiratory motion remains a major impediment in a substantial amount of patients undergoing coronary magnetic resonance angiography (CMRA). Traditionally, respiratory motion compensation has been performed with a one-dimensional respiratory navigator positioned on the right hemi-diaphragm, using a motion model to estimate and correct for the bulk respiratory motion of the heart. Recent technical advancements has allowed for direct respiratory motion estimation of the heart, with improved motion compensation performance. Some of these new methods, particularly using image-based navigators or respiratory binning, allow for more advanced motion correction which enables CMRA data acquisition throughout most or all of the respiratory cycle, thereby significantly reducing scan time. This review describes the three components typically involved in most motion compensation strategies for CMRA, including respiratory motion estimation, gating and correction, and how these processes can be utilized to perform advanced respiratory motion compensation. PMID:23708271
Recommended minimal cockpit head motion box dimensions
DOT National Transportation Integrated Search
2001-09-26
This memo provides recommendations for the dimensions of the minimal CHMB based on a study of pilot head motion in actual flight. These recommended dimensions should accommodate the vast majority of the targeted head motion exhibited by the vast majo...
A computational model for reference-frame synthesis with applications to motion perception.
Clarke, Aaron M; Öğmen, Haluk; Herzog, Michael H
2016-09-01
As discovered by the Gestaltists, in particular by Duncker, we often perceive motion to be within a non-retinotopic reference frame. For example, the motion of a reflector on a bicycle appears to be circular, whereas, it traces out a cycloidal path with respect to external world coordinates. The reflector motion appears to be circular because the human brain subtracts the horizontal motion of the bicycle from the reflector motion. The bicycle serves as a reference frame for the reflector motion. Here, we present a general mathematical framework, based on vector fields, to explain non-retinotopic motion processing. Using four types of non-retinotopic motion paradigms, we show how the theory works in detail. For example, we show how non-retinotopic motion in the Ternus-Pikler display can be computed. Copyright © 2015 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Jiao, Jieqing; Salinas, Cristian A.; Searle, Graham E.; Gunn, Roger N.; Schnabel, Julia A.
2012-02-01
Dynamic Positron Emission Tomography is a powerful tool for quantitative imaging of in vivo biological processes. The long scan durations necessitate motion correction, to maintain the validity of the dynamic measurements, which can be particularly challenging due to the low signal-to-noise ratio (SNR) and spatial resolution, as well as the complex tracer behaviour in the dynamic PET data. In this paper we develop a novel automated expectation-maximisation image registration framework that incorporates temporal tracer kinetic information to correct for inter-frame subject motion during dynamic PET scans. We employ the Zubal human brain phantom to simulate dynamic PET data using SORTEO (a Monte Carlo-based simulator), in order to validate the proposed method for its ability to recover imposed rigid motion. We have conducted a range of simulations using different noise levels, and corrupted the data with a range of rigid motion artefacts. The performance of our motion correction method is compared with pairwise registration using normalised mutual information as a voxel similarity measure (an approach conventionally used to correct for dynamic PET inter-frame motion based solely on intensity information). To quantify registration accuracy, we calculate the target registration error across the images. The results show that our new dynamic image registration method based on tracer kinetics yields better realignment of the simulated datasets, halving the target registration error when compared to the conventional method at small motion levels, as well as yielding smaller residuals in translation and rotation parameters. We also show that our new method is less affected by the low signal in the first few frames, which the conventional method based on normalised mutual information fails to realign.
NASA Astrophysics Data System (ADS)
da Silva Junior, Evert Pereira; Esteves, Guilherme Pompeu; Dames, Karla Kristine; Melo, Pedro Lopes de
2011-01-01
Changes in thoracoabdominal motion are highly prevalent in patients with chronic respiratory diseases. Home care services that use telemedicine techniques and Internet-based monitoring have the potential to improve the management of these patients. However, there is no detailed description in the literature of a system for Internet-based monitoring of patients with disturbed thoracoabdominal motion. The purpose of this work was to describe the development of a new telemedicine instrument for Internet-based home monitoring of thoracoabdominal movement. The instrument directly measures changes in the thorax and abdomen circumferences and transfers data through a transmission control protocol/Internet protocol connection. After the design details are described, the accuracy of the electronic and software processing units of the instrument is evaluated by using electronic signals simulating normal subjects and individuals with thoracoabdominal motion disorders. The results obtained during in vivo studies on normal subjects simulating thoracoabdominal motion disorders showed that this new system is able to detect a reduction in abdominal movement that is associated with abnormal thoracic breathing (p < 0.0001) and the reduction in thoracic movement during abnormal abdominal breathing (p < 0.005). Simulated asynchrony in thoracoabdominal motion was also adequately detected by the system (p < 0.0001). The experimental results obtained for patients with respiratory diseases were in close agreement with the expected values, providing evidence that this instrument can be a useful tool for the evaluation of thoracoabdominal motion. The Internet transmission tests showed that the acquisition and analysis of the thoracoabdominal motion signals can be performed remotely. The user can also receive medical recommendations. The proposed system can be used in a spectrum of telemedicine scenarios, which can reduce the costs of assistance offered to patients with respiratory diseases.
A system for learning statistical motion patterns.
Hu, Weiming; Xiao, Xuejuan; Fu, Zhouyu; Xie, Dan; Tan, Tieniu; Maybank, Steve
2006-09-01
Analysis of motion patterns is an effective approach for anomaly detection and behavior prediction. Current approaches for the analysis of motion patterns depend on known scenes, where objects move in predefined ways. It is highly desirable to automatically construct object motion patterns which reflect the knowledge of the scene. In this paper, we present a system for automatically learning motion patterns for anomaly detection and behavior prediction based on a proposed algorithm for robustly tracking multiple objects. In the tracking algorithm, foreground pixels are clustered using a fast accurate fuzzy K-means algorithm. Growing and prediction of the cluster centroids of foreground pixels ensure that each cluster centroid is associated with a moving object in the scene. In the algorithm for learning motion patterns, trajectories are clustered hierarchically using spatial and temporal information and then each motion pattern is represented with a chain of Gaussian distributions. Based on the learned statistical motion patterns, statistical methods are used to detect anomalies and predict behaviors. Our system is tested using image sequences acquired, respectively, from a crowded real traffic scene and a model traffic scene. Experimental results show the robustness of the tracking algorithm, the efficiency of the algorithm for learning motion patterns, and the encouraging performance of algorithms for anomaly detection and behavior prediction.
Indexing and retrieving motions of characters in close contact.
Ho, Edmond S L; Komura, Taku
2009-01-01
Human motion indexing and retrieval are important for animators due to the need to search for motions in the database which can be blended and concatenated. Most of the previous researches of human motion indexing and retrieval compute the Euclidean distance of joint angles or joint positions. Such approaches are difficult to apply for cases in which multiple characters are closely interacting with each other, as the relationships of the characters are not encoded in the representation. In this research, we propose a topology-based approach to index the motions of two human characters in close contact. We compute and encode how the two bodies are tangled based on the concept of rational tangles. The encoded relationships, which we define as TangleList, are used to determine the similarity of the pairs of postures. Using our method, we can index and retrieve motions such as one person piggy-backing another, one person assisting another in walking, and two persons dancing / wrestling. Our method is useful to manage a motion database of multiple characters. We can also produce motion graph structures of two characters closely interacting with each other by interpolating and concatenating topologically similar postures and motion clips, which are applicable to 3D computer games and computer animation.
NASA Astrophysics Data System (ADS)
Nastula, J.; Kolaczek, B.; Salstein, D. A.
2008-04-01
Understanding changes in the global balance of the Earths angular momentum due to the mass redistribution of geophysical fluids is needed to explain the observed polar motion. The impact of continental hydrologic signals, from land water, snow, and ice, on polar motion excitation (hydrological angular momentum-HAM), is still inadequately known. Although estimates of HAM have been made from several models of global hydrology based upon the observed distribution of surface water, snow, and soil moisture, the relatively sparse observation network and the presence of errors in the data and the geophysical fluid models preclude a full understanding of the HAM influence on polar motion variations. Recently the GRACE mission monitoring Earths time variable gravity field has allowed us to determine the mass term of polar motion excitation functions and compare them with the mass term derivable as a residual from the geodetic excitation functions and geophysical fluid motion terms on seasonal time scales. Differences between these mass terms in the years 2004 - 2005.5 are still on the order of 20 mas. Besides the overall mass excitation of polar motion comparisons with GRACE (RL04-release), we also intercompare the non-atmospheric, non-oceanic signals in the mass term of geodetic polar motion excitation with hydrological excitation of polar motion.
A four-dimensional motion field atlas of the tongue from tagged and cine magnetic resonance imaging
NASA Astrophysics Data System (ADS)
Xing, Fangxu; Prince, Jerry L.; Stone, Maureen; Wedeen, Van J.; El Fakhri, Georges; Woo, Jonghye
2017-02-01
Representation of human tongue motion using three-dimensional vector fields over time can be used to better understand tongue function during speech, swallowing, and other lingual behaviors. To characterize the inter-subject variability of the tongue's shape and motion of a population carrying out one of these functions it is desirable to build a statistical model of the four-dimensional (4D) tongue. In this paper, we propose a method to construct a spatio-temporal atlas of tongue motion using magnetic resonance (MR) images acquired from fourteen healthy human subjects. First, cine MR images revealing the anatomical features of the tongue are used to construct a 4D intensity image atlas. Second, tagged MR images acquired to capture internal motion are used to compute a dense motion field at each time frame using a phase-based motion tracking method. Third, motion fields from each subject are pulled back to the cine atlas space using the deformation fields computed during the cine atlas construction. Finally, a spatio-temporal motion field atlas is created to show a sequence of mean motion fields and their inter-subject variation. The quality of the atlas was evaluated by deforming cine images in the atlas space. Comparison between deformed and original cine images showed high correspondence. The proposed method provides a quantitative representation to observe the commonality and variability of the tongue motion field for the first time, and shows potential in evaluation of common properties such as strains and other tensors based on motion fields.
A Four-dimensional Motion Field Atlas of the Tongue from Tagged and Cine Magnetic Resonance Imaging.
Xing, Fangxu; Prince, Jerry L; Stone, Maureen; Wedeen, Van J; Fakhri, Georges El; Woo, Jonghye
2017-01-01
Representation of human tongue motion using three-dimensional vector fields over time can be used to better understand tongue function during speech, swallowing, and other lingual behaviors. To characterize the inter-subject variability of the tongue's shape and motion of a population carrying out one of these functions it is desirable to build a statistical model of the four-dimensional (4D) tongue. In this paper, we propose a method to construct a spatio-temporal atlas of tongue motion using magnetic resonance (MR) images acquired from fourteen healthy human subjects. First, cine MR images revealing the anatomical features of the tongue are used to construct a 4D intensity image atlas. Second, tagged MR images acquired to capture internal motion are used to compute a dense motion field at each time frame using a phase-based motion tracking method. Third, motion fields from each subject are pulled back to the cine atlas space using the deformation fields computed during the cine atlas construction. Finally, a spatio-temporal motion field atlas is created to show a sequence of mean motion fields and their inter-subject variation. The quality of the atlas was evaluated by deforming cine images in the atlas space. Comparison between deformed and original cine images showed high correspondence. The proposed method provides a quantitative representation to observe the commonality and variability of the tongue motion field for the first time, and shows potential in evaluation of common properties such as strains and other tensors based on motion fields.
NASA Astrophysics Data System (ADS)
Jaume-i-Capó, Antoni; Varona, Javier; González-Hidalgo, Manuel; Mas, Ramon; Perales, Francisco J.
2012-02-01
Human motion capture has a wide variety of applications, and in vision-based motion capture systems a major issue is the human body model and its initialization. We present a computer vision algorithm for building a human body model skeleton in an automatic way. The algorithm is based on the analysis of the human shape. We decompose the body into its main parts by computing the curvature of a B-spline parameterization of the human contour. This algorithm has been applied in a context where the user is standing in front of a camera stereo pair. The process is completed after the user assumes a predefined initial posture so as to identify the main joints and construct the human model. Using this model, the initialization problem of a vision-based markerless motion capture system of the human body is solved.
Motion versus position in the perception of head-centred movement.
Freeman, Tom C A; Sumnall, Jane H
2002-01-01
Abstract. Observers can recover motion with respect to the head during an eye movement by comparing signals encoding retinal motion and the velocity of pursuit. Evidently there is a mismatch between these signals because perceived head-centred motion is not always veridical. One example is the Filehne illusion, in which a stationary object appears to move in the opposite direction to pursuit. Like the motion aftereffect, the phenomenal experience of the Filehne illusion is one in which the stimulus moves but does not seem to go anywhere. This raises problems when measuring the illusion by motion nulling because the more traditional technique confounds perceived motion with changes in perceived position. We devised a new nulling technique using global-motion stimuli that degraded familiar position cues but preserved cues to motion. Stimuli consisted of random-dot patterns comprising signal and noise dots that moved at the same retinal 'base' speed. Noise moved in random directions. In an eye-stationary speed-matching experiment we found noise slowed perceived retinal speed as 'coherence strength' (ie percentage of signal) was reduced. The effect occurred over the two-octave range of base speeds studied and well above direction threshold. When the same stimuli were combined with pursuit, observers were able to null the Filehne illusion by adjusting coherence. A power law relating coherence to retinal base speed fit the data well with a negative exponent. Eye-movement recordings showed that pursuit was quite accurate. We then tested the hypothesis that the stimuli found at the null-points appeared to move at the same retinal speed. Two observers supported the hypothesis, a third partially, and a fourth showed a small linear trend. In addition, the retinal speed found by the traditional Filehne technique was similar to the matches obtained with the global-motion stimuli. The results provide support for the idea that speed is the critical cue in head-centred motion perception.
Lin, Chin-Teng; Tsai, Shu-Fang; Ko, Li-Wei
2013-10-01
Motion sickness is a common experience for many people. Several previous researches indicated that motion sickness has a negative effect on driving performance and sometimes leads to serious traffic accidents because of a decline in a person's ability to maintain self-control. This safety issue has motivated us to find a way to prevent vehicle accidents. Our target was to determine a set of valid motion sickness indicators that would predict the occurrence of a person's motion sickness as soon as possible. A successful method for the early detection of motion sickness will help us to construct a cognitive monitoring system. Such a monitoring system can alert people before they become sick and prevent them from being distracted by various motion sickness symptoms while driving or riding in a car. In our past researches, we investigated the physiological changes that occur during the transition of a passenger's cognitive state using electroencephalography (EEG) power spectrum analysis, and we found that the EEG power responses in the left and right motors, parietal, lateral occipital, and occipital midline brain areas were more highly correlated to subjective sickness levels than other brain areas. In this paper, we propose the use of a self-organizing neural fuzzy inference network (SONFIN) to estimate a driver's/passenger's sickness level based on EEG features that have been extracted online from five motion sickness-related brain areas, while either in real or virtual vehicle environments. The results show that our proposed learning system is capable of extracting a set of valid motion sickness indicators that originated from EEG dynamics, and through SONFIN, a neuro-fuzzy prediction model, we successfully translated the set of motion sickness indicators into motion sickness levels. The overall performance of this proposed EEG-based learning system can achieve an average prediction accuracy of ~82%.
ERIC Educational Resources Information Center
Tomczak, Ewa; Ewert, Anna
2015-01-01
We examine cross-linguistic influence in the processing of motion sentences by L2 users from an embodied cognition perspective. The experiment employs a priming paradigm to test two hypotheses based on previous action and motion research in cognitive psychology. The first hypothesis maintains that conceptual representations of motion are embodied…
2012-06-01
MISP) COMPLIANT ARCHITECTURE WHITE SANDS MISSILE RANGE REAGAN TEST SITE YUMA PROVING GROUND DUGWAY PROVING GROUND ABERDEEN TEST CENTER...DIGITAL MOTION IMAGERY COMPRESSION BEST PRACTICES GUIDE – A MOTION IMAGERY STANDARDS PROFILE (MISP) COMPLIANT ARCHITECTURE ...delivery, and archival purposes. These practices are based on a Motion Imagery Standards Profile (MISP) compliant architecture , which has been defined
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Young-Keun, E-mail: ykkim@handong.edu; Kim, Kyung-Soo
Maritime transportation demands an accurate measurement system to track the motion of oscillating container boxes in real time. However, it is a challenge to design a sensor system that can provide both reliable and non-contact methods of 6-DOF motion measurements of a remote object for outdoor applications. In the paper, a sensor system based on two 2D laser scanners is proposed for detecting the relative 6-DOF motion of a crane load in real time. Even without implementing a camera, the proposed system can detect the motion of a remote object using four laser beam points. Because it is a laser-basedmore » sensor, the system is expected to be highly robust to sea weather conditions.« less
Brain-machine interfacing control of whole-body humanoid motion
Bouyarmane, Karim; Vaillant, Joris; Sugimoto, Norikazu; Keith, François; Furukawa, Jun-ichiro; Morimoto, Jun
2014-01-01
We propose to tackle in this paper the problem of controlling whole-body humanoid robot behavior through non-invasive brain-machine interfacing (BMI), motivated by the perspective of mapping human motor control strategies to human-like mechanical avatar. Our solution is based on the adequate reduction of the controllable dimensionality of a high-DOF humanoid motion in line with the state-of-the-art possibilities of non-invasive BMI technologies, leaving the complement subspace part of the motion to be planned and executed by an autonomous humanoid whole-body motion planning and control framework. The results are shown in full physics-based simulation of a 36-degree-of-freedom humanoid motion controlled by a user through EEG-extracted brain signals generated with motor imagery task. PMID:25140134
Optimization of motion control laws for tether crawler or elevator systems
NASA Technical Reports Server (NTRS)
Swenson, Frank R.; Von Tiesenhausen, Georg
1988-01-01
Based on the proposal of a motion control law by Lorenzini (1987), a method is developed for optimizing motion control laws for tether crawler or elevator systems in terms of the performance measures of travel time, the smoothness of acceleration and deceleration, and the maximum values of velocity and acceleration. The Lorenzini motion control law, based on powers of the hyperbolic tangent function, is modified by the addition of a constant-velocity section, and this modified function is then optimized by parameter selections to minimize the peak acceleration value for a selected travel time or to minimize travel time for the selected peak values of velocity and acceleration. It is shown that the addition of a constant-velocity segment permits further optimization of the motion control law performance.
Open architecture CMM motion controller
NASA Astrophysics Data System (ADS)
Chang, David; Spence, Allan D.; Bigg, Steve; Heslip, Joe; Peterson, John
2001-12-01
Although initially the only Coordinate Measuring Machine (CMM) sensor available was a touch trigger probe, technological advances in sensors and computing have greatly increased the variety of available inspection sensors. Non-contact laser digitizers and analog scanning touch probes require very well tuned CMM motion control, as well as an extensible, open architecture interface. This paper describes the implementation of a retrofit CMM motion controller designed for open architecture interface to a variety of sensors. The controller is based on an Intel Pentium microcomputer and a Servo To Go motion interface electronics card. Motor amplifiers, safety, and additional interface electronics are housed in a separate enclosure. Host Signal Processing (HSP) is used for the motion control algorithm. Compared to the usual host plus DSP architecture, single CPU HSP simplifies integration with the various sensors, and implementation of software geometric error compensation. Motion control tuning is accomplished using a remote computer via 100BaseTX Ethernet. A Graphical User Interface (GUI) is used to enter geometric error compensation data, and to optimize the motion control tuning parameters. It is shown that this architecture achieves the required real time motion control response, yet is much easier to extend to additional sensors.
Incremental Dynamic Analysis of Koyna Dam under Repeated Ground Motions
NASA Astrophysics Data System (ADS)
Zainab Nik Azizan, Nik; Majid, Taksiah A.; Nazri, Fadzli Mohamed; Maity, Damodar; Abdullah, Junaidah
2018-03-01
This paper discovers the incremental dynamic analysis (IDA) of concrete gravity dam under single and repeated earthquake loadings to identify the limit state of the dam. Seven ground motions with horizontal and vertical direction as seismic input considered in the nonlinear dynamic analysis based on the real repeated earthquake in the worldwide. All the ground motions convert to respond spectrum and scaled according to the developed elastic respond spectrum in order to match the characteristic of the ground motion to the soil type. The scaled was depends on the fundamental period, T1 of the dam. The Koyna dam has been selected as a case study for the purpose of the analysis by assuming that no sliding and rigid foundation, has been estimated. IDA curves for Koyna dam developed for single and repeated ground motions and the performance level of the dam identifies. The IDA curve of repeated ground motion shown stiffer rather than single ground motion. The ultimate state displacement for a single event is 45.59mm and decreased to 39.33mm under repeated events which are decreased about 14%. This showed that the performance level of the dam based on seismic loadings depend on ground motion pattern.
The application of mean field theory to image motion estimation.
Zhang, J; Hanauer, G G
1995-01-01
Previously, Markov random field (MRF) model-based techniques have been proposed for image motion estimation. Since motion estimation is usually an ill-posed problem, various constraints are needed to obtain a unique and stable solution. The main advantage of the MRF approach is its capacity to incorporate such constraints, for instance, motion continuity within an object and motion discontinuity at the boundaries between objects. In the MRF approach, motion estimation is often formulated as an optimization problem, and two frequently used optimization methods are simulated annealing (SA) and iterative-conditional mode (ICM). Although the SA is theoretically optimal in the sense of finding the global optimum, it usually takes many iterations to converge. The ICM, on the other hand, converges quickly, but its results are often unsatisfactory due to its "hard decision" nature. Previously, the authors have applied the mean field theory to image segmentation and image restoration problems. It provides results nearly as good as SA but with much faster convergence. The present paper shows how the mean field theory can be applied to MRF model-based motion estimation. This approach is demonstrated on both synthetic and real-world images, where it produced good motion estimates.
Angle-independent measure of motion for image-based gating in 3D coronary angiography
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lehmann, Glen C.; Holdsworth, David W.; Drangova, Maria
2006-05-15
The role of three-dimensional (3D) image guidance for interventional procedures and minimally invasive surgeries is increasing for the treatment of vascular disease. Currently, most interventional procedures are guided by two-dimensional x-ray angiography, but computed rotational angiography has the potential to provide 3D geometric information about the coronary arteries. The creation of 3D angiographic images of the coronary arteries requires synchronization of data acquisition with respect to the cardiac cycle, in order to minimize motion artifacts. This can be achieved by inferring the extent of motion from a patient's electrocardiogram (ECG) signal. However, a direct measurement of motion (from the 2Dmore » angiograms) has the potential to improve the 3D angiographic images by ensuring that only projections acquired during periods of minimal motion are included in the reconstruction. This paper presents an image-based metric for measuring the extent of motion in 2D x-ray angiographic images. Adaptive histogram equalization was applied to projection images to increase the sharpness of coronary arteries and the superior-inferior component of the weighted centroid (SIC) was measured. The SIC constitutes an image-based metric that can be used to track vessel motion, independent of apparent motion induced by the rotational acquisition. To evaluate the technique, six consecutive patients scheduled for routine coronary angiography procedures were studied. We compared the end of the SIC rest period ({rho}) to R-waves (R) detected in the patient's ECG and found a mean difference of 14{+-}80 ms. Two simultaneous angular positions were acquired and {rho} was detected for each position. There was no statistically significant difference (P=0.79) between {rho} in the two simultaneously acquired angular positions. Thus we have shown the SIC to be independent of view angle, which is critical for rotational angiography. A preliminary image-based gating strategy that employed the SIC was compared to an ECG-based gating strategy in a porcine model. The image-based gating strategy selected 61 projection images, compared to 45 selected by the ECG-gating strategy. Qualitative comparison revealed that although both the SIC-based and ECG-gated reconstructions decreased motion artifact compared to reconstruction with no gating, the SIC-based gating technique increased the conspicuity of smaller vessels when compared to ECG gating in maximum intensity projections of the reconstructions and increased the sharpness of a vessel cross section in multi-planar reformats of the reconstruction.« less
NASA Astrophysics Data System (ADS)
Oktarisa, Y.; Utami, I. S.; Denny, Y. R.
2017-02-01
This study has been done to 34 science teacher candidates of Teachers’ Training and Education Faculty of Sultan Ageng Tirtayasa University at their first year of study during 2015-2016 school years. This research focused on student’s misconception about motion and force and how Problem Based Learning (PBL) reducing it. Diagnostic test of misconception about motion and force has been detected by using Force Concept Inventory (FCI). FCI had been used in pretest and posttest, and to find the reducing of students’ misconception N-Gain pretest and posttest of each student had been calculated. Quasi experiment one group pretest and posttest had been used as the research method, and Problem Based Learning (PBL) used as the treatment of manipulation. After two weeks learning motion and force with PBL approach, N-gain which obtained prove that misconception about motion and force had been reducing.
Modal-pushover-based ground-motion scaling procedure
Kalkan, Erol; Chopra, Anil K.
2011-01-01
Earthquake engineering is increasingly using nonlinear response history analysis (RHA) to demonstrate the performance of structures. This rigorous method of analysis requires selection and scaling of ground motions appropriate to design hazard levels. This paper presents a modal-pushover-based scaling (MPS) procedure to scale ground motions for use in a nonlinear RHA of buildings. In the MPS method, the ground motions are scaled to match to a specified tolerance, a target value of the inelastic deformation of the first-mode inelastic single-degree-of-freedom (SDF) system whose properties are determined by the first-mode pushover analysis. Appropriate for first-mode dominated structures, this approach is extended for structures with significant contributions of higher modes by considering elastic deformation of second-mode SDF systems in selecting a subset of the scaled ground motions. Based on results presented for three actual buildings-4, 6, and 13-story-the accuracy and efficiency of the MPS procedure are established and its superiority over the ASCE/SEI 7-05 scaling procedure is demonstrated.
Ube, Hitoshi; Yasuda, Yoshihiro; Sato, Hiroyasu; Shionoya, Mitsuhiko
2017-02-08
Metal ions can serve as a centre of molecular motions due to their coordination geometry, reversible bonding nature and external stimuli responsiveness. Such essential features of metal ions have been utilized for metal-mediated molecular machines with the ability to motion switch via metallation/demetallation or coordination number variation at the metal centre; however, motion switching based on the change in coordination geometry remain largely unexplored. Herein, we report a Pt II -centred molecular gear that demonstrates control of rotor engagement and disengagement based on photo- and thermally driven cis-trans isomerization at the Pt II centre. This molecular rotary motion transmitter has been constructed from two coordinating azaphosphatriptycene rotators and one Pt II ion as a stator. Isomerization between an engaged cis-form and a disengaged trans-form is reversibly driven by ultraviolet irradiation and heating. Such a photo- and thermally triggered motional interconversion between engaged/disengaged states on a metal ion would provide a selector switch for more complex interlocking systems.
Theoretical Comparison of Motional and Transformer EMF Device Damping Efficiency
NASA Astrophysics Data System (ADS)
GRAVES, K. E.; TONCICH, D.; IOVENITTI, P. G.
2000-06-01
In this paper, theoretical comparison between electromagnetic dampers based on a “motional emf” and “transformer emf” design is presented. Transformer emf devices are based on the generation of emf in a stationary circuit, in which the emf is generated by a time-varying magnetic field linking the circuit. Motional emf devices are based on the generation of emf due to a moving conductor within a stationary magnetic field. Both of these designs can be used as damping elements for applications such as semi-active and regenerative vehicle suspension systems. The findings herein are provided so as to evaluate the most efficient device for such applications. The analysis consists of comparing the damping coefficient of the electromagnetic devices for a given magnetic field and given volume of conducting material. It has been found that for a limited range of dimensions, the transformer emf devices can be more then 1·2 times as efficient as the motional emf devices. However, for most realistic situations, motional emf devices will have the highest efficiency.
Reconstructing 3-D skin surface motion for the DIET breast cancer screening system.
Botterill, Tom; Lotz, Thomas; Kashif, Amer; Chase, J Geoffrey
2014-05-01
Digital image-based elasto-tomography (DIET) is a prototype system for breast cancer screening. A breast is imaged while being vibrated, and the observed surface motion is used to infer the internal stiffness of the breast, hence identifying tumors. This paper describes a computer vision system for accurately measuring 3-D surface motion. A model-based segmentation is used to identify the profile of the breast in each image, and the 3-D surface is reconstructed by fitting a model to the profiles. The surface motion is measured using a modern optical flow implementation customized to the application, then trajectories of points on the 3-D surface are given by fusing the optical flow with the reconstructed surfaces. On data from human trials, the system is shown to exceed the performance of an earlier marker-based system at tracking skin surface motion. We demonstrate that the system can detect a 10 mm tumor in a silicone phantom breast.
NASA Astrophysics Data System (ADS)
Sauppe, Sebastian; Hahn, Andreas; Brehm, Marcus; Paysan, Pascal; Seghers, Dieter; Kachelrieß, Marc
2016-03-01
We propose an adapted method of our previously published five-dimensional (5D) motion compensation (MoCo) algorithm1, developed for micro-CT imaging of small animals, to provide for the first time motion artifact-free 5D cone-beam CT (CBCT) images from a conventional flat detector-based CBCT scan of clinical patients. Image quality of retrospectively respiratory- and cardiac-gated volumes from flat detector CBCT scans is deteriorated by severe sparse projection artifacts. These artifacts further complicate motion estimation, as it is required for MoCo image reconstruction. For high quality 5D CBCT images at the same x-ray dose and the same number of projections as todays 3D CBCT we developed a double MoCo approach based on motion vector fields (MVFs) for respiratory and cardiac motion. In a first step our already published four-dimensional (4D) artifact-specific cyclic motion-compensation (acMoCo) approach is applied to compensate for the respiratory patient motion. With this information a cyclic phase-gated deformable heart registration algorithm is applied to the respiratory motion-compensated 4D CBCT data, thus resulting in cardiac MVFs. We apply these MVFs on double-gated images and thereby respiratory and cardiac motion-compensated 5D CBCT images are obtained. Our 5D MoCo approach processing patient data acquired with the TrueBeam 4D CBCT system (Varian Medical Systems). Our double MoCo approach turned out to be very efficient and removed nearly all streak artifacts due to making use of 100% of the projection data for each reconstructed frame. The 5D MoCo patient data show fine details and no motion blurring, even in regions close to the heart where motion is fastest.
Objective Motion Cueing Criteria Investigation Based on Three Flight Tasks
NASA Technical Reports Server (NTRS)
Zaal, Petrus M. T.; Schroeder, Jeffery A.; Chung, William W.
2015-01-01
This paper intends to help establish fidelity criteria to accompany the simulator motion system diagnostic test specified by the International Civil Aviation Organization. Twelve air- line transport pilots flew three tasks in the NASA Vertical Motion Simulator under four different motion conditions. The experiment used three different hexapod motion configurations, each with a different tradeoff between motion filter gain and break frequency, and one large motion configuration that utilized as much of the simulator's motion space as possible. The motion condition significantly affected: 1) pilot motion fidelity ratings, and sink rate and lateral deviation at touchdown for the approach and landing task, 2) pilot motion fidelity ratings, roll deviations, maximum pitch rate, and number of stick shaker activations in the stall task, and 3) heading deviation after an engine failure in the takeoff task. Significant differences in pilot-vehicle performance were used to define initial objective motion cueing criteria boundaries. These initial fidelity boundaries show promise but need refinement.
Motion/imagery secure cloud enterprise architecture analysis
NASA Astrophysics Data System (ADS)
DeLay, John L.
2012-06-01
Cloud computing with storage virtualization and new service-oriented architectures brings a new perspective to the aspect of a distributed motion imagery and persistent surveillance enterprise. Our existing research is focused mainly on content management, distributed analytics, WAN distributed cloud networking performance issues of cloud based technologies. The potential of leveraging cloud based technologies for hosting motion imagery, imagery and analytics workflows for DOD and security applications is relatively unexplored. This paper will examine technologies for managing, storing, processing and disseminating motion imagery and imagery within a distributed network environment. Finally, we propose areas for future research in the area of distributed cloud content management enterprises.
Shear velocity criterion for incipient motion of sediment
Simoes, Francisco J.
2014-01-01
The prediction of incipient motion has had great importance to the theory of sediment transport. The most commonly used methods are based on the concept of critical shear stress and employ an approach similar, or identical, to the Shields diagram. An alternative method that uses the movability number, defined as the ratio of the shear velocity to the particle’s settling velocity, was employed in this study. A large amount of experimental data were used to develop an empirical incipient motion criterion based on the movability number. It is shown that this approach can provide a simple and accurate method of computing the threshold condition for sediment motion.
Zhang, Lina; Zhang, Hui; Liu, Mei; Dong, Bin
2016-06-22
In this paper, we report a polymer-based raspberry-like micromotor. Interestingly, the resulting micromotor exhibits multistimuli-responsive motion behavior. Its on-off-on motion can be regulated by the application of stimuli such as H2O2, near-infrared light, NH3, or their combinations. Because of the versatility in motion control, the current micromotor has great potential in the application field of logic gate and logic circuit. With use of different stimuli as the inputs and the micromotor motion as the output, reprogrammable OR and INHIBIT logic gates or logic circuit consisting of OR, NOT, and AND logic gates can be achieved.
Insitu aircraft verification of the quality of satellite cloud winds over oceanic regions
NASA Technical Reports Server (NTRS)
Hasler, A. F.; Skillman, W. C.
1979-01-01
A five year aircraft experiment to verify the quality of satellite cloud winds over oceans using in situ aircraft inertial navigation system wind measurements is presented. The final results show that satellite measured cumulus cloud motions are very good estimators of the cloud base wind for trade wind and subtropical high regions. The average magnitude of the vector differences between the cloud motion and the cloud base wind is given. For cumulus clouds near frontal regions, the cloud motion agreed best with the mean cloud layer wind. For a very limited sample, cirrus cloud motions also most closely followed the mean wind in the cloud layer.
Research and development of a control system for multi axis cooperative motion based on PMAC
NASA Astrophysics Data System (ADS)
Guo, Xiao-xiao; Dong, Deng-feng; Zhou, Wei-hu
2017-10-01
Based on Programmable Multi-axes Controller (PMAC), a design of a multi axis motion control system for the simulator of spatial targets' dynamic optical properties is proposed. According to analysis the properties of spatial targets' simulator motion control system, using IPC as the main control layer, TurboPMAC2 as the control layer to meet coordinated motion control, data acquisition and analog output. A simulator using 5 servomotors which is connected with speed reducers to drive the output axis was implemented to simulate the motion of both the sun and the space target. Based on PMAC using PID and a notch filter algorithm, negative feedback, the speed and acceleration feed forward algorithm to satisfy the axis' requirements of the good stability and high precision at low speeds. In the actual system, it shows that the velocity precision is higher than 0.04 s ° and the precision of repetitive positioning is better than 0.006° when each axis is at a low-speed. Besides, the system achieves the control function of multi axis coordinated motion. The design provides an important technical support for detecting spatial targets, also promoting the theoretical research.
NASA Astrophysics Data System (ADS)
Carranza, N.; Cristóbal, G.; Sroubek, F.; Ledesma-Carbayo, M. J.; Santos, A.
2006-08-01
Myocardial motion analysis and quantification is of utmost importance for analyzing contractile heart abnormalities and it can be a symptom of a coronary artery disease. A fundamental problem in processing sequences of images is the computation of the optical flow, which is an approximation to the real image motion. This paper presents a new algorithm for optical flow estimation based on a spatiotemporal-frequency (STF) approach, more specifically on the computation of the Wigner-Ville distribution (WVD) and the Hough Transform (HT) of the motion sequences. The later is a well-known line and shape detection method very robust against incomplete data and noise. The rationale of using the HT in this context is because it provides a value of the displacement field from the STF representation. In addition, a probabilistic approach based on Gaussian mixtures has been implemented in order to improve the accuracy of the motion detection. Experimental results with synthetic sequences are compared against an implementation of the variational technique for local and global motion estimation, where it is shown that the results obtained here are accurate and robust to noise degradations. Real cardiac magnetic resonance images have been tested and evaluated with the current method.
Gait Recognition Using Wearable Motion Recording Sensors
NASA Astrophysics Data System (ADS)
Gafurov, Davrondzhon; Snekkenes, Einar
2009-12-01
This paper presents an alternative approach, where gait is collected by the sensors attached to the person's body. Such wearable sensors record motion (e.g. acceleration) of the body parts during walking. The recorded motion signals are then investigated for person recognition purposes. We analyzed acceleration signals from the foot, hip, pocket and arm. Applying various methods, the best EER obtained for foot-, pocket-, arm- and hip- based user authentication were 5%, 7%, 10% and 13%, respectively. Furthermore, we present the results of our analysis on security assessment of gait. Studying gait-based user authentication (in case of hip motion) under three attack scenarios, we revealed that a minimal effort mimicking does not help to improve the acceptance chances of impostors. However, impostors who know their closest person in the database or the genders of the users can be a threat to gait-based authentication. We also provide some new insights toward the uniqueness of gait in case of foot motion. In particular, we revealed the following: a sideway motion of the foot provides the most discrimination, compared to an up-down or forward-backward directions; and different segments of the gait cycle provide different level of discrimination.
Hardie, Russell C; Barnard, Kenneth J; Ordonez, Raul
2011-12-19
Fast nonuniform interpolation based super-resolution (SR) has traditionally been limited to applications with translational interframe motion. This is in part because such methods are based on an underlying assumption that the warping and blurring components in the observation model commute. For translational motion this is the case, but it is not true in general. This presents a problem for applications such as airborne imaging where translation may be insufficient. Here we present a new Fourier domain analysis to show that, for many image systems, an affine warping model with limited zoom and shear approximately commutes with the point spread function when diffraction effects are modeled. Based on this important result, we present a new fast adaptive Wiener filter (AWF) SR algorithm for non-translational motion and study its performance with affine motion. The fast AWF SR method employs a new smart observation window that allows us to precompute all the needed filter weights for any type of motion without sacrificing much of the full performance of the AWF. We evaluate the proposed algorithm using simulated data and real infrared airborne imagery that contains a thermal resolution target allowing for objective resolution analysis.
Verstraten, Frans A J; Niehorster, Diederick C; van de Grind, Wim A; Wade, Nicholas J
2015-10-01
In his original contribution, Exner's principal concern was a comparison between the properties of different aftereffects, and particularly to determine whether aftereffects of motion were similar to those of color and whether they could be encompassed within a unified physiological framework. Despite the fact that he was unable to answer his main question, there are some excellent-so far unknown-contributions in Exner's paper. For example, he describes observations that can be related to binocular interaction, not only in motion aftereffects but also in rivalry. To the best of our knowledge, Exner provides the first description of binocular rivalry induced by differently moving patterns in each eye, for motion as well as for their aftereffects. Moreover, apart from several known, but beautifully addressed, phenomena he makes a clear distinction between motion in depth based on stimulus properties and motion in depth based on the interpretation of motion. That is, the experience of movement, as distinct from the perception of movement. The experience, unlike the perception, did not result in a motion aftereffect in depth.
Niehorster, Diederick C.; van de Grind, Wim A.; Wade, Nicholas J.
2015-01-01
In his original contribution, Exner’s principal concern was a comparison between the properties of different aftereffects, and particularly to determine whether aftereffects of motion were similar to those of color and whether they could be encompassed within a unified physiological framework. Despite the fact that he was unable to answer his main question, there are some excellent—so far unknown—contributions in Exner’s paper. For example, he describes observations that can be related to binocular interaction, not only in motion aftereffects but also in rivalry. To the best of our knowledge, Exner provides the first description of binocular rivalry induced by differently moving patterns in each eye, for motion as well as for their aftereffects. Moreover, apart from several known, but beautifully addressed, phenomena he makes a clear distinction between motion in depth based on stimulus properties and motion in depth based on the interpretation of motion. That is, the experience of movement, as distinct from the perception of movement. The experience, unlike the perception, did not result in a motion aftereffect in depth. PMID:27648213
NASA Astrophysics Data System (ADS)
Kiso, Atsushi; Seki, Hirokazu
This paper describes a method for discriminating of the human forearm motions based on the myoelectric signals using an adaptive fuzzy inference system. In conventional studies, the neural network is often used to estimate motion intention by the myoelectric signals and realizes the high discrimination precision. On the other hand, this study uses the fuzzy inference for a human forearm motion discrimination based on the myoelectric signals. This study designs the membership function and the fuzzy rules using the average value and the standard deviation of the root mean square of the myoelectric potential for every channel of each motion. In addition, the characteristics of the myoelectric potential gradually change as a result of the muscle fatigue. Therefore, the motion discrimination should be performed by taking muscle fatigue into consideration. This study proposes a method to redesign the fuzzy inference system such that dynamic change of the myoelectric potential because of the muscle fatigue will be taken into account. Some experiments carried out using a myoelectric hand simulator show the effectiveness of the proposed motion discrimination method.
Motion compensated shape error concealment.
Schuster, Guido M; Katsaggelos, Aggelos K
2006-02-01
The introduction of Video Objects (VOs) is one of the innovations of MPEG-4. The alpha-plane of a VO defines its shape at a given instance in time and hence determines the boundary of its texture. In packet-based networks, shape, motion, and texture are subject to loss. While there has been considerable attention paid to the concealment of texture and motion errors, little has been done in the field of shape error concealment. In this paper we propose a post-processing shape error concealment technique that uses the motion compensated boundary information of the previously received alpha-plane. The proposed approach is based on matching received boundary segments in the current frame to the boundary in the previous frame. This matching is achieved by finding a maximally smooth motion vector field. After the current boundary segments are matched to the previous boundary, the missing boundary pieces are reconstructed by motion compensation. Experimental results demonstrating the performance of the proposed motion compensated shape error concealment method, and comparing it with the previously proposed weighted side matching method are presented.
Improved frame-based estimation of head motion in PET brain imaging
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mukherjee, J. M., E-mail: joyeeta.mitra@umassmed.edu; Lindsay, C.; King, M. A.
Purpose: Head motion during PET brain imaging can cause significant degradation of image quality. Several authors have proposed ways to compensate for PET brain motion to restore image quality and improve quantitation. Head restraints can reduce movement but are unreliable; thus the need for alternative strategies such as data-driven motion estimation or external motion tracking. Herein, the authors present a data-driven motion estimation method using a preprocessing technique that allows the usage of very short duration frames, thus reducing the intraframe motion problem commonly observed in the multiple frame acquisition method. Methods: The list mode data for PET acquisition ismore » uniformly divided into 5-s frames and images are reconstructed without attenuation correction. Interframe motion is estimated using a 3D multiresolution registration algorithm and subsequently compensated for. For this study, the authors used 8 PET brain studies that used F-18 FDG as the tracer and contained minor or no initial motion. After reconstruction and prior to motion estimation, known motion was introduced to each frame to simulate head motion during a PET acquisition. To investigate the trade-off in motion estimation and compensation with respect to frames of different length, the authors summed 5-s frames accordingly to produce 10 and 60 s frames. Summed images generated from the motion-compensated reconstructed frames were then compared to the original PET image reconstruction without motion compensation. Results: The authors found that our method is able to compensate for both gradual and step-like motions using frame times as short as 5 s with a spatial accuracy of 0.2 mm on average. Complex volunteer motion involving all six degrees of freedom was estimated with lower accuracy (0.3 mm on average) than the other types investigated. Preprocessing of 5-s images was necessary for successful image registration. Since their method utilizes nonattenuation corrected frames, it is not susceptible to motion introduced between CT and PET acquisitions. Conclusions: The authors have shown that they can estimate motion for frames with time intervals as short as 5 s using nonattenuation corrected reconstructed FDG PET brain images. Intraframe motion in 60-s frames causes degradation of accuracy to about 2 mm based on the motion type.« less
Improved frame-based estimation of head motion in PET brain imaging
Mukherjee, J. M.; Lindsay, C.; Mukherjee, A.; Olivier, P.; Shao, L.; King, M. A.; Licho, R.
2016-01-01
Purpose: Head motion during PET brain imaging can cause significant degradation of image quality. Several authors have proposed ways to compensate for PET brain motion to restore image quality and improve quantitation. Head restraints can reduce movement but are unreliable; thus the need for alternative strategies such as data-driven motion estimation or external motion tracking. Herein, the authors present a data-driven motion estimation method using a preprocessing technique that allows the usage of very short duration frames, thus reducing the intraframe motion problem commonly observed in the multiple frame acquisition method. Methods: The list mode data for PET acquisition is uniformly divided into 5-s frames and images are reconstructed without attenuation correction. Interframe motion is estimated using a 3D multiresolution registration algorithm and subsequently compensated for. For this study, the authors used 8 PET brain studies that used F-18 FDG as the tracer and contained minor or no initial motion. After reconstruction and prior to motion estimation, known motion was introduced to each frame to simulate head motion during a PET acquisition. To investigate the trade-off in motion estimation and compensation with respect to frames of different length, the authors summed 5-s frames accordingly to produce 10 and 60 s frames. Summed images generated from the motion-compensated reconstructed frames were then compared to the original PET image reconstruction without motion compensation. Results: The authors found that our method is able to compensate for both gradual and step-like motions using frame times as short as 5 s with a spatial accuracy of 0.2 mm on average. Complex volunteer motion involving all six degrees of freedom was estimated with lower accuracy (0.3 mm on average) than the other types investigated. Preprocessing of 5-s images was necessary for successful image registration. Since their method utilizes nonattenuation corrected frames, it is not susceptible to motion introduced between CT and PET acquisitions. Conclusions: The authors have shown that they can estimate motion for frames with time intervals as short as 5 s using nonattenuation corrected reconstructed FDG PET brain images. Intraframe motion in 60-s frames causes degradation of accuracy to about 2 mm based on the motion type. PMID:27147355
1991-09-01
description of motion sickness will be based on the assumption that only one peculiar thing happens: a poison response is provoked by motion. Common sense...available for study , because it can be produced for study without the complicating presence of a poison. It is produced by a motion stimulus that...34nausea occurred only during gastric relaxation and hypomotility" (26). The electrical activity of the gut has also been studied during motion
Analysis of accelerated motion in the theory of relativity
NASA Technical Reports Server (NTRS)
Jones, R. T.
1976-01-01
Conventional treatments of accelerated motion in the theory of relativity have led to certain difficulties of interpretation. Certain reversals in the apparent gravitational field of an accelerated body may be avoided by simpler analysis based on the use of restricted conformal transformations. In the conformal theory the velocity of light remains constant even for experimenters in accelerated motion. The problem considered is that of rectilinear motion with a variable velocity. The motion takes place along the x or x' axis of two coordinate systems.
Dove, Erica; Astell, Arlene J
2017-01-11
The number of people living with dementia and mild cognitive impairment (MCI) is increasing substantially. Although there are many research efforts directed toward the prevention and treatment of dementia and MCI, it is also important to learn more about supporting people to live well with dementia or MCI through cognitive, physical, and leisure means. While past research suggests that technology can be used to support positive aging for people with dementia or MCI, the use of motion-based technology has not been thoroughly explored with this population. The aim of this study was to identify and synthesize the current literature involving the use of motion-based technology for people living with dementia or MCI by identifying themes while noting areas requiring further research. A systematic review of studies involving the use of motion-based technology for human participants living with dementia or MCI was conducted. A total of 31 articles met the inclusion criteria. Five questions are addressed concerning (1) context of use; (2) population included (ie, dementia, MCI, or both); (3) hardware and software selection; (4) use of motion-based technology in a group or individual setting; and (5) details about the introduction, teaching, and support methods applied when using the motion-based technology with people living with dementia or MCI. The findings of this review confirm the potential of motion-based technology to improve the lives of people living with dementia or MCI. The use of this technology also spans across several contexts including cognitive, physical, and leisure; all of which support multidimensional well-being. The literature provides evidence that people living with dementia or MCI can learn how to use this technology and that they enjoy doing so. However, there is a lack of information provided in the literature regarding the introduction, training, and support methods applied when using this form of technology with this population. Future research should address the appropriate introduction, teaching, and support required for people living with dementia or MCI to use the motion-based technology. In addition, it is recommended that the diverse needs of these specific end-users be considered in the design and development of this technology. ©Erica Dove, Arlene J Astell. Originally published in the Journal of Medical Internet Research (http://www.jmir.org), 11.01.2017.
Astell, Arlene J
2017-01-01
Background The number of people living with dementia and mild cognitive impairment (MCI) is increasing substantially. Although there are many research efforts directed toward the prevention and treatment of dementia and MCI, it is also important to learn more about supporting people to live well with dementia or MCI through cognitive, physical, and leisure means. While past research suggests that technology can be used to support positive aging for people with dementia or MCI, the use of motion-based technology has not been thoroughly explored with this population. Objective The aim of this study was to identify and synthesize the current literature involving the use of motion-based technology for people living with dementia or MCI by identifying themes while noting areas requiring further research. Methods A systematic review of studies involving the use of motion-based technology for human participants living with dementia or MCI was conducted. Results A total of 31 articles met the inclusion criteria. Five questions are addressed concerning (1) context of use; (2) population included (ie, dementia, MCI, or both); (3) hardware and software selection; (4) use of motion-based technology in a group or individual setting; and (5) details about the introduction, teaching, and support methods applied when using the motion-based technology with people living with dementia or MCI. Conclusions The findings of this review confirm the potential of motion-based technology to improve the lives of people living with dementia or MCI. The use of this technology also spans across several contexts including cognitive, physical, and leisure; all of which support multidimensional well-being. The literature provides evidence that people living with dementia or MCI can learn how to use this technology and that they enjoy doing so. However, there is a lack of information provided in the literature regarding the introduction, training, and support methods applied when using this form of technology with this population. Future research should address the appropriate introduction, teaching, and support required for people living with dementia or MCI to use the motion-based technology. In addition, it is recommended that the diverse needs of these specific end-users be considered in the design and development of this technology. PMID:28077346
Fukushima, Kikuro; Barnes, Graham R; Ito, Norie; Olley, Peter M; Warabi, Tateo
2014-07-01
Aging affects virtually all functions including sensory/motor and cognitive activities. While retinal image motion is the primary input for smooth-pursuit, its efficiency/accuracy depends on cognitive processes. Elderly subjects exhibit gain decrease during initial and steady-state pursuit, but reports on latencies are conflicting. Using a cue-dependent memory-based smooth-pursuit task, we identified important extra-retinal mechanisms for initial pursuit in young adults including cue information priming and extra-retinal drive components (Ito et al. in Exp Brain Res 229:23-35, 2013). We examined aging effects on parameters for smooth-pursuit using the same tasks. Elderly subjects were tested during three task conditions as previously described: memory-based pursuit, simple ramp-pursuit just to follow motion of a single spot, and popping-out of the correct spot during memory-based pursuit to enhance retinal image motion. Simple ramp-pursuit was used as a task that did not require visual motion working memory. To clarify aging effects, we then compared the results with the previous young subject data. During memory-based pursuit, elderly subjects exhibited normal working memory of cue information. Most movement-parameters including pursuit latencies differed significantly between memory-based pursuit and simple ramp-pursuit and also between young and elderly subjects. Popping-out of the correct spot motion was ineffective for enhancing initial pursuit in elderly subjects. However, the latency difference between memory-based pursuit and simple ramp-pursuit in individual subjects, which includes decision-making delay in the memory task, was similar between the two groups. Our results suggest that smooth-pursuit latencies depend on task conditions and that, although the extra-retinal mechanisms were functional for initial pursuit in elderly subjects, they were less effective.
MRI-Based Nonrigid Motion Correction in Simultaneous PET/MRI
Chun, Se Young; Reese, Timothy G.; Ouyang, Jinsong; Guerin, Bastien; Catana, Ciprian; Zhu, Xuping; Alpert, Nathaniel M.; El Fakhri, Georges
2014-01-01
Respiratory and cardiac motion is the most serious limitation to whole-body PET, resulting in spatial resolution close to 1 cm. Furthermore, motion-induced inconsistencies in the attenuation measurements often lead to significant artifacts in the reconstructed images. Gating can remove motion artifacts at the cost of increased noise. This paper presents an approach to respiratory motion correction using simultaneous PET/MRI to demonstrate initial results in phantoms, rabbits, and nonhuman primates and discusses the prospects for clinical application. Methods Studies with a deformable phantom, a free-breathing primate, and rabbits implanted with radioactive beads were performed with simultaneous PET/MRI. Motion fields were estimated from concurrently acquired tagged MR images using 2 B-spline nonrigid image registration methods and incorporated into a PET list-mode ordered-subsets expectation maximization algorithm. Using the measured motion fields to transform both the emission data and the attenuation data, we could use all the coincidence data to reconstruct any phase of the respiratory cycle. We compared the resulting SNR and the channelized Hotelling observer (CHO) detection signal-to-noise ratio (SNR) in the motion-corrected reconstruction with the results obtained from standard gating and uncorrected studies. Results Motion correction virtually eliminated motion blur without reducing SNR, yielding images with SNR comparable to those obtained by gating with 5–8 times longer acquisitions in all studies. The CHO study in dynamic phantoms demonstrated a significant improvement (166%–276%) in lesion detection SNR with MRI-based motion correction as compared with gating (P < 0.001). This improvement was 43%–92% for large motion compared with lesion detection without motion correction (P < 0.001). CHO SNR in the rabbit studies confirmed these results. Conclusion Tagged MRI motion correction in simultaneous PET/MRI significantly improves lesion detection compared with respiratory gating and no motion correction while reducing radiation dose. In vivo primate and rabbit studies confirmed the improvement in PET image quality and provide the rationale for evaluation in simultaneous whole-body PET/MRI clinical studies. PMID:22743250
Dhont, Jennifer; Vandemeulebroucke, Jef; Burghelea, Manuela; Poels, Kenneth; Depuydt, Tom; Van Den Begin, Robbe; Jaudet, Cyril; Collen, Christine; Engels, Benedikt; Reynders, Truus; Boussaer, Marlies; Gevaert, Thierry; De Ridder, Mark; Verellen, Dirk
2018-02-01
To evaluate the short and long-term variability of breathing induced tumor motion. 3D tumor motion of 19 lung and 18 liver lesions captured over the course of an SBRT treatment were evaluated and compared to the motion on 4D-CT. An implanted fiducial could be used for unambiguous motion information. Fast orthogonal fluoroscopy (FF) sequences, included in the treatment workflow, were used to evaluate motion during treatment. Several motion parameters were compared between different FF sequences from the same fraction to evaluate the intrafraction variability. To assess interfraction variability, amplitude and hysteresis were compared between fractions and with the 3D tumor motion registered by 4D-CT. Population based margins, necessary on top of the ITV to capture all motion variability, were calculated based on the motion captured during treatment. Baseline drift in the cranio-caudal (CC) or anterior-poster (AP) direction is significant (ie. >5 mm) for a large group of patients, in contrary to intrafraction amplitude and hysteresis variability. However, a correlation between intrafraction amplitude variability and mean motion amplitude was found (Pearson's correlation coefficient, r = 0.72, p < 10 -4 ). Interfraction variability in amplitude is significant for 46% of all lesions. As such, 4D-CT accurately captures the motion during treatment for some fractions but not for all. Accounting for motion variability during treatment increases the PTV margins in all directions, most significantly in CC from 5 mm to 13.7 mm for lung and 8.0 mm for liver. Both short-term and day-to-day tumor motion variability can be significant, especially for lesions moving with amplitudes above 7 mm. Abandoning passive motion management strategies in favor of more active ones is advised. Copyright © 2017 Elsevier B.V. All rights reserved.
Markerless motion estimation for motion-compensated clinical brain imaging
NASA Astrophysics Data System (ADS)
Kyme, Andre Z.; Se, Stephen; Meikle, Steven R.; Fulton, Roger R.
2018-05-01
Motion-compensated brain imaging can dramatically reduce the artifacts and quantitative degradation associated with voluntary and involuntary subject head motion during positron emission tomography (PET), single photon emission computed tomography (SPECT) and computed tomography (CT). However, motion-compensated imaging protocols are not in widespread clinical use for these modalities. A key reason for this seems to be the lack of a practical motion tracking technology that allows for smooth and reliable integration of motion-compensated imaging protocols in the clinical setting. We seek to address this problem by investigating the feasibility of a highly versatile optical motion tracking method for PET, SPECT and CT geometries. The method requires no attached markers, relying exclusively on the detection and matching of distinctive facial features. We studied the accuracy of this method in 16 volunteers in a mock imaging scenario by comparing the estimated motion with an accurate marker-based method used in applications such as image guided surgery. A range of techniques to optimize performance of the method were also studied. Our results show that the markerless motion tracking method is highly accurate (<2 mm discrepancy against a benchmarking system) on an ethnically diverse range of subjects and, moreover, exhibits lower jitter and estimation of motion over a greater range than some marker-based methods. Our optimization tests indicate that the basic pose estimation algorithm is very robust but generally benefits from rudimentary background masking. Further marginal gains in accuracy can be achieved by accounting for non-rigid motion of features. Efficiency gains can be achieved by capping the number of features used for pose estimation provided that these features adequately sample the range of head motion encountered in the study. These proof-of-principle data suggest that markerless motion tracking is amenable to motion-compensated brain imaging and holds good promise for a practical implementation in clinical PET, SPECT and CT systems.
O'Connell, Dylan; Shaverdian, Narek; Kishan, Amar U; Thomas, David H; Dou, Tai H; Lewis, John H; Lamb, James M; Cao, Minsong; Tenn, Stephen; Percy, Lee P; Low, Daniel A
To compare lung tumor motion measured with a model-based technique to commercial 4-dimensional computed tomography (4DCT) scans and describe a workflow for using model-based 4DCT as a clinical simulation protocol. Twenty patients were imaged using a model-based technique and commercial 4DCT. Tumor motion was measured on each commercial 4DCT dataset and was calculated on model-based datasets for 3 breathing amplitude percentile intervals: 5th to 85th, 5th to 95th, and 0th to 100th. Internal target volumes (ITVs) were defined on the 4DCT and 5th to 85th interval datasets and compared using Dice similarity. Images were evaluated for noise and rated by 2 radiation oncologists for artifacts. Mean differences in tumor motion magnitude between commercial and model-based images were 0.47 ± 3.0, 1.63 ± 3.17, and 5.16 ± 4.90 mm for the 5th to 85th, 5th to 95th, and 0th to 100th amplitude intervals, respectively. Dice coefficients between ITVs defined on commercial and 5th to 85th model-based images had a mean value of 0.77 ± 0.09. Single standard deviation image noise was 11.6 ± 9.6 HU in the liver and 6.8 ± 4.7 HU in the aorta for the model-based images compared with 57.7 ± 30 and 33.7 ± 15.4 for commercial 4DCT. Mean model error within the ITV regions was 1.71 ± 0.81 mm. Model-based images exhibited reduced presence of artifacts at the tumor compared with commercial images. Tumor motion measured with the model-based technique using the 5th to 85th percentile breathing amplitude interval corresponded more closely to commercial 4DCT than the 5th to 95th or 0th to 100th intervals, which showed greater motion on average. The model-based technique tended to display increased tumor motion when breathing amplitude intervals wider than 5th to 85th were used because of the influence of unusually deep inhalations. These results suggest that care must be taken in selecting the appropriate interval during image generation when using model-based 4DCT methods. Copyright © 2017 American Society for Radiation Oncology. Published by Elsevier Inc. All rights reserved.
On a PCA-based lung motion model
NASA Astrophysics Data System (ADS)
Li, Ruijiang; Lewis, John H.; Jia, Xun; Zhao, Tianyu; Liu, Weifeng; Wuenschel, Sara; Lamb, James; Yang, Deshan; Low, Daniel A.; Jiang, Steve B.
2011-09-01
Respiration-induced organ motion is one of the major uncertainties in lung cancer radiotherapy and is crucial to be able to accurately model the lung motion. Most work so far has focused on the study of the motion of a single point (usually the tumor center of mass), and much less work has been done to model the motion of the entire lung. Inspired by the work of Zhang et al (2007 Med. Phys. 34 4772-81), we believe that the spatiotemporal relationship of the entire lung motion can be accurately modeled based on principle component analysis (PCA) and then a sparse subset of the entire lung, such as an implanted marker, can be used to drive the motion of the entire lung (including the tumor). The goal of this work is twofold. First, we aim to understand the underlying reason why PCA is effective for modeling lung motion and find the optimal number of PCA coefficients for accurate lung motion modeling. We attempt to address the above important problems both in a theoretical framework and in the context of real clinical data. Second, we propose a new method to derive the entire lung motion using a single internal marker based on the PCA model. The main results of this work are as follows. We derived an important property which reveals the implicit regularization imposed by the PCA model. We then studied the model using two mathematical respiratory phantoms and 11 clinical 4DCT scans for eight lung cancer patients. For the mathematical phantoms with cosine and an even power (2n) of cosine motion, we proved that 2 and 2n PCA coefficients and eigenvectors will completely represent the lung motion, respectively. Moreover, for the cosine phantom, we derived the equivalence conditions for the PCA motion model and the physiological 5D lung motion model (Low et al 2005 Int. J. Radiat. Oncol. Biol. Phys. 63 921-9). For the clinical 4DCT data, we demonstrated the modeling power and generalization performance of the PCA model. The average 3D modeling error using PCA was within 1 mm (0.7 ± 0.1 mm). When a single artificial internal marker was used to derive the lung motion, the average 3D error was found to be within 2 mm (1.8 ± 0.3 mm) through comprehensive statistical analysis. The optimal number of PCA coefficients needs to be determined on a patient-by-patient basis and two PCA coefficients seem to be sufficient for accurate modeling of the lung motion for most patients. In conclusion, we have presented thorough theoretical analysis and clinical validation of the PCA lung motion model. The feasibility of deriving the entire lung motion using a single marker has also been demonstrated on clinical data using a simulation approach.
Asymptotically Optimal Motion Planning for Learned Tasks Using Time-Dependent Cost Maps
Bowen, Chris; Ye, Gu; Alterovitz, Ron
2015-01-01
In unstructured environments in people’s homes and workspaces, robots executing a task may need to avoid obstacles while satisfying task motion constraints, e.g., keeping a plate of food level to avoid spills or properly orienting a finger to push a button. We introduce a sampling-based method for computing motion plans that are collision-free and minimize a cost metric that encodes task motion constraints. Our time-dependent cost metric, learned from a set of demonstrations, encodes features of a task’s motion that are consistent across the demonstrations and, hence, are likely required to successfully execute the task. Our sampling-based motion planner uses the learned cost metric to compute plans that simultaneously avoid obstacles and satisfy task constraints. The motion planner is asymptotically optimal and minimizes the Mahalanobis distance between the planned trajectory and the distribution of demonstrations in a feature space parameterized by the locations of task-relevant objects. The motion planner also leverages the distribution of the demonstrations to significantly reduce plan computation time. We demonstrate the method’s effectiveness and speed using a small humanoid robot performing tasks requiring both obstacle avoidance and satisfaction of learned task constraints. Note to Practitioners Motivated by the desire to enable robots to autonomously operate in cluttered home and workplace environments, this paper presents an approach for intuitively training a robot in a manner that enables it to repeat the task in novel scenarios and in the presence of unforeseen obstacles in the environment. Based on user-provided demonstrations of the task, our method learns features of the task that are consistent across the demonstrations and that we expect should be repeated by the robot when performing the task. We next present an efficient algorithm for planning robot motions to perform the task based on the learned features while avoiding obstacles. We demonstrate the effectiveness of our motion planner for scenarios requiring transferring a powder and pushing a button in environments with obstacles, and we plan to extend our results to more complex tasks in the future. PMID:26279642
Ensemble machine learning and forecasting can achieve 99% uptime for rural handpumps
Thomas, Evan A.
2017-01-01
Broken water pumps continue to impede efforts to deliver clean and economically-viable water to the global poor. The literature has demonstrated that customers’ health benefits and willingness to pay for clean water are best realized when clean water infrastructure performs extremely well (>99% uptime). In this paper, we used sensor data from 42 Afridev-brand handpumps observed for 14 months in western Kenya to demonstrate how sensors and supervised ensemble machine learning could be used to increase total fleet uptime from a best-practices baseline of about 70% to >99%. We accomplish this increase in uptime by forecasting pump failures and identifying existing failures very quickly. Comparing the costs of operating the pump per functional year over a lifetime of 10 years, we estimate that implementing this algorithm would save 7% on the levelized cost of water relative to a sensor-less scheduled maintenance program. Combined with a rigorous system for dispatching maintenance personnel, implementing this algorithm in a real-world program could significantly improve health outcomes and customers’ willingness to pay for water services. PMID:29182673
Shape memory alloy wire for self-sensing servo actuation
NASA Astrophysics Data System (ADS)
Josephine Selvarani Ruth, D.; Dhanalakshmi, K.
2017-01-01
This paper reports on the development of a straightforward approach to realise self-sensing shape memory alloy (SMA) wire actuated control. A differential electrical resistance measurement circuit (the sensorless signal conditioning (SSC) circuit) is designed; this sensing signal is directly used as the feedback for control. Antagonistic SMA wire actuators designed for servo actuation is realized in self-sensing actuation (SSA) mode for direct control with the differential electrical resistance feedback. The self-sensing scheme is established on a 1-DOF manipulator with the discrete time sliding mode controls which demonstrates good control performance, whatever be the disturbance and loading conditions. The uniqueness of this work is the design of the generic electronic SSC circuit for SMA actuated system, for measurement and control. With a concern to the implementation of self-sensing technique in SMA, this scheme retains the systematic control architecture by using the sensing signal (self-sensed, electrical resistance corresponding to the system position) for feedback, without requiring any processing as that of the methods adopted and reported previously for SSA techniques of SMA.
An optimal control strategy for two-dimensional motion camouflage with non-holonimic constraints.
Rañó, Iñaki
2012-07-01
Motion camouflage is a stealth behaviour observed both in hover-flies and in dragonflies. Existing controllers for mimicking motion camouflage generate this behaviour on an empirical basis or without considering the kinematic motion restrictions present in animal trajectories. This study summarises our formal contributions to solve the generation of motion camouflage as a non-linear optimal control problem. The dynamics of the system capture the kinematic restrictions to motion of the agents, while the performance index ensures camouflage trajectories. An extensive set of simulations support the technique, and a novel analysis of the obtained trajectories contributes to our understanding of possible mechanisms to obtain sensor based motion camouflage, for instance, in mobile robots.
DOE Office of Scientific and Technical Information (OSTI.GOV)
George, Rohini; Department of Biomedical Engineering, Virginia Commonwealth University, Richmond, VA; Chung, Theodore D.
2006-07-01
Purpose: Respiratory gating is a commercially available technology for reducing the deleterious effects of motion during imaging and treatment. The efficacy of gating is dependent on the reproducibility within and between respiratory cycles during imaging and treatment. The aim of this study was to determine whether audio-visual biofeedback can improve respiratory reproducibility by decreasing residual motion and therefore increasing the accuracy of gated radiotherapy. Methods and Materials: A total of 331 respiratory traces were collected from 24 lung cancer patients. The protocol consisted of five breathing training sessions spaced about a week apart. Within each session the patients initially breathedmore » without any instruction (free breathing), with audio instructions and with audio-visual biofeedback. Residual motion was quantified by the standard deviation of the respiratory signal within the gating window. Results: Audio-visual biofeedback significantly reduced residual motion compared with free breathing and audio instruction. Displacement-based gating has lower residual motion than phase-based gating. Little reduction in residual motion was found for duty cycles less than 30%; for duty cycles above 50% there was a sharp increase in residual motion. Conclusions: The efficiency and reproducibility of gating can be improved by: incorporating audio-visual biofeedback, using a 30-50% duty cycle, gating during exhalation, and using displacement-based gating.« less
Scalable Photogrammetric Motion Capture System "mosca": Development and Application
NASA Astrophysics Data System (ADS)
Knyaz, V. A.
2015-05-01
Wide variety of applications (from industrial to entertainment) has a need for reliable and accurate 3D information about motion of an object and its parts. Very often the process of movement is rather fast as in cases of vehicle movement, sport biomechanics, animation of cartoon characters. Motion capture systems based on different physical principles are used for these purposes. The great potential for obtaining high accuracy and high degree of automation has vision-based system due to progress in image processing and analysis. Scalable inexpensive motion capture system is developed as a convenient and flexible tool for solving various tasks requiring 3D motion analysis. It is based on photogrammetric techniques of 3D measurements and provides high speed image acquisition, high accuracy of 3D measurements and highly automated processing of captured data. Depending on the application the system can be easily modified for different working areas from 100 mm to 10 m. The developed motion capture system uses from 2 to 4 technical vision cameras for video sequences of object motion acquisition. All cameras work in synchronization mode at frame rate up to 100 frames per second under the control of personal computer providing the possibility for accurate calculation of 3D coordinates of interest points. The system was used for a set of different applications fields and demonstrated high accuracy and high level of automation.
Hand interception of occluded motion in humans: a test of model-based vs. on-line control
Zago, Myrka; Lacquaniti, Francesco
2015-01-01
Two control schemes have been hypothesized for the manual interception of fast visual targets. In the model-free on-line control, extrapolation of target motion is based on continuous visual information, without resorting to physical models. In the model-based control, instead, a prior model of target motion predicts the future spatiotemporal trajectory. To distinguish between the two hypotheses in the case of projectile motion, we asked participants to hit a ball that rolled down an incline at 0.2 g and then fell in air at 1 g along a parabola. By varying starting position, ball velocity and trajectory differed between trials. Motion on the incline was always visible, whereas parabolic motion was either visible or occluded. We found that participants were equally successful at hitting the falling ball in both visible and occluded conditions. Moreover, in different trials the intersection points were distributed along the parabolic trajectories of the ball, indicating that subjects were able to extrapolate an extended segment of the target trajectory. Remarkably, this trend was observed even at the very first repetition of movements. These results are consistent with the hypothesis of model-based control, but not with on-line control. Indeed, ball path and speed during the occlusion could not be extrapolated solely from the kinematic information obtained during the preceding visible phase. The only way to extrapolate ball motion correctly during the occlusion was to assume that the ball would fall under gravity and air drag when hidden from view. Such an assumption had to be derived from prior experience. PMID:26133803
Beigi, Parmida; Rohling, Robert; Salcudean, Septimiu E; Ng, Gary C
2017-11-01
This paper presents a new micro-motion-based approach to track a needle in ultrasound images captured by a handheld transducer. We propose a novel learning-based framework to track a handheld needle by detecting microscale variations of motion dynamics over time. The current state of the art on using motion analysis for needle detection uses absolute motion and hence work well only when the transducer is static. We have introduced and evaluated novel spatiotemporal and spectral features, obtained from the phase image, in a self-supervised tracking framework to improve the detection accuracy in the subsequent frames using incremental training. Our proposed tracking method involves volumetric feature selection and differential flow analysis to incorporate the neighboring pixels and mitigate the effects of the subtle tremor motion of a handheld transducer. To evaluate the detection accuracy, the method is tested on porcine tissue in-vivo, during the needle insertion in the biceps femoris muscle. Experimental results show the mean, standard deviation and root-mean-square errors of [Formula: see text], [Formula: see text] and [Formula: see text] in the insertion angle, and 0.82, 1.21, 1.47 mm, in the needle tip, respectively. Compared to the appearance-based detection approaches, the proposed method is especially suitable for needles with ultrasonic characteristics that are imperceptible in the static image and to the naked eye.
Study of the Navigation Method for a Snake Robot Based on the Kinematics Model with MEMS IMU.
Zhao, Xu; Dou, Lihua; Su, Zhong; Liu, Ning
2018-03-16
A snake robot is a type of highly redundant mobile robot that significantly differs from a tracked robot, wheeled robot and legged robot. To address the issue of a snake robot performing self-localization in the application environment without assistant orientation, an autonomous navigation method is proposed based on the snake robot's motion characteristic constraints. The method realized the autonomous navigation of the snake robot with non-nodes and an external assistant using its own Micro-Electromechanical-Systems (MEMS) Inertial-Measurement-Unit (IMU). First, it studies the snake robot's motion characteristics, builds the kinematics model, and then analyses the motion constraint characteristics and motion error propagation properties. Second, it explores the snake robot's navigation layout, proposes a constraint criterion and the fixed relationship, and makes zero-state constraints based on the motion features and control modes of a snake robot. Finally, it realizes autonomous navigation positioning based on the Extended-Kalman-Filter (EKF) position estimation method under the constraints of its motion characteristics. With the self-developed snake robot, the test verifies the proposed method, and the position error is less than 5% of Total-Traveled-Distance (TDD). In a short-distance environment, this method is able to meet the requirements of a snake robot in order to perform autonomous navigation and positioning in traditional applications and can be extended to other familiar multi-link robots.
Kasagi, M; Fujita, K; Tsuji, M; Takewaki, I
2016-02-01
A base-isolated building may sometimes exhibit an undesirable large response to a long-duration, long-period earthquake ground motion and a connected building system without base-isolation may show a large response to a near-fault (rather high-frequency) earthquake ground motion. To overcome both deficiencies, a new hybrid control system of base-isolation and building-connection is proposed and investigated. In this new hybrid building system, a base-isolated building is connected to a stiffer free wall with oil dampers. It has been demonstrated in a preliminary research that the proposed hybrid system is effective both for near-fault (rather high-frequency) and long-duration, long-period earthquake ground motions and has sufficient redundancy and robustness for a broad range of earthquake ground motions.An automatic generation algorithm of this kind of smart structures of base-isolation and building-connection hybrid systems is presented in this paper. It is shown that, while the proposed algorithm does not work well in a building without the connecting-damper system, it works well in the proposed smart hybrid system with the connecting damper system.
Xie, Jun; Xu, Guanghua; Wang, Jing; Li, Min; Han, Chengcheng; Jia, Yaguang
Steady-state visual evoked potentials (SSVEP) based paradigm is a conventional BCI method with the advantages of high information transfer rate, high tolerance to artifacts and the robust performance across users. But the occurrence of mental load and fatigue when users stare at flickering stimuli is a critical problem in implementation of SSVEP-based BCIs. Based on electroencephalography (EEG) power indices α, θ, θ + α, ratio index θ/α and response properties of amplitude and SNR, this study quantitatively evaluated the mental load and fatigue in both of conventional flickering and the novel motion-reversal visual attention tasks. Results over nine subjects revealed significant mental load alleviation in motion-reversal task rather than flickering task. The interaction between factors of "stimulation type" and "fatigue level" also illustrated the motion-reversal stimulation as a superior anti-fatigue solution for long-term BCI operation. Taken together, our work provided an objective method favorable for the design of more practically applicable steady-state evoked potential based BCIs.
Internal twisting motion dependent conductance of an aperiodic DNA molecule
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta
The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less
Variable disparity-motion estimation based fast three-view video coding
NASA Astrophysics Data System (ADS)
Bae, Kyung-Hoon; Kim, Seung-Cheol; Hwang, Yong Seok; Kim, Eun-Soo
2009-02-01
In this paper, variable disparity-motion estimation (VDME) based 3-view video coding is proposed. In the encoding, key-frame coding (KFC) based motion estimation and variable disparity estimation (VDE) for effectively fast three-view video encoding are processed. These proposed algorithms enhance the performance of 3-D video encoding/decoding system in terms of accuracy of disparity estimation and computational overhead. From some experiments, stereo sequences of 'Pot Plant' and 'IVO', it is shown that the proposed algorithm's PSNRs is 37.66 and 40.55 dB, and the processing time is 0.139 and 0.124 sec/frame, respectively.
NASA Astrophysics Data System (ADS)
Mastmeyer, Andre; Wilms, Matthias; Handels, Heinz
2018-03-01
Virtual reality (VR) training simulators of liver needle insertion in the hepatic area of breathing virtual patients often need 4D image data acquisitions as a prerequisite. Here, first a population-based breathing virtual patient 4D atlas is built and second the requirement of a dose-relevant or expensive acquisition of a 4D CT or MRI data set for a new patient can be mitigated by warping the mean atlas motion. The breakthrough contribution of this work is the construction and reuse of population-based, learned 4D motion models.
Modeling respiratory mechanics in the MCAT and spline-based MCAT phantoms
NASA Astrophysics Data System (ADS)
Segars, W. P.; Lalush, D. S.; Tsui, B. M. W.
2001-02-01
Respiratory motion can cause artifacts in myocardial SPECT and computed tomography (CT). The authors incorporate models of respiratory mechanics into the current 4D MCAT and into the next generation spline-based MCAT phantoms. In order to simulate respiratory motion in the current MCAT phantom, the geometric solids for the diaphragm, heart, ribs, and lungs were altered through manipulation of parameters defining them. Affine transformations were applied to the control points defining the same respiratory structures in the spline-based MCAT phantom to simulate respiratory motion. The Non-Uniform Rational B-Spline (NURBS) surfaces for the lungs and body outline were constructed in such a way as to be linked to the surrounding ribs. Expansion and contraction of the thoracic cage then coincided with expansion and contraction of the lungs and body. The changes both phantoms underwent were spline-interpolated over time to create time continuous 4D respiratory models. The authors then used the geometry-based and spline-based MCAT phantoms in an initial simulation study of the effects of respiratory motion on myocardial SPECT. The simulated reconstructed images demonstrated distinct artifacts in the inferior region of the myocardium. It is concluded that both respiratory models can be effective tools for researching effects of respiratory motion.
Video-based respiration monitoring with automatic region of interest detection.
Janssen, Rik; Wang, Wenjin; Moço, Andreia; de Haan, Gerard
2016-01-01
Vital signs monitoring is ubiquitous in clinical environments and emerging in home-based healthcare applications. Still, since current monitoring methods require uncomfortable sensors, respiration rate remains the least measured vital sign. In this paper, we propose a video-based respiration monitoring method that automatically detects a respiratory region of interest (RoI) and signal using a camera. Based on the observation that respiration induced chest/abdomen motion is an independent motion system in a video, our basic idea is to exploit the intrinsic properties of respiration to find the respiratory RoI and extract the respiratory signal via motion factorization. We created a benchmark dataset containing 148 video sequences obtained on adults under challenging conditions and also neonates in the neonatal intensive care unit (NICU). The measurements obtained by the proposed video respiration monitoring (VRM) method are not significantly different from the reference methods (guided breathing or contact-based ECG; p-value = 0.6), and explain more than 99% of the variance of the reference values with low limits of agreement (-2.67 to 2.81 bpm). VRM seems to provide a valid solution to ECG in confined motion scenarios, though precision may be reduced for neonates. More studies are needed to validate VRM under challenging recording conditions, including upper-body motion types.
High School Students' Understanding of Projectile Motion Concepts
ERIC Educational Resources Information Center
Dilber, Refik; Karaman, Ibrahim; Duzgun, Bahattin
2009-01-01
The aim of this study was to investigate the effectiveness of conceptual change-based instruction and traditionally designed physics instruction on students' understanding of projectile motion concepts. Misconceptions related to projectile motion concepts were determined by related literature on this subject. Accordingly, the Projectile Motion…
NASA Astrophysics Data System (ADS)
Sousa, Teresa; Amaral, Carlos; Andrade, João; Pires, Gabriel; Nunes, Urbano J.; Castelo-Branco, Miguel
2017-08-01
Objective. The achievement of multiple instances of control with the same type of mental strategy represents a way to improve flexibility of brain-computer interface (BCI) systems. Here we test the hypothesis that pure visual motion imagery of an external actuator can be used as a tool to achieve three classes of electroencephalographic (EEG) based control, which might be useful in attention disorders. Approach. We hypothesize that different numbers of imagined motion alternations lead to distinctive signals, as predicted by distinct motion patterns. Accordingly, a distinct number of alternating sensory/perceptual signals would lead to distinct neural responses as previously demonstrated using functional magnetic resonance imaging (fMRI). We anticipate that differential modulations should also be observed in the EEG domain. EEG recordings were obtained from twelve participants using three imagery tasks: imagery of a static dot, imagery of a dot with two opposing motions in the vertical axis (two motion directions) and imagery of a dot with four opposing motions in vertical or horizontal axes (four directions). The data were analysed offline. Main results. An increase of alpha-band power was found in frontal and central channels as a result of visual motion imagery tasks when compared with static dot imagery, in contrast with the expected posterior alpha decreases found during simple visual stimulation. The successful classification and discrimination between the three imagery tasks confirmed that three different classes of control based on visual motion imagery can be achieved. The classification approach was based on a support vector machine (SVM) and on the alpha-band relative spectral power of a small group of six frontal and central channels. Patterns of alpha activity, as captured by single-trial SVM closely reflected imagery properties, in particular the number of imagined motion alternations. Significance. We found a new mental task based on visual motion imagery with potential for the implementation of multiclass (3) BCIs. Our results are consistent with the notion that frontal alpha synchronization is related with high internal processing demands, changing with the number of alternation levels during imagery. Together, these findings suggest the feasibility of pure visual motion imagery tasks as a strategy to achieve multiclass control systems with potential for BCI and in particular, neurofeedback applications in non-motor (attentional) disorders.
MR-assisted PET Motion Correction for eurological Studies in an Integrated MR-PET Scanner
Catana, Ciprian; Benner, Thomas; van der Kouwe, Andre; Byars, Larry; Hamm, Michael; Chonde, Daniel B.; Michel, Christian J.; El Fakhri, Georges; Schmand, Matthias; Sorensen, A. Gregory
2011-01-01
Head motion is difficult to avoid in long PET studies, degrading the image quality and offsetting the benefit of using a high-resolution scanner. As a potential solution in an integrated MR-PET scanner, the simultaneously acquired MR data can be used for motion tracking. In this work, a novel data processing and rigid-body motion correction (MC) algorithm for the MR-compatible BrainPET prototype scanner is described and proof-of-principle phantom and human studies are presented. Methods To account for motion, the PET prompts and randoms coincidences as well as the sensitivity data are processed in the line or response (LOR) space according to the MR-derived motion estimates. After sinogram space rebinning, the corrected data are summed and the motion corrected PET volume is reconstructed from these sinograms and the attenuation and scatter sinograms in the reference position. The accuracy of the MC algorithm was first tested using a Hoffman phantom. Next, human volunteer studies were performed and motion estimates were obtained using two high temporal resolution MR-based motion tracking techniques. Results After accounting for the physical mismatch between the two scanners, perfectly co-registered MR and PET volumes are reproducibly obtained. The MR output gates inserted in to the PET list-mode allow the temporal correlation of the two data sets within 0.2 s. The Hoffman phantom volume reconstructed processing the PET data in the LOR space was similar to the one obtained processing the data using the standard methods and applying the MC in the image space, demonstrating the quantitative accuracy of the novel MC algorithm. In human volunteer studies, motion estimates were obtained from echo planar imaging and cloverleaf navigator sequences every 3 seconds and 20 ms, respectively. Substantially improved PET images with excellent delineation of specific brain structures were obtained after applying the MC using these MR-based estimates. Conclusion A novel MR-based MC algorithm was developed for the integrated MR-PET scanner. High temporal resolution MR-derived motion estimates (obtained while simultaneously acquiring anatomical or functional MR data) can be used for PET MC. An MR-based MC has the potential to improve PET as a quantitative method, increasing its reliability and reproducibility which could benefit a large number of neurological applications. PMID:21189415
NASA Astrophysics Data System (ADS)
Wagner, Martin G.; Laeseke, Paul F.; Schubert, Tilman; Slagowski, Jordan M.; Speidel, Michael A.; Mistretta, Charles A.
2017-03-01
Fluoroscopic image guidance for minimally invasive procedures in the thorax and abdomen suffers from respiratory and cardiac motion, which can cause severe subtraction artifacts and inaccurate image guidance. This work proposes novel techniques for respiratory motion tracking in native fluoroscopic images as well as a model based estimation of vessel deformation. This would allow compensation for respiratory motion during the procedure and therefore simplify the workflow for minimally invasive procedures such as liver embolization. The method first establishes dynamic motion models for both the contrast-enhanced vasculature and curvilinear background features based on a native (non-contrast) and a contrast-enhanced image sequence acquired prior to device manipulation, under free breathing conditions. The model of vascular motion is generated by applying the diffeomorphic demons algorithm to an automatic segmentation of the subtraction sequence. The model of curvilinear background features is based on feature tracking in the native sequence. The two models establish the relationship between the respiratory state, which is inferred from curvilinear background features, and the vascular morphology during that same respiratory state. During subsequent fluoroscopy, curvilinear feature detection is applied to determine the appropriate vessel mask to display. The result is a dynamic motioncompensated vessel mask superimposed on the fluoroscopic image. Quantitative evaluation of the proposed methods was performed using a digital 4D CT-phantom (XCAT), which provides realistic human anatomy including sophisticated respiratory and cardiac motion models. Four groups of datasets were generated, where different parameters (cycle length, maximum diaphragm motion and maximum chest expansion) were modified within each image sequence. Each group contains 4 datasets consisting of the initial native and contrast enhanced sequences as well as a sequence, where the respiratory motion is tracked. The respiratory motion tracking error was between 1.00 % and 1.09 %. The estimated dynamic vessel masks yielded a Sørensen-Dice coefficient between 0.94 and 0.96. Finally, the accuracy of the vessel contours was measured in terms of the 99th percentile of the error, which ranged between 0.64 and 0.96 mm. The presented results show that the approach is feasible for respiratory motion tracking and compensation and could therefore considerably improve the workflow of minimally invasive procedures in the thorax and abdomen
Kyme, Andre; Meikle, Steven; Baldock, Clive; Fulton, Roger
2012-08-01
Motion-compensated radiotracer imaging of fully conscious rodents represents an important paradigm shift for preclinical investigations. In such studies, if motion tracking is performed through a transparent enclosure containing the awake animal, light refraction at the interface will introduce errors in stereo pose estimation. We have performed a thorough investigation of how this impacts the accuracy of pose estimates and the resulting motion correction, and developed an efficient method to predict and correct for refraction-based error. The refraction model underlying this study was validated using a state-of-the-art motion tracking system. Refraction-based error was shown to be dependent on tracking marker size, working distance, and interface thickness and tilt. Correcting for refraction error improved the spatial resolution and quantitative accuracy of motion-corrected positron emission tomography images. Since the methods are general, they may also be useful in other contexts where data are corrupted by refraction effects. Crown Copyright © 2012. Published by Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Santos, C. Almeida; Costa, C. Oliveira; Batista, J.
2016-05-01
The paper describes a kinematic model-based solution to estimate simultaneously the calibration parameters of the vision system and the full-motion (6-DOF) of large civil engineering structures, namely of long deck suspension bridges, from a sequence of stereo images captured by digital cameras. Using an arbitrary number of images and assuming a smooth structure motion, an Iterated Extended Kalman Filter is used to recursively estimate the projection matrices of the cameras and the structure full-motion (displacement and rotation) over time, helping to meet the structure health monitoring fulfilment. Results related to the performance evaluation, obtained by numerical simulation and with real experiments, are reported. The real experiments were carried out in indoor and outdoor environment using a reduced structure model to impose controlled motions. In both cases, the results obtained with a minimum setup comprising only two cameras and four non-coplanar tracking points, showed a high accuracy results for on-line camera calibration and structure full motion estimation.
Towards Wearable A-Mode Ultrasound Sensing for Real-Time Finger Motion Recognition.
Yang, Xingchen; Sun, Xueli; Zhou, Dalin; Li, Yuefeng; Liu, Honghai
2018-06-01
It is evident that surface electromyography (sEMG) based human-machine interfaces (HMI) have inherent difficulty in predicting dexterous musculoskeletal movements such as finger motions. This paper is an attempt to investigate a plausible alternative to sEMG, ultrasound-driven HMI, for dexterous motion recognition due to its characteristic of detecting morphological changes of deep muscles and tendons. A multi-channel A-mode ultrasound lightweight device is adopted to evaluate the performance of finger motion recognition; an experiment is designed for both widely acceptable offline and online algorithms with eight able-bodied subjects employed. The experiment result presents that the offline recognition accuracy is up to 98.83% ± 0.79%. The real-time motion completion rate is 95.4% ± 8.7% and online motion selection time is 0.243 ± 0.127 s. The outcomes confirm the feasibility of A-mode ultrasound based wearable HMI and its prosperous applications in prosthetic devices, virtual reality, and remote manipulation.
Shen, Simon; Syal, Karan; Tao, Nongjian; Wang, Shaopeng
2015-12-01
We present a Single-Cell Motion Characterization System (SiCMoCS) to automatically extract bacterial cell morphological features from microscope images and use those features to automatically classify cell motion for rod shaped motile bacterial cells. In some imaging based studies, bacteria cells need to be attached to the surface for time-lapse observation of cellular processes such as cell membrane-protein interactions and membrane elasticity. These studies often generate large volumes of images. Extracting accurate bacterial cell morphology features from these images is critical for quantitative assessment. Using SiCMoCS, we demonstrated simultaneous and automated motion tracking and classification of hundreds of individual cells in an image sequence of several hundred frames. This is a significant improvement from traditional manual and semi-automated approaches to segmenting bacterial cells based on empirical thresholds, and a first attempt to automatically classify bacterial motion types for motile rod shaped bacterial cells, which enables rapid and quantitative analysis of various types of bacterial motion.
Motion sickness and otolith sensitivity - A pilot study of habituation to linear acceleration
NASA Technical Reports Server (NTRS)
Potvin, A. R.; Sadoff, M.; Billingham, J.
1977-01-01
Astronauts, particularly in Skylab flights, experienced varying degrees of motion sickness lasting 3-5 days. One possible mechanism for this motion sickness adaptation is believed to be a reduction in otolith sensitivity with an attendant reduction in sensory conflict. In an attempt to determine if this hypothesis is valid, a ground-based pilot study was conducted on a vertical linear accelerator. The extent of habituation to accelerations which initially produced motion sickness was evaluated, along with the possible value of habituation training to minimize the space motion sickness problem. Results showed that habituation occurred for 6 of the 8 subjects tested. However, in tests designed to measure dynamic and static otolith function, no significant differences between pre- and post-habituation tests were observed. Cross habituation effects to a standard Coriolis acceleration test were not significant. It is unlikely that ground-based pre-habituation to linear accelerations of the type examined would alter susceptibility to space motion sickness.
Samba: a real-time motion capture system using wireless camera sensor networks.
Oh, Hyeongseok; Cha, Geonho; Oh, Songhwai
2014-03-20
There is a growing interest in 3D content following the recent developments in 3D movies, 3D TVs and 3D smartphones. However, 3D content creation is still dominated by professionals, due to the high cost of 3D motion capture instruments. The availability of a low-cost motion capture system will promote 3D content generation by general users and accelerate the growth of the 3D market. In this paper, we describe the design and implementation of a real-time motion capture system based on a portable low-cost wireless camera sensor network. The proposed system performs motion capture based on the data-driven 3D human pose reconstruction method to reduce the computation time and to improve the 3D reconstruction accuracy. The system can reconstruct accurate 3D full-body poses at 16 frames per second using only eight markers on the subject's body. The performance of the motion capture system is evaluated extensively in experiments.
The lucky image-motion prediction for simple scene observation based soft-sensor technology
NASA Astrophysics Data System (ADS)
Li, Yan; Su, Yun; Hu, Bin
2015-08-01
High resolution is important to earth remote sensors, while the vibration of the platforms of the remote sensors is a major factor restricting high resolution imaging. The image-motion prediction and real-time compensation are key technologies to solve this problem. For the reason that the traditional autocorrelation image algorithm cannot meet the demand for the simple scene image stabilization, this paper proposes to utilize soft-sensor technology in image-motion prediction, and focus on the research of algorithm optimization in imaging image-motion prediction. Simulations results indicate that the improving lucky image-motion stabilization algorithm combining the Back Propagation Network (BP NN) and support vector machine (SVM) is the most suitable for the simple scene image stabilization. The relative error of the image-motion prediction based the soft-sensor technology is below 5%, the training computing speed of the mathematical predication model is as fast as the real-time image stabilization in aerial photography.
The relationship between human field motion and preferred visible wavelengths.
Benedict, S C; Burge, J M
1990-01-01
The purpose of this study was to investigate the relationship between human field motion and preferred visible wavelengths. The study was based on the principle of resonancy from Rogers' science of unitary human beings; 201 subjects were tested using a modified version of Ference's human field motion test (HFMT). Two matrices of color were projected to provide an environment for the measurement of preferred visible wavelengths. There was no statistically significant relationship (r = 0.0387, p = 0.293) between scores on the human field motion test and preferred visible wavelengths as measured in nanometers. The Rogerian concept of accelerated human field rhythms being coordinate with higher frequency environment patterns was not supported in this study. Questions concerning the validity of the HFMT were expressed and were based upon the ambiguity of the terminology of the instrument and the lack of understanding of the concepts used to describe human field motion. Recommendations include the use of other methods to study Rogers' framework, and the development of other instrumentation to measure human field motion.
Samba: A Real-Time Motion Capture System Using Wireless Camera Sensor Networks
Oh, Hyeongseok; Cha, Geonho; Oh, Songhwai
2014-01-01
There is a growing interest in 3D content following the recent developments in 3D movies, 3D TVs and 3D smartphones. However, 3D content creation is still dominated by professionals, due to the high cost of 3D motion capture instruments. The availability of a low-cost motion capture system will promote 3D content generation by general users and accelerate the growth of the 3D market. In this paper, we describe the design and implementation of a real-time motion capture system based on a portable low-cost wireless camera sensor network. The proposed system performs motion capture based on the data-driven 3D human pose reconstruction method to reduce the computation time and to improve the 3D reconstruction accuracy. The system can reconstruct accurate 3D full-body poses at 16 frames per second using only eight markers on the subject's body. The performance of the motion capture system is evaluated extensively in experiments. PMID:24658618
Multiscale turbulence models based on convected fluid microstructure
NASA Astrophysics Data System (ADS)
Holm, Darryl D.; Tronci, Cesare
2012-11-01
The Euler-Poincaré approach to complex fluids is used to derive multiscale equations for computationally modeling Euler flows as a basis for modeling turbulence. The model is based on a kinematic sweeping ansatz (KSA) which assumes that the mean fluid flow serves as a Lagrangian frame of motion for the fluctuation dynamics. Thus, we regard the motion of a fluid parcel on the computationally resolvable length scales as a moving Lagrange coordinate for the fluctuating (zero-mean) motion of fluid parcels at the unresolved scales. Even in the simplest two-scale version on which we concentrate here, the contributions of the fluctuating motion under the KSA to the mean motion yields a system of equations that extends known results and appears to be suitable for modeling nonlinear backscatter (energy transfer from smaller to larger scales) in turbulence using multiscale methods.
A motion sensing-based framework for robotic manipulation.
Deng, Hao; Xia, Zeyang; Weng, Shaokui; Gan, Yangzhou; Fang, Peng; Xiong, Jing
2016-01-01
To data, outside of the controlled environments, robots normally perform manipulation tasks operating with human. This pattern requires the robot operators with high technical skills training for varied teach-pendant operating system. Motion sensing technology, which enables human-machine interaction in a novel and natural interface using gestures, has crucially inspired us to adopt this user-friendly and straightforward operation mode on robotic manipulation. Thus, in this paper, we presented a motion sensing-based framework for robotic manipulation, which recognizes gesture commands captured from motion sensing input device and drives the action of robots. For compatibility, a general hardware interface layer was also developed in the framework. Simulation and physical experiments have been conducted for preliminary validation. The results have shown that the proposed framework is an effective approach for general robotic manipulation with motion sensing control.
Integrated evaluation of visually induced motion sickness in terms of autonomic nervous regulation.
Kiryu, Tohru; Tada, Gen; Toyama, Hiroshi; Iijima, Atsuhiko
2008-01-01
To evaluate visually-induced motion sickness, we integrated subjective and objective responses in terms of autonomic nervous regulation. Twenty-seven subjects viewed a 2-min-long first-person-view video section five times (total 10 min) continuously. Measured biosignals, the RR interval, respiration, and blood pressure, were used to estimate the indices related to autonomic nervous activity (ANA). Then we determined the trigger points and some sensation sections based on the time-varying behavior of ANA-related indices. We found that there was a suitable combination of biosignals to present the symptoms of visually-induced motion sickness. Based on the suitable combination, integrating trigger points and subjective scores allowed us to represent the time-distribution of subjective responses during visual exposure, and helps us to understand what types of camera motions will cause visually-induced motion sickness.
Generating Concise Rules for Human Motion Retrieval
NASA Astrophysics Data System (ADS)
Mukai, Tomohiko; Wakisaka, Ken-Ichi; Kuriyama, Shigeru
This paper proposes a method for retrieving human motion data with concise retrieval rules based on the spatio-temporal features of motion appearance. Our method first converts motion clip into a form of clausal language that represents geometrical relations between body parts and their temporal relationship. A retrieval rule is then learned from the set of manually classified examples using inductive logic programming (ILP). ILP automatically discovers the essential rule in the same clausal form with a user-defined hypothesis-testing procedure. All motions are indexed using this clausal language, and the desired clips are retrieved by subsequence matching using the rule. Such rule-based retrieval offers reasonable performance and the rule can be intuitively edited in the same language form. Consequently, our method enables efficient and flexible search from a large dataset with simple query language.
Steering particles by breaking symmetries
NASA Astrophysics Data System (ADS)
Bet, Bram; Samin, Sela; Georgiev, Rumen; Burak Eral, Huseyin; van Roij, René
2018-06-01
We derive general equations of motions for highly-confined particles that perform quasi-two-dimensional motion in Hele-Shaw channels, which we solve analytically, aiming to derive design principles for self-steering particles. Based on symmetry properties of a particle, its equations of motion can be simplified, where we retrieve an earlier-known equation of motion for the orientation of dimer particles consisting of disks (Uspal et al 2013 Nat. Commun. 4), but now in full generality. Subsequently, these solutions are compared with particle trajectories that are obtained numerically. For mirror-symmetric particles, excellent agreement between the analytical and numerical solutions is found. For particles lacking mirror symmetry, the analytic solutions provide means to classify the motion based on particle geometry, while we find that taking the side-wall interactions into account is important to accurately describe the trajectories.
Audiovisual associations alter the perception of low-level visual motion
Kafaligonul, Hulusi; Oluk, Can
2015-01-01
Motion perception is a pervasive nature of vision and is affected by both immediate pattern of sensory inputs and prior experiences acquired through associations. Recently, several studies reported that an association can be established quickly between directions of visual motion and static sounds of distinct frequencies. After the association is formed, sounds are able to change the perceived direction of visual motion. To determine whether such rapidly acquired audiovisual associations and their subsequent influences on visual motion perception are dependent on the involvement of higher-order attentive tracking mechanisms, we designed psychophysical experiments using regular and reverse-phi random dot motions isolating low-level pre-attentive motion processing. Our results show that an association between the directions of low-level visual motion and static sounds can be formed and this audiovisual association alters the subsequent perception of low-level visual motion. These findings support the view that audiovisual associations are not restricted to high-level attention based motion system and early-level visual motion processing has some potential role. PMID:25873869
Feghali, Rosario; Mitiche, Amar
2004-11-01
The purpose of this study is to investigate a method of tracking moving objects with a moving camera. This method estimates simultaneously the motion induced by camera movement. The problem is formulated as a Bayesian motion-based partitioning problem in the spatiotemporal domain of the image quence. An energy functional is derived from the Bayesian formulation. The Euler-Lagrange descent equations determine imultaneously an estimate of the image motion field induced by camera motion and an estimate of the spatiotemporal motion undary surface. The Euler-Lagrange equation corresponding to the surface is expressed as a level-set partial differential equation for topology independence and numerically stable implementation. The method can be initialized simply and can track multiple objects with nonsimultaneous motions. Velocities on motion boundaries can be estimated from geometrical properties of the motion boundary. Several examples of experimental verification are given using synthetic and real-image sequences.
Stout, Jeffrey N; Tisdall, M Dylan; McDaniel, Patrick; Gagoski, Borjan; Bolar, Divya S; Grant, Patricia Ellen; Adalsteinsson, Elfar
2017-12-01
Subject motion may cause errors in estimates of blood T 2 when using the T 2 -relaxation under spin tagging (TRUST) technique on noncompliant subjects like neonates. By incorporating 3D volume navigators (vNavs) into the TRUST pulse sequence, independent measurements of motion during scanning permit evaluation of these errors. The effects of integrated vNavs on TRUST-based T 2 estimates were evaluated using simulations and in vivo subject data. Two subjects were scanned with the TRUST+vNav sequence during prescribed movements. Mean motion scores were derived from vNavs and TRUST images, along with a metric of exponential fit quality. Regression analysis was performed between T 2 estimates and mean motion scores. Also, motion scores were determined from independent neonatal scans. vNavs negligibly affected venous blood T 2 estimates and better detected subject motion than fit quality metrics. Regression analysis showed that T 2 is biased upward by 4.1 ms per 1 mm of mean motion score. During neonatal scans, mean motion scores of 0.6 to 2.0 mm were detected. Motion during TRUST causes an overestimate of T 2 , which suggests a cautious approach when comparing TRUST-based cerebral oxygenation measurements of noncompliant subjects. Magn Reson Med 78:2283-2289, 2017. © 2017 International Society for Magnetic Resonance in Medicine. © 2017 International Society for Magnetic Resonance in Medicine.
A research on motion design for APP's loading pages based on time perception
NASA Astrophysics Data System (ADS)
Cao, Huai; Hu, Xiaoyun
2018-04-01
Due to restrictions caused by objective reasons like network bandwidth, hardware performance and etc., waiting is still an inevitable phenomenon that appears in our using mobile-terminal products. Relevant researches show that users' feelings in a waiting scenario can affect their evaluations on the whole product and services the product provides. With the development of user experience and inter-facial design subjects, the role of motion effect in the interface design has attracted more and more scholars' attention. In the current studies, the research theory of motion design in a waiting scenario is imperfect. This article will use the basic theory and experimental research methods of cognitive psychology to explore the motion design's impact on user's time perception when users are waiting for loading APP pages. Firstly, the article analyzes the factors that affect waiting experience of loading APP pages based on the theory of time perception, and then discusses motion design's impact on the level of time-perception when loading pages and its design strategy. Moreover, by the operation analysis of existing loading motion designs, the article classifies the existing loading motions and designs an experiment to verify the impact of different types of motions on the user's time perception. The result shows that the waiting time perception of mobile's terminals' APPs is related to the loading motion types, the combination type of loading motions can effectively shorten the waiting time perception as it scores a higher mean value in the length of time perception.
NASA Astrophysics Data System (ADS)
Wang, Xingjian; Shi, Cun; Wang, Shaoping
2017-07-01
Hybrid actuation system with dissimilar redundant actuators, which is composed of a hydraulic actuator (HA) and an electro-hydrostatic actuator (EHA), has been applied on modern civil aircraft to improve the reliability. However, the force fighting problem arises due to different dynamic performances between HA and EHA. This paper proposes an extended state observer (ESO)-based motion synchronisation control method. To cope with the problem of unavailability of the state signals, the well-designed ESO is utilised to observe the HA and EHA state variables which are unmeasured. In particular, the extended state of ESO can estimate the lumped effect of the unknown external disturbances acting on the control surface, the nonlinear dynamics, uncertainties, and the coupling term between HA and EHA. Based on the observed states of ESO, motion synchronisation controllers are presented to make HA and EHA to simultaneously track the desired motion trajectories, which are generated by a trajectory generator. Additionally, the unknown disturbances and the coupling terms can be compensated by using the extended state of the proposed ESO. Finally, comparative simulation results indicate that the proposed ESO-based motion synchronisation controller can achieve great force fighting reduction between HA and EHA.
NASA Astrophysics Data System (ADS)
Liu, Zengjun; Wang, Lei; Li, Kui; Gao, Jiaxin
2017-05-01
Hybrid inertial navigation system (HINS) is a new kind of inertial navigation system (INS), which combines advantages of platform INS, strap-down INS and rotational INS. HINS has a physical platform to isolate the angular motion as platform INS does, HINS also uses strap-down attitude algorithms and applies rotation modulation technique. Tri-axis HINS has three gimbals to isolate the angular motion in the dynamic base, in which way the system can reduce the effects of angular motion and improve the positioning precision. However, the angular motion will affect the compensation of some error parameters, especially for the lever arm effect. The lever arm effect caused by position errors between the accelerometers and rotation center cannot be ignored due to the rapid rotation of inertial measurement unit (IMU) and it will cause fluctuation and stage in velocity in HINS. The influences of angular motion on the lever arm effect compensation are analyzed firstly in this paper, and then the compensation method of lever arm effect based on the photoelectric encoders in dynamic base is proposed. Results of experiments on turntable show that after compensation, the fluctuations and stages in velocity curve disappear.
Global velocity constrained cloud motion prediction for short-term solar forecasting
NASA Astrophysics Data System (ADS)
Chen, Yanjun; Li, Wei; Zhang, Chongyang; Hu, Chuanping
2016-09-01
Cloud motion is the primary reason for short-term solar power output fluctuation. In this work, a new cloud motion estimation algorithm using a global velocity constraint is proposed. Compared to the most used Particle Image Velocity (PIV) algorithm, which assumes the homogeneity of motion vectors, the proposed method can capture the accurate motion vector for each cloud block, including both the motional tendency and morphological changes. Specifically, global velocity derived from PIV is first calculated, and then fine-grained cloud motion estimation can be achieved by global velocity based cloud block researching and multi-scale cloud block matching. Experimental results show that the proposed global velocity constrained cloud motion prediction achieves comparable performance to the existing PIV and filtered PIV algorithms, especially in a short prediction horizon.
Marker-free motion correction in weight-bearing cone-beam CT of the knee joint.
Berger, M; Müller, K; Aichert, A; Unberath, M; Thies, J; Choi, J-H; Fahrig, R; Maier, A
2016-03-01
To allow for a purely image-based motion estimation and compensation in weight-bearing cone-beam computed tomography of the knee joint. Weight-bearing imaging of the knee joint in a standing position poses additional requirements for the image reconstruction algorithm. In contrast to supine scans, patient motion needs to be estimated and compensated. The authors propose a method that is based on 2D/3D registration of left and right femur and tibia segmented from a prior, motion-free reconstruction acquired in supine position. Each segmented bone is first roughly aligned to the motion-corrupted reconstruction of a scan in standing or squatting position. Subsequently, a rigid 2D/3D registration is performed for each bone to each of K projection images, estimating 6 × 4 × K motion parameters. The motion of individual bones is combined into global motion fields using thin-plate-spline extrapolation. These can be incorporated into a motion-compensated reconstruction in the backprojection step. The authors performed visual and quantitative comparisons between a state-of-the-art marker-based (MB) method and two variants of the proposed method using gradient correlation (GC) and normalized gradient information (NGI) as similarity measure for the 2D/3D registration. The authors evaluated their method on four acquisitions under different squatting positions of the same patient. All methods showed substantial improvement in image quality compared to the uncorrected reconstructions. Compared to NGI and MB, the GC method showed increased streaking artifacts due to misregistrations in lateral projection images. NGI and MB showed comparable image quality at the bone regions. Because the markers are attached to the skin, the MB method performed better at the surface of the legs where the authors observed slight streaking of the NGI and GC methods. For a quantitative evaluation, the authors computed the universal quality index (UQI) for all bone regions with respect to the motion-free reconstruction. The authors quantitative evaluation over regions around the bones yielded a mean UQI of 18.4 for no correction, 53.3 and 56.1 for the proposed method using GC and NGI, respectively, and 53.7 for the MB reference approach. In contrast to the authors registration-based corrections, the MB reference method caused slight nonrigid deformations at bone outlines when compared to a motion-free reference scan. The authors showed that their method based on the NGI similarity measure yields reconstruction quality close to the MB reference method. In contrast to the MB method, the proposed method does not require any preparation prior to the examination which will improve the clinical workflow and patient comfort. Further, the authors found that the MB method causes small, nonrigid deformations at the bone outline which indicates that markers may not accurately reflect the internal motion close to the knee joint. Therefore, the authors believe that the proposed method is a promising alternative to MB motion management.
Marker-free motion correction in weight-bearing cone-beam CT of the knee joint
Berger, M.; Müller, K.; Aichert, A.; Unberath, M.; Thies, J.; Choi, J.-H.; Fahrig, R.; Maier, A.
2016-01-01
Purpose: To allow for a purely image-based motion estimation and compensation in weight-bearing cone-beam computed tomography of the knee joint. Methods: Weight-bearing imaging of the knee joint in a standing position poses additional requirements for the image reconstruction algorithm. In contrast to supine scans, patient motion needs to be estimated and compensated. The authors propose a method that is based on 2D/3D registration of left and right femur and tibia segmented from a prior, motion-free reconstruction acquired in supine position. Each segmented bone is first roughly aligned to the motion-corrupted reconstruction of a scan in standing or squatting position. Subsequently, a rigid 2D/3D registration is performed for each bone to each of K projection images, estimating 6 × 4 × K motion parameters. The motion of individual bones is combined into global motion fields using thin-plate-spline extrapolation. These can be incorporated into a motion-compensated reconstruction in the backprojection step. The authors performed visual and quantitative comparisons between a state-of-the-art marker-based (MB) method and two variants of the proposed method using gradient correlation (GC) and normalized gradient information (NGI) as similarity measure for the 2D/3D registration. Results: The authors evaluated their method on four acquisitions under different squatting positions of the same patient. All methods showed substantial improvement in image quality compared to the uncorrected reconstructions. Compared to NGI and MB, the GC method showed increased streaking artifacts due to misregistrations in lateral projection images. NGI and MB showed comparable image quality at the bone regions. Because the markers are attached to the skin, the MB method performed better at the surface of the legs where the authors observed slight streaking of the NGI and GC methods. For a quantitative evaluation, the authors computed the universal quality index (UQI) for all bone regions with respect to the motion-free reconstruction. The authors quantitative evaluation over regions around the bones yielded a mean UQI of 18.4 for no correction, 53.3 and 56.1 for the proposed method using GC and NGI, respectively, and 53.7 for the MB reference approach. In contrast to the authors registration-based corrections, the MB reference method caused slight nonrigid deformations at bone outlines when compared to a motion-free reference scan. Conclusions: The authors showed that their method based on the NGI similarity measure yields reconstruction quality close to the MB reference method. In contrast to the MB method, the proposed method does not require any preparation prior to the examination which will improve the clinical workflow and patient comfort. Further, the authors found that the MB method causes small, nonrigid deformations at the bone outline which indicates that markers may not accurately reflect the internal motion close to the knee joint. Therefore, the authors believe that the proposed method is a promising alternative to MB motion management. PMID:26936708
Patch-based frame interpolation for old films via the guidance of motion paths
NASA Astrophysics Data System (ADS)
Xia, Tianran; Ding, Youdong; Yu, Bing; Huang, Xi
2018-04-01
Due to improper preservation, traditional films will appear frame loss after digital. To deal with this problem, this paper presents a new adaptive patch-based method of frame interpolation via the guidance of motion paths. Our method is divided into three steps. Firstly, we compute motion paths between two reference frames using optical flow estimation. Then, the adaptive bidirectional interpolation with holes filled is applied to generate pre-intermediate frames. Finally, using patch match to interpolate intermediate frames with the most similar patches. Since the patch match is based on the pre-intermediate frames that contain the motion paths constraint, we show a natural and inartificial frame interpolation. We test different types of old film sequences and compare with other methods, the results prove that our method has a desired performance without hole or ghost effects.
Syal, Karan; Iriya, Rafael; Yang, Yunze; Yu, Hui; Wang, Shaopeng; Haydel, Shelley E; Chen, Hong-Yuan; Tao, Nongjian
2016-01-26
Antimicrobial susceptibility tests (ASTs) are important for confirming susceptibility to empirical antibiotics and detecting resistance in bacterial isolates. Currently, most ASTs performed in clinical microbiology laboratories are based on bacterial culturing, which take days to complete for slowly growing microorganisms. A faster AST will reduce morbidity and mortality rates and help healthcare providers administer narrow spectrum antibiotics at the earliest possible treatment stage. We report the development of a nonculture-based AST using a plasmonic imaging and tracking (PIT) technology. We track the motion of individual bacterial cells tethered to a surface with nanometer (nm) precision and correlate the phenotypic motion with bacterial metabolism and antibiotic action. We show that antibiotic action significantly slows down bacterial motion, which can be quantified for development of a rapid phenotypic-based AST.
Off-line programming motion and process commands for robotic welding of Space Shuttle main engines
NASA Technical Reports Server (NTRS)
Ruokangas, C. C.; Guthmiller, W. A.; Pierson, B. L.; Sliwinski, K. E.; Lee, J. M. F.
1987-01-01
The off-line-programming software and hardware being developed for robotic welding of the Space Shuttle main engine are described and illustrated with diagrams, drawings, graphs, and photographs. The menu-driven workstation-based interactive programming system is designed to permit generation of both motion and process commands for the robotic workcell by weld engineers (with only limited knowledge of programming or CAD systems) on the production floor. Consideration is given to the user interface, geometric-sources interfaces, overall menu structure, weld-parameter data base, and displays of run time and archived data. Ongoing efforts to address limitations related to automatic-downhand-configuration coordinated motion, a lack of source codes for the motion-control software, CAD data incompatibility, interfacing with the robotic workcell, and definition of the welding data base are discussed.
Adaptive Radiation for Lung Cancer
Gomez, Daniel R.; Chang, Joe Y.
2011-01-01
The challenges of lung cancer radiotherapy are intra/inter-fraction tumor/organ anatomy/motion changes and the need to spare surrounding critical structures. Evolving radiotherapy technologies, such as four-dimensional (4D) image-based motion management, daily on-board imaging and adaptive radiotherapy based on volumetric images over the course of radiotherapy, have enabled us to deliver higher dose to target while minimizing normal tissue toxicities. The image-guided radiotherapy adapted to changes of motion and anatomy has made the radiotherapy more precise and allowed ablative dose delivered to the target using novel treatment approaches such as intensity-modulated radiation therapy, stereotactic body radiation therapy, and proton therapy in lung cancer, techniques used to be considered very sensitive to motion change. Future clinical trials using real time tracking and biological adaptive radiotherapy based on functional images are proposed. PMID:20814539