Sample records for based transport model

  1. Eukaryotic major facilitator superfamily transporter modeling based on the prokaryotic GlpT crystal structure.

    PubMed

    Lemieux, M Joanne

    2007-01-01

    The major facilitator superfamily (MFS) of transporters represents the largest family of secondary active transporters and has a diverse range of substrates. With structural information for four MFS transporters, we can see a strong structural commonality suggesting, as predicted, a common architecture for MFS transporters. The rate for crystal structure determination of MFS transporters is slow, making modeling of both prokaryotic and eukaryotic transporters more enticing. In this review, models of eukaryotic transporters Glut1, G6PT, OCT1, OCT2 and Pho84, based on the crystal structures of the prokaryotic GlpT, based on the crystal structure of LacY are discussed. The techniques used to generate the different models are compared. In addition, the validity of these models and the strategy of using prokaryotic crystal structures to model eukaryotic proteins are discussed. For comparison, E. coli GlpT was modeled based on the E. coli LacY structure and compared to the crystal structure of GlpT demonstrating that experimental evidence is essential for accurate modeling of membrane proteins.

  2. A Process-Based Transport-Distance Model of Aeolian Transport

    NASA Astrophysics Data System (ADS)

    Naylor, A. K.; Okin, G.; Wainwright, J.; Parsons, A. J.

    2017-12-01

    We present a new approach to modeling aeolian transport based on transport distance. Particle fluxes are based on statistical probabilities of particle detachment and distributions of transport lengths, which are functions of particle size classes. A computational saltation model is used to simulate transport distances over a variety of sizes. These are fit to an exponential distribution, which has the advantages of computational economy, concordance with current field measurements, and a meaningful relationship to theoretical assumptions about mean and median particle transport distance. This novel approach includes particle-particle interactions, which are important for sustaining aeolian transport and dust emission. Results from this model are compared with results from both bulk- and particle-sized-specific transport equations as well as empirical wind tunnel studies. The transport-distance approach has been successfully used for hydraulic processes, and extending this methodology from hydraulic to aeolian transport opens up the possibility of modeling joint transport by wind and water using consistent physics. Particularly in nutrient-limited environments, modeling the joint action of aeolian and hydraulic transport is essential for understanding the spatial distribution of biomass across landscapes and how it responds to climatic variability and change.

  3. Generalized free-space diffuse photon transport model based on the influence analysis of a camera lens diaphragm.

    PubMed

    Chen, Xueli; Gao, Xinbo; Qu, Xiaochao; Chen, Duofang; Ma, Xiaopeng; Liang, Jimin; Tian, Jie

    2010-10-10

    The camera lens diaphragm is an important component in a noncontact optical imaging system and has a crucial influence on the images registered on the CCD camera. However, this influence has not been taken into account in the existing free-space photon transport models. To model the photon transport process more accurately, a generalized free-space photon transport model is proposed. It combines Lambertian source theory with analysis of the influence of the camera lens diaphragm to simulate photon transport process in free space. In addition, the radiance theorem is also adopted to establish the energy relationship between the virtual detector and the CCD camera. The accuracy and feasibility of the proposed model is validated with a Monte-Carlo-based free-space photon transport model and physical phantom experiment. A comparison study with our previous hybrid radiosity-radiance theorem based model demonstrates the improvement performance and potential of the proposed model for simulating photon transport process in free space.

  4. Reactive solute transport in streams: 1. Development of an equilibrium- based model

    USGS Publications Warehouse

    Runkel, Robert L.; Bencala, Kenneth E.; Broshears, Robert E.; Chapra, Steven C.

    1996-01-01

    An equilibrium-based solute transport model is developed for the simulation of trace metal fate and transport in streams. The model is formed by coupling a solute transport model with a chemical equilibrium submodel based on MINTEQ. The solute transport model considers the physical processes of advection, dispersion, lateral inflow, and transient storage, while the equilibrium submodel considers the speciation and complexation of aqueous species, precipitation/dissolution and sorption. Within the model, reactions in the water column may result in the formation of solid phases (precipitates and sorbed species) that are subject to downstream transport and settling processes. Solid phases on the streambed may also interact with the water column through dissolution and sorption/desorption reactions. Consideration of both mobile (water-borne) and immobile (streambed) solid phases requires a unique set of governing differential equations and solution techniques that are developed herein. The partial differential equations describing physical transport and the algebraic equations describing chemical equilibria are coupled using the sequential iteration approach.

  5. Charge carrier transport in polycrystalline organic thin film based field effect transistors

    NASA Astrophysics Data System (ADS)

    Rani, Varsha; Sharma, Akanksha; Ghosh, Subhasis

    2016-05-01

    The charge carrier transport mechanism in polycrystalline thin film based organic field effect transistors (OFETs) has been explained using two competing models, multiple trapping and releases (MTR) model and percolation model. It has been shown that MTR model is most suitable for explaining charge carrier transport in grainy polycrystalline organic thin films. The energetic distribution of traps determined independently using Mayer-Neldel rule (MNR) is in excellent agreement with the values obtained by MTR model for copper phthalocyanine and pentacene based OFETs.

  6. Littoral transport rates in the Santa Barbara Littoral Cell: a process-based model analysis

    USGS Publications Warehouse

    Elias, E. P. L.; Barnard, Patrick L.; Brocatus, John

    2009-01-01

    Identification of the sediment transport patterns and pathways is essential for sustainable coastal zone management of the heavily modified coastline of Santa Barbara and Ventura County (California, USA). A process-based model application, based on Delft3D Online Morphology, is used to investigate the littoral transport potential along the Santa Barbara Littoral Cell (between Point Conception and Mugu Canyon). An advanced optimalization procedure is applied to enable annual sediment transport computations by reducing the ocean wave climate in 10 wave height - direction classes. Modeled littoral transport rates compare well with observed dredging volumes, and erosion or sedimentation hotspots coincide with the modeled divergence and convergence of the transport gradients. Sediment transport rates are strongly dependent on the alongshore variation in wave height due to wave sheltering, diffraction and focusing by the Northern Channel Islands, and the local orientation of the geologically-controlled coastline. Local transport gradients exceed the net eastward littoral transport, and are considered a primary driver for hot-spot erosion.

  7. Safety Assessment of Dangerous Goods Transport Enterprise Based on the Relative Entropy Aggregation in Group Decision Making Model

    PubMed Central

    Wu, Jun; Li, Chengbing; Huo, Yueying

    2014-01-01

    Safety of dangerous goods transport is directly related to the operation safety of dangerous goods transport enterprise. Aiming at the problem of the high accident rate and large harm in dangerous goods logistics transportation, this paper took the group decision making problem based on integration and coordination thought into a multiagent multiobjective group decision making problem; a secondary decision model was established and applied to the safety assessment of dangerous goods transport enterprise. First of all, we used dynamic multivalue background and entropy theory building the first level multiobjective decision model. Secondly, experts were to empower according to the principle of clustering analysis, and combining with the relative entropy theory to establish a secondary rally optimization model based on relative entropy in group decision making, and discuss the solution of the model. Then, after investigation and analysis, we establish the dangerous goods transport enterprise safety evaluation index system. Finally, case analysis to five dangerous goods transport enterprises in the Inner Mongolia Autonomous Region validates the feasibility and effectiveness of this model for dangerous goods transport enterprise recognition, which provides vital decision making basis for recognizing the dangerous goods transport enterprises. PMID:25477954

  8. Safety assessment of dangerous goods transport enterprise based on the relative entropy aggregation in group decision making model.

    PubMed

    Wu, Jun; Li, Chengbing; Huo, Yueying

    2014-01-01

    Safety of dangerous goods transport is directly related to the operation safety of dangerous goods transport enterprise. Aiming at the problem of the high accident rate and large harm in dangerous goods logistics transportation, this paper took the group decision making problem based on integration and coordination thought into a multiagent multiobjective group decision making problem; a secondary decision model was established and applied to the safety assessment of dangerous goods transport enterprise. First of all, we used dynamic multivalue background and entropy theory building the first level multiobjective decision model. Secondly, experts were to empower according to the principle of clustering analysis, and combining with the relative entropy theory to establish a secondary rally optimization model based on relative entropy in group decision making, and discuss the solution of the model. Then, after investigation and analysis, we establish the dangerous goods transport enterprise safety evaluation index system. Finally, case analysis to five dangerous goods transport enterprises in the Inner Mongolia Autonomous Region validates the feasibility and effectiveness of this model for dangerous goods transport enterprise recognition, which provides vital decision making basis for recognizing the dangerous goods transport enterprises.

  9. Modeling, Monitoring and Fault Diagnosis of Spacecraft Air Contaminants

    NASA Technical Reports Server (NTRS)

    Ramirez, W. Fred; Skliar, Mikhail; Narayan, Anand; Morgenthaler, George W.; Smith, Gerald J.

    1996-01-01

    Progress and results in the development of an integrated air quality modeling, monitoring, fault detection, and isolation system are presented. The focus was on development of distributed models of the air contaminants transport, the study of air quality monitoring techniques based on the model of transport process and on-line contaminant concentration measurements, and sensor placement. Different approaches to the modeling of spacecraft air contamination are discussed, and a three-dimensional distributed parameter air contaminant dispersion model applicable to both laminar and turbulent transport is proposed. A two-dimensional approximation of a full scale transport model is also proposed based on the spatial averaging of the three dimensional model over the least important space coordinate. A computer implementation of the transport model is considered and a detailed development of two- and three-dimensional models illustrated by contaminant transport simulation results is presented. The use of a well established Kalman filtering approach is suggested as a method for generating on-line contaminant concentration estimates based on both real time measurements and the model of contaminant transport process. It is shown that high computational requirements of the traditional Kalman filter can render difficult its real-time implementation for high-dimensional transport model and a novel implicit Kalman filtering algorithm is proposed which is shown to lead to an order of magnitude faster computer implementation in the case of air quality monitoring.

  10. Unified computational model of transport in metal-insulating oxide-metal systems

    NASA Astrophysics Data System (ADS)

    Tierney, B. D.; Hjalmarson, H. P.; Jacobs-Gedrim, R. B.; Agarwal, Sapan; James, C. D.; Marinella, M. J.

    2018-04-01

    A unified physics-based model of electron transport in metal-insulator-metal (MIM) systems is presented. In this model, transport through metal-oxide interfaces occurs by electron tunneling between the metal electrodes and oxide defect states. Transport in the oxide bulk is dominated by hopping, modeled as a series of tunneling events that alter the electron occupancy of defect states. Electron transport in the oxide conduction band is treated by the drift-diffusion formalism and defect chemistry reactions link all the various transport mechanisms. It is shown that the current-limiting effect of the interface band offsets is a function of the defect vacancy concentration. These results provide insight into the underlying physical mechanisms of leakage currents in oxide-based capacitors and steady-state electron transport in resistive random access memory (ReRAM) MIM devices. Finally, an explanation of ReRAM bipolar switching behavior based on these results is proposed.

  11. The Ames two-dimensional stratosphere-mesospheric model. [chemistry and transport of SST pollution

    NASA Technical Reports Server (NTRS)

    Whitten, R. C.; Borucki, W. J.; Watson, V. R.; Capone, L. A.; Maples, A. L.; Riegel, C. A.

    1974-01-01

    A two-dimensional model of the stratosphere and mesosphere has recently been developed at Ames Research Center. The model contains chemistry based on 18 species that are solved for at each step and a seasonally-varying transport model based on both winds and eddy transport. The model is described and a preliminary assessment of the impact of supersonic aircraft flights on the ozone layer is given.

  12. Geomorphically based predictive mapping of soil thickness in upland watersheds

    NASA Astrophysics Data System (ADS)

    Pelletier, Jon D.; Rasmussen, Craig

    2009-09-01

    The hydrologic response of upland watersheds is strongly controlled by soil (regolith) thickness. Despite the need to quantify soil thickness for input into hydrologic models, there is currently no widely used, geomorphically based method for doing so. In this paper we describe and illustrate a new method for predictive mapping of soil thicknesses using high-resolution topographic data, numerical modeling, and field-based calibration. The model framework works directly with input digital elevation model data to predict soil thicknesses assuming a long-term balance between soil production and erosion. Erosion rates in the model are quantified using one of three geomorphically based sediment transport models: nonlinear slope-dependent transport, nonlinear area- and slope-dependent transport, and nonlinear depth- and slope-dependent transport. The model balances soil production and erosion locally to predict a family of solutions corresponding to a range of values of two unconstrained model parameters. A small number of field-based soil thickness measurements can then be used to calibrate the local value of those unconstrained parameters, thereby constraining which solution is applicable at a particular study site. As an illustration, the model is used to predictively map soil thicknesses in two small, ˜0.1 km2, drainage basins in the Marshall Gulch watershed, a semiarid drainage basin in the Santa Catalina Mountains of Pima County, Arizona. Field observations and calibration data indicate that the nonlinear depth- and slope-dependent sediment transport model is the most appropriate transport model for this site. The resulting framework provides a generally applicable, geomorphically based tool for predictive mapping of soil thickness using high-resolution topographic data sets.

  13. A musculo-mechanical model of esophageal transport based on an immersed boundary-finite element approach

    NASA Astrophysics Data System (ADS)

    Kou, Wenjun; Griffith, Boyce E.; Pandolfino, John E.; Kahrilas, Peter J.; Patankar, Neelesh A.

    2015-11-01

    This work extends a fiber-based immersed boundary (IB) model of esophageal transport by incorporating a continuum model of the deformable esophageal wall. The continuum-based esophagus model adopts finite element approach that is capable of describing more complex and realistic material properties and geometries. The leakage from mismatch between Lagrangian and Eulerian meshes resulting from large deformations of the esophageal wall is avoided by careful choice of interaction points. The esophagus model, which is described as a multi-layered, fiber-reinforced nonlinear elastic material, is coupled to bolus and muscle-activation models using the IB approach to form the esophageal transport model. Cases of esophageal transport with different esophagus models are studied. Results on the transport characteristics, including pressure field and esophageal wall kinematics and stress, are analyzed and compared. Support from NIH grant R01 DK56033 and R01 DK079902 is gratefully acknowledged. BEG is supported by NSF award ACI 1460334.

  14. Integrated urban systems model with multiple transportation supply agents.

    DOT National Transportation Integrated Search

    2012-10-01

    This project demonstrates the feasibility of developing quantitative models that can forecast future networks under : current and alternative transportation planning processes. The current transportation planning process is modeled : based on empiric...

  15. Data-based mathematical modeling of vectorial transport across double-transfected polarized cells.

    PubMed

    Bartholomé, Kilian; Rius, Maria; Letschert, Katrin; Keller, Daniela; Timmer, Jens; Keppler, Dietrich

    2007-09-01

    Vectorial transport of endogenous small molecules, toxins, and drugs across polarized epithelial cells contributes to their half-life in the organism and to detoxification. To study vectorial transport in a quantitative manner, an in vitro model was used that includes polarized MDCKII cells stably expressing the recombinant human uptake transporter OATP1B3 in their basolateral membrane and the recombinant ATP-driven efflux pump ABCC2 in their apical membrane. These double-transfected cells enabled mathematical modeling of the vectorial transport of the anionic prototype substance bromosulfophthalein (BSP) that has frequently been used to examine hepatobiliary transport. Time-dependent analyses of (3)H-labeled BSP in the basolateral, intracellular, and apical compartments of cells cultured on filter membranes and efflux experiments in cells preloaded with BSP were performed. A mathematical model was fitted to the experimental data. Data-based modeling was optimized by including endogenous transport processes in addition to the recombinant transport proteins. The predominant contributions to the overall vectorial transport of BSP were mediated by OATP1B3 (44%) and ABCC2 (28%). Model comparison predicted a previously unrecognized endogenous basolateral efflux process as a negative contribution to total vectorial transport, amounting to 19%, which is in line with the detection of the basolateral efflux pump Abcc4 in MDCKII cells. Rate-determining steps in the vectorial transport were identified by calculating control coefficients. Data-based mathematical modeling of vectorial transport of BSP as a model substance resulted in a quantitative description of this process and its components. The same systems biology approach may be applied to other cellular systems and to different substances.

  16. One-Dimensional Transport with Equilibrium Chemistry (OTEQ) - A Reactive Transport Model for Streams and Rivers

    USGS Publications Warehouse

    Runkel, Robert L.

    2010-01-01

    OTEQ is a mathematical simulation model used to characterize the fate and transport of waterborne solutes in streams and rivers. The model is formed by coupling a solute transport model with a chemical equilibrium submodel. The solute transport model is based on OTIS, a model that considers the physical processes of advection, dispersion, lateral inflow, and transient storage. The equilibrium submodel is based on MINTEQ, a model that considers the speciation and complexation of aqueous species, acid-base reactions, precipitation/dissolution, and sorption. Within OTEQ, reactions in the water column may result in the formation of solid phases (precipitates and sorbed species) that are subject to downstream transport and settling processes. Solid phases on the streambed may also interact with the water column through dissolution and sorption/desorption reactions. Consideration of both mobile (waterborne) and immobile (streambed) solid phases requires a unique set of governing differential equations and solution techniques that are developed herein. The partial differential equations describing physical transport and the algebraic equations describing chemical equilibria are coupled using the sequential iteration approach. The model's ability to simulate pH, precipitation/dissolution, and pH-dependent sorption provides a means of evaluating the complex interactions between instream chemistry and hydrologic transport at the field scale. This report details the development and application of OTEQ. Sections of the report describe model theory, input/output specifications, model applications, and installation instructions. OTEQ may be obtained over the Internet at http://water.usgs.gov/software/OTEQ.

  17. An integrated GIS-based data model for multimodal urban public transportation analysis and management

    NASA Astrophysics Data System (ADS)

    Chen, Shaopei; Tan, Jianjun; Ray, C.; Claramunt, C.; Sun, Qinqin

    2008-10-01

    Diversity is one of the main characteristics of transportation data collected from multiple sources or formats, which can be extremely complex and disparate. Moreover, these multimodal transportation data are usually characterised by spatial and temporal properties. Multimodal transportation network data modelling involves both an engineering and research domain that has attracted the design of a number of spatio-temporal data models in the geographic information system (GIS). However, the application of these specific models to multimodal transportation network is still a challenging task. This research addresses this challenge from both integrated multimodal data organization and object-oriented modelling perspectives, that is, how a complex urban transportation network should be organized, represented and modeled appropriately when considering a multimodal point of view, and using object-oriented modelling method. We proposed an integrated GIS-based data model for multimodal urban transportation network that lays a foundation to enhance the multimodal transportation network analysis and management. This modelling method organizes and integrates multimodal transit network data, and supports multiple representations for spatio-temporal objects and relationship as both visual and graphic views. The data model is expressed by using a spatio-temporal object-oriented modelling method, i.e., the unified modelling language (UML) extended to spatial and temporal plug-in for visual languages (PVLs), which provides an essential support to the spatio-temporal data modelling for transportation GIS.

  18. Atomistic full-quantum transport model for zigzag graphene nanoribbon-based structures: Complex energy-band method

    NASA Astrophysics Data System (ADS)

    Chen, Chun-Nan; Luo, Win-Jet; Shyu, Feng-Lin; Chung, Hsien-Ching; Lin, Chiun-Yan; Wu, Jhao-Ying

    2018-01-01

    Using a non-equilibrium Green’s function framework in combination with the complex energy-band method, an atomistic full-quantum model for solving quantum transport problems for a zigzag-edge graphene nanoribbon (zGNR) structure is proposed. For transport calculations, the mathematical expressions from the theory for zGNR-based device structures are derived in detail. The transport properties of zGNR-based devices are calculated and studied in detail using the proposed method.

  19. Density-driven transport of gas phase chemicals in unsaturated soils

    NASA Astrophysics Data System (ADS)

    Fen, Chiu-Shia; Sun, Yong-tai; Cheng, Yuen; Chen, Yuanchin; Yang, Whaiwan; Pan, Changtai

    2018-01-01

    Variations of gas phase density are responsible for advective and diffusive transports of organic vapors in unsaturated soils. Laboratory experiments were conducted to explore dense gas transport (sulfur hexafluoride, SF6) from different source densities through a nitrogen gas-dry soil column. Gas pressures and SF6 densities at transient state were measured along the soil column for three transport configurations (horizontal, vertically upward and vertically downward transport). These measurements and others reported in the literature were compared with simulation results obtained from two models based on different diffusion approaches: the dusty gas model (DGM) equations and a Fickian-type molar fraction-based diffusion expression. The results show that the DGM and Fickian-based models predicted similar dense gas density profiles which matched the measured data well for horizontal transport of dense gas at low to high source densities, despite the pressure variations predicted in the soil column were opposite to the measurements. The pressure evolutions predicted by both models were in trend similar to the measured ones for vertical transport of dense gas. However, differences between the dense gas densities predicted by the DGM and Fickian-based models were discernible for vertically upward transport of dense gas even at low source densities, as the DGM-based predictions matched the measured data better than the Fickian results did. For vertically downward transport, the dense gas densities predicted by both models were not greatly different from our experimental measurements, but substantially greater than the observations obtained from the literature, especially at high source densities. Further research will be necessary for exploring factors affecting downward transport of dense gas in soil columns. Use of the measured data to compute flux components of SF6 showed that the magnitudes of diffusive flux component based on the Fickian-type diffusion expressions in terms of molar concentration, molar fraction and mass density fraction gradient were almost the same. However, they were greater than the result computed with the mass fraction gradient for > 24% and the DGM-based result for more than one time. As a consequence, the DGM-based total flux of SF6 was in magnitude greatly less than the Fickian result not only for horizontal transport (diffusion-dominating) but also for vertical transport (advection and diffusion) of dense gas. Particularly, the Fickian-based total flux was more than two times in magnitude as much as the DGM result for vertically upward transport of dense gas.

  20. Mathematical model of water transport in Bacon and alkaline matrix-type hydrogen-oxygen fuel cells

    NASA Technical Reports Server (NTRS)

    Prokopius, P. R.; Easter, R. W.

    1972-01-01

    Based on general mass continuity and diffusive transport equations, a mathematical model was developed that simulates the transport of water in Bacon and alkaline-matrix fuel cells. The derived model was validated by using it to analytically reproduce various Bacon and matrix-cell experimental water transport transients.

  1. Modeling flow and solute transport in irrigation furrows

    USDA-ARS?s Scientific Manuscript database

    This paper presents an internally coupled flow and solute transport model for free-draining irrigation furrows. Furrow hydraulics is simulated with a numerical zero-inertia model and solute transport is computed with a model based on a numerical solution of the cross-section averaged advection-dispe...

  2. Influence of Transport on Two-Dimensional Model Simulation. Tracer Sensitivity to 2-D Model Transport. 1; Long Lived Tracers

    NASA Technical Reports Server (NTRS)

    Fleming, Eric L.; Jackman, Charles H.; Considine, David B.; Stolarski, Richard S.

    1999-01-01

    In this study, we examine the sensitivity of long lived tracers to changes in the base transport components in our 2-D model. Changes to the strength of the residual circulation in the upper troposphere and stratosphere and changes to the lower stratospheric K(sub zz) had similar effects in that increasing the transport rates decreased the overall stratospheric mean age, and increased the rate of removal of material from the stratosphere. Increasing the stratospheric K(sub yy) increased the mean age due to the greater recycling of air parcels through the middle atmosphere, via the residual circulation, before returning to the troposphere. However, increasing K(sub yy) along with self-consistent increases in the corresponding planetary wave drive, which leads to a stronger residual circulation, more than compensates for the K(sub yy)-effect, and produces significantly younger ages throughout the stratosphere. Simulations with very small tropical stratospheric K(sub yy) decreased the globally averaged age of air by as much as 25% in the middle and upper stratosphere, and resulted in substantially weaker vertical age gradients above 20 km in the extratropics. We found only very small stratospheric tracer sensitivity to the magnitude of the horizontal mixing across the tropopause, and to the strength of the mesospheric gravity wave drag and diffusion used in the model. We also investigated the transport influence on chemically active tracers and found a strong age-tracer correlation, both in concentration and calculated lifetimes. The base model transport gives the most favorable overall comparison with a variety of inert tracer observations, and provides a significant improvement over our previous 1995 model transport. Moderate changes to the base transport were found to provide modest agreement with some of the measurements. Transport scenarios with residence times ranging from moderately shorter to slightly longer relative to the base case simulated N2O lifetimes that were within the observational estimates of Volk et al. [1997]. However, only scenarios with rather fast transport rates were comparable with the Volk et al. estimates of CFCl3 lifetimes. This is inconsistent with model-measurement comparisons of mean age in which the base model or slightly slower transport rates compared the most favorably with balloon SF6 data. For all comparisons shown, large transport changes away from the base case resulted in simulations that were outside the range of measurements, and in many cases, far outside this range.

  3. Transportation Safety Analysis

    DOT National Transportation Integrated Search

    1976-11-01

    A conceptual structure was developed for a model expressing transportation accident deaths as a function of transportation activity levels. The literature and data bases were reviewed. A first-level model was developed for the following modes: highwa...

  4. Risk Evaluation of Railway Coal Transportation Network Based on Multi Level Grey Evaluation Model

    NASA Astrophysics Data System (ADS)

    Niu, Wei; Wang, Xifu

    2018-01-01

    The railway transport mode is currently the most important way of coal transportation, and now China’s railway coal transportation network has become increasingly perfect, but there is still insufficient capacity, some lines close to saturation and other issues. In this paper, the theory and method of risk assessment, analytic hierarchy process and multi-level gray evaluation model are applied to the risk evaluation of coal railway transportation network in China. Based on the example analysis of Shanxi railway coal transportation network, to improve the internal structure and the competitiveness of the market.

  5. Development of Tokamak Transport Solvers for Stiff Confinement Systems

    NASA Astrophysics Data System (ADS)

    St. John, H. E.; Lao, L. L.; Murakami, M.; Park, J. M.

    2006-10-01

    Leading transport models such as GLF23 [1] and MM95 [2] describe turbulent plasma energy, momentum and particle flows. In order to accommodate existing transport codes and associated solution methods effective diffusivities have to be derived from these turbulent flow models. This can cause significant problems in predicting unique solutions. We have developed a parallel transport code solver, GCNMP, that can accommodate both flow based and diffusivity based confinement models by solving the discretized nonlinear equations using modern Newton, trust region, steepest descent and homotopy methods. We present our latest development efforts, including multiple dynamic grids, application of two-level parallel schemes, and operator splitting techniques that allow us to combine flow based and diffusivity based models in tokamk simulations. 6pt [1] R.E. Waltz, et al., Phys. Plasmas 4, 7 (1997). [2] G. Bateman, et al., Phys. Plasmas 5, 1793 (1998).

  6. Using agent based modeling to assess the effect of increased Bus Rapid Transit system infrastructure on walking for transportation.

    PubMed

    Lemoine, Pablo D; Cordovez, Juan Manuel; Zambrano, Juan Manuel; Sarmiento, Olga L; Meisel, Jose D; Valdivia, Juan Alejandro; Zarama, Roberto

    2016-07-01

    The effect of transport infrastructure on walking is of interest to researchers because it provides an opportunity, from the public policy point of view, to increase physical activity (PA). We use an agent based model (ABM) to examine the effect of transport infrastructure on walking. Particular relevance is given to assess the effect of the growth of the Bus Rapid Transit (BRT) system in Bogotá on walking. In the ABM agents are assigned a home, work location, and socioeconomic status (SES) based on which they are assigned income for transportation. Individuals must decide between the available modes of transport (i.e., car, taxi, bus, BRT, and walking) as the means of reaching their destination, based on resources and needed travel time. We calibrated the model based on Bogota's 2011 mobility survey. The ABM results are consistent with previous empirical findings, increasing BRT access does indeed increase the number of minutes that individuals walk for transportation, although this effect also depends on the availability of other transport modes. The model indicates a saturation process: as more BRT lanes are added, the increment in minutes walking becomes smaller, and eventually the walking time decreases. Our findings on the potential contribution of the expansion of the BRT system to walking for transportation suggest that ABMs may prove helpful in designing policies to continue promoting walking. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Making Transporter Models for Drug-Drug Interaction Prediction Mobile.

    PubMed

    Ekins, Sean; Clark, Alex M; Wright, Stephen H

    2015-10-01

    The past decade has seen increased numbers of studies publishing ligand-based computational models for drug transporters. Although they generally use small experimental data sets, these models can provide insights into structure-activity relationships for the transporter. In addition, such models have helped to identify new compounds as substrates or inhibitors of transporters of interest. We recently proposed that many transporters are promiscuous and may require profiling of new chemical entities against multiple substrates for a specific transporter. Furthermore, it should be noted that virtually all of the published ligand-based transporter models are only accessible to those involved in creating them and, consequently, are rarely shared effectively. One way to surmount this is to make models shareable or more accessible. The development of mobile apps that can access such models is highlighted here. These apps can be used to predict ligand interactions with transporters using Bayesian algorithms. We used recently published transporter data sets (MATE1, MATE2K, OCT2, OCTN2, ASBT, and NTCP) to build preliminary models in a commercial tool and in open software that can deliver the model in a mobile app. In addition, several transporter data sets extracted from the ChEMBL database were used to illustrate how such public data and models can be shared. Predicting drug-drug interactions for various transporters using computational models is potentially within reach of anyone with an iPhone or iPad. Such tools could help prioritize which substrates should be used for in vivo drug-drug interaction testing and enable open sharing of models. Copyright © 2015 by The American Society for Pharmacology and Experimental Therapeutics.

  8. Transport characteristics of nanoparticle-based ferrofluids in a gel model of the brain

    PubMed Central

    Basak, Soubir; Brogan, David; Dietrich, Hans; Ritter, Rogers; Dacey, Ralph G; Biswas, Pratim

    2009-01-01

    A current advance in nanotechnology is the selective targeting of therapeutics by external magnetic field-guided delivery. This is an important area of research in medicine. The use of magnetic forces results in the formation of agglomerated structures in the field region. The transport characteristics of these agglomerated structures are explored. A nonintrusive method based on in situ light-scattering techniques is used to characterize the velocity of such particles in a magnetic field gradient. A transport model for the chain-like agglomerates is developed based on these experimental observations. The transport characteristics of magnetic nanoparticle drug carriers are then explored in gel-based simulated models of the brain. Results of such measurements demonstrate decreased diffusion of magnetic nanoparticles when placed in a high magnetic field gradient. PMID:19421367

  9. Steepest entropy ascent quantum thermodynamic model of electron and phonon transport

    NASA Astrophysics Data System (ADS)

    Li, Guanchen; von Spakovsky, Michael R.; Hin, Celine

    2018-01-01

    An advanced nonequilibrium thermodynamic model for electron and phonon transport is formulated based on the steepest-entropy-ascent quantum thermodynamics framework. This framework, based on the principle of steepest entropy ascent (or the equivalent maximum entropy production principle), inherently satisfies the laws of thermodynamics and mechanics and is applicable at all temporal and spatial scales even in the far-from-equilibrium realm. Specifically, the model is proven to recover the Boltzmann transport equations in the near-equilibrium limit and the two-temperature model of electron-phonon coupling when no dispersion is assumed. The heat and mass transport at a temperature discontinuity across a homogeneous interface where the dispersion and coupling of electron and phonon transport are both considered are then modeled. Local nonequilibrium system evolution and nonquasiequilibrium interactions are predicted and the results discussed.

  10. A Correlation-Based Transition Model using Local Variables. Part 1; Model Formation

    NASA Technical Reports Server (NTRS)

    Menter, F. R.; Langtry, R. B.; Likki, S. R.; Suzen, Y. B.; Huang, P. G.; Volker, S.

    2006-01-01

    A new correlation-based transition model has been developed, which is based strictly on local variables. As a result, the transition model is compatible with modern computational fluid dynamics (CFD) approaches, such as unstructured grids and massive parallel execution. The model is based on two transport equations, one for intermittency and one for the transition onset criteria in terms of momentum thickness Reynolds number. The proposed transport equations do not attempt to model the physics of the transition process (unlike, e.g., turbulence models) but from a framework for the implementation of correlation-based models into general-purpose CFD methods.

  11. The Science of Transportation Analysis and Simulation

    NASA Astrophysics Data System (ADS)

    Gleibe, John

    2010-03-01

    Transportation Science focuses on methods developed to model and analyze the interaction between human behavior and transportation systems. From the human behavioral, or demand, perspective, we are interested in how person and households organize their activities across space and time, with travel viewed as an enabling activity. We have a particular interest in how to model the range of responses to public policy and transportation system changes, which leads to the consideration of both short- and long-term decision-making, interpersonal dependencies, and non-transportation-related opportunities and constraints, including household budgets, land use systems and economic systems. This has led to the development of complex structural econometric modeling systems as well as agent-based simulations. From the transportation systems, or supply, perspective we are interested in the level of service provide by transportation facilities, be it auto, transit or multi-modal systems. This has led to the development of network models and equilibrium concepts as well as hybrid simulation systems based on concepts borrowed from physics, such as fluid flow models, and cellular automata-type models. In this presentation, we review a representative sample of these methods and their use in transportation planning and public policy analysis.

  12. Estimation of water table level and nitrate pollution based on geostatistical and multiple mass transport models

    NASA Astrophysics Data System (ADS)

    Matiatos, Ioannis; Varouhakis, Emmanouil A.; Papadopoulou, Maria P.

    2015-04-01

    As the sustainable use of groundwater resources is a great challenge for many countries in the world, groundwater modeling has become a very useful and well established tool for studying groundwater management problems. Based on various methods used to numerically solve algebraic equations representing groundwater flow and contaminant mass transport, numerical models are mainly divided into Finite Difference-based and Finite Element-based models. The present study aims at evaluating the performance of a finite difference-based (MODFLOW-MT3DMS), a finite element-based (FEFLOW) and a hybrid finite element and finite difference (Princeton Transport Code-PTC) groundwater numerical models simulating groundwater flow and nitrate mass transport in the alluvial aquifer of Trizina region in NE Peloponnese, Greece. The calibration of groundwater flow in all models was performed using groundwater hydraulic head data from seven stress periods and the validation was based on a series of hydraulic head data for two stress periods in sufficient numbers of observation locations. The same periods were used for the calibration of nitrate mass transport. The calibration and validation of the three models revealed that the simulated values of hydraulic heads and nitrate mass concentrations coincide well with the observed ones. The models' performance was assessed by performing a statistical analysis of these different types of numerical algorithms. A number of metrics, such as Mean Absolute Error (MAE), Root Mean Square Error (RMSE), Bias, Nash Sutcliffe Model Efficiency (NSE) and Reliability Index (RI) were used allowing the direct comparison of models' performance. Spatiotemporal Kriging (STRK) was also applied using separable and non-separable spatiotemporal variograms to predict water table level and nitrate concentration at each sampling station for two selected hydrological stress periods. The predictions were validated using the respective measured values. Maps of water table level and nitrate concentrations were produced and compared with those obtained from groundwater and mass transport numerical models. Preliminary results showed similar efficiency of the spatiotemporal geostatistical method with the numerical models. However data requirements of the former model were significantly less. Advantages and disadvantages of the methods performance were analysed and discussed indicating the characteristics of the different approaches.

  13. Light transport in turbid media with non-scattering, low-scattering and high absorption heterogeneities based on hybrid simplified spherical harmonics with radiosity model

    PubMed Central

    Yang, Defu; Chen, Xueli; Peng, Zhen; Wang, Xiaorui; Ripoll, Jorge; Wang, Jing; Liang, Jimin

    2013-01-01

    Modeling light propagation in the whole body is essential and necessary for optical imaging. However, non-scattering, low-scattering and high absorption regions commonly exist in biological tissues, which lead to inaccuracy of the existing light transport models. In this paper, a novel hybrid light transport model that couples the simplified spherical harmonics approximation (SPN) with the radiosity theory (HSRM) was presented, to accurately describe light transport in turbid media with non-scattering, low-scattering and high absorption heterogeneities. In the model, the radiosity theory was used to characterize the light transport in non-scattering regions and the SPN was employed to handle the scattering problems, including subsets of low-scattering and high absorption. A Neumann source constructed by the light transport in the non-scattering region and formed at the interface between the non-scattering and scattering regions was superposed into the original light source, to couple the SPN with the radiosity theory. The accuracy and effectiveness of the HSRM was first verified with both regular and digital mouse model based simulations and a physical phantom based experiment. The feasibility and applicability of the HSRM was then investigated by a broad range of optical properties. Lastly, the influence of depth of the light source on the model was also discussed. Primary results showed that the proposed model provided high performance for light transport in turbid media with non-scattering, low-scattering and high absorption heterogeneities. PMID:24156077

  14. Light transport in turbid media with non-scattering, low-scattering and high absorption heterogeneities based on hybrid simplified spherical harmonics with radiosity model.

    PubMed

    Yang, Defu; Chen, Xueli; Peng, Zhen; Wang, Xiaorui; Ripoll, Jorge; Wang, Jing; Liang, Jimin

    2013-01-01

    Modeling light propagation in the whole body is essential and necessary for optical imaging. However, non-scattering, low-scattering and high absorption regions commonly exist in biological tissues, which lead to inaccuracy of the existing light transport models. In this paper, a novel hybrid light transport model that couples the simplified spherical harmonics approximation (SPN) with the radiosity theory (HSRM) was presented, to accurately describe light transport in turbid media with non-scattering, low-scattering and high absorption heterogeneities. In the model, the radiosity theory was used to characterize the light transport in non-scattering regions and the SPN was employed to handle the scattering problems, including subsets of low-scattering and high absorption. A Neumann source constructed by the light transport in the non-scattering region and formed at the interface between the non-scattering and scattering regions was superposed into the original light source, to couple the SPN with the radiosity theory. The accuracy and effectiveness of the HSRM was first verified with both regular and digital mouse model based simulations and a physical phantom based experiment. The feasibility and applicability of the HSRM was then investigated by a broad range of optical properties. Lastly, the influence of depth of the light source on the model was also discussed. Primary results showed that the proposed model provided high performance for light transport in turbid media with non-scattering, low-scattering and high absorption heterogeneities.

  15. Next Generation Transport Phenomenology Model

    NASA Technical Reports Server (NTRS)

    Strickland, Douglas J.; Knight, Harold; Evans, J. Scott

    2004-01-01

    This report describes the progress made in Quarter 3 of Contract Year 3 on the development of Aeronomy Phenomenology Modeling Tool (APMT), an open-source, component-based, client-server architecture for distributed modeling, analysis, and simulation activities focused on electron and photon transport for general atmospheres. In the past quarter, column emission rate computations were implemented in Java, preexisting Fortran programs for computing synthetic spectra were embedded into APMT through Java wrappers, and work began on a web-based user interface for setting input parameters and running the photoelectron and auroral electron transport models.

  16. A Nonlinear Dynamic Inversion Predictor-Based Model Reference Adaptive Controller for a Generic Transport Model

    NASA Technical Reports Server (NTRS)

    Campbell, Stefan F.; Kaneshige, John T.

    2010-01-01

    Presented here is a Predictor-Based Model Reference Adaptive Control (PMRAC) architecture for a generic transport aircraft. At its core, this architecture features a three-axis, non-linear, dynamic-inversion controller. Command inputs for this baseline controller are provided by pilot roll-rate, pitch-rate, and sideslip commands. This paper will first thoroughly present the baseline controller followed by a description of the PMRAC adaptive augmentation to this control system. Results are presented via a full-scale, nonlinear simulation of NASA s Generic Transport Model (GTM).

  17. Integrating Norm Activation Model and Theory of Planned Behavior to Understand Sustainable Transport Behavior: Evidence from China.

    PubMed

    Liu, Yuwei; Sheng, Hong; Mundorf, Norbert; Redding, Colleen; Ye, Yinjiao

    2017-12-18

    With increasing urbanization in China, many cities are facing serious environmental problems due to continuous and substantial increase in automobile transportation. It is becoming imperative to examine effective ways to reduce individual automobile use to facilitate sustainable transportation behavior. Empirical, theory-based research on sustainable transportation in China is limited. In this research, we propose an integrated model based on the norm activation model and the theory of planned behavior by combining normative and rational factors to predict individuals' intention to reduce car use. Data from a survey of 600 car drivers in China's three metropolitan areas was used to test the proposed model and hypotheses. Results showed that three variables, perceived norm of car-transport reduction, attitude towards reduction, and perceived behavior control over car-transport reduction, significantly affected the intention to reduce car-transport. Personal norms mediated the relationship between awareness of consequences of car-transport, ascription of responsibility of car-transport, perceived subjective norm for car-transport reduction, and intention to reduce car-transport. The results of this research not only contribute to theory development in the area of sustainable transportation behavior, but also provide a theoretical frame of reference for relevant policy-makers in urban transport management.

  18. Integrating Norm Activation Model and Theory of Planned Behavior to Understand Sustainable Transport Behavior: Evidence from China

    PubMed Central

    Liu, Yuwei; Sheng, Hong; Mundorf, Norbert; Redding, Colleen

    2017-01-01

    With increasing urbanization in China, many cities are facing serious environmental problems due to continuous and substantial increase in automobile transportation. It is becoming imperative to examine effective ways to reduce individual automobile use to facilitate sustainable transportation behavior. Empirical, theory-based research on sustainable transportation in China is limited. In this research, we propose an integrated model based on the norm activation model and the theory of planned behavior by combining normative and rational factors to predict individuals’ intention to reduce car use. Data from a survey of 600 car drivers in China’s three metropolitan areas was used to test the proposed model and hypotheses. Results showed that three variables, perceived norm of car-transport reduction, attitude towards reduction, and perceived behavior control over car-transport reduction, significantly affected the intention to reduce car-transport. Personal norms mediated the relationship between awareness of consequences of car-transport, ascription of responsibility of car-transport, perceived subjective norm for car-transport reduction, and intention to reduce car-transport. The results of this research not only contribute to theory development in the area of sustainable transportation behavior, but also provide a theoretical frame of reference for relevant policy-makers in urban transport management. PMID:29258245

  19. Modifying Bagnold's Sediment Transport Equation for Use in Watershed-Scale Channel Incision Models

    NASA Astrophysics Data System (ADS)

    Lammers, R. W.; Bledsoe, B. P.

    2016-12-01

    Destabilized stream channels may evolve through a sequence of stages, initiated by bed incision and followed by bank erosion and widening. Channel incision can be modeled using Exner-type mass balance equations, but model accuracy is limited by the accuracy and applicability of the selected sediment transport equation. Additionally, many sediment transport relationships require significant data inputs, limiting their usefulness in data-poor environments. Bagnold's empirical relationship for bedload transport is attractive because it is based on stream power, a relatively straightforward parameter to estimate using remote sensing data. However, the equation is also dependent on flow depth, which is more difficult to measure or estimate for entire drainage networks. We recast Bagnold's original sediment transport equation using specific discharge in place of flow depth. Using a large dataset of sediment transport rates from the literature, we show that this approach yields similar predictive accuracy as other stream power based relationships. We also explore the applicability of various critical stream power equations, including Bagnold's original, and support previous conclusions that these critical values can be predicted well based solely on sediment grain size. In addition, we propagate error in these sediment transport equations through channel incision modeling to compare the errors associated with our equation to alternative formulations. This new version of Bagnold's bedload transport equation has utility for channel incision modeling at larger spatial scales using widely available and remote sensing data.

  20. Residence-time framework for modeling multicomponent reactive transport in stream hyporheic zones

    NASA Astrophysics Data System (ADS)

    Painter, S. L.; Coon, E. T.; Brooks, S. C.

    2017-12-01

    Process-based models for transport and transformation of nutrients and contaminants in streams require tractable representations of solute exchange between the stream channel and biogeochemically active hyporheic zones. Residence-time based formulations provide an alternative to detailed three-dimensional simulations and have had good success in representing hyporheic exchange of non-reacting solutes. We extend the residence-time formulation for hyporheic transport to accommodate general multicomponent reactive transport. To that end, the integro-differential form of previous residence time models is replaced by an equivalent formulation based on a one-dimensional advection dispersion equation along the channel coupled at each channel location to a one-dimensional transport model in Lagrangian travel-time form. With the channel discretized for numerical solution, the associated Lagrangian model becomes a subgrid model representing an ensemble of streamlines that are diverted into the hyporheic zone before returning to the channel. In contrast to the previous integro-differential forms of the residence-time based models, the hyporheic flowpaths have semi-explicit spatial representation (parameterized by travel time), thus allowing coupling to general biogeochemical models. The approach has been implemented as a stream-corridor subgrid model in the open-source integrated surface/subsurface modeling software ATS. We use bedform-driven flow coupled to a biogeochemical model with explicit microbial biomass dynamics as an example to show that the subgrid representation is able to represent redox zonation in sediments and resulting effects on metal biogeochemical dynamics in a tractable manner that can be scaled to reach scales.

  1. Dissipative transport in superlattices within the Wigner function formalism

    DOE PAGES

    Jonasson, O.; Knezevic, I.

    2015-07-30

    Here, we employ the Wigner function formalism to simulate partially coherent, dissipative electron transport in biased semiconductor superlattices. We introduce a model collision integral with terms that describe energy dissipation, momentum relaxation, and the decay of spatial coherences (localization). Based on a particle-based solution to the Wigner transport equation with the model collision integral, we simulate quantum electronic transport at 10 K in a GaAs/AlGaAs superlattice and accurately reproduce its current density vs field characteristics obtained in experiment.

  2. Use of MODIS Satellite Images and an Atmospheric Dust Transport Model to Evaluate Juniperus spp. Pollen Phenology and Dispersal

    NASA Technical Reports Server (NTRS)

    Luvall, J. C.; Sprigg, W. A.; Levetin, E.; Huete, A.; Nickovic, S.; Pejanovic, G. A.; Vukovic, A.; VandeWater, P. K.; Myers, O. B.; Budge, A. M.; hide

    2011-01-01

    Pollen can be transported great distances. Van de Water et. al. reported Juniperus spp. pollen was transported 200-600 km. Hence local observations of plant phenology may not be consistent with the timing and source of pollen collected by pollen sampling instruments. The DREAM (Dust REgional Atmospheric Model) is a verified model for atmospheric dust transport modeling using MODIS data products to identify source regions and quantities of dust. We are modifying the DREAM model to incorporate pollen transport. Pollen release will be estimated based on MODIS derived phenology of Juniperus spp. communities. Ground based observational records of pollen release timing and quantities will be used as verification. This information will be used to support the Centers for Disease Control and Prevention's National Environmental Public Health Tracking Program and the State of New Mexico environmental public health decision support for asthma and allergies alerts.

  3. A Primer for Agent-Based Simulation and Modeling in Transportation Applications

    DOT National Transportation Integrated Search

    2013-11-01

    Agent-based modeling and simulation (ABMS) methods have been applied in a spectrum of research domains. This primer focuses on ABMS in the transportation interdisciplinary domain, describes the basic concepts of ABMS and the recent progress of ABMS i...

  4. Phase space effects on fast ion distribution function modeling in tokamaks

    NASA Astrophysics Data System (ADS)

    Podestà, M.; Gorelenkova, M.; Fredrickson, E. D.; Gorelenkov, N. N.; White, R. B.

    2016-05-01

    Integrated simulations of tokamak discharges typically rely on classical physics to model energetic particle (EP) dynamics. However, there are numerous cases in which energetic particles can suffer additional transport that is not classical in nature. Examples include transport by applied 3D magnetic perturbations and, more notably, by plasma instabilities. Focusing on the effects of instabilities, ad-hoc models can empirically reproduce increased transport, but the choice of transport coefficients is usually somehow arbitrary. New approaches based on physics-based reduced models are being developed to address those issues in a simplified way, while retaining a more correct treatment of resonant wave-particle interactions. The kick model implemented in the tokamak transport code TRANSP is an example of such reduced models. It includes modifications of the EP distribution by instabilities in real and velocity space, retaining correlations between transport in energy and space typical of resonant EP transport. The relevance of EP phase space modifications by instabilities is first discussed in terms of predicted fast ion distribution. Results are compared with those from a simple, ad-hoc diffusive model. It is then shown that the phase-space resolved model can also provide additional insight into important issues such as internal consistency of the simulations and mode stability through the analysis of the power exchanged between energetic particles and the instabilities.

  5. Phase space effects on fast ion distribution function modeling in tokamaks

    DOE Data Explorer

    White, R. B. [Princeton Plasma Physics Lab. (PPPL), Princeton, NJ (United States); Podesta, M. [Princeton Plasma Physics Lab. (PPPL), Princeton, NJ (United States); Gorelenkova, M. [Princeton Plasma Physics Lab. (PPPL), Princeton, NJ (United States); Fredrickson, E. D. [Princeton Plasma Physics Lab. (PPPL), Princeton, NJ (United States); Gorelenkov, N. N. [Princeton Plasma Physics Lab. (PPPL), Princeton, NJ (United States)

    2016-06-01

    Integrated simulations of tokamak discharges typically rely on classical physics to model energetic particle (EP) dynamics. However, there are numerous cases in which energetic particles can suffer additional transport that is not classical in nature. Examples include transport by applied 3D magnetic perturbations and, more notably, by plasma instabilities. Focusing on the effects of instabilities, ad-hoc models can empirically reproduce increased transport, but the choice of transport coefficients is usually somehow arbitrary. New approaches based on physics-based reduced models are being developed to address those issues in a simplified way, while retaining a more correct treatment of resonant wave-particle interactions. The kick model implemented in the tokamak transport code TRANSP is an example of such reduced models. It includes modifications of the EP distribution by instabilities in real and velocity space, retaining correlations between transport in energy and space typical of resonant EP transport. The relevance of EP phase space modifications by instabilities is first discussed in terms of predicted fast ion distribution. Results are compared with those from a simple, ad-hoc diffusive model. It is then shown that the phase-space resolved model can also provide additional insight into important issues such as internal consistency of the simulations and mode stability through the analysis of the power exchanged between energetic particles and the instabilities.

  6. ITC Recommendations for Transporter Kinetic Parameter Estimation and Translational Modeling of Transport-Mediated PK and DDIs in Humans

    PubMed Central

    Zamek-Gliszczynski, MJ; Lee, CA; Poirier, A; Bentz, J; Chu, X; Ellens, H; Ishikawa, T; Jamei, M; Kalvass, JC; Nagar, S; Pang, KS; Korzekwa, K; Swaan, PW; Taub, ME; Zhao, P; Galetin, A

    2013-01-01

    This white paper provides a critical analysis of methods for estimating transporter kinetics and recommendations on proper parameter calculation in various experimental systems. Rational interpretation of transporter-knockout animal findings and application of static and dynamic physiologically based modeling approaches for prediction of human transporter-mediated pharmacokinetics and drug–drug interactions (DDIs) are presented. The objective is to provide appropriate guidance for the use of in vitro, in vivo, and modeling tools in translational transporter science. PMID:23588311

  7. Particle Transport through Scattering Regions with Clear Layers and Inclusions

    NASA Astrophysics Data System (ADS)

    Bal, Guillaume

    2002-08-01

    This paper introduces generalized diffusion models for the transport of particles in scattering media with nonscattering inclusions. Classical diffusion is known as a good approximation of transport only in scattering media. Based on asymptotic expansions and the coupling of transport and diffusion models, generalized diffusion equations with nonlocal interface conditions are proposed which offer a computationally cheap, yet accurate, alternative to solving the full phase-space transport equations. The paper shows which computational model should be used depending on the size and shape of the nonscattering inclusions in the simplified setting of two space dimensions. An important application is the treatment of clear layers in near-infrared (NIR) spectroscopy, an imaging technique based on the propagation of NIR photons in human tissues.

  8. Charge transport model in nanodielectric composites based on quantum tunneling mechanism and dual-level traps

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Guochang; Chen, George, E-mail: gc@ecs.soton.ac.uk, E-mail: sli@mail.xjtu.edu.cn; School of Electronic and Computer Science, University of Southampton, Southampton SO17 1BJ

    Charge transport properties in nanodielectrics present different tendencies for different loading concentrations. The exact mechanisms that are responsible for charge transport in nanodielectrics are not detailed, especially for high loading concentration. A charge transport model in nanodielectrics has been proposed based on quantum tunneling mechanism and dual-level traps. In the model, the thermally assisted hopping (TAH) process for the shallow traps and the tunnelling process for the deep traps are considered. For different loading concentrations, the dominant charge transport mechanisms are different. The quantum tunneling mechanism plays a major role in determining the charge conduction in nanodielectrics with high loadingmore » concentrations. While for low loading concentrations, the thermal hopping mechanism will dominate the charge conduction process. The model can explain the observed conductivity property in nanodielectrics with different loading concentrations.« less

  9. Numerical modeling of hydrodynamics and sediment transport—an integrated approach

    NASA Astrophysics Data System (ADS)

    Gic-Grusza, Gabriela; Dudkowska, Aleksandra

    2017-10-01

    Point measurement-based estimation of bedload transport in the coastal zone is very difficult. The only way to assess the magnitude and direction of bedload transport in larger areas, particularly those characterized by complex bottom topography and hydrodynamics, is to use a holistic approach. This requires modeling of waves, currents, and the critical bed shear stress and bedload transport magnitude, with a due consideration to the realistic bathymetry and distribution of surface sediment types. Such a holistic approach is presented in this paper which describes modeling of bedload transport in the Gulf of Gdańsk. Extreme storm conditions defined based on 138-year NOAA data were assumed. The SWAN model (Booij et al. 1999) was used to define wind-wave fields, whereas wave-induced currents were calculated using the Kołodko and Gic-Grusza (2015) model, and the magnitude of bedload transport was estimated using the modified Meyer-Peter and Müller (1948) formula. The calculations were performed using a GIS model. The results obtained are innovative. The approach presented appears to be a valuable source of information on bedload transport in the coastal zone.

  10. Generalized analytical solutions to multispecies transport equations with scale-dependent dispersion coefficients subject to time-dependent boundary conditions

    NASA Astrophysics Data System (ADS)

    Chen, J. S.; Chiang, S. Y.; Liang, C. P.

    2017-12-01

    It is essential to develop multispecies transport analytical models based on a set of advection-dispersion equations (ADEs) coupled with sequential first-order decay reactions for the synchronous prediction of plume migrations of both parent and its daughter species of decaying contaminants such as radionuclides, dissolved chlorinated organic compounds, pesticides and nitrogen. Although several analytical models for multispecies transport have already been reported, those currently available in the literature have primarily been derived based on ADEs with constant dispersion coefficients. However, there have been a number of studies demonstrating that the dispersion coefficients increase with the solute travel distance as a consequence of variation in the hydraulic properties of the porous media. This study presents novel analytical models for multispecies transport with distance-dependent dispersion coefficients. The correctness of the derived analytical models is confirmed by comparing them against the numerical models. Results show perfect agreement between the analytical and numerical models. Comparison of our new analytical model for multispecies transport with scale-dependent dispersion to an analytical model with constant dispersion is made to illustrate the effects of the dispersion coefficients on the multispecies transport of decaying contaminants.

  11. Process based modeling of total longshore sediment transport

    USGS Publications Warehouse

    Haas, K.A.; Hanes, D.M.

    2004-01-01

    Waves, currents, and longshore sand transport are calculated locally as a function of position in the nearshore region using process based numerical models. The resultant longshore sand transport is then integrated across the nearshore to provide predictions of the total longshore transport of sand due to waves and longshore currents. Model results are in close agreement with the I1-P1 correlation described by Komar and Inman (1970) and the CERC (1984) formula. Model results also indicate that the proportionality constant in the I1-P1 formula depends weakly upon the sediment size, the shape of the beach profile, and the particular local sediment flux formula that is employed. Model results indicate that the various effects and influences of sediment size tend to cancel out, resulting in little overall dependence on sediment size.

  12. Direct coupling of a genome-scale microbial in silico model and a groundwater reactive transport model.

    PubMed

    Fang, Yilin; Scheibe, Timothy D; Mahadevan, Radhakrishnan; Garg, Srinath; Long, Philip E; Lovley, Derek R

    2011-03-25

    The activity of microorganisms often plays an important role in dynamic natural attenuation or engineered bioremediation of subsurface contaminants, such as chlorinated solvents, metals, and radionuclides. To evaluate and/or design bioremediated systems, quantitative reactive transport models are needed. State-of-the-art reactive transport models often ignore the microbial effects or simulate the microbial effects with static growth yield and constant reaction rate parameters over simulated conditions, while in reality microorganisms can dynamically modify their functionality (such as utilization of alternative respiratory pathways) in response to spatial and temporal variations in environmental conditions. Constraint-based genome-scale microbial in silico models, using genomic data and multiple-pathway reaction networks, have been shown to be able to simulate transient metabolism of some well studied microorganisms and identify growth rate, substrate uptake rates, and byproduct rates under different growth conditions. These rates can be identified and used to replace specific microbially-mediated reaction rates in a reactive transport model using local geochemical conditions as constraints. We previously demonstrated the potential utility of integrating a constraint-based microbial metabolism model with a reactive transport simulator as applied to bioremediation of uranium in groundwater. However, that work relied on an indirect coupling approach that was effective for initial demonstration but may not be extensible to more complex problems that are of significant interest (e.g., communities of microbial species and multiple constraining variables). Here, we extend that work by presenting and demonstrating a method of directly integrating a reactive transport model (FORTRAN code) with constraint-based in silico models solved with IBM ILOG CPLEX linear optimizer base system (C library). The models were integrated with BABEL, a language interoperability tool. The modeling system is designed in such a way that constraint-based models targeting different microorganisms or competing organism communities can be easily plugged into the system. Constraint-based modeling is very costly given the size of a genome-scale reaction network. To save computation time, a binary tree is traversed to examine the concentration and solution pool generated during the simulation in order to decide whether the constraint-based model should be called. We also show preliminary results from the integrated model including a comparison of the direct and indirect coupling approaches and evaluated the ability of the approach to simulate field experiment. Published by Elsevier B.V.

  13. A Correlation-Based Transition Model using Local Variables. Part 2; Test Cases and Industrial Applications

    NASA Technical Reports Server (NTRS)

    Langtry, R. B.; Menter, F. R.; Likki, S. R.; Suzen, Y. B.; Huang, P. G.; Volker, S.

    2006-01-01

    A new correlation-based transition model has been developed, which is built strictly on local variables. As a result, the transition model is compatible with modern computational fluid dynamics (CFD) methods using unstructured grids and massive parallel execution. The model is based on two transport equations, one for the intermittency and one for the transition onset criteria in terms of momentum thickness Reynolds number. The proposed transport equations do not attempt to model the physics of the transition process (unlike, e.g., turbulence models), but form a framework for the implementation of correlation-based models into general-purpose CFD methods.

  14. Analysis and forecast of railway coal transportation volume based on BP neural network combined forecasting model

    NASA Astrophysics Data System (ADS)

    Xu, Yongbin; Xie, Haihong; Wu, Liuyi

    2018-05-01

    The share of coal transportation in the total railway freight volume is about 50%. As is widely acknowledged, coal industry is vulnerable to the economic situation and national policies. Coal transportation volume fluctuates significantly under the new economic normal. Grasp the overall development trend of railway coal transportation market, have important reference and guidance significance to the railway and coal industry decision-making. By analyzing the economic indicators and policy implications, this paper expounds the trend of the coal transportation volume, and further combines the economic indicators with the high correlation with the coal transportation volume with the traditional traffic prediction model to establish a combined forecasting model based on the back propagation neural network. The error of the prediction results is tested, which proves that the method has higher accuracy and has practical application.

  15. Multiscale solute transport upscaling for a three-dimensional hierarchical porous medium

    NASA Astrophysics Data System (ADS)

    Zhang, Mingkan; Zhang, Ye

    2015-03-01

    A laboratory-generated hierarchical, fully heterogeneous aquifer model (FHM) provides a reference for developing and testing an upscaling approach that integrates large-scale connectivity mapping with flow and transport modeling. Based on the FHM, three hydrostratigraphic models (HSMs) that capture lithological (static) connectivity at different resolutions are created, each corresponding to a sedimentary hierarchy. Under increasing system lnK variances (0.1, 1.0, 4.5), flow upscaling is first conducted to calculate equivalent hydraulic conductivity for individual connectivity (or unit) of the HSMs. Given the computed flow fields, an instantaneous, conservative tracer test is simulated by all models. For the HSMs, two upscaling formulations are tested based on the advection-dispersion equation (ADE), implementing space versus time-dependent macrodispersivity. Comparing flow and transport predictions of the HSMs against those of the reference model, HSMs capturing connectivity at increasing resolutions are more accurate, although upscaling errors increase with system variance. Results suggest: (1) by explicitly modeling connectivity, an enhanced degree of freedom in representing dispersion can improve the ADE-based upscaled models by capturing non-Fickian transport of the FHM; (2) when connectivity is sufficiently resolved, the type of data conditioning used to model transport becomes less critical. Data conditioning, however, is influenced by the prediction goal; (3) when aquifer is weakly-to-moderately heterogeneous, the upscaled models adequately capture the transport simulation of the FHM, despite the existence of hierarchical heterogeneity at smaller scales. When aquifer is strongly heterogeneous, the upscaled models become less accurate because lithological connectivity cannot adequately capture preferential flows; (4) three-dimensional transport connectivities of the hierarchical aquifer differ quantitatively from those analyzed for two-dimensional systems. This article was corrected on 7 MAY 2015. See the end of the full text for details.

  16. Suspended solids transport: an analysis based on turbidity measurements and event based fully calibrated hydrodynamic models.

    PubMed

    Langeveld, J G; Veldkamp, R G; Clemens, F

    2005-01-01

    Modelling suspended solids transport is a key issue for predicting the pollution load discharged by CSOs. Nonetheless, there is still much debate on the main drivers for suspended solids transport and on the modelling approach to be adopted. Current sewer models provide suspended solids transport models. These models, however, rely upon erosion-deposition criteria developed in fluvial environments, therewith oversimplifying the sewer sediment characteristics. Consequently, the performance of these models is poor from a theoretical point of view. To get an improved understanding of the temporal and spatial variations in suspended solids transport, a measuring network was installed in the sewer system of Loenen in conjunction with a hydraulic measuring network from June through December 2001. During the measuring period, 15 storm events rendered high-quality data on both the hydraulics and the turbidity. For each storm event, a hydrodynamic model was calibrated using the Clemens' method. The conclusion of the paper is that modelling of suspended solids transport has been and will be one of the challenges in the field of urban drainage modelling. A direct relation of either shear stress or flow velocity with turbidity could not be found, likely because of the time varying characteristics of the suspended solids.

  17. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Podestà, M., E-mail: mpodesta@pppl.gov; Gorelenkova, M.; Fredrickson, E. D.

    Integrated simulations of tokamak discharges typically rely on classical physics to model energetic particle (EP) dynamics. However, there are numerous cases in which energetic particles can suffer additional transport that is not classical in nature. Examples include transport by applied 3D magnetic perturbations and, more notably, by plasma instabilities. Focusing on the effects of instabilities, ad-hoc models can empirically reproduce increased transport, but the choice of transport coefficients is usually somehow arbitrary. New approaches based on physics-based reduced models are being developed to address those issues in a simplified way, while retaining a more correct treatment of resonant wave-particle interactions.more » The kick model implemented in the tokamak transport code TRANSP is an example of such reduced models. It includes modifications of the EP distribution by instabilities in real and velocity space, retaining correlations between transport in energy and space typical of resonant EP transport. The relevance of EP phase space modifications by instabilities is first discussed in terms of predicted fast ion distribution. Results are compared with those from a simple, ad-hoc diffusive model. It is then shown that the phase-space resolved model can also provide additional insight into important issues such as internal consistency of the simulations and mode stability through the analysis of the power exchanged between energetic particles and the instabilities.« less

  18. Modeling anomalous radial transport in kinetic transport codes

    NASA Astrophysics Data System (ADS)

    Bodi, K.; Krasheninnikov, S. I.; Cohen, R. H.; Rognlien, T. D.

    2009-11-01

    Anomalous transport is typically the dominant component of the radial transport in magnetically confined plasmas, where the physical origin of this transport is believed to be plasma turbulence. A model is presented for anomalous transport that can be used in continuum kinetic edge codes like TEMPEST, NEO and the next-generation code being developed by the Edge Simulation Laboratory. The model can also be adapted to particle-based codes. It is demonstrated that the model with a velocity-dependent diffusion and convection terms can match a diagonal gradient-driven transport matrix as found in contemporary fluid codes, but can also include off-diagonal effects. The anomalous transport model is also combined with particle drifts and a particle/energy-conserving Krook collision operator to study possible synergistic effects with neoclassical transport. For the latter study, a velocity-independent anomalous diffusion coefficient is used to mimic the effect of long-wavelength ExB turbulence.

  19. MODELING TRANSPORT IN THE DOWN GRADIENT PORTION OF THE 200-PO-1 OPERABLE UNIT AT THE HANFORD SITE

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    MEHTA S; ALY AH; MILLER CW

    2009-12-03

    Remedial Investigations are underway for the 200-PO-l Operable Unit (OU) at the U.S. Department of Energy's Hanford Site in Washington State. To support the baseline risk assessment and evaluation of remedial alternatives, fate and transport modeling is being conducted to predict the future concentration of contaminants of potential concern in the 200-PO-1 OU. This study focuses on modeling the 'down gradient' transport of those contaminants that migrate beyond the 3-D model domain selected for performing detailed 'source area' modeling within the 200-PO-1 OU. The down gradient portion is defined as that region of the 200-PO-1 OU that is generally outsidemore » the 200 Area (considered 'source area') of the Hanford Site. A 1-D transport model is developed for performing down gradient contaminant fate and transport modeling. The 1-D transport model is deemed adequate based on the inferred transport pathway of tritium in the past and the observation that most of the contaminant mass remains at or near the water table within the unconfined aquifer of the Hanford Formation and the Cold-Creek/Pre-Missoula Gravel unit. The Pipe Pathway feature of the GoldSim software is used to perform the calculations. The Pipe Pathway uses a Laplace transform approach to provide analytical solutions to a broad range of advection-dominated mass transport systems involving one-dimensional advection, longitudinal dispersion, retardation, decay and ingrowth, and exchanges with immobile storage zones. Based on the historical concentration distribution data for the extensive tritium plume in this area, three Pipe Pathways are deemed adequate for modeling transport of contaminants. Each of these three Pipe Pathways is discretized into several zones, based on the saturated thickness variation in the unconfined aquifer and the location of monitoring wells used for risk assessment calculation. The mass fluxes of contaminants predicted to exit the source area model domain are used as an input to the down gradient model, while the flow velocities applied are based on the present-day hydraulic gradients and estimation of hydraulic conductivity in the unconfined aquifer. The results of the calculation indicate that the future concentrations of contaminants of potential concern in the down gradient portion of the 200-PO-1 OU declines with time and distance.« less

  20. WASP TRANSPORT MODELING AND WASP ECOLOGICAL MODELING

    EPA Science Inventory

    A combination of lectures, demonstrations, and hands-on excercises will be used to introduce pollutant transport modeling with the U.S. EPA's general water quality model, WASP (Water Quality Analysis Simulation Program). WASP features include a user-friendly Windows-based interfa...

  1. Sorafenib metabolism, transport, and enterohepatic recycling: physiologically based modeling and simulation in mice.

    PubMed

    Edginton, Andrea N; Zimmerman, Eric I; Vasilyeva, Aksana; Baker, Sharyn D; Panetta, John C

    2016-05-01

    This study used uncertainty and sensitivity analysis to evaluate a physiologically based pharmacokinetic (PBPK) model of the complex mechanisms of sorafenib and its two main metabolites, sorafenib glucuronide and sorafenib N-oxide in mice. A PBPK model for sorafenib and its two main metabolites was developed to explain disposition in mice. It included relevant influx (Oatp) and efflux (Abcc2 and Abcc3) transporters, hepatic metabolic enzymes (CYP3A4 and UGT1A9), and intestinal β-glucuronidase. Parameterization of drug-specific processes was based on in vitro, ex vivo, and in silico data along with plasma and liver pharmacokinetic data from single and multiple transporter knockout mice. Uncertainty analysis demonstrated that the model structure and parameter values could explain the observed variability in the pharmacokinetic data. Global sensitivity analysis demonstrated the global effects of metabolizing enzymes on sorafenib and metabolite disposition and the local effects of transporters on their respective substrate exposures. In addition, through hypothesis testing, the model supported that the influx transporter Oatp is a weak substrate for sorafenib and a strong substrate for sorafenib glucuronide and that the efflux transporter Abcc2 is not the only transporter affected in the Abcc2 knockout mouse. Translation of the mouse model to humans for the purpose of explaining exceptionally high human pharmacokinetic variability and its relationship with exposure-dependent dose-limiting toxicities will require delineation of the importance of these processes on disposition.

  2. ESTIMATION OF GROUNDWATER POLLUTION POTENTIAL BY PESTICIDES IN MID-ATLANTIC COASTAL PLAIN WATERSHEDS

    EPA Science Inventory

    A simple GIS-based transport model to estimate the potential for groundwater pollution by pesticides has been developed within the ArcView GIS environment. The pesticide leaching analytical model, which is based on one-dimensional advective-dispersive-reactive (ADR) transport, ha...

  3. Galactic Cosmic-ray Transport in the Global Heliosphere: A Four-Dimensional Stochastic Model

    NASA Astrophysics Data System (ADS)

    Florinski, V.

    2009-04-01

    We study galactic cosmic-ray transport in the outer heliosphere and heliosheath using a newly developed transport model based on stochastic integration of the phase-space trajectories of Parker's equation. The model employs backward integration of the diffusion-convection transport equation using Ito calculus and is four-dimensional in space+momentum. We apply the model to the problem of galactic proton transport in the heliosphere during a negative solar minimum. Model results are compared with the Voyager measurements of galactic proton radial gradients and spectra in the heliosheath. We show that the heliosheath is not as efficient in diverting cosmic rays during solar minima as predicted by earlier two-dimensional models.

  4. Transport and Reactive Flow Modelling Using A Particle Tracking Method Based on Continuous Time Random Walks

    NASA Astrophysics Data System (ADS)

    Oliveira, R.; Bijeljic, B.; Blunt, M. J.; Colbourne, A.; Sederman, A. J.; Mantle, M. D.; Gladden, L. F.

    2017-12-01

    Mixing and reactive processes have a large impact on the viability of enhanced oil and gas recovery projects that involve acid stimulation and CO2 injection. To achieve a successful design of the injection schemes an accurate understanding of the interplay between pore structure, flow and reactive transport is necessary. Dependent on transport and reactive conditions, this complex coupling can also be dependent on initial rock heterogeneity across a variety of scales. To address these issues, we devise a new method to study transport and reactive flow in porous media at multiple scales. The transport model is based on an efficient Particle Tracking Method based on Continuous Time Random Walks (CTRW-PTM) on a lattice. Transport is modelled using an algorithm described in Rhodes and Blunt (2006) and Srinivasan et al. (2010); this model is expanded to enable for reactive flow predictions in subsurface rock undergoing a first-order fluid/solid chemical reaction. The reaction-induced alteration in fluid/solid interface is accommodated in the model through changes in porosity and flow field, leading to time dependent transport characteristics in the form of transit time distributions which account for rock heterogeneity change. This also enables the study of concentration profiles at the scale of interest. Firstly, we validate transport model by comparing the probability of molecular displacement (propagators) measured by Nuclear Magnetic Resonance (NMR) with our modelled predictions for concentration profiles. The experimental propagators for three different porous media of increasing complexity, a beadpack, a Bentheimer sandstone and a Portland carbonate, show a good agreement with the model. Next, we capture the time evolution of the propagators distribution in a reactive flow experiment, where hydrochloric acid is injected into a limestone rock. We analyse the time-evolving non-Fickian signatures for the transport during reactive flow and observe an increase in transport heterogeneity at latter times, representing the increase in rock heterogeneity. Evolution of transit time distribution is associated with the evolution of concentration profiles, thus highlighting the impact of initial rock structure on the reactive transport for a range of Pe and Da numbers.

  5. A reaction-based paradigm to model reactive chemical transport in groundwater with general kinetic and equilibrium reactions.

    PubMed

    Zhang, Fan; Yeh, Gour-Tsyh; Parker, Jack C; Brooks, Scott C; Pace, Molly N; Kim, Young-Jin; Jardine, Philip M; Watson, David B

    2007-06-16

    This paper presents a reaction-based water quality transport model in subsurface flow systems. Transport of chemical species with a variety of chemical and physical processes is mathematically described by M partial differential equations (PDEs). Decomposition via Gauss-Jordan column reduction of the reaction network transforms M species reactive transport equations into two sets of equations: a set of thermodynamic equilibrium equations representing N(E) equilibrium reactions and a set of reactive transport equations of M-N(E) kinetic-variables involving no equilibrium reactions (a kinetic-variable is a linear combination of species). The elimination of equilibrium reactions from reactive transport equations allows robust and efficient numerical integration. The model solves the PDEs of kinetic-variables rather than individual chemical species, which reduces the number of reactive transport equations and simplifies the reaction terms in the equations. A variety of numerical methods are investigated for solving the coupled transport and reaction equations. Simulation comparisons with exact solutions were performed to verify numerical accuracy and assess the effectiveness of various numerical strategies to deal with different application circumstances. Two validation examples involving simulations of uranium transport in soil columns are presented to evaluate the ability of the model to simulate reactive transport with complex reaction networks involving both kinetic and equilibrium reactions.

  6. A new multiscale air quality transport model (Fluidity, 4.1.9) using fully unstructured anisotropic adaptive mesh technology

    NASA Astrophysics Data System (ADS)

    Zheng, J.; Zhu, J.; Wang, Z.; Fang, F.; Pain, C. C.; Xiang, J.

    2015-06-01

    A new anisotropic hr-adaptive mesh technique has been applied to modelling of multiscale transport phenomena, which is based on a discontinuous Galerkin/control volume discretization on unstructured meshes. Over existing air quality models typically based on static-structured grids using a locally nesting technique, the advantage of the anisotropic hr-adaptive model has the ability to adapt the mesh according to the evolving pollutant distribution and flow features. That is, the mesh resolution can be adjusted dynamically to simulate the pollutant transport process accurately and effectively. To illustrate the capability of the anisotropic adaptive unstructured mesh model, three benchmark numerical experiments have been setup for two-dimensional (2-D) transport phenomena. Comparisons have been made between the results obtained using uniform resolution meshes and anisotropic adaptive resolution meshes.

  7. Meeting in Turkey: WASP Transport Modeling and WASP Ecological Modeling

    EPA Science Inventory

    A combination of lectures, demonstrations, and hands-on excercises will be used to introduce pollutant transport modeling with the U.S. EPA's general water quality model, WASP (Water Quality Analysis Simulation Program). WASP features include a user-friendly Windows-based interfa...

  8. Meeting in Korea: WASP Transport Modeling and WASP Ecological Modeling

    EPA Science Inventory

    A combination of lectures, demonstrations, and hands-on excercises will be used to introduce pollutant transport modeling with the U.S. EPA's general water quality model, WASP (Water Quality Analysis Simulation Program). WASP features include a user-friendly Windows-based interfa...

  9. Development of speed models for improving travel forecasting and highway performance evaluation : [technical summary].

    DOT National Transportation Integrated Search

    2013-12-01

    Travel forecasting models predict travel demand based on the present transportation system and its use. Transportation modelers must develop, validate, and calibrate models to ensure that predicted travel demand is as close to reality as possible. Mo...

  10. Research on configuration of railway self-equipped tanker based on minimum cost maximum flow model

    NASA Astrophysics Data System (ADS)

    Yang, Yuefang; Gan, Chunhui; Shen, Tingting

    2017-05-01

    In the study of the configuration of the tanker of chemical logistics park, the minimum cost maximum flow model is adopted. Firstly, the transport capacity of the park loading and unloading area and the transportation demand of the dangerous goods are taken as the constraint condition of the model; then the transport arc capacity, the transport arc flow and the transport arc edge weight are determined in the transportation network diagram; finally, the software calculations. The calculation results show that the configuration issue of the tankers can be effectively solved by the minimum cost maximum flow model, which has theoretical and practical application value for tanker management of railway transportation of dangerous goods in the chemical logistics park.

  11. Vehicle coordinated transportation dispatching model base on multiple crisis locations

    NASA Astrophysics Data System (ADS)

    Tian, Ran; Li, Shanwei; Yang, Guoying

    2018-05-01

    Many disastrous events are often caused after unconventional emergencies occur, and the requirements of disasters are often different. It is difficult for a single emergency resource center to satisfy such requirements at the same time. Therefore, how to coordinate the emergency resources stored by multiple emergency resource centers to various disaster sites requires the coordinated transportation of emergency vehicles. In this paper, according to the problem of emergency logistics coordination scheduling, based on the related constraints of emergency logistics transportation, an emergency resource scheduling model based on multiple disasters is established.

  12. Study on multimodal transport route under low carbon background

    NASA Astrophysics Data System (ADS)

    Liu, Lele; Liu, Jie

    2018-06-01

    Low-carbon environmental protection is the focus of attention around the world, scientists are constantly researching on production of carbon emissions and living carbon emissions. However, there is little literature about multimodal transportation based on carbon emission at home and abroad. Firstly, this paper introduces the theory of multimodal transportation, the multimodal transport models that didn't consider carbon emissions and consider carbon emissions are analyzed. On this basis, a multi-objective programming 0-1 programming model with minimum total transportation cost and minimum total carbon emission is proposed. The idea of weight is applied to Ideal point method for solving problem, multi-objective programming is transformed into a single objective function. The optimal solution of carbon emission to transportation cost under different weights is determined by a single objective function with variable weights. Based on the model and algorithm, an example is given and the results are analyzed.

  13. Use of MODIS Satellite Images and an Atmospheric Dust Transport Model to Evaluate Juniperus spp. Pollen Phenology and Dispersal

    NASA Technical Reports Server (NTRS)

    Luvall, Jeffrey C.

    2011-01-01

    Pollen can be transported great distances. Van de Water et. al. reported Juniperus spp. pollen was transported 200-600 km. Hence local obse rvations of plant phenology may not be consistent with the timing and source of pollen collected by pollen sampling instruments. The DREAM (Dust REgional Atmospheric Model, Nickovic et al. 2001) is a verified model for atmospheric dust transport modeling using MODIS data produ cts to identify source regions and quantities of dust. We are modifyi ng the DREAM model to incorporate pollen transport. Pollen release wi ll be estimated based on MODIS derived phenology of Juniperus spp. communities. Ground based observations records of pollen release timing and quantities will be used as verification. This information will be used to support the Centers for Disease Control and Prevention?s Nat ional Environmental Public Health Tracking Program and the State of New Mexico environmental public health decision support for asthma and allergies alerts.

  14. Use of MODIS Satellite Images and an Atmospheric Dust Transport Model To Evaluate Juniperus spp. Pollen Phenology and Dispersal

    NASA Technical Reports Server (NTRS)

    Luvall, J. C.; Sprigg, W. A.; Levetin, Estelle; Huete, Alfredo; Nickovic, S.; Pejanovic, G. A.; Vukovic, A.; VandeWater, P. K.; Myers, O. B.; Budge, A. M.; hide

    2011-01-01

    Pollen can be transported great distances. Van de Water et. al., 2003 reported Juniperus spp. pollen was transported 200-600 km. Hence local observations of plant phenology may not be consistent with the timing and source of pollen collected by pollen sampling instruments. The DREAM (Dust REgional Atmospheric Model, Nickovic et al. 2001) is a verified model for atmospheric dust transport modeling using MODIS data products to identify source regions and quantities of dust. We are modifying the DREAM model to incorporate pollen transport. Pollen release will be estimated based on MODIS derived phenology of Juniperus spp. communities. Ground based observational records of pollen release timing and quantities will be used as verification. This information will be used to support the Centers for Disease Control and Prevention's National Environmental Public Health Tracking Program and the State of New Mexico environmental public health decision support for asthma and allergies alerts.

  15. Implementation of Gravity Model to Estimation of Transportation Market Shares

    NASA Astrophysics Data System (ADS)

    Krata, Przemysław

    2010-03-01

    The theoretical consideration presented in the paper is inspired by market gravity models, as an interesting attitude towards operations research on a market. The transportation market issues are emphasized. The mathematical model of relations, taking place between transportation companies and their customers on the market, which is applied in the course of the research is based on continuous functions characteristics. This attitude enables the use of the field theory notions. The resultant vector-type utility function facilitates obtaining of competitive advantage areas for all transportation companies located on the considered transportation market.

  16. Transport mechanisms at the pulmonary mucosa: implications for drug delivery.

    PubMed

    Nickel, Sabrina; Clerkin, Caoimhe G; Selo, Mohammed Ali; Ehrhardt, Carsten

    2016-01-01

    Over the past years, a significant number of papers have substantiated earlier findings proposing a role for drug transporter proteins in pulmonary drug disposition. Whilst the majority of reports present data from in vitro models, a growing number of publications advance the field by introducing sophisticated ex vivo and in vivo techniques. In a few cases, evidence from clinical studies in human volunteers is complementing the picture. In this review, recent advances in pulmonary drug transporter research are critically evaluated. Transporter expression data in tissues and cell-based in vitro models is summarized and information on transport activity assessed. Novel techniques allowing for better quantification of transporter-related effects following pulmonary delivery are also described. Different tissue and cell populations of the lung have distinct transporter expression patterns. Whether these patterns are affected by disease, gender and smoking habits requires further clarification. Transporters have been found to have an impact on drug absorption processes, at least in vitro. Recent ex vivo experiments using isolated, perfused lung models, however, suggest that mainly efflux pumps have significant effects on absorption into the pulmonary circulation. Whether these rodent-based ex vivo models predict the human situation is basis for further research.

  17. An Approach for Economic Analysis of Intermodal Transportation

    PubMed Central

    Sahin, Bahri; Ust, Yasin; Guneri, Ali Fuat; Gulsun, Bahadir; Turan, Eda

    2014-01-01

    A different intermodal transportation model based on cost analysis considering technical, economical, and operational parameters is presented. The model consists of such intermodal modes as sea-road, sea-railway, road-railway, and multimode of sea-road-railway. A case study of cargo transportation has been carried out by using the suggested model. Then, the single road transportation mode has been compared to intermodal modes in terms of transportation costs. This comparison takes into account the external costs of intermodal transportation. The research reveals that, in the short distance transportation, single transportation modes always tend to be advantageous. As the transportation distance gets longer, intermodal transportation advantages begin to be effective on the costs. In addition, the proposed method in this study leads to determining the fleet size and capacity for transportation and the appropriate transportation mode. PMID:25152919

  18. An approach for economic analysis of intermodal transportation.

    PubMed

    Sahin, Bahri; Yilmaz, Huseyin; Ust, Yasin; Guneri, Ali Fuat; Gulsun, Bahadir; Turan, Eda

    2014-01-01

    A different intermodal transportation model based on cost analysis considering technical, economical, and operational parameters is presented. The model consists of such intermodal modes as sea-road, sea-railway, road-railway, and multimode of sea-road-railway. A case study of cargo transportation has been carried out by using the suggested model. Then, the single road transportation mode has been compared to intermodal modes in terms of transportation costs. This comparison takes into account the external costs of intermodal transportation. The research reveals that, in the short distance transportation, single transportation modes always tend to be advantageous. As the transportation distance gets longer, intermodal transportation advantages begin to be effective on the costs. In addition, the proposed method in this study leads to determining the fleet size and capacity for transportation and the appropriate transportation mode.

  19. Machine Learning and Deep Learning Models to Predict Runoff Water Quantity and Quality

    NASA Astrophysics Data System (ADS)

    Bradford, S. A.; Liang, J.; Li, W.; Murata, T.; Simunek, J.

    2017-12-01

    Contaminants can be rapidly transported at the soil surface by runoff to surface water bodies. Physically-based models, which are based on the mathematical description of main hydrological processes, are key tools for predicting surface water impairment. Along with physically-based models, data-driven models are becoming increasingly popular for describing the behavior of hydrological and water resources systems since these models can be used to complement or even replace physically based-models. In this presentation we propose a new data-driven model as an alternative to a physically-based overland flow and transport model. First, we have developed a physically-based numerical model to simulate overland flow and contaminant transport (the HYDRUS-1D overland flow module). A large number of numerical simulations were carried out to develop a database containing information about the impact of various input parameters (weather patterns, surface topography, vegetation, soil conditions, contaminants, and best management practices) on runoff water quantity and quality outputs. This database was used to train data-driven models. Three different methods (Neural Networks, Support Vector Machines, and Recurrence Neural Networks) were explored to prepare input- output functional relations. Results demonstrate the ability and limitations of machine learning and deep learning models to predict runoff water quantity and quality.

  20. Modeling and analysis of transport in the mammary glands

    NASA Astrophysics Data System (ADS)

    Quezada, Ana; Vafai, Kambiz

    2014-08-01

    The transport of three toxins moving from the blood stream into the ducts of the mammary glands is analyzed in this work. The model predictions are compared with experimental data from the literature. The utility of the model lies in its potential to improve our understanding of toxin transport as a pre-disposing factor to breast cancer. This work is based on a multi-layer transport model to analyze the toxins present in the breast milk. The breast milk in comparison with other sampling strategies allows us to understand the mass transport of toxins once inside the bloodstream of breastfeeding women. The multi-layer model presented describes the transport of caffeine, DDT and cimetidine. The analysis performed takes into account the unique transport mechanisms for each of the toxins. Our model predicts the movement of toxins and/or drugs within the mammary glands as well as their bioaccumulation in the tissues.

  1. SPRAYTRAN USER'S GUIDE: A GIS-BASED ATMOSPHERIC SPRAY DROPLET DISPERSION MODELING SYSTEM

    EPA Science Inventory

    The offsite drift of pesticide from spray operations is an ongoing source of concern. The SPRAY TRANsport (SPRAYTRAN) system, documented in this report, incorporates the near-field spray application model, AGDISP, into a meso-scale atmospheric transport model. The AGDISP model ...

  2. Development and calibration of the statewide land use-transport model

    DOT National Transportation Integrated Search

    1999-02-12

    The TRANUS package has been used to develop an integrated land use-transport model at the statewide level. It is based upon a specific modeling approach described by de la Barra (1989,1995). For the prototype statewide model developed during this pro...

  3. Predicting Ambulance Time of Arrival to the Emergency Department Using Global Positioning System and Google Maps

    PubMed Central

    Fleischman, Ross J.; Lundquist, Mark; Jui, Jonathan; Newgard, Craig D.; Warden, Craig

    2014-01-01

    Objective To derive and validate a model that accurately predicts ambulance arrival time that could be implemented as a Google Maps web application. Methods This was a retrospective study of all scene transports in Multnomah County, Oregon, from January 1 through December 31, 2008. Scene and destination hospital addresses were converted to coordinates. ArcGIS Network Analyst was used to estimate transport times based on street network speed limits. We then created a linear regression model to improve the accuracy of these street network estimates using weather, patient characteristics, use of lights and sirens, daylight, and rush-hour intervals. The model was derived from a 50% sample and validated on the remainder. Significance of the covariates was determined by p < 0.05 for a t-test of the model coefficients. Accuracy was quantified by the proportion of estimates that were within 5 minutes of the actual transport times recorded by computer-aided dispatch. We then built a Google Maps-based web application to demonstrate application in real-world EMS operations. Results There were 48,308 included transports. Street network estimates of transport time were accurate within 5 minutes of actual transport time less than 16% of the time. Actual transport times were longer during daylight and rush-hour intervals and shorter with use of lights and sirens. Age under 18 years, gender, wet weather, and trauma system entry were not significant predictors of transport time. Our model predicted arrival time within 5 minutes 73% of the time. For lights and sirens transports, accuracy was within 5 minutes 77% of the time. Accuracy was identical in the validation dataset. Lights and sirens saved an average of 3.1 minutes for transports under 8.8 minutes, and 5.3 minutes for longer transports. Conclusions An estimate of transport time based only on a street network significantly underestimated transport times. A simple model incorporating few variables can predict ambulance time of arrival to the emergency department with good accuracy. This model could be linked to global positioning system data and an automated Google Maps web application to optimize emergency department resource use. Use of lights and sirens had a significant effect on transport times. PMID:23865736

  4. Advanced propulsion for LEO-Moon transport. 3: Transportation model. M.S. Thesis - California Univ.

    NASA Technical Reports Server (NTRS)

    Henley, Mark W.

    1992-01-01

    A simplified computational model of low Earth orbit-Moon transportation system has been developed to provide insight into the benefits of new transportation technologies. A reference transportation infrastructure, based upon near-term technology developments, is used as a departure point for assessing other, more advanced alternatives. Comparison of the benefits of technology application, measured in terms of a mass payback ratio, suggests that several of the advanced technology alternatives could substantially improve the efficiency of low Earth orbit-Moon transportation.

  5. A continuum mechanics-based musculo-mechanical model for esophageal transport

    NASA Astrophysics Data System (ADS)

    Kou, Wenjun; Griffith, Boyce E.; Pandolfino, John E.; Kahrilas, Peter J.; Patankar, Neelesh A.

    2017-11-01

    In this work, we extend our previous esophageal transport model using an immersed boundary (IB) method with discrete fiber-based structural model, to one using a continuum mechanics-based model that is approximated based on finite elements (IB-FE). To deal with the leakage of flow when the Lagrangian mesh becomes coarser than the fluid mesh, we employ adaptive interaction quadrature points to deal with Lagrangian-Eulerian interaction equations based on a previous work (Griffith and Luo [1]). In particular, we introduce a new anisotropic adaptive interaction quadrature rule. The new rule permits us to vary the interaction quadrature points not only at each time-step and element but also at different orientations per element. This helps to avoid the leakage issue without sacrificing the computational efficiency and accuracy in dealing with the interaction equations. For the material model, we extend our previous fiber-based model to a continuum-based model. We present formulations for general fiber-reinforced material models in the IB-FE framework. The new material model can handle non-linear elasticity and fiber-matrix interactions, and thus permits us to consider more realistic material behavior of biological tissues. To validate our method, we first study a case in which a three-dimensional short tube is dilated. Results on the pressure-displacement relationship and the stress distribution matches very well with those obtained from the implicit FE method. We remark that in our IB-FE case, the three-dimensional tube undergoes a very large deformation and the Lagrangian mesh-size becomes about 6 times of Eulerian mesh-size in the circumferential orientation. To validate the performance of the method in handling fiber-matrix material models, we perform a second study on dilating a long fiber-reinforced tube. Errors are small when we compare numerical solutions with analytical solutions. The technique is then applied to the problem of esophageal transport. We use two fiber-reinforced models for the esophageal tissue: a bi-linear model and an exponential model. We present three cases on esophageal transport that differ in the material model and the muscle fiber architecture. The overall transport features are consistent with those observed from the previous model. We remark that the continuum-based model can handle more realistic and complicated material behavior. This is demonstrated in our third case where a spatially varying fiber architecture is included based on experimental study. We find that this unique muscle fiber architecture could generate a so-called pressure transition zone, which is a luminal pressure pattern that is of clinical interest. This suggests an important role of muscle fiber architecture in esophageal transport.

  6. Development of a Computer-Based Air Force Installation Restoration Workstation for Contaminant Modeling and Decision-Making

    DTIC Science & Technology

    1995-03-01

    advisory system provides a decision framework for selecting an appropriate model from the nuimerous available transport models conditinni-ed on...l1, T ,TV Groundwater Modeling, Contaminant Transport , Optimi2atio’ 2; Total Reliability, Remediation Si , , -J % UNCLASSIFIED UNCLASSIFIED...0 0 0 0 S 0 Sn S Even with the choice of an appropriate transport model, considlrable uncertainty is likely to be present in the analysis of

  7. Modeling tracer transport in randomly heterogeneous porous media by nonlocal moment equations: Anomalous transport

    NASA Astrophysics Data System (ADS)

    Morales-Casique, E.; Lezama-Campos, J. L.; Guadagnini, A.; Neuman, S. P.

    2013-05-01

    Modeling tracer transport in geologic porous media suffers from the corrupt characterization of the spatial distribution of hydrogeologic properties of the system and the incomplete knowledge of processes governing transport at multiple scales. Representations of transport dynamics based on a Fickian model of the kind considered in the advection-dispersion equation (ADE) fail to capture (a) the temporal variation associated with the rate of spreading of a tracer, and (b) the distribution of early and late arrival times which are often observed in field and/or laboratory scenarios and are considered as the signature of anomalous transport. Elsewhere we have presented exact stochastic moment equations to model tracer transport in randomly heterogeneous aquifers. We have also developed a closure scheme which enables one to provide numerical solutions of such moment equations at different orders of approximations. The resulting (ensemble) average and variance of concentration fields were found to display a good agreement against Monte Carlo - based simulation results for mildly heterogeneous (or well-conditioned strongly heterogeneous) media. Here we explore the ability of the moment equations approach to describe the distribution of early arrival times and late time tailing effects which can be observed in Monte-Carlo based breakthrough curves (BTCs) of the (ensemble) mean concentration. We show that BTCs of mean resident concentration calculated at a fixed space location through higher-order approximations of moment equations display long tailing features of the kind which is typically associated with anomalous transport behavior and are not represented by an ADE model with constant dispersive parameter, such as the zero-order approximation.

  8. ATLAS - A new Lagrangian transport and mixing model with detailed stratospheric chemistry

    NASA Astrophysics Data System (ADS)

    Wohltmann, I.; Rex, M.; Lehmann, R.

    2009-04-01

    We present a new global Chemical Transport Model (CTM) with full stratospheric chemistry and Lagrangian transport and mixing called ATLAS. Lagrangian models have some crucial advantages over Eulerian grid-box based models, like no numerical diffusion, no limitation of the time step of the model by the CFL criterion, conservation of mixing ratios by design and easy parallelization of code. The transport module is based on a trajectory code developed at the Alfred Wegener Institute. The horizontal and vertical resolution, the vertical coordinate system (pressure, potential temperature, hybrid coordinate) and the time step of the model are flexible, so that the model can be used both for process studies and long-time runs over several decades. Mixing of the Lagrangian air parcels is parameterized based on the local shear and strain of the flow with a method similar to that used in the CLaMS model, but with some modifications like a triangulation that introduces no vertical layers. The stratospheric chemistry module was developed at the Institute and includes 49 species and 170 reactions and a detailed treatment of heterogenous chemistry on polar stratospheric clouds. We present an overview over the model architecture, the transport and mixing concept and some validation results. Comparison of model results with tracer data from flights of the ER2 aircraft in the stratospheric polar vortex in 1999/2000 which are able to resolve fine tracer filaments show that excellent agreement with observed tracer structures can be achieved with a suitable mixing parameterization.

  9. Fuzzy multi-objective chance-constrained programming model for hazardous materials transportation

    NASA Astrophysics Data System (ADS)

    Du, Jiaoman; Yu, Lean; Li, Xiang

    2016-04-01

    Hazardous materials transportation is an important and hot issue of public safety. Based on the shortest path model, this paper presents a fuzzy multi-objective programming model that minimizes the transportation risk to life, travel time and fuel consumption. First, we present the risk model, travel time model and fuel consumption model. Furthermore, we formulate a chance-constrained programming model within the framework of credibility theory, in which the lengths of arcs in the transportation network are assumed to be fuzzy variables. A hybrid intelligent algorithm integrating fuzzy simulation and genetic algorithm is designed for finding a satisfactory solution. Finally, some numerical examples are given to demonstrate the efficiency of the proposed model and algorithm.

  10. PREDICTING SUBSURFACE CONTAMINANT TRANSPORT AND TRANSFORMATION: CONSIDERATIONS FOR MODEL SELECTION AND FIELD VALIDATION

    EPA Science Inventory

    Predicting subsurface contaminant transport and transformation requires mathematical models based on a variety of physical, chemical, and biological processes. The mathematical model is an attempt to quantitatively describe observed processes in order to permit systematic forecas...

  11. Understanding of flux-limited behaviors of heat transport in nonlinear regime

    NASA Astrophysics Data System (ADS)

    Guo, Yangyu; Jou, David; Wang, Moran

    2016-01-01

    The classical Fourier's law of heat transport breaks down in highly nonequilibrium situations as in nanoscale heat transport, where nonlinear effects become important. The present work is aimed at exploring the flux-limited behaviors based on a categorization of existing nonlinear heat transport models in terms of their theoretical foundations. Different saturation heat fluxes are obtained, whereas the same qualitative variation trend of heat flux versus exerted temperature gradient is got in diverse nonlinear models. The phonon hydrodynamic model is proposed to act as a standard to evaluate other heat flux limiters because of its more rigorous physical foundation. A deeper knowledge is thus achieved about the phenomenological generalized heat transport models. The present work provides deeper understanding and accurate modeling of nonlocal and nonlinear heat transport beyond the diffusive limit.

  12. Static Aeroelastic and Longitudinal Trim Model of Flexible Wing Aircraft Using Finite-Element Vortex-Lattice Coupled Solution

    NASA Technical Reports Server (NTRS)

    Ting, Eric; Nguyen, Nhan; Trinh, Khanh

    2014-01-01

    This paper presents a static aeroelastic model and longitudinal trim model for the analysis of a flexible wing transport aircraft. The static aeroelastic model is built using a structural model based on finite-element modeling and coupled to an aerodynamic model that uses vortex-lattice solution. An automatic geometry generation tool is used to close the loop between the structural and aerodynamic models. The aeroelastic model is extended for the development of a three degree-of-freedom longitudinal trim model for an aircraft with flexible wings. The resulting flexible aircraft longitudinal trim model is used to simultaneously compute the static aeroelastic shape for the aircraft model and the longitudinal state inputs to maintain an aircraft trim state. The framework is applied to an aircraft model based on the NASA Generic Transport Model (GTM) with wing structures allowed to flexibly deformed referred to as the Elastically Shaped Aircraft Concept (ESAC). The ESAC wing mass and stiffness properties are based on a baseline "stiff" values representative of current generation transport aircraft.

  13. Lagrangian Transport Model Forecasts as Useful Support of the Flight Planning During the Intercontinental Transport and Chemical Transformation 2002 (ITCT 2k2) Measurement Campaign

    NASA Astrophysics Data System (ADS)

    Forster, C.; Cooper, O.; Stohl, A.; Eckhardt, S.; James, P.; Dunlea, E.; Nicks, D. K.; Holloway, J. S.; Hübler, G.; Parrish, D. D.; Ryerson, T. B.; Trainer, M.

    2002-12-01

    In this study, the Lagrangian tracer transport model FLEXPART is shown to be a useful forecasting tool for the flight planning during the ITCT 2k2 (Intercontinental Transport and Chemical Transformation 2002) aircraft measurement campaign. The advantages of this model are that it requires only a short computation time, has a finer spatial resolution and does not suffer numerical diffusion compared to chemistry transport models (CTMs). It is a compromise between simple trajectory calculations and complex CTMs that makes best use of available computer hardware. During the campaign FLEXPART provided three-day forecasts for four different anthropogenic CO tracers: Asian, North American, Japanese, and European. The forecasts were based on data from the Aviation model (AVN) of the National Center for Environmental Prediction (NCEP) and relied on the EDGAR emission inventory for the base year 1990. In two case studies, the forecast abilities of FLEXPART are analysed and discussed by comparing the forecasts with measurement data, results from the post analysis modelling, infrared satellite images, and backward trajectories calculated with two different Lagrangian trajectory models. It is shown that intercontinental transport and dispersion of pollution plumes were qualitatively well predicted, and the aircraft could successfully be directed into the polluted air masses.

  14. Continuous Probabilistic Modeling of Tracer Stone Dispersal in Upper Regime

    NASA Astrophysics Data System (ADS)

    Hernandez Moreira, R. R.; Viparelli, E.

    2017-12-01

    Morphodynamic models that specifically account for the non-uniformity of the bed material are generally based on some form of the active layer approximation. These models have proven to be useful tools in the study of transport, erosion and deposition of non-uniform bed material in the case of channel bed aggradation and degradation. However, when local spatial effects over short time scales compared to those characterizing the changes in mean bed elevation dominate the vertical sediment fluxes, as is the presence of bedforms, active layer models cannot capture key details of the sediment transport process. To overcome the limitations of active layer based models, Parker, Paola and Leclair (PPL) proposed a continuous probabilistic modeling frameworks in which the sediment exchange between the bedload transport and the mobile bed is described in terms of probability density functions of bed elevation, entrainment and deposition. Here we present the implementation of a modified version of the PPL modeling framework for the study of tracer stones dispsersal in upper regime bedload transport conditions (i.e. upper regime plane bed at the transition between dunes and antidunes, downstream migrating antidunes and upper regime plane bed with bedload transport in sheet flow mode) in which the probability functions are based on measured time series of bed elevation fluctuations. The extension to the more general case of mixtures of sediments differing in size is the future development of the proposed work.

  15. Integrated freight network model : a GIS-based platform for transportation analyses.

    DOT National Transportation Integrated Search

    2015-01-01

    The models currently used to examine the behavior transportation systems are usually mode-specific. That is, they focus on a single mode (i.e. railways, highways, or waterways). The lack of : integration limits the usefulness of models to analyze the...

  16. Characterization of chemical agent transport in paints.

    PubMed

    Willis, Matthew P; Gordon, Wesley; Lalain, Teri; Mantooth, Brent

    2013-09-15

    A combination of vacuum-based vapor emission measurements with a mass transport model was employed to determine the interaction of chemical warfare agents with various materials, including transport parameters of agents in paints. Accurate determination of mass transport parameters enables the simulation of the chemical agent distribution in a material for decontaminant performance modeling. The evaluation was performed with the chemical warfare agents bis(2-chloroethyl) sulfide (distilled mustard, known as the chemical warfare blister agent HD) and O-ethyl S-[2-(diisopropylamino)ethyl] methylphosphonothioate (VX), an organophosphate nerve agent, deposited on to two different types of polyurethane paint coatings. The results demonstrated alignment between the experimentally measured vapor emission flux and the predicted vapor flux. Mass transport modeling demonstrated rapid transport of VX into the coatings; VX penetrated through the aliphatic polyurethane-based coating (100 μm) within approximately 107 min. By comparison, while HD was more soluble in the coatings, the penetration depth in the coatings was approximately 2× lower than VX. Applications of mass transport parameters include the ability to predict agent uptake, and subsequent long-term vapor emission or contact transfer where the agent could present exposure risks. Additionally, these parameters and model enable the ability to perform decontamination modeling to predict how decontaminants remove agent from these materials. Published by Elsevier B.V.

  17. Comparing Lagrangian and Eulerian models for CO2 transport - a step towards Bayesian inverse modeling using WRF/STILT-VPRM

    NASA Astrophysics Data System (ADS)

    Pillai, D.; Gerbig, C.; Kretschmer, R.; Beck, V.; Karstens, U.; Neininger, B.; Heimann, M.

    2012-01-01

    We present simulations of atmospheric CO2 concentrations provided by two modeling systems, run at high spatial resolution: the Eulerian-based Weather Research Forecasting (WRF) model and the Lagrangian-based Stochastic Time-Inverted Lagrangian Transport (STILT) model, both of which are coupled to a diagnostic biospheric model, the Vegetation Photosynthesis and Respiration Model (VPRM). The consistency of the simulations is assessed with special attention paid to the details of horizontal as well as vertical transport and mixing of CO2 concentrations in the atmosphere. The dependence of model mismatch (Eulerian vs. Lagrangian) on models' spatial resolution is further investigated. A case study using airborne measurements during which both models showed large deviations from each other is analyzed in detail as an extreme case. Using aircraft observations and pulse release simulations, we identified differences in the representation of details in the interaction between turbulent mixing and advection through wind shear as the main cause of discrepancies between WRF and STILT transport at a spatial resolution such as 2 and 6 km. Based on observations and inter-model comparisons of atmospheric CO2 concentrations, we show that a refinement of the parameterization of turbulent velocity variance and Lagrangian time-scale in STILT is needed to achieve a better match between the Eulerian and the Lagrangian transport at such a high spatial resolution (e.g. 2 and 6 km). Nevertheless, the inter-model differences in simulated CO2 time series for a tall tower observatory at Ochsenkopf in Germany are about a factor of two smaller than the model-data mismatch and about a factor of three smaller than the mismatch between the current global model simulations and the data. Thus suggests that it is reasonable to use STILT as an adjoint model of WRF atmospheric transport.

  18. Application of multimedia models for screening assessment of long-range transport potential and overall persistence.

    PubMed

    Klasmeier, Jörg; Matthies, Michael; Macleod, Matthew; Fenner, Kathrin; Scheringer, Martin; Stroebe, Maximilian; Le Gall, Anne Christine; Mckone, Thomas; Van De Meent, Dik; Wania, Frank

    2006-01-01

    We propose a multimedia model-based methodology to evaluate whether a chemical substance qualifies as POP-like based on overall persistence (Pov) and potential for long-range transport (LRTP). It relies upon screening chemicals against the Pov and LRTP characteristics of selected reference chemicals with well-established environmental fates. Results indicate that chemicals of high and low concern in terms of persistence and long-range transport can be consistently identified by eight contemporary multimedia models using the proposed methodology. Model results for three hypothetical chemicals illustrate that the model-based classification of chemicals according to Pov and LRTP is not always consistent with the single-media half-life approach proposed by the UNEP Stockholm Convention and thatthe models provide additional insight into the likely long-term hazards associated with chemicals in the environment. We suggest this model-based classification method be adopted as a complement to screening against defined half-life criteria at the initial stages of tiered assessments designed to identify POP-like chemicals and to prioritize further environmental fate studies for new and existing chemicals.

  19. Systems pharmacology modeling of drug‐induced hyperbilirubinemia: Differentiating hepatotoxicity and inhibition of enzymes/transporters

    PubMed Central

    Battista, C; Woodhead, JL; Stahl, SH; Mettetal, JT; Watkins, PB; Siler, SQ; Howell, BA

    2017-01-01

    Elevations in serum bilirubin during drug treatment may indicate global liver dysfunction and a high risk of liver failure. However, drugs also can increase serum bilirubin in the absence of hepatic injury by inhibiting specific enzymes/transporters. We constructed a mechanistic model of bilirubin disposition based on known functional polymorphisms in bilirubin metabolism/transport. Using physiologically based pharmacokinetic (PBPK) model‐predicted drug exposure and enzyme/transporter inhibition constants determined in vitro, our model correctly predicted indinavir‐mediated hyperbilirubinemia in humans and rats. Nelfinavir was predicted not to cause hyperbilirubinemia, consistent with clinical observations. We next examined a new drug candidate that caused both elevations in serum bilirubin and biochemical evidence of liver injury in rats. Simulations suggest that bilirubin elevation primarily resulted from inhibition of transporters rather than global liver dysfunction. We conclude that mechanistic modeling of bilirubin can help elucidate underlying mechanisms of drug‐induced hyperbilirubinemia, and thereby distinguish benign from clinically important elevations in serum bilirubin. PMID:28074467

  20. Impact of Transport Zone Number in Simulation Models on Cost-Benefit Analysis Results in Transport Investments

    NASA Astrophysics Data System (ADS)

    Chmielewski, Jacek

    2017-10-01

    Nowadays, feasibility studies need to be prepared for all planned transport investments, mainly those co-financed with UE grants. One of the fundamental aspect of feasibility study is the economic justification of an investment, evaluated in an area of so called cost-benefit analysis (CBA). The main goal of CBA calculation is to prove that a transport investment is really important for the society and should be implemented as economically efficient one. It can be said that the number of hours (PH - passengers hours) in trips and travelled kilometres (PK - passengers kilometres) are the most important for CBA results. The differences between PH and PK calculated for particular investment scenarios are the base for benefits calculation. Typically, transport simulation models are the best source for such data. Transport simulation models are one of the most powerful tools for transport network planning. They make it possible to evaluate forecast traffic volume and passenger flows in a public transport system for defined scenarios of transport and area development. There are many different transport models. Their construction is often similar, and they mainly differ in the level of their accuracy. Even models for the same area may differ in this matter. Typically, such differences come from the accuracy of supply side representation: road and public transport network representation. In many cases only main roads and a public transport network are represented, while local and service roads are eliminated as a way of reality simplification. This also enables a faster and more effective calculation process. On the other hand, the description of demand part of these models based on transport zones is often stable. Difficulties with data collection, mainly data on land use, resulted in the lack of changes in the analysed land division into so called transport zones. In this paper the author presents an influence of land division on the results of traffic analyses, and hence on CBA outcome. Moreover, the paper shows that the effectiveness of investments as represented in the results of cost-benefit analyses is strictly correlated to a transport model detail.

  1. Use of MODIS Satellite Data to Evaluate Juniperus spp. Pollen Phenology to Support a Pollen Dispersal Model, PREAM, to Support Public Health Allergy Alerts

    NASA Technical Reports Server (NTRS)

    Luvall, J. C.; Sprigg, W. A.; Levetin, E.; Huete, A.; Nickovic, S.; Prasad, A.; Pejanovic, G. A.; Vukovic, A.; VandeWater, P. K.; Budge, A. M.; hide

    2013-01-01

    Pollen can be transported great distances. Van de Water et. al., 2003 reported Juniperus spp. pollen was transported 200-600 km. Hence local observations of plant phenology may not be consistent with the timing and source of pollen collected by pollen sampling instruments. The DREAM (Dust REgional Atmospheric Model) is a verified model for atmospheric dust transport modeling using MODIS data products to identify source regions and concentrations of dust. We are modifying the DREAM model to incorporate pollen transport. Pollen emission is based on MODIS-derived phenology of Juniperus spp. communities. Ground-based observational records of pollen release timing and quantities will be used as model verification. This information will be used to support the Centers for Disease Control and Prevention s National Environmental Public Health Tracking Program and the State of New Mexico environmental public health decision support for asthma and allergies alerts

  2. Use of MODIS Satellite Data to Evaluate Juniperus spp. Pollen Phenology to Support a Pollen Dispersal Model, PREAM, to Support Public Health Allergy Alerts

    NASA Technical Reports Server (NTRS)

    Luvall, J. C.; Sprigg, W. A.; Levetin, E.; Huete, A.; Nickovic, S.; Prasad, A.; Pejanovic, G. A.; Vukovic, A.; VandeWater, P. K.; Budge, A. M.; hide

    2012-01-01

    Pollen can be transported great distances. Van de Water et. al., 2003 reported Juniperus spp. pollen was transported 200-600 km. Hence local observations of plant phenology may not be consistent with the timing and source of pollen collected by pollen sampling instruments. The DREAM (Dust REgional Atmospheric Model, Nickovic et al. 2001) is a verified model for atmospheric dust transport modeling using MODIS data products to identify source regions and concentrations of dust. We are modifying the DREAM model to incorporate pollen transport. Pollen emission is based on MODIS-derived phenology of Juniperus spp. communities. Ground-based observational records of pollen release timing and quantities will be used as model verification. This information will be used to support the Centers for Disease Control and Prevention's National Environmental Public Health Tracking Program and the State of New Mexico environmental public health decision support for asthma and allergies alerts.

  3. Use of MODIS Satellite Data to Evaluate Juniperus spp. Pollen Phenology to Support a Pollen Dispersal Model, PREAM, to Support Public Health Allergy Alerts

    NASA Astrophysics Data System (ADS)

    Luvall, J. C.; Sprigg, W. A.; Levetin, E.; Huete, A. R.; Nickovic, S.; Prasad, A. K.; Pejanovic, G.; Vukovic, A.; Van De Water, P. K.; Budge, A.; Hudspeth, W. B.; Krapfl, H.; Toth, B.; Zelicoff, A.; Myers, O.; Bunderson, L.; Ponce-Campos, G.; Menache, M.; Crimmins, T. M.; Vujadinovic, M.

    2012-12-01

    Pollen can be transported great distances. Van de Water et. al., 2003 reported Juniperus spp. pollen was transported 200-600 km. Hence local observations of plant phenology may not be consistent with the timing and source of pollen collected by pollen sampling instruments. The DREAM (Dust REgional Atmospheric Model, Nickovic et al. 2001) is a verified model for atmospheric dust transport modeling using MODIS data products to identify source regions and concentrations of dust. We are modifying the DREAM model to incorporate pollen transport. Pollen emission is based on MODIS-derived phenology of Juniperus spp. communities. Ground-based observational records of pollen release timing and quantities will be used as model verification. This information will be used to support the Centers for Disease Control and Prevention's National Environmental Public Health Tracking Program and the State of New Mexico environmental public health decision support for asthma and allergies alerts.

  4. Determining the transport mechanism of an enzyme-catalytic complex metabolic network based on biological robustness.

    PubMed

    Wang, Lei

    2013-04-01

    Understanding the transport mechanism of 1,3-propanediol (1,3-PD) is of critical importance to do further research on gene regulation. Due to the lack of intracellular information, on the basis of enzyme-catalytic system, using biological robustness as performance index, we present a system identification model to infer the most possible transport mechanism of 1,3-PD, in which the performance index consists of the relative error of the extracellular substance concentrations and biological robustness of the intracellular substance concentrations. We will not use a Boolean framework but prefer a model description based on ordinary differential equations. Among other advantages, this also facilitates the robustness analysis, which is the main goal of this paper. An algorithm is constructed to seek the solution of the identification model. Numerical results show that the most possible transport way is active transport coupled with passive diffusion.

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Podesta, M.; Gorelenkova, M.; Fredrickson, E. D.

    Here, integrated simulations of tokamak discharges typically rely on classical physics to model energetic particle (EP) dynamics. However, there are numerous cases in which energetic particles can suffer additional transport that is not classical in nature. Examples include transport by applied 3D magnetic perturbations and, more notably, by plasma instabilities. Focusing on the effects of instabilities,ad-hocmodels can empirically reproduce increased transport, but the choice of transport coefficients is usually somehow arbitrary. New approaches based on physics-based reduced models are being developed to address those issues in a simplified way, while retaining a more correct treatment of resonant wave-particle interactions. Themore » kick model implemented in the tokamaktransport code TRANSP is an example of such reduced models. It includes modifications of the EP distribution by instabilities in real and velocity space, retaining correlations between transport in energy and space typical of resonant EP transport. The relevance of EP phase space modifications by instabilities is first discussed in terms of predicted fast ion distribution. Results are compared with those from a simple, ad-hoc diffusive model. It is then shown that the phase-space resolved model can also provide additional insight into important issues such as internal consistency of the simulations and mode stability through the analysis of the power exchanged between energetic particles and the instabilities.« less

  6. Comparing Lagrangian and Eulerian models for CO2 transport - a step towards Bayesian inverse modeling using WRF/STILT-VPRM

    NASA Astrophysics Data System (ADS)

    Pillai, D.; Gerbig, C.; Kretschmer, R.; Beck, V.; Karstens, U.; Neininger, B.; Heimann, M.

    2012-10-01

    We present simulations of atmospheric CO2 concentrations provided by two modeling systems, run at high spatial resolution: the Eulerian-based Weather Research Forecasting (WRF) model and the Lagrangian-based Stochastic Time-Inverted Lagrangian Transport (STILT) model, both of which are coupled to a diagnostic biospheric model, the Vegetation Photosynthesis and Respiration Model (VPRM). The consistency of the simulations is assessed with special attention paid to the details of horizontal as well as vertical transport and mixing of CO2 concentrations in the atmosphere. The dependence of model mismatch (Eulerian vs. Lagrangian) on models' spatial resolution is further investigated. A case study using airborne measurements during which two models showed large deviations from each other is analyzed in detail as an extreme case. Using aircraft observations and pulse release simulations, we identified differences in the representation of details in the interaction between turbulent mixing and advection through wind shear as the main cause of discrepancies between WRF and STILT transport at a spatial resolution such as 2 and 6 km. Based on observations and inter-model comparisons of atmospheric CO2 concentrations, we show that a refinement of the parameterization of turbulent velocity variance and Lagrangian time-scale in STILT is needed to achieve a better match between the Eulerian and the Lagrangian transport at such a high spatial resolution (e.g. 2 and 6 km). Nevertheless, the inter-model differences in simulated CO2 time series for a tall tower observatory at Ochsenkopf in Germany are about a factor of two smaller than the model-data mismatch and about a factor of three smaller than the mismatch between the current global model simulations and the data.

  7. Electronic transport in VO 2 —Experimentally calibrated Boltzmann transport modeling

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kinaci, Alper; Kado, Motohisa; Rosenmann, Daniel

    2015-12-28

    Materials that undergo metal-insulator transitions (MITs) are under intense study because the transition is scientifically fascinating and technologically promising for various applications. Among these materials, VO2 has served as a prototype due to its favorable transition temperature. While the physical underpinnings of the transition have been heavily investigated experimentally and computationally, quantitative modeling of electronic transport in the two phases has yet to be undertaken. In this work, we establish a density-functional-theory (DFT)-based approach to model electronic transport properties in VO2 in the semiconducting and metallic regimes, focusing on band transport using the Boltzmann transport equations. We synthesized high qualitymore » VO2 films and measured the transport quantities across the transition, in order to calibrate the free parameters in the model. We find that the experimental calibration of the Hubbard correction term can efficiently and adequately model the metallic and semiconducting phases, allowing for further computational design of MIT materials for desirable transport properties.« less

  8. Model for toroidal velocity in H-mode plasmas in the presence of internal transport barriers

    NASA Astrophysics Data System (ADS)

    Chatthong, B.; Onjun, T.; Singhsomroje, W.

    2010-06-01

    A model for predicting toroidal velocity in H-mode plasmas in the presence of internal transport barriers (ITBs) is developed using an empirical approach. In this model, it is assumed that the toroidal velocity is directly proportional to the local ion temperature. This model is implemented in the BALDUR integrated predictive modelling code so that simulations of ITB plasmas can be carried out self-consistently. In these simulations, a combination of a semi-empirical mixed Bohm/gyro-Bohm (mixed B/gB) core transport model that includes ITB effects and NCLASS neoclassical transport is used to compute a core transport. The boundary is taken to be at the top of the pedestal, where the pedestal values are described using a theory-based pedestal model based on a combination of magnetic and flow shear stabilization pedestal width scaling and an infinite-n ballooning pressure gradient model. The combination of the mixed B/gB core transport model with ITB effects, together with the pedestal and the toroidal velocity models, is used to simulate the time evolution of plasma current, temperature and density profiles of 10 JET optimized shear discharges. It is found that the simulations can reproduce an ITB formation in these discharges. Statistical analyses including root mean square error (RMSE) and offset are used to quantify the agreement. It is found that the averaged RMSE and offset among these discharges are about 24.59% and -0.14%, respectively.

  9. A Model to Couple Flow, Thermal and Reactive Chemical Transport, and Geo-mechanics in Variably Saturated Media

    NASA Astrophysics Data System (ADS)

    Yeh, G. T.; Tsai, C. H.

    2015-12-01

    This paper presents the development of a THMC (thermal-hydrology-mechanics-chemistry) process model in variably saturated media. The governing equations for variably saturated flow and reactive chemical transport are obtained based on the mass conservation principle of species transport supplemented with Darcy's law, constraint of species concentration, equation of states, and constitutive law of K-S-P (Conductivity-Degree of Saturation-Capillary Pressure). The thermal transport equation is obtained based on the conservation of energy. The geo-mechanic displacement is obtained based on the assumption of equilibrium. Conventionally, these equations have been implicitly coupled via the calculations of secondary variables based on primary variables. The mechanisms of coupling have not been obvious. In this paper, governing equations are explicitly coupled for all primary variables. The coupling is accomplished via the storage coefficients, transporting velocities, and conduction-dispersion-diffusion coefficient tensor; one set each for every primary variable. With this new system of equations, the coupling mechanisms become clear. Physical interpretations of every term in the coupled equations will be discussed. Examples will be employed to demonstrate the intuition and superiority of these explicit coupling approaches. Keywords: Variably Saturated Flow, Thermal Transport, Geo-mechanics, Reactive Transport.

  10. Effects of seasonal variability in across- and alongshore transport of anchoveta ( Engraulis ringens) larvae on model-based pre-recruitment indices off central Chile

    NASA Astrophysics Data System (ADS)

    Parada, Carolina; Colas, Francois; Soto-Mendoza, Samuel; Castro, Leonardo

    2012-01-01

    An individual-based model (IBM) of anchoveta ( Engraulis ringens) larvae was coupled to a climatological hydrodynamic (Regional Oceanic Modeling System, ROMS) model for central-southern Chile to answer the question as to whether or not across- and alongshore transport off central-southern Chile enhances retention in the spawning areas during the winter and summer reproductive periods, using model-based pre-recruitment indices (simulated transport success to nursery areas). The hydrodynamic model validation showed that ROMS captures the mean Seas Surface Temperature and Eddie Kinetic Energy observed in satellite-based data over the entire region. The IBM was used to simulate the transport of eggs and larvae from spawning zones in central Chile (Constitución, Dichato, Gulf of Arauco and Lebu-Corral) to historical nursery areas (HRZ, region between 35°S and 37°S). Model results corroborated HRZ as the most successful pre-recruitment zone (particles originated in the Dichato and Gulf of Arauco spawning areas), as well as identifying Lebu-Corral as a zone of high retention with a high associated pre-recruitment index (particles originated in the Lebu-Corral spawning zone). The highest pre-recruitment values were mainly found in winter. The Constitución and Dichato spawning zones displayed a typical summer upwelling velocity pattern, while the Gulf of Arauco in summertime showed strong offshore and alongshore velocity components. The Lebu-Corral region in winter presented important near-surface cross-shore transport towards the coast (associated with downwelling events), this might be one of the major mechanisms leading to high retention levels and a high pre-recruitment index for Lebu-Corral spawning zone. The limitations of the modeling approach are discussed and put into perspective for future work.

  11. You Can Run, But You Can't Hide Juniper Pollen Phenology and Dispersal

    NASA Technical Reports Server (NTRS)

    Luvall, Jeffrey C.

    2013-01-01

    Pollen can be transported great distances. Van de Water et. al., 2003 reported Juniperus spp. pollen was transported 200-600 km. Hence local observations of plant phenology may not be consistent with the timing and source of pollen collected by pollen sampling instruments. The DREAM (Dust REgional Atmospheric Model, Nickovic et al. 2001) is a verified model for atmospheric dust transport modeling using MODIS data products to identify source regions and quantities of dust. We are modified the DREAM model to incorporate pollen transport. Pollen release is estimated based on MODIS derived phenology of Juniperus spp. communities. Ground based observational records of pollen release timing and quantities are used as verification. This information will be used to support the Centers for Disease Control and Prevention's National Environmental Public Health Tracking Program and the State of New Mexico environmental public health decision support for asthma and allergies alerts.

  12. Data Driven Model Development for the Supersonic Semispan Transport (S(sup 4)T)

    NASA Technical Reports Server (NTRS)

    Kukreja, Sunil L.

    2011-01-01

    We investigate two common approaches to model development for robust control synthesis in the aerospace community; namely, reduced order aeroservoelastic modelling based on structural finite-element and computational fluid dynamics based aerodynamic models and a data-driven system identification procedure. It is shown via analysis of experimental Super- Sonic SemiSpan Transport (S4T) wind-tunnel data using a system identification approach it is possible to estimate a model at a fixed Mach, which is parsimonious and robust across varying dynamic pressures.

  13. Hybrid light transport model based bioluminescence tomography reconstruction for early gastric cancer detection

    NASA Astrophysics Data System (ADS)

    Chen, Xueli; Liang, Jimin; Hu, Hao; Qu, Xiaochao; Yang, Defu; Chen, Duofang; Zhu, Shouping; Tian, Jie

    2012-03-01

    Gastric cancer is the second cause of cancer-related death in the world, and it remains difficult to cure because it has been in late-stage once that is found. Early gastric cancer detection becomes an effective approach to decrease the gastric cancer mortality. Bioluminescence tomography (BLT) has been applied to detect early liver cancer and prostate cancer metastasis. However, the gastric cancer commonly originates from the gastric mucosa and grows outwards. The bioluminescent light will pass through a non-scattering region constructed by gastric pouch when it transports in tissues. Thus, the current BLT reconstruction algorithms based on the approximation model of radiative transfer equation are not optimal to handle this problem. To address the gastric cancer specific problem, this paper presents a novel reconstruction algorithm that uses a hybrid light transport model to describe the bioluminescent light propagation in tissues. The radiosity theory integrated with the diffusion equation to form the hybrid light transport model is utilized to describe light propagation in the non-scattering region. After the finite element discretization, the hybrid light transport model is converted into a minimization problem which fuses an l1 norm based regularization term to reveal the sparsity of bioluminescent source distribution. The performance of the reconstruction algorithm is first demonstrated with a digital mouse based simulation with the reconstruction error less than 1mm. An in situ gastric cancer-bearing nude mouse based experiment is then conducted. The primary result reveals the ability of the novel BLT reconstruction algorithm in early gastric cancer detection.

  14. Phase space effects on fast ion distribution function modeling in tokamaks

    DOE PAGES

    Podesta, M.; Gorelenkova, M.; Fredrickson, E. D.; ...

    2016-04-14

    Here, integrated simulations of tokamak discharges typically rely on classical physics to model energetic particle (EP) dynamics. However, there are numerous cases in which energetic particles can suffer additional transport that is not classical in nature. Examples include transport by applied 3D magnetic perturbations and, more notably, by plasma instabilities. Focusing on the effects of instabilities,ad-hocmodels can empirically reproduce increased transport, but the choice of transport coefficients is usually somehow arbitrary. New approaches based on physics-based reduced models are being developed to address those issues in a simplified way, while retaining a more correct treatment of resonant wave-particle interactions. Themore » kick model implemented in the tokamaktransport code TRANSP is an example of such reduced models. It includes modifications of the EP distribution by instabilities in real and velocity space, retaining correlations between transport in energy and space typical of resonant EP transport. The relevance of EP phase space modifications by instabilities is first discussed in terms of predicted fast ion distribution. Results are compared with those from a simple, ad-hoc diffusive model. It is then shown that the phase-space resolved model can also provide additional insight into important issues such as internal consistency of the simulations and mode stability through the analysis of the power exchanged between energetic particles and the instabilities.« less

  15. Peritoneal fluid transport in CAPD patients with different transport rates of small solutes.

    PubMed

    Sobiecka, Danuta; Waniewski, Jacek; Weryński, Andrzej; Lindholm, Bengt

    2004-01-01

    Continuous ambulatory peritoneal dialysis (CAPD) patients with high peritoneal solute transport rate often have inadequate peritoneal fluid transport. It is not known whether this inadequate fluid transport is due solely to a too rapid fall of osmotic pressure, or if the decreased effectiveness of fluid transport is also a contributing factor. To analyze fluid transport parameters and the effectiveness of dialysis fluid osmotic pressure in the induction of fluid flow in CAPD patients with different small solute transport rates. 44 CAPD patients were placed in low (n = 6), low-average (n = 13), high-average (n = 19), and high (n = 6) transport groups according to a modified peritoneal equilibration test (PET). The study involved a 6-hour peritoneal dialysis dwell with 2 L 3.86% glucose dialysis fluid for each patient. Radioisotopically labeled serum albumin was added as a volume marker.The fluid transport parameters (osmotic conductance and fluid absorption rate) were estimated using three mathematical models of fluid transport: (1) Pyle model (model P), which describes ultrafiltration rate as an exponential function of time; (2) model OS, which is based on the linear relationship of ultrafiltration rate and overall osmolality gradient between dialysis fluid and blood; and (3) model G, which is based on the linear relationship between ultrafiltration rate and glucose concentration gradient between dialysis fluid and blood. Diffusive mass transport coefficients (K(BD)) for glucose, urea, creatinine, potassium, and sodium were estimated using the modified Babb-Randerson-Farrell model. The high transport group had significantly lower dialysate volume and glucose and osmolality gradients between dialysate and blood, but significantly higher K(BD) for small solutes compared with the other transport groups. Osmotic conductance, fluid absorption rate, and initial ultrafiltration rate did not differ among the transport groups for model OS and model P. Model G yielded unrealistic values of fluid transport parameters that differed from those estimated by models OS and P. The K(BD) values for small solutes were significantly different among the groups, and did not correlate with fluid transport parameters for model OS. The difference in fluid transport between the different transport groups was due only to the differences in the rate of disappearance of the overall osmotic pressure of the dialysate, which was a combined result of the transport rate of glucose and other small solutes. Although the glucose gradient is the major factor influencing ultrafiltration rate, other solutes, such as urea, are also of importance. The counteractive effect of plasma small solutes on transcapillary ultrafiltration was found to be especially notable in low transport patients. Thus, glucose gradient alone should not be considered the only force that shapes the ultrafiltration profile during peritoneal dialysis. We did not find any correlations between diffusive mass transport coefficients for small solutes and fluid transport parameters such as osmotic conductance or fluid and volume marker absorption. We may thus conclude that the pathway(s) for fluid transport appears to be partly independent from the pathway(s) for small solute transport, which supports the hypothesis of different pore types for fluid and solute transport.

  16. A multivariate quadrature based moment method for LES based modeling of supersonic combustion

    NASA Astrophysics Data System (ADS)

    Donde, Pratik; Koo, Heeseok; Raman, Venkat

    2012-07-01

    The transported probability density function (PDF) approach is a powerful technique for large eddy simulation (LES) based modeling of scramjet combustors. In this approach, a high-dimensional transport equation for the joint composition-enthalpy PDF needs to be solved. Quadrature based approaches provide deterministic Eulerian methods for solving the joint-PDF transport equation. In this work, it is first demonstrated that the numerical errors associated with LES require special care in the development of PDF solution algorithms. The direct quadrature method of moments (DQMOM) is one quadrature-based approach developed for supersonic combustion modeling. This approach is shown to generate inconsistent evolution of the scalar moments. Further, gradient-based source terms that appear in the DQMOM transport equations are severely underpredicted in LES leading to artificial mixing of fuel and oxidizer. To overcome these numerical issues, a semi-discrete quadrature method of moments (SeQMOM) is formulated. The performance of the new technique is compared with the DQMOM approach in canonical flow configurations as well as a three-dimensional supersonic cavity stabilized flame configuration. The SeQMOM approach is shown to predict subfilter statistics accurately compared to the DQMOM approach.

  17. Quantitative analysis of intra-Golgi transport shows intercisternal exchange for all cargo

    PubMed Central

    Dmitrieff, Serge; Rao, Madan; Sens, Pierre

    2013-01-01

    The mechanisms controlling the transport of proteins through the Golgi stack of mammalian and plant cells is the subject of intense debate, with two models, cisternal progression and intercisternal exchange, emerging as major contenders. A variety of transport experiments have claimed support for each of these models. We reevaluate these experiments using a single quantitative coarse-grained framework of intra-Golgi transport that accounts for both transport models and their many variants. Our analysis makes a definitive case for the existence of intercisternal exchange both for small membrane proteins and large protein complexes––this implies that membrane structures larger than the typical protein-coated vesicles must be involved in transport. Notwithstanding, we find that current observations on protein transport cannot rule out cisternal progression as contributing significantly to the transport process. To discriminate between the different models of intra-Golgi transport, we suggest experiments and an analysis based on our extended theoretical framework that compare the dynamics of transiting and resident proteins. PMID:24019488

  18. Particle tracking acceleration via signed distance fields in direct-accelerated geometry Monte Carlo

    DOE PAGES

    Shriwise, Patrick C.; Davis, Andrew; Jacobson, Lucas J.; ...

    2017-08-26

    Computer-aided design (CAD)-based Monte Carlo radiation transport is of value to the nuclear engineering community for its ability to conduct transport on high-fidelity models of nuclear systems, but it is more computationally expensive than native geometry representations. This work describes the adaptation of a rendering data structure, the signed distance field, as a geometric query tool for accelerating CAD-based transport in the direct-accelerated geometry Monte Carlo toolkit. Demonstrations of its effectiveness are shown for several problems. The beginnings of a predictive model for the data structure's utilization based on various problem parameters is also introduced.

  19. Systematic Development of Intelligent Systems for Public Road Transport.

    PubMed

    García, Carmelo R; Quesada-Arencibia, Alexis; Cristóbal, Teresa; Padrón, Gabino; Alayón, Francisco

    2016-07-16

    This paper presents an architecture model for the development of intelligent systems for public passenger transport by road. The main objective of our proposal is to provide a framework for the systematic development and deployment of telematics systems to improve various aspects of this type of transport, such as efficiency, accessibility and safety. The architecture model presented herein is based on international standards on intelligent transport system architectures, ubiquitous computing and service-oriented architecture for distributed systems. To illustrate the utility of the model, we also present a use case of a monitoring system for stops on a public passenger road transport network.

  20. Systematic Development of Intelligent Systems for Public Road Transport

    PubMed Central

    García, Carmelo R.; Quesada-Arencibia, Alexis; Cristóbal, Teresa; Padrón, Gabino; Alayón, Francisco

    2016-01-01

    This paper presents an architecture model for the development of intelligent systems for public passenger transport by road. The main objective of our proposal is to provide a framework for the systematic development and deployment of telematics systems to improve various aspects of this type of transport, such as efficiency, accessibility and safety. The architecture model presented herein is based on international standards on intelligent transport system architectures, ubiquitous computing and service-oriented architecture for distributed systems. To illustrate the utility of the model, we also present a use case of a monitoring system for stops on a public passenger road transport network. PMID:27438836

  1. Stochastic Fluctuations in a Babcock-Leighton Model of the Solar Cycle

    NASA Astrophysics Data System (ADS)

    Charbonneau, Paul; Dikpati, Mausumi

    2000-11-01

    We investigate the effect of stochastic fluctuations on a flux transport model of the solar cycle based on the Babcock-Leighton mechanism. Specifically, we make use of our recent flux transport model (Dikpati & Charbonneau) to investigate the consequences of introducing large-amplitude stochastic fluctuations in either or both the meridional flow and poloidal source term in the model. Solar cycle-like oscillatory behavior persists even for fluctuation amplitudes as high as 300%, thus demonstrating the inherent robustness of this class of solar cycle models. We also find that high-amplitude fluctuations lead to a spread of cycle amplitude and duration showing a statistically significant anticorrelation, comparable to that observed in sunspot data. This is a feature of the solar cycle that is notoriously difficult to reproduce with dynamo models based on mean field electrodynamics and relying only on nonlinearities associated with the back-reaction of the Lorentz force to produce amplitude modulation. Another noteworthy aspect of our flux transport model is the fact that meridional circulation in the convective envelope acts as a ``clock'' regulating the tempo of the solar cycle; shorter-than-average cycles are typically soon followed by longer-than-average cycles. In other words, the oscillation exhibits good phase locking, a property that also characterizes the solar activity cycle. This shows up quite clearly in our model, but we argue that it is in fact a generic property of flux transport models based on the Babcock-Leighton mechanism, and relies on meridional circulation as the primary magnetic field transport agent.

  2. Development and evaluation of the bacterial fate and transport module for the Agricultural Policy/Environmental eXtender (APEX) model.

    PubMed

    Hong, Eun-Mi; Park, Yongeun; Muirhead, Richard; Jeong, Jaehak; Pachepsky, Yakov A

    2018-02-15

    The Agricultural Policy/Environmental eXtender (APEX) is a watershed-scale water quality model that includes detailed representation of agricultural management. The objective of this work was to develop a process-based model for simulating the fate and transport of manure-borne bacteria on land and in streams with the APEX model. The bacteria model utilizes manure erosion rates to estimate the amount of edge-of-field bacteria export. Bacteria survival in manure is simulated as a two-stage process separately for each manure application event. In-stream microbial fate and transport processes include bacteria release from streambeds due to sediment resuspension during high flow events, active release from the streambed sediment during low flow periods, bacteria settling with sediment, and survival. Default parameter values were selected from published databases and evaluated based on field observations. The APEX model with the newly developed microbial fate and transport module was applied to simulate fate and transport of the fecal indicator bacterium Escherichia coli in the Toenepi watershed, New Zealand that was monitored for seven years. The stream network of the watershed ran through grazing lands with daily bovine waste deposition. Results show that the APEX with the bacteria module reproduced well the monitored pattern of E. coli concentrations at the watershed outlet. The APEX with the microbial fate and transport module will be utilized for predicting microbial quality of water as affected by various agricultural practices, evaluating monitoring protocols, and supporting the selection of management practices based on regulations that rely on fecal indicator bacteria concentrations. Published by Elsevier B.V.

  3. Research on vehicles and cargos matching model based on virtual logistics platform

    NASA Astrophysics Data System (ADS)

    Zhuang, Yufeng; Lu, Jiang; Su, Zhiyuan

    2018-04-01

    Highway less than truckload (LTL) transportation vehicles and cargos matching problem is a joint optimization problem of typical vehicle routing and loading, which is also a hot issue of operational research. This article based on the demand of virtual logistics platform, for the problem of the highway LTL transportation, the matching model of the idle vehicle and the transportation order is set up and the corresponding genetic algorithm is designed. Then the algorithm is implemented by Java. The simulation results show that the solution is satisfactory.

  4. Statistical description of turbulent transport for flux driven toroidal plasmas

    NASA Astrophysics Data System (ADS)

    Anderson, J.; Imadera, K.; Kishimoto, Y.; Li, J. Q.; Nordman, H.

    2017-06-01

    A novel methodology to analyze non-Gaussian probability distribution functions (PDFs) of intermittent turbulent transport in global full-f gyrokinetic simulations is presented. In this work, the auto-regressive integrated moving average (ARIMA) model is applied to time series data of intermittent turbulent heat transport to separate noise and oscillatory trends, allowing for the extraction of non-Gaussian features of the PDFs. It was shown that non-Gaussian tails of the PDFs from first principles based gyrokinetic simulations agree with an analytical estimation based on a two fluid model.

  5. A flow-control mechanism for distributed systems

    NASA Technical Reports Server (NTRS)

    Maitan, J.

    1991-01-01

    A new approach to the rate-based flow control in store-and-forward networks is evaluated. Existing methods display oscillations in the presence of transport delays. The proposed scheme is based on the explicit use of an embedded dynamic model of a store-and-forward buffer in a controller's feedback loop. It is shown that the use of the model eliminates the oscillations caused by the transport delays. The paper presents simulation examples and assesses the applicability of the scheme in the new generation of high-speed photonic networks where transport delays must be considered.

  6. Assessment of Alternative Conceptual Models Using Reactive Transport Modeling with Monitoring Data

    NASA Astrophysics Data System (ADS)

    Dai, Z.; Price, V.; Heffner, D.; Hodges, R.; Temples, T.; Nicholson, T.

    2005-12-01

    Monitoring data proved very useful in evaluating alternative conceptual models, simulating contaminant transport behavior, and reducing uncertainty. A graded approach using three alternative conceptual site models was formulated to simulate a field case of tetrachloroethene (PCE) transport and biodegradation. These models ranged from simple to complex in their representation of subsurface heterogeneities. The simplest model was a single-layer homogeneous aquifer that employed an analytical reactive transport code, BIOCHLOR (Aziz et al., 1999). Due to over-simplification of the aquifer structure, this simulation could not reproduce the monitoring data. The second model consisted of a multi-layer conceptual model, in combination with numerical modules, MODFLOW and RT3D within GMS, to simulate flow and reactive transport. Although the simulation results from the second model were comparatively better than those from the simple model, they still did not adequately reproduce the monitoring well concentrations because the geological structures were still inadequately defined. Finally, a more realistic conceptual model was formulated that incorporated heterogeneities and geologic structures identified from well logs and seismic survey data using the Petra and PetraSeis software. This conceptual model included both a major channel and a younger channel that were detected in the PCE source area. In this model, these channels control the local ground-water flow direction and provide a preferential chemical transport pathway. Simulation results using this conceptual site model proved compatible with the monitoring concentration data. This study demonstrates that the bias and uncertainty from inadequate conceptual models are much larger than those introduced from an inadequate choice of model parameter values (Neuman and Wierenga, 2003; Meyer et al., 2004; Ye et al., 2004). This case study integrated conceptual and numerical models, based on interpreted local hydrogeologic and geochemical data, with detailed monitoring plume data. It provided key insights for confirming alternative conceptual site models and assessing the performance of monitoring networks. A monitoring strategy based on this graded approach for assessing alternative conceptual models can provide the technical bases for identifying critical monitoring locations, adequate monitoring frequency, and performance indicator parameters for performance monitoring involving ground-water levels and PCE concentrations.

  7. A review of physically based models for soil erosion by water

    NASA Astrophysics Data System (ADS)

    Le, Minh-Hoang; Cerdan, Olivier; Sochala, Pierre; Cheviron, Bruno; Brivois, Olivier; Cordier, Stéphane

    2010-05-01

    Physically-based models rely on fundamental physical equations describing stream flow and sediment and associated nutrient generation in a catchment. This paper reviews several existing erosion and sediment transport approaches. The process of erosion include soil detachment, transport and deposition, we present various forms of equations and empirical formulas used when modelling and quantifying each of these processes. In particular, we detail models describing rainfall and infiltration effects and the system of equations to describe the overland flow and the evolution of the topography. We also present the formulas for the flow transport capacity and the erodibility functions. Finally, we present some recent numerical schemes to approach the shallow water equations and it's coupling with infiltration and erosion source terms.

  8. A Comparative Study of Spectral Auroral Intensity Predictions From Multiple Electron Transport Models

    NASA Astrophysics Data System (ADS)

    Grubbs, Guy; Michell, Robert; Samara, Marilia; Hampton, Donald; Hecht, James; Solomon, Stanley; Jahn, Jorg-Micha

    2018-01-01

    It is important to routinely examine and update models used to predict auroral emissions resulting from precipitating electrons in Earth's magnetotail. These models are commonly used to invert spectral auroral ground-based images to infer characteristics about incident electron populations when in situ measurements are unavailable. In this work, we examine and compare auroral emission intensities predicted by three commonly used electron transport models using varying electron population characteristics. We then compare model predictions to same-volume in situ electron measurements and ground-based imaging to qualitatively examine modeling prediction error. Initial comparisons showed differences in predictions by the GLobal airglOW (GLOW) model and the other transport models examined. Chemical reaction rates and radiative rates in GLOW were updated using recent publications, and predictions showed better agreement with the other models and the same-volume data, stressing that these rates are important to consider when modeling auroral processes. Predictions by each model exhibit similar behavior for varying atmospheric constants, energies, and energy fluxes. Same-volume electron data and images are highly correlated with predictions by each model, showing that these models can be used to accurately derive electron characteristics and ionospheric parameters based solely on multispectral optical imaging data.

  9. Development of index based pavement performance models for pavement management system (PMS) of LADOTD.

    DOT National Transportation Integrated Search

    2009-03-01

    This report focuses on pavement performance and treatment models for Louisiana Department of : Transportation and Development (LADOTD) and is in continuation of Louisiana Transportation : Research Center (LTRC) Report No. 430 Development of Unifor...

  10. Work zone lane closure analysis model.

    DOT National Transportation Integrated Search

    2009-10-01

    At the Alabama Department of Transportation (ALDOT), the tool used by traffic engineers to predict whether a queue will form at a freeway work zone is the Excel-based "Lane Rental Model" developed at the Oklahoma Department of Transportation (OkDOT) ...

  11. Application of SELECT and SWAT models to simulate source load, fate, and transport of fecal bacteria in watersheds.

    NASA Astrophysics Data System (ADS)

    Ranatunga, T.

    2017-12-01

    Modeling of fate and transport of fecal bacteria in a watershed is a processed based approach that considers releases from manure, point sources, and septic systems. Overland transport with water and sediments, infiltration into soils, transport in the vadose zone and groundwater, die-off and growth processes, and in-stream transport are considered as the other major processes in bacteria simulation. This presentation will discuss a simulation of fecal indicator bacteria source loading and in-stream conditions of a non-tidal watershed (Cedar Bayou Watershed) in South Central Texas using two models; Spatially Explicit Load Enrichment Calculation Tool (SELECT) and Soil and Water Assessment Tool (SWAT). Furthermore, it will discuss a probable approach of bacteria source load reduction in order to meet the water quality standards in the streams. The selected watershed is listed as having levels of fecal indicator bacteria that posed a risk for contact recreation and wading by the Texas Commission of Environmental Quality (TCEQ). The SELECT modeling approach was used in estimating the bacteria source loading from land categories. Major bacteria sources considered were, failing septic systems, discharges from wastewater treatment facilities, excreta from livestock (Cattle, Horses, Sheep and Goat), excreta from Wildlife (Feral Hogs, and Deer), Pet waste (mainly from Dogs), and runoff from urban surfaces. The estimated source loads from SELECT model were input to the SWAT model, and simulate the bacteria transport through the land and in-stream. The calibrated SWAT model was then used to estimate the indicator bacteria in-stream concentrations for future years based on regional land use, population and household forecast (up to 2040). Based on the reductions required to meet the water quality standards in-stream, the corresponding required source load reductions were estimated.

  12. A generalized interval fuzzy mixed integer programming model for a multimodal transportation problem under uncertainty

    NASA Astrophysics Data System (ADS)

    Tian, Wenli; Cao, Chengxuan

    2017-03-01

    A generalized interval fuzzy mixed integer programming model is proposed for the multimodal freight transportation problem under uncertainty, in which the optimal mode of transport and the optimal amount of each type of freight transported through each path need to be decided. For practical purposes, three mathematical methods, i.e. the interval ranking method, fuzzy linear programming method and linear weighted summation method, are applied to obtain equivalents of constraints and parameters, and then a fuzzy expected value model is presented. A heuristic algorithm based on a greedy criterion and the linear relaxation algorithm are designed to solve the model.

  13. Energy demand and environmental implications in urban transport — Case of Delhi

    NASA Astrophysics Data System (ADS)

    Bose, Ranjan Kumar

    A simple model of passenger transport in the city of Delhi has been developed using a computer-based software called—Long Range Energy Alternatives Planning (LEAP) and the associated Environmental Database (EDB) model. The hierarchical structure of LEAP represents the traffic patterns in terms of passenger travel demand, mode (rail/road), type of vehicle and occupancy (persons per vehicle). Transport database in Delhi together with fuel consumption values for the vehicle types, formed the basis of the transport demand and energy consumption calculations. Emission factors corresponding to the actual vehicle types and driving conditions in Delhi is introduced into the EDB and linked to the energy consumption values for estimating total emission of CO, HC, NO x, SO 2 Pb and TSP. The LEAP model is used to estimate total energy demand and the vehicular emissions for the base year-1990/91 and extrapolate for the future—1994/95, 2000/01, 2004/05 and 2009/10, respectively. The model is run under five alternative scenarios to study the impact of different urban transport policy initiatives that would reduce total energy requirement in the transport sector of Delhi and also reduce emission. The prime objective is to arrive at an optimal transport policy which limits the future growth of fuel consumption as well as air pollution.

  14. Study on Contaminant Transportation of a Typical Chemical Industry Park Based on GMS Software

    NASA Astrophysics Data System (ADS)

    Huang, LinXian; Liu, GuoZhen; Xing, LiTing; Liu, BenHua; Xu, ZhengHe; Yang, LiZhi; Zhu, HebgHua

    2018-03-01

    The groundwater solute transport model can effectively simulated the transport path, the transport scope, and the concentration of contaminant which can provide quantitative data for groundwater pollution repair and groundwater resource management. In this study, we selected biological modern technology research base of Shandong province as research objective and simulated the pollution characteristic of typicalcontaminant cis-1, 3-dichloropropene under different operating conditions by using GMS software.

  15. Generic reactive transport codes as flexible tools to integrate soil organic matter degradation models with water, transport and geochemistry in soils

    NASA Astrophysics Data System (ADS)

    Jacques, Diederik; Gérard, Fréderic; Mayer, Uli; Simunek, Jirka; Leterme, Bertrand

    2016-04-01

    A large number of organic matter degradation, CO2 transport and dissolved organic matter models have been developed during the last decades. However, organic matter degradation models are in many cases strictly hard-coded in terms of organic pools, degradation kinetics and dependency on environmental variables. The scientific input of the model user is typically limited to the adjustment of input parameters. In addition, the coupling with geochemical soil processes including aqueous speciation, pH-dependent sorption and colloid-facilitated transport are not incorporated in many of these models, strongly limiting the scope of their application. Furthermore, the most comprehensive organic matter degradation models are combined with simplified representations of flow and transport processes in the soil system. We illustrate the capability of generic reactive transport codes to overcome these shortcomings. The formulations of reactive transport codes include a physics-based continuum representation of flow and transport processes, while biogeochemical reactions can be described as equilibrium processes constrained by thermodynamic principles and/or kinetic reaction networks. The flexibility of these type of codes allows for straight-forward extension of reaction networks, permits the inclusion of new model components (e.g.: organic matter pools, rate equations, parameter dependency on environmental conditions) and in such a way facilitates an application-tailored implementation of organic matter degradation models and related processes. A numerical benchmark involving two reactive transport codes (HPx and MIN3P) demonstrates how the process-based simulation of transient variably saturated water flow (Richards equation), solute transport (advection-dispersion equation), heat transfer and diffusion in the gas phase can be combined with a flexible implementation of a soil organic matter degradation model. The benchmark includes the production of leachable organic matter and inorganic carbon in the aqueous and gaseous phases, as well as different decomposition functions with first-order, linear dependence or nonlinear dependence on a biomass pool. In addition, we show how processes such as local bioturbation (bio-diffusion) can be included implicitly through a Fickian formulation of transport of soil organic matter. Coupling soil organic matter models with generic and flexible reactive transport codes offers a valuable tool to enhance insights into coupled physico-chemical processes at different scales within the scope of C-biogeochemical cycles, possibly linked with other chemical elements such as plant nutrients and pollutants.

  16. Development of a prototype land use model for statewide transportation planning activities.

    DOT National Transportation Integrated Search

    2011-11-30

    Future land use forecasting is an important input to transportation planning modeling. Traditionally, land use is allocated to individual : traffic analysis zones (TAZ) based on variables such as the amount of vacant land, zoning restriction, land us...

  17. Decision support tool to assess importance of transportation facilities.

    DOT National Transportation Integrated Search

    2008-01-01

    Assessing the importance of transportation facilities is an increasingly growing topic of interest to federal and state transportation agencies. This work proposes an optimization based model that uses concepts and techniques of complex networks scie...

  18. A coupled hydrodynamic-hydrochemical modeling for predicting mineral transport in a natural acid drainage system.

    NASA Astrophysics Data System (ADS)

    Zegers Risopatron, G., Sr.; Navarro, L.; Montserrat, S., Sr.; McPhee, J. P.; Niño, Y.

    2017-12-01

    The geochemistry of water and sediments, coupled with hydrodynamic transport in mountainous channels, is of particular interest in central Chilean Andes due to natural occurrence of acid waters. In this paper, we present a coupled transport and geochemical model to estimate and understand transport processes and fate of minerals at the Yerba Loca Basin, located near Santiago, Chile. In the upper zone, water presentes low pH ( 3) and high concentrations of iron, aluminum, copper, manganese and zinc. Acidity and minerals are the consequence of water-rock interactions in hydrothermal alteration zones, rich in sulphides and sulphates, covered by seasonal snow and glaciers. Downstream, as a consequence of neutral to alkaline lateral water contributions (pH >7) along the river, pH increases and concentration of solutes decreases. The mineral transport model has three components: (i) a hydrodynamic model, where we use HEC-RAS to solve 1D Saint-Venant equations, (ii) a sediment transport model to estimate erosion and sedimentation rates, which quantify minerals transference between water and riverbed and (iii) a solute transport model, based on the 1D OTIS model which takes into account the temporal delay in solutes transport that typically is observed in natural channels (transient storage). Hydrochemistry is solved using PHREEQC, a software for speciation and batch reaction. Our results show that correlation between mineral precipitation and dissolution according to pH values changes along the river. Based on pH measurements (and according to literature) we inferred that main minerals in the water system are brochantite, ferrihydrite, hydrobasaluminite and schwertmannite. Results show that our model can predict the transport and fate of minerals and metals in the Yerba Loca Basin. Mineral dissolution and precipitation process occur for limited ranges of pH values. When pH values are increased, iron minerals (schwertmannite) are the first to precipitate ( 2.5

  19. Distributed source pollutant transport module based on BTOPMC: a case study of the Laixi River basin in the Sichuan province of southwest China

    NASA Astrophysics Data System (ADS)

    Zhang, Hongbo; Ao, Tianqi; Gusyev, Maksym; Ishidaira, Hiroshi; Magome, Jun; Takeuchi, Kuniyoshi

    2018-06-01

    Nitrogen and phosphorus concentrations in Chinese river catchments are contributed by agricultural non-point and industrial point sources causing deterioration of river water quality and degradation of ecosystem functioning for a long distance downstream. To evaluate these impacts, a distributed pollutant transport module was developed on the basis of BTOPMC (Block-Wise Use of TOPMODEL with Muskingum-Cunge Method), a grid-based distributed hydrological model, using the water flow routing process of BTOPMC as the carrier of pollutant transport due a direct runoff. The pollutant flux at each grid is simulated based on mass balance of pollutants within the grid and surface water transport of these pollutants occurs between grids in the direction of the water flow on daily time steps. The model was tested in the study area of the Lu county area situated in the Laixi River basin in the Sichuan province of southwest China. The simulated concentrations of nitrogen and phosphorus are compared with the available monthly data at several water quality stations. These results demonstrate a greater pollutant concentration in the beginning of high flow period indicating the main mechanism of pollution transport. From these preliminary results, we suggest that the distributed pollutant transport model can reflect the characteristics of the pollutant transport and reach the expected target.

  20. Large-scale transportation network congestion evolution prediction using deep learning theory.

    PubMed

    Ma, Xiaolei; Yu, Haiyang; Wang, Yunpeng; Wang, Yinhai

    2015-01-01

    Understanding how congestion at one location can cause ripples throughout large-scale transportation network is vital for transportation researchers and practitioners to pinpoint traffic bottlenecks for congestion mitigation. Traditional studies rely on either mathematical equations or simulation techniques to model traffic congestion dynamics. However, most of the approaches have limitations, largely due to unrealistic assumptions and cumbersome parameter calibration process. With the development of Intelligent Transportation Systems (ITS) and Internet of Things (IoT), transportation data become more and more ubiquitous. This triggers a series of data-driven research to investigate transportation phenomena. Among them, deep learning theory is considered one of the most promising techniques to tackle tremendous high-dimensional data. This study attempts to extend deep learning theory into large-scale transportation network analysis. A deep Restricted Boltzmann Machine and Recurrent Neural Network architecture is utilized to model and predict traffic congestion evolution based on Global Positioning System (GPS) data from taxi. A numerical study in Ningbo, China is conducted to validate the effectiveness and efficiency of the proposed method. Results show that the prediction accuracy can achieve as high as 88% within less than 6 minutes when the model is implemented in a Graphic Processing Unit (GPU)-based parallel computing environment. The predicted congestion evolution patterns can be visualized temporally and spatially through a map-based platform to identify the vulnerable links for proactive congestion mitigation.

  1. Large-Scale Transportation Network Congestion Evolution Prediction Using Deep Learning Theory

    PubMed Central

    Ma, Xiaolei; Yu, Haiyang; Wang, Yunpeng; Wang, Yinhai

    2015-01-01

    Understanding how congestion at one location can cause ripples throughout large-scale transportation network is vital for transportation researchers and practitioners to pinpoint traffic bottlenecks for congestion mitigation. Traditional studies rely on either mathematical equations or simulation techniques to model traffic congestion dynamics. However, most of the approaches have limitations, largely due to unrealistic assumptions and cumbersome parameter calibration process. With the development of Intelligent Transportation Systems (ITS) and Internet of Things (IoT), transportation data become more and more ubiquitous. This triggers a series of data-driven research to investigate transportation phenomena. Among them, deep learning theory is considered one of the most promising techniques to tackle tremendous high-dimensional data. This study attempts to extend deep learning theory into large-scale transportation network analysis. A deep Restricted Boltzmann Machine and Recurrent Neural Network architecture is utilized to model and predict traffic congestion evolution based on Global Positioning System (GPS) data from taxi. A numerical study in Ningbo, China is conducted to validate the effectiveness and efficiency of the proposed method. Results show that the prediction accuracy can achieve as high as 88% within less than 6 minutes when the model is implemented in a Graphic Processing Unit (GPU)-based parallel computing environment. The predicted congestion evolution patterns can be visualized temporally and spatially through a map-based platform to identify the vulnerable links for proactive congestion mitigation. PMID:25780910

  2. Road screening and distribution route multi-objective robust optimization for hazardous materials based on neural network and genetic algorithm.

    PubMed

    Ma, Changxi; Hao, Wei; Pan, Fuquan; Xiang, Wang

    2018-01-01

    Route optimization of hazardous materials transportation is one of the basic steps in ensuring the safety of hazardous materials transportation. The optimization scheme may be a security risk if road screening is not completed before the distribution route is optimized. For road screening issues of hazardous materials transportation, a road screening algorithm of hazardous materials transportation is built based on genetic algorithm and Levenberg-Marquardt neural network (GA-LM-NN) by analyzing 15 attributes data of each road network section. A multi-objective robust optimization model with adjustable robustness is constructed for the hazardous materials transportation problem of single distribution center to minimize transportation risk and time. A multi-objective genetic algorithm is designed to solve the problem according to the characteristics of the model. The algorithm uses an improved strategy to complete the selection operation, applies partial matching cross shift and single ortho swap methods to complete the crossover and mutation operation, and employs an exclusive method to construct Pareto optimal solutions. Studies show that the sets of hazardous materials transportation road can be found quickly through the proposed road screening algorithm based on GA-LM-NN, whereas the distribution route Pareto solutions with different levels of robustness can be found rapidly through the proposed multi-objective robust optimization model and algorithm.

  3. SCREENING MODEL FOR NONAQUEOUS PHASE-LIQUID TRANSPORT IN THE VADOSE ZONE USING GREEN-AMPT AND KINEMATIC WAVE THEORY

    EPA Science Inventory

    In this paper, a screening model for flow of a nonaqueous phase liquid (NAPL) and associated chemical transport in the vadose zone is developed. he model is based on kinematic approximation of the governing equations for both the NAPL and a partitionable chemical constituent. he ...

  4. Modeling highly transient flow, mass, and heat transport in the Chattahoochee River near Atlanta, Georgia

    USGS Publications Warehouse

    Jobson, Harvey E.; Keefer, Thomas N.

    1979-01-01

    A coupled flow-temperature model has been developed and verified for a 27.9-km reach of the Chattahoochee River between Buford Dam and Norcross, Ga. Flow in this reach of the Chattahoochee is continuous but highly regulated by Buford Dam, a flood-control and hydroelectric facility located near Buford, Ga. Calibration and verification utilized two sets of data collected under highly unsteady discharge conditions. Existing solution techniques, with certain minor improvements, were applied to verify the existing technology of flow and transport modeling. A linear, implicit finite-difference flow model was coupled with implicit, finite-difference transport and temperature models. Both the conservative and nonconservative forms of the transport equation were solved, and the difference in the predicted concentrations of dye were found to be insignificant. The temperature model, therefore, was based on the simpler nonconservative form of the transport equation. (Woodard-USGS)

  5. A cavitation model based on Eulerian stochastic fields

    NASA Astrophysics Data System (ADS)

    Magagnato, F.; Dumond, J.

    2013-12-01

    Non-linear phenomena can often be described using probability density functions (pdf) and pdf transport models. Traditionally the simulation of pdf transport requires Monte-Carlo codes based on Lagrangian "particles" or prescribed pdf assumptions including binning techniques. Recently, in the field of combustion, a novel formulation called the stochastic-field method solving pdf transport based on Eulerian fields has been proposed which eliminates the necessity to mix Eulerian and Lagrangian techniques or prescribed pdf assumptions. In the present work, for the first time the stochastic-field method is applied to multi-phase flow and in particular to cavitating flow. To validate the proposed stochastic-field cavitation model, two applications are considered. Firstly, sheet cavitation is simulated in a Venturi-type nozzle. The second application is an innovative fluidic diode which exhibits coolant flashing. Agreement with experimental results is obtained for both applications with a fixed set of model constants. The stochastic-field cavitation model captures the wide range of pdf shapes present at different locations.

  6. A compartment model of alveolar-capillary oxygen diffusion with ventilation-perfusion gradient and dynamics of air transport through the respiratory tract.

    PubMed

    Jaworski, Jacek; Redlarski, Grzegorz

    2014-08-01

    This paper presents a model of alveolar-capillary oxygen diffusion with dynamics of air transport through the respiratory tract. For this purpose electrical model representing the respiratory tract mechanics and differential equations representing oxygen membrane diffusion are combined. Relevant thermodynamic relations describing the mass of oxygen transported into the human body are proposed as the connection between these models, as well as the influence of ventilation-perfusion mismatch on the oxygen diffusion. The model is verified based on simulation results of varying exercise intensities and statistical calculations of the results obtained during various clinical trials. The benefit of the approach proposed is its application in simulation-based research aimed to generate quantitative data of normal and pathological conditions. Based on the model presented, taking into account many essential physiological processes and air transport dynamics, comprehensive and combined studies of the respiratory efficiency can be performed. The impact of physical exercise, precise changes in respiratory tract mechanics and alterations in breathing pattern can be analyzed together with the impact of various changes in alveolar-capillary oxygen diffusion. This may be useful in simulation of effects of many severe medical conditions and increased activity level. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Computation of electron transport and relaxation properties in gases based on improved multi-term approximation of Boltzmann equation

    NASA Astrophysics Data System (ADS)

    Cai, X. J.; Wang, X. X.; Zou, X. B.; Lu, Z. W.

    2018-01-01

    An understanding of electron kinetics is of importance in various applications of low temperature plasmas. We employ a series of model and real gases to investigate electron transport and relaxation properties based on improved multi-term approximation of the Boltzmann equation. First, a comparison of different methods to calculate the interaction integrals has been carried out; the effects of free parameters, such as vmax, lmax, and the arbitrary temperature Tb, on the convergence of electron transport coefficients are analyzed. Then, the modified attachment model of Ness et al. and SF6 are considered to investigate the effect of attachment on the electron transport properties. The deficiency of the pulsed Townsend technique to measure the electron transport and reaction coefficients in electronegative gases is highlighted when the reduced electric field is small. In order to investigate the effect of external magnetic field on the electron transport properties, Ar plasmas in high power impulse sputtering devices are considered. In the end, the electron relaxation properties of the Reid model under the influence of electric and magnetic fields are demonstrated.

  8. Numerical and Experimental Investigation of Turbulent Transport Control via Shaping of Radial Plasma Flow Profiles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gilmore, Mark Allen

    Turbulence, and turbulence-driven transport are ubiquitous in magnetically confined plasmas, where there is an intimate relationship between turbulence, transport, instability driving mechanisms (such as gradients), plasma flows, and flow shear. Though many of the detailed physics of the interrelationship between turbulence, transport, drive mechanisms, and flow remain unclear, there have been many demonstrations that transport and/or turbulence can be suppressed or reduced via manipulations of plasma flow profiles. This is well known in magnetic fusion plasmas [e.g., high confinement mode (H-mode) and internal transport barriers (ITB’s)], and has also been demonstrated in laboratory plasmas. However, it may be that themore » levels of particle transport obtained in such cases [e.g. H-mode, ITB’s] are actually lower than is desirable for a practical fusion device. Ideally, one would be able to actively feedback control the turbulent transport, via manipulation of the flow profiles. The purpose of this research was to investigate the feasibility of using both advanced model-based control algorithms, as well as non-model-based algorithms, to control cross-field turbulence-driven particle transport through appropriate manipulation of radial plasma flow profiles. The University of New Mexico was responsible for the experimental portion of the project, while our collaborators at the University of Montana provided plasma transport modeling, and collaborators at Lehigh University developed and explored control methods.« less

  9. Mechanical approach to chemical transport

    PubMed Central

    Kocherginsky, Nikolai; Gruebele, Martin

    2016-01-01

    Nonequilibrium thermodynamics describes the rates of transport phenomena with the aid of various thermodynamic forces, but often the phenomenological transport coefficients are not known, and the description is not easily connected with equilibrium relations. We present a simple and intuitive model to address these issues. Our model is based on Lagrangian dynamics for chemical systems with dissipation, so one may think of the model as physicochemical mechanics. Using one main equation, the model allows a systematic derivation of all transport and equilibrium equations, subject to the limitation that heat generated or absorbed in the system must be small for the model to be valid. A table with all major examples of transport and equilibrium processes described using physicochemical mechanics is given. In equilibrium, physicochemical mechanics reduces to standard thermodynamics and the Gibbs–Duhem relation, and we show that the First and Second Laws of thermodynamics are satisfied for our system plus bath model. Out of equilibrium, our model provides relationships between transport coefficients and describes system evolution in the presence of several simultaneous external fields. The model also leads to an extension of the Onsager–Casimir reciprocal relations for properties simultaneously transported by many components. PMID:27647899

  10. Erosion and Sediment Transport Modelling in Shallow Waters: A Review on Approaches, Models and Applications.

    PubMed

    Hajigholizadeh, Mohammad; Melesse, Assefa M; Fuentes, Hector R

    2018-03-14

    The erosion and sediment transport processes in shallow waters, which are discussed in this paper, begin when water droplets hit the soil surface. The transport mechanism caused by the consequent rainfall-runoff process determines the amount of generated sediment that can be transferred downslope. Many significant studies and models are performed to investigate these processes, which differ in terms of their effecting factors, approaches, inputs and outputs, model structure and the manner that these processes represent. This paper attempts to review the related literature concerning sediment transport modelling in shallow waters. A classification based on the representational processes of the soil erosion and sediment transport models (empirical, conceptual, physical and hybrid) is adopted, and the commonly-used models and their characteristics are listed. This review is expected to be of interest to researchers and soil and water conservation managers who are working on erosion and sediment transport phenomena in shallow waters. The paper format should be helpful for practitioners to identify and generally characterize the types of available models, their strengths and their basic scope of applicability.

  11. Erosion and Sediment Transport Modelling in Shallow Waters: A Review on Approaches, Models and Applications

    PubMed Central

    Fuentes, Hector R.

    2018-01-01

    The erosion and sediment transport processes in shallow waters, which are discussed in this paper, begin when water droplets hit the soil surface. The transport mechanism caused by the consequent rainfall-runoff process determines the amount of generated sediment that can be transferred downslope. Many significant studies and models are performed to investigate these processes, which differ in terms of their effecting factors, approaches, inputs and outputs, model structure and the manner that these processes represent. This paper attempts to review the related literature concerning sediment transport modelling in shallow waters. A classification based on the representational processes of the soil erosion and sediment transport models (empirical, conceptual, physical and hybrid) is adopted, and the commonly-used models and their characteristics are listed. This review is expected to be of interest to researchers and soil and water conservation managers who are working on erosion and sediment transport phenomena in shallow waters. The paper format should be helpful for practitioners to identify and generally characterize the types of available models, their strengths and their basic scope of applicability. PMID:29538335

  12. Data Driven Model Development for the SuperSonic SemiSpan Transport (S(sup 4)T)

    NASA Technical Reports Server (NTRS)

    Kukreja, Sunil L.

    2011-01-01

    In this report, we will investigate two common approaches to model development for robust control synthesis in the aerospace community; namely, reduced order aeroservoelastic modelling based on structural finite-element and computational fluid dynamics based aerodynamic models, and a data-driven system identification procedure. It is shown via analysis of experimental SuperSonic SemiSpan Transport (S4T) wind-tunnel data that by using a system identification approach it is possible to estimate a model at a fixed Mach, which is parsimonious and robust across varying dynamic pressures.

  13. Travel demand forecasting models: a comparison of EMME/2 and QUR II using a real-world network.

    DOT National Transportation Integrated Search

    2000-10-01

    In order to automate the travel demand forecasting process in urban transportation planning, a number of : commercial computer based travel demand forecasting models have been developed, which have provided : transportation planners with powerful and...

  14. Railroads and the Environment : Estimation of Fuel Consumption in Rail Transportation : Volume 1. Analytical Model

    DOT National Transportation Integrated Search

    1975-05-01

    The report describes an analytical approach to estimation of fuel consumption in rail transportation, and provides sample computer calculations suggesting the sensitivity of fuel usage to various parameters. The model used is based upon careful delin...

  15. 49 CFR 535.9 - Enforcement approach.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... Transportation Other Regulations Relating to Transportation (Continued) NATIONAL HIGHWAY TRAFFIC SAFETY... testing throughout a given model year in order to validate data received from manufacturers and will... model year. The average set balance is based upon the engines or vehicles performance above or below the...

  16. An efficient transport solver for tokamak plasmas

    DOE PAGES

    Park, Jin Myung; Murakami, Masanori; St. John, H. E.; ...

    2017-01-03

    A simple approach to efficiently solve a coupled set of 1-D diffusion-type transport equations with a stiff transport model for tokamak plasmas is presented based on the 4th order accurate Interpolated Differential Operator scheme along with a nonlinear iteration method derived from a root-finding algorithm. Here, numerical tests using the Trapped Gyro-Landau-Fluid model show that the presented high order method provides an accurate transport solution using a small number of grid points with robust nonlinear convergence.

  17. Model-based transportation performance : a comparative framework and literature synthesis [research brief].

    DOT National Transportation Integrated Search

    2012-04-01

    In a time of serious fiscal and environmental constraints, there has been a renewed call to identify transportation investments and related policy decisions that will optimize transportation, environmental, economic, and equity outcomes. Several infl...

  18. Modeling erosion and sedimentation coupled with hydrological and overland flow processes at the watershed scale

    NASA Astrophysics Data System (ADS)

    Kim, Jongho; Ivanov, Valeriy Y.; Katopodes, Nikolaos D.

    2013-09-01

    A novel two-dimensional, physically based model of soil erosion and sediment transport coupled to models of hydrological and overland flow processes has been developed. The Hairsine-Rose formulation of erosion and deposition processes is used to account for size-selective sediment transport and differentiate bed material into original and deposited soil layers. The formulation is integrated within the framework of the hydrologic and hydrodynamic model tRIBS-OFM, Triangulated irregular network-based, Real-time Integrated Basin Simulator-Overland Flow Model. The integrated model explicitly couples the hydrodynamic formulation with the advection-dominated transport equations for sediment of multiple particle sizes. To solve the system of equations including both the Saint-Venant and the Hairsine-Rose equations, the finite volume method is employed based on Roe's approximate Riemann solver on an unstructured grid. The formulation yields space-time dynamics of flow, erosion, and sediment transport at fine scale. The integrated model has been successfully verified with analytical solutions and empirical data for two benchmark cases. Sensitivity tests to grid resolution and the number of used particle sizes have been carried out. The model has been validated at the catchment scale for the Lucky Hills watershed located in southeastern Arizona, USA, using 10 events for which catchment-scale streamflow and sediment yield data were available. Since the model is based on physical laws and explicitly uses multiple types of watershed information, satisfactory results were obtained. The spatial output has been analyzed and the driving role of topography in erosion processes has been discussed. It is expected that the integrated formulation of the model has the promise to reduce uncertainties associated with typical parameterizations of flow and erosion processes. A potential for more credible modeling of earth-surface processes is thus anticipated.

  19. Quantitative prediction of repaglinide-rifampicin complex drug interactions using dynamic and static mechanistic models: delineating differential CYP3A4 induction and OATP1B1 inhibition potential of rifampicin.

    PubMed

    Varma, Manthena V S; Lin, Jian; Bi, Yi-An; Rotter, Charles J; Fahmi, Odette A; Lam, Justine L; El-Kattan, Ayman F; Goosen, Theunis C; Lai, Yurong

    2013-05-01

    Repaglinide is mainly metabolized by cytochrome P450 enzymes CYP2C8 and CYP3A4, and it is also a substrate to a hepatic uptake transporter, organic anion transporting polypeptide (OATP)1B1. The purpose of this study is to predict the dosing time-dependent pharmacokinetic interactions of repaglinide with rifampicin, using mechanistic models. In vitro hepatic transport of repaglinide, characterized using sandwich-cultured human hepatocytes, and intrinsic metabolic parameters were used to build a dynamic whole-body physiologically-based pharmacokinetic (PBPK) model. The PBPK model adequately described repaglinide plasma concentration-time profiles and successfully predicted area under the plasma concentration-time curve ratios of repaglinide (within ± 25% error), dosed (staggered 0-24 hours) after rifampicin treatment when primarily considering induction of CYP3A4 and reversible inhibition of OATP1B1 by rifampicin. Further, a static mechanistic "extended net-effect" model incorporating transport and metabolic disposition parameters of repaglinide and interaction potency of rifampicin was devised. Predictions based on the static model are similar to those observed in the clinic (average error ∼19%) and to those based on the PBPK model. Both the models suggested that the combined effect of increased gut extraction and decreased hepatic uptake caused minimal repaglinide systemic exposure change when repaglinide is dosed simultaneously or 1 hour after the rifampicin dose. On the other hand, isolated induction effect as a result of temporal separation of the two drugs translated to an approximate 5-fold reduction in repaglinide systemic exposure. In conclusion, both dynamic and static mechanistic models are instrumental in delineating the quantitative contribution of transport and metabolism in the dosing time-dependent repaglinide-rifampicin interactions.

  20. Image-based modeling of flow and reactive transport in porous media

    NASA Astrophysics Data System (ADS)

    Qin, Chao-Zhong; Hoang, Tuong; Verhoosel, Clemens V.; Harald van Brummelen, E.; Wijshoff, Herman M. A.

    2017-04-01

    Due to the availability of powerful computational resources and high-resolution acquisition of material structures, image-based modeling has become an important tool in studying pore-scale flow and transport processes in porous media [Scheibe et al., 2015]. It is also playing an important role in the upscaling study for developing macroscale porous media models. Usually, the pore structure of a porous medium is directly discretized by the voxels obtained from visualization techniques (e.g. micro CT scanning), which can avoid the complex generation of computational mesh. However, this discretization may considerably overestimate the interfacial areas between solid walls and pore spaces. As a result, it could impact the numerical predictions of reactive transport and immiscible two-phase flow. In this work, two types of image-based models are used to study single-phase flow and reactive transport in a porous medium of sintered glass beads. One model is from a well-established voxel-based simulation tool. The other is based on the mixed isogeometric finite cell method [Hoang et al., 2016], which has been implemented in the open source Nutils (http://www.nutils.org). The finite cell method can be used in combination with isogeometric analysis to enable the higher-order discretization of problems on complex volumetric domains. A particularly interesting application of this immersed simulation technique is image-based analysis, where the geometry is smoothly approximated by segmentation of a B-spline level set approximation of scan data [Verhoosel et al., 2015]. Through a number of case studies by the two models, we will show the advantages and disadvantages of each model in modeling single-phase flow and reactive transport in porous media. Particularly, we will highlight the importance of preserving high-resolution interfaces between solid walls and pore spaces in image-based modeling of porous media. References Hoang, T., C. V. Verhoosel, F. Auricchio, E. H. van Brummelen, and A. Reali (2016), Mixed Isogeometric Finite Cell Methods for the Stokes problem, Computer Methods in Applied Mechanics and Engineering, doi:10.1016/j.cma.2016.07.027. Scheibe, T. D., W. A. Perkins, M. C. Richmond, M. I. McKinley, P. D. J. Romero-Gomez, M. Oostrom, T. W. Wietsma, J. A. Serkowski, and J. M. Zachara (2015), Pore-scale and multiscale numerical simulation of flow and transport in a laboratory-scale column, Water Resources Research, 51(2), 1023-1035, doi:10.1002/2014WR015959. Verhoosel, C. V., G. J. van Zwieten, B. van Rietbergen, and R. de Borst (2015), Image-based goal-oriented adaptive isogeometric analysis with application to the micro-mechanical modeling of trabecular bone, Computer Methods in Applied Mechanics and Engineering, 284(February), 138-164, doi:10.1016/j.cma.2014.07.009.

  1. Quantitative evaluation of analyte transport on microfluidic paper-based analytical devices (μPADs).

    PubMed

    Ota, Riki; Yamada, Kentaro; Suzuki, Koji; Citterio, Daniel

    2018-02-07

    The transport efficiency during capillary flow-driven sample transport on microfluidic paper-based analytical devices (μPADs) made from filter paper has been investigated for a selection of model analytes (Ni 2+ , Zn 2+ , Cu 2+ , PO 4 3- , bovine serum albumin, sulforhodamine B, amaranth) representing metal cations, complex anions, proteins and anionic molecules. For the first time, the transport of the analytical target compounds rather than the sample liquid, has been quantitatively evaluated by means of colorimetry and absorption spectrometry-based methods. The experiments have revealed that small paperfluidic channel dimensions, additional user operation steps (e.g. control of sample volume, sample dilution, washing step) as well as the introduction of sample liquid wicking areas allow to increase analyte transport efficiency. It is also shown that the interaction of analytes with the negatively charged cellulosic paper substrate surface is strongly influenced by the physico-chemical properties of the model analyte and can in some cases (Cu 2+ ) result in nearly complete analyte depletion during sample transport. The quantitative information gained through these experiments is expected to contribute to the development of more sensitive μPADs.

  2. Sediment transport by runoff on debris-mantled dryland hillslopes

    NASA Astrophysics Data System (ADS)

    Michaelides, Katerina; Martin, Gareth J.

    2012-09-01

    Hillslopes supply sediment to river channels, and therefore impact drainage basin functioning and evolution. The relationship between hillslope attributes and sediment flux forms the basis of geomorphic transport laws used to model the long-term topographic evolution of drainage basins, but their specific interactions during individual storm events are not well understood. Runoff-driven erosion of coarse particles, prevalent in dryland environments, presents a particular set of conditions for sediment transport that is poorly resolved in current models. In order to address this gap, we developed a particle-based, force-balance model for sheetwash sediment transport on coarse, debris-mantled hillslopes within a rainfall-runoff model. We use the model to examine how the interplay between hillslope attributes (gradient, length and grain size distribution) and runoff characteristics affects sediment transport, grain-size changes on the hillslope, and sediment supply to the slope base. The relationship between sediment flux and hillslope gradient was found to transition from linear above a threshold to sigmoidal depending on hillslope length, initial grain sizes, and runoff characteristics. Grain sizes supplied to the slope base vary in a complex manner with hillslope attributes but an overall coarsening of the hillslopes is found to occur with increasing gradient, corroborating previous findings from field measurements. Intense, short duration storms result in within-hillslope sediment redistribution and equifinality in sediment supply for different hillslope characteristics, which explain the lack of field evidence for any systematic relationships. Our model findings provide insights into hillslope responses to climatic forcing and have theoretical implications for modeling hillslope evolution in dry lands.

  3. Relativistic space-charge-limited transport in Dirac semiconductor

    NASA Astrophysics Data System (ADS)

    Ang, Yee Sin; Zubair, M.; Ang, L. K.; Lavoie, Philippe

    The theory of space-charge-limited (SCL) current was first formulated by Mott and Gurney more than 70 years ago based on the semiclassical transport of quasi-free electron in dielectric solids. Its validity for recently fabricated 2D materials, which can host different classes of exotic quasiparticles, remains questionable. Recently, SCL transport measurements in 2D Dirac semiconductor, such as MoS2 and hBN monolayers, revealed anomalous current-voltage scaling of J V 1 . 7 which cannot be satisfactorily explained by conventional theories. In this work, we propose a theory of space-charge-limited transport that takes into account the relativistic quasiparticle dynamics in 2D Dirac semiconductor based on semiclassical Boltzmann transport equation. Our relativistic SCL model reveals an unconventional scaling relation of J Vα with 3 / 2 < α < 2 in the trap-free (or trap-filled) regime, which is in stark contrast to the Mott-Gurney relation of α = 2 and the Mark-Helfrich relation of α > 2 . The α < 2 scaling is a unique manifestation of the massive Dirac quasiparticles and is supported by the experimental data of MoS2. The relativistic SCL model proposed here shall provide a physical basis for the modelling of Dirac-material-based devices

  4. Assessment of parametric uncertainty for groundwater reactive transport modeling,

    USGS Publications Warehouse

    Shi, Xiaoqing; Ye, Ming; Curtis, Gary P.; Miller, Geoffery L.; Meyer, Philip D.; Kohler, Matthias; Yabusaki, Steve; Wu, Jichun

    2014-01-01

    The validity of using Gaussian assumptions for model residuals in uncertainty quantification of a groundwater reactive transport model was evaluated in this study. Least squares regression methods explicitly assume Gaussian residuals, and the assumption leads to Gaussian likelihood functions, model parameters, and model predictions. While the Bayesian methods do not explicitly require the Gaussian assumption, Gaussian residuals are widely used. This paper shows that the residuals of the reactive transport model are non-Gaussian, heteroscedastic, and correlated in time; characterizing them requires using a generalized likelihood function such as the formal generalized likelihood function developed by Schoups and Vrugt (2010). For the surface complexation model considered in this study for simulating uranium reactive transport in groundwater, parametric uncertainty is quantified using the least squares regression methods and Bayesian methods with both Gaussian and formal generalized likelihood functions. While the least squares methods and Bayesian methods with Gaussian likelihood function produce similar Gaussian parameter distributions, the parameter distributions of Bayesian uncertainty quantification using the formal generalized likelihood function are non-Gaussian. In addition, predictive performance of formal generalized likelihood function is superior to that of least squares regression and Bayesian methods with Gaussian likelihood function. The Bayesian uncertainty quantification is conducted using the differential evolution adaptive metropolis (DREAM(zs)) algorithm; as a Markov chain Monte Carlo (MCMC) method, it is a robust tool for quantifying uncertainty in groundwater reactive transport models. For the surface complexation model, the regression-based local sensitivity analysis and Morris- and DREAM(ZS)-based global sensitivity analysis yield almost identical ranking of parameter importance. The uncertainty analysis may help select appropriate likelihood functions, improve model calibration, and reduce predictive uncertainty in other groundwater reactive transport and environmental modeling.

  5. River network bedload model: a tool to investigate the impact of flow regulation on grain size distribution in a large Alpine catchment

    NASA Astrophysics Data System (ADS)

    Costa, Anna; Molnar, Peter

    2017-04-01

    Sediment transport rates along rivers and the grain size distribution (GSD) of coarse channel bed sediment are the result of the long term balance between transport capacity and sediment supply. Transport capacity, mainly a function of channel geometry and flow competence, can be altered by changes in climatic forcing as well as by human activities. In Alpine rivers it is hydropower production systems that are the main causes of modification to the transport capacity of water courses through flow regulation, leading over longer time scales to the adjustment of river bed GSDs. We developed a river network bedload transport model to evaluate the impacts of hydropower on the transfer of sediments and the GSDs of the Upper Rhône basin, a 5,200 km2 catchment located in the Swiss Alps. Many large reservoirs for hydropower production have been built along the main tributaries of the Rhône River since the 1960s, resulting in a complex system of intakes, tunnels, and pumping stations. Sediment storage behind dams and intakes, is accompanied by altered discharge due to hydropower operations, mainly higher flow in winter and lower in summer. It is expected that this change in flow regime may have resulted in different bedload transport. However, due the non-linear, threshold-based nature of the relation between discharge and sediment mobilization, the effects of changed hydraulic conditions are not easily deducible, and because observations of bedload in pre- and post-dam conditions are usually not available, a modelling approach is often necessary. In our modelling approach, the river network is conceptualized as a series of connected links (river reaches). Average geometric characteristics of each link (width, length, and slope of cross section) are extracted from digital elevation data, while surface roughness coefficients are assigned based on the GSD. Under the assumptions of rectangular prismatic cross sections and normal flow conditions, bed shear stress is estimated from available time series of daily discharge distributed along the river network. Potential bedload transport is estimated by the Wilcock and Crowe surface-based model for the entire GSD. Mass balance between transport capacity and sediment supply, applied to each individual grain size, determines the actual transport and the resulting GSD of the channel bed. Channel bed erosion is allowed through a long-term erosion rate. Sediment input from hillslopes is included as lateral sediment flux. Initial and boundary conditions are set based on available data of GSDs, while an approximation of the depth of the mobile bed is selected through sensitivity analysis. With the river network bedload model we aim to estimate the effect of flow regulation, i.e. altered transport capacity, on sediment transport and GSD of the entire Rhône river system. The model can also be applied as a tool to explore possible changes in bedload transport and channel GSDs under different discharge scenarios based, for example, on climate change projections or modified hydropower operation policies.

  6. 3 Lectures: "Lagrangian Models", "Numerical Transport Schemes", and "Chemical and Transport Models"

    NASA Technical Reports Server (NTRS)

    Douglass, A.

    2005-01-01

    The topics for the three lectures for the Canadian Summer School are Lagrangian Models, numerical transport schemes, and chemical and transport models. In the first lecture I will explain the basic components of the Lagrangian model (a trajectory code and a photochemical code), the difficulties in using such a model (initialization) and show some applications in interpretation of aircraft and satellite data. If time permits I will show some results concerning inverse modeling which is being used to evaluate sources of tropospheric pollutants. In the second lecture I will discuss one of the core components of any grid point model, the numerical transport scheme. I will explain the basics of shock capturing schemes, and performance criteria. I will include an example of the importance of horizontal resolution to polar processes. We have learned from NASA's global modeling initiative that horizontal resolution matters for predictions of the future evolution of the ozone hole. The numerical scheme will be evaluated using performance metrics based on satellite observations of long-lived tracers. The final lecture will discuss the evolution of chemical transport models over the last decade. Some of the problems with assimilated winds will be demonstrated, using satellite data to evaluate the simulations.

  7. Monitoring Cosmic Radiation Risk: Comparisons between Observations and Predictive Codes for Naval Aviation

    DTIC Science & Technology

    2009-01-01

    proton PARMA PHITS -based Analytical Radiation Model in the Atmosphere PCAIRE Predictive Code for Aircrew Radiation Exposure PHITS Particle and...radiation transport code utilized is called PARMA ( PHITS based Analytical Radiation Model in the Atmosphere) [36]. The particle fluxes calculated from the...same dose equivalent coefficient regulations from the ICRP-60 regulations. As a result, the transport codes utilized by EXPACS ( PHITS ) and CARI-6

  8. Monitoring Cosmic Radiation Risk: Comparisons Between Observations and Predictive Codes for Naval Aviation

    DTIC Science & Technology

    2009-07-05

    proton PARMA PHITS -based Analytical Radiation Model in the Atmosphere PCAIRE Predictive Code for Aircrew Radiation Exposure PHITS Particle and Heavy...transport code utilized is called PARMA ( PHITS based Analytical Radiation Model in the Atmosphere) [36]. The particle fluxes calculated from the input...dose equivalent coefficient regulations from the ICRP-60 regulations. As a result, the transport codes utilized by EXPACS ( PHITS ) and CARI-6 (PARMA

  9. Pupils' Response to a Model for Water Transport.

    ERIC Educational Resources Information Center

    Johnstone, A. H.; Mahmoud, N. A.

    1981-01-01

    Described is a model, based on the physical sciences, designed to teach secondary students about water transport through the use of an animated film. Pupils (N=440) taught by this method developed a self-consistent, although reduced, picture and understanding of osmosis. (Author/DC)

  10. Modeling contrast agent flow in cerebral aneurysms: comparison of CFD with medical imaging

    NASA Astrophysics Data System (ADS)

    Rayz, Vitaliy; Vali, Alireza; Sigovan, Monica; Lawton, Michael; Saloner, David; Boussel, Loic

    2016-11-01

    PURPOSE: The flow in cerebral aneurysms is routinely assessed with X-ray angiography, an imaging technique based on a contrast agent injection. In addition to requiring a patient's catheterization and radiation exposure, the X-ray angiography may inaccurately estimate the flow residence time, as the injection alters the native blood flow patterns. Numerical modeling of the contrast transport based on MRI imaging, provides a non-invasive alternative for the flow diagnostics. METHODS: The flow in 3 cerebral aneurysms was measured in vivo with 4D PC-MRI, which provides time-resolved, 3D velocity field. The measured velocities were used to simulate a contrast agent transport by solving the advection-diffusion equation. In addition, the flow in the same patient-specific geometries was simulated with CFD and the velocities obtained from the Navier-Stokes solution were used to model the transport of a virtual contrast. RESULTS: Contrast filling and washout patterns obtained in simulations based on MRI-measured velocities were in agreement with those obtained using the Navier-Stokes solution. Some discrepancies were observed in comparison to the X-ray angiography data, as numerical modeling of the contrast transport is based on the native blood flow unaffected by the contrast injection. NIH HL115267.

  11. Minimum requirements for predictive pore-network modeling of solute transport in micromodels

    NASA Astrophysics Data System (ADS)

    Mehmani, Yashar; Tchelepi, Hamdi A.

    2017-10-01

    Pore-scale models are now an integral part of analyzing fluid dynamics in porous materials (e.g., rocks, soils, fuel cells). Pore network models (PNM) are particularly attractive due to their computational efficiency. However, quantitative predictions with PNM have not always been successful. We focus on single-phase transport of a passive tracer under advection-dominated regimes and compare PNM with high-fidelity direct numerical simulations (DNS) for a range of micromodel heterogeneities. We identify the minimum requirements for predictive PNM of transport. They are: (a) flow-based network extraction, i.e., discretizing the pore space based on the underlying velocity field, (b) a Lagrangian (particle tracking) simulation framework, and (c) accurate transfer of particles from one pore throat to the next. We develop novel network extraction and particle tracking PNM methods that meet these requirements. Moreover, we show that certain established PNM practices in the literature can result in first-order errors in modeling advection-dominated transport. They include: all Eulerian PNMs, networks extracted based on geometric metrics only, and flux-based nodal transfer probabilities. Preliminary results for a 3D sphere pack are also presented. The simulation inputs for this work are made public to serve as a benchmark for the research community.

  12. High-resolution CO2 and CH4 flux inverse modeling combining GOSAT, OCO-2 and ground-based observations

    NASA Astrophysics Data System (ADS)

    Maksyutov, S. S.; Oda, T.; Saito, M.; Ito, A.; Janardanan Achari, R.; Sasakawa, M.; Machida, T.; Kaiser, J. W.; Belikov, D.; Valsala, V.; O'Dell, C.; Yoshida, Y.; Matsunaga, T.

    2017-12-01

    We develop a high-resolution CO2 and CH4 flux inversion system that is based on the Lagrangian-Eulerian coupled tracer transport model, and is designed to estimate surface fluxes from atmospheric CO2 and CH4 data observed by the GOSAT and OCO-2 satellites and by global in-situ networks, including observation in Siberia. We use the Lagrangian particle dispersion model (LPDM) FLEXPART to estimate the surface flux footprints for each observation at 0.1-degree spatial resolution for three days of transport. The LPDM is coupled to a global atmospheric tracer transport model (NIES-TM). The adjoint of the coupled transport model is used in an iterative optimization procedure based on either quasi-Newtonian algorithm or singular value decomposition. Combining surface and satellite data for use in inversion requires correcting for biases present in satellite observation data, that is done in a two-step procedure. As a first step, bi-weekly corrections to prior flux fields are estimated for the period of 2009 to 2015 from in-situ CO2 and CH4 data from global observation network, included in Obspack-GVP (for CO2), WDCGG (CH4) and JR-STATION datasets. High-resolution prior fluxes were prepared for anthropogenic emissions (ODIAC and EDGAR), biomass burning (GFAS), and the terrestrial biosphere. The terrestrial biosphere flux was constructed using a vegetation mosaic map and separate simulations of CO2 fluxes by the VISIT model for each vegetation type present in a grid. The prior flux uncertainty for land is scaled proportionally to monthly mean GPP by the MODIS product for CO2 and EDGAR emissions for CH4. Use of the high-resolution transport leads to improved representation of the anthropogenic plumes, often observed at continental continuous observation sites. OCO-2 observations are aggregated to 1 second averages, to match the 0.1 degree resolution of the transport model. Before including satellite observations in the inversion, the monthly varying latitude-dependent bias is estimated by comparing satellite observations with column abundance simulated with surface fluxes optimized by surface inversion. The bias-corrected GOSAT and OCO-2 data are then used in the inversion together with ground-based observations. Application of the bias correction to satellite data reduces the difference between the flux estimates based on ground-based and satellite observations.

  13. A physically-based channel-modeling framework integrating HEC-RAS sediment transport capabilities and the USDA-ARS bank-stability and toe-erosion model (BSTEM)

    USDA-ARS?s Scientific Manuscript database

    Classical, one-dimensional, mobile bed, sediment-transport models simulate vertical channel adjustment, raising or lowering cross-section node elevations to simulate erosion or deposition. This approach does not account for bank erosion processes including toe scour and mass failure. In many systems...

  14. Wave-induced bedload transport - a study of the southern Baltic coastal zone

    NASA Astrophysics Data System (ADS)

    Dudkowska, Aleksandra; Gic-Grusza, Gabriela

    2017-03-01

    The wave-induced bedload transport and spatial distribution of its magnitude in the southern Baltic coastal zone of Poland are estimated. The vicinity of Lubiatowo was selected as a representative part of the Polish coast. It was assumed that transport is a function of shear stress; alternative approaches, based on force balances and discharge relationships, were not considered in the present study. Four models were studied and compared over a wide range of bottom shear stress and wind-wave conditions. The set of models comprises classic theories that assume a simplified influence of turbulence on sediment transport (e.g., advocated by authors such as Du Boys, Meyer-Peter and Müller, Ribberink, Engelund and Hansen). It is shown that these models allow to estimate transport comparable to measured values under similar environmental conditions. A united general model for bedload transport is proposed, and a set of maps of wave bedload transport for various wind conditions in the study area is presented.

  15. Hybrid Multiscale Finite Volume method for multiresolution simulations of flow and reactive transport in porous media

    NASA Astrophysics Data System (ADS)

    Barajas-Solano, D. A.; Tartakovsky, A. M.

    2017-12-01

    We present a multiresolution method for the numerical simulation of flow and reactive transport in porous, heterogeneous media, based on the hybrid Multiscale Finite Volume (h-MsFV) algorithm. The h-MsFV algorithm allows us to couple high-resolution (fine scale) flow and transport models with lower resolution (coarse) models to locally refine both spatial resolution and transport models. The fine scale problem is decomposed into various "local'' problems solved independently in parallel and coordinated via a "global'' problem. This global problem is then coupled with the coarse model to strictly ensure domain-wide coarse-scale mass conservation. The proposed method provides an alternative to adaptive mesh refinement (AMR), due to its capacity to rapidly refine spatial resolution beyond what's possible with state-of-the-art AMR techniques, and the capability to locally swap transport models. We illustrate our method by applying it to groundwater flow and reactive transport of multiple species.

  16. A Mechanistic Pharmacokinetic Model for Liver Transporter Substrates Under Liver Cirrhosis Conditions

    PubMed Central

    Li, R; Barton, HA; Maurer, TS

    2015-01-01

    Liver cirrhosis is a disease characterized by the loss of functional liver mass. Physiologically based pharmacokinetic (PBPK) modeling was applied to interpret and predict how the interplay among physiological changes in cirrhosis affects pharmacokinetics. However, previous PBPK models under cirrhotic conditions were developed for permeable cytochrome P450 substrates and do not directly apply to substrates of liver transporters. This study characterizes a PBPK model for liver transporter substrates in relation to the severity of liver cirrhosis. A published PBPK model structure for liver transporter substrates under healthy conditions and the physiological changes for cirrhosis are combined to simulate pharmacokinetics of liver transporter substrates in patients with mild and moderate cirrhosis. The simulated pharmacokinetics under liver cirrhosis reasonably approximate observations. This analysis includes meta-analysis to obtain system-dependent parameters in cirrhosis patients and a top-down approach to improve understanding of the effect of cirrhosis on transporter-mediated drug disposition under cirrhotic conditions. PMID:26225262

  17. PHT3D-UZF: A reactive transport model for variably-saturated porous media

    USGS Publications Warehouse

    Wu, Ming Zhi; Post, Vincent E. A.; Salmon, S. Ursula; Morway, Eric D.; Prommer, H.

    2016-01-01

    A modified version of the MODFLOW/MT3DMS-based reactive transport model PHT3D was developed to extend current reactive transport capabilities to the variably-saturated component of the subsurface system and incorporate diffusive reactive transport of gaseous species. Referred to as PHT3D-UZF, this code incorporates flux terms calculated by MODFLOW's unsaturated-zone flow (UZF1) package. A volume-averaged approach similar to the method used in UZF-MT3DMS was adopted. The PHREEQC-based computation of chemical processes within PHT3D-UZF in combination with the analytical solution method of UZF1 allows for comprehensive reactive transport investigations (i.e., biogeochemical transformations) that jointly involve saturated and unsaturated zone processes. Intended for regional-scale applications, UZF1 simulates downward-only flux within the unsaturated zone. The model was tested by comparing simulation results with those of existing numerical models. The comparison was performed for several benchmark problems that cover a range of important hydrological and reactive transport processes. A 2D simulation scenario was defined to illustrate the geochemical evolution following dewatering in a sandy acid sulfate soil environment. Other potential applications include the simulation of biogeochemical processes in variably-saturated systems that track the transport and fate of agricultural pollutants, nutrients, natural and xenobiotic organic compounds and micropollutants such as pharmaceuticals, as well as the evolution of isotope patterns.

  18. Innovative mathematical modeling in environmental remediation.

    PubMed

    Yeh, Gour-Tsyh; Gwo, Jin-Ping; Siegel, Malcolm D; Li, Ming-Hsu; Fang, Yilin; Zhang, Fan; Luo, Wensui; Yabusaki, Steve B

    2013-05-01

    There are two different ways to model reactive transport: ad hoc and innovative reaction-based approaches. The former, such as the Kd simplification of adsorption, has been widely employed by practitioners, while the latter has been mainly used in scientific communities for elucidating mechanisms of biogeochemical transport processes. It is believed that innovative mechanistic-based models could serve as protocols for environmental remediation as well. This paper reviews the development of a mechanistically coupled fluid flow, thermal transport, hydrologic transport, and reactive biogeochemical model and example-applications to environmental remediation problems. Theoretical bases are sufficiently described. Four example problems previously carried out are used to demonstrate how numerical experimentation can be used to evaluate the feasibility of different remediation approaches. The first one involved the application of a 56-species uranium tailing problem to the Melton Branch Subwatershed at Oak Ridge National Laboratory (ORNL) using the parallel version of the model. Simulations were made to demonstrate the potential mobilization of uranium and other chelating agents in the proposed waste disposal site. The second problem simulated laboratory-scale system to investigate the role of natural attenuation in potential off-site migration of uranium from uranium mill tailings after restoration. It showed inadequacy of using a single Kd even for a homogeneous medium. The third example simulated laboratory experiments involving extremely high concentrations of uranium, technetium, aluminum, nitrate, and toxic metals (e.g., Ni, Cr, Co). The fourth example modeled microbially-mediated immobilization of uranium in an unconfined aquifer using acetate amendment in a field-scale experiment. The purposes of these modeling studies were to simulate various mechanisms of mobilization and immobilization of radioactive wastes and to illustrate how to apply reactive transport models for environmental remediation. Copyright © 2011 Elsevier Ltd. All rights reserved.

  19. Consumer Behavior in the Choice of Mode of Transport: A Case Study in the Toledo-Madrid Corridor

    PubMed Central

    Muro-Rodríguez, Ana I.; Perez-Jiménez, Israel R.; Gutiérrez-Broncano, Santiago

    2017-01-01

    Within the context of the consumption of goods or services the decisions made by individuals involve the choice between a set of discrete alternatives, such as the choice of mode of transport. The methodology for analyzing the consumer behavior are the models of discrete choice based on the Theory of Random Utility. These models are based on the definition of preferences through a utility function that is maximized. These models also denominated of disaggregated demand derived from the decision of a set of individuals, who are formalized by the application of probabilistic models. The objective of this study is to determine the behavior of the consumer in the choice of a service, namely of transport services and in a short-distance corridor, such as Toledo-Madrid. The Toledo-Madrid corridor is characterized by being short distance, with high speed train available within the choice options to get the airport, along with the bus and the car. And where offers of HST and aircraft services can be proposed as complementary modes. By applying disaggregated transport models with revealed preference survey data and declared preferences, one can determine the most important variables involved in the choice and determine the arrangements for payment of individuals. These payment provisions may condition the use of certain transport policies to promote the use of efficient transportation. PMID:28676776

  20. Consumer Behavior in the Choice of Mode of Transport: A Case Study in the Toledo-Madrid Corridor.

    PubMed

    Muro-Rodríguez, Ana I; Perez-Jiménez, Israel R; Gutiérrez-Broncano, Santiago

    2017-01-01

    Within the context of the consumption of goods or services the decisions made by individuals involve the choice between a set of discrete alternatives, such as the choice of mode of transport. The methodology for analyzing the consumer behavior are the models of discrete choice based on the Theory of Random Utility. These models are based on the definition of preferences through a utility function that is maximized. These models also denominated of disaggregated demand derived from the decision of a set of individuals, who are formalized by the application of probabilistic models. The objective of this study is to determine the behavior of the consumer in the choice of a service, namely of transport services and in a short-distance corridor, such as Toledo-Madrid. The Toledo-Madrid corridor is characterized by being short distance, with high speed train available within the choice options to get the airport, along with the bus and the car. And where offers of HST and aircraft services can be proposed as complementary modes. By applying disaggregated transport models with revealed preference survey data and declared preferences, one can determine the most important variables involved in the choice and determine the arrangements for payment of individuals. These payment provisions may condition the use of certain transport policies to promote the use of efficient transportation.

  1. Fate and Transport of Nanoparticles in Porous Media: A Numerical Study

    NASA Astrophysics Data System (ADS)

    Taghavy, Amir

    Understanding the transport characteristics of NPs in natural soil systems is essential to revealing their potential impact on the food chain and groundwater. In addition, many nanotechnology-based remedial measures require effective transport of NPs through soil, which necessitates accurate understanding of their transport and retention behavior. Based upon the conceptual knowledge of environmental behavior of NPs, mathematical models can be developed to represent the coupling of processes that govern the fate of NPs in subsurface, serving as effective tools for risk assessment and/or design of remedial strategies. This work presents an innovative hybrid Eulerian-Lagrangian modeling technique for simulating the simultaneous reactive transport of nanoparticles (NPs) and dissolved constituents in porous media. Governing mechanisms considered in the conceptual model include particle-soil grain, particle-particle, particle-dissolved constituents, and particle- oil/water interface interactions. The main advantage of this technique, compared to conventional Eulerian models, lies in its ability to address non-uniformity in physicochemical particle characteristics. The developed numerical simulator was applied to investigate the fate and transport of NPs in a number of practical problems relevant to the subsurface environment. These problems included: (1) reductive dechlorination of chlorinated solvents by zero-valent iron nanoparticles (nZVI) in dense non-aqueous phase liquid (DNAPL) source zones; (2) reactive transport of dissolving silver nanoparticles (nAg) and the dissolved silver ions; (3) particle-particle interactions and their effects on the particle-soil grain interactions; and (4) influence of particle-oil/water interface interactions on NP transport in porous media.

  2. A Comparison of Geographic Information Systems, Complex Networks, and Other Models for Analyzing Transportation Network Topologies

    NASA Technical Reports Server (NTRS)

    Alexandrov, Natalia (Technical Monitor); Kuby, Michael; Tierney, Sean; Roberts, Tyler; Upchurch, Christopher

    2005-01-01

    This report reviews six classes of models that are used for studying transportation network topologies. The report is motivated by two main questions. First, what can the "new science" of complex networks (scale-free, small-world networks) contribute to our understanding of transport network structure, compared to more traditional methods? Second, how can geographic information systems (GIS) contribute to studying transport networks? The report defines terms that can be used to classify different kinds of models by their function, composition, mechanism, spatial and temporal dimensions, certainty, linearity, and resolution. Six broad classes of models for analyzing transport network topologies are then explored: GIS; static graph theory; complex networks; mathematical programming; simulation; and agent-based modeling. Each class of models is defined and classified according to the attributes introduced earlier. The paper identifies some typical types of research questions about network structure that have been addressed by each class of model in the literature.

  3. An Intercomparison of 2-D Models Within a Common Framework

    NASA Technical Reports Server (NTRS)

    Weisenstein, Debra K.; Ko, Malcolm K. W.; Scott, Courtney J.; Jackman, Charles H.; Fleming, Eric L.; Considine, David B.; Kinnison, Douglas E.; Connell, Peter S.; Rotman, Douglas A.; Bhartia, P. K. (Technical Monitor)

    2002-01-01

    A model intercomparison among the Atmospheric and Environmental Research (AER) 2-D model, the Goddard Space Flight Center (GSFC) 2-D model, and the Lawrence Livermore National Laboratory 2-D model allows us to separate differences due to model transport from those due to the model's chemical formulation. This is accomplished by constructing two hybrid models incorporating the transport parameters of the GSFC and LLNL models within the AER model framework. By comparing the results from the native models (AER and e.g. GSFC) with those from the hybrid model (e.g. AER chemistry with GSFC transport), differences due to chemistry and transport can be identified. For the analysis, we examined an inert tracer whose emission pattern is based on emission from a High Speed Civil Transport (HSCT) fleet; distributions of trace species in the 2015 atmosphere; and the response of stratospheric ozone to an HSCT fleet. Differences in NO(y) in the upper stratosphere are found between models with identical transport, implying different model representations of atmospheric chemical processes. The response of O3 concentration to HSCT aircraft emissions differs in the models from both transport-dominated differences in the HSCT-induced perturbations of H2O and NO(y) as well as from differences in the model represent at ions of O3 chemical processes. The model formulations of cold polar processes are found to be the most significant factor in creating large differences in the calculated ozone perturbations

  4. A self-consistent transport model for molecular conduction based on extended Hückel theory with full three-dimensional electrostatics

    NASA Astrophysics Data System (ADS)

    Zahid, F.; Paulsson, M.; Polizzi, E.; Ghosh, A. W.; Siddiqui, L.; Datta, S.

    2005-08-01

    We present a transport model for molecular conduction involving an extended Hückel theoretical treatment of the molecular chemistry combined with a nonequilibrium Green's function treatment of quantum transport. The self-consistent potential is approximated by CNDO (complete neglect of differential overlap) method and the electrostatic effects of metallic leads (bias and image charges) are included through a three-dimensional finite element method. This allows us to capture spatial details of the electrostatic potential profile, including effects of charging, screening, and complicated electrode configurations employing only a single adjustable parameter to locate the Fermi energy. As this model is based on semiempirical methods it is computationally inexpensive and flexible compared to ab initio models, yet at the same time it is able to capture salient qualitative features as well as several relevant quantitative details of transport. We apply our model to investigate recent experimental data on alkane dithiol molecules obtained in a nanopore setup. We also present a comparison study of single molecule transistors and identify electronic properties that control their performance.

  5. Impact of compressibility on heat transport characteristics of large terrestrial planets

    NASA Astrophysics Data System (ADS)

    Čížková, Hana; van den Berg, Arie; Jacobs, Michel

    2017-07-01

    We present heat transport characteristics for mantle convection in large terrestrial exoplanets (M ⩽ 8M⊕) . Our thermal convection model is based on a truncated anelastic liquid approximation (TALA) for compressible fluids and takes into account a selfconsistent thermodynamic description of material properties derived from mineral physics based on a multi-Einstein vibrational approach. We compare heat transport characteristics in compressible models with those obtained with incompressible models based on the classical- and extended Boussinesq approximation (BA and EBA respectively). Our scaling analysis shows that heat flux scales with effective dissipation number as Nu ∼Dieff-0.71 and with Rayleigh number as Nu ∼Raeff0.27. The surface heat flux of the BA models strongly overestimates the values from the corresponding compressible models, whereas the EBA models systematically underestimate the heat flux by ∼10%-15% with respect to a corresponding compressible case. Compressible models are also systematically warmer than the EBA models. Compressibility effects are therefore important for mantle dynamic processes, especially for large rocky exoplanets and consequently also for formation of planetary atmospheres, through outgassing, and the existence of a magnetic field, through thermal coupling of mantle and core dynamic systems.

  6. Modeling the sustainable development of innovation in transport construction based on the communication approach

    NASA Astrophysics Data System (ADS)

    Revunova, Svetlana; Vlasenko, Vyacheslav; Bukreev, Anatoly

    2017-10-01

    The article proposes the models of innovative activity development, which is driven by the formation of “points of innovation-driven growth”. The models are based on the analysis of the current state and dynamics of innovative development of construction enterprises in the transport sector and take into account a number of essential organizational and economic changes in management. The authors substantiate implementing such development models as an organizational innovation that has a communication genesis. The use of the communication approach to the formation of “points of innovation-driven growth” allowed the authors to apply the mathematical tools of the graph theory in order to activate the innovative activity of the transport industry in the region. As a result, the authors have proposed models that allow constructing an optimal mechanism for the formation of “points of innovation-driven growth”.

  7. Use of Dynamic Traffic Assignment in FSUTMS in Support of Transportation Planning in Florida

    DOT National Transportation Integrated Search

    2012-06-01

    Transportation planning is based on the physical : structure of roadway networks and, less : tangibly, on choices individuals make about their : transportation needs and use of the roads. For a : task this complex, computer modeling is essential. : I...

  8. Electromechanical and Chemical Sensing at the Nanoscale: DFT and Transport Modeling

    NASA Astrophysics Data System (ADS)

    Maiti, Amitesh

    Of the many nanoelectronic applications proposed for near to medium-term commercial deployment, sensors based on carbon nanotubes (CNT) and metal-oxide nanowires are receiving significant attention from researchers. Such devices typically operate on the basis of the changes of electrical response characteristics of the active component (CNT or nanowire) when subjected to an externally applied mechanical stress or the adsorption of a chemical or bio-molecule. Practical development of such technologies can greatly benefit from quantum chemical modeling based on density functional theory (DFT), and from electronic transport modeling based on non-equilibrium Green's function (NEGF). DFT can compute useful quantities like possible bond-rearrangements, binding energy, charge transfer, and changes to the electronic structure, while NEGF can predict changes in electronic transport behavior and contact resistance. Effects of surrounding medium and intrinsic structural defects can also be taken into account. In this work we review some recent DFT and transport investigations on (1) CNT-based nano-electromechanical sensors (NEMS) and (2) gas-sensing properties of CNTs and metal-oxide nanowires. We also briefly discuss our current understanding of CNT-metal contacts which, depending upon the metal, the deposition technique, and the masking method can have a significant effect on device performance.

  9. Coupled Vortex-Lattice Flight Dynamic Model with Aeroelastic Finite-Element Model of Flexible Wing Transport Aircraft with Variable Camber Continuous Trailing Edge Flap for Drag Reduction

    NASA Technical Reports Server (NTRS)

    Nguyen, Nhan; Ting, Eric; Nguyen, Daniel; Dao, Tung; Trinh, Khanh

    2013-01-01

    This paper presents a coupled vortex-lattice flight dynamic model with an aeroelastic finite-element model to predict dynamic characteristics of a flexible wing transport aircraft. The aircraft model is based on NASA Generic Transport Model (GTM) with representative mass and stiffness properties to achieve a wing tip deflection about twice that of a conventional transport aircraft (10% versus 5%). This flexible wing transport aircraft is referred to as an Elastically Shaped Aircraft Concept (ESAC) which is equipped with a Variable Camber Continuous Trailing Edge Flap (VCCTEF) system for active wing shaping control for drag reduction. A vortex-lattice aerodynamic model of the ESAC is developed and is coupled with an aeroelastic finite-element model via an automated geometry modeler. This coupled model is used to compute static and dynamic aeroelastic solutions. The deflection information from the finite-element model and the vortex-lattice model is used to compute unsteady contributions to the aerodynamic force and moment coefficients. A coupled aeroelastic-longitudinal flight dynamic model is developed by coupling the finite-element model with the rigid-body flight dynamic model of the GTM.

  10. A fluctuation-induced plasma transport diagnostic based upon fast-Fourier transform spectral analysis

    NASA Technical Reports Server (NTRS)

    Powers, E. J.; Kim, Y. C.; Hong, J. Y.; Roth, J. R.; Krawczonek, W. M.

    1978-01-01

    A diagnostic, based on fast Fourier-transform spectral analysis techniques, that provides experimental insight into the relationship between the experimentally observable spectral characteristics of the fluctuations and the fluctuation-induced plasma transport is described. The model upon which the diagnostic technique is based and its experimental implementation is discussed. Some characteristic results obtained during the course of an experimental study of fluctuation-induced transport in the electric field dominated NASA Lewis bumpy torus plasma are presented.

  11. Optimization of municipal solid waste transportation by integrating GIS analysis, equation-based, and agent-based model.

    PubMed

    Nguyen-Trong, Khanh; Nguyen-Thi-Ngoc, Anh; Nguyen-Ngoc, Doanh; Dinh-Thi-Hai, Van

    2017-01-01

    The amount of municipal solid waste (MSW) has been increasing steadily over the last decade by reason of population rising and waste generation rate. In most of the urban areas, disposal sites are usually located outside of the urban areas due to the scarcity of land. There is no fixed route map for transportation. The current waste collection and transportation are already overloaded arising from the lack of facilities and insufficient resources. In this paper, a model for optimizing municipal solid waste collection will be proposed. Firstly, the optimized plan is developed in a static context, and then it is integrated into a dynamic context using multi-agent based modelling and simulation. A case study related to Hagiang City, Vietnam, is presented to show the efficiency of the proposed model. From the optimized results, it has been found that the cost of the MSW collection is reduced by 11.3%. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. A multiclass vehicular dynamic traffic flow model for main roads and dedicated lanes/roads of multimodal transport network

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sossoe, K.S., E-mail: kwami.sossoe@irt-systemx.fr; Lebacque, J-P., E-mail: jean-patrick.lebacque@ifsttar.fr

    2015-03-10

    We present in this paper a model of vehicular traffic flow for a multimodal transportation road network. We introduce the notion of class of vehicles to refer to vehicles of different transport modes. Our model describes the traffic on highways (which may contain several lanes) and network transit for pubic transportation. The model is drafted with Eulerian and Lagrangian coordinates and uses a Logit model to describe the traffic assignment of our multiclass vehicular flow description on shared roads. The paper also discusses traffic streams on dedicated lanes for specific class of vehicles with event-based traffic laws. An Euler-Lagrangian-remap schememore » is introduced to numerically approximate the model’s flow equations.« less

  13. Theory of ion transport with fast acid-base equilibrations in bioelectrochemical systems.

    PubMed

    Dykstra, J E; Biesheuvel, P M; Bruning, H; Ter Heijne, A

    2014-07-01

    Bioelectrochemical systems recover valuable components and energy in the form of hydrogen or electricity from aqueous organic streams. We derive a one-dimensional steady-state model for ion transport in a bioelectrochemical system, with the ions subject to diffusional and electrical forces. Since most of the ionic species can undergo acid-base reactions, ion transport is combined in our model with infinitely fast ion acid-base equilibrations. The model describes the current-induced ammonia evaporation and recovery at the cathode side of a bioelectrochemical system that runs on an organic stream containing ammonium ions. We identify that the rate of ammonia evaporation depends not only on the current but also on the flow rate of gas in the cathode chamber, the diffusion of ammonia from the cathode back into the anode chamber, through the ion exchange membrane placed in between, and the membrane charge density.

  14. Incorporating Decoherence in the Dynamic Disorder Model of Organic Semiconductors

    NASA Astrophysics Data System (ADS)

    Si, Wei; Yao, Yao; Wu, Chang-Qin

    2014-03-01

    The transport phenomena in crystalline organic semiconductors, such as pentacene, have drawn much attention recently, where the electron-phonon interaction plays a crucial role. An important advance is the dynamic disorder model proposed by Troisi et. al., which is successful in determining the carrier mobility and explaining the optical conductivity measurements. In this work, we aim to incorporate the decoherence effects in the dynamic disorder model, which is essential for the self-consistent description of the carrier dynamics. The method is based on the energy-based decoherence correction widely used in the surface hopping algorithm. The resulting dynamics shows a diffusion process of wave packets with finite localization length, which scales with the decoherence time. In addition, the calculated mobility decreases with increasing temperature. Thus the method could describe a band-like transport based on localized states, which is the type of transport anticipated in these materials.

  15. Simulation of Long Lived Tracers Using an Improved Empirically Based Two-Dimensional Model Transport Algorithm

    NASA Technical Reports Server (NTRS)

    Fleming, E. L.; Jackman, C. H.; Stolarski, R. S.; Considine, D. B.

    1998-01-01

    We have developed a new empirically-based transport algorithm for use in our GSFC two-dimensional transport and chemistry model. The new algorithm contains planetary wave statistics, and parameterizations to account for the effects due to gravity waves and equatorial Kelvin waves. As such, this scheme utilizes significantly more information compared to our previous algorithm which was based only on zonal mean temperatures and heating rates. The new model transport captures much of the qualitative structure and seasonal variability observed in long lived tracers, such as: isolation of the tropics and the southern hemisphere winter polar vortex; the well mixed surf-zone region of the winter sub-tropics and mid-latitudes; the latitudinal and seasonal variations of total ozone; and the seasonal variations of mesospheric H2O. The model also indicates a double peaked structure in methane associated with the semiannual oscillation in the tropical upper stratosphere. This feature is similar in phase but is significantly weaker in amplitude compared to the observations. The model simulations of carbon-14 and strontium-90 are in good agreement with observations, both in simulating the peak in mixing ratio at 20-25 km, and the decrease with altitude in mixing ratio above 25 km. We also find mostly good agreement between modeled and observed age of air determined from SF6 outside of the northern hemisphere polar vortex. However, observations inside the vortex reveal significantly older air compared to the model. This is consistent with the model deficiencies in simulating CH4 in the northern hemisphere winter high latitudes and illustrates the limitations of the current climatological zonal mean model formulation. The propagation of seasonal signals in water vapor and CO2 in the lower stratosphere showed general agreement in phase, and the model qualitatively captured the observed amplitude decrease in CO2 from the tropics to midlatitudes. However, the simulated seasonal amplitudes were attenuated too rapidly with altitude in the tropics. Overall, the simulations with the new transport formulation are in substantially better agreement with observations compared with our previous model transport.

  16. Spatio-temporal Model of Xenobiotic Distribution and Metabolism in an in Silico Mouse Liver Lobule

    NASA Astrophysics Data System (ADS)

    Fu, Xiao; Sluka, James; Clendenon, Sherry; Glazier, James; Ryan, Jennifer; Dunn, Kenneth; Wang, Zemin; Klaunig, James

    Our study aims to construct a structurally plausible in silico model of a mouse liver lobule to simulate the transport of xenobiotics and the production of their metabolites. We use a physiologically-based model to calculate blood-flow rates in a network of mouse liver sinusoids and simulate transport, uptake and biotransformation of xenobiotics within the in silico lobule. Using our base model, we then explore the effects of variations of compound-specific (diffusion, transport and metabolism) and compound-independent (temporal alteration of blood flow pattern) parameters, and examine their influence on the distribution of xenobiotics and metabolites. Our simulations show that the transport mechanism (diffusive and transporter-mediated) of xenobiotics and blood flow both impact the regional distribution of xenobiotics in a mouse hepatic lobule. Furthermore, differential expression of metabolic enzymes along each sinusoid's portal to central axis, together with differential cellular availability of xenobiotics, induce non-uniform production of metabolites. Thus, the heterogeneity of the biochemical and biophysical properties of xenobiotics, along with the complexity of blood flow, result in different exposures to xenobiotics for hepatocytes at different lobular locations. We acknowledge support from National Institute of Health GM 077138 and GM 111243.

  17. Diffusive mass transport in agglomerated glassy fallout from a near-surface nuclear test

    NASA Astrophysics Data System (ADS)

    Weisz, David G.; Jacobsen, Benjamin; Marks, Naomi E.; Knight, Kim B.; Isselhardt, Brett H.; Matzel, Jennifer E.

    2018-02-01

    Aerodynamically-shaped glassy fallout is formed when vapor phase constituents from the nuclear device are incorporated into molten carriers (i.e. fallout precursor materials derived from soil or other near-field environmental debris). The effects of speciation and diffusive transport of condensing constituents are not well defined in models of fallout formation. Previously we reported observations of diffuse micrometer scale layers enriched in Na, Fe, Ca, and 235U, and depleted in Al and Ti, at the interfaces of agglomerated fallout objects. Here, we derive the timescales of uranium mass transport in such fallout as it cools from 2500 K to 1500 K by applying a 1-dimensional planar diffusion model to the observed 235U/30Si variation at the interfaces. By modeling the thermal transport between the fireball and the carrier materials, the time of mass transport is calculated to be <0.6 s, <1 s, <2 s, and <3.5 s for fireball yields of 0.1 kt, 1 kt, 10 kt, and 100 kt respectively. Based on the calculated times of mass transport, a maximum temperature of deposition of uranium onto the carrier material of ∼2200 K is inferred (1σ uncertainty of ∼200 K). We also determine that the occurrence of micrometer scale layers of material enriched in relatively volatile Na-species as well as more refractory Ca-species provides evidence for an oxygen-rich fireball based on the vapor pressure of the two species under oxidizing conditions. These results represent the first application of diffusion-based modeling to derive material transport, thermal environments, and oxidation-speciation in near-surface nuclear detonation environments.

  18. Diffusive mass transport in agglomerated glassy fallout from a near-surface nuclear test

    DOE PAGES

    Weisz, David G.; Jacobsen, Benjamin; Marks, Naomi E.; ...

    2017-12-15

    Aerodynamically-shaped glassy fallout is formed when vapor phase constituents from the nuclear device are incorporated into molten carriers (i.e. fallout precursor materials derived from soil or other near-field environmental debris). The effects of speciation and diffusive transport of condensing constituents are not well defined in models of fallout formation. Previously we reported observations of diffuse micrometer scale layers enriched in Na, Fe, Ca, and 235U, and depleted in Al and Ti, at the interfaces of agglomerated fallout objects. Here in this paper, we derive the timescales of uranium mass transport in such fallout as it cools from 2500 K tomore » 1500 K by applying a 1-dimensional planar diffusion model to the observed 235U/ 30Si variation at the interfaces. By modeling the thermal transport between the fireball and the carrier materials, the time of mass transport is calculated to be <0.6 s, <1 s, <2 s, and <3.5 s for fireball yields of 0.1 kt, 1 kt, 10 kt, and 100 kt respectively. Based on the calculated times of mass transport, a maximum temperature of deposition of uranium onto the carrier material of ~2200 K is inferred (1σ uncertainty of ~200 K). We also determine that the occurrence of micrometer scale layers of material enriched in relatively volatile Na-species as well as more refractory Ca-species provides evidence for an oxygen-rich fireball based on the vapor pressure of the two species under oxidizing conditions. These results represent the first application of diffusion-based modeling to derive material transport, thermal environments, and oxidation-speciation in near-surface nuclear detonation environments.« less

  19. Diffusive mass transport in agglomerated glassy fallout from a near-surface nuclear test

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Weisz, David G.; Jacobsen, Benjamin; Marks, Naomi E.

    Aerodynamically-shaped glassy fallout is formed when vapor phase constituents from the nuclear device are incorporated into molten carriers (i.e. fallout precursor materials derived from soil or other near-field environmental debris). The effects of speciation and diffusive transport of condensing constituents are not well defined in models of fallout formation. Previously we reported observations of diffuse micrometer scale layers enriched in Na, Fe, Ca, and 235U, and depleted in Al and Ti, at the interfaces of agglomerated fallout objects. Here in this paper, we derive the timescales of uranium mass transport in such fallout as it cools from 2500 K tomore » 1500 K by applying a 1-dimensional planar diffusion model to the observed 235U/ 30Si variation at the interfaces. By modeling the thermal transport between the fireball and the carrier materials, the time of mass transport is calculated to be <0.6 s, <1 s, <2 s, and <3.5 s for fireball yields of 0.1 kt, 1 kt, 10 kt, and 100 kt respectively. Based on the calculated times of mass transport, a maximum temperature of deposition of uranium onto the carrier material of ~2200 K is inferred (1σ uncertainty of ~200 K). We also determine that the occurrence of micrometer scale layers of material enriched in relatively volatile Na-species as well as more refractory Ca-species provides evidence for an oxygen-rich fireball based on the vapor pressure of the two species under oxidizing conditions. These results represent the first application of diffusion-based modeling to derive material transport, thermal environments, and oxidation-speciation in near-surface nuclear detonation environments.« less

  20. Peristaltic transport and mixing of cytosol through the whole body of Physarum plasmodium.

    PubMed

    Iima, Makoto; Nakagaki, Toshiyuki

    2012-09-01

    We study how the net transport and mixing of chemicals occur in a relatively large amoeba, the true slime mold Physarum polycephalum. The shuttle streaming of the amoeba is characterized by a rhythmic flow of the order of 1 μm/s in which the protoplasm streams back and forth. To explain the experimentally observed transport of chemicals, we formulate a simplified model to consider the mechanism by which net transport can be induced by shuttle (or periodic) motion inside the amoeba. This model is independent from the details of fluid property as it is based on the mass conservation law only. Even in such a simplified model, we demonstrate that sectional oscillations play an important role in net transport and discuss the effects of the sectional boundary motion on net transport in the microorganism.

  1. Intercomparison of 3D pore-scale flow and solute transport simulation methods

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yang, Xiaofan; Mehmani, Yashar; Perkins, William A.

    2016-09-01

    Multiple numerical approaches have been developed to simulate porous media fluid flow and solute transport at the pore scale. These include methods that 1) explicitly model the three-dimensional geometry of pore spaces and 2) those that conceptualize the pore space as a topologically consistent set of stylized pore bodies and pore throats. In previous work we validated a model of class 1, based on direct numerical simulation using computational fluid dynamics (CFD) codes, against magnetic resonance velocimetry (MRV) measurements of pore-scale velocities. Here we expand that validation to include additional models of class 1 based on the immersed-boundary method (IMB),more » lattice Boltzmann method (LBM), smoothed particle hydrodynamics (SPH), as well as a model of class 2 (a pore-network model or PNM). The PNM approach used in the current study was recently improved and demonstrated to accurately simulate solute transport in a two-dimensional experiment. While the PNM approach is computationally much less demanding than direct numerical simulation methods, the effect of conceptualizing complex three-dimensional pore geometries on solute transport in the manner of PNMs has not been fully determined. We apply all four approaches (CFD, LBM, SPH and PNM) to simulate pore-scale velocity distributions and nonreactive solute transport, and intercompare the model results with previously reported experimental observations. Experimental observations are limited to measured pore-scale velocities, so solute transport comparisons are made only among the various models. Comparisons are drawn both in terms of macroscopic variables (e.g., permeability, solute breakthrough curves) and microscopic variables (e.g., local velocities and concentrations).« less

  2. A mixture theory model of fluid and solute transport in the microvasculature of normal and malignant tissues. I. Theory.

    PubMed

    Schuff, M M; Gore, J P; Nauman, E A

    2013-05-01

    In order to better understand the mechanisms governing transport of drugs, nanoparticle-based treatments, and therapeutic biomolecules, and the role of the various physiological parameters, a number of mathematical models have previously been proposed. The limitations of the existing transport models indicate the need for a comprehensive model that includes transport in the vessel lumen, the vessel wall, and the interstitial space and considers the effects of the solute concentration on fluid flow. In this study, a general model to describe the transient distribution of fluid and multiple solutes at the microvascular level was developed using mixture theory. The model captures the experimentally observed dependence of the hydraulic permeability coefficient of the capillary wall on the concentration of solutes present in the capillary wall and the surrounding tissue. Additionally, the model demonstrates that transport phenomena across the capillary wall and in the interstitium are related to the solute concentration as well as the hydrostatic pressure. The model is used in a companion paper to examine fluid and solute transport for the simplified case of an axisymmetric geometry with no solid deformation or interconversion of mass.

  3. Independent Evaluation of Heavy-Truck Safety Applications Based on Vehicle-to-Vehicle and Vehicle-to-Infrastructure Communications Used in the Safety Pilot Model Deployment

    DOT National Transportation Integrated Search

    2016-01-01

    This report presents the methodology and results of the independent evaluation of heavy trucks (HTs) in the Safety Pilot Model Deployment (SPMD); part of the United States Department of Transportations Intelligent Transportation Systems research p...

  4. GIS-based channel flow and sediment transport simulation using CCHE1D coupled with AnnAGNPS

    USDA-ARS?s Scientific Manuscript database

    CCHE1D (Center for Computational Hydroscience and Engineering 1-Dimensional model) simulates unsteady free-surface flows with nonequilibrium, nonuniform sediment transport in dendritic channel networks. Since early 1990’s, the model and its software packages have been developed and continuously main...

  5. Systems Models for Transportation Problems : Part 2. The Social Physics for Modern Societies - the Role of the Cities

    DOT National Transportation Integrated Search

    1977-09-01

    The objective of the research was to make use of a physically based social systems model, developed earlier, to study the determinants of city sizes and their national interactions. In particular, information on the role of a transportation system in...

  6. A hybrid modeling with data assimilation to evaluate human exposure level

    NASA Astrophysics Data System (ADS)

    Koo, Y. S.; Cheong, H. K.; Choi, D.; Kim, A. L.; Yun, H. Y.

    2015-12-01

    Exposure models are designed to better represent human contact with PM (Particulate Matter) and other air pollutants such as CO, SO2, O3, and NO2. The exposure concentrations of the air pollutants to human are determined by global and regional long range transport of global and regional scales from Europe and China as well as local emissions from urban and road vehicle sources. To assess the exposure level in detail, the multiple scale influence from background to local sources should be considered. A hybrid air quality modeling methodology combing a grid-based chemical transport model with a local plume dispersion model was used to provide spatially and temporally resolved air quality concentration for human exposure levels in Korea. In the hybrid modeling approach, concentrations from a grid-based chemical transport model and a local plume dispersion model are added to provide contributions from photochemical interactions, long-range (regional) transport and local-scale dispersion. The CAMx (Comprehensive Air quality Model with Extensions was used for the background concentrations from anthropogenic and natural emissions in East Asia including Korea while the road dispersion by vehicle emission was calculated by CALPUFF model. The total exposure level of the pollutants was finally assessed by summing the background and road contributions. In the hybrid modeling, the data assimilation method based on the optimal interpolation was applied to overcome the discrepancies between the model predicted concentrations and observations. The air quality data from the air quality monitoring stations in Korea. The spatial resolution of the hybrid model was 50m for the Seoul Metropolitan Ares. This example clearly demonstrates that the exposure level could be estimated to the fine scale for the exposure assessment by using the hybrid modeling approach with data assimilation.

  7. Predicting commuter flows in spatial networks using a radiation model based on temporal ranges

    NASA Astrophysics Data System (ADS)

    Ren, Yihui; Ercsey-Ravasz, Mária; Wang, Pu; González, Marta C.; Toroczkai, Zoltán

    2014-11-01

    Understanding network flows such as commuter traffic in large transportation networks is an ongoing challenge due to the complex nature of the transportation infrastructure and human mobility. Here we show a first-principles based method for traffic prediction using a cost-based generalization of the radiation model for human mobility, coupled with a cost-minimizing algorithm for efficient distribution of the mobility fluxes through the network. Using US census and highway traffic data, we show that traffic can efficiently and accurately be computed from a range-limited, network betweenness type calculation. The model based on travel time costs captures the log-normal distribution of the traffic and attains a high Pearson correlation coefficient (0.75) when compared with real traffic. Because of its principled nature, this method can inform many applications related to human mobility driven flows in spatial networks, ranging from transportation, through urban planning to mitigation of the effects of catastrophic events.

  8. Experimental study on unsteady open channel flow and bedload transport based on a physical model

    NASA Astrophysics Data System (ADS)

    Cao, W.

    2015-12-01

    Flow in a nature river are usually unsteady, while nearly all the theories about bedload transport are on the basis of steady, uniform flow, and also with supposed equilibrium state of sediment transport. This is may be one of the main reasons why the bedload transport formulas are notoriously poor accuracy to predict the bedload. The aim of this research is to shed light on the effect of unsteadiness on the bedload transport based on experimental studies. The novel of this study is that the experiments were not carried out in a conventional flume but in a physical model, which are more similar to the actual river. On the other hand, in our experiments, multiple consecutive flood wave were reproduced in the physical model, and all the flow and sediment parameters are based on a large number of data obtained from many of identical flood waves. This method allow us to get more data for one flood, efficiently avoids the uncertainty of bedload rate only for one single flood wave, due to the stochastic fluctuation of the bedload transport. Three different flood waves were selected in the experiments. During each run of experiment, the water level of five different positions along the model were measured by ultrasonic water level gauge, flow velocity at the middle of the channel were measured by two dimensional electromagnetic current meter. Moreover, the bedload transport rate was measured by a unique automatic trap collecting and weighing system at the end of the physical model. The results shows that the celerity of flood wave propagate varies for different flow conditions. The velocity distribution was approximately accord with log-law profile during the entire rising and falling limb of flood. The bedload transport rate show intensity fluctuation in all the experiments, moreover, for different flood waves, the moment when the shear stress reaches its maximum value is not the exact moment when the sediment transport rate reaches its maximum value, which indicates that the movement of flow and the sediment are not always synchronous during the flood processes. Comparing the bedload transport rate with the existing results of steady flows shows that the bedload transport capacity in unsteady flow is greater than that of the steady flow with same bed shear stresses. (Supported by KPNST(2013BAB12B01; 2012BAB04B01) and NSFC(11472310))

  9. Use of Dynamic Traffic Assignment in FSUTMS in Support of Transportation Planning in Florida [Summary

    DOT National Transportation Integrated Search

    2012-01-01

    Transportation planning is based on the physical : structure of roadway networks and, less : tangibly, on choices individuals make about their : transportation needs and use of the roads. For a : task this complex, computer modeling is essential. : I...

  10. Simulations of an accelerator-based shielding experiment using the particle and heavy-ion transport code system PHITS.

    PubMed

    Sato, T; Sihver, L; Iwase, H; Nakashima, H; Niita, K

    2005-01-01

    In order to estimate the biological effects of HZE particles, an accurate knowledge of the physics of interaction of HZE particles is necessary. Since the heavy ion transport problem is a complex one, there is a need for both experimental and theoretical studies to develop accurate transport models. RIST and JAERI (Japan), GSI (Germany) and Chalmers (Sweden) are therefore currently developing and bench marking the General-Purpose Particle and Heavy-Ion Transport code System (PHITS), which is based on the NMTC and MCNP for nucleon/meson and neutron transport respectively, and the JAM hadron cascade model. PHITS uses JAERI Quantum Molecular Dynamics (JQMD) and the Generalized Evaporation Model (GEM) for calculations of fission and evaporation processes, a model developed at NASA Langley for calculation of total reaction cross sections, and the SPAR model for stopping power calculations. The future development of PHITS includes better parameterization in the JQMD model used for the nucleus-nucleus reactions, and improvement of the models used for calculating total reaction cross sections, and addition of routines for calculating elastic scattering of heavy ions, and inclusion of radioactivity and burn up processes. As a part of an extensive bench marking of PHITS, we have compared energy spectra of secondary neutrons created by reactions of HZE particles with different targets, with thicknesses ranging from <1 to 200 cm. We have also compared simulated and measured spatial, fluence and depth-dose distributions from different high energy heavy ion reactions. In this paper, we report simulations of an accelerator-based shielding experiment, in which a beam of 1 GeV/n Fe-ions has passed through thin slabs of polyethylene, Al, and Pb at an acceptance angle up to 4 degrees. c2005 Published by Elsevier Ltd on behalf of COSPAR.

  11. Integrated modeling approach using SELECT and SWAT models to simulate source loading and in-stream conditions of fecal indicator bacteria.

    NASA Astrophysics Data System (ADS)

    Ranatunga, T.

    2016-12-01

    Modeling of fate and transport of fecal bacteria in a watershed is generally a processed based approach that considers releases from manure, point sources, and septic systems. Overland transport with water and sediments, infiltration into soils, transport in the vadose zone and groundwater, die-off and growth processes, and in-stream transport are considered as the other major processes in bacteria simulation. This presentation will discuss a simulation of fecal indicator bacteria (E.coli) source loading and in-stream conditions of a non-tidal watershed (Cedar Bayou Watershed) in South Central Texas using two models; Spatially Explicit Load Enrichment Calculation Tool (SELECT) and Soil and Water Assessment Tool (SWAT). Furthermore, it will discuss a probable approach of bacteria source load reduction in order to meet the water quality standards in the streams. The selected watershed is listed as having levels of fecal indicator bacteria that posed a risk for contact recreation and wading by the Texas Commission of Environmental Quality (TCEQ). The SELECT modeling approach was used in estimating the bacteria source loading from land categories. Major bacteria sources considered were, failing septic systems, discharges from wastewater treatment facilities, excreta from livestock (Cattle, Horses, Sheep and Goat), excreta from Wildlife (Feral Hogs, and Deer), Pet waste (mainly from Dogs), and runoff from urban surfaces. The estimated source loads were input to the SWAT model in order to simulate the transport through the land and in-stream conditions. The calibrated SWAT model was then used to estimate the indicator bacteria in-stream concentrations for future years based on H-GAC's regional land use, population and household projections (up to 2040). Based on the in-stream reductions required to meet the water quality standards, the corresponding required source load reductions were estimated.

  12. ANALYZING NUMERICAL ERRORS IN DOMAIN HEAT TRANSPORT MODELS USING THE CVBEM.

    USGS Publications Warehouse

    Hromadka, T.V.; ,

    1985-01-01

    Besides providing an exact solution for steady-state heat conduction processes (Laplace Poisson equations), the CVBEM (complex variable boundary element method) can be used for the numerical error analysis of domain model solutions. For problems where soil water phase change latent heat effects dominate the thermal regime, heat transport can be approximately modeled as a time-stepped steady-state condition in the thawed and frozen regions, respectively. The CVBEM provides an exact solution of the two-dimensional steady-state heat transport problem, and also provides the error in matching the prescribed boundary conditions by the development of a modeling error distribution or an approximative boundary generation. This error evaluation can be used to develop highly accurate CVBEM models of the heat transport process, and the resulting model can be used as a test case for evaluating the precision of domain models based on finite elements or finite differences.

  13. Experimental and AI-based numerical modeling of contaminant transport in porous media

    NASA Astrophysics Data System (ADS)

    Nourani, Vahid; Mousavi, Shahram; Sadikoglu, Fahreddin; Singh, Vijay P.

    2017-10-01

    This study developed a new hybrid artificial intelligence (AI)-meshless approach for modeling contaminant transport in porous media. The key innovation of the proposed approach is that both black box and physically-based models are combined for modeling contaminant transport. The effectiveness of the approach was evaluated using experimental and real world data. Artificial neural network (ANN) and adaptive neuro-fuzzy inference system (ANFIS) were calibrated to predict temporal contaminant concentrations (CCs), and the effect of noisy and de-noised data on the model performance was evaluated. Then, considering the predicted CCs at test points (TPs, in experimental study) and piezometers (in Myandoab plain) as interior conditions, the multiquadric radial basis function (MQ-RBF), as a meshless approach which solves partial differential equation (PDE) of contaminant transport in porous media, was employed to estimate the CC values at any point within the study area where there was no TP or piezometer. Optimal values of the dispersion coefficient in the advection-dispersion PDE and shape coefficient of MQ-RBF were determined using the imperialist competitive algorithm. In temporal contaminant transport modeling, de-noised data enhanced the performance of ANN and ANFIS methods in terms of the determination coefficient, up to 6 and 5%, respectively, in the experimental study and up to 39 and 18%, respectively, in the field study. Results showed that the efficiency of ANFIS-meshless model was more than ANN-meshless model up to 2 and 13% in the experimental and field studies, respectively.

  14. Model-based confirmation of alternative substrates of mitochondrial electron transport chain.

    PubMed

    Kleessen, Sabrina; Araújo, Wagner L; Fernie, Alisdair R; Nikoloski, Zoran

    2012-03-30

    Discrimination of metabolic models based on high throughput metabolomics data, reflecting various internal and external perturbations, is essential for identifying the components that contribute to the emerging behavior of metabolic processes. Here, we investigate 12 different models of the mitochondrial electron transport chain (ETC) in Arabidopsis thaliana during dark-induced senescence in order to elucidate the alternative substrates to this metabolic pathway. Our findings demonstrate that the coupling of the proposed computational approach, based on dynamic flux balance analysis, with time-resolved metabolomics data results in model-based confirmations of the hypotheses that, during dark-induced senescence in Arabidopsis, (i) under conditions where the main substrate for the ETC are not fully available, isovaleryl-CoA dehydrogenase and 2-hydroxyglutarate dehydrogenase are able to donate electrons to the ETC, (ii) phytanoyl-CoA does not act even as an indirect substrate of the electron transfer flavoprotein/electron-transfer flavoprotein:ubiquinone oxidoreductase complex, and (iii) the mitochondrial γ-aminobutyric acid transporter has functional significance in maintaining mitochondrial metabolism. Our study provides a basic framework for future in silico studies of alternative pathways in mitochondrial metabolism under extended darkness whereby the role of its components can be computationally discriminated based on available molecular profile data.

  15. Modeling bed load transport and step-pool morphology with a reduced-complexity approach

    NASA Astrophysics Data System (ADS)

    Saletti, Matteo; Molnar, Peter; Hassan, Marwan A.; Burlando, Paolo

    2016-04-01

    Steep mountain channels are complex fluvial systems, where classical methods developed for lowland streams fail to capture the dynamics of sediment transport and bed morphology. Estimations of sediment transport based on average conditions have more than one order of magnitude of uncertainty because of the wide grain-size distribution of the bed material, the small relative submergence of coarse grains, the episodic character of sediment supply, and the complex boundary conditions. Most notably, bed load transport is modulated by the structure of the bed, where grains are imbricated in steps and similar bedforms and, therefore, they are much more stable then predicted. In this work we propose a new model based on a reduced-complexity (RC) approach focused on the reproduction of the step-pool morphology. In our 2-D cellular-automaton model entrainment, transport and deposition of particles are considered via intuitive rules based on physical principles. A parsimonious set of parameters allows the control of the behavior of the system, and the basic processes can be considered in a deterministic or stochastic way. The probability of entrainment of grains (and, as a consequence, particle travel distances and resting times) is a function of flow conditions and bed topography. Sediment input is fed at the upper boundary of the channel at a constant or variable rate. Our model yields realistic results in terms of longitudinal bed profiles and sediment transport trends. Phases of aggradation and degradation can be observed in the channel even under a constant input and the memory of the morphology can be quantified with long-range persistence indicators. Sediment yield at the channel outlet shows intermittency as observed in natural streams. Steps are self-formed in the channel and their stability is tested against the model parameters. Our results show the potential of RC models as complementary tools to more sophisticated models. They provide a realistic description of complex morphological systems and help to better identify the key physical principles that rule their dynamics.

  16. Predicting Change in Sediment Transport Rates in the Wake of the Cerro Grande Fire: Limitations and Potential of a Physically-based Approach

    NASA Astrophysics Data System (ADS)

    Canfield, H. E.; Wilson, C. J.; Lane, L. J.; McLin, S. G.; Earles, A.

    2001-12-01

    One of the benefits of physically based hydrologic models is that since they are based on physics, they can potentially be used to describe hydrologic response to change. On the Pajarito Plateau in New Mexico the introduction of cattle in the late 1800s, and then establishment of the Los Alamos National Laboratory in the 1940s has had a profound effect on the cover on the watersheds surrounding Los Alamos, with a proliferation of a more dense under story, on the hillsides, and more impermeable areas at the town site. Since the establishment of the Laboratory, there have been several large forest fires, most recently, the Cerro Grande Fire in May 2000. Hydrologic models suggest an eight-fold increase in the 100yr-6hr-flood peak in Los Alamos Canyon, and a corresponding three to four fold increase in sediment transport in the Canyon under post-burn conditions. However, the magnitude of the predicted scour depends strongly on what processes are allowed to occur in the model. The predicted scour is much greater if the model incorporates an observed inset channel, where modeled velocities are much greater than in the full wetted area. Furthermore, the model suggests that armoring has the potential to cut off the supply of sediment in the bed, so that scour and sediment transport are limited by the capability of the flow to transport larger particles that might otherwise armor the bed. Therefore, the magnitude of the predicted increase in sediment transport depends strongly on the ability of channels to armor as well as an a-priori understanding of how scour and deposition will occur in the canyon in response to flows much greater than the historical record. As such, reliance on model estimates of sediment transport based on the physics of flow is inadequate for assessing the effects of change and, at-best, provides only a range in the possible response to an extreme event. In this poster we examine available data on post-fire armoring rates, and observations about historical changes in channel morphology to bound the range of possible sediment transport rates for a large flow in Los Alamos Canyon.

  17. Modeling flow and solute transport at a tile drain field site by explicit representation of preferential flow structures: Equifinality and uncertainty

    NASA Astrophysics Data System (ADS)

    Zehe, E.; Klaus, J.

    2011-12-01

    Rapid flow in connected preferential flow paths is crucial for fast transport of water and solutes through soils, especially at tile drained field sites. The present study tests whether an explicit treatment of worm burrows is feasible for modeling water flow, bromide and pesticide transport in structured heterogeneous soils with a 2-dimensional Richards based model. The essence is to represent worm burrows as morphologically connected paths of low flow resistance and low retention capacity in the spatially highly resolved model domain. The underlying extensive database to test this approach was collected during an irrigation experiment, which investigated transport of bromide and the herbicide Isoproturon at a 900 sqm tile drained field site. In a first step we investigated whether the inherent uncertainty in key data causes equifinality i.e. whether there are several spatial model setups that reproduce tile drain event discharge in an acceptable manner. We found a considerable equifinality in the spatial setup of the model, when key parameters such as the area density of worm burrows and the maximum volumetric water flows inside these macropores were varied within the ranges of either our measurement errors or measurements reported in the literature. Thirteen model runs yielded a Nash-Sutcliffe coefficient of more than 0.9. Also, the flow volumes were in good accordance and peak timing errors where less than or equal to 20 min. In the second step we investigated thus whether this "equifinality" in spatial model setups may be reduced when including the bromide tracer data into the model falsification process. We simulated transport of bromide for the 13 spatial model setups, which performed best with respect to reproduce tile drain event discharge, without any further calibration. Four of this 13 model setups allowed to model bromide transport within fixed limits of acceptability. Parameter uncertainty and equifinality could thus be reduced. Thirdly, we selected one of those four setups for simulating transport of Isoproturon, which was applied the day before the irrigation experiment, and tested different parameter combinations to characterise adsorption according to the footprint data base. Simulations could, however, only reproduce the observed event based leaching behaviour, when we allowed for retardation coefficients that were very close to one. This finding is consistent with observations various field observations. We conclude: a) A realistic representation of dominating structures and their topology is of key importance for predicting preferential water and mass flows at tile drained hillslopes. b) Parameter uncertainty and equifinality could be reduced, but a system inherent equifinality in a 2-dimensional Richards based model has to be accepted.

  18. A multi-ion generalized transport model of the polar wind

    NASA Technical Reports Server (NTRS)

    Demars, H. G.; Schunk, R. W.

    1994-01-01

    The higher-order generalizations of the equations of standard hydrodynamics, known collectively as generalized transport theories, have been used since the early 1980s to describe the terrestrial polar wind. Inherent in the structure of generalized transport theories is the ability to describe not only interparticle collisions but also certain non-Maxwellian processes, such as heat flow and viscous stress, that are characteristic of any plasma flow that is not collision dominated. Because the polar wind exhibits a transition from collision-dominated to collisionless flow, generalized transport theories possess advantages for polar wind modeling not shared by either collision-dominated models (such as standard hydrodynamics) or collisionless models (such as those based on solving the collisionless Boltzmann equation). In general, previous polar wind models have used generalized transport equations to describe electrons and only one species of ion (H(+)). If other ion species were included in the models at all, it was in a simplified or semiempirical manner. The model described in this paper is the first polar wind model that uses a generalized transport theory (bi-Maxwellian-based 16-moment theory) to describe all of the species, both major and minor, in the polar wind plasma. In the model, electrons and three ion species (H(+), He(+), O(+)) are assumed to be major and several ion species are assumed to be minor (NO(+), Fe(+), O(++)). For all species, a complete 16-moment transport formulation is used, so that profiles of density, drift velocity, parallel and perpendicular temperatures, and the field-aligned parallel and perpendicular energy flows are obtained. In the results presented here, emphasis is placed on describing those constituents of the polar wind that have received little attention in past studies. In particular, characteristic solutions are presented for supersonic H(+) outflow and for both supersonic and subsonic outflows of the major ion He(+). Solutions are also presented for various minor ions, both atomic and molecular and both singly and multiply charged.

  19. Generation of net sediment transport by velocity skewness in oscillatory sheet flow

    NASA Astrophysics Data System (ADS)

    Chen, Xin; Li, Yong; Chen, Genfa; Wang, Fujun; Tang, Xuelin

    2018-01-01

    This study utilizes a qualitative approach and a two-phase numerical model to investigate net sediment transport caused by velocity skewness beneath oscillatory sheet flow and current. The qualitative approach is derived based on the pseudo-laminar approximation of boundary layer velocity and exponential approximation of concentration. The two-phase model can obtain well the instantaneous erosion depth, sediment flux, boundary layer thickness, and sediment transport rate. It can especially illustrate the difference between positive and negative flow stages caused by velocity skewness, which is considerably important in determining the net boundary layer flow and sediment transport direction. The two-phase model also explains the effect of sediment diameter and phase-lag to sediment transport by comparing the instantaneous-type formulas to better illustrate velocity skewness effect. In previous studies about sheet flow transport in pure velocity-skewed flows, net sediment transport is only attributed to the phase-lag effect. In the present study with the qualitative approach and two-phase model, phase-lag effect is shown important but not sufficient for the net sediment transport beneath pure velocity-skewed flow and current, while the asymmetric wave boundary layer development between positive and negative flow stages also contributes to the sediment transport.

  20. Morphodynamic Modeling of the Lower Yellow River, China: Flux (Equilibrium) Form or Entrainment (Nonequilibrium) Form of Sediment Mass Conservation?

    NASA Astrophysics Data System (ADS)

    An, C.; Parker, G.; Ma, H.; Naito, K.; Moodie, A. J.; Fu, X.

    2017-12-01

    Models of river morphodynamics consist of three elements: (1) a treatment of flow hydraulics, (2) a formulation relating some aspect of sediment transport to flow hydraulics, and (3) a description of sediment conservation. In the case of unidirectional river flow, the Exner equation of sediment conservation is commonly described in terms of a flux-based formulation, in which bed elevation variation is related to the streamwise gradient of sediment transport rate. An alternate formulation of the Exner equation, however, is the entrainment-based formulation in which bed elevation variation is related to the difference between the entrainment rate of bed sediment into suspension and the deposition rate of suspended sediment onto the bed. In the flux-based formulation, sediment transport is regarded to be in a local equilibrium state (i.e., sediment transport rate locally equals sediment transport capacity). However, the entrainment-based formulation does not require this constraint; the sediment transport rate may lag in space and time behind the changing flow conditions. In modeling the fine-grained Lower Yellow River, it is usual to treat sediment conservation in terms of an entrainment-based (nonequilibrium) rather than a flux-based (equilibrium) formulation with the consideration that fine-grained sediment may be entrained at one place but deposited only at some distant location downstream. However, the differences in prediction between the two formulations are still not well known, and the entrainment formulation may not always be necessary for the Lower Yellow River. Here we study this problem by comparing the results of flux-based and entrainment-based morphodynamics under conditions typical of the Yellow River, using sediment transport equations specifically designed for the Lower Yellow River. We find, somewhat unexpectedly, that in a treatment of a 200-km reach using uniform sediment, there is little difference between the two formulations unless the sediment fall velocity is arbitrarily greatly reduced. A consideration of sediment mixtures, however, shows that the two formulations give very different patterns of grain sorting. We explain this in terms of the structures of the two Exner equations for sediment mixtures, and define conditions for applicability of each formulation.

  1. Highway Air Pollution Dispersion Modeling : Preliminary Evaluation of Thirteen Models

    DOT National Transportation Integrated Search

    1978-06-01

    Thirteen highway air pollution dispersion models have been tested, using a portion of the Airedale air quality data base. The Transportation Air Pollution Studies (TAPS) System, a data base management system specifically designed for evaluating dispe...

  2. Highway Air Pollution Dispersion Modeling : Preliminary Evaluation of Thirteen Models

    DOT National Transportation Integrated Search

    1977-01-01

    Thirteen highway air pollution dispersion models have been tested, using a portion of the Airedale air quality data base. The Transportation Air Pollution Studies (TAPS) System, a data base management system specifically designed for evaluating dispe...

  3. Fluid dilution and efficiency of Na(+) transport in a mathematical model of a thick ascending limb cell.

    PubMed

    Nieves-González, Aniel; Clausen, Chris; Marcano, Mariano; Layton, Anita T; Layton, Harold E; Moore, Leon C

    2013-03-15

    Thick ascending limb (TAL) cells are capable of reducing tubular fluid Na(+) concentration to as low as ~25 mM, and yet they are thought to transport Na(+) efficiently owing to passive paracellular Na(+) absorption. Transport efficiency in the TAL is of particular importance in the outer medulla where O(2) availability is limited by low blood flow. We used a mathematical model of a TAL cell to estimate the efficiency of Na(+) transport and to examine how tubular dilution and cell volume regulation influence transport efficiency. The TAL cell model represents 13 major solutes and the associated transporters and channels; model equations are based on mass conservation and electroneutrality constraints. We analyzed TAL transport in cells with conditions relevant to the inner stripe of the outer medulla, the cortico-medullary junction, and the distal cortical TAL. At each location Na(+) transport efficiency was computed as functions of changes in luminal NaCl concentration ([NaCl]), [K(+)], [NH(4)(+)], junctional Na(+) permeability, and apical K(+) permeability. Na(+) transport efficiency was calculated as the ratio of total net Na(+) transport to transcellular Na(+) transport. Transport efficiency is predicted to be highest at the cortico-medullary boundary where the transepithelial Na(+) gradient is the smallest. Transport efficiency is lowest in the cortex where luminal [NaCl] approaches static head.

  4. PhreeqcRM: A reaction module for transport simulators based on the geochemical model PHREEQC

    USGS Publications Warehouse

    Parkhurst, David L.; Wissmeier, Laurin

    2015-01-01

    PhreeqcRM is a geochemical reaction module designed specifically to perform equilibrium and kinetic reaction calculations for reactive transport simulators that use an operator-splitting approach. The basic function of the reaction module is to take component concentrations from the model cells of the transport simulator, run geochemical reactions, and return updated component concentrations to the transport simulator. If multicomponent diffusion is modeled (e.g., Nernst–Planck equation), then aqueous species concentrations can be used instead of component concentrations. The reaction capabilities are a complete implementation of the reaction capabilities of PHREEQC. In each cell, the reaction module maintains the composition of all of the reactants, which may include minerals, exchangers, surface complexers, gas phases, solid solutions, and user-defined kinetic reactants.PhreeqcRM assigns initial and boundary conditions for model cells based on standard PHREEQC input definitions (files or strings) of chemical compositions of solutions and reactants. Additional PhreeqcRM capabilities include methods to eliminate reaction calculations for inactive parts of a model domain, transfer concentrations and other model properties, and retrieve selected results. The module demonstrates good scalability for parallel processing by using multiprocessing with MPI (message passing interface) on distributed memory systems, and limited scalability using multithreading with OpenMP on shared memory systems. PhreeqcRM is written in C++, but interfaces allow methods to be called from C or Fortran. By using the PhreeqcRM reaction module, an existing multicomponent transport simulator can be extended to simulate a wide range of geochemical reactions. Results of the implementation of PhreeqcRM as the reaction engine for transport simulators PHAST and FEFLOW are shown by using an analytical solution and the reactive transport benchmark of MoMaS.

  5. Influence of Transport on Two-Dimensional Model Simulation: 2. Stratospheric Aircraft Perturbations. 2; Stratospheric Aircraft Perturbations

    NASA Technical Reports Server (NTRS)

    Fleming, Eric L.; Jackman, Charles H.; Considine, David B.

    1999-01-01

    We have adopted the transport scenarios used in Part 1 to examine the sensitivity of stratospheric aircraft perturbations to transport changes in our 2-D model. Changes to the strength of the residual circulation in the upper troposphere and stratosphere and changes to the lower stratospheric K(sub zz) had similar effects in that increasing the transport rates decreased the overall stratospheric residence time and reduced the magnitude of the negative perturbation response in total ozone. Increasing the stratospheric K(sub yy) increased the residence time and enhanced the global scale negative total ozone response. However, increasing K(sub yy) along with self-consistent increases in the corresponding planetary wave drive, which leads to a stronger residual circulation, more than compensates for the K(sub yy)-effect, and results in a significantly weaker perturbation response, relative to the base case, throughout the stratosphere. We found a relatively minor model perturbation response sensitivity to the magnitude of K(sub yy) in the tropical stratosphere, and only a very small sensitivity to the magnitude of the horizontal mixing across the tropopause and to the strength of the mesospheric gravity wave drag and diffusion. These transport simulations also revealed a generally strong correlation between passive NO(sub y) accumulation and age of air throughout the stratosphere, such that faster transport rates resulted in a younger mean age and a smaller NO(y) mass accumulation. However, specific variations in K(sub yy) and mesospheric gravity wave strength exhibited very little NO(sub y)-age correlation in the lower stratosphere, similar to 3-D model simulations performed in the recent NASA "Models and Measurements" II analysis. The base model transport, which gives the most favorable overall comparison with inert tracer observations, simulated a global/annual mean total ozone response of -0.59%, with only a slightly larger response in the northern compared to the southern hemisphere. For transport scenarios which gave tracer simulations within some agreement with measurements, the annual/globally averaged total ozone response ranged from -0.45% to -0.70%. Our previous 1995 model exhibited overly fast transport rates, resulting in a global/annually averaged perturbation total ozone response of -0.25%, which is significantly weaker compared to the 1999 model. This illustrates how transport deficiencies can bias model simulations of stratospheric aircraft.

  6. Comparison of a Rat Primary Cell-Based Blood-Brain Barrier Model With Epithelial and Brain Endothelial Cell Lines: Gene Expression and Drug Transport.

    PubMed

    Veszelka, Szilvia; Tóth, András; Walter, Fruzsina R; Tóth, Andrea E; Gróf, Ilona; Mészáros, Mária; Bocsik, Alexandra; Hellinger, Éva; Vastag, Monika; Rákhely, Gábor; Deli, Mária A

    2018-01-01

    Cell culture-based blood-brain barrier (BBB) models are useful tools for screening of CNS drug candidates. Cell sources for BBB models include primary brain endothelial cells or immortalized brain endothelial cell lines. Despite their well-known differences, epithelial cell lines are also used as surrogate models for testing neuropharmaceuticals. The aim of the present study was to compare the expression of selected BBB related genes including tight junction proteins, solute carriers (SLC), ABC transporters, metabolic enzymes and to describe the paracellular properties of nine different culture models. To establish a primary BBB model rat brain capillary endothelial cells were co-cultured with rat pericytes and astrocytes (EPA). As other BBB and surrogate models four brain endothelial cells lines, rat GP8 and RBE4 cells, and human hCMEC/D3 cells with or without lithium treatment (D3 and D3L), and four epithelial cell lines, native human intestinal Caco-2 and high P-glycoprotein expressing vinblastine-selected VB-Caco-2 cells, native MDCK and MDR1 transfected MDCK canine kidney cells were used. To test transporter functionality, the permeability of 12 molecules, glucopyranose, valproate, baclofen, gabapentin, probenecid, salicylate, rosuvastatin, pravastatin, atorvastatin, tacrine, donepezil, was also measured in the EPA and epithelial models. Among the junctional protein genes, the expression level of occludin was high in all models except the GP8 and RBE4 cells, and each model expressed a unique claudin pattern. Major BBB efflux (P-glycoprotein or ABCB1) and influx transporters (GLUT-1, LAT-1) were present in all models at mRNA levels. The transcript of BCRP (ABCG2) was not expressed in MDCK, GP8 and RBE4 cells. The absence of gene expression of important BBB efflux and influx transporters BCRP, MRP6, -9, MCT6, -8, PHT2, OATPs in one or both types of epithelial models suggests that Caco-2 or MDCK models are not suitable to test drug candidates which are substrates of these transporters. Brain endothelial cell lines GP8, RBE4, D3 and D3L did not form a restrictive paracellular barrier necessary for screening small molecular weight pharmacons. Therefore, among the tested culture models, the primary cell-based EPA model is suitable for the functional analysis of the BBB.

  7. High-resolution modelling of waves, currents and sediment transport in the Catalan Sea.

    NASA Astrophysics Data System (ADS)

    Sánchez-Arcilla, Agustín; Grifoll, Manel; Pallares, Elena; Espino, Manuel

    2013-04-01

    In order to investigate coastal shelf dynamics, a sequence of high resolution multi-scale models have been implemented for the Catalan shelf (North-western Mediterranean Sea). The suite consists of a set of increasing-resolution nested models, based on the circulation model ROMS (Regional Ocean Modelling System), the wave model SWAN (Simulation Waves Nearshore) and the sediment transport model CSTM (Community Sediment Transport Model), covering different ranges of spatial (from ~1 km at shelf-slope regions to ~40 m around river mouth or local beaches) and temporal scales (from storms events to seasonal variability). Contributions in the understanding of local processes such as along-shelf dynamics in the inner-shelf, sediment dispersal from the river discharge or bi-directional wave-current interactions under different synoptic conditions and resolution have been obtained using the Catalan Coast as a pilot site. Numerical results have been compared with "ad-hoc" intensive field campaigns, data from observational models and remote sensing products. The results exhibit acceptable agreement with observations and the investigation has allowed developing generic knowledge and more efficient (process-based) strategies for the coastal and shelf management.

  8. Physiologically based pharmacokinetic modeling of deltamethrin: Development of a rat and human diffusion-limited model

    EPA Science Inventory

    Mirfazaelian et al. (2006) developed a physiologically based pharmacokinetic (PBPK) model for the pyrethroid pesticide deltamethrin in the rat. This model describes gastrointestinal tract absorption as a saturable process mediated by phase III efflux transporters which pump delta...

  9. Development of solute transport models in YMPYRÄ framework to simulate solute migration in military shooting and training areas

    NASA Astrophysics Data System (ADS)

    Warsta, L.; Karvonen, T.

    2017-12-01

    There are currently 25 shooting and training areas in Finland managed by The Finnish Defence Forces (FDF), where military activities can cause contamination of open waters and groundwater reservoirs. In the YMPYRÄ project, a computer software framework is being developed that combines existing open environmental data and proprietary information collected by FDF with computational models to investigate current and prevent future environmental problems. A data centric philosophy is followed in the development of the system, i.e. the models are updated and extended to handle available data from different areas. The results generated by the models are summarized as easily understandable flow and risk maps that can be opened in GIS programs and used in environmental assessments by experts. Substances investigated with the system include explosives and metals such as lead, and both surface and groundwater dominated areas can be simulated. The YMPYRÄ framework is composed of a three dimensional soil and groundwater flow model, several solute transport models and an uncertainty assessment system. Solute transport models in the framework include particle based, stream tube and finite volume based approaches. The models can be used to simulate solute dissolution from source area, transport in the unsaturated layers to groundwater and finally migration in groundwater to water extraction wells and springs. The models can be used to simulate advection, dispersion, equilibrium adsorption on soil particles, solubility and dissolution from solute phase and dendritic solute decay chains. Correct numerical solutions were confirmed by comparing results to analytical 1D and 2D solutions and by comparing the numerical solutions to each other. The particle based and stream tube type solute transport models were useful as they could complement the traditional finite volume based approach which in certain circumstances produced numerical dispersion due to piecewise solution of the governing equations in computational grids and included computationally intensive and in some cases unstable iterative solutions. The YMPYRÄ framework is being developed by WaterHope, Gain Oy, and SITO Oy consulting companies and funded by FDF.

  10. 0-6759 : developing a business process and logical model to support a tour-based travel demand model design for TxDOT.

    DOT National Transportation Integrated Search

    2013-08-01

    The Texas Department of Transportation : (TxDOT) created a standardized trip-based : modeling approach for travel demand modeling : called the Texas Package Suite of Travel Demand : Models (referred to as the Texas Package) to : oversee the travel de...

  11. Mixed Transportation Network Design under a Sustainable Development Perspective

    PubMed Central

    Qin, Jin; Ni, Ling-lin; Shi, Feng

    2013-01-01

    A mixed transportation network design problem considering sustainable development was studied in this paper. Based on the discretization of continuous link-grade decision variables, a bilevel programming model was proposed to describe the problem, in which sustainability factors, including vehicle exhaust emissions, land-use scale, link load, and financial budget, are considered. The objective of the model is to minimize the total amount of resources exploited under the premise of meeting all the construction goals. A heuristic algorithm, which combined the simulated annealing and path-based gradient projection algorithm, was developed to solve the model. The numerical example shows that the transportation network optimized with the method above not only significantly alleviates the congestion on the link, but also reduces vehicle exhaust emissions within the network by up to 41.56%. PMID:23476142

  12. Mixed transportation network design under a sustainable development perspective.

    PubMed

    Qin, Jin; Ni, Ling-lin; Shi, Feng

    2013-01-01

    A mixed transportation network design problem considering sustainable development was studied in this paper. Based on the discretization of continuous link-grade decision variables, a bilevel programming model was proposed to describe the problem, in which sustainability factors, including vehicle exhaust emissions, land-use scale, link load, and financial budget, are considered. The objective of the model is to minimize the total amount of resources exploited under the premise of meeting all the construction goals. A heuristic algorithm, which combined the simulated annealing and path-based gradient projection algorithm, was developed to solve the model. The numerical example shows that the transportation network optimized with the method above not only significantly alleviates the congestion on the link, but also reduces vehicle exhaust emissions within the network by up to 41.56%.

  13. A unified framework for heat and mass transport at the atomic scale

    NASA Astrophysics Data System (ADS)

    Ponga, Mauricio; Sun, Dingyi

    2018-04-01

    We present a unified framework to simulate heat and mass transport in systems of particles. The proposed framework is based on kinematic mean field theory and uses a phenomenological master equation to compute effective transport rates between particles without the need to evaluate operators. We exploit this advantage and apply the model to simulate transport phenomena at the nanoscale. We demonstrate that, when calibrated to experimentally-measured transport coefficients, the model can accurately predict transient and steady state temperature and concentration profiles even in scenarios where the length of the device is comparable to the mean free path of the carriers. Through several example applications, we demonstrate the validity of our model for all classes of materials, including ones that, until now, would have been outside the domain of computational feasibility.

  14. Sustainable intermodal freight transportation: Applying the geospatial intermodal freight transport model

    NASA Astrophysics Data System (ADS)

    Comer, Bryan

    To study the energy and environmental impacts of emissions associated with freight transportation, the Geospatial Intermodal Freight Transport (GIFT) model was created as a joint research collaborative between the Rochester Institute of Technology (RIT) and the University of Delaware (UD). The GIFT model is a Geographic Information Systems (GIS) based model that links the U.S. and Canadian water, rail, and road transportation networks through intermodal transfer facilities to create an intermodal network. The purpose of my thesis is to apply the GIFT model to examine potential public policies related to intermodal freight transportation in the Great Lakes region of the United States. My thesis will consist of two papers. The first paper will examine the environmental, economic, and time-of-delivery tradeoffs associated with freight transportation in the Great Lakes region and examine opportunities for marine vessels to replace a portion of heavy-duty trucks for containerized freight transport. The second paper will explore the potential benefits of using the Great Lakes as a corridor for short-sea shipping as part of a longer intermodal route. The intent of my thesis is to shed light on the current issues associated with freight transport in the Great Lakes region and present public policy alternatives to address said issues. Ideally, this thesis will better inform policymakers on the impacts and tradeoffs associated with freight transportation.

  15. Modeling sediment transport with an integrated view of the biofilm effects

    NASA Astrophysics Data System (ADS)

    Fang, H. W.; Lai, H. J.; Cheng, W.; Huang, L.; He, G. J.

    2017-09-01

    Most natural sediment is invariably covered by biofilms in reservoirs and lakes, which have significant influence on bed form dynamics and sediment transport, and also play a crucial role in natural river evolution, pollutant transport, and habitat changes. However, most models for sediment transport are based on experiments using clean sediments without biological materials. In this study, a three-dimensional mathematical model of hydrodynamics and sediment transport is presented with a comprehensive consideration of the biofilm effects. The changes of the bed resistance mainly due to the different bed form dynamics of the biofilm-coated sediment (biosediment), which affect the hydrodynamic characteristics, are considered. Moreover, the variations of parameters related to sediment transport after the biofilm growth are integrated, including the significant changes of the incipient velocity, settling velocity, reference concentration, and equilibrium bed load transport rate. The proposed model is applied to evaluate the effects of biofilms on the hydrodynamic characteristics and sediment transport in laboratory experiments. Results indicate that the mean velocity increases after the biofilm growth, and the turbulence intensity near the river bed decreases under the same flow condition. Meanwhile, biofilm inhibits sediment from moving independently. Thus, the moderate erosion is observed for biosediment resulting in smaller suspended sediment concentrations. The proposed model can reasonably reflect these sediment transport characteristics with biofilms, and the approach to integration of the biological impact could also be used in other modeling of sediment transport, which can be further applied to provide references for the integrated management of natural aqueous systems.

  16. Application of a data assimilation method via an ensemble Kalman filter to reactive urea hydrolysis transport modeling

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Juxiu Tong; Bill X. Hu; Hai Huang

    2014-03-01

    With growing importance of water resources in the world, remediations of anthropogenic contaminations due to reactive solute transport become even more important. A good understanding of reactive rate parameters such as kinetic parameters is the key to accurately predicting reactive solute transport processes and designing corresponding remediation schemes. For modeling reactive solute transport, it is very difficult to estimate chemical reaction rate parameters due to complex processes of chemical reactions and limited available data. To find a method to get the reactive rate parameters for the reactive urea hydrolysis transport modeling and obtain more accurate prediction for the chemical concentrations,more » we developed a data assimilation method based on an ensemble Kalman filter (EnKF) method to calibrate reactive rate parameters for modeling urea hydrolysis transport in a synthetic one-dimensional column at laboratory scale and to update modeling prediction. We applied a constrained EnKF method to pose constraints to the updated reactive rate parameters and the predicted solute concentrations based on their physical meanings after the data assimilation calibration. From the study results we concluded that we could efficiently improve the chemical reactive rate parameters with the data assimilation method via the EnKF, and at the same time we could improve solute concentration prediction. The more data we assimilated, the more accurate the reactive rate parameters and concentration prediction. The filter divergence problem was also solved in this study.« less

  17. Reconstructing Sediment Supply, Transport and Deposition Behind the Elwha River Dams

    NASA Astrophysics Data System (ADS)

    Beveridge, C.

    2017-12-01

    The Elwha River watershed in Olympic National Park of Washington State, USA is predominantly a steep, mountainous landscape where dominant geomorphic processes include landslides, debris flows and gullying. The river is characterized by substantial variability of channel morphology and fluvial processes, and alternates between narrow bedrock canyons and wider alluvial reaches for much of its length. Literature suggests that the Elwha watershed is topographically and tectonically in steady state. The removal of the two massive hydropower dams along the river in 2013 marked the largest dam removal in history. Over the century long lifespan of the dams, approximately 21 million cubic meters of sediment was impounded behind them. Long term erosion rates documented in this region and reservoir sedimentation data give unprecedented opportunities to test watershed sediment yield models and examine dominant processes that control sediment yield over human time scales. In this study, we aim to reconstruct sediment supply, transport and deposition behind the Glines Canyon Dam (most upstream dam) over its lifespan using a watershed modeling approach. We developed alternative models of varying complexity for sediment production and transport at the network scale driven by hydrologic forcing. We simulate sediment supply and transport in tributaries upstream of the dam. The modeled sediment supply and transport dynamics are based on calibrated formulae (e.g., bedload transport is simulated using Wilcock-Crowe 2003 with modification based on observed bedload transport in the Elwha River). Observational data that aid in our approach include DEM, channel morphology, meteorology, and streamflow and sediment (bedload and suspended load) discharge. We aim to demonstrate how the observed sediment yield behind the dams was influenced by upstream transport supply and capacity limitations, thereby demonstrating the scale effects of flow and sediment transport processes in the Elwha River watershed.

  18. Estimating the microbiological risks associated with inland flood events: Bridging theory and models of pathogen transport

    PubMed Central

    Collender, Philip A.; Cooke, Olivia C.; Bryant, Lee D.; Kjeldsen, Thomas R.; Remais, Justin V.

    2017-01-01

    Flooding is known to facilitate infectious disease transmission, yet quantitative research on microbiological risks associated with floods has been limited. Pathogen fate and transport models provide a framework to examine interactions between landscape characteristics, hydrology, and waterborne disease risks, but have not been widely developed for flood conditions. We critically examine capabilities of current hydrological models to represent unusual flow paths, non-uniform flow depths, and unsteady flow velocities that accompany flooding. We investigate the theoretical linkages between hydrodynamic processes and spatio-temporally variable suspension and deposition of pathogens from soils and sediments; pathogen dispersion in flow; and concentrations of constituents influencing pathogen transport and persistence. Identifying gaps in knowledge and modeling practice, we propose a research agenda to strengthen microbial fate and transport modeling applied to inland floods: 1) development of models incorporating pathogen discharges from flooded sources (e.g., latrines), effects of transported constituents on pathogen persistence, and supply-limited pathogen transport; 2) studies assessing parameter identifiability and comparing model performance under varying degrees of process representation, in a range of settings; 3) development of remotely sensed datasets to support modeling of vulnerable, data-poor regions; and 4) collaboration between modelers and field-based researchers to expand the collection of useful data in situ. PMID:28757789

  19. Parameterization of eddy sensible heat transports in a zonally averaged dynamic model of the atmosphere

    NASA Technical Reports Server (NTRS)

    Genthon, Christophe; Le Treut, Herve; Sadourny, Robert; Jouzel, Jean

    1990-01-01

    A Charney-Branscome based parameterization has been tested as a way of representing the eddy sensible heat transports missing in a zonally averaged dynamic model (ZADM) of the atmosphere. The ZADM used is a zonally averaged version of a general circulation model (GCM). The parameterized transports in the ZADM are gaged against the corresponding fluxes explicitly simulated in the GCM, using the same zonally averaged boundary conditions in both models. The Charney-Branscome approach neglects stationary eddies and transient barotropic disturbances and relies on a set of simplifying assumptions, including the linear appoximation, to describe growing transient baroclinic eddies. Nevertheless, fairly satisfactory results are obtained when the parameterization is performed interactively with the model. Compared with noninteractive tests, a very efficient restoring feedback effect between the modeled zonal-mean climate and the parameterized meridional eddy transport is identified.

  20. A practical nonlocal model for heat transport in magnetized laser plasmas

    NASA Astrophysics Data System (ADS)

    Nicolaï, Ph. D.; Feugeas, J.-L. A.; Schurtz, G. P.

    2006-03-01

    A model of nonlocal transport for multidimensional radiation magnetohydrodynamics codes is presented. In laser produced plasmas, it is now believed that the heat transport can be strongly modified by the nonlocal nature of the electron conduction. Other mechanisms, such as self-generated magnetic fields, may also affect the heat transport. The model described in this work, based on simplified Fokker-Planck equations aims at extending the model of G. Schurtz, Ph. Nicolaï, and M. Busquet [Phys. Plasmas 7, 4238 (2000)] to magnetized plasmas. A complete system of nonlocal equations is derived from kinetic equations with self-consistent electric and magnetic fields. These equations are analyzed and simplified in order to be implemented into large laser fusion codes and coupled to other relevant physics. The model is applied to two laser configurations that demonstrate the main features of the model and point out the nonlocal Righi-Leduc effect in a multidimensional case.

  1. Validation of the Activities of Community Transportation model for individuals with cognitive impairments.

    PubMed

    Sohlberg, McKay Moore; Fickas, Stephen; Lemoncello, Rik; Hung, Pei-Fang

    2009-01-01

    To develop a theoretical, functional model of community navigation for individuals with cognitive impairments: the Activities of Community Transportation (ACTs). Iterative design using qualitative methods (i.e. document review, focus groups and observations). Four agencies providing travel training to adults with cognitive impairments in the USA participated in the validation study. A thorough document review and series of focus groups led to the development of a comprehensive model (ACTs Wheels) delineating the requisite steps and skills for community navigation. The model was validated and updated based on observations of 395 actual trips by travellers with navigational challenges from the four participating agencies. Results revealed that the 'ACTs Wheel' models were complete and comprehensive. The 'ACTs Wheels' represent a comprehensive model of the steps needed to navigate to destinations using paratransit and fixed-route public transportation systems for travellers with cognitive impairments. Suggestions are made for future investigations of community transportation for this population.

  2. Quantitative analysis of elevation of serum creatinine via renal transporter inhibition by trimethoprim in healthy subjects using physiologically-based pharmacokinetic model.

    PubMed

    Nakada, Tomohisa; Kudo, Toshiyuki; Kume, Toshiyuki; Kusuhara, Hiroyuki; Ito, Kiyomi

    2018-02-01

    Serum creatinine (SCr) levels rise during trimethoprim therapy for infectious diseases. This study aimed to investigate whether the elevation of SCr can be quantitatively explained using a physiologically-based pharmacokinetic (PBPK) model incorporating inhibition by trimethoprim on tubular secretion of creatinine via renal transporters such as organic cation transporter 2 (OCT2), OCT3, multidrug and toxin extrusion protein 1 (MATE1), and MATE2-K. Firstly, pharmacokinetic parameters in the PBPK model of trimethoprim were determined to reproduce the blood concentration profile after a single intravenous and oral administration of trimethoprim in healthy subjects. The model was verified with datasets of both cumulative urinary excretions after a single administration and the blood concentration profile after repeated oral administration. The pharmacokinetic model of creatinine consisted of the creatinine synthesis rate, distribution volume, and creatinine clearance (CL cre ), including tubular secretion via each transporter. When combining the models for trimethoprim and creatinine, the predicted increments in SCr from baseline were 29.0%, 39.5%, and 25.8% at trimethoprim dosages of 5 mg/kg (b.i.d.), 5 mg/kg (q.i.d.), and 200 mg (b.i.d.), respectively, which were comparable with the observed values. The present model analysis enabled us to quantitatively explain increments in SCr during trimethoprim treatment by its inhibition of renal transporters. Copyright © 2017 The Japanese Society for the Study of Xenobiotics. Published by Elsevier Ltd. All rights reserved.

  3. Development and evaluation of the bacterial fate and transport module for the agricultural policy/environmental extender (APEX) model

    USDA-ARS?s Scientific Manuscript database

    The Agricultural Policy/Environmental eXtender (APEX) is a watershed-scale water quality model that includes detailed representation of agricultural management but currently does not have microbial fate and transport simulation capabilities. The objective of this work was to develop a process-based ...

  4. Physical Foundations for Socio-Economic Modeling for Transportation Planning : Part 1. Interaction Between Urban Centers as a Potential Process.

    DOT National Transportation Integrated Search

    1977-09-01

    The objective of this research is to make use of a physically based social system model to study the determinants of city sizes and their interactions in a nation. In particular, it was required that attention be paid to how new transportation system...

  5. Numerical modeling of heat and mass transport processes in an evaporative thermal protection system

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bobrov, I.N.; Kuryachii, A.P.

    1992-08-01

    We propose a mathematical model of heat and mass transport processes in a moist, porous material subject to capillary action. The material is in contact with a heated surface, and the processes take place while the liquid is evaporating in a cavity with a drainage hole. A sample calculation based on the model is presented. 45 refs., 4 figs.

  6. Observations and 3D hydrodynamics-based modeling of decadal-scale shoreline change along the Outer Banks, North Carolina

    USGS Publications Warehouse

    Safak, Ilgar; List, Jeffrey; Warner, John C.; Kumar, Nirnimesh

    2017-01-01

    Long-term decadal-scale shoreline change is an important parameter for quantifying the stability of coastal systems. The decadal-scale coastal change is controlled by processes that occur on short time scales (such as storms) and long-term processes (such as prevailing waves). The ability to predict decadal-scale shoreline change is not well established and the fundamental physical processes controlling this change are not well understood. Here we investigate the processes that create large-scale long-term shoreline change along the Outer Banks of North Carolina, an uninterrupted 60 km stretch of coastline, using both observations and a numerical modeling approach. Shoreline positions for a 24-yr period were derived from aerial photographs of the Outer Banks. Analysis of the shoreline position data showed that, although variable, the shoreline eroded an average of 1.5 m/yr throughout this period. The modeling approach uses a three-dimensional hydrodynamics-based numerical model coupled to a spectral wave model and simulates the full 24-yr time period on a spatial grid running on a short (second scale) time-step to compute the sediment transport patterns. The observations and the model results show similar magnitudes (O(105 m3/yr)) and patterns of alongshore sediment fluxes. Both the observed and the modeled alongshore sediment transport rates have more rapid changes at the north of our section due to continuously curving coastline, and possible effects of alongshore variations in shelf bathymetry. The southern section with a relatively uniform orientation, on the other hand, has less rapid transport rate changes. Alongshore gradients of the modeled sediment fluxes are translated into shoreline change rates that have agreement in some locations but vary in others. Differences between observations and model results are potentially influenced by geologic framework processes not included in the model. Both the observations and the model results show higher rates of erosion (∼−1 m/yr) averaged over the northern half of the section as compared to the southern half where the observed and modeled averaged net shoreline changes are smaller (<0.1 m/yr). The model indicates accretion in some shallow embayments, whereas observations indicate erosion in these locations. Further analysis identifies that the magnitude of net alongshore sediment transport is strongly dominated by events associated with high wave energy. However, both big- and small- wave events cause shoreline change of the same order of magnitude because it is the gradients in transport, not the magnitude, that are controlling shoreline change. Results also indicate that alongshore momentum is not a simple balance between wave breaking and bottom stress, but also includes processes of horizontal vortex force, horizontal advection and pressure gradient that contribute to long-term alongshore sediment transport. As a comparison to a more simple approach, an empirical formulation for alongshore sediment transport is used. The empirical estimates capture the effect of the breaking term in the hydrodynamics-based model, however, other processes that are accounted for in the hydrodynamics-based model improve the agreement with the observed alongshore sediment transport.

  7. A Comparative Data-Based Modeling Study on Respiratory CO2 Gas Exchange during Mechanical Ventilation

    PubMed Central

    Kim, Chang-Sei; Ansermino, J. Mark; Hahn, Jin-Oh

    2016-01-01

    The goal of this study is to derive a minimally complex but credible model of respiratory CO2 gas exchange that may be used in systematic design and pilot testing of closed-loop end-tidal CO2 controllers in mechanical ventilation. We first derived a candidate model that captures the essential mechanisms involved in the respiratory CO2 gas exchange process. Then, we simplified the candidate model to derive two lower-order candidate models. We compared these candidate models for predictive capability and reliability using experimental data collected from 25 pediatric subjects undergoing dynamically varying mechanical ventilation during surgical procedures. A two-compartment model equipped with transport delay to account for CO2 delivery between the lungs and the tissues showed modest but statistically significant improvement in predictive capability over the same model without transport delay. Aggregating the lungs and the tissues into a single compartment further degraded the predictive fidelity of the model. In addition, the model equipped with transport delay demonstrated superior reliability to the one without transport delay. Further, the respiratory parameters derived from the model equipped with transport delay, but not the one without transport delay, were physiologically plausible. The results suggest that gas transport between the lungs and the tissues must be taken into account to accurately reproduce the respiratory CO2 gas exchange process under conditions of wide-ranging and dynamically varying mechanical ventilation conditions. PMID:26870728

  8. The SPACE 1.0 model: a Landlab component for 2-D calculation of sediment transport, bedrock erosion, and landscape evolution

    NASA Astrophysics Data System (ADS)

    Shobe, Charles M.; Tucker, Gregory E.; Barnhart, Katherine R.

    2017-12-01

    Models of landscape evolution by river erosion are often either transport-limited (sediment is always available but may or may not be transportable) or detachment-limited (sediment must be detached from the bed but is then always transportable). While several models incorporate elements of, or transition between, transport-limited and detachment-limited behavior, most require that either sediment or bedrock, but not both, are eroded at any given time. Modeling landscape evolution over large spatial and temporal scales requires a model that can (1) transition freely between transport-limited and detachment-limited behavior, (2) simultaneously treat sediment transport and bedrock erosion, and (3) run in 2-D over large grids and be coupled with other surface process models. We present SPACE (stream power with alluvium conservation and entrainment) 1.0, a new model for simultaneous evolution of an alluvium layer and a bedrock bed based on conservation of sediment mass both on the bed and in the water column. The model treats sediment transport and bedrock erosion simultaneously, embracing the reality that many rivers (even those commonly defined as bedrock rivers) flow over a partially alluviated bed. SPACE improves on previous models of bedrock-alluvial rivers by explicitly calculating sediment erosion and deposition rather than relying on a flux-divergence (Exner) approach. The SPACE model is a component of the Landlab modeling toolkit, a Python-language library used to create models of Earth surface processes. Landlab allows efficient coupling between the SPACE model and components simulating basin hydrology, hillslope evolution, weathering, lithospheric flexure, and other surface processes. Here, we first derive the governing equations of the SPACE model from existing sediment transport and bedrock erosion formulations and explore the behavior of local analytical solutions for sediment flux and alluvium thickness. We derive steady-state analytical solutions for channel slope, alluvium thickness, and sediment flux, and show that SPACE matches predicted behavior in detachment-limited, transport-limited, and mixed conditions. We provide an example of landscape evolution modeling in which SPACE is coupled with hillslope diffusion, and demonstrate that SPACE provides an effective framework for simultaneously modeling 2-D sediment transport and bedrock erosion.

  9. External Device to Incrementally Skid the Habitat (E-DISH)

    NASA Technical Reports Server (NTRS)

    Brazell, J. W.; Introne, Steve; Bedell, Lisa; Credle, Ben; Holp, Graham; Ly, Siao; Tait, Terry

    1994-01-01

    A Mars habitat transport system was designed as part of the NASA Mars exploration program. The transport system, the External Device to Incrementally Skid the Habitat (E - DISH), will be used to transport Mars habitats from their landing sites to the colony base and will be detached after unloading. The system requirements for Mars were calculated and scaled for model purposes. Specific model materials are commonly found and recommendations for materials for the Mars design are included.

  10. Route prediction model of infectious diseases for 2018 Winter Olympics in Korea

    NASA Astrophysics Data System (ADS)

    Kim, Eungyeong; Lee, Seok; Byun, Young Tae; Kim, Jae Hun; Lee, Hyuk-jae; Lee, Taikjin

    2014-03-01

    There are many types of respiratory infectious diseases caused by germs, virus, mycetes and parasites. Researchers recently have tried to develop mathematical models to predict the epidemic of infectious diseases. However, with the development of ground transportation system in modern society, the spread of infectious diseases became faster and more complicated in terms of the speed and the pathways. The route of infectious diseases during Vancouver Olympics was predicted based on the Susceptible-Infectious-Recovered (SIR) model. In this model only the air traffic as an essential factor for the intercity migration of infectious diseases was involved. Here, we propose a multi-city transmission model to predict the infection route during 2018 Winter Olympics in Korea based on the pre-existing SIR model. Various types of transportation system such as a train, a car, a bus, and an airplane for the interpersonal contact in both inter- and intra-city are considered. Simulation is performed with assumptions and scenarios based on realistic factors including demographic, transportation and diseases data in Korea. Finally, we analyze an economic profit and loss caused by the variation of the number of tourists during the Olympics.

  11. Transportation Planning with Immune System Derived Approach

    NASA Astrophysics Data System (ADS)

    Sugiyama, Kenji; Yaji, Yasuhito; Ootsuki, John Takuya; Fujimoto, Yasutaka; Sekiguchi, Takashi

    This paper presents an immune system derived approach for planning transportation of materials between manufacturing processes in the factory. Transportation operations are modeled by Petri Net, and divided into submodels. Transportation orders are derived from the firing sequences of those submodels through convergence calculation by the immune system derived excitation and suppression operations. Basic evaluation of this approach is conducted by simulation-based investigation.

  12. Morphodynamics modelling of bars in channels with graded sediment and sediment supply variation with the Telemac-Mascaret System

    NASA Astrophysics Data System (ADS)

    Cordier, Florian; Tassi, Pablo; Claude, Nicolas; Crosato, Alessandra; Rodrigues, Stéphane; Pham van Bang, Damien

    2017-04-01

    Numerical modelling of graded sediment transport in rivers remains a challenge [Siviglia and Crosato, 2016] and only few studies have considered the non-uniform distribution of sediment, although sediment grading is an inherent characteristic of natural rivers. The present work aims at revisiting the morphodynamics module of the Telemac-Mascaret modelling system and to integrate the latest developments to model the effects of non-uniform sediment on i) the sediment transport capacity estimated at the interface between the flow and the riverbed and on ii) the vertical sorting of sediment deposits in response to sediment supply changes. The implementation of these two processes has a key role on the modelling of bar dynamics in aggrading/degrading channels [Blom, 2008]. Numerical modelling of graded sediment transport remains a challenge due to the difficulty to reproduce the non-linear interactions between grains of different shape and size. Application of classical bedload equations usually fails in reproducing relevant transport rates [Recking, 2010 and references therein]. In this work, the graded sediment transport model of Wilcock and Crowe [2003] and the active layer concept of Hirano [1971] for the formulation of the exchange layer are implemented. The ability to reproduce the formation and evolution of graded-sediment bars is assessed on the basis of laboratory experiences from the literature. References: Blom, A., Ribberink, J. S., and Parker, G. 2008. Vertical sorting and the morphodynamics of bed form-dominated rivers: A sorting evolution model. Journal of Geophysical Research: Earth Surface, 113(F1). Lauer, J. W., Viparelli, E., and Piégay, H. 2016. Morphodynamics and sediment tracers in 1-d (mast-1d): 1-d sediment transport that includes exchange with an off-channel sediment reservoir. Advances in Water Resources. Recking, A. 2010. A comparison between flume and field bed load transport data and consequences for surface-based bed load transport prediction. Water Resources Research, 46(3). W03518. Siviglia, A. and Crosato, A. 2016. Numerical modelling of river morphodynamics: latest developments and remaining challenges. Advances in Water Resources, 90:1-9. Wilcock, P. R. and Crowe, J. C. 2003. Surface-based transport model for mixed-size sediment. Journal of Hydraulic Engineering, 129(2):120-128.

  13. Expression, Purification, and Structural Insights for the Human Uric Acid Transporter, GLUT9, Using the Xenopus laevis Oocytes System

    PubMed Central

    Clémençon, Benjamin; Lüscher, Benjamin P.; Fine, Michael; Baumann, Marc U.; Surbek, Daniel V.; Bonny, Olivier; Hediger, Matthias A.

    2014-01-01

    The urate transporter, GLUT9, is responsible for the basolateral transport of urate in the proximal tubule of human kidneys and in the placenta, playing a central role in uric acid homeostasis. GLUT9 shares the least homology with other members of the glucose transporter family, especially with the glucose transporting members GLUT1-4 and is the only member of the GLUT family to transport urate. The recently published high-resolution structure of XylE, a bacterial D-xylose transporting homologue, yields new insights into the structural foundation of this GLUT family of proteins. While this represents a huge milestone, it is unclear if human GLUT9 can benefit from this advancement through subsequent structural based targeting and mutagenesis. Little progress has been made toward understanding the mechanism of GLUT9 since its discovery in 2000. Before work can begin on resolving the mechanisms of urate transport we must determine methods to express, purify and analyze hGLUT9 using a model system adept in expressing human membrane proteins. Here, we describe the surface expression, purification and isolation of monomeric protein, and functional analysis of recombinant hGLUT9 using the Xenopus laevis oocyte system. In addition, we generated a new homology-based high-resolution model of hGLUT9 from the XylE crystal structure and utilized our purified protein to generate a low-resolution single particle reconstruction. Interestingly, we demonstrate that the functional protein extracted from the Xenopus system fits well with the homology-based model allowing us to generate the predicted urate-binding pocket and pave a path for subsequent mutagenesis and structure-function studies. PMID:25286413

  14. Assessment of sustainable urban transport development based on entropy and unascertained measure.

    PubMed

    Li, Yancang; Yang, Jing; Shi, Huawang; Li, Yijie

    2017-01-01

    To find a more effective method for the assessment of sustainable urban transport development, the comprehensive assessment model of sustainable urban transport development was established based on the unascertained measure. On the basis of considering the factors influencing urban transport development, the comprehensive assessment indexes were selected, including urban economical development, transport demand, environment quality and energy consumption, and the assessment system of sustainable urban transport development was proposed. In view of different influencing factors of urban transport development, the index weight was calculated through the entropy weight coefficient method. Qualitative and quantitative analyses were conducted according to the actual condition. Then, the grade was obtained by using the credible degree recognition criterion from which the urban transport development level can be determined. Finally, a comprehensive assessment method for urban transport development was introduced. The application practice showed that the method can be used reasonably and effectively for the comprehensive assessment of urban transport development.

  15. Nonlocal transport in the presence of transport barriers

    NASA Astrophysics Data System (ADS)

    Del-Castillo-Negrete, D.

    2013-10-01

    There is experimental, numerical, and theoretical evidence that transport in plasmas can, under certain circumstances, depart from the standard local, diffusive description. Examples include fast pulse propagation phenomena in perturbative experiments, non-diffusive scaling in L-mode plasmas, and non-Gaussian statistics of fluctuations. From the theoretical perspective, non-diffusive transport descriptions follow from the relaxation of the restrictive assumptions (locality, scale separation, and Gaussian/Markovian statistics) at the foundation of diffusive models. We discuss an alternative class of models able to capture some of the observed non-diffusive transport phenomenology. The models are based on a class of nonlocal, integro-differential operators that provide a unifying framework to describe non- Fickian scale-free transport, and non-Markovian (memory) effects. We study the interplay between nonlocality and internal transport barriers (ITBs) in perturbative transport including cold edge pulses and power modulation. Of particular interest in the nonlocal ``tunnelling'' of perturbations through ITBs. Also, flux-gradient diagrams are discussed as diagnostics to detect nonlocal transport processes in numerical simulations and experiments. Work supported by the US Department of Energy.

  16. TRANSPORT AND SURVIVAL OF VIRUSES IN THE SUBSURFACE PROCESSES, EXPERIMENTS, AND SIMULATION MODELS

    EPA Science Inventory

    The remediation of ground water contaminated with waterborne pathogens, in particular with viruses, is based on their probable or actual ability to be transported from the source of origin to a point of withdrawal while maintaining the capacity to cause infections. The transport ...

  17. Current-based detection of nonlocal spin transport in graphene for spin-based logic applications

    NASA Astrophysics Data System (ADS)

    Wen, Hua; Zhu, Tiancong; Luo, Yunqiu Kelly; Amamou, Walid; Kawakami, Roland K.

    2014-05-01

    Graphene has been proposed for novel spintronic devices due to its robust and efficient spin transport properties at room temperature. Some of the most promising proposals require current-based readout for integration purposes, but the current-based detection of spin accumulation has not yet been developed. In this work, we demonstrate current-based detection of spin transport in graphene using a modified nonlocal geometry. By adding a variable shunt resistor in parallel to the nonlocal voltmeter, we are able to systematically cross over from the conventional voltage-based detection to current-based detection. As the shunt resistor is reduced, the output current from the spin accumulation increases as the shunt resistance drops below a characteristic value R*. We analyze this behavior using a one-dimensional drift-diffusion model, which accounts well for the observed behavior. These results provide the experimental and theoretical foundation for current-based detection of nonlocal spin transport.

  18. Influence of geologic layering on heat transport and storage in an aquifer thermal energy storage system

    NASA Astrophysics Data System (ADS)

    Bridger, D. W.; Allen, D. M.

    2014-01-01

    A modeling study was carried out to evaluate the influence of aquifer heterogeneity, as represented by geologic layering, on heat transport and storage in an aquifer thermal energy storage (ATES) system in Agassiz, British Columbia, Canada. Two 3D heat transport models were developed and calibrated using the flow and heat transport code FEFLOW including: a "non-layered" model domain with homogeneous hydraulic and thermal properties; and, a "layered" model domain with variable hydraulic and thermal properties assigned to discrete geological units to represent aquifer heterogeneity. The base model (non-layered) shows limited sensitivity for the ranges of all thermal and hydraulic properties expected at the site; the model is most sensitive to vertical anisotropy and hydraulic gradient. Simulated and observed temperatures within the wells reflect a combination of screen placement and layering, with inconsistencies largely explained by the lateral continuity of high permeability layers represented in the model. Simulation of heat injection, storage and recovery show preferential transport along high permeability layers, resulting in longitudinal plume distortion, and overall higher short-term storage efficiencies.

  19. Analytical mesoscale modeling of aeolian sand transport

    NASA Astrophysics Data System (ADS)

    Lämmel, Marc; Kroy, Klaus

    2017-11-01

    The mesoscale structure of aeolian sand transport determines a variety of natural phenomena studied in planetary and Earth science. We analyze it theoretically beyond the mean-field level, based on the grain-scale transport kinetics and splash statistics. A coarse-grained analytical model is proposed and verified by numerical simulations resolving individual grain trajectories. The predicted height-resolved sand flux and other important characteristics of the aeolian transport layer agree remarkably well with a comprehensive compilation of field and wind-tunnel data, suggesting that the model robustly captures the essential mesoscale physics. By comparing the predicted saturation length with field data for the minimum sand-dune size, we elucidate the importance of intermittent turbulent wind fluctuations for field measurements and reconcile conflicting previous models for this most enigmatic emergent aeolian scale.

  20. Use of transport models for wildfire behavior simulations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Linn, R.R.; Harlow, F.H.

    1998-01-01

    Investigators have attempted to describe the behavior of wildfires for over fifty years. Current models for numerical description are mainly algebraic and based on statistical or empirical ideas. The authors have developed a transport model called FIRETEC. The use of transport formulations connects the propagation rates to the full conservation equations for energy, momentum, species concentrations, mass, and turbulence. In this paper, highlights of the model formulation and results are described. The goal of the FIRETEC model is to describe most probable average behavior of wildfires in a wide variety of conditions. FIRETEC represents the essence of the combination ofmore » many small-scale processes without resolving each process in complete detail.« less

  1. Reactive solute transport in streams: 2. Simulation of a pH modification experiment

    USGS Publications Warehouse

    Runkel, Robert L.; McKnight, Diane M.; Bencala, Kenneth E.; Chapra, Steven C.

    1996-01-01

    We present an application of an equilibrium-based solute transport model to a pH-modification experiment conducted on the Snake River, an acidic, metal-rich stream located in the Rocky Mountains of Colorado. During the experiment, instream pH decreased from 4.2 to 3.2, causing a marked increase in dissolved iron concentrations. Model application requires specification of several parameters that are estimated using tracer techniques, mass balance calculations, and geochemical data. Two basic questions are addressed through model application: (1) What are the processes responsible for the observed increase in dissolved iron concentrations? (2) Can the identified processes be represented within the equilibrium-based transport model? Simulation results indicate that the increase in iron was due to the dissolution of hydrous iron oxides and the photoreduction of ferric iron. Dissolution from the streambed is represented by considering a trace compartment consisting of freshly precipitated hydrous iron oxide and an abundant compartment consisting of aged precipitates that are less soluble. Spatial variability in the solubility of hydrous iron oxide is attributed to heterogeneity in the streambed sediments, temperature effects, and/or variability in the effects of photoreduction. Solubility products estimated via simulation fall within a narrow range (pKsp from 40.2 to 40.8) relative to the 6 order of magnitude variation reported for laboratory experiments (pKsp from 37.3 to 43.3). Results also support the use of an equilibrium-based transport model as the predominate features of the iron and pH profiles are reproduced. The model provides a valuable tool for quantifying the nature and extent of pH-dependent processes within the context of hydrologic transport.

  2. Reactive Solute Transport in Streams: 2. Simulation of a pH Modification Experiment

    NASA Astrophysics Data System (ADS)

    Runkel, Robert L.; McKnight, Diane M.; Bencala, Kenneth E.; Chapra, Steven C.

    1996-02-01

    We present an application of an equilibrium-based solute transport model to a pH-modification experiment conducted on the Snake River, an acidic, metal-rich stream located in the Rocky Mountains of Colorado. During the experiment, instream pH decreased from 4.2 to 3.2, causing a marked increase in dissolved iron concentrations. Model application requires specification of several parameters that are estimated using tracer techniques, mass balance calculations, and geochemical data. Two basic questions are addressed through model application: (1) What are the processes responsible for the observed increase in dissolved iron concentrations? (2) Can the identified processes be represented within the equilibrium-based transport model? Simulation results indicate that the increase in iron was due to the dissolution of hydrous iron oxides and the photoreduction of ferric iron. Dissolution from the streambed is represented by considering a trace compartment consisting of freshly precipitated hydrous iron oxide and an abundant compartment consisting of aged precipitates that are less soluble. Spatial variability in the solubility of hydrous iron oxide is attributed to heterogeneity in the streambed sediments, temperature effects, and/or variability in the effects of photoreduction. Solubility products estimated via simulation fall within a narrow range (pKsp from 40.2 to 40.8) relative to the 6 order of magnitude variation reported for laboratory experiments (pKsp from 37.3 to 43.3). Results also support the use of an equilibrium-based transport model as the predominate features of the iron and pH profiles are reproduced. The model provides a valuable tool for quantifying the nature and extent of pH-dependent processes within the context of hydrologic transport.

  3. Modelling of the mercury loss in fluorescent lamps under the influence of metal oxide coatings

    NASA Astrophysics Data System (ADS)

    Santos Abreu, A.; Mayer, J.; Lenk, D.; Horn, S.; Konrad, A.; Tidecks, R.

    2016-11-01

    The mercury transport and loss mechanisms in the metal oxide coatings of mercury low pressure discharge fluorescent lamps have been investigated. An existing model based on a ballistic process is discussed in the context of experimental mercury loss data. Two different approaches to the modeling of the mercury loss have been developed. The first one is based on mercury transition rates between the plasma, the coating, and the glass without specifying the underlying physical processes. The second one is based on a transport process driven by diffusion and a binding process of mercury reacting to mercury oxide inside the layers. Moreover, we extended the diffusion based model to handle multi-component coatings. All approaches are applied to describe mercury loss experiments under the influence of an Al 2 O 3 coating.

  4. Assessment and Requirements of Nuclear Reaction Databases for GCR Transport in the Atmosphere and Structures

    NASA Technical Reports Server (NTRS)

    Cucinotta, F. A.; Wilson, J. W.; Shinn, J. L.; Tripathi, R. K.

    1998-01-01

    The transport properties of galactic cosmic rays (GCR) in the atmosphere, material structures, and human body (self-shielding) am of interest in risk assessment for supersonic and subsonic aircraft and for space travel in low-Earth orbit and on interplanetary missions. Nuclear reactions, such as knockout and fragmentation, present large modifications of particle type and energies of the galactic cosmic rays in penetrating materials. We make an assessment of the current nuclear reaction models and improvements in these model for developing required transport code data bases. A new fragmentation data base (QMSFRG) based on microscopic models is compared to the NUCFRG2 model and implications for shield assessment made using the HZETRN radiation transport code. For deep penetration problems, the build-up of light particles, such as nucleons, light clusters and mesons from nuclear reactions in conjunction with the absorption of the heavy ions, leads to the dominance of the charge Z = 0, 1, and 2 hadrons in the exposures at large penetration depths. Light particles are produced through nuclear or cluster knockout and in evaporation events with characteristically distinct spectra which play unique roles in the build-up of secondary radiation's in shielding. We describe models of light particle production in nucleon and heavy ion induced reactions and make an assessment of the importance of light particle multiplicity and spectral parameters in these exposures.

  5. Dissipative time-dependent quantum transport theory.

    PubMed

    Zhang, Yu; Yam, Chi Yung; Chen, GuanHua

    2013-04-28

    A dissipative time-dependent quantum transport theory is developed to treat the transient current through molecular or nanoscopic devices in presence of electron-phonon interaction. The dissipation via phonon is taken into account by introducing a self-energy for the electron-phonon coupling in addition to the self-energy caused by the electrodes. Based on this, a numerical method is proposed. For practical implementation, the lowest order expansion is employed for the weak electron-phonon coupling case and the wide-band limit approximation is adopted for device and electrodes coupling. The corresponding hierarchical equation of motion is derived, which leads to an efficient and accurate time-dependent treatment of inelastic effect on transport for the weak electron-phonon interaction. The resulting method is applied to a one-level model system and a gold wire described by tight-binding model to demonstrate its validity and the importance of electron-phonon interaction for the quantum transport. As it is based on the effective single-electron model, the method can be readily extended to time-dependent density functional theory.

  6. Particle acceleration and transport at a 2D CME-driven shock using the HAFv3 and PATH Code

    NASA Astrophysics Data System (ADS)

    Li, G.; Ao, X.; Fry, C. D.; Verkhoglyadova, O. P.; Zank, G. P.

    2012-12-01

    We study particle acceleration at a 2D CME-driven shock and the subsequent transport in the inner heliosphere (up to 2 AU) by coupling the kinematic Hakamada-Akasofu-Fry version 3 (HAFv3) solar wind model (Hakamada and Akasofu, 1982, Fry et al. 2003) with the Particle Acceleration and Transport in the Heliosphere (PATH) model (Zank et al., 2000, Li et al., 2003, 2005, Verkhoglyadova et al. 2009). The HAFv3 provides the evolution of a two-dimensional shock geometry and other plasma parameters, which are fed into the PATH model to investigate the effect of a varying shock geometry on particle acceleration and transport. The transport module of the PATH model is parallelized and utilizes the state-of-the-art GPU computation technique to achieve a rapid physics-based numerical description of the interplanetary energetic particles. Together with a fast execution of the HAFv3 model, the coupled code gives us a possibility to nowcast/forecast the interplanetary radiation environment.

  7. Run-of-River Impoundments Can Remain Unfilled While Transporting Gravel Bedload: Numerical Modeling Results

    NASA Astrophysics Data System (ADS)

    Pearson, A.; Pizzuto, J. E.

    2015-12-01

    Previous work at run-of-river (ROR) dams in northern Delaware has shown that bedload supplied to ROR impoundments can be transported over the dam when impoundments remain unfilled. Transport is facilitated by high levels of sand in the impoundment that lowers the critical shear stresses for particle entrainment, and an inversely sloping sediment ramp connecting the impoundment bed (where the water depth is typically equal to the dam height) with the top of the dam (Pearson and Pizzuto, in press). We demonstrate with one-dimensional bed material transport modeling that bed material can move through impoundments and that equilibrium transport (i.e., a balance between supply to and export from the impoundment, with a constant bed elevation) is possible even when the bed elevation is below the top of the dam. Based on our field work and previous HEC-RAS modeling, we assess bed material transport capacity at the base of the sediment ramp (and ignore detailed processes carrying sediment up and ramp and over the dam). The hydraulics at the base of the ramp are computed using a weir equation, providing estimates of water depth, velocity, and friction, based on the discharge and sediment grain size distribution of the impoundment. Bedload transport rates are computed using the Wilcock-Crowe equation, and changes in the impoundment's bed elevation are determined by sediment continuity. Our results indicate that impoundments pass the gravel supplied from upstream with deep pools when gravel supply rate is low, gravel grain sizes are relatively small, sand supply is high, and discharge is high. Conversely, impoundments will tend to fill their pools when gravel supply rate is high, gravel grain sizes are relatively large, sand supply is low, and discharge is low. The rate of bedload supplied to an impoundment is the primary control on how fast equilibrium transport is reached, with discharge having almost no influence on the timing of equilibrium.

  8. Detailed assessment of global transport-energy models’ structures and projections

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yeh, Sonia; Mishra, Gouri Shankar; Fulton, Lew

    This paper focuses on comparing the frameworks and projections from four major global transportation models with considerable transportation technology and behavioral detail. We analyze and compare the modeling frameworks, underlying data, assumptions, intermediate parameters, and projections to identify the sources of divergence or consistency, as well as key knowledge gaps. We find that there are significant differences in the base-year data and key parameters for future projections, especially for developing countries. These include passenger and freight activity, mode shares, vehicle ownership rates, and even energy consumption by mode, particularly for shipping, aviation and trucking. This may be due in partmore » to a lack of previous efforts to do such consistency-checking and “bench-marking.” We find that the four models differ in terms of the relative roles of various mitigation strategies to achieve a 2°C / 450 ppm CO2e target: the economics-based integrated assessment models favor the use of low carbon fuels as the primary mitigation option followed by efficiency improvements, whereas transport-only and expert-based models favor efficiency improvements of vehicles followed by mode shifts. We offer recommendations for future modeling improvements focusing on (1) reducing data gaps; (2) translating the findings from this study into relevant policy implications such as feasibility of current policy goals, additional policy targets needed, regional vs. global reductions, etc.; (3) modeling strata of demographic groups to improve understanding of vehicle ownership levels, travel behavior, and urban vs. rural considerations; and (4) conducting coordinated efforts in aligning input assumptions and historical data, policy analysis, and modeling insights.« less

  9. Turbulent scalar flux transport in head-on quenching of turbulent premixed flames: a direct numerical simulations approach to assess models for Reynolds averaged Navier Stokes simulations

    NASA Astrophysics Data System (ADS)

    Lai, Jiawei; Alwazzan, Dana; Chakraborty, Nilanjan

    2017-11-01

    The statistical behaviour and the modelling of turbulent scalar flux transport have been analysed using a direct numerical simulation (DNS) database of head-on quenching of statistically planar turbulent premixed flames by an isothermal wall. A range of different values of Damköhler, Karlovitz numbers and Lewis numbers has been considered for this analysis. The magnitudes of the turbulent transport and mean velocity gradient terms in the turbulent scalar flux transport equation remain small in comparison to the pressure gradient, molecular dissipation and reaction-velocity fluctuation correlation terms in the turbulent scalar flux transport equation when the flame is away from the wall but the magnitudes of all these terms diminish and assume comparable values during flame quenching before vanishing altogether. It has been found that the existing models for the turbulent transport, pressure gradient, molecular dissipation and reaction-velocity fluctuation correlation terms in the turbulent scalar flux transport equation do not adequately address the respective behaviours extracted from DNS data in the near-wall region during flame quenching. Existing models for transport equation-based closures of turbulent scalar flux have been modified in such a manner that these models provide satisfactory prediction both near to and away from the wall.

  10. Development and application of the microbial fate and transport module for the Agricultural Policy/Environmental eXtender (APEX) model

    NASA Astrophysics Data System (ADS)

    Hong, E.; Park, Y.; Muirhead, R.; Jeong, J.; Pachepsky, Y. A.

    2017-12-01

    Pathogenic microorganisms in recreational and irrigation waters remain the subject of concern. Water quality models are used to estimate microbial quality of water sources, to evaluate microbial contamination-related risks, to guide the microbial water quality monitoring, and to evaluate the effect of agricultural management on the microbial water quality. The Agricultural Policy/Environmental eXtender (APEX) is the watershed-scale water quality model that includes highly detailed representation of agricultural management. The APEX currently does not have microbial fate and transport simulation capabilities. The objective of this work was to develop the first APEX microbial fate and transport module that could use the APEX conceptual model of manure removal together with recently introduced conceptualizations of the in-stream microbial fate and transport. The module utilizes manure erosion rates found in the APEX. Bacteria survival in soil-manure mixing layer was simulated with the two-stage survival model. Individual survival patterns were simulated for each manure application date. Simulated in-stream microbial fate and transport processes included the reach-scale passive release of bacteria with resuspended bottom sediment during high flow events, the transport of bacteria from bottom sediment due to the hyporheic exchange during low flow periods, the deposition with settling sediment, and the two-stage survival. Default parameter values were available from recently published databases. The APEX model with the newly developed microbial fate and transport module was applied to simulate seven years of monitoring data for the Toenepi watershed in New Zealand. Based on calibration and testing results, the APEX with the microbe module reproduced well the monitored pattern of E. coli concentrations at the watershed outlet. The APEX with the microbial fate and transport module will be utilized for predicting microbial quality of water under various agricultural practices, evaluating monitoring protocols, and supporting the selection of management practices based on regulations that rely on fecal indicator bacteria concentrations.

  11. Mathematical Modeling and Experimental Validation of Nanoemulsion-Based Drug Transport across Cellular Barriers.

    PubMed

    Kadakia, Ekta; Shah, Lipa; Amiji, Mansoor M

    2017-07-01

    Nanoemulsions have shown potential in delivering drug across epithelial and endothelial cell barriers, which express efflux transporters. However, their transport mechanisms are not entirely understood. Our goal was to investigate the cellular permeability of nanoemulsion-encapsulated drugs and apply mathematical modeling to elucidate transport mechanisms and sensitive nanoemulsion attributes. Transport studies were performed in Caco-2 cells, using fish oil nanoemulsions and a model substrate, rhodamine-123. Permeability data was modeled using a semi-mechanistic approach, capturing the following cellular processes: endocytotic uptake of the nanoemulsion, release of rhodamine-123 from the nanoemulsion, efflux and passive permeability of rhodamine-123 in aqueous solution. Nanoemulsions not only improved the permeability of rhodamine-123, but were also less sensitive to efflux transporters. The model captured bidirectional permeability results and identified sensitive processes, such as the release of the nanoemulsion-encapsulated drug and cellular uptake of the nanoemulsion. Mathematical description of cellular processes, improved our understanding of transport mechanisms, such as nanoemulsions don't inhibit efflux to improve drug permeability. Instead, their endocytotic uptake, results in higher intracellular drug concentrations, thereby increasing the concentration gradient and transcellular permeability across biological barriers. Modeling results indicated optimizing nanoemulsion attributes like the droplet size and intracellular drug release rate, may further improve drug permeability.

  12. Ground-water models for water resources planning

    USGS Publications Warehouse

    Moore, John E.

    1980-01-01

    In the past decade hydrologists have emphasized the development of computer-based mathematical models to aid in the understanding of flow, the transport of solutes, transport of heat, and deformation in the groundwater system. These models have been used to provide information and predictions for water managers. Too frequently, groundwater was neglected in water-resource planning because managers believed that it could not be adequately evaluated in terms of availability, quality, and effect of development on surface water supplies. Now, however, with newly developed digital groundwater models, effects of development can be predicted. Such models have been used to predict hydrologic and quality changes under different stresses. These models have grown in complexity over the last 10 years from simple one-layer flow models to three-dimensional simulations of groundwater flow which may include solute transport, heat transport, effects of land subsidence, and encroachment of salt water. This paper illustrates, through case histories, how predictive groundwater models have provided the information needed for the sound planning and management of water resources in the United States. (USGS)

  13. A fluid membrane enhances the velocity of cargo transport by small teams of kinesin-1

    NASA Astrophysics Data System (ADS)

    Li, Qiaochu; Tseng, Kuo-Fu; King, Stephen J.; Qiu, Weihong; Xu, Jing

    2018-03-01

    Kinesin-1 (hereafter referred to as kinesin) is a major microtubule-based motor protein for plus-end-directed intracellular transport in live cells. While the single-molecule functions of kinesin are well characterized, the physiologically relevant transport of membranous cargos by small teams of kinesins remains poorly understood. A key experimental challenge remains in the quantitative control of the number of motors driving transport. Here we utilized "motile fraction" to overcome this challenge and experimentally accessed transport by a single kinesin through the physiologically relevant transport by a small team of kinesins. We used a fluid lipid bilayer to model the cellular membrane in vitro and employed optical trapping to quantify the transport of membrane-enclosed cargos versus traditional membrane-free cargos under identical conditions. We found that coupling motors via a fluid membrane significantly enhances the velocity of cargo transport by small teams of kinesins. Importantly, enclosing a cargo in a fluid lipid membrane did not impact single-kinesin transport, indicating that membrane-dependent velocity enhancement for team-based transport arises from altered interactions between kinesins. Our study demonstrates that membrane-based coupling between motors is a key determinant of kinesin-based transport. Enhanced velocity may be critical for fast delivery of cargos in live cells.

  14. Transport of fluid and solutes in the body I. Formulation of a mathematical model.

    PubMed

    Gyenge, C C; Bowen, B D; Reed, R K; Bert, J L

    1999-09-01

    A compartmental model of short-term whole body fluid, protein, and ion distribution and transport is formulated. The model comprises four compartments: a vascular and an interstitial compartment, each with an embedded cellular compartment. The present paper discusses the assumptions on which the model is based and describes the equations that make up the model. Fluid and protein transport parameters from a previously validated model as well as ionic exchange parameters from the literature or from statistical estimation [see companion paper: C. C. Gyenge, B. D. Bowen, R. K. Reed, and J. L. Bert. Am. J. Physiol. 277 (Heart Circ. Physiol. 46): H1228-H1240, 1999] are used in formulating the model. The dynamic model has the ability to simulate 1) transport across the capillary membrane of fluid, proteins, and small ions and their distribution between the vascular and interstitial compartments; 2) the changes in extracellular osmolarity; 3) the distribution and transport of water and ions associated with each of the cellular compartments; 4) the cellular transmembrane potential; and 5) the changes of volume in the four fluid compartments. The validation and testing of the proposed model against available experimental data are presented in the companion paper.

  15. Stochastic-field cavitation model

    NASA Astrophysics Data System (ADS)

    Dumond, J.; Magagnato, F.; Class, A.

    2013-07-01

    Nonlinear phenomena can often be well described using probability density functions (pdf) and pdf transport models. Traditionally, the simulation of pdf transport requires Monte-Carlo codes based on Lagrangian "particles" or prescribed pdf assumptions including binning techniques. Recently, in the field of combustion, a novel formulation called the stochastic-field method solving pdf transport based on Eulerian fields has been proposed which eliminates the necessity to mix Eulerian and Lagrangian techniques or prescribed pdf assumptions. In the present work, for the first time the stochastic-field method is applied to multi-phase flow and, in particular, to cavitating flow. To validate the proposed stochastic-field cavitation model, two applications are considered. First, sheet cavitation is simulated in a Venturi-type nozzle. The second application is an innovative fluidic diode which exhibits coolant flashing. Agreement with experimental results is obtained for both applications with a fixed set of model constants. The stochastic-field cavitation model captures the wide range of pdf shapes present at different locations.

  16. Stochastic-field cavitation model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dumond, J., E-mail: julien.dumond@areva.com; AREVA GmbH, Erlangen, Paul-Gossen-Strasse 100, D-91052 Erlangen; Magagnato, F.

    2013-07-15

    Nonlinear phenomena can often be well described using probability density functions (pdf) and pdf transport models. Traditionally, the simulation of pdf transport requires Monte-Carlo codes based on Lagrangian “particles” or prescribed pdf assumptions including binning techniques. Recently, in the field of combustion, a novel formulation called the stochastic-field method solving pdf transport based on Eulerian fields has been proposed which eliminates the necessity to mix Eulerian and Lagrangian techniques or prescribed pdf assumptions. In the present work, for the first time the stochastic-field method is applied to multi-phase flow and, in particular, to cavitating flow. To validate the proposed stochastic-fieldmore » cavitation model, two applications are considered. First, sheet cavitation is simulated in a Venturi-type nozzle. The second application is an innovative fluidic diode which exhibits coolant flashing. Agreement with experimental results is obtained for both applications with a fixed set of model constants. The stochastic-field cavitation model captures the wide range of pdf shapes present at different locations.« less

  17. Experimental and AI-based numerical modeling of contaminant transport in porous media.

    PubMed

    Nourani, Vahid; Mousavi, Shahram; Sadikoglu, Fahreddin; Singh, Vijay P

    2017-10-01

    This study developed a new hybrid artificial intelligence (AI)-meshless approach for modeling contaminant transport in porous media. The key innovation of the proposed approach is that both black box and physically-based models are combined for modeling contaminant transport. The effectiveness of the approach was evaluated using experimental and real world data. Artificial neural network (ANN) and adaptive neuro-fuzzy inference system (ANFIS) were calibrated to predict temporal contaminant concentrations (CCs), and the effect of noisy and de-noised data on the model performance was evaluated. Then, considering the predicted CCs at test points (TPs, in experimental study) and piezometers (in Myandoab plain) as interior conditions, the multiquadric radial basis function (MQ-RBF), as a meshless approach which solves partial differential equation (PDE) of contaminant transport in porous media, was employed to estimate the CC values at any point within the study area where there was no TP or piezometer. Optimal values of the dispersion coefficient in the advection-dispersion PDE and shape coefficient of MQ-RBF were determined using the imperialist competitive algorithm. In temporal contaminant transport modeling, de-noised data enhanced the performance of ANN and ANFIS methods in terms of the determination coefficient, up to 6 and 5%, respectively, in the experimental study and up to 39 and 18%, respectively, in the field study. Results showed that the efficiency of ANFIS-meshless model was more than ANN-meshless model up to 2 and 13% in the experimental and field studies, respectively. Copyright © 2017. Published by Elsevier B.V.

  18. A performance comparison of scalar, vector, and concurrent vector computers including supercomputers for modeling transport of reactive contaminants in groundwater

    NASA Astrophysics Data System (ADS)

    Tripathi, Vijay S.; Yeh, G. T.

    1993-06-01

    Sophisticated and highly computation-intensive models of transport of reactive contaminants in groundwater have been developed in recent years. Application of such models to real-world contaminant transport problems, e.g., simulation of groundwater transport of 10-15 chemically reactive elements (e.g., toxic metals) and relevant complexes and minerals in two and three dimensions over a distance of several hundred meters, requires high-performance computers including supercomputers. Although not widely recognized as such, the computational complexity and demand of these models compare with well-known computation-intensive applications including weather forecasting and quantum chemical calculations. A survey of the performance of a variety of available hardware, as measured by the run times for a reactive transport model HYDROGEOCHEM, showed that while supercomputers provide the fastest execution times for such problems, relatively low-cost reduced instruction set computer (RISC) based scalar computers provide the best performance-to-price ratio. Because supercomputers like the Cray X-MP are inherently multiuser resources, often the RISC computers also provide much better turnaround times. Furthermore, RISC-based workstations provide the best platforms for "visualization" of groundwater flow and contaminant plumes. The most notable result, however, is that current workstations costing less than $10,000 provide performance within a factor of 5 of a Cray X-MP.

  19. Numerical investigation of diesel exhaust particle transport and deposition in the CT-scan based lung airway

    NASA Astrophysics Data System (ADS)

    Islam, Mohammad S.; Saha, Suvash C.; Sauret, Emilie; Gu, Y. T.; Molla, Md Mamun

    2017-06-01

    Diesel exhaust particulates matter (DEPM) is a compound mixture of gasses and fine particles that contain more than 40 toxic air pollutants including benzene, formaldehyde, and nitrogen oxides. Exposure of DEPM to human lung airway during respiratory inhalation causes severe health hazards like diverse pulmonary diseases. This paper studies the DEPM transport and deposition in upper three generations of the realistic lung airways. A 3-D digital airway bifurcation model is constructed from the computerized tomography (CT) scan data of a healthy adult man. The Euler-Lagrange approach is used to solve the continuum and disperse phases of the calculation. Local averaged Navier-Stokes equations are solved to calculate the transport of the continuum phase. Lagrangian based Discrete Phase Model (DPM) is used to investigate the particle transport and deposition in the current anatomical model. The effects of size specific monodispersed particles on deposition are extensively investigated during different breathing pattern. The numerical results illustrate that particle diameter and breathing pattern have a substantial impact on particles transport and deposition in the tracheobronchial airways. The present realistic bifurcation model also depicts a new deposition hot spot which could advance the understanding of the therapeutic drug delivery system to the specific position of the respiratory airways.

  20. Transport Physics in Thin-Film Oxides: From Capacitors to Memristors1

    NASA Astrophysics Data System (ADS)

    Tierney, Brian; Hjalmarson, Harold; McLain, Michael; Hughart, David; Marinella, Matthew; Mamaluy, Denis; Gao, Xujiao

    A physics-based model of transport mechanisms in metal-insulator-metal (M-I-M) systems is developed to explain transport through the metal-oxide interfaces and in the bulk of the insulating oxide. Interface tunneling, such as that between the metal to the conduction band or bound defect states, is accounted for by a WKB model. Our model also incorporates the evolution of the associated oxide defect chemistry. Continuum calculations are performed for both Ta2O5 M-I-M capacitors and TaOx-Based M-I-M memristors, as both devices are structurally similar and can be characterized by a common set of transport mechanisms. However, due to the electroforming process for which memristors are subjected, different transport mechanisms dominate for each type of device. Also, the effects of pulsed ionizing radiation from an external source are included in the model. It is shown that such radiation can be used to probe whether the M-I-M system is in a capacitive or memristive state. 1Sandia National Laboratories is a multi-program laboratory managed and operated by Sandia Corporation, a wholly owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energy's National Nuclear Security Administration under contract DE-AC04-94AL85000.

  1. Sediment plume model-a comparison between use of measured turbidity data and satellite images for model calibration.

    PubMed

    Sadeghian, Amir; Hudson, Jeff; Wheater, Howard; Lindenschmidt, Karl-Erich

    2017-08-01

    In this study, we built a two-dimensional sediment transport model of Lake Diefenbaker, Saskatchewan, Canada. It was calibrated by using measured turbidity data from stations along the reservoir and satellite images based on a flood event in 2013. In June 2013, there was heavy rainfall for two consecutive days on the frozen and snow-covered ground in the higher elevations of western Alberta, Canada. The runoff from the rainfall and the melted snow caused one of the largest recorded inflows to the headwaters of the South Saskatchewan River and Lake Diefenbaker downstream. An estimated discharge peak of over 5200 m 3 /s arrived at the reservoir inlet with a thick sediment front within a few days. The sediment plume moved quickly through the entire reservoir and remained visible from satellite images for over 2 weeks along most of the reservoir, leading to concerns regarding water quality. The aims of this study are to compare, quantitatively and qualitatively, the efficacy of using turbidity data and satellite images for sediment transport model calibration and to determine how accurately a sediment transport model can simulate sediment transport based on each of them. Both turbidity data and satellite images were very useful for calibrating the sediment transport model quantitatively and qualitatively. Model predictions and turbidity measurements show that the flood water and suspended sediments entered upstream fairly well mixed and moved downstream as overflow with a sharp gradient at the plume front. The model results suggest that the settling and resuspension rates of sediment are directly proportional to flow characteristics and that the use of constant coefficients leads to model underestimation or overestimation unless more data on sediment formation become available. Hence, this study reiterates the significance of the availability of data on sediment distribution and characteristics for building a robust and reliable sediment transport model.

  2. IPA (v1): a framework for agent-based modelling of soil water movement

    NASA Astrophysics Data System (ADS)

    Mewes, Benjamin; Schumann, Andreas H.

    2018-06-01

    In the last decade, agent-based modelling (ABM) became a popular modelling technique in social sciences, medicine, biology, and ecology. ABM was designed to simulate systems that are highly dynamic and sensitive to small variations in their composition and their state. As hydrological systems, and natural systems in general, often show dynamic and non-linear behaviour, ABM can be an appropriate way to model these systems. Nevertheless, only a few studies have utilized the ABM method for process-based modelling in hydrology. The percolation of water through the unsaturated soil is highly responsive to the current state of the soil system; small variations in composition lead to major changes in the transport system. Hence, we present a new approach for modelling the movement of water through a soil column: autonomous water agents that transport water through the soil while interacting with their environment as well as with other agents under physical laws.

  3. [Construction of individual-based ecological model for Scomber japonicas at its early growth stages in East China Sea].

    PubMed

    Li, Yue-Song; Chen, Xin-Jun; Yang, Hong

    2012-06-01

    By adopting FVCOM-simulated 3-D physical field and based on the biological processes of chub mackerel (Scomber japonicas) in its early life history from the individual-based biological model, the individual-based ecological model for S. japonicas at its early growth stages in the East China Sea was constructed through coupling the physical field in March-July with the biological model by the method of Lagrange particle tracking. The model constructed could well simulate the transport process and abundance distribution of S. japonicas eggs and larvae. The Taiwan Warm Current, Kuroshio, and Tsushima Strait Warm Current directly affected the transport process and distribution of the eggs and larvae, and indirectly affected the growth and survive of the eggs and larvae through the transport to the nursery grounds with different water temperature and foods. The spawning grounds in southern East China Sea made more contributions to the recruitment to the fishing grounds in northeast East China Sea, but less to the Yangtze estuary and Zhoushan Island. The northwestern and southwestern parts of spawning grounds had strong connectivity with the nursery grounds of Cheju and Tsushima Straits, whereas the northeastern and southeastern parts of the spawning ground had strong connectivity with the nursery grounds of Kyushu and Pacific Ocean.

  4. Vulnerability of Population and Transportation Infrastructure at the East Bank of Delaware Bay Due to Coastal Flooding in Sea-Level Rise Conditions

    DTIC Science & Technology

    2013-04-30

    resulting impact on residents and transportation infrastructure. The three-dimensional coastal ocean model FVCOM coupled with a two-dimensional...shallow water model is used to simulate hydrodynamic flooding from coastal ocean water with fine-resolution meshes, and a topography-based hydrologic... ocean model FVCOM coupled with a two-dimensional shallow water model is used to simulate hydrodynamic flooding from coastal ocean water with fine

  5. Nonpoint Source Solute Transport Normal to Aquifer Bedding in Heterogeneous, Markov Chain Random Fields

    NASA Astrophysics Data System (ADS)

    Zhang, H.; Harter, T.; Sivakumar, B.

    2005-12-01

    Facies-based geostatistical models have become important tools for the stochastic analysis of flow and transport processes in heterogeneous aquifers. However, little is known about the dependency of these processes on the parameters of facies- based geostatistical models. This study examines the nonpoint source solute transport normal to the major bedding plane in the presence of interconnected high conductivity (coarse- textured) facies in the aquifer medium and the dependence of the transport behavior upon the parameters of the constitutive facies model. A facies-based Markov chain geostatistical model is used to quantify the spatial variability of the aquifer system hydrostratigraphy. It is integrated with a groundwater flow model and a random walk particle transport model to estimate the solute travel time probability distribution functions (pdfs) for solute flux from the water table to the bottom boundary (production horizon) of the aquifer. The cases examined include, two-, three-, and four-facies models with horizontal to vertical facies mean length anisotropy ratios, ek, from 25:1 to 300:1, and with a wide range of facies volume proportions (e.g, from 5% to 95% coarse textured facies). Predictions of travel time pdfs are found to be significantly affected by the number of hydrostratigraphic facies identified in the aquifer, the proportions of coarse-textured sediments, the mean length of the facies (particularly the ratio of length to thickness of coarse materials), and - to a lesser degree - the juxtapositional preference among the hydrostratigraphic facies. In transport normal to the sedimentary bedding plane, travel time pdfs are not log- normally distributed as is often assumed. Also, macrodispersive behavior (variance of the travel time pdf) was found to not be a unique function of the conductivity variance. The skewness of the travel time pdf varied from negatively skewed to strongly positively skewed within the parameter range examined. We also show that the Markov chain approach may give significantly different travel time pdfs when compared to the more commonly used Gaussian random field approach even though the first and second order moments in the geostatistical distribution of the lnK field are identical. The choice of the appropriate geostatistical model is therefore critical in the assessment of nonpoint source transport.

  6. Nonpoint source solute transport normal to aquifer bedding in heterogeneous, Markov chain random fields

    NASA Astrophysics Data System (ADS)

    Zhang, Hua; Harter, Thomas; Sivakumar, Bellie

    2006-06-01

    Facies-based geostatistical models have become important tools for analyzing flow and mass transport processes in heterogeneous aquifers. Yet little is known about the relationship between these latter processes and the parameters of facies-based geostatistical models. In this study, we examine the transport of a nonpoint source solute normal (perpendicular) to the major bedding plane of an alluvial aquifer medium that contains multiple geologic facies, including interconnected, high-conductivity (coarse textured) facies. We also evaluate the dependence of the transport behavior on the parameters of the constitutive facies model. A facies-based Markov chain geostatistical model is used to quantify the spatial variability of the aquifer system's hydrostratigraphy. It is integrated with a groundwater flow model and a random walk particle transport model to estimate the solute traveltime probability density function (pdf) for solute flux from the water table to the bottom boundary (the production horizon) of the aquifer. The cases examined include two-, three-, and four-facies models, with mean length anisotropy ratios for horizontal to vertical facies, ek, from 25:1 to 300:1 and with a wide range of facies volume proportions (e.g., from 5 to 95% coarse-textured facies). Predictions of traveltime pdfs are found to be significantly affected by the number of hydrostratigraphic facies identified in the aquifer. Those predictions of traveltime pdfs also are affected by the proportions of coarse-textured sediments, the mean length of the facies (particularly the ratio of length to thickness of coarse materials), and, to a lesser degree, the juxtapositional preference among the hydrostratigraphic facies. In transport normal to the sedimentary bedding plane, traveltime is not lognormally distributed as is often assumed. Also, macrodispersive behavior (variance of the traveltime) is found not to be a unique function of the conductivity variance. For the parameter range examined, the third moment of the traveltime pdf varies from negatively skewed to strongly positively skewed. We also show that the Markov chain approach may give significantly different traveltime distributions when compared to the more commonly used Gaussian random field approach, even when the first- and second-order moments in the geostatistical distribution of the lnK field are identical. The choice of the appropriate geostatistical model is therefore critical in the assessment of nonpoint source transport, and uncertainty about that choice must be considered in evaluating the results.

  7. Validating the energy transport modeling of the DIII-D and EAST ramp up experiments using TSC

    NASA Astrophysics Data System (ADS)

    Liu, Li; Guo, Yong; Chan, Vincent; Mao, Shifeng; Wang, Yifeng; Pan, Chengkang; Luo, Zhengping; Zhao, Hailin; Ye, Minyou

    2017-06-01

    The confidence in ramp up scenario design of the China fusion engineering test reactor (CFETR) can be significantly enhanced using validated transport models to predict the current profile and temperature profile. In the tokamak simulation code (TSC), two semi-empirical energy transport models (the Coppi-Tang (CT) and BGB model) and three theory-based models (the GLF23, MMM95 and CDBM model) are investigated on the CFETR relevant ramp up discharges, including three DIII-D ITER-like ramp up discharges and one EAST ohmic discharge. For the DIII-D discharges, all the transport models yield dynamic {{\\ell}\\text{i}} within +/- 0.15 deviations except for some time points where the experimental fluctuation is very strong. All the models agree with the experimental {β\\text{p}} except that the CT model strongly overestimates {β\\text{p}} in the first half of ramp up phase. When applying the CT, CDBM and GLF23 model to estimate the internal flux, they show maximum deviations of more than 10% because of inaccuracies in the temperature profile predictions, while the BGB model performs best on the internal flux. Although all the models fall short in reproducing the dynamic {{\\ell}\\text{i}} evolution for the EAST tokamak, the result of the BGB model is the closest to the experimental {{\\ell}\\text{i}} . Based on these comparisons, we conclude that the BGB model is the most consistent among these models for simulating CFETR ohmic ramp-up. The CT model with improvement for better simulation of the temperature profiles in the first half of ramp up phase will also be attractive. For the MMM95, GLF23 and CDBM model, better prediction of the edge temperature will improve the confidence for CFETR L-mode simulation. Conclusive validation of any transport model will require extensive future investigation covering a larger variety discharges.

  8. cDF Theory Software for mesoscopic modeling of equilibrium and transport phenomena

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    2015-12-01

    The approach is based on classical Density Functional Theory ((cDFT) coupled with the Poisson-Nernst-Planck (PNP) transport kinetics model and quantum mechanical description of short-range interaction and elementary transport processes. The model we proposed and implemented is fully atomistic, taking into account pairwise short-range and manybody long-range interactions. But in contrast to standard molecular dynamics (MD) simulations, where long-range manybody interactions are evaluated as a sum of pair-wise atom-atom contributions, we include them analytically based on wellestablished theories of electrostatic and excluded volume interactions in multicomponent systems. This feature of the PNP/cDFT approach allows us to reach well beyond the length-scalesmore » accessible to MD simulations, while retaining the essential physics of interatomic interactions from first principles and in a parameter-free fashion.« less

  9. Modelling approaches for pipe inclination effect on deposition limit velocity of settling slurry flow

    NASA Astrophysics Data System (ADS)

    Matoušek, Václav; Kesely, Mikoláš; Vlasák, Pavel

    2018-06-01

    The deposition velocity is an important operation parameter in hydraulic transport of solid particles in pipelines. It represents flow velocity at which transported particles start to settle out at the bottom of the pipe and are no longer transported. A number of predictive models has been developed to determine this threshold velocity for slurry flows of different solids fractions (fractions of different grain size and density). Most of the models consider flow in a horizontal pipe only, modelling approaches for inclined flows are extremely scarce due partially to a lack of experimental information about the effect of pipe inclination on the slurry flow pattern and behaviour. We survey different approaches to modelling of particle deposition in flowing slurry and discuss mechanisms on which deposition-limit models are based. Furthermore, we analyse possibilities to incorporate the effect of flow inclination into the predictive models and select the most appropriate ones based on their ability to modify the modelled deposition mechanisms to conditions associated with the flow inclination. A usefulness of the selected modelling approaches and their modifications are demonstrated by comparing model predictions with experimental results for inclined slurry flows from our own laboratory and from the literature.

  10. Understanding Air Transportation Market Dynamics Using a Search Algorithm for Calibrating Travel Demand and Price

    NASA Technical Reports Server (NTRS)

    Kumar, Vivek; Horio, Brant M.; DeCicco, Anthony H.; Hasan, Shahab; Stouffer, Virginia L.; Smith, Jeremy C.; Guerreiro, Nelson M.

    2015-01-01

    This paper presents a search algorithm based framework to calibrate origin-destination (O-D) market specific airline ticket demands and prices for the Air Transportation System (ATS). This framework is used for calibrating an agent based model of the air ticket buy-sell process - Airline Evolutionary Simulation (Airline EVOS) -that has fidelity of detail that accounts for airline and consumer behaviors and the interdependencies they share between themselves and the NAS. More specificially, this algorithm simultaneous calibrates demand and airfares for each O-D market, to within specified threshold of a pre-specified target value. The proposed algorithm is illustrated with market data targets provided by the Transportation System Analysis Model (TSAM) and Airline Origin and Destination Survey (DB1B). Although we specify these models and datasources for this calibration exercise, the methods described in this paper are applicable to calibrating any low-level model of the ATS to some other demand forecast model-based data. We argue that using a calibration algorithm such as the one we present here to synchronize ATS models with specialized forecast demand models, is a powerful tool for establishing credible baseline conditions in experiments analyzing the effects of proposed policy changes to the ATS.

  11. Representing the effects of stratosphere–troposphere exchange on 3-D O3 distributions in chemistry transport models using a potential vorticity-based parameterization

    EPA Science Inventory

    Downward transport of ozone (O3) from the stratosphere can be a significant contributor to tropospheric O3 background levels. However, this process often is not well represented in current regional models. In this study, we develop a seasonally and spatially varying potential vor...

  12. Transportation Sector Model of the National Energy Modeling System. Volume 1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    NONE

    1998-01-01

    This report documents the objectives, analytical approach and development of the National Energy Modeling System (NEMS) Transportation Model (TRAN). The report catalogues and describes the model assumptions, computational methodology, parameter estimation techniques, model source code, and forecast results generated by the model. The NEMS Transportation Model comprises a series of semi-independent models which address different aspects of the transportation sector. The primary purpose of this model is to provide mid-term forecasts of transportation energy demand by fuel type including, but not limited to, motor gasoline, distillate, jet fuel, and alternative fuels (such as CNG) not commonly associated with transportation. Themore » current NEMS forecast horizon extends to the year 2010 and uses 1990 as the base year. Forecasts are generated through the separate consideration of energy consumption within the various modes of transport, including: private and fleet light-duty vehicles; aircraft; marine, rail, and truck freight; and various modes with minor overall impacts, such as mass transit and recreational boating. This approach is useful in assessing the impacts of policy initiatives, legislative mandates which affect individual modes of travel, and technological developments. The model also provides forecasts of selected intermediate values which are generated in order to determine energy consumption. These elements include estimates of passenger travel demand by automobile, air, or mass transit; estimates of the efficiency with which that demand is met; projections of vehicle stocks and the penetration of new technologies; and estimates of the demand for freight transport which are linked to forecasts of industrial output. Following the estimation of energy demand, TRAN produces forecasts of vehicular emissions of the following pollutants by source: oxides of sulfur, oxides of nitrogen, total carbon, carbon dioxide, carbon monoxide, and volatile organic compounds.« less

  13. Space transportation nodes assumptions and requirements: Lunar base systems study task 2.1

    NASA Technical Reports Server (NTRS)

    Kahn, Taher Ali; Simonds, Charles H.; Stump, William R.

    1988-01-01

    The Space Transportation Nodes Assumptions and Requirements task was performed as part of the Advanced Space Transportation Support Contract, a NASA Johnson Space Center (JSC) study intended to provide planning for a Lunar Base near the year 2000. The original task statement has been revised to satisfy the following queries: (1) What vehicles are to be processed at the transportation node; (2) What is the flow of activities involved in a vehicle passing through the node; and (3) What node support resources are necessary to support a lunar scenario traffic model composed of a mix of vehicles in an active flight schedule. The Lunar Base Systems Study is concentrating on the initial years of the Phase 2 Lunar Base Scenario. The study will develop the first five years of that phase in order to define the transportation and surface systems (including mass, volumes, power requirements, and designs).

  14. Routing and Scheduling Optimization Model of Sea Transportation

    NASA Astrophysics Data System (ADS)

    barus, Mika debora br; asyrafy, Habib; nababan, Esther; mawengkang, Herman

    2018-01-01

    This paper examines the routing and scheduling optimization model of sea transportation. One of the issues discussed is about the transportation of ships carrying crude oil (tankers) which is distributed to many islands. The consideration is the cost of transportation which consists of travel costs and the cost of layover at the port. Crude oil to be distributed consists of several types. This paper develops routing and scheduling model taking into consideration some objective functions and constraints. The formulation of the mathematical model analyzed is to minimize costs based on the total distance visited by the tanker and minimize the cost of the ports. In order for the model of the problem to be more realistic and the cost calculated to be more appropriate then added a parameter that states the multiplier factor of cost increases as the charge of crude oil is filled.

  15. Innovative mathematical modeling in environmental remediation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yeh, Gour T.; National Central Univ.; Univ. of Central Florida

    2013-05-01

    There are two different ways to model reactive transport: ad hoc and innovative reaction-based approaches. The former, such as the Kd simplification of adsorption, has been widely employed by practitioners, while the latter has been mainly used in scientific communities for elucidating mechanisms of biogeochemical transport processes. It is believed that innovative mechanistic-based models could serve as protocols for environmental remediation as well. This paper reviews the development of a mechanistically coupled fluid flow, thermal transport, hydrologic transport, and reactive biogeochemical model and example-applications to environmental remediation problems. Theoretical bases are sufficiently described. Four example problems previously carried out aremore » used to demonstrate how numerical experimentation can be used to evaluate the feasibility of different remediation approaches. The first one involved the application of a 56-species uranium tailing problem to the Melton Branch Subwatershed at Oak Ridge National Laboratory (ORNL) using the parallel version of the model. Simulations were made to demonstrate the potential mobilization of uranium and other chelating agents in the proposed waste disposal site. The second problem simulated laboratory-scale system to investigate the role of natural attenuation in potential off-site migration of uranium from uranium mill tailings after restoration. It showed inadequacy of using a single Kd even for a homogeneous medium. The third example simulated laboratory experiments involving extremely high concentrations of uranium, technetium, aluminum, nitrate, and toxic metals (e.g.,Ni, Cr, Co).The fourth example modeled microbially-mediated immobilization of uranium in an unconfined aquifer using acetate amendment in a field-scale experiment. The purposes of these modeling studies were to simulate various mechanisms of mobilization and immobilization of radioactive wastes and to illustrate how to apply reactive transport models for environmental remediation.The second problem simulated laboratory-scale system to investigate the role of natural attenuation in potential off-site migration of uranium from uranium mill tailings after restoration. It showed inadequacy of using a single Kd even for a homogeneous medium.« less

  16. Colloid Transport in Saturated Porous Media: Elimination of Attachment Efficiency in a New Colloid Transport Model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Landkamer, Lee L.; Harvey, Ronald W.; Scheibe, Timothy D.

    A new colloid transport model is introduced that is conceptually simple but captures the essential features of complicated attachment and detachment behavior of colloids when conditions of secondary minimum attachment exist. This model eliminates the empirical concept of collision efficiency; the attachment rate is computed directly from colloid filtration theory. Also, a new paradigm for colloid detachment based on colloid population heterogeneity is introduced. Assuming the dispersion coefficient can be estimated from tracer behavior, this model has only two fitting parameters: (1) the fraction of colloids that attach irreversibly and (2) the rate at which reversibly attached colloids leave themore » surface. These two parameters were correlated to physical parameters that control colloid transport such as the depth of the secondary minimum and pore water velocity. Given this correlation, the model serves as a heuristic tool for exploring the influence of physical parameters such as surface potential and fluid velocity on colloid transport. This model can be extended to heterogeneous systems characterized by both primary and secondary minimum deposition by simply increasing the fraction of colloids that attach irreversibly.« less

  17. Validation metrics for turbulent plasma transport

    DOE PAGES

    Holland, C.

    2016-06-22

    Developing accurate models of plasma dynamics is essential for confident predictive modeling of current and future fusion devices. In modern computer science and engineering, formal verification and validation processes are used to assess model accuracy and establish confidence in the predictive capabilities of a given model. This paper provides an overview of the key guiding principles and best practices for the development of validation metrics, illustrated using examples from investigations of turbulent transport in magnetically confined plasmas. Particular emphasis is given to the importance of uncertainty quantification and its inclusion within the metrics, and the need for utilizing synthetic diagnosticsmore » to enable quantitatively meaningful comparisons between simulation and experiment. As a starting point, the structure of commonly used global transport model metrics and their limitations is reviewed. An alternate approach is then presented, which focuses upon comparisons of predicted local fluxes, fluctuations, and equilibrium gradients against observation. Furthermore, the utility of metrics based upon these comparisons is demonstrated by applying them to gyrokinetic predictions of turbulent transport in a variety of discharges performed on the DIII-D tokamak, as part of a multi-year transport model validation activity.« less

  18. Validation metrics for turbulent plasma transport

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Holland, C.

    Developing accurate models of plasma dynamics is essential for confident predictive modeling of current and future fusion devices. In modern computer science and engineering, formal verification and validation processes are used to assess model accuracy and establish confidence in the predictive capabilities of a given model. This paper provides an overview of the key guiding principles and best practices for the development of validation metrics, illustrated using examples from investigations of turbulent transport in magnetically confined plasmas. Particular emphasis is given to the importance of uncertainty quantification and its inclusion within the metrics, and the need for utilizing synthetic diagnosticsmore » to enable quantitatively meaningful comparisons between simulation and experiment. As a starting point, the structure of commonly used global transport model metrics and their limitations is reviewed. An alternate approach is then presented, which focuses upon comparisons of predicted local fluxes, fluctuations, and equilibrium gradients against observation. Furthermore, the utility of metrics based upon these comparisons is demonstrated by applying them to gyrokinetic predictions of turbulent transport in a variety of discharges performed on the DIII-D tokamak, as part of a multi-year transport model validation activity.« less

  19. Self-consistent core-pedestal transport simulations with neural network accelerated models

    DOE PAGES

    Meneghini, Orso; Smith, Sterling P.; Snyder, Philip B.; ...

    2017-07-12

    Fusion whole device modeling simulations require comprehensive models that are simultaneously physically accurate, fast, robust, and predictive. In this paper we describe the development of two neural-network (NN) based models as a means to perform a snon-linear multivariate regression of theory-based models for the core turbulent transport fluxes, and the pedestal structure. Specifically, we find that a NN-based approach can be used to consistently reproduce the results of the TGLF and EPED1 theory-based models over a broad range of plasma regimes, and with a computational speedup of several orders of magnitudes. These models are then integrated into a predictive workflowmore » that allows prediction with self-consistent core-pedestal coupling of the kinetic profiles within the last closed flux surface of the plasma. Finally, the NN paradigm is capable of breaking the speed-accuracy trade-off that is expected of traditional numerical physics models, and can provide the missing link towards self-consistent coupled core-pedestal whole device modeling simulations that are physically accurate and yet take only seconds to run.« less

  20. Self-consistent core-pedestal transport simulations with neural network accelerated models

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Meneghini, Orso; Smith, Sterling P.; Snyder, Philip B.

    Fusion whole device modeling simulations require comprehensive models that are simultaneously physically accurate, fast, robust, and predictive. In this paper we describe the development of two neural-network (NN) based models as a means to perform a snon-linear multivariate regression of theory-based models for the core turbulent transport fluxes, and the pedestal structure. Specifically, we find that a NN-based approach can be used to consistently reproduce the results of the TGLF and EPED1 theory-based models over a broad range of plasma regimes, and with a computational speedup of several orders of magnitudes. These models are then integrated into a predictive workflowmore » that allows prediction with self-consistent core-pedestal coupling of the kinetic profiles within the last closed flux surface of the plasma. Finally, the NN paradigm is capable of breaking the speed-accuracy trade-off that is expected of traditional numerical physics models, and can provide the missing link towards self-consistent coupled core-pedestal whole device modeling simulations that are physically accurate and yet take only seconds to run.« less

  1. Self-consistent core-pedestal transport simulations with neural network accelerated models

    NASA Astrophysics Data System (ADS)

    Meneghini, O.; Smith, S. P.; Snyder, P. B.; Staebler, G. M.; Candy, J.; Belli, E.; Lao, L.; Kostuk, M.; Luce, T.; Luda, T.; Park, J. M.; Poli, F.

    2017-08-01

    Fusion whole device modeling simulations require comprehensive models that are simultaneously physically accurate, fast, robust, and predictive. In this paper we describe the development of two neural-network (NN) based models as a means to perform a snon-linear multivariate regression of theory-based models for the core turbulent transport fluxes, and the pedestal structure. Specifically, we find that a NN-based approach can be used to consistently reproduce the results of the TGLF and EPED1 theory-based models over a broad range of plasma regimes, and with a computational speedup of several orders of magnitudes. These models are then integrated into a predictive workflow that allows prediction with self-consistent core-pedestal coupling of the kinetic profiles within the last closed flux surface of the plasma. The NN paradigm is capable of breaking the speed-accuracy trade-off that is expected of traditional numerical physics models, and can provide the missing link towards self-consistent coupled core-pedestal whole device modeling simulations that are physically accurate and yet take only seconds to run.

  2. Model-based Confirmation of Alternative Substrates of Mitochondrial Electron Transport Chain

    PubMed Central

    Kleessen, Sabrina; Araújo, Wagner L.; Fernie, Alisdair R.; Nikoloski, Zoran

    2012-01-01

    Discrimination of metabolic models based on high throughput metabolomics data, reflecting various internal and external perturbations, is essential for identifying the components that contribute to the emerging behavior of metabolic processes. Here, we investigate 12 different models of the mitochondrial electron transport chain (ETC) in Arabidopsis thaliana during dark-induced senescence in order to elucidate the alternative substrates to this metabolic pathway. Our findings demonstrate that the coupling of the proposed computational approach, based on dynamic flux balance analysis, with time-resolved metabolomics data results in model-based confirmations of the hypotheses that, during dark-induced senescence in Arabidopsis, (i) under conditions where the main substrate for the ETC are not fully available, isovaleryl-CoA dehydrogenase and 2-hydroxyglutarate dehydrogenase are able to donate electrons to the ETC, (ii) phytanoyl-CoA does not act even as an indirect substrate of the electron transfer flavoprotein/electron-transfer flavoprotein:ubiquinone oxidoreductase complex, and (iii) the mitochondrial γ-aminobutyric acid transporter has functional significance in maintaining mitochondrial metabolism. Our study provides a basic framework for future in silico studies of alternative pathways in mitochondrial metabolism under extended darkness whereby the role of its components can be computationally discriminated based on available molecular profile data. PMID:22334689

  3. Conjunction of radial basis function interpolator and artificial intelligence models for time-space modeling of contaminant transport in porous media

    NASA Astrophysics Data System (ADS)

    Nourani, Vahid; Mousavi, Shahram; Dabrowska, Dominika; Sadikoglu, Fahreddin

    2017-05-01

    As an innovation, both black box and physical-based models were incorporated into simulating groundwater flow and contaminant transport. Time series of groundwater level (GL) and chloride concentration (CC) observed at different piezometers of study plain were firstly de-noised by the wavelet-based de-noising approach. The effect of de-noised data on the performance of artificial neural network (ANN) and adaptive neuro-fuzzy inference system (ANFIS) was evaluated. Wavelet transform coherence was employed for spatial clustering of piezometers. Then for each cluster, ANN and ANFIS models were trained to predict GL and CC values. Finally, considering the predicted water heads of piezometers as interior conditions, the radial basis function as a meshless method which solves partial differential equations of GFCT, was used to estimate GL and CC values at any point within the plain where there is not any piezometer. Results indicated that efficiency of ANFIS based spatiotemporal model was more than ANN based model up to 13%.

  4. Accessibility-based evaluation of transportation and land-use planning : from laboratory to practice : USDOT Region V Regional University Transportation Center final report.

    DOT National Transportation Integrated Search

    2016-12-16

    The concept of accessibility has made inroads into planning practice, largely at the system level. That is, accessibility is measured or modeled for current or future regional transportation and land-use scenarios for evaluation or broad policy guida...

  5. EFFECTS OF PORE WATER VELOCITY ON THE TRANSPORT OF ARSENATE. (R825403)

    EPA Science Inventory

    The potential for AsO4 to exhibit sorption-related
    nonequilibrium

    during transport has not been previously determined.
    Consequently, the objectives of this study were to
    determine
    the applicability of transport models based on the advec
    tion-di...

  6. Comparative analysis of zonal systems for macro-level crash modeling.

    PubMed

    Cai, Qing; Abdel-Aty, Mohamed; Lee, Jaeyoung; Eluru, Naveen

    2017-06-01

    Macro-level traffic safety analysis has been undertaken at different spatial configurations. However, clear guidelines for the appropriate zonal system selection for safety analysis are unavailable. In this study, a comparative analysis was conducted to determine the optimal zonal system for macroscopic crash modeling considering census tracts (CTs), state-wide traffic analysis zones (STAZs), and a newly developed traffic-related zone system labeled traffic analysis districts (TADs). Poisson lognormal models for three crash types (i.e., total, severe, and non-motorized mode crashes) are developed based on the three zonal systems without and with consideration of spatial autocorrelation. The study proposes a method to compare the modeling performance of the three types of geographic units at different spatial configurations through a grid based framework. Specifically, the study region is partitioned to grids of various sizes and the model prediction accuracy of the various macro models is considered within these grids of various sizes. These model comparison results for all crash types indicated that the models based on TADs consistently offer a better performance compared to the others. Besides, the models considering spatial autocorrelation outperform the ones that do not consider it. Based on the modeling results and motivation for developing the different zonal systems, it is recommended using CTs for socio-demographic data collection, employing TAZs for transportation demand forecasting, and adopting TADs for transportation safety planning. The findings from this study can help practitioners select appropriate zonal systems for traffic crash modeling, which leads to develop more efficient policies to enhance transportation safety. Copyright © 2017 Elsevier Ltd and National Safety Council. All rights reserved.

  7. Modeling of patient's blood pressure variation during ambulance transportation

    NASA Astrophysics Data System (ADS)

    Sakatani, Kenji; Ono, Takahiko; Kobayasi, Yasuhide; Hikita, Shinichi; Saito, Mitsuyuki

    2007-12-01

    In an emergency transportation by ambulance, a patient is transported in a supine position. In this position, a patient's blood pressure (BP) variation depending on an inertial force which occurs when an ambulance accelerates or decelerates. This BP variation causes a critical damage for a patent with brain disorder. In order to keep a patient stable during transportation, it is required to maintain small BP variation. To analyze the BP variation during transportation, a model of the BP variation has so far been made. But, it can estimate the BP variation only in braking. The purpose of this paper is to make a dynamical model of the BP variation which can simulate it in both braking and accelerating. First, to obtain the data to construct the model, we used a tilting bed to measure a head-to-foot acceleration and BP of fingertip. Based on this data, we build a mathematical model whose input is the head-to-foot acceleration and output is the Mean BP variation. It is a switched model which switches two models depending on the jerk. We add baroreceptor reflex to the model as a offset value.

  8. On the transport of emulsions in porous media

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cortis, Andrea; Ghezzehei, Teamrat A.

    2007-06-27

    Emulsions appear in many subsurface applications includingbioremediation, surfactant-enhanced remediation, and enhancedoil-recovery. Modeling emulsion transport in porous media is particularlychallenging because the rheological and physical properties of emulsionsare different from averages of the components. Current modelingapproaches are based on filtration theories, which are not suited toadequately address the pore-scale permeability fluctuations and reductionof absolute permeability that are often encountered during emulsiontransport. In this communication, we introduce a continuous time randomwalk based alternative approach that captures these unique features ofemulsion transport. Calculations based on the proposed approach resultedin excellent match with experimental observations of emulsionbreakthrough from the literature. Specifically, the new approachmore » explainsthe slow late-time tailing behavior that could not be fitted using thestandard approach. The theory presented in this paper also provides animportant stepping stone toward a generalizedself-consistent modeling ofmultiphase flow.« less

  9. Computation of Alfvèn eigenmode stability and saturation through a reduced fast ion transport model in the TRANSP tokamak transport code

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Podestà, M.; Gorelenkova, M.; Gorelenkov, N. N.

    Alfvénic instabilities (AEs) are well known as a potential cause of enhanced fast ion transport in fusion devices. Given a specific plasma scenario, quantitative predictions of (i) expected unstable AE spectrum and (ii) resulting fast ion transport are required to prevent or mitigate the AE-induced degradation in fusion performance. Reduced models are becoming an attractive tool to analyze existing scenarios as well as for scenario prediction in time-dependent simulations. Here, in this work, a neutral beam heated NSTX discharge is used as reference to illustrate the potential of a reduced fast ion transport model, known as kick model, that hasmore » been recently implemented for interpretive and predictive analysis within the framework of the time-dependent tokamak transport code TRANSP. Predictive capabilities for AE stability and saturation amplitude are first assessed, based on given thermal plasma profiles only. Predictions are then compared to experimental results, and the interpretive capabilities of the model further discussed. Overall, the reduced model captures the main properties of the instabilities and associated effects on the fast ion population. Finally, additional information from the actual experiment enables further tuning of the model's parameters to achieve a close match with measurements.« less

  10. Computation of Alfvèn eigenmode stability and saturation through a reduced fast ion transport model in the TRANSP tokamak transport code

    DOE PAGES

    Podestà, M.; Gorelenkova, M.; Gorelenkov, N. N.; ...

    2017-07-20

    Alfvénic instabilities (AEs) are well known as a potential cause of enhanced fast ion transport in fusion devices. Given a specific plasma scenario, quantitative predictions of (i) expected unstable AE spectrum and (ii) resulting fast ion transport are required to prevent or mitigate the AE-induced degradation in fusion performance. Reduced models are becoming an attractive tool to analyze existing scenarios as well as for scenario prediction in time-dependent simulations. Here, in this work, a neutral beam heated NSTX discharge is used as reference to illustrate the potential of a reduced fast ion transport model, known as kick model, that hasmore » been recently implemented for interpretive and predictive analysis within the framework of the time-dependent tokamak transport code TRANSP. Predictive capabilities for AE stability and saturation amplitude are first assessed, based on given thermal plasma profiles only. Predictions are then compared to experimental results, and the interpretive capabilities of the model further discussed. Overall, the reduced model captures the main properties of the instabilities and associated effects on the fast ion population. Finally, additional information from the actual experiment enables further tuning of the model's parameters to achieve a close match with measurements.« less

  11. Trouble with diffusion: Reassessing hillslope erosion laws with a particle-based model

    NASA Astrophysics Data System (ADS)

    Tucker, Gregory E.; Bradley, D. Nathan

    2010-03-01

    Many geomorphic systems involve a broad distribution of grain motion length scales, ranging from a few particle diameters to the length of an entire hillslope or stream. Studies of analogous physical systems have revealed that such broad motion distributions can have a significant impact on macroscale dynamics and can violate the assumptions behind standard, local gradient flux laws. Here, a simple particle-based model of sediment transport on a hillslope is used to study the relationship between grain motion statistics and macroscopic landform evolution. Surface grains are dislodged by random disturbance events with probabilities and distances that depend on local microtopography. Despite its simplicity, the particle model reproduces a surprisingly broad range of slope forms, including asymmetric degrading scarps and cinder cone profiles. At low slope angles the dynamics are diffusion like, with a short-range, thin-tailed hop length distribution, a parabolic, convex upward equilibrium slope form, and a linear relationship between transport rate and gradient. As slope angle steepens, the characteristic grain motion length scale begins to approach the length of the slope, leading to planar equilibrium forms that show a strongly nonlinear correlation between transport rate and gradient. These high-probability, long-distance motions violate the locality assumption embedded in many common gradient-based geomorphic transport laws. The example of a degrading scarp illustrates the potential for grain motion dynamics to vary in space and time as topography evolves. This characteristic renders models based on independent, stationary statistics inapplicable. An accompanying analytical framework based on treating grain motion as a survival process is briefly outlined.

  12. Monte Carlo simulation based on dynamic disorder model in organic semiconductors: From coherent to incoherent transport

    NASA Astrophysics Data System (ADS)

    Yao, Yao; Si, Wei; Hou, Xiaoyuan; Wu, Chang-Qin

    2012-06-01

    The dynamic disorder model for charge carrier transport in organic semiconductors has been extensively studied in recent years. Although it is successful on determining the value of bandlike mobility in the organic crystalline materials, the incoherent hopping, the typical transport characteristic in amorphous molecular semiconductors, cannot be described. In this work, the decoherence process is taken into account via a phenomenological parameter, say, decoherence time, and the projective and Monte Carlo method are applied for this model to determine the waiting time and thus the diffusion coefficient. It is obtained that the type of transport is changed from coherent to incoherent with a sufficiently short decoherence time, which indicates the essential role of decoherence time in determining the type of transport in organics. We have also discussed the spatial extent of carriers for different decoherence time, and the transition from delocalization (carrier resides in about 10 molecules) to localization is observed. Based on the experimental results of spatial extent, we estimate that the decoherence time in pentacene has the order of 1 ps. Furthermore, the dependence of diffusion coefficient on decoherence time is also investigated, and corresponding experiments are discussed.

  13. Monte Carlo simulation based on dynamic disorder model in organic semiconductors: from coherent to incoherent transport.

    PubMed

    Yao, Yao; Si, Wei; Hou, Xiaoyuan; Wu, Chang-Qin

    2012-06-21

    The dynamic disorder model for charge carrier transport in organic semiconductors has been extensively studied in recent years. Although it is successful on determining the value of bandlike mobility in the organic crystalline materials, the incoherent hopping, the typical transport characteristic in amorphous molecular semiconductors, cannot be described. In this work, the decoherence process is taken into account via a phenomenological parameter, say, decoherence time, and the projective and Monte Carlo method are applied for this model to determine the waiting time and thus the diffusion coefficient. It is obtained that the type of transport is changed from coherent to incoherent with a sufficiently short decoherence time, which indicates the essential role of decoherence time in determining the type of transport in organics. We have also discussed the spatial extent of carriers for different decoherence time, and the transition from delocalization (carrier resides in about 10 molecules) to localization is observed. Based on the experimental results of spatial extent, we estimate that the decoherence time in pentacene has the order of 1 ps. Furthermore, the dependence of diffusion coefficient on decoherence time is also investigated, and corresponding experiments are discussed.

  14. Predicting paclitaxel-induced neutropenia using the DMET platform.

    PubMed

    Nieuweboer, Annemieke J M; Smid, Marcel; de Graan, Anne-Joy M; Elbouazzaoui, Samira; de Bruijn, Peter; Martens, John W; Mathijssen, Ron H J; van Schaik, Ron H N

    2015-01-01

    The use of paclitaxel in cancer treatment is limited by paclitaxel-induced neutropenia. We investigated the ability of genetic variation in drug-metabolizing enzymes and transporters to predict hematological toxicity. Using a discovery and validation approach, we identified a pharmacogenetic predictive model for neutropenia. For this, a drug-metabolizing enzymes and transporters plus DNA chip was used, which contains 1936 SNPs in 225 metabolic enzyme and drug-transporter genes. Our 10-SNP model in 279 paclitaxel-dosed patients reached 43% sensitivity in the validation cohort. Analysis in 3-weekly treated patients only resulted in improved sensitivity of 79%, with a specificity of 33%. None of our models reached statistical significance. Our drug-metabolizing enzymes and transporters-based SNP-models are currently of limited value for predicting paclitaxel-induced neutropenia in clinical practice. Original submitted 9 March 2015; Revision submitted 20 May 2015.

  15. Elucidating the effects of river fluctuation on microbial removal during riverbank filtration

    NASA Astrophysics Data System (ADS)

    Derx, J.; Sommer, R.; Farnleitner, A. H.; Blaschke, A. P.

    2010-12-01

    The transfer of microbial pathogens from surface or waste water can have adverse effects on groundwater quality at riverbank filtration sites. Previous studies on groundwater protection in sandy unconfined aquifers with the focus on virus transport and health based water quality targets, such as done in the Netherlands, revealed larger protection zones than zones limited by 60 days of groundwater travel time. The 60 days of travel time are the design criterion in Austria for drinking water protection. However, in gravel aquifers, microbial transport processes differ significantly to those in sandy aquifers. Preferential flow and aquifer heterogeneities dominate microbial transport in sandy gravels and gravel aquifers. Microbial mass transfer and dual domain transport models were used previously to reproduce these effects. Furthermore, microbial transport has mainly been studied in the field during steady state groundwater flow situations. Hence, previous microbial transport models have seldom accounted for transient groundwater flow conditions. These dynamic flow conditions could have immense effects on the fate of microorganisms because of the variations in flow velocities, which are dominating microbial transport. In the current study, we used a variably saturated, three-dimensional groundwater flow and transport model coupled to a hydrodynamic surface water model at a riverbank filtration site. With this model, we estimated the required groundwater protection zones based on 8 log10 viral reductions and compared them to the 60 days travel time zones. The 8 log10 removal steps were based on a preliminary microbial risk assessment scheme for enteroviruses at the riverbank infiltration sites. The groundwater protection zones were estimated for a set of well withdrawal rates, river fluctuation ranges and frequencies, river gradients and bank slopes. The river flow dynamics and the morphology of the riverbed and banks are potentially important factors affecting microbial transport processes during riverbank filtration, which were previously not accounted for. Acknowledgments We would like to thank the Austrian Science Funds FWF for financial support as part of the Doctoral program DK-plus W1219-N22 on Water Resource Systems and the Vienna Waterworks (MA31) as part of the GWRS-Vienna project. We would also like to thank the MA39 (IFUM) for helping at the preliminary risk assessment.

  16. Impacts of Suspended Sediment and Estuarine - Shelf Exchange Pathways on Shelf Ecosystem Dynamics in the Northern Gulf of Mexico

    NASA Astrophysics Data System (ADS)

    Wiggert, J. D.; Pan, C.; Dinniman, M. S.; Lau, Y.; Fitzpatrick, P. J.; O'Brien, S. J.; Bouchard, C.; Quas, L. M.; Miles, T. N.; Cambazoglu, M. K.; Dykstra, S. L.; Dzwonkowski, B.; Jacobs, G. A.; Church, I.; Hofmann, E. E.

    2017-12-01

    A circulation model based on the Coupled-Ocean-Atmosphere-Wave-Sediment Transport (COAWST) Modeling System, with coupled biogeochemical and sediment transport modules, has been implemented for Mississippi Sound and the adjacent continental shelf region. The model has 400-m horizontal resolution, 24 vertical layers, and includes wetting/drying capability to resolve shallow inshore regions. The circulation model was spun-up using oceanographic initial and lateral boundary conditions provided by a 1-km resolution regional implementation of the Navy Coastal Ocean Model (NCOM) in the Gulf of Mexico. The biogeochemical module includes multiple size classes of phytoplankton, zooplankton and detritus, a fish larvae compartment, and explicitly tracks dissolved oxygen with benthic cycling interaction. The sediment transport model is implemented based on benthic mapping data that provides bottom sediment type distributions and spatio-temporal validation. A regionally specific atmospheric forcing product that provides improved spatial and temporal resolution, including diurnal sea breeze impacts, has been developed and applied. Model experiments focus on periods when comprehensive ship-based sampling was deployed by the CONCORDE (Consortium for Coastal River-Dominated Ecosystems) research program, which was established to investigate the complex fine-scale biological, chemical and physical interactions in a marine system controlled by pulsed-river plume dynamics. Biophysical interactions and biogeochemical variability associated with estuarine - shelf exchanges between nearshore lagoonal estuarine waters and the continental shelf revealed by the model provide new insight into how seasonal variation of hydrological forcing conditions influence ecological and biogeochemical processes in the highly productive Northern Gulf region. Application of the COAWST-based model system with and without inclusion of the sediment transport module demonstrates how suspended sediment in the nearshore waters influences inner shelf ecosystem function through impacts exerted on the in situ light environment and particle aggregation-mediated organic matter fluxes.

  17. Maximum likelihood Bayesian model averaging and its predictive analysis for groundwater reactive transport models

    USGS Publications Warehouse

    Curtis, Gary P.; Lu, Dan; Ye, Ming

    2015-01-01

    While Bayesian model averaging (BMA) has been widely used in groundwater modeling, it is infrequently applied to groundwater reactive transport modeling because of multiple sources of uncertainty in the coupled hydrogeochemical processes and because of the long execution time of each model run. To resolve these problems, this study analyzed different levels of uncertainty in a hierarchical way, and used the maximum likelihood version of BMA, i.e., MLBMA, to improve the computational efficiency. This study demonstrates the applicability of MLBMA to groundwater reactive transport modeling in a synthetic case in which twenty-seven reactive transport models were designed to predict the reactive transport of hexavalent uranium (U(VI)) based on observations at a former uranium mill site near Naturita, CO. These reactive transport models contain three uncertain model components, i.e., parameterization of hydraulic conductivity, configuration of model boundary, and surface complexation reactions that simulate U(VI) adsorption. These uncertain model components were aggregated into the alternative models by integrating a hierarchical structure into MLBMA. The modeling results of the individual models and MLBMA were analyzed to investigate their predictive performance. The predictive logscore results show that MLBMA generally outperforms the best model, suggesting that using MLBMA is a sound strategy to achieve more robust model predictions relative to a single model. MLBMA works best when the alternative models are structurally distinct and have diverse model predictions. When correlation in model structure exists, two strategies were used to improve predictive performance by retaining structurally distinct models or assigning smaller prior model probabilities to correlated models. Since the synthetic models were designed using data from the Naturita site, the results of this study are expected to provide guidance for real-world modeling. Limitations of applying MLBMA to the synthetic study and future real-world modeling are discussed.

  18. Users guide: The LaRC human-operator-simulator-based pilot model

    NASA Technical Reports Server (NTRS)

    Bogart, E. H.; Waller, M. C.

    1985-01-01

    A Human Operator Simulator (HOS) based pilot model has been developed for use at NASA LaRC for analysis of flight management problems. The model is currently configured to simulate piloted flight of an advanced transport airplane. The generic HOS operator and machine model was originally developed under U.S. Navy sponsorship by Analytics, Inc. and through a contract with LaRC was configured to represent a pilot flying a transport airplane. A version of the HOS program runs in batch mode on LaRC's (60-bit-word) central computer system. This document provides a guide for using the program and describes in some detail the assortment of files used during its operation.

  19. Comparison of ACCENT 2000 Shuttle Plume Data with SIMPLE Model Predictions

    NASA Astrophysics Data System (ADS)

    Swaminathan, P. K.; Taylor, J. C.; Ross, M. N.; Zittel, P. F.; Lloyd, S. A.

    2001-12-01

    The JHU/APL Stratospheric IMpact of PLume Effluents (SIMPLE)model was employed to analyze the trace species in situ composition data collected during the ACCENT 2000 intercepts of the space shuttle Space Transportation Launch System (STS) rocket plume as a function of time and radial location within the cold plume. The SIMPLE model is initialized using predictions for species depositions calculated using an afterburning model based on standard TDK/SPP nozzle and SPF plume flowfield codes with an expanded chemical kinetic scheme. The time dependent ambient stratospheric chemistry is fully coupled to the plume species evolution whose transport is based on empirically derived diffusion. Model/data comparisons are encouraging through capturing observed local ozone recovery times as well as overall morphology of chlorine chemistry.

  20. Sensitivity analyses of a colloid-facilitated contaminant transport model for unsaturated heterogeneous soil conditions.

    NASA Astrophysics Data System (ADS)

    Périard, Yann; José Gumiere, Silvio; Rousseau, Alain N.; Caron, Jean

    2013-04-01

    Certain contaminants may travel faster through soils when they are sorbed to subsurface colloidal particles. Indeed, subsurface colloids may act as carriers of some contaminants accelerating their translocation through the soil into the water table. This phenomenon is known as colloid-facilitated contaminant transport. It plays a significant role in contaminant transport in soils and has been recognized as a source of groundwater contamination. From a mechanistic point of view, the attachment/detachment of the colloidal particles from the soil matrix or from the air-water interface and the straining process may modify the hydraulic properties of the porous media. Šimůnek et al. (2006) developed a model that can simulate the colloid-facilitated contaminant transport in variably saturated porous media. The model is based on the solution of a modified advection-dispersion equation that accounts for several processes, namely: straining, exclusion and attachement/detachement kinetics of colloids through the soil matrix. The solutions of these governing, partial differential equations are obtained using a standard Galerkin-type, linear finite element scheme, implemented in the HYDRUS-2D/3D software (Šimůnek et al., 2012). Modeling colloid transport through the soil and the interaction of colloids with the soil matrix and other contaminants is complex and requires the characterization of many model parameters. In practice, it is very difficult to assess actual transport parameter values, so they are often calibrated. However, before calibration, one needs to know which parameters have the greatest impact on output variables. This kind of information can be obtained through a sensitivity analysis of the model. The main objective of this work is to perform local and global sensitivity analyses of the colloid-facilitated contaminant transport module of HYDRUS. Sensitivity analysis was performed in two steps: (i) we applied a screening method based on Morris' elementary effects and the one-at-a-time approach (O.A.T); and (ii), we applied Sobol's global sensitivity analysis method which is based on variance decompositions. Results illustrate that ψm (maximum sorption rate of mobile colloids), kdmc (solute desorption rate from mobile colloids), and Ks (saturated hydraulic conductivity) are the most sensitive parameters with respect to the contaminant travel time. The analyses indicate that this new module is able to simulate the colloid-facilitated contaminant transport. However, validations under laboratory conditions are needed to confirm the occurrence of the colloid transport phenomenon and to understand model prediction under non-saturated soil conditions. Future work will involve monitoring of the colloidal transport phenomenon through soil column experiments. The anticipated outcome will provide valuable information on the understanding of the dominant mechanisms responsible for colloidal transports, colloid-facilitated contaminant transport and, also, the colloid detachment/deposition processes impacts on soil hydraulic properties. References: Šimůnek, J., C. He, L. Pang, & S. A. Bradford, Colloid-Facilitated Solute Transport in Variably Saturated Porous Media: Numerical Model and Experimental Verification, Vadose Zone Journal, 2006, 5, 1035-1047 Šimůnek, J., M. Šejna, & M. Th. van Genuchten, The C-Ride Module for HYDRUS (2D/3D) Simulating Two-Dimensional Colloid-Facilitated Solute Transport in Variably-Saturated Porous Media, Version 1.0, PC Progress, Prague, Czech Republic, 45 pp., 2012.

  1. Origin of traps and charge transport mechanism in hafnia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Islamov, D. R., E-mail: damir@isp.nsc.ru; Gritsenko, V. A., E-mail: grits@isp.nsc.ru; Novosibirsk State University, Novosibirsk 630090

    2014-12-01

    In this study, we demonstrated experimentally and theoretically that oxygen vacancies are responsible for the charge transport in HfO{sub 2}. Basing on the model of phonon-assisted tunneling between traps, and assuming that the electron traps are oxygen vacancies, good quantitative agreement between the experimental and theoretical data of current-voltage characteristics was achieved. The thermal trap energy of 1.25 eV in HfO{sub 2} was determined based on the charge transport experiments.

  2. A simple reactive-transport model of calcite precipitation in soils and other porous media

    NASA Astrophysics Data System (ADS)

    Kirk, G. J. D.; Versteegen, A.; Ritz, K.; Milodowski, A. E.

    2015-09-01

    Calcite formation in soils and other porous media generally occurs around a localised source of reactants, such as a plant root or soil macro-pore, and the rate depends on the transport of reactants to and from the precipitation zone as well as the kinetics of the precipitation reaction itself. However most studies are made in well mixed systems, in which such transport limitations are largely removed. We developed a mathematical model of calcite precipitation near a source of base in soil, allowing for transport limitations and precipitation kinetics. We tested the model against experimentally-determined rates of calcite precipitation and reactant concentration-distance profiles in columns of soil in contact with a layer of HCO3--saturated exchange resin. The model parameter values were determined independently. The agreement between observed and predicted results was satisfactory given experimental limitations, indicating that the model correctly describes the important processes. A sensitivity analysis showed that all model parameters are important, indicating a simpler treatment would be inadequate. The sensitivity analysis showed that the amount of calcite precipitated and the spread of the precipitation zone were sensitive to parameters controlling rates of reactant transport (soil moisture content, salt content, pH, pH buffer power and CO2 pressure), as well as to the precipitation rate constant. We illustrate practical applications of the model with two examples: pH changes and CaCO3 precipitation in the soil around a plant root, and around a soil macro-pore containing a source of base such as urea.

  3. Modeling of turbulent transport as a volume process

    NASA Technical Reports Server (NTRS)

    Jennings, Mark J.; Morel, Thomas

    1987-01-01

    An alternative type of modeling was proposed for the turbulent transport terms in Reynolds-averaged equations. One particular implementation of the model was considered, based on the two-point velocity correlations. The model was found to reproduce the trends but not the magnitude of the nonisotropic behavior of the turbulent transport. Some interesting insights were developed concerning the shape of the contracted two-point correlation volume. This volume is strongly deformed by mean shear from the spherical shape found in unstrained flows. Of particular interest is the finding that the shape is sharply waisted, indicating preferential lines of communication, which should have a direct effect on turbulent transfer and on other processes.

  4. Energy-confinement scaling for high-beta plasmas in the W7-AS stellarator.

    PubMed

    Preuss, R; Dinklage, A; Weller, A

    2007-12-14

    High-beta energy-confinement data are subjected to comparisons of scaling invariant, first-principles physical models. The models differ in the inclusion of basic equations indicating the nature of transport. The result for high-beta data of the W7-AS stellarator is that global transport is described best with a collisional high-beta model, which is different from previous outcomes for low-beta data. Model predictive calculations indicate the validation of energy-confinement prediction with respect to plasma beta and collisionality nu*. The finding of different transport behaviors in distinct beta regimes is important for the development of fusion energy based on magnetic confinement and for the assessment of different confinement concepts.

  5. Predicting Transport of 3,5,6-Trichloro-2-Pyridinol Into Saliva Using a Combination Experimental and Computational Approach

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Smith, Jordan Ned; Carver, Zana A.; Weber, Thomas J.

    A combination experimental and computational approach was developed to predict chemical transport into saliva. A serous-acinar chemical transport assay was established to measure chemical transport with non-physiological (standard cell culture medium) and physiological (using surrogate plasma and saliva medium) conditions using 3,5,6-trichloro-2-pyridinol (TCPy) a metabolite of the pesticide chlorpyrifos. High levels of TCPy protein binding was observed in cell culture medium and rat plasma resulting in different TCPy transport behaviors in the two experimental conditions. In the non-physiological transport experiment, TCPy reached equilibrium at equivalent concentrations in apical and basolateral chambers. At higher TCPy doses, increased unbound TCPy was observed,more » and TCPy concentrations in apical and basolateral chambers reached equilibrium faster than lower doses, suggesting only unbound TCPy is able to cross the cellular monolayer. In the physiological experiment, TCPy transport was slower than non-physiological conditions, and equilibrium was achieved at different concentrations in apical and basolateral chambers at a comparable ratio (0.034) to what was previously measured in rats dosed with TCPy (saliva:blood ratio: 0.049). A cellular transport computational model was developed based on TCPy protein binding kinetics and accurately simulated all transport experiments using different permeability coefficients for the two experimental conditions (1.4 vs 0.4 cm/hr for non-physiological and physiological experiments, respectively). The computational model was integrated into a physiologically based pharmacokinetic (PBPK) model and accurately predicted TCPy concentrations in saliva of rats dosed with TCPy. Overall, this study demonstrates an approach to predict chemical transport in saliva potentially increasing the utility of salivary biomonitoring in the future.« less

  6. Integrating Geochemical Reactions with a Particle-Tracking Approach to Simulate Nitrogen Transport and Transformation in Aquifers

    NASA Astrophysics Data System (ADS)

    Cui, Z.; Welty, C.; Maxwell, R. M.

    2011-12-01

    Lagrangian, particle-tracking models are commonly used to simulate solute advection and dispersion in aquifers. They are computationally efficient and suffer from much less numerical dispersion than grid-based techniques, especially in heterogeneous and advectively-dominated systems. Although particle-tracking models are capable of simulating geochemical reactions, these reactions are often simplified to first-order decay and/or linear, first-order kinetics. Nitrogen transport and transformation in aquifers involves both biodegradation and higher-order geochemical reactions. In order to take advantage of the particle-tracking approach, we have enhanced an existing particle-tracking code SLIM-FAST, to simulate nitrogen transport and transformation in aquifers. The approach we are taking is a hybrid one: the reactive multispecies transport process is operator split into two steps: (1) the physical movement of the particles including the attachment/detachment to solid surfaces, which is modeled by a Lagrangian random-walk algorithm; and (2) multispecies reactions including biodegradation are modeled by coupling multiple Monod equations with other geochemical reactions. The coupled reaction system is solved by an ordinary differential equation solver. In order to solve the coupled system of equations, after step 1, the particles are converted to grid-based concentrations based on the mass and position of the particles, and after step 2 the newly calculated concentration values are mapped back to particles. The enhanced particle-tracking code is capable of simulating subsurface nitrogen transport and transformation in a three-dimensional domain with variably saturated conditions. Potential application of the enhanced code is to simulate subsurface nitrogen loading to the Chesapeake Bay and its tributaries. Implementation details, verification results of the enhanced code with one-dimensional analytical solutions and other existing numerical models will be presented in addition to a discussion of implementation challenges.

  7. Retardation of mobile radionuclides in granitic rock fractures by matrix diffusion

    NASA Astrophysics Data System (ADS)

    Hölttä, P.; Poteri, A.; Siitari-Kauppi, M.; Huittinen, N.

    Transport of iodide and sodium has been studied by means of block fracture and core column experiments to evaluate the simplified radionuclide transport concept. The objectives were to examine the processes causing retention in solute transport, especially matrix diffusion, and to estimate their importance during transport in different scales and flow conditions. Block experiments were performed using a Kuru Grey granite block having a horizontally planar natural fracture. Core columns were constructed from cores drilled orthogonal to the fracture of the granite block. Several tracer tests were performed using uranine, 131I and 22Na as tracers at water flow rates 0.7-50 μL min -1. Transport of tracers was modelled by applying the advection-dispersion model based on the generalized Taylor dispersion added with matrix diffusion. Scoping calculations were combined with experiments to test the model concepts. Two different experimental configurations could be modelled applying consistent transport processes and parameters. The processes, advection-dispersion and matrix diffusion, were conceptualized with sufficient accuracy to replicate the experimental results. The effects of matrix diffusion were demonstrated on the slightly sorbing sodium and mobile iodine breakthrough curves.

  8. Verification of Modelica-Based Models with Analytical Solutions for Tritium Diffusion

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rader, Jordan D.; Greenwood, Michael Scott; Humrickhouse, Paul W.

    Here, tritium transport in metal and molten salt fluids combined with diffusion through high-temperature structural materials is an important phenomenon in both magnetic confinement fusion (MCF) and molten salt reactor (MSR) applications. For MCF, tritium is desirable to capture for fusion fuel. For MSRs, uncaptured tritium potentially can be released to the environment. In either application, quantifying the time- and space-dependent tritium concentration in the working fluid(s) and structural components is necessary.Whereas capability exists specifically for calculating tritium transport in such systems (e.g., using TMAP for fusion reactors), it is desirable to unify the calculation of tritium transport with othermore » system variables such as dynamic fluid and structure temperature combined with control systems such as those that might be found in a system code. Some capability for radioactive trace substance transport exists in thermal-hydraulic systems codes (e.g., RELAP5-3D); however, this capability is not coupled to species diffusion through solids. Combined calculations of tritium transport and thermal-hydraulic solution have been demonstrated with TRIDENT but only for a specific type of MSR.Researchers at Oak Ridge National Laboratory have developed a set of Modelica-based dynamic system modeling tools called TRANsient Simulation Framework Of Reconfigurable Models (TRANSFORM) that were used previously to model advanced fission reactors and associated systems. In this system, the augmented TRANSFORM library includes dynamically coupled fluid and solid trace substance transport and diffusion. Results from simulations are compared against analytical solutions for verification.« less

  9. Verification of Modelica-Based Models with Analytical Solutions for Tritium Diffusion

    DOE PAGES

    Rader, Jordan D.; Greenwood, Michael Scott; Humrickhouse, Paul W.

    2018-03-20

    Here, tritium transport in metal and molten salt fluids combined with diffusion through high-temperature structural materials is an important phenomenon in both magnetic confinement fusion (MCF) and molten salt reactor (MSR) applications. For MCF, tritium is desirable to capture for fusion fuel. For MSRs, uncaptured tritium potentially can be released to the environment. In either application, quantifying the time- and space-dependent tritium concentration in the working fluid(s) and structural components is necessary.Whereas capability exists specifically for calculating tritium transport in such systems (e.g., using TMAP for fusion reactors), it is desirable to unify the calculation of tritium transport with othermore » system variables such as dynamic fluid and structure temperature combined with control systems such as those that might be found in a system code. Some capability for radioactive trace substance transport exists in thermal-hydraulic systems codes (e.g., RELAP5-3D); however, this capability is not coupled to species diffusion through solids. Combined calculations of tritium transport and thermal-hydraulic solution have been demonstrated with TRIDENT but only for a specific type of MSR.Researchers at Oak Ridge National Laboratory have developed a set of Modelica-based dynamic system modeling tools called TRANsient Simulation Framework Of Reconfigurable Models (TRANSFORM) that were used previously to model advanced fission reactors and associated systems. In this system, the augmented TRANSFORM library includes dynamically coupled fluid and solid trace substance transport and diffusion. Results from simulations are compared against analytical solutions for verification.« less

  10. Comparison of an Agent-based Model of Disease Propagation with the Generalised SIR Epidemic Model

    DTIC Science & Technology

    2009-08-01

    has become a practical method for conducting Epidemiological Modelling. In the agent- based approach the whole township can be modelled as a system of...SIR system was initially developed based on a very simplified model of social interaction. For instance an assumption of uniform population mixing was...simulating the progress of a disease within a host and of transmission between hosts is based upon Transportation Analysis and Simulation System

  11. Non-Fickian dispersive transport of strontium in laboratory-scale columns: Modelling and evaluation

    NASA Astrophysics Data System (ADS)

    Liu, Dongxu; Jivkov, Andrey P.; Wang, Lichun; Si, Gaohua; Yu, Jing

    2017-06-01

    In the context of environmental remediation of contaminated sites and safety assessment of nuclear waste disposal in the near-surface zone, we investigate the leaching and non-Fickian dispersive migration with sorption of strontium (mocking strontium-90) through columns packed with sand and clay. Analysis is based on breakthrough curves (BTCs) from column experiments, which simulated rainfall infiltration and source term release scenario, rather than applying constant tracer solution at the inlet as commonly used. BTCs are re-evaluated and transport parameters are estimated by inverse modelling using two approaches: (1) equilibrium advection-dispersion equation (ADE); and (2) continuous time random walk (CTRW). Firstly, based on a method for calculating leach concentration, the inlet condition with an exponential decay input is identified. Secondly, the results show that approximately 39%-58% of Br- and 16%-49% of Sr2+ are eluted from the columns at the end of the breakthrough experiments. This suggests that trapping mechanisms, including diffusion into immobile zones and attachment of tracer on mineral surfaces, are more pronounced for Sr2+ than for Br-. Thirdly, we demonstrate robustness of CTRW-based truncated power-law (TPL) model in capturing non-Fickian reactive transport with 0 < β < 2, and Fickian transport with β > 2. The non-Fickian dispersion observed experimentally is explained by variations of local flow field from preferential flow paths due to physical heterogeneities. Particularly, the additional sorption process of strontium on clay minerals contributes to the delay of the peak concentration and the tailing features, which leads to an enhanced non-Fickian transport for strontium. Finally, the ADE and CTRW approaches to environmental modelling are evaluated. It is shown that CTRW with a sorption term can describe non-Fickian dispersive transport of strontium at laboratory scale by identifying appropriate parameters, while the traditional ADE with a retardation factor fails to reproduce the complex non-Fickian transport of strontium with strong sorption on clay surface.

  12. Incorporating environmental justice measures into equilibrium-based transportation network design models

    DOT National Transportation Integrated Search

    2007-08-01

    This research outlines three major challenges of incorporating Environmental Justice (EJ) into metropolitan transportation planning and proposes a new variation of the user equilibrium discrete network design problem (UEDNDP) for achieving EJ amongst...

  13. A New Poisson-Nernst-Planck Model with Ion-Water Interactions for Charge Transport in Ion Channels.

    PubMed

    Chen, Duan

    2016-08-01

    In this work, we propose a new Poisson-Nernst-Planck (PNP) model with ion-water interactions for biological charge transport in ion channels. Due to narrow geometries of these membrane proteins, ion-water interaction is critical for both dielectric property of water molecules in channel pore and transport dynamics of mobile ions. We model the ion-water interaction energy based on realistic experimental observations in an efficient mean-field approach. Variation of a total energy functional of the biological system yields a new PNP-type continuum model. Numerical simulations show that the proposed model with ion-water interaction energy has the new features that quantitatively describe dielectric properties of water molecules in narrow pores and are possible to model the selectivity of some ion channels.

  14. Examination of tracer transport in the NCAR CCM2 by comparison of CFCl3 simulations with ALE/GAGE observations

    NASA Technical Reports Server (NTRS)

    Hartley, Dana E.; Williamson, David L.; Rasch, Philip J.; Prinn, Ronald G.

    1994-01-01

    The latest version of the National Center for Atmospheric Research (NCAR) community climate model (CCM2) contains a semi-Lagrangian tracer transport scheme for the purpose of advecting water vapor and for including chemistry in the climate model. One way to diagnose the CCM2 transport is to simulate CFCl3 in the CCM2 since it has a well-known industry-based source distribution and a photochemical sink and to compare the model results to Atmospheric Lifetime Experiment/Global Atmospheric Gases Experiment ALE/GAGE observations around the globe. In this paper we focus on this comparison and discuss the synoptic scale issues of tracer transport where appropriate. We compare the model and observations on both 12-hour and monthly timescales. The higher-frequency events allow us to diagnose the synoptic scale transport in the CCM2 associated with the observational sites and to determine uncertainties in our high-resolution source distribution. We find that the CCM2 does simulate many of the key features such as pollution events and some seasonal transports, but there are still some dynamical features of tracer transport such as the storm track dynamics and cross-equatorial flow that merit further study in both the model and the real atmosphere.

  15. Modelling of human transplacental transport as performed in Copenhagen, Denmark.

    PubMed

    Mathiesen, Line; Mørck, Thit Aarøe; Zuri, Giuseppina; Andersen, Maria Helena; Pehrson, Caroline; Frederiksen, Marie; Mose, Tina; Rytting, Erik; Poulsen, Marie S; Nielsen, Jeanette K S; Knudsen, Lisbeth E

    2014-07-01

    Placenta perfusion models are very effective when studying the placental mechanisms in order to extrapolate to real-life situations. The models are most often used to investigate the transport of substances between mother and foetus, including the potential metabolism of these. We have studied the relationships between maternal and foetal exposures to various compounds including pollutants such as polychlorinated biphenyls, polybrominated flame retardants, nanoparticles as well as recombinant human antibodies. The compounds have been studied in the human placenta perfusion model and to some extent in vitro with an established human monolayer trophoblast cell culture model. Results from our studies distinguish placental transport of substances by physicochemical properties, adsorption to placental tissue, binding to transport and receptor proteins and metabolism. We have collected data from different classes of chemicals and nanoparticles for comparisons across chemical structures as well as different test systems. Our test systems are based on human material to bypass the extrapolation from animal data. By combining data from our two test systems, we are able to rank and compare the transport of different classes of substances according to their transport ability. Ultimately, human data including measurements in cord blood contribute to the study of placental transport. © 2014 Nordic Association for the Publication of BCPT (former Nordic Pharmacological Society).

  16. The effect on Arctic climate of atmospheric meridional energy-transport changes studied based on the CESM climate model

    NASA Astrophysics Data System (ADS)

    Grand Graversen, Rune

    2017-04-01

    The Arctic amplification of global warming, and the pronounced Arctic sea-ice retreat constitute some of the most alarming signs of global climate change. These Arctic changes are likely a consequence of a combination of several processes, for instance enhanced uptake of solar radiation in the Arctic due to a decrease of sea ice (the ice-albedo feedback), and increase in the local Arctic greenhouse effect due to enhanced moister flux from lower latitudes. Many of the proposed processes appear to be dependent on each other, for instance an increase in water-vapour advection to the Arctic enhances the greenhouse effect in the Arctic and the longwave radiation to the surface, leading to sea-ice melt and enhancement of the ice-albedo feedback. The effects of albedo changes and other radiative feedbacks have been investigated in earlier studies based on model experiments designed to examine these effects specifically. Here we instead focus on the effects of meridional transport changes into the Arctic, both of moister and dry-static energy. Hence we here present results of model experiments with the CESM climate model designed specifically to extract the effects of the changes of the two transport components. In the CESM model the moister transport to the Arctic increases, whereas the dry-static transport decreases in response to a doubling of CO2. This is in agreement with other model results. The model is now forced with these transport changes of water-vapour and dry-static energy associated with a CO2 doubling. The results show that changes of the water-vapour transport lead to Arctic warming. This is partly a consequence of the ice-albedo feedback due to sea-ice melt caused by the change of the water-vapour advection. The changes of the dry-static transport lead to Arctic cooling, which however is smaller than the warming induced by the water-vapour component. Hence this study support the hypothesis that changes in the atmospheric circulation contribute to the Arctic temperature amplification of the ongoing global warming.

  17. On the validity of travel-time based nonlinear bioreactive transport models in steady-state flow.

    PubMed

    Sanz-Prat, Alicia; Lu, Chuanhe; Finkel, Michael; Cirpka, Olaf A

    2015-01-01

    Travel-time based models simplify the description of reactive transport by replacing the spatial coordinates with the groundwater travel time, posing a quasi one-dimensional (1-D) problem and potentially rendering the determination of multidimensional parameter fields unnecessary. While the approach is exact for strictly advective transport in steady-state flow if the reactive properties of the porous medium are uniform, its validity is unclear when local-scale mixing affects the reactive behavior. We compare a two-dimensional (2-D), spatially explicit, bioreactive, advective-dispersive transport model, considered as "virtual truth", with three 1-D travel-time based models which differ in the conceptualization of longitudinal dispersion: (i) neglecting dispersive mixing altogether, (ii) introducing a local-scale longitudinal dispersivity constant in time and space, and (iii) using an effective longitudinal dispersivity that increases linearly with distance. The reactive system considers biodegradation of dissolved organic carbon, which is introduced into a hydraulically heterogeneous domain together with oxygen and nitrate. Aerobic and denitrifying bacteria use the energy of the microbial transformations for growth. We analyze six scenarios differing in the variance of log-hydraulic conductivity and in the inflow boundary conditions (constant versus time-varying concentration). The concentrations of the 1-D models are mapped to the 2-D domain by means of the kinematic (for case i), and mean groundwater age (for cases ii & iii), respectively. The comparison between concentrations of the "virtual truth" and the 1-D approaches indicates extremely good agreement when using an effective, linearly increasing longitudinal dispersivity in the majority of the scenarios, while the other two 1-D approaches reproduce at least the concentration tendencies well. At late times, all 1-D models give valid approximations of two-dimensional transport. We conclude that the conceptualization of nonlinear bioreactive transport in complex multidimensional domains by quasi 1-D travel-time models is valid for steady-state flow fields if the reactants are introduced over a wide cross-section, flow is at quasi steady state, and dispersive mixing is adequately parametrized. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Sediment transport in forested head water catchments - Calibration and validation of a soil erosion and landscape evolution model

    NASA Astrophysics Data System (ADS)

    Hancock, G. R.; Webb, A. A.; Turner, L.

    2017-11-01

    Sediment transport and soil erosion can be determined by a variety of field and modelling approaches. Computer based soil erosion and landscape evolution models (LEMs) offer the potential to be reliable assessment and prediction tools. An advantage of such models is that they provide both erosion and deposition patterns as well as total catchment sediment output. However, before use, like all models they require calibration and validation. In recent years LEMs have been used for a variety of both natural and disturbed landscape assessment. However, these models have not been evaluated for their reliability in steep forested catchments. Here, the SIBERIA LEM is calibrated and evaluated for its reliability for two steep forested catchments in south-eastern Australia. The model is independently calibrated using two methods. Firstly, hydrology and sediment transport parameters are inferred from catchment geomorphology and soil properties and secondly from catchment sediment transport and discharge data. The results demonstrate that both calibration methods provide similar parameters and reliable modelled sediment transport output. A sensitivity study of the input parameters demonstrates the model's sensitivity to correct parameterisation and also how the model could be used to assess potential timber harvesting as well as the removal of vegetation by fire.

  19. Crystal growth from the vapor phase experiment MA-085

    NASA Technical Reports Server (NTRS)

    Wiedemeir, H.; Sadeek, H.; Klaessig, F. C.; Norek, M.

    1976-01-01

    Three vapor transport experiments on multicomponent systems were performed during the Apollo Soyuz mission to determine the effects of microgravity forces on crystal morphology and mass transport rates. The mixed systems used germanium selenide, tellurium, germanium tetraiodide (transport agent), germanium monosulfide, germanium tetrachloride (transport agent), and argon (inert atmosphere). The materials were enclosed in evacuated sealed ampoules of fused silica and were transported in a temperature gradient of the multipurpose electric furnace onboard the Apollo Soyuz spacecraft. Preliminary evaluation of 2 systems shows improved quality of space grown crystals in terms of growth morphology and bulk perfection. This conclusion is based on a direct comparison of space grown and ground based crystals by means of X-ray diffraction, microscopic, and chemical etching techniques. The observation of greater mass transport rates than predicted for a microgravity environment by existing vapor transport models indicates the existence of nongravity caused transport effects in a reactive solid/gas phase system.

  20. Increased Uptake of Chelated Copper Ions by Lolium perenne Attributed to Amplified Membrane and Endodermal Damage

    PubMed Central

    Johnson, Anthea; Singhal, Naresh

    2015-01-01

    The contributions of mechanisms by which chelators influence metal translocation to plant shoot tissues are analyzed using a combination of numerical modelling and physical experiments. The model distinguishes between apoplastic and symplastic pathways of water and solute movement. It also includes the barrier effects of the endodermis and plasma membrane. Simulations are used to assess transport pathways for free and chelated metals, identifying mechanisms involved in chelate-enhanced phytoextraction. Hypothesized transport mechanisms and parameters specific to amendment treatments are estimated, with simulated results compared to experimental data. Parameter values for each amendment treatment are estimated based on literature and experimental values, and used for model calibration and simulation of amendment influences on solute transport pathways and mechanisms. Modeling indicates that chelation alters the pathways for Cu transport. For free ions, Cu transport to leaf tissue can be described using purely apoplastic or transcellular pathways. For strong chelators (ethylenediaminetetraacetic acid (EDTA) and diethylenetriaminepentaacetic acid (DTPA)), transport by the purely apoplastic pathway is insufficient to represent measured Cu transport to leaf tissue. Consistent with experimental observations, increased membrane permeability is required for simulating translocation in EDTA and DTPA treatments. Increasing the membrane permeability is key to enhancing phytoextraction efficiency. PMID:26512647

  1. Flow assignment model for quantitative analysis of diverting bulk freight from road to railway

    PubMed Central

    Liu, Chang; Wang, Jiaxi; Xiao, Jie; Liu, Siqi; Wu, Jianping; Li, Jian

    2017-01-01

    Since railway transport possesses the advantage of high volume and low carbon emissions, diverting some freight from road to railway will help reduce the negative environmental impacts associated with transport. This paper develops a flow assignment model for quantitative analysis of diverting truck freight to railway. First, a general network which considers road transportation, railway transportation, handling and transferring is established according to all the steps in the whole transportation process. Then general functions which embody the factors which the shippers will pay attention to when choosing mode and path are formulated. The general functions contain the congestion cost on road, the capacity constraints of railways and freight stations. Based on the general network and general cost function, a user equilibrium flow assignment model is developed to simulate the flow distribution on the general network under the condition that all shippers choose transportation mode and path independently. Since the model is nonlinear and challenging, we adopt a method that uses tangent lines to constitute envelope curve to linearize it. Finally, a numerical example is presented to test the model and show the method of making quantitative analysis of bulk freight modal shift between road and railway. PMID:28771536

  2. Charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta

    By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency.more » The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.« less

  3. Hardware accelerated high performance neutron transport computation based on AGENT methodology

    NASA Astrophysics Data System (ADS)

    Xiao, Shanjie

    The spatial heterogeneity of the next generation Gen-IV nuclear reactor core designs brings challenges to the neutron transport analysis. The Arbitrary Geometry Neutron Transport (AGENT) AGENT code is a three-dimensional neutron transport analysis code being developed at the Laboratory for Neutronics and Geometry Computation (NEGE) at Purdue University. It can accurately describe the spatial heterogeneity in a hierarchical structure through the R-function solid modeler. The previous version of AGENT coupled the 2D transport MOC solver and the 1D diffusion NEM solver to solve the three dimensional Boltzmann transport equation. In this research, the 2D/1D coupling methodology was expanded to couple two transport solvers, the radial 2D MOC solver and the axial 1D MOC solver, for better accuracy. The expansion was benchmarked with the widely applied C5G7 benchmark models and two fast breeder reactor models, and showed good agreement with the reference Monte Carlo results. In practice, the accurate neutron transport analysis for a full reactor core is still time-consuming and thus limits its application. Therefore, another content of my research is focused on designing a specific hardware based on the reconfigurable computing technique in order to accelerate AGENT computations. It is the first time that the application of this type is used to the reactor physics and neutron transport for reactor design. The most time consuming part of the AGENT algorithm was identified. Moreover, the architecture of the AGENT acceleration system was designed based on the analysis. Through the parallel computation on the specially designed, highly efficient architecture, the acceleration design on FPGA acquires high performance at the much lower working frequency than CPUs. The whole design simulations show that the acceleration design would be able to speedup large scale AGENT computations about 20 times. The high performance AGENT acceleration system will drastically shortening the computation time for 3D full-core neutron transport analysis, making the AGENT methodology unique and advantageous, and thus supplies the possibility to extend the application range of neutron transport analysis in either industry engineering or academic research.

  4. Research on centrality of urban transport network nodes

    NASA Astrophysics Data System (ADS)

    Wang, Kui; Fu, Xiufen

    2017-05-01

    Based on the actual data of urban transport in Guangzhou, 19,150 bus stations in Guangzhou (as of 2014) are selected as nodes. Based on the theory of complex network, the network model of Guangzhou urban transport is constructed. By analyzing the degree centrality index, betweenness centrality index and closeness centrality index of nodes in the network, the level of centrality of each node in the network is studied. From a different point of view to determine the hub node of Guangzhou urban transport network, corresponding to the city's key sites and major transfer sites. The reliability of the network is determined by the stability of some key nodes (transport hub station). The research of network node centralization can provide a theoretical basis for the rational allocation of urban transport network sites and public transport system planning.

  5. Effect of natural particles on the transport of lindane in saturated porous media: Laboratory experiments and model-based analysis

    NASA Astrophysics Data System (ADS)

    Ngueleu, Stéphane K.; Grathwohl, Peter; Cirpka, Olaf A.

    2013-06-01

    Colloidal particles can act as carriers for adsorbing pollutants, such as hydrophobic organic pollutants, and enhance their mobility in the subsurface. In this study, we investigate the influence of colloidal particles on the transport of pesticides through saturated porous media by column experiments. We also investigate the effect of particle size on this transport. The model pesticide is lindane (gamma-hexachlorocyclohexane), a representative hydrophobic insecticide which has been banned in 2009 but is still used in many developing countries. The breakthrough curves are analyzed with the help of numerical modeling, in which we examine the minimum model complexity needed to simulate such transport. The transport of lindane without particles can be described by advective-dispersive transport coupled to linear three-site sorption, one site being in local equilibrium and the others undergoing first-order kinetic sorption. In the presence of mobile particles, the total concentration of mobile lindane is increased, that is, lindane is transported not only in aqueous solution but also sorbed onto the smallest, mobile particles. The models developed to simulate separate and associated transport of lindane and the particles reproduced the measurements very well and showed that the adsorption/desorption of lindane to the particles could be expressed by a common first-order rate law, regardless whether the particles are mobile, attached, or strained.

  6. A hydro-sedimentary modeling system for flash flood propagation and hazard estimation under different agricultural practices

    NASA Astrophysics Data System (ADS)

    Kourgialas, N. N.; Karatzas, G. P.

    2014-03-01

    A modeling system for the estimation of flash flood flow velocity and sediment transport is developed in this study. The system comprises three components: (a) a modeling framework based on the hydrological model HSPF, (b) the hydrodynamic module of the hydraulic model MIKE 11 (quasi-2-D), and (c) the advection-dispersion module of MIKE 11 as a sediment transport model. An important parameter in hydraulic modeling is the Manning's coefficient, an indicator of the channel resistance which is directly dependent on riparian vegetation changes. Riparian vegetation's effect on flood propagation parameters such as water depth (inundation), discharge, flow velocity, and sediment transport load is investigated in this study. Based on the obtained results, when the weed-cutting percentage is increased, the flood wave depth decreases while flow discharge, velocity and sediment transport load increase. The proposed modeling system is used to evaluate and illustrate the flood hazard for different riparian vegetation cutting scenarios. For the estimation of flood hazard, a combination of the flood propagation characteristics of water depth, flow velocity and sediment load was used. Next, a well-balanced selection of the most appropriate agricultural cutting practices of riparian vegetation was performed. Ultimately, the model results obtained for different agricultural cutting practice scenarios can be employed to create flood protection measures for flood-prone areas. The proposed methodology was applied to the downstream part of a small Mediterranean river basin in Crete, Greece.

  7. An Integrated Modeling Approach for Describing Fate and Transport of Perfluorinated Compounds (PFCs) in Estuarine Reservoir

    NASA Astrophysics Data System (ADS)

    Zhang, J.; Nguyen Viet, T.; Wang, X.; Chen, H.; Gin, K. Y. H.

    2014-12-01

    The fate and transport processes of emerging contaminants in aquatic ecosystems are complex, which are not only determined by their own properties but also influenced by the environmental setting, physical, chemical and biological processes. A 3D-emerging contaminant model has been developed based on Delft3D water quality model and coupled with a hydrodynamic model and a catchment-scale 1D- hydrological and hydraulic model to study the possible fate and transport mechanisms of perfluorinated compounds (PFCs) in Marina Reservoir in Singapore. The main processes in the contaminant model include partitioning (among detritus, dissolved organic matter and phytoplankton), settling, resuspension and degradation. We used the integrated model to quantify the distribution of the total PFCs and two major components, namely perfluorooctanoate (PFOA) and perfluorooctane sulfonate (PFOS) in the water, sediments and organisms in the reservoir. The model yielded good agreement with the field measurements when evaluated based on the datasets in 2009 and 2010 as well as recent observations in 2013 and 2014. Our results elucidate that the model can be a useful tool to characterize the occurrence, sources, sinks and trends of PFCs both in the water column and in the sediments in the reservoir. Thisapproach provides a better understanding of mechanisms that influence the fate and transport of emerging contaminants and lays down a framework for future experiments to further explore how the dominant environmental factors change towards mitigation of emerging contaminants in the reservoirs.

  8. A Global System for Transportation Simulation and Visualization in Emergency Evacuation Scenarios

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lu, Wei; Liu, Cheng; Thomas, Neil

    2015-01-01

    Simulation-based studies are frequently used for evacuation planning and decision making processes. Given the transportation systems complexity and data availability, most evacuation simulation models focus on certain geographic areas. With routine improvement of OpenStreetMap road networks and LandScanTM global population distribution data, we present WWEE, a uniform system for world-wide emergency evacuation simulations. WWEE uses unified data structure for simulation inputs. It also integrates a super-node trip distribution model as the default simulation parameter to improve the system computational performance. Two levels of visualization tools are implemented for evacuation performance analysis, including link-based macroscopic visualization and vehicle-based microscopic visualization. Formore » left-hand and right-hand traffic patterns in different countries, the authors propose a mirror technique to experiment with both scenarios without significantly changing traffic simulation models. Ten cities in US, Europe, Middle East, and Asia are modeled for demonstration. With default traffic simulation models for fast and easy-to-use evacuation estimation and visualization, WWEE also retains the capability of interactive operation for users to adopt customized traffic simulation models. For the first time, WWEE provides a unified platform for global evacuation researchers to estimate and visualize their strategies performance of transportation systems under evacuation scenarios.« less

  9. A magnetic model for low/hard state of black hole binaries

    NASA Astrophysics Data System (ADS)

    Ye, Yong-Chun; Wang, Ding-Xiong; Huang, Chang-Yin; Cao, Xiao-Feng

    2016-03-01

    A magnetic model for the low/hard state (LHS) of two black hole X-ray binaries (BHXBs), H1743-322 and GX 339-4, is proposed based on transport of the magnetic field from a companion into an accretion disk around a black hole (BH). This model consists of a truncated thin disk with an inner advection-dominated accretion flow (ADAF). The spectral profiles of the sources are fitted in agreement with the data observed at four different dates corresponding to the rising phase of the LHS. In addition, the association of the LHS with a quasi-steady jet is modeled based on transport of magnetic field, where the Blandford-Znajek (BZ) and Blandford-Payne (BP) processes are invoked to drive the jets from BH and inner ADAF. It turns out that the steep radio/X-ray correlations observed in H1743-322 and GX 339-4 can be interpreted based on our model.

  10. A Selected Library of Transport Coefficients for Combustion and Plasma Physics Applications

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cloutman, L.D.

    2000-08-01

    COYOTE and similar combustion programs based on the multicomponent Navier-Stokes equations require the mixture viscosity, thermal conductivity, and species transport coefficients as input. This report documents a model of these molecular transport coefficients that is simpler than the general theory, but which provides adequate accuracy for many purposes. This model leads to a computationally convenient, self-contained, and easy-to-use source of such data in a format suitable for use by such programs. We present the data for various neutral species in two forms. The first form is a simple functional fit to the transport coefficients. The second form is the usemore » of tabulated Lennard-Jones parameters in simple theoretical expressions for the gas-phase transport coefficients. The model then is extended to the case of a two-temperature plasma. Lennard-Jones parameters are given for a number of chemical species of interest in combustion research.« less

  11. Calculation of effective transport properties of partially saturated gas diffusion layers

    NASA Astrophysics Data System (ADS)

    Bednarek, Tomasz; Tsotridis, Georgios

    2017-02-01

    A large number of currently available Computational Fluid Dynamics numerical models of Polymer Electrolyte Membrane Fuel Cells (PEMFC) are based on the assumption that porous structures are mainly considered as thin and homogenous layers, hence the mass transport equations in structures such as Gas Diffusion Layers (GDL) are usually modelled according to the Darcy assumptions. Application of homogenous models implies that the effects of porous structures are taken into consideration via the effective transport properties of porosity, tortuosity, permeability (or flow resistance), diffusivity, electric and thermal conductivity. Therefore, reliable values of those effective properties of GDL play a significant role for PEMFC modelling when employing Computational Fluid Dynamics, since these parameters are required as input values for performing the numerical calculations. The objective of the current study is to calculate the effective transport properties of GDL, namely gas permeability, diffusivity and thermal conductivity, as a function of liquid water saturation by using the Lattice-Boltzmann approach. The study proposes a method of uniform water impregnation of the GDL based on the "Fine-Mist" assumption by taking into account the surface tension of water droplets and the actual shape of GDL pores.

  12. Adaptive fuzzy-neural-network control for maglev transportation system.

    PubMed

    Wai, Rong-Jong; Lee, Jeng-Dao

    2008-01-01

    A magnetic-levitation (maglev) transportation system including levitation and propulsion control is a subject of considerable scientific interest because of highly nonlinear and unstable behaviors. In this paper, the dynamic model of a maglev transportation system including levitated electromagnets and a propulsive linear induction motor (LIM) based on the concepts of mechanical geometry and motion dynamics is developed first. Then, a model-based sliding-mode control (SMC) strategy is introduced. In order to alleviate chattering phenomena caused by the inappropriate selection of uncertainty bound, a simple bound estimation algorithm is embedded in the SMC strategy to form an adaptive sliding-mode control (ASMC) scheme. However, this estimation algorithm is always a positive value so that tracking errors introduced by any uncertainty will cause the estimated bound increase even to infinity with time. Therefore, it further designs an adaptive fuzzy-neural-network control (AFNNC) scheme by imitating the SMC strategy for the maglev transportation system. In the model-free AFNNC, online learning algorithms are designed to cope with the problem of chattering phenomena caused by the sign action in SMC design, and to ensure the stability of the controlled system without the requirement of auxiliary compensated controllers despite the existence of uncertainties. The outputs of the AFNNC scheme can be directly supplied to the electromagnets and LIM without complicated control transformations for relaxing strict constrains in conventional model-based control methodologies. The effectiveness of the proposed control schemes for the maglev transportation system is verified by numerical simulations, and the superiority of the AFNNC scheme is indicated in comparison with the SMC and ASMC strategies.

  13. Assessment of sustainable urban transport development based on entropy and unascertained measure

    PubMed Central

    Li, Yancang; Yang, Jing; Li, Yijie

    2017-01-01

    To find a more effective method for the assessment of sustainable urban transport development, the comprehensive assessment model of sustainable urban transport development was established based on the unascertained measure. On the basis of considering the factors influencing urban transport development, the comprehensive assessment indexes were selected, including urban economical development, transport demand, environment quality and energy consumption, and the assessment system of sustainable urban transport development was proposed. In view of different influencing factors of urban transport development, the index weight was calculated through the entropy weight coefficient method. Qualitative and quantitative analyses were conducted according to the actual condition. Then, the grade was obtained by using the credible degree recognition criterion from which the urban transport development level can be determined. Finally, a comprehensive assessment method for urban transport development was introduced. The application practice showed that the method can be used reasonably and effectively for the comprehensive assessment of urban transport development. PMID:29084281

  14. Modeling preferential water flow and solute transport in unsaturated soil using the active region model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sheng, F.; Wang, K.; Zhang, R.

    2009-03-15

    Preferential flow and solute transport are common processes in the unsaturated soil, in which distributions of soil water content and solute concentrations are often characterized as fractal patterns. An active region model (ARM) was recently proposed to describe the preferential flow and transport patterns. In this study, ARM governing equations were derived to model the preferential soil water flow and solute transport processes. To evaluate the ARM equations, dye infiltration experiments were conducted, in which distributions of soil water content and Cl{sup -} concentration were measured. Predicted results using the ARM and the mobile-immobile region model (MIM) were compared withmore » the measured distributions of soil water content and Cl{sup -} concentration. Although both the ARM and the MIM are two-region models, they are fundamental different in terms of treatments of the flow region. The models were evaluated based on the modeling efficiency (ME). The MIM provided relatively poor prediction results of the preferential flow and transport with negative ME values or positive ME values less than 0.4. On the contrary, predicted distributions of soil water content and Cl- concentration using the ARM agreed reasonably well with the experimental data with ME values higher than 0.8. The results indicated that the ARM successfully captured the macroscopic behavior of preferential flow and solute transport in the unsaturated soil.« less

  15. Modulation of charge transport properties in poly(3,4-ethylenedioxythiophene) nanocomposites for thermoelectric applications

    NASA Astrophysics Data System (ADS)

    Galliani, Daniela; Battiston, Simone; Ruffo, Riccardo; Trabattoni, Silvia; Narducci, Dario

    2018-01-01

    Conjugated polymer poly(3,4-dioxyethylenthiofene) (PEDOT) has recently gained attention for room-temperature thermoelectric applications due to its low cost, safety and the possibility of easy processing. This makes it an interesting prospective alternative to tellurides commonly used around room temperature. Still, low thermoelectric efficiencies of polymers might be more easily increased, were a model of its transport properties available. The aim of this paper is to validate a model recently reported, making use of the concept of transport energy to frame the onset of transport properties reported over the last few years in the literature. To this aim, PEDOT and PEDOT-based nanocomposites embedding CuO nanoplatelets were prepared and analysed. We found that the model adequately fits the trends observed in pure PEDOT and in its nanocomposites. Transport and Fermi energy were verified to depend on the polymer oxidation level only,while the transport coefficient was found to be sensitive to PEDOT stacking and was modulated by the introduction of CuO nanoplatelets.

  16. Probabilistic transport models for plasma transport in the presence of critical thresholds: Beyond the diffusive paradigma)

    NASA Astrophysics Data System (ADS)

    Sánchez, R.; van Milligen, B. Ph.; Carreras, B. A.

    2005-05-01

    It is argued that the modeling of plasma transport in tokamaks may benefit greatly from extending the usual local paradigm to accommodate scale-free transport mechanisms. This can be done by combining Lévy distributions and a nonlinear threshold condition within the continuous time random walk concept. The advantages of this nonlocal, nonlinear extension are illustrated by constructing a simple particle density transport model that, as a result of these ideas, spontaneously exhibits much of nondiffusive phenomenology routinely observed in tokamaks. The fluid limit of the system shows that the kind of equations that are appropriate to capture these dynamics are based on fractional differential operators. In them, effective diffusivities and pinch velocities are found that are dynamically set by the system in response to the specific characteristics of the fueling source and external perturbations. This fact suggests some dramatic consequences for the extrapolation of these transport properties to larger size systems.

  17. CHARACTERIZING SPATIAL AND TEMPORAL DYNAMICS: DEVELOPMENT OF A GRID-BASED WATERSHED MERCURY LOADING MODEL

    EPA Science Inventory

    A distributed grid-based watershed mercury loading model has been developed to characterize spatial and temporal dynamics of mercury from both point and non-point sources. The model simulates flow, sediment transport, and mercury dynamics on a daily time step across a diverse lan...

  18. A Nonlinear Regression Model Estimating Single Source Concentrations of Primary and Secondarily Formed 2.5

    EPA Science Inventory

    Various approaches and tools exist to estimate local and regional PM2.5 impacts from a single emissions source, ranging from simple screening techniques to Gaussian based dispersion models and complex grid-based Eulerian photochemical transport models. These approache...

  19. Description of Transport Codes for Space Radiation Shielding

    NASA Technical Reports Server (NTRS)

    Kim, Myung-Hee Y.; Wilson, John W.; Cucinotta, Francis A.

    2011-01-01

    This slide presentation describes transport codes and their use for studying and designing space radiation shielding. When combined with risk projection models radiation transport codes serve as the main tool for study radiation and designing shielding. There are three criteria for assessing the accuracy of transport codes: (1) Ground-based studies with defined beams and material layouts, (2) Inter-comparison of transport code results for matched boundary conditions and (3) Comparisons to flight measurements. These three criteria have a very high degree with NASA's HZETRN/QMSFRG.

  20. A nearest neighbor approach for automated transporter prediction and categorization from protein sequences.

    PubMed

    Li, Haiquan; Dai, Xinbin; Zhao, Xuechun

    2008-05-01

    Membrane transport proteins play a crucial role in the import and export of ions, small molecules or macromolecules across biological membranes. Currently, there are a limited number of published computational tools which enable the systematic discovery and categorization of transporters prior to costly experimental validation. To approach this problem, we utilized a nearest neighbor method which seamlessly integrates homologous search and topological analysis into a machine-learning framework. Our approach satisfactorily distinguished 484 transporter families in the Transporter Classification Database, a curated and representative database for transporters. A five-fold cross-validation on the database achieved a positive classification rate of 72.3% on average. Furthermore, this method successfully detected transporters in seven model and four non-model organisms, ranging from archaean to mammalian species. A preliminary literature-based validation has cross-validated 65.8% of our predictions on the 11 organisms, including 55.9% of our predictions overlapping with 83.6% of the predicted transporters in TransportDB.

  1. Literature review of organic matter transport from marshes

    NASA Technical Reports Server (NTRS)

    Dow, D. D.

    1982-01-01

    A conceptual model for estimating a transport coefficient for the movement of nonliving organic matter from wetlands to the adjacent embayments was developed in a manner that makes it compatible with the Earth Resources Laboratory's Productive Capacity Model. The model, which envisages detritus movement from wetland pixels to the nearest land-water boundary followed by movement within the water column from tidal creeks to the adjacent embayment, can be transposed to deal with only the interaction between tidal water and the marsh or to estimate the transport from embayments to the adjacent coastal waters. The outwelling hypothesis postulated wetlands as supporting coastal fisheries either by exporting nutrients, such as inorganic nitrogen, which stimulated the plankton-based grazing food chain in the water column, or through the export of dissolved and particulate organic carbon which provided a benthic, detritus-based food web which provides the food source for the grazing food chain in a more indirect fashion.

  2. Reactive solute transport in acidic streams

    USGS Publications Warehouse

    Broshears, R.E.

    1996-01-01

    Spatial and temporal profiles of Ph and concentrations of toxic metals in streams affected by acid mine drainage are the result of the interplay of physical and biogeochemical processes. This paper describes a reactive solute transport model that provides a physically and thermodynamically quantitative interpretation of these profiles. The model combines a transport module that includes advection-dispersion and transient storage with a geochemical speciation module based on MINTEQA2. Input to the model includes stream hydrologic properties derived from tracer-dilution experiments, headwater and lateral inflow concentrations analyzed in field samples, and a thermodynamic database. Simulations reproduced the general features of steady-state patterns of observed pH and concentrations of aluminum and sulfate in St. Kevin Gulch, an acid mine drainage stream near Leadville, Colorado. These patterns were altered temporarily by injection of sodium carbonate into the stream. A transient simulation reproduced the observed effects of the base injection.

  3. Super-Joule heating in graphene and silver nanowire network

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maize, Kerry; Das, Suprem R.; Sadeque, Sajia

    Transistors, sensors, and transparent conductors based on randomly assembled nanowire networks rely on multi-component percolation for unique and distinctive applications in flexible electronics, biochemical sensing, and solar cells. While conduction models for 1-D and 1-D/2-D networks have been developed, typically assuming linear electronic transport and self-heating, the model has not been validated by direct high-resolution characterization of coupled electronic pathways and thermal response. In this letter, we show the occurrence of nonlinear “super-Joule” self-heating at the transport bottlenecks in networks of silver nanowires and silver nanowire/single layer graphene hybrid using high resolution thermoreflectance (TR) imaging. TR images at the microscopicmore » self-heating hotspots within nanowire network and nanowire/graphene hybrid network devices with submicron spatial resolution are used to infer electrical current pathways. The results encourage a fundamental reevaluation of transport models for network-based percolating conductors.« less

  4. Computational analysis of species transport and electrochemical characteristics of a MOLB-type SOFC

    NASA Astrophysics Data System (ADS)

    Hwang, J. J.; Chen, C. K.; Lai, D. Y.

    A multi-physics model coupling electrochemical kinetics with fluid dynamics has been developed to simulate the transport phenomena in mono-block-layer built (MOLB) solid oxide fuel cells (SOFC). A typical MOLB module is composed of trapezoidal flow channels, corrugated positive electrode-electrolyte-negative electrode (PEN) plates, and planar inter-connecters. The control volume-based finite difference method is employed for calculation, which is based on the conservation of mass, momentum, energy, species, and electric charge. In the porous electrodes, the flow momentum is governed by a Darcy model with constant porosity and permeability. The diffusion of reactants follows the Bruggman model. The chemistry within the plates is described via surface reactions with a fixed surface-to-volume ratio, tortuosity and average pore size. Species transports as well as the local variations of electrochemical characteristics, such as overpotential and current density distributions in the electrodes of an MOLB SOFC, are discussed in detail.

  5. Mass Transport through Nanostructured Membranes: Towards a Predictive Tool

    PubMed Central

    Darvishmanesh, Siavash; Van der Bruggen, Bart

    2016-01-01

    This study proposes a new mechanism to understand the transport of solvents through nanostructured membranes from a fundamental point of view. The findings are used to develop readily applicable mathematical models to predict solvent fluxes and solute rejections through solvent resistant membranes used for nanofiltration. The new model was developed based on a pore-flow type of transport. New parameters found to be of fundamental importance were introduced to the equation, i.e., the affinity of the solute and the solvent for the membrane expressed as the hydrogen-bonding contribution of the solubility parameter for the solute, solvent and membrane. A graphical map was constructed to predict the solute rejection based on the hydrogen-bonding contribution of the solubility parameter. The model was evaluated with performance data from the literature. Both the solvent flux and the solute rejection calculated with the new approach were similar to values reported in the literature. PMID:27918434

  6. Impact of downslope soil transport on carbon storage and fate in permafrost dominated landscapes

    NASA Astrophysics Data System (ADS)

    Shelef, E.; Rowland, J. C.; Wilson, C. J.; Altmann, G.; Hilley, G. E.

    2014-12-01

    A large fraction of high latitude permafrost-dominated landscapes are covered by soil mantled hillslopes. In these landscapes, soil organic carbon (SOC) accumulates and is lost through lateral transport processes. At present, these processes are not included in regional or global landsurface climate models. We present preliminary results of a soil transport and storage model over a permafrost dominated hillslope. In this model soil carbon is transported downslope within a mobile layer that thaws every summer. The model tracks soil transport and its subsequent storage at the hillslope's base. In a scenario where a carbon poor subsurface is blanketed by a carbon-rich surface layer, the progressive downslope soil transport can result in net carbon sequestration. This sequestration occurs because SOC is carried from the hilllsope's near-surface layer, where it is produced by plants and is capable of decomposing, into depositional sites at the hillslope's base where it is stored in frozen deposits such that it's decomposition rate is effectively zero. We use the model to evaluate the quantities of carbon stored in depositional settings during the Holocene, and to predict changes in sequestration rate in response to thaw depth thickening expected to occur within the next century due to climate-change. At the Holocene time scale, we show that a large amount of SOC is likely stored in depositional sites that comprise only a small fraction of arctic landscapes. The convergent topography of these sites makes them susceptible to fluvial erosion and suggests that increased fluvial incision in response to climate-change-induced thawing has the potential to release significant amounts of carbon to the river system, and potentially to the atmosphere. At the time scale of the next century, increased thaw depth may increase soil-transport rates on hillslopes and therefore increase SOC sequestration rates at a magnitude that may partly compensate for the carbon release expected from permafrost thawing. Model guided field data collection is essential to reduce the uncertainty of these estimates.

  7. Second-order closure models for supersonic turbulent flows

    NASA Technical Reports Server (NTRS)

    Speziale, Charles G.; Sarkar, Sutanu

    1991-01-01

    Recent work by the authors on the development of a second-order closure model for high-speed compressible flows is reviewed. This turbulence closure is based on the solution of modeled transport equations for the Favre-averaged Reynolds stress tensor and the solenoidal part of the turbulent dissipation rate. A new model for the compressible dissipation is used along with traditional gradient transport models for the Reynolds heat flux and mass flux terms. Consistent with simple asymptotic analyses, the deviatoric part of the remaining higher-order correlations in the Reynolds stress transport equation are modeled by a variable density extension of the newest incompressible models. The resulting second-order closure model is tested in a variety of compressible turbulent flows which include the decay of isotropic turbulence, homogeneous shear flow, the supersonic mixing layer, and the supersonic flat-plate turbulent boundary layer. Comparisons between the model predictions and the results of physical and numerical experiments are quite encouraging.

  8. Second-order closure models for supersonic turbulent flows

    NASA Technical Reports Server (NTRS)

    Speziale, Charles G.; Sarkar, Sutanu

    1991-01-01

    Recent work on the development of a second-order closure model for high-speed compressible flows is reviewed. This turbulent closure is based on the solution of modeled transport equations for the Favre-averaged Reynolds stress tensor and the solenoidal part of the turbulent dissipation rate. A new model for the compressible dissipation is used along with traditional gradient transport models for the Reynolds heat flux and mass flux terms. Consistent with simple asymptotic analyses, the deviatoric part of the remaining higher-order correlations in the Reynolds stress transport equations are modeled by a variable density extension of the newest incompressible models. The resulting second-order closure model is tested in a variety of compressible turbulent flows which include the decay of isotropic turbulence, homogeneous shear flow, the supersonic mixing layer, and the supersonic flat-plate turbulent boundary layer. Comparisons between the model predictions and the results of physical and numerical experiments are quite encouraging.

  9. Predicting phenolic acid absorption in Caco-2 cells: a theoretical permeability model and mechanistic study.

    PubMed

    Farrell, Tracy L; Poquet, Laure; Dew, Tristan P; Barber, Stuart; Williamson, Gary

    2012-02-01

    There is a considerable need to rationalize the membrane permeability and mechanism of transport for potential nutraceuticals. The aim of this investigation was to develop a theoretical permeability equation, based on a reported descriptive absorption model, enabling calculation of the transcellular component of absorption across Caco-2 monolayers. Published data for Caco-2 permeability of 30 drugs transported by the transcellular route were correlated with the descriptors 1-octanol/water distribution coefficient (log D, pH 7.4) and size, based on molecular mass. Nonlinear regression analysis was used to derive a set of model parameters a', β', and b' with an integrated molecular mass function. The new theoretical transcellular permeability (TTP) model obtained a good fit of the published data (R² = 0.93) and predicted reasonably well (R² = 0.86) the experimental apparent permeability coefficient (P(app)) for nine non-training set compounds reportedly transported by the transcellular route. For the first time, the TTP model was used to predict the absorption characteristics of six phenolic acids, and this original investigation was supported by in vitro Caco-2 cell mechanistic studies, which suggested that deviation of the P(app) value from the predicted transcellular permeability (P(app)(trans)) may be attributed to involvement of active uptake, efflux transporters, or paracellular flux.

  10. Mathematical modeling of kidney transport.

    PubMed

    Layton, Anita T

    2013-01-01

    In addition to metabolic waste and toxin excretion, the kidney also plays an indispensable role in regulating the balance of water, electrolytes, nitrogen, and acid-base. In this review, we describe representative mathematical models that have been developed to better understand kidney physiology and pathophysiology, including the regulation of glomerular filtration, the regulation of renal blood flow by means of the tubuloglomerular feedback mechanisms and of the myogenic mechanism, the urine concentrating mechanism, epithelial transport, and regulation of renal oxygen transport. We discuss the extent to which these modeling efforts have expanded our understanding of renal function in both health and disease. Copyright © 2013 Wiley Periodicals, Inc.

  11. Improvement of the Davydov theory of bioenergy transport in protein molecular systems.

    PubMed

    Pang, X F

    2000-11-01

    The Hamiltonian and the wave function in the Davydov theory have simultaneously been improved and extended, based on some physical and biological grounds and on results from other models. The equations of motion for the improved Davydov model with a quasicoherent two-quanta state and a new interaction term in the Hamiltonian describe bioenergy transport along the molecular chains in protein molecules by a soliton mechanism. Some elementary properties of the soliton, including the nonlinear coupling energy and greatly increased binding energy of the soliton, are also given. The results obtained suggest that the model could be a candidate for a bioenergy transport mechanism in protein molecules.

  12. Fuzzy Temporal Logic Based Railway Passenger Flow Forecast Model

    PubMed Central

    Dou, Fei; Jia, Limin; Wang, Li; Xu, Jie; Huang, Yakun

    2014-01-01

    Passenger flow forecast is of essential importance to the organization of railway transportation and is one of the most important basics for the decision-making on transportation pattern and train operation planning. Passenger flow of high-speed railway features the quasi-periodic variations in a short time and complex nonlinear fluctuation because of existence of many influencing factors. In this study, a fuzzy temporal logic based passenger flow forecast model (FTLPFFM) is presented based on fuzzy logic relationship recognition techniques that predicts the short-term passenger flow for high-speed railway, and the forecast accuracy is also significantly improved. An applied case that uses the real-world data illustrates the precision and accuracy of FTLPFFM. For this applied case, the proposed model performs better than the k-nearest neighbor (KNN) and autoregressive integrated moving average (ARIMA) models. PMID:25431586

  13. MRI-Based Computational Model of Heterogeneous Tracer Transport following Local Infusion into a Mouse Hind Limb Tumor

    PubMed Central

    Magdoom, Kulam Najmudeen; Pishko, Gregory L.; Rice, Lori; Pampo, Chris; Siemann, Dietmar W.; Sarntinoranont, Malisa

    2014-01-01

    Systemic drug delivery to solid tumors involving macromolecular therapeutic agents is challenging for many reasons. Amongst them is their chaotic microvasculature which often leads to inadequate and uneven uptake of the drug. Localized drug delivery can circumvent such obstacles and convection-enhanced delivery (CED) - controlled infusion of the drug directly into the tissue - has emerged as a promising delivery method for distributing macromolecules over larger tissue volumes. In this study, a three-dimensional MR image-based computational porous media transport model accounting for realistic anatomical geometry and tumor leakiness was developed for predicting the interstitial flow field and distribution of albumin tracer following CED into the hind-limb tumor (KHT sarcoma) in a mouse. Sensitivity of the model to changes in infusion flow rate, catheter placement and tissue hydraulic conductivity were investigated. The model predictions suggest that 1) tracer distribution is asymmetric due to heterogeneous porosity; 2) tracer distribution volume varies linearly with infusion volume within the whole leg, and exponentially within the tumor reaching a maximum steady-state value; 3) infusion at the center of the tumor with high flow rates leads to maximum tracer coverage in the tumor with minimal leakage outside; and 4) increasing the tissue hydraulic conductivity lowers the tumor interstitial fluid pressure and decreases the tracer distribution volume within the whole leg and tumor. The model thus predicts that the interstitial fluid flow and drug transport is sensitive to porosity and changes in extracellular space. This image-based model thus serves as a potential tool for exploring the effects of transport heterogeneity in tumors. PMID:24619021

  14. Intercomparison of 3D pore-scale flow and solute transport simulation methods

    DOE PAGES

    Mehmani, Yashar; Schoenherr, Martin; Pasquali, Andrea; ...

    2015-09-28

    Multiple numerical approaches have been developed to simulate porous media fluid flow and solute transport at the pore scale. These include 1) methods that explicitly model the three-dimensional geometry of pore spaces and 2) methods that conceptualize the pore space as a topologically consistent set of stylized pore bodies and pore throats. In previous work we validated a model of the first type, using computational fluid dynamics (CFD) codes employing a standard finite volume method (FVM), against magnetic resonance velocimetry (MRV) measurements of pore-scale velocities. Here we expand that validation to include additional models of the first type based onmore » the lattice Boltzmann method (LBM) and smoothed particle hydrodynamics (SPH), as well as a model of the second type, a pore-network model (PNM). The PNM approach used in the current study was recently improved and demonstrated to accurately simulate solute transport in a two-dimensional experiment. While the PNM approach is computationally much less demanding than direct numerical simulation methods, the effect of conceptualizing complex three-dimensional pore geometries on solute transport in the manner of PNMs has not been fully determined. We apply all four approaches (FVM-based CFD, LBM, SPH and PNM) to simulate pore-scale velocity distributions and (for capable codes) nonreactive solute transport, and intercompare the model results. Comparisons are drawn both in terms of macroscopic variables (e.g., permeability, solute breakthrough curves) and microscopic variables (e.g., local velocities and concentrations). Generally good agreement was achieved among the various approaches, but some differences were observed depending on the model context. The intercomparison work was challenging because of variable capabilities of the codes, and inspired some code enhancements to allow consistent comparison of flow and transport simulations across the full suite of methods. This paper provides support for confidence in a variety of pore-scale modeling methods and motivates further development and application of pore-scale simulation methods.« less

  15. Morphodynamic Modeling Using The SToRM Computational System

    NASA Astrophysics Data System (ADS)

    Simoes, F.

    2016-12-01

    The framework of the work presented here is the open source SToRM (System for Transport and River Modeling) eco-hydraulics modeling system, which is one of the models released with the iRIC hydraulic modeling graphical software package (http://i-ric.org/). SToRM has been applied to the simulation of various complex environmental problems, including natural waterways, steep channels with regime transition, and rapidly varying flood flows with wetting and drying fronts. In its previous version, however, channel bed was treated as static and the ability of simulating sediment transport rates or bed deformation was not included. The work presented here reports SToRM's newly developed extensions to expand the system's capability to calculate morphological changes in alluvial river systems. The sediment transport module of SToRM has been developed based on the general recognition that meaningful advances depend on physically solid formulations and robust and accurate numerical solution methods. The basic concepts of mass and momentum conservation are used, where the feedback mechanisms between the flow of water, the sediment in transport, and the bed changes are directly incorporated in the governing equations used in the mathematical model. This is accomplished via a non-capacity transport formulation based on the work of Cao et al. [Z. Cao et al., "Non-capacity or capacity model for fluvial sediment transport," Water Management, 165(WM4):193-211, 2012], where the governing equations are augmented with source/sink terms due to water-sediment interaction. The same unsteady, shock-capturing numerical schemes originally used in SToRM were adapted to the new physics, using a control volume formulation over unstructured computational grids. The presentation will include a brief overview of these methodologies, and the result of applications of the model to a number of relevant physical test cases with movable bed, where computational results are compared to experimental data.

  16. Intercomparison of 3D pore-scale flow and solute transport simulation methods

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yang, Xiaofan; Mehmani, Yashar; Perkins, William A.

    2016-09-01

    Multiple numerical approaches have been developed to simulate porous media fluid flow and solute transport at the pore scale. These include 1) methods that explicitly model the three-dimensional geometry of pore spaces and 2) methods that conceptualize the pore space as a topologically consistent set of stylized pore bodies and pore throats. In previous work we validated a model of the first type, using computational fluid dynamics (CFD) codes employing a standard finite volume method (FVM), against magnetic resonance velocimetry (MRV) measurements of pore-scale velocities. Here we expand that validation to include additional models of the first type based onmore » the lattice Boltzmann method (LBM) and smoothed particle hydrodynamics (SPH), as well as a model of the second type, a pore-network model (PNM). The PNM approach used in the current study was recently improved and demonstrated to accurately simulate solute transport in a two-dimensional experiment. While the PNM approach is computationally much less demanding than direct numerical simulation methods, the effect of conceptualizing complex three-dimensional pore geometries on solute transport in the manner of PNMs has not been fully determined. We apply all four approaches (FVM-based CFD, LBM, SPH and PNM) to simulate pore-scale velocity distributions and (for capable codes) nonreactive solute transport, and intercompare the model results. Comparisons are drawn both in terms of macroscopic variables (e.g., permeability, solute breakthrough curves) and microscopic variables (e.g., local velocities and concentrations). Generally good agreement was achieved among the various approaches, but some differences were observed depending on the model context. The intercomparison work was challenging because of variable capabilities of the codes, and inspired some code enhancements to allow consistent comparison of flow and transport simulations across the full suite of methods. This study provides support for confidence in a variety of pore-scale modeling methods and motivates further development and application of pore-scale simulation methods.« less

  17. Integrating multimodal transport into cellulosic biofuel supply chain design under feedstock seasonality with a case study based on California.

    PubMed

    Xie, Fei; Huang, Yongxi; Eksioglu, Sandra

    2014-01-01

    A multistage, mixed integer programing model was developed that fully integrates multimodal transport into the cellulosic biofuel supply chain design under feedstock seasonality. Three transport modes are considered: truck, single railcar, and unit train. The goal is to minimize the total cost for infrastructure, feedstock harvesting, biofuel production, and transportation. Strategic decisions including the locations and capacities of transshipment hubs, biorefineries, and terminals and tactical decisions on system operations are optimized in an integrated manner. When the model was implemented to a case study of cellulosic ethanol production in California, it was found that trucks are convenient for short-haul deliveries while rails are more effective for long-haul transportation. Taking the advantage of these benefits, the multimodal transport provides more cost effective solutions than the single-mode transport (truck). Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. Computation of Alfvèn eigenmode stability and saturation through a reduced fast ion transport model in the TRANSP tokamak transport code

    NASA Astrophysics Data System (ADS)

    Podestà, M.; Gorelenkova, M.; Gorelenkov, N. N.; White, R. B.

    2017-09-01

    Alfvénic instabilities (AEs) are well known as a potential cause of enhanced fast ion transport in fusion devices. Given a specific plasma scenario, quantitative predictions of (i) expected unstable AE spectrum and (ii) resulting fast ion transport are required to prevent or mitigate the AE-induced degradation in fusion performance. Reduced models are becoming an attractive tool to analyze existing scenarios as well as for scenario prediction in time-dependent simulations. In this work, a neutral beam heated NSTX discharge is used as reference to illustrate the potential of a reduced fast ion transport model, known as kick model, that has been recently implemented for interpretive and predictive analysis within the framework of the time-dependent tokamak transport code TRANSP. Predictive capabilities for AE stability and saturation amplitude are first assessed, based on given thermal plasma profiles only. Predictions are then compared to experimental results, and the interpretive capabilities of the model further discussed. Overall, the reduced model captures the main properties of the instabilities and associated effects on the fast ion population. Additional information from the actual experiment enables further tuning of the model’s parameters to achieve a close match with measurements.

  19. Model-based transportation performance : a comparative framework and literature synthesis.

    DOT National Transportation Integrated Search

    2012-03-01

    In an era of limited resources and a proliferation of data, there is increasing pressure to conduct careful evaluations of the economic, environmental, and equity effects of investments and policies that influence transportation and land-use systems....

  20. Production of synthetic winds for the Global Reference Atmosphere Model (GRAM)

    DOT National Transportation Integrated Search

    2010-12-15

    The Aerospace Corporation was tasked by the Volpe National Transportation systems Center to provide technical support to the Federal Aviation Administration, Office of Commercial Space Transportation (FAA/AST), in developing a method based on Princip...

  1. Documentation Supplement for Base Case v4.10_FTransport - Updates for Final Transport Rule

    EPA Pesticide Factsheets

    View the document that describes the changes implemented as a result for the Final Cross-State Air Pollution Rule (Transport Rule) analysis in EPA’s application of the Integrated Planning Model (IPM).

  2. Developing a model-based decision support system for call-a-ride paratransit service problems.

    DOT National Transportation Integrated Search

    2011-02-01

    Paratransit is the transportation service that supplements larger public transportation : systems by providing individualized rides without fixed routes or timetables. In 1990, : the Americans with Disabilities Act (ADA) was passed which allows passe...

  3. Oyster larval transport in coastal Alabama: Dominance of physical transport over biological behavior in a shallow estuary

    NASA Astrophysics Data System (ADS)

    Kim, Choong-Ki; Park, Kyeong; Powers, Sean P.; Graham, William M.; Bayha, Keith M.

    2010-10-01

    Among the various factors affecting recruitment of marine invertebrates and fish, larval transport may produce spatial and temporal patterns of abundance that are important determinants of management strategies. Here we conducted a field and modeling study to investigate the larval transport of eastern oyster, Crassostrea virginica, in Mobile Bay and eastern Mississippi Sound, Alabama. A three-dimensional larval transport model accounting for physical transport, biological movement of larvae, and site- and larval-specific conditions was developed. A hydrodynamic model was used to simulate physical transport, and biological movement was parameterized as a function of swimming and sinking velocity of oyster larvae. Site- and larval-specific conditions, including spawning location, spawning stock size, spawning time, and larval period, were determined based on the previous studies. The model reasonably reproduced the observed gradient in oyster spat settlement and bivalve larval concentration, although the model results were less dynamic than the data, probably owing to the simplified biological conditions employed in the model. A persistent gradient decreasing from west to east in the model results at time scales of overall average, season, and each survey in 2006 suggests that the larval supply may be responsible for the corresponding gradient in oyster spat settlement observed over the past 40 years. Biological movement increased larval retention near the spawning area, thus providing a favorable condition for local recruitment of oysters. Inclusion of biological movement, however, caused little change in the overall patterns of larval transport and still resulted in a west-east gradient, presumably because of frequent destratification in the shallow Mobile Bay system.

  4. Space evolution model and empirical analysis of an urban public transport network

    NASA Astrophysics Data System (ADS)

    Sui, Yi; Shao, Feng-jing; Sun, Ren-cheng; Li, Shu-jing

    2012-07-01

    This study explores the space evolution of an urban public transport network, using empirical evidence and a simulation model validated on that data. Public transport patterns primarily depend on traffic spatial-distribution, demands of passengers and expected utility of investors. Evolution is an iterative process of satisfying the needs of passengers and investors based on a given traffic spatial-distribution. The temporal change of urban public transport network is evaluated both using topological measures and spatial ones. The simulation model is validated using empirical data from nine big cities in China. Statistical analyses on topological and spatial attributes suggest that an evolution network with traffic demands characterized by power-law numerical values which distribute in a mode of concentric circles tallies well with these nine cities.

  5. The effects of mannitol on the transport of ciprofloxacin across respiratory epithelia.

    PubMed

    Ong, Hui Xin; Traini, Daniela; Salama, Rania; Anderson, Sandra D; Daviskas, Evangelia; Young, Paul M

    2013-08-05

    Inhalation of antibiotics and mucolytics is the most important combination of inhaled drugs for chronic obstructive lung diseases and has become a standard part of treatment. However, it is yet to be determined whether the administration of a mucolytic has an effect on the transport rate of antibiotics across the airway epithelial cells. Consequently, the aim of this study was to investigate the effects of inhalation dry powder, specifically mannitol, on ciprofloxacin transport using a Calu-3 air-interface cell model. Transport studies of ciprofloxacin HCl were performed using different configurations including single spray-dried ciprofloxacin alone, co-spray-dried ciprofloxacin with mannitol, and deposition of mannitol prior to ciprofloxacin deposition. To understand the mechanism of transport and interactions between the drugs, pH measurements of apical surface liquid (ASL) and further transport studies were performed with ciprofloxacin base, with and without the presence of ion channel/transport inhibitors such as disodium cromoglycate and furosemide. Mannitol was found to delay absorption of ciprofloxacin HCl through the increase in ASL volume and subsequent reduction in pH. Conversely, ciprofloxacin base had a higher transport rate after mannitol deposition. This study clearly demonstrates that the deposition of mannitol prior to ciprofloxacin on the air-interface Calu-3 cell model has an effect on its transport rate. This was also dependent on the salt form of the drug and the timing and sequence of formulations administered.

  6. Evaluation of Diagnostic CO2 Flux and Transport Modeling in NU-WRF and GEOS-5

    NASA Astrophysics Data System (ADS)

    Kawa, S. R.; Collatz, G. J.; Tao, Z.; Wang, J. S.; Ott, L. E.; Liu, Y.; Andrews, A. E.; Sweeney, C.

    2015-12-01

    We report on recent diagnostic (constrained by observations) model simulations of atmospheric CO2 flux and transport using a newly developed facility in the NASA Unified-Weather Research and Forecast (NU-WRF) model. The results are compared to CO2 data (ground-based, airborne, and GOSAT) and to corresponding simulations from a global model that uses meteorology from the NASA GEOS-5 Modern Era Retrospective analysis for Research and Applications (MERRA). The objective of these intercomparisons is to assess the relative strengths and weaknesses of the respective models in pursuit of an overall carbon process improvement at both regional and global scales. Our guiding hypothesis is that the finer resolution and improved land surface representation in NU-WRF will lead to better comparisons with CO2 data than those using global MERRA, which will, in turn, inform process model development in global prognostic models. Initial intercomparison results, however, have generally been mixed: NU-WRF is better at some sites and times but not uniformly. We are examining the model transport processes in detail to diagnose differences in the CO2 behavior. These comparisons are done in the context of a long history of simulations from the Parameterized Chemistry and Transport Model, based on GEOS-5 meteorology and Carnegie Ames-Stanford Approach-Global Fire Emissions Database (CASA-GFED) fluxes, that capture much of the CO2 variation from synoptic to seasonal to global scales. We have run the NU-WRF model using unconstrained, internally generated meteorology within the North American domain, and with meteorological 'nudging' from Global Forecast System and North American Regional Reanalysis (NARR) in an effort to optimize the CO2 simulations. Output results constrained by NARR show the best comparisons to data. Discrepancies, of course, may arise either from flux or transport errors and compensating errors are possible. Resolving their interplay is also important to using the data in inverse models. Recent analysis is focused on planetary boundary depth, which can be significantly different between MERRA and NU-WRF, along with subgrid transport differences. Characterization of transport differences between the models will allow us to better constrain the CO2 fluxes, which is the major objective of this work.

  7. Ground-water models for water resource planning

    USGS Publications Warehouse

    Moore, J.E.

    1983-01-01

    In the past decade hydrogeologists have emphasized the development of computer-based mathematical models to aid in the understanding of flow, the transport of solutes, transport of heat, and deformation in the ground-water system. These models have been used to provide information and predictions for water managers. Too frequently, ground-water was neglected in water resource planning because managers believed that it could not be adequately evaluated in terms of availability, quality, and effect of development on surface-water supplies. Now, however, with newly developed digital ground-water models, effects of development can be predicted. Such models have been used to predict hydrologic and quality changes under different stresses. These models have grown in complexity over the last ten years from simple one-layer models to three-dimensional simulations of ground-water flow, which may include solute transport, heat transport, effects of land subsidence, and encroachment of saltwater. Case histories illustrate how predictive ground-water models have provided the information needed for the sound planning and management of water resources in the USA. ?? 1983 D. Reidel Publishing Company.

  8. A characteristics-based method for solving the transport equation and its application to the process of mantle differentiation and continental root growth

    NASA Astrophysics Data System (ADS)

    de Smet, Jeroen H.; van den Berg, Arie P.; Vlaar, Nico J.; Yuen, David A.

    2000-03-01

    Purely advective transport of composition is of major importance in the Geosciences, and efficient and accurate solution methods are needed. A characteristics-based method is used to solve the transport equation. We employ a new hybrid interpolation scheme, which allows for the tuning of stability and accuracy through a threshold parameter ɛth. Stability is established by bilinear interpolations, and bicubic splines are used to maintain accuracy. With this scheme, numerical instabilities can be suppressed by allowing numerical diffusion to work in time and locally in space. The scheme can be applied efficiently for preliminary modelling purposes. This can be followed by detailed high-resolution experiments. First, the principal effects of this hybrid interpolation method are illustrated and some tests are presented for numerical solutions of the transport equation. Second, we illustrate that this approach works successfully for a previously developed continental evolution model for the convecting upper mantle. In this model the transport equation contains a source term, which describes the melt production in pressure-released partial melting. In this model, a characteristic phenomenon of small-scale melting diapirs is observed (De Smet et al.1998; De Smet et al. 1999). High-resolution experiments with grid cells down to 700m horizontally and 515m vertically result in highly detailed observations of the diapiric melting phenomenon.

  9. Exploring a potential energy surface by machine learning for characterizing atomic transport

    NASA Astrophysics Data System (ADS)

    Kanamori, Kenta; Toyoura, Kazuaki; Honda, Junya; Hattori, Kazuki; Seko, Atsuto; Karasuyama, Masayuki; Shitara, Kazuki; Shiga, Motoki; Kuwabara, Akihide; Takeuchi, Ichiro

    2018-03-01

    We propose a machine-learning method for evaluating the potential barrier governing atomic transport based on the preferential selection of dominant points for atomic transport. The proposed method generates numerous random samples of the entire potential energy surface (PES) from a probabilistic Gaussian process model of the PES, which enables defining the likelihood of the dominant points. The robustness and efficiency of the method are demonstrated on a dozen model cases for proton diffusion in oxides, in comparison with a conventional nudge elastic band method.

  10. Soil moisture modeling review

    NASA Technical Reports Server (NTRS)

    Hildreth, W. W.

    1978-01-01

    A determination of the state of the art in soil moisture transport modeling based on physical or physiological principles was made. It was found that soil moisture models based on physical principles have been under development for more than 10 years. However, these models were shown to represent infiltration and redistribution of soil moisture quite well. Evapotranspiration has not been as adequately incorporated into the models.

  11. Tomographic imaging of non-local media based on space-fractional diffusion models

    NASA Astrophysics Data System (ADS)

    Buonocore, Salvatore; Semperlotti, Fabio

    2018-06-01

    We investigate a generalized tomographic imaging framework applicable to a class of inhomogeneous media characterized by non-local diffusive energy transport. Under these conditions, the transport mechanism is well described by fractional-order continuum models capable of capturing anomalous diffusion that would otherwise remain undetected when using traditional integer-order models. Although the underlying idea of the proposed framework is applicable to any transport mechanism, the case of fractional heat conduction is presented as a specific example to illustrate the methodology. By using numerical simulations, we show how complex inhomogeneous media involving non-local transport can be successfully imaged if fractional order models are used. In particular, results will show that by properly recognizing and accounting for the fractional character of the host medium not only allows achieving increased resolution but, in case of strong and spatially distributed non-locality, it represents the only viable approach to achieve a successful reconstruction.

  12. Multiscale Sediment-Laden Flow Theory and Its Application in Flood Risk Management

    NASA Astrophysics Data System (ADS)

    Cao, Z. X.; Pender, G.; Hu, P.

    2011-09-01

    Sediment-laden flows over erodible bed normally feature multiple time scales. The time scales of sediment transport and bed deformation relative to the flow essentially measure how fast sediment transport adapts to capacity regime in line with local flow scenario and the bed deforms as compared to the flow, which literally dictate if a capacity based and/or decoupled model is justified. This paper synthesizes the recently developed multiscale theory for sediment-laden flows over erodible bed, with bed load and suspended load transport respectively. It is unravelled that bed load transport can adapt to capacity sufficiently rapidly even under highly unsteady flows and thus a capacity model is mostly applicable, whereas a non-capacity model is critical for suspended sediment because of the lower rate of adaptation to capacity. Physically coupled modeling is critical for cases characterized by rapid bed variation. Applications are outlined on flash floods and landslide dam break floods.

  13. Rational design of capillary-driven flows for paper-based microfluidics.

    PubMed

    Elizalde, Emanuel; Urteaga, Raúl; Berli, Claudio L A

    2015-05-21

    The design of paper-based assays that integrate passive pumping requires a precise programming of the fluid transport, which has to be encoded in the geometrical shape of the substrate. This requirement becomes critical in multiple-step processes, where fluid handling must be accurate and reproducible for each operation. The present work theoretically investigates the capillary imbibition in paper-like substrates to better understand fluid transport in terms of the macroscopic geometry of the flow domain. A fluid dynamic model was derived for homogeneous porous substrates with arbitrary cross-sectional shapes, which allows one to determine the cross-sectional profile required for a prescribed fluid velocity or mass transport rate. An extension of the model to slit microchannels is also demonstrated. Calculations were validated by experiments with prototypes fabricated in our lab. The proposed method constitutes a valuable tool for the rational design of paper-based assays.

  14. Predicting longshore gradients in longshore transport: the CERC formula compared to Delft3D

    USGS Publications Warehouse

    List, Jeffrey H.; Hanes, Daniel M.; Ruggiero, Peter

    2007-01-01

    The prediction of longshore transport gradients is critical for forecasting shoreline change. We employ simple test cases consisting of shoreface pits at varying distances from the shoreline to compare the longshore transport gradients predicted by the CERC formula against results derived from the process-based model Delft3D. Results show that while in some cases the two approaches give very similar results, in many cases the results diverge greatly. Although neither approach is validated with field data here, the Delft3D-based transport gradients provide much more consistent predictions of erosional and accretionary zones as the pit location varies across the shoreface.

  15. DRAINWAT--Based Methods For Estimating Nitrogen Transport in Poorly Drained Watersheds

    Treesearch

    Devendra M. Amatya; George M. Chescheir; Glenn P. Fernandez; R. Wayne Skaggs; J.W. Gilliam

    2004-01-01

    Methods are needed to quantify effects of land use and management practices on nutrient and sediment loads at the watershed scale. Two methods were used to apply a DRAINMOD-based watershed-scale model (DRAINWAT) to estimate total nitrogen (N) transport from a poorly drained, forested watershed. In both methods, in-stream retention or losses of N were calculated with a...

  16. Prediction of water loss and viscoelastic deformation of apple tissue using a multiscale model.

    PubMed

    Aregawi, Wondwosen A; Abera, Metadel K; Fanta, Solomon W; Verboven, Pieter; Nicolai, Bart

    2014-11-19

    A two-dimensional multiscale water transport and mechanical model was developed to predict the water loss and deformation of apple tissue (Malus × domestica Borkh. cv. 'Jonagold') during dehydration. At the macroscopic level, a continuum approach was used to construct a coupled water transport and mechanical model. Water transport in the tissue was simulated using a phenomenological approach using Fick's second law of diffusion. Mechanical deformation due to shrinkage was based on a structural mechanics model consisting of two parts: Yeoh strain energy functions to account for non-linearity and Maxwell's rheological model of visco-elasticity. Apparent parameters of the macroscale model were computed from a microscale model. The latter accounted for water exchange between different microscopic structures of the tissue (intercellular space, the cell wall network and cytoplasm) using transport laws with the water potential as the driving force for water exchange between different compartments of tissue. The microscale deformation mechanics were computed using a model where the cells were represented as a closed thin walled structure. The predicted apparent water transport properties of apple cortex tissue from the microscale model showed good agreement with the experimentally measured values. Deviations between calculated and measured mechanical properties of apple tissue were observed at strains larger than 3%, and were attributed to differences in water transport behavior between the experimental compression tests and the simulated dehydration-deformation behavior. Tissue dehydration and deformation in the high relative humidity range ( > 97% RH) could, however, be accurately predicted by the multiscale model. The multiscale model helped to understand the dynamics of the dehydration process and the importance of the different microstructural compartments (intercellular space, cell wall, membrane and cytoplasm) for water transport and mechanical deformation.

  17. Longitudinal train dynamics model for a rail transit simulation system

    DOE PAGES

    Wang, Jinghui; Rakha, Hesham A.

    2018-01-01

    The paper develops a longitudinal train dynamics model in support of microscopic railway transportation simulation. The model can be calibrated without any mechanical data making it ideal for implementation in transportation simulators. The calibration and validation work is based on data collected from the Portland light rail train fleet. The calibration procedure is mathematically formulated as a constrained non-linear optimization problem. The validity of the model is assessed by comparing instantaneous model predictions against field observations, and also evaluated in the domains of acceleration/deceleration versus speed and acceleration/deceleration versus distance. A test is conducted to investigate the adequacy of themore » model in simulation implementation. The results demonstrate that the proposed model can adequately capture instantaneous train dynamics, and provides good performance in the simulation test. Thus, the model provides a simple theoretical foundation for microscopic simulators and will significantly support the planning, management and control of railway transportation systems.« less

  18. Past, present and prospect of an Artificial Intelligence (AI) based model for sediment transport prediction

    NASA Astrophysics Data System (ADS)

    Afan, Haitham Abdulmohsin; El-shafie, Ahmed; Mohtar, Wan Hanna Melini Wan; Yaseen, Zaher Mundher

    2016-10-01

    An accurate model for sediment prediction is a priority for all hydrological researchers. Many conventional methods have shown an inability to achieve an accurate prediction of suspended sediment. These methods are unable to understand the behaviour of sediment transport in rivers due to the complexity, noise, non-stationarity, and dynamism of the sediment pattern. In the past two decades, Artificial Intelligence (AI) and computational approaches have become a remarkable tool for developing an accurate model. These approaches are considered a powerful tool for solving any non-linear model, as they can deal easily with a large number of data and sophisticated models. This paper is a review of all AI approaches that have been applied in sediment modelling. The current research focuses on the development of AI application in sediment transport. In addition, the review identifies major challenges and opportunities for prospective research. Throughout the literature, complementary models superior to classical modelling.

  19. Longitudinal train dynamics model for a rail transit simulation system

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Jinghui; Rakha, Hesham A.

    The paper develops a longitudinal train dynamics model in support of microscopic railway transportation simulation. The model can be calibrated without any mechanical data making it ideal for implementation in transportation simulators. The calibration and validation work is based on data collected from the Portland light rail train fleet. The calibration procedure is mathematically formulated as a constrained non-linear optimization problem. The validity of the model is assessed by comparing instantaneous model predictions against field observations, and also evaluated in the domains of acceleration/deceleration versus speed and acceleration/deceleration versus distance. A test is conducted to investigate the adequacy of themore » model in simulation implementation. The results demonstrate that the proposed model can adequately capture instantaneous train dynamics, and provides good performance in the simulation test. Thus, the model provides a simple theoretical foundation for microscopic simulators and will significantly support the planning, management and control of railway transportation systems.« less

  20. Testing a blowing snow model against distributed snow measurements at Upper Sheep Creek, Idaho, United States of America

    Treesearch

    Rajiv Prasad; David G. Tarboton; Glen E. Liston; Charles H. Luce; Mark S. Seyfried

    2001-01-01

    In this paper a physically based snow transport model (SnowTran-3D) was used to simulate snow drifting over a 30 m grid and was compared to detailed snow water equivalence (SWE) surveys on three dates within a small 0.25 km2 subwatershed, Upper Sheep Creek. Two precipitation scenarios and two vegetation scenarios were used to carry out four snow transport model runs in...

  1. Application of nonlinear adaptive motion washout to transport ground-handling simulation

    NASA Technical Reports Server (NTRS)

    Parrish, R. V.; Martin, D. J., Jr.

    1983-01-01

    The application of a nonlinear coordinated adaptive motion washout to the transport ground-handling environment is documented. Additions to both the aircraft math model and the motion washout system are discussed. The additions to the simulated-aircraft math model provided improved modeling fidelity for braking and reverse-thrust application, and the additions to the motion-base washout system allowed transition from the desired flight parameters to the less restrictive ground parameters of the washout.

  2. Turbulent particle transport in streams: can exponential settling be reconciled with fluid mechanics?

    PubMed

    McNair, James N; Newbold, J Denis

    2012-05-07

    Most ecological studies of particle transport in streams that focus on fine particulate organic matter or benthic invertebrates use the Exponential Settling Model (ESM) to characterize the longitudinal pattern of particle settling on the bed. The ESM predicts that if particles are released into a stream, the proportion that have not yet settled will decline exponentially with transport time or distance and will be independent of the release elevation above the bed. To date, no credible basis in fluid mechanics has been established for this model, nor has it been rigorously tested against more-mechanistic alternative models. One alternative is the Local Exchange Model (LEM), which is a stochastic advection-diffusion model that includes both longitudinal and vertical spatial dimensions and is based on classical fluid mechanics. The LEM predicts that particle settling will be non-exponential in the near field but will become exponential in the far field, providing a new theoretical justification for far-field exponential settling that is based on plausible fluid mechanics. We review properties of the ESM and LEM and compare these with available empirical evidence. Most evidence supports the prediction of both models that settling will be exponential in the far field but contradicts the ESM's prediction that a single exponential distribution will hold for all transport times and distances. Copyright © 2012 Elsevier Ltd. All rights reserved.

  3. Computational Fluid Dynamics modeling of contrast transport in basilar aneurysms following flow-altering surgeries.

    PubMed

    Vali, Alireza; Abla, Adib A; Lawton, Michael T; Saloner, David; Rayz, Vitaliy L

    2017-01-04

    In vivo measurement of blood velocity fields and flow descriptors remains challenging due to image artifacts and limited resolution of current imaging methods; however, in vivo imaging data can be used to inform and validate patient-specific computational fluid dynamics (CFD) models. Image-based CFD can be particularly useful for planning surgical interventions in complicated cases such as fusiform aneurysms of the basilar artery, where it is crucial to alter pathological hemodynamics while preserving flow to the distal vasculature. In this study, patient-specific CFD modeling was conducted for two basilar aneurysm patients considered for surgical treatment. In addition to velocity fields, transport of contrast agent was simulated for the preoperative and postoperative conditions using two approaches. The transport of a virtual contrast passively following the flow streamlines was simulated to predict post-surgical flow regions prone to thrombus deposition. In addition, the transport of a mixture of blood with an iodine-based contrast agent was modeled to compare and verify the CFD results with X-ray angiograms. The CFD-predicted patterns of contrast flow were qualitatively compared to in vivo X-ray angiograms acquired before and after the intervention. The results suggest that the mixture modeling approach, accounting for the flow rates and properties of the contrast injection, is in better agreement with the X-ray angiography data. The virtual contrast modeling assessed the residence time based on flow patterns unaffected by the injection procedure, which makes the virtual contrast modeling approach better suited for prediction of thrombus deposition, which is not limited to the peri-procedural state. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Perfluoroalkyl phosphonic and phosphinic acids as proton conductors for anhydrous proton-exchange membranes.

    PubMed

    Herath, Mahesha B; Creager, Stephen E; Kitaygorodskiy, Alex; DesMarteau, Darryl D

    2010-09-10

    A study of proton-transport rates and mechanisms under anhydrous conditions using a series of acid model compounds, analogous to comb-branch perfluorinated ionomers functionalized with phosphonic, phosphinic, sulfonic, and carboxylic acid protogenic groups, is reported. Model compounds are characterized with respect to proton conductivity, viscosity, proton, and anion (conjugate base) self-diffusion coefficients, and Hammett acidity. The highest conductivities, and also the highest viscosities, are observed for the phosphonic and phosphinic acid model compounds. Arrhenius analysis of conductivity and viscosity for these two acids reveals much lower activation energies for ion transport than for viscous flow. Additionally, the proton self-diffusion coefficients are much higher than the conjugate-base self-diffusion coefficients for these two acids. Taken together, these data suggest that anhydrous proton transport in the phosphonic and phosphinic acid model compounds occurs primarily by a structure-diffusion, hopping-based mechanism rather than a vehicle mechanism. Further analysis of ionic conductivity and ion self-diffusion rates by using the Nernst-Einstein equation reveals that the phosphonic and phosphinic acid model compounds are relatively highly dissociated even under anhydrous conditions. In contrast, sulfonic and carboxylic acid-based systems exhibit relatively low degrees of dissociation under anhydrous conditions. These findings suggest that fluoroalkyl phosphonic and phosphinic acids are good candidates for further development as anhydrous, high-temperature proton conductors.

  5. Position-dependent effects of polylysine on Sec protein transport.

    PubMed

    Liang, Fu-Cheng; Bageshwar, Umesh K; Musser, Siegfried M

    2012-04-13

    The bacterial Sec protein translocation system catalyzes the transport of unfolded precursor proteins across the cytoplasmic membrane. Using a recently developed real time fluorescence-based transport assay, the effects of the number and distribution of positive charges on the transport time and transport efficiency of proOmpA were examined. As expected, an increase in the number of lysine residues generally increased transport time and decreased transport efficiency. However, the observed effects were highly dependent on the polylysine position in the mature domain. In addition, a string of consecutive positive charges generally had a more significant effect on transport time and efficiency than separating the charges into two or more charged segments. Thirty positive charges distributed throughout the mature domain resulted in effects similar to 10 consecutive charges near the N terminus of the mature domain. These data support a model in which the local effects of positive charge on the translocation kinetics dominate over total thermodynamic constraints. The rapid translocation kinetics of some highly charged proOmpA mutants suggest that the charge is partially shielded from the electric field gradient during transport, possibly by the co-migration of counter ions. The transport times of precursors with multiple positively charged sequences, or "pause sites," were fairly well predicted by a local effect model. However, the kinetic profile predicted by this local effect model was not observed. Instead, the transport kinetics observed for precursors with multiple polylysine segments support a model in which translocation through the SecYEG pore is not the rate-limiting step of transport.

  6. Position-dependent Effects of Polylysine on Sec Protein Transport*

    PubMed Central

    Liang, Fu-Cheng; Bageshwar, Umesh K.; Musser, Siegfried M.

    2012-01-01

    The bacterial Sec protein translocation system catalyzes the transport of unfolded precursor proteins across the cytoplasmic membrane. Using a recently developed real time fluorescence-based transport assay, the effects of the number and distribution of positive charges on the transport time and transport efficiency of proOmpA were examined. As expected, an increase in the number of lysine residues generally increased transport time and decreased transport efficiency. However, the observed effects were highly dependent on the polylysine position in the mature domain. In addition, a string of consecutive positive charges generally had a more significant effect on transport time and efficiency than separating the charges into two or more charged segments. Thirty positive charges distributed throughout the mature domain resulted in effects similar to 10 consecutive charges near the N terminus of the mature domain. These data support a model in which the local effects of positive charge on the translocation kinetics dominate over total thermodynamic constraints. The rapid translocation kinetics of some highly charged proOmpA mutants suggest that the charge is partially shielded from the electric field gradient during transport, possibly by the co-migration of counter ions. The transport times of precursors with multiple positively charged sequences, or “pause sites,” were fairly well predicted by a local effect model. However, the kinetic profile predicted by this local effect model was not observed. Instead, the transport kinetics observed for precursors with multiple polylysine segments support a model in which translocation through the SecYEG pore is not the rate-limiting step of transport. PMID:22367204

  7. Modeling the Provenance of Crater Ejecta

    NASA Astrophysics Data System (ADS)

    Huang, Ya-Huei; Minton, David A.

    2014-11-01

    The cratering history of the Moon provides a way to study the violent early history of our early solar system. Nevertheless, we are still limited in our ability to interpret the lunar cratering history because the complex process of generation and subsequent transportation and destruction of impact melt products is relatively poorly understood. Here we describe a preliminary model for the transport of datable impact melt products by craters over Gy timescales on the lunar surface. We use a numerical model based on the Maxwell Z-model to model the exhumation and transport of ejecta material from within the excavation flow of a transient crater. We describe our algorithm for rapidly estimating the provenance of ejecta material for use in a Monte Carlo cratering code capable of simulating lunar cratering over Gy timescales.

  8. Ozone formation during an episode over Europe: A 3-D chemical/transport model simulation

    NASA Technical Reports Server (NTRS)

    Berntsen, Terje; Isaksen, Ivar S. A.

    1994-01-01

    A 3-D regional photochemical tracer/transport model for Europe and the Eastern Atlantic has been developed based on the NASA/GISS CTM. The model resolution is 4x5 degrees latitude and longitude with 9 layers in the vertical (7 in the troposphere). Advective winds, convection statistics and other meteorological data from the NASA/GISS GCM are used. An extensive gas-phase chemical scheme based on the scheme used in our global 2D model has been incorporated in the 3D model. In this work ozone formation in the troposphere is studied with the 3D model during a 5 day period starting June 30. Extensive local ozone production is found and the relationship between the source regions and the downwind areas are discussed. Variations in local ozone formation as a function of total emission rate, as well as the composition of the emissions (HC/NO(x)) ratio and isoprene emissions) are elucidated. An important vertical transport process in the troposphere is by convective clouds. The 3D model includes an explicit parameterization of this process. It is shown that this process has significant influence on the calculated surface ozone concentrations.

  9. Chemical vapor deposition modeling for high temperature materials

    NASA Technical Reports Server (NTRS)

    Gokoglu, Suleyman A.

    1992-01-01

    The formalism for the accurate modeling of chemical vapor deposition (CVD) processes has matured based on the well established principles of transport phenomena and chemical kinetics in the gas phase and on surfaces. The utility and limitations of such models are discussed in practical applications for high temperature structural materials. Attention is drawn to the complexities and uncertainties in chemical kinetics. Traditional approaches based on only equilibrium thermochemistry and/or transport phenomena are defended as useful tools, within their validity, for engineering purposes. The role of modeling is discussed within the context of establishing the link between CVD process parameters and material microstructures/properties. It is argued that CVD modeling is an essential part of designing CVD equipment and controlling/optimizing CVD processes for the production and/or coating of high performance structural materials.

  10. Using RAQMS Chemical Transport Model, Aircraft In-situ and Satellite Data to Verify Ground-based Biomass Burning Emissions from the Extreme Fire Event in Boreal Alaska 2004

    NASA Astrophysics Data System (ADS)

    Soja, A. J.; Pierce, R. B.; Al-Saadi, J. A.; Alvarado, E.; Sandberg, D. V.; Ottmar, R. D.; Kittaka, C.; McMillian, W. W.; Sachse, G. W.; Warner, J. X.; Szykman, J. J.

    2006-12-01

    Current climate change scenarios are predicted to result in increased biomass burning, particularly in boreal regions. Biomass burning events feedback to the climate system by altering albedo (affecting the energy balance) and by direct and indirect fire emissions. Additionally, fire emissions influence air quality and human health downwind of burning. Biomass burning emission estimates are difficult to quantify in near-real-time and accurate estimates are useful for large-scale chemical transport models, which could be used to warn the public of potential health risks and for climate modeling. In this talk, we describe a methodology to quantify emissions, validate those emission estimates, transport the emissions and verify the resultant CO plume 100's of kilometers from the fire events using aircraft in-situ and satellite data. First, we developed carbon consumption estimates that are specifically designed for near-real-time use in conjunction with satellite-derived fire data for regional- to global-chemical transport models. Large-scale carbon consumption estimates are derived for 10 ecozones across North America and each zone contains 3 classes of severity. The estimates range is from a low severity 3.11 t C ha-1 estimate from the Western Taiga Shield to a high severity 59.83 t C ha-1 estimate from the Boreal Cordillera. These estimates are validated using extensive supplementary ground-based Alaskan data. Then, the RAQMS chemical transport model ingests these data and transports CO from the Alaskan 2004 fires across North America, where results are compared with in-situ flight CO data measured during INTEX-A and satellite-based CO data (AIRS and MOPITT). Ground-based CO is 6 to 14 times greater than the typically modeled fire climatology. RAQMS often overestimates CO in the biomass plumes in comparison to satellite- derived CO data and we suspect this may be due to the satellite instruments low sensitivity to planetary boundary layer CO, which is prevalent in the near field plumes, and also the assumption of high-severity fires throughout the burning season. RAQMS underestimates biomass CO in comparison to in-situ CO data (146 out of 148 ascents and descents), and we suspect this may be due to RAQMS difficulty in defining narrow fire plumes due to the 1.4° x 1.4° resolution.

  11. Modeling & processing of ceramic and polymer precursor ceramic matrix composite materials

    NASA Astrophysics Data System (ADS)

    Wang, Xiaolin

    Synthesis and processing of novel materials with various advanced approaches have attracted much attention of engineers and scientists for the past thirty years. Many advanced materials display a number of exceptional properties and can be produced with different novel processing techniques. For example, AlN is a promising candidate for electronic, optical and opto-electronic applications due to its high thermal conductivity, high electrical resistivity, high acoustic wave velocity and large band gap. Large bulk AlN crystal can be produced by sublimation of AlN powder. Novel nonostructured multicomponent refractory metal-based ceramics (carbides, borides and nitrides) show a lot of exceptional mechanical, thermal and chemical properties, and can be easily produced by pyrolysis of suitable preceramic precursors mixed with metal particles. The objective of this work is to study sublimation and synthesis of AlN powder, and synthesis of SiC-based metal ceramics. For AlN sublimation crystal growth, we will focus on modeling the processes in the powder source that affect significantly the sublimation growth as a whole. To understand the powder porosity evolution and vapor transport during powder sublimation, the interplay between vapor transport and powder sublimation will be studied. A physics-based computational model will be developed considering powder sublimation and porosity evolution. Based on the proposed model, the effect of a central hole in the powder on the sublimation rate is studied and the result is compared to the case of powder without a hole. The effect of hole size on the sublimation rate will be studied. The effects of initial porosity, particle size and driving force on the sublimation rate are also studied. Moreover, the optimal growth condition for large diameter crystal quality and high growth rate will be determined. For synthesis of SiC-based metal ceramics, we will focus on developing a multi-scale process model to describe the dynamic behavior of filler particle reaction, microstructure evolution, at the microscale as well as transient fluid flow, heat transfer, and species transport at the macroscale. The model comprises of (i) a microscale model and (ii) a macroscale transport model, and aims to provide optimal conditions for the fabrication process of the ceramics. The porous media macroscale model for SiC-based metal-ceramic materials processing will be developed to understand the thermal polymer pyrolysis, chemical reaction of active fillers and transport phenomena in the porous media. The macroscale model will include heat and mass transfer, curing, pyrolysis, chemical reaction and crystallization in a mixture of preceramic polymers and submicron/nano-sized metal particles of uranium, zirconium, niobium, or hafnium. The effects of heating rate, sample size, size and volume ratio of the metal particles on the reaction rate and product uniformity will be studied. The microscale model will be developed for modeling the synthesis of SiC matrix and metal particles. The macroscale model provides thermal boundary conditions to the microscale model. The microscale model applies to repetitive units in the porous structure and describes mass transport, composition changes and motion of metal particles. The unit-cell is the representation unit of the source material, and it consists of several metal particles, SiC matrix and other components produced from the synthesis process. The reactions between different components, the microstructure evolution of the product will be considered. The effects of heating rate and metal particle size on species uniformity and microstructure are investigated.

  12. Electrical and fluid transport in consolidated sphere packs

    NASA Astrophysics Data System (ADS)

    Zhan, Xin; Schwartz, Lawrence M.; Toksöz, M. Nafi

    2015-05-01

    We calculate geometrical and transport properties (electrical conductivity, permeability, specific surface area, and surface conductivity) of a family of model granular porous media from an image based representation of its microstructure. The models are based on the packing described by Finney and cover a wide range of porosities. Finite difference methods are applied to solve for electrical conductivity and hydraulic permeability. Two image processing methods are used to identify the pore-grain interface and to test correlations linking permeability to electrical conductivity. A three phase conductivity model is developed to compute surface conductivity associated with the grain-pore interface. Our results compare well against empirical models over the entire porosity range studied. We conclude by examining the influence of image resolution on our calculations.

  13. Field-dependent critical state of high-Tc superconducting strip simultaneously exposed to transport current and perpendicular magnetic field

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xue, Cun; He, An; Yong, Huadong

    We present an exact analytical approach for arbitrary field-dependent critical state of high-T{sub c} superconducting strip with transport current. The sheet current and flux-density profiles are derived by solving the integral equations, which agree with experiments quite well. For small transport current, the approximate explicit expressions of sheet current, flux-density and penetration depth for the Kim model are derived based on the mean value theorem for integration. We also extend the results to the field-dependent critical state of superconducting strip in the simultaneous presence of applied field and transport current. The sheet current distributions calculated by the Kim model agreemore » with experiments better than that by the Bean model. Moreover, the lines in the I{sub a}-B{sub a} plane for the Kim model are not monotonic, which is quite different from that the Bean model. The results reveal that the maximum transport current in thin superconducting strip will decrease with increasing applied field which vanishes for the Bean model. The results of this paper are useful to calculate ac susceptibility and ac loss.« less

  14. Comprehensive Validation of an Intermittency Transport Model for Transitional Low-Pressure Turbine Flows

    NASA Technical Reports Server (NTRS)

    Suzen, Y. B.; Huang, P. G.

    2005-01-01

    A transport equation for the intermittency factor is employed to predict transitional flows under the effects of pressure gradients, freestream turbulence intensities, Reynolds number variations, flow separation and reattachment. and unsteady wake-blade interactions representing diverse operating conditions encountered in low-pressure turbines. The intermittent behaviour of the transitional flows is taken into account and incorporated into computations by modifying the eddy viscosity, Mu(sub t), with the intermittency factor, gamma. Turbulent quantities are predicted by using Menter's two-equation turbulence model (SST). The onset location of transition is obtained from correlations based on boundary-layer momentum thickness, acceleration parameter, and turbulence intensity. The intermittency factor is obtained from a transport model which can produce both the experimentally observed streamwise variation of intermittency and a realistic profile in the cross stream direction. The intermittency transport model is tested and validated against several well documented low pressure turbine experiments ranging from flat plate cases to unsteady wake-blade interaction experiments. Overall, good agreement between the experimental data and computational results is obtained illustrating the predicting capabilities of the model and the current intermittency transport modelling approach for transitional flow simulations.

  15. Validation metrics for turbulent plasma transport

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Holland, C., E-mail: chholland@ucsd.edu

    Developing accurate models of plasma dynamics is essential for confident predictive modeling of current and future fusion devices. In modern computer science and engineering, formal verification and validation processes are used to assess model accuracy and establish confidence in the predictive capabilities of a given model. This paper provides an overview of the key guiding principles and best practices for the development of validation metrics, illustrated using examples from investigations of turbulent transport in magnetically confined plasmas. Particular emphasis is given to the importance of uncertainty quantification and its inclusion within the metrics, and the need for utilizing synthetic diagnosticsmore » to enable quantitatively meaningful comparisons between simulation and experiment. As a starting point, the structure of commonly used global transport model metrics and their limitations is reviewed. An alternate approach is then presented, which focuses upon comparisons of predicted local fluxes, fluctuations, and equilibrium gradients against observation. The utility of metrics based upon these comparisons is demonstrated by applying them to gyrokinetic predictions of turbulent transport in a variety of discharges performed on the DIII-D tokamak [J. L. Luxon, Nucl. Fusion 42, 614 (2002)], as part of a multi-year transport model validation activity.« less

  16. Coarsening of physics for biogeochemical model in NEMO

    NASA Astrophysics Data System (ADS)

    Bricaud, Clement; Le Sommer, Julien; Madec, Gurvan; Deshayes, Julie; Chanut, Jerome; Perruche, Coralie

    2017-04-01

    Ocean mesoscale and submesoscale turbulence contribute to ocean tracer transport and to shaping ocean biogeochemical tracers distribution. Representing adequately tracer transport in ocean models therefore requires to increase model resolution so that the impact of ocean turbulence is adequately accounted for. But due to supercomputers power and storage limitations, global biogeochemical models are not yet run routinely at eddying resolution. Still, because the "effective resolution" of eddying ocean models is much coarser than the physical model grid resolution, tracer transport can be reconstructed to a large extent by computing tracer transport and diffusion with a model grid resolution close to the effective resolution of the physical model. This observation has motivated the implementation of a new capability in NEMO ocean model (http://www.nemo-ocean.eu/) that allows to run the physical model and the tracer transport model at different grid resolutions. In a first time, we present results obtained with this new capability applied to a synthetic age tracer in a global eddying model configuration. In this model configuration, ocean dynamic is computed at ¼° resolution but tracer transport is computed at 3/4° resolution. The solution obtained is compared to 2 reference setup ,one at ¼° resolution for both physics and passive tracer models and one at 3/4° resolution for both physics and passive tracer model. We discuss possible options for defining the vertical diffusivity coefficient for the tracer transport model based on information from the high resolution grid. We describe the impact of this choice on the distribution and one the penetration of the age tracer. In a second time we present results obtained by coupling the physics with the biogeochemical model PISCES. We look at the impact of this methodology on some tracers distribution and dynamic. The method described here can found applications in ocean forecasting, such as the Copernicus Marine service operated by Mercator-Ocean, and in Earth System Models for climate applications.

  17. A big-data model for multi-modal public transportation with application to macroscopic control and optimisation

    NASA Astrophysics Data System (ADS)

    Faizrahnemoon, Mahsa; Schlote, Arieh; Maggi, Lorenzo; Crisostomi, Emanuele; Shorten, Robert

    2015-11-01

    This paper describes a Markov-chain-based approach to modelling multi-modal transportation networks. An advantage of the model is the ability to accommodate complex dynamics and handle huge amounts of data. The transition matrix of the Markov chain is built and the model is validated using the data extracted from a traffic simulator. A realistic test-case using multi-modal data from the city of London is given to further support the ability of the proposed methodology to handle big quantities of data. Then, we use the Markov chain as a control tool to improve the overall efficiency of a transportation network, and some practical examples are described to illustrate the potentials of the approach.

  18. Recommended direct simulation Monte Carlo collision model parameters for modeling ionized air transport processes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Swaminathan-Gopalan, Krishnan; Stephani, Kelly A., E-mail: ksteph@illinois.edu

    2016-02-15

    A systematic approach for calibrating the direct simulation Monte Carlo (DSMC) collision model parameters to achieve consistency in the transport processes is presented. The DSMC collision cross section model parameters are calibrated for high temperature atmospheric conditions by matching the collision integrals from DSMC against ab initio based collision integrals that are currently employed in the Langley Aerothermodynamic Upwind Relaxation Algorithm (LAURA) and Data Parallel Line Relaxation (DPLR) high temperature computational fluid dynamics solvers. The DSMC parameter values are computed for the widely used Variable Hard Sphere (VHS) and the Variable Soft Sphere (VSS) models using the collision-specific pairing approach.more » The recommended best-fit VHS/VSS parameter values are provided over a temperature range of 1000-20 000 K for a thirteen-species ionized air mixture. Use of the VSS model is necessary to achieve consistency in transport processes of ionized gases. The agreement of the VSS model transport properties with the transport properties as determined by the ab initio collision integral fits was found to be within 6% in the entire temperature range, regardless of the composition of the mixture. The recommended model parameter values can be readily applied to any gas mixture involving binary collisional interactions between the chemical species presented for the specified temperature range.« less

  19. Quantitative Analysis of Complex Drug-Drug Interactions Between Repaglinide and Cyclosporin A/Gemfibrozil Using Physiologically Based Pharmacokinetic Models With In Vitro Transporter/Enzyme Inhibition Data.

    PubMed

    Kim, Soo-Jin; Toshimoto, Kota; Yao, Yoshiaki; Yoshikado, Takashi; Sugiyama, Yuichi

    2017-09-01

    Quantitative analysis of transporter- and enzyme-mediated complex drug-drug interactions (DDIs) is challenging. Repaglinide (RPG) is transported into the liver by OATP1B1 and then is metabolized by CYP2C8 and CYP3A4. The purpose of this study was to describe the complex DDIs of RPG quantitatively based on unified physiologically based pharmacokinetic (PBPK) models using in vitro K i values for OATP1B1, CYP3A4, and CYP2C8. Cyclosporin A (CsA) or gemfibrozil (GEM) increased the blood concentrations of RPG. The time profiles of RPG and the inhibitors were analyzed by PBPK models, considering the inhibition of OATP1B1 and CYP3A4 by CsA or OATP1B1 inhibition by GEM and its glucuronide and the mechanism-based inhibition of CYP2C8 by GEM glucuronide. RPG-CsA interaction was closely predicted using a reported in vitro K i,OATP1B1 value in the presence of CsA preincubation. RPG-GEM interaction was underestimated compared with observed data, but the simulation was improved with the increase of f m,CYP2C8 . These results based on in vitro K i values for transport and metabolism suggest the possibility of a bottom-up approach with in vitro inhibition data for the prediction of complex DDIs using unified PBPK models and in vitro f m value of a substrate for multiple enzymes should be considered carefully for the prediction. Copyright © 2017 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

  20. Measuring the misfit between seismograms using an optimal transport distance: application to full waveform inversion

    NASA Astrophysics Data System (ADS)

    Métivier, L.; Brossier, R.; Mérigot, Q.; Oudet, E.; Virieux, J.

    2016-04-01

    Full waveform inversion using the conventional L2 distance to measure the misfit between seismograms is known to suffer from cycle skipping. An alternative strategy is proposed in this study, based on a measure of the misfit computed with an optimal transport distance. This measure allows to account for the lateral coherency of events within the seismograms, instead of considering each seismic trace independently, as is done generally in full waveform inversion. The computation of this optimal transport distance relies on a particular mathematical formulation allowing for the non-conservation of the total energy between seismograms. The numerical solution of the optimal transport problem is performed using proximal splitting techniques. Three synthetic case studies are investigated using this strategy: the Marmousi 2 model, the BP 2004 salt model, and the Chevron 2014 benchmark data. The results emphasize interesting properties of the optimal transport distance. The associated misfit function is less prone to cycle skipping. A workflow is designed to reconstruct accurately the salt structures in the BP 2004 model, starting from an initial model containing no information about these structures. A high-resolution P-wave velocity estimation is built from the Chevron 2014 benchmark data, following a frequency continuation strategy. This estimation explains accurately the data. Using the same workflow, full waveform inversion based on the L2 distance converges towards a local minimum. These results yield encouraging perspectives regarding the use of the optimal transport distance for full waveform inversion: the sensitivity to the accuracy of the initial model is reduced, the reconstruction of complex salt structure is made possible, the method is robust to noise, and the interpretation of seismic data dominated by reflections is enhanced.

  1. Colloid transport in saturated porous media: Elimination of attachment efficiency in a new colloid transport model

    USGS Publications Warehouse

    Landkamer, Lee L.; Harvey, Ronald W.; Scheibe, Timothy D.; Ryan, Joseph N.

    2013-01-01

    A colloid transport model is introduced that is conceptually simple yet captures the essential features of colloid transport and retention in saturated porous media when colloid retention is dominated by the secondary minimum because an electrostatic barrier inhibits substantial deposition in the primary minimum. This model is based on conventional colloid filtration theory (CFT) but eliminates the empirical concept of attachment efficiency. The colloid deposition rate is computed directly from CFT by assuming all predicted interceptions of colloids by collectors result in at least temporary deposition in the secondary minimum. Also, a new paradigm for colloid re-entrainment based on colloid population heterogeneity is introduced. To accomplish this, the initial colloid population is divided into two fractions. One fraction, by virtue of physiochemical characteristics (e.g., size and charge), will always be re-entrained after capture in a secondary minimum. The remaining fraction of colloids, again as a result of physiochemical characteristics, will be retained “irreversibly” when captured by a secondary minimum. Assuming the dispersion coefficient can be estimated from tracer behavior, this model has only two fitting parameters: (1) the fraction of the initial colloid population that will be retained “irreversibly” upon interception by a secondary minimum, and (2) the rate at which reversibly retained colloids leave the secondary minimum. These two parameters were correlated to the depth of the Derjaguin-Landau-Verwey-Overbeek (DLVO) secondary energy minimum and pore-water velocity, two physical forces that influence colloid transport. Given this correlation, the model serves as a heuristic tool for exploring the influence of physical parameters such as surface potential and fluid velocity on colloid transport.

  2. Systems Models for Transportation Problems : Volume 1. Introducing a Systems Science for Transportation Planning.

    DOT National Transportation Integrated Search

    1976-03-01

    This introductory portion of a system science for tranportation planning, which is based on the statistical physics of ensembles, a foundations laid on how statistical mechanics, equilibrium thermodynamics, and near equilbrium thermodynamics can be u...

  3. Abstract ID: 240 A probabilistic-based nuclear reaction model for Monte Carlo ion transport in particle therapy.

    PubMed

    Maria Jose, Gonzalez Torres; Jürgen, Henniger

    2018-01-01

    In order to expand the Monte Carlo transport program AMOS to particle therapy applications, the ion module is being developed in the radiation physics group (ASP) at the TU Dresden. This module simulates the three main interactions of ions in matter for the therapy energy range: elastic scattering, inelastic collisions and nuclear reactions. The simulation of the elastic scattering is based on the Binary Collision Approximation and the inelastic collisions on the Bethe-Bloch theory. The nuclear reactions, which are the focus of the module, are implemented according to a probabilistic-based model developed in the group. The developed model uses probability density functions to sample the occurrence of a nuclear reaction given the initial energy of the projectile particle as well as the energy at which this reaction will take place. The particle is transported until the reaction energy is reached and then the nuclear reaction is simulated. This approach allows a fast evaluation of the nuclear reactions. The theory and application of the proposed model will be addressed in this presentation. The results of the simulation of a proton beam colliding with tissue will also be presented. Copyright © 2017.

  4. Evaluation of Convective Transport in the GEOS-5 Chemistry and Climate Model

    NASA Technical Reports Server (NTRS)

    Pickering, Kenneth E.; Ott, Lesley E.; Shi, Jainn J.; Tao. Wei-Kuo; Mari, Celine; Schlager, Hans

    2011-01-01

    The NASA Goddard Earth Observing System (GEOS-5) Chemistry and Climate Model (CCM) consists of a global atmospheric general circulation model and the combined stratospheric and tropospheric chemistry package from the NASA Global Modeling Initiative (GMI) chemical transport model. The subgrid process of convective tracer transport is represented through the Relaxed Arakawa-Schubert parameterization in the GEOS-5 CCM. However, substantial uncertainty for tracer transport is associated with this parameterization, as is the case with all global and regional models. We have designed a project to comprehensively evaluate this parameterization from the point of view of tracer transport, and determine the most appropriate improvements that can be made to the GEOS-5 convection algorithm, allowing improvement in our understanding of the role of convective processes in determining atmospheric composition. We first simulate tracer transport in individual observed convective events with a cloud-resolving model (WRF). Initial condition tracer profiles (CO, CO2, O3) are constructed from aircraft data collected in undisturbed air, and the simulations are evaluated using aircraft data taken in the convective anvils. A single-column (SCM) version of the GEOS-5 GCM with online tracers is then run for the same convective events. SCM output is evaluated based on averaged tracer fields from the cloud-resolving model. Sensitivity simulations with adjusted parameters will be run in the SCM to determine improvements in the representation of convective transport. The focus of the work to date is on tropical continental convective events from the African Monsoon Multidisciplinary Analyses (AMMA) field mission in August 2006 that were extensively sampled by multiple research aircraft.

  5. Flow regulation in the Swiss Alps: a river network modelling approach to investigate the impacts on bed load and grain size distribution

    NASA Astrophysics Data System (ADS)

    Costa, A.; Molnar, P.; Schmitt, R. J. P.

    2017-12-01

    The grain size distribution (GSD) of river bed sediment results from the long term balance between transport capacity and sediment supply. Changes in climate and human activities may alter the spatial distribution of transport capacity and sediment supply along channels and hence impact local bedload transport and GSD. The effects of changed flow are not easily inferable due the non-linear, threshold-based nature of the relation between discharge and sediment mobilization, and the network-scale control on local sediment supply. We present a network-scale model for fractional sediment transport to quantify the impact of hydropower (HP) operations on river network GSD. We represent the river network as a series of connected links for which we extract the geometric characteristics from satellite images and a digital elevation model. We assign surface roughness based on the channel bed GSD. Bed shear stress is estimated at link-scale under the assumptions of rectangular prismatic cross sections and normal flow. The mass balance between sediment supply and transport capacity, computed with the Wilcock and Crowe model, determines transport rates of multiple grain size classes and the resulting GSD. We apply the model to the upper Rhone basin, a large Alpine basin in Switzerland. Since 1960s, changed flow conditions due to HP operations and sediment storage behind dams have potentially altered the sediment transport of the basin. However, little is known on the magnitude and spatial distribution of these changes. We force the model with time series of daily discharge derived with a spatially distributed hydrological model for pre and post HP scenarios. We initialize GSD under the assumption that coarse grains (d90) are mobilized only during mean annual maximum flows, and on the basis of ratios between d90 and characteristic diameters estimated from field measurements. Results show that effects of flow regulation vary significantly in space and in time and are grain size dependent. HP operations led to an overall reduction of sediment transport at network scale, especially in summer and for coarser grains, leading to a general coarsening of the river bed sediments at the upstream reaches. The model allows investigating the impact of modified HP operations and climate change projections on sediment dynamics at the network scale.

  6. A multi-scale Lattice Boltzmann model for simulating solute transport in 3D X-ray micro-tomography images of aggregated porous materials

    NASA Astrophysics Data System (ADS)

    Zhang, Xiaoxian; Crawford, John W.; Flavel, Richard J.; Young, Iain M.

    2016-10-01

    The Lattice Boltzmann (LB) model and X-ray computed tomography (CT) have been increasingly used in combination over the past decade to simulate water flow and chemical transport at pore scale in porous materials. Because of its limitation in resolution and the hierarchical structure of most natural soils, the X-ray CT tomography can only identify pores that are greater than its resolution and treats other pores as solid. As a result, the so-called solid phase in X-ray images may in reality be a grey phase, containing substantial connected pores capable of conducing fluids and solute. Although modified LB models have been developed to simulate fluid flow in such media, models for solute transport are relatively limited. In this paper, we propose a LB model for simulating solute transport in binary soil images containing permeable solid phase. The model is based on the single-relaxation time approach and uses a modified partial bounce-back method to describe the resistance caused by the permeable solid phase to chemical transport. We derive the relationship between the diffusion coefficient and the parameter introduced in the partial bounce-back method, and test the model against analytical solution for movement of a pulse of tracer. We also validate it against classical finite volume method for solute diffusion in a simple 2D image, and then apply the model to a soil image acquired using X-ray tomography at resolution of 30 μm in attempts to analyse how the ability of the solid phase to diffuse solute at micron-scale affects the behaviour of the solute at macro-scale after a volumetric average. Based on the simulated results, we discuss briefly the danger in interpreting experimental results using the continuum model without fully understanding the pore-scale processes, as well as the potential of using pore-scale modelling and tomography to help improve the continuum models.

  7. Charge transport calculations by a wave-packet dynamical approach using maximally localized Wannier functions based on density functional theory: Application to high-mobility organic semiconductors

    NASA Astrophysics Data System (ADS)

    Ishii, Hiroyuki; Kobayashi, Nobuhiko; Hirose, Kenji

    2017-01-01

    We present a wave-packet dynamical approach to charge transport using maximally localized Wannier functions based on density functional theory including van der Waals interactions. We apply it to the transport properties of pentacene and rubrene single crystals and show the temperature-dependent natures from bandlike to thermally activated behaviors as a function of the magnitude of external static disorder. We compare the results with those obtained by the conventional band and hopping models and experiments.

  8. tran-SAS v1.0: a numerical model to compute catchment-scale hydrologic transport using StorAge Selection functions

    NASA Astrophysics Data System (ADS)

    Benettin, Paolo; Bertuzzo, Enrico

    2018-04-01

    This paper presents the tran-SAS package, which includes a set of codes to model solute transport and water residence times through a hydrological system. The model is based on a catchment-scale approach that aims at reproducing the integrated response of the system at one of its outlets. The codes are implemented in MATLAB and are meant to be easy to edit, so that users with minimal programming knowledge can adapt them to the desired application. The problem of large-scale solute transport has both theoretical and practical implications. On the one side, the ability to represent the ensemble of water flow trajectories through a heterogeneous system helps unraveling streamflow generation processes and allows us to make inferences on plant-water interactions. On the other side, transport models are a practical tool that can be used to estimate the persistence of solutes in the environment. The core of the package is based on the implementation of an age master equation (ME), which is solved using general StorAge Selection (SAS) functions. The age ME is first converted into a set of ordinary differential equations, each addressing the transport of an individual precipitation input through the catchment, and then it is discretized using an explicit numerical scheme. Results show that the implementation is efficient and allows the model to run in short times. The numerical accuracy is critically evaluated and it is shown to be satisfactory in most cases of hydrologic interest. Additionally, a higher-order implementation is provided within the package to evaluate and, if necessary, to improve the numerical accuracy of the results. The codes can be used to model streamflow age and solute concentration, but a number of additional outputs can be obtained by editing the codes to further advance the ability to understand and model catchment transport processes.

  9. Flow and contaminant transport in an airliner cabin induced by a moving body: Model experiments and CFD predictions

    NASA Astrophysics Data System (ADS)

    Poussou, Stephane B.; Mazumdar, Sagnik; Plesniak, Michael W.; Sojka, Paul E.; Chen, Qingyan

    2010-08-01

    The effects of a moving human body on flow and contaminant transport inside an aircraft cabin were investigated. Experiments were performed in a one-tenth scale, water-based model. The flow field and contaminant transport were measured using the Particle Image Velocimetry (PIV) and Planar Laser-Induced Fluorescence (PLIF) techniques, respectively. Measurements were obtained with (ventilation case) and without (baseline case) the cabin environmental control system (ECS). The PIV measurements show strong intermittency in the instantaneous near-wake flow. A symmetric downwash flow was observed along the vertical centerline of the moving body in the baseline case. The evolution of this flow pattern is profoundly perturbed by the flow from the ECS. Furthermore, a contaminant originating from the moving body is observed to convect to higher vertical locations in the presence of ventilation. These experimental data were used to validate a Computational Fluid Dynamic (CFD) model. The CFD model can effectively capture the characteristic flow features and contaminant transport observed in the small-scale model.

  10. Lumped Parameter Models for Predicting Nitrogen Transport in Lower Coastal Plain Watersheds

    Treesearch

    Devendra M. Amatya; George M. Chescheir; Glen P. Fernandez; R. Wayne Skaggs; F. Birgand; J.W. Gilliam

    2003-01-01

    hl recent years physically based comprehensive disfributed watershed scale hydrologic/water quality models have been developed and applied 10 evaluate cumulative effects of land arld water management practices on receiving waters, Although fhesc complex physically based models are capable of simulating the impacts ofthese changes in large watersheds, they are often...

  11. Mass transport modelling for the electroreduction of CO2 on Cu nanowires

    NASA Astrophysics Data System (ADS)

    Raciti, David; Mao, Mark; Wang, Chao

    2018-01-01

    Mass transport plays an important role in CO2 reduction electrocatalysis. Albeit being more pronounced on nanostructured electrodes, the studies of mass transport for CO2 reduction have yet been limited to planar electrodes. We report here the development of a mass transport model for the electroreduction of CO2 on Cu nanowire electrodes. Fed with the experimental data from electrocatalytic studies, the local concentrations of CO2, {{{{HCO}}}3}-,{{{{CO}}}3}2- and OH- on the nanostructured electrodes are calculated by solving the diffusion equations with spatially distributed electrochemical reaction terms incorporated. The mass transport effects on the catalytic activity and selectivity of the Cu nanowire electrocatalysts are thus discussed by using the local pH as the descriptor. The established correlations between the electrocatalytic performance and the local pH shows that, the latter does not only determine the acid-base reaction equilibrium, but also regulates the mass transport and reaction kinetics. Based on these findings, the optimal range of local pH for CO2 reduction is discussed in terms of a fine balance among the suppression of hydrogen evolution, improvement of C2 product selectivity and limitation of CO2 supply. Our work highlights the importance of understanding the mass transport effects in interpretation of CO2 reduction electrocatalysis on high-surface-area catalysts.

  12. Use of MODIS Satellite Images and an Atmospheric Dust Transport Model to Evaluate Juniperus spp. Pollen Phenology and Transport

    NASA Technical Reports Server (NTRS)

    Luvall, J. C.; Sprigg, W. A.; Levetin, E.; Huete, A.; Nickovic, S.; Pejanovic, G. A.; Vukovic, A.; Van de Water, P. K.; Myers, O. B.; Budge, A. M.; hide

    2011-01-01

    Pollen can be transported great distances. Van de Water et al., 2003 reported Juniperus spp. pollen, a significant aeroallergen was transported 200-600 km. Hence local observations of plant phenology may not be consistent with the timing and source of pollen collected by pollen sampling instruments. Direct detection of pollen via satellite is not practical. A practical alternative combines modeling and phenological observations using ground based sampling and satellite data. The DREAM (Dust REgional Atmospheric Model) is a verified model for atmospheric dust transport modeling using MODIS data products to identify source regions and quantities of dust (Nickovic et al. 2001). The use of satellite data products for studying phenology is well documented (White and Nemani 2006). In the current project MODIS data will provide critical input to the PREAM model providing pollen source location, timing of pollen release, and vegetation type. We are modifying the DREAM model (PREAM - Pollen REgional Atmospheric Model) to incorporate pollen transport. The linkages already exist with DREAM through PHAiRS (Public Health Applications in Remote Sensing) to the public health community. This linkage has the potential to fill this data gap so that the potential association of health effects of pollen can better be tracked for possible linkage with health outcome data which may be associated with asthma, respiratory effects, myocardial infarction, and lost workdays. Juniperus spp. pollen phenology may respond to a wide range of environmental factors such as day length, growing degree-days, precipitation patterns and soil moisture. Species differences are also important. These environmental factors vary over both time and spatial scales. Ground based networks such as the USA National Phenology Network have been established to provide national wide observations of vegetation phenology. However, the density of observers is not adequate to sufficiently document the phenology variability over large regions. Hence the use of satellite data is critical to observe Juniperus spp. pollen phenology. MODIS data was used to observe Juniperus spp. pollen phenology. The MODIS surface reflectance product(MOD09) provided information on the Juniper spp. cone formation and cone density (Fig 1). Ground based observational records of pollen release timing and quantities were used as verification. Techniques developed using MOD09 surface reflectance products will be directly applicable to the next generation sensors such as VIIRS.

  13. Use Of MODIS Satellite Images And An Atmospheric Dust Transport Model To Evaluate Juniperus Spp. Pollen Phenology And Transport

    NASA Astrophysics Data System (ADS)

    Luvall, J. C.; Sprigg, W. A.; Levetin, E.; Huete, A. R.; Nickovic, S.; Crimmins, T. M.; Van De Water, P. K.; Pejanovic, G.; Vukovic, A. J.; Myers, O.; Budge, A.; Zelicoff, A.; Bunderson, L.; Ponce-Campos, G.

    2011-12-01

    Pollen can be transported great distances. Van de Water et al., 2003 reported Juniperus spp. pollen, a significant aeroallergen was transported 200-600 km. Hence local observations of plant phenology may not be consistent with the timing and source of pollen collected by pollen sampling instruments. Direct detection of pollen via satellite is not practical. A practical alternative combines modeling and phenological observations using ground based sampling and satellite data. The DREAM (Dust REgional Atmospheric Model) is a verified model for atmospheric dust transport modeling using MODIS data products to identify source regions and quantities of dust (Nickovic et al. 2001). The use of satellite data products for studying phenology is well documented (White and Nemani 2006). In the current project MODIS data will provide critical input to the PREAM model providing pollen source location, timing of pollen release, and vegetation type. We are modifying the DREAM model (PREAM - Pollen REgional Atmospheric Model) to incorporate pollen transport. The linkages already exist with DREAM through PHAiRS (Public Health Applications in Remote Sensing) to the public health community. This linkage has the potential to fill this data gap so that the potential association of health effects of pollen can better be tracked for possible linkage with health outcome data which may be associated with asthma, respiratory effects, myocardial infarction, and lost workdays. Juniperus spp. pollen phenology may respond to a wide range of environmental factors such as day length, growing degree-days, precipitation patterns and soil moisture. Species differences are also important. These environmental factors vary over both time and spatial scales. Ground based networks such as the USA National Phenology Network have been established to provide national wide observations of vegetation phenology. However, the density of observers is not adequate to sufficiently document the phenology variability over large regions. Hence the use of satellite data is critical to observe Juniperus spp. pollen phenology. MODIS data was used to observe Juniperus spp. pollen phenology. The MODIS surface reflectance product(MOD09) provided information on the Juniper spp. cone formation and cone density. Ground based observational records of pollen release timing and quantities were used as verification. Techniques developed using MOD09 surface reflectance products will be directly applicable to the next generation sensors such as VIIRS.

  14. A Stream Morphology Classification for Eco-hydraulic Purposes Based on Geospatial Data: a Solute Transport Application Case

    NASA Astrophysics Data System (ADS)

    Jiménez Jaramillo, M. A.; Camacho Botero, L. A.; Vélez Upegui, J. I.

    2010-12-01

    Variation in stream morphology along a basin drainage network leads to different hydraulic patterns and sediment transport processes. Moreover, solute transport processes along streams, and stream habitats for fisheries and microorganisms, rely on stream corridor structure, including elements such as bed forms, channel patterns, riparian vegetation, and the floodplain. In this work solute transport processes simulation and stream habitat identification are carried out at the basin scale. A reach-scale morphological classification system based on channel slope and specific stream power was implemented by using digital elevation models and hydraulic geometry relationships. Although the morphological framework allows identification of cascade, step-pool, plane bed and pool-riffle morphologies along the drainage network, it still does not account for floodplain configuration and bed-forms identification of those channel types. Hence, as a first application case in order to obtain parsimonious three-dimensional characterizations of drainage channels, the morphological framework has been updated by including topographical floodplain delimitation through a Multi-resolution Valley Bottom Flatness Index assessing, and a stochastic bed form representation of the step-pool morphology. Model outcomes were tested in relation to in-stream water storage for different flow conditions and representative travel times according to the Aggregated Dead Zone -ADZ- model conceptualization of solute transport processes.

  15. Description of bipolar charge transport in polyethylene using a fluid model with a constant mobility: model prediction

    NASA Astrophysics Data System (ADS)

    LeRoy, S.; Segur, P.; Teyssedre, G.; Laurent, C.

    2004-01-01

    We present a conduction model aimed at describing bipolar transport and space charge phenomena in low density polyethylene under dc stress. In the first part we recall the basic requirements for the description of charge transport and charge storage in disordered media with emphasis on the case of polyethylene. A quick review of available conduction models is presented and our approach is compared with these models. Then, the bases of the model are described and related assumptions are discussed. Finally, results on external current, trapped and free space charge distributions, field distribution and recombination rate are presented and discussed, considering a constant dc voltage, a step-increase of the voltage, and a polarization-depolarization protocol for the applied voltage. It is shown that the model is able to describe the general features reported for external current, electroluminescence and charge distribution in polyethylene.

  16. Simulation of the fate of faecal bacteria in estuarine and coastal waters based on a fractionated sediment transport model

    NASA Astrophysics Data System (ADS)

    Yang, Chen; Liu, Ying

    2017-08-01

    A two-dimensional depth-integrated numerical model is refined in this paper to simulate the hydrodynamics, graded sediment transport process and the fate of faecal bacteria in estuarine and coastal waters. The sediment mixture is divided into several fractions according to the grain size. A bed evolution model is adopted to simulate the processes of the bed elevation change and sediment grain size sorting. The faecal bacteria transport equation includes enhanced source and sink terms to represent bacterial kinetic transformation and disappearance or reappearance due to sediment deposition or re-suspension. A novel partition ratio and dynamic decay rates of faecal bacteria are adopted in the numerical model. The model has been applied to the turbid water environment in the Bristol Channel and Severn estuary, UK. The predictions by the present model are compared with field data and those by non-fractionated model.

  17. Transportation Network Role for Central Italy Macroregion Development in a Territorial Frames Model Based

    NASA Astrophysics Data System (ADS)

    Di Ludovico, Donato; D'Ovidio, Gino

    2017-10-01

    This paper refers to an interdisciplinary planning research approach that aims to combine urban aspects related to a territorial spatial development with transport requirements connected to an efficiency and sustainable mobility. The proposed research method is based on “Territorial Frames” (TFs) model that derived from an original interpretation of the local context divided into a summation of territorial settlement fabrics characterized in terms of spatial tile, morphology and mobility axes. The TFs, with their own autonomous, different size and structure, are used as the main plot, able to assemble the settlement systems and their posturbane forms. With a view to polycentric and spatial development, the research method allows us to analyse the completeness of the TFs and their connective potential, in order to locate the missing/inefficient elements of the transportation network and planning other TFs essential to support economic and social development processes of the most isolated and disadvantaged inland areas. Finally, a case study of the Italian Median Macroregion configuration based on TFs model approach is proposed, analysed and discussed.

  18. Network-based model of the growth of termite nests

    NASA Astrophysics Data System (ADS)

    Eom, Young-Ho; Perna, Andrea; Fortunato, Santo; Darrouzet, Eric; Theraulaz, Guy; Jost, Christian

    2015-12-01

    We present a model for the growth of the transportation network inside nests of the social insect subfamily Termitinae (Isoptera, termitidae). These nests consist of large chambers (nodes) connected by tunnels (edges). The model based on the empirical analysis of the real nest networks combined with pruning (edge removal, either random or weighted by betweenness centrality) and a memory effect (preferential growth from the latest added chambers) successfully predicts emergent nest properties (degree distribution, size of the largest connected component, average path lengths, backbone link ratios, and local graph redundancy). The two pruning alternatives can be associated with different genuses in the subfamily. A sensitivity analysis on the pruning and memory parameters indicates that Termitinae networks favor fast internal transportation over efficient defense strategies against ant predators. Our results provide an example of how complex network organization and efficient network properties can be generated from simple building rules based on local interactions and contribute to our understanding of the mechanisms that come into play for the formation of termite networks and of biological transportation networks in general.

  19. Numerical modeling of coupled variably saturated fluid flow and reactive transport with fast and slow chemical reactions

    NASA Astrophysics Data System (ADS)

    Yeh, Gour-Tsyh (George); Siegel, Malcolm D.; Li, Ming-Hsu

    2001-02-01

    The couplings among chemical reaction rates, advective and diffusive transport in fractured media or soils, and changes in hydraulic properties due to precipitation and dissolution within fractures and in rock matrix are important for both nuclear waste disposal and remediation of contaminated sites. This paper describes the development and application of LEHGC2.0, a mechanistically based numerical model for simulation of coupled fluid flow and reactive chemical transport, including both fast and slow reactions in variably saturated media. Theoretical bases and numerical implementations are summarized, and two example problems are demonstrated. The first example deals with the effect of precipitation/dissolution on fluid flow and matrix diffusion in a two-dimensional fractured media. Because of the precipitation and decreased diffusion of solute from the fracture into the matrix, retardation in the fractured medium is not as large as the case wherein interactions between chemical reactions and transport are not considered. The second example focuses on a complicated but realistic advective-dispersive-reactive transport problem. This example exemplifies the need for innovative numerical algorithms to solve problems involving stiff geochemical reactions.

  20. Using GPS, GIS, and Accelerometer Data to Predict Transportation Modes.

    PubMed

    Brondeel, Ruben; Pannier, Bruno; Chaix, Basile

    2015-12-01

    Active transportation is a substantial source of physical activity, which has a positive influence on many health outcomes. A survey of transportation modes for each trip is challenging, time-consuming, and requires substantial financial investments. This study proposes a passive collection method and the prediction of modes at the trip level using random forests. The RECORD GPS study collected real-life trip data from 236 participants over 7 d, including the transportation mode, global positioning system, geographical information systems, and accelerometer data. A prediction model of transportation modes was constructed using the random forests method. Finally, we investigated the performance of models on the basis of a limited number of participants/trips to predict transportation modes for a large number of trips. The full model had a correct prediction rate of 90%. A simpler model of global positioning system explanatory variables combined with geographical information systems variables performed nearly as well. Relatively good predictions could be made using a model based on the 991 trips of the first 30 participants. This study uses real-life data from a large sample set to test a method for predicting transportation modes at the trip level, thereby providing a useful complement to time unit-level prediction methods. By enabling predictions on the basis of a limited number of observations, this method may decrease the workload for participants/researchers and provide relevant trip-level data to investigate relations between transportation and health.

  1. Sources, Transport, and Climate Impacts of Biomass Burning Aerosols

    NASA Technical Reports Server (NTRS)

    Chin, Mian

    2010-01-01

    In this presentation, I will first talk about fundamentals of modeling of biomass burning emissions of aerosols, then show the results of GOCART model simulated biomass burning aerosols. I will compare the model results with observations of satellite and ground-based network in terms of total aerosol optical depth, aerosol absorption optical depth, and vertical distributions. Finally the long-range transport of biomass burning aerosols and the climate effects will be addressed. I will also discuss the uncertainties associated with modeling and observations of biomass burning aerosols

  2. Modeling of the Nitric Oxide Transport in the Human Lungs.

    PubMed

    Karamaoun, Cyril; Van Muylem, Alain; Haut, Benoît

    2016-01-01

    In the human lungs, nitric oxide (NO) acts as a bronchodilatator, by relaxing the bronchial smooth muscles and is closely linked to the inflammatory status of the lungs, owing to its antimicrobial activity. Furthermore, the molar fraction of NO in the exhaled air has been shown to be higher for asthmatic patients than for healthy patients. Multiple models have been developed in order to characterize the NO dynamics in the lungs, owing to their complex structure. Indeed, direct measurements in the lungs are difficult and, therefore, these models are valuable tools to interpret experimental data. In this work, a new model of the NO transport in the human lungs is proposed. It belongs to the family of the morphological models and is based on the morphometric model of Weibel (1963). When compared to models published previously, its main new features are the layered representation of the wall of the airways and the possibility to simulate the influence of bronchoconstriction (BC) and of the presence of mucus on the NO transport in lungs. The model is based on a geometrical description of the lungs, at rest and during a respiratory cycle, coupled with transport equations, written in the layers composing an airway wall and in the lumen of the airways. First, it is checked that the model is able to reproduce experimental information available in the literature. Second, the model is used to discuss some features of the NO transport in healthy and unhealthy lungs. The simulation results are analyzed, especially when BC has occurred in the lungs. For instance, it is shown that BC can have a significant influence on the NO transport in the tissues composing an airway wall. It is also shown that the relation between BC and the molar fraction of NO in the exhaled air is complex. Indeed, BC might lead to an increase or to a decrease of this molar fraction, depending on the extent of the BC and on the possible presence of mucus. This should be confirmed experimentally and might provide an interesting way to characterize the extent of BC in unhealthy patients.

  3. Reproducing tailing in breakthrough curves: Are statistical models equally representative and predictive?

    NASA Astrophysics Data System (ADS)

    Pedretti, Daniele; Bianchi, Marco

    2018-03-01

    Breakthrough curves (BTCs) observed during tracer tests in highly heterogeneous aquifers display strong tailing. Power laws are popular models for both the empirical fitting of these curves, and the prediction of transport using upscaling models based on best-fitted estimated parameters (e.g. the power law slope or exponent). The predictive capacity of power law based upscaling models can be however questioned due to the difficulties to link model parameters with the aquifers' physical properties. This work analyzes two aspects that can limit the use of power laws as effective predictive tools: (a) the implication of statistical subsampling, which often renders power laws undistinguishable from other heavily tailed distributions, such as the logarithmic (LOG); (b) the difficulties to reconcile fitting parameters obtained from models with different formulations, such as the presence of a late-time cutoff in the power law model. Two rigorous and systematic stochastic analyses, one based on benchmark distributions and the other on BTCs obtained from transport simulations, are considered. It is found that a power law model without cutoff (PL) results in best-fitted exponents (αPL) falling in the range of typical experimental values reported in the literature (1.5 < αPL < 4). The PL exponent tends to lower values as the tailing becomes heavier. Strong fluctuations occur when the number of samples is limited, due to the effects of subsampling. On the other hand, when the power law model embeds a cutoff (PLCO), the best-fitted exponent (αCO) is insensitive to the degree of tailing and to the effects of subsampling and tends to a constant αCO ≈ 1. In the PLCO model, the cutoff rate (λ) is the parameter that fully reproduces the persistence of the tailing and is shown to be inversely correlated to the LOG scale parameter (i.e. with the skewness of the distribution). The theoretical results are consistent with the fitting analysis of a tracer test performed during the MADE-5 experiment. It is shown that a simple mechanistic upscaling model based on the PLCO formulation is able to predict the ensemble of BTCs from the stochastic transport simulations without the need of any fitted parameters. The model embeds the constant αCO = 1 and relies on a stratified description of the transport mechanisms to estimate λ. The PL fails to reproduce the ensemble of BTCs at late time, while the LOG model provides consistent results as the PLCO model, however without a clear mechanistic link between physical properties and model parameters. It is concluded that, while all parametric models may work equally well (or equally wrong) for the empirical fitting of the experimental BTCs tails due to the effects of subsampling, for predictive purposes this is not true. A careful selection of the proper heavily tailed models and corresponding parameters is required to ensure physically-based transport predictions.

  4. Five-minute, 1/2°, and 1° data sets of continental watersheds and river networks for use in regional and global hydrologic and climate system modeling studies

    NASA Astrophysics Data System (ADS)

    Graham, S. T.; Famiglietti, J. S.; Maidment, D. R.

    1999-02-01

    A major shortcoming of the land surface component in climate models is the absence of a river transport algorithm. This issue becomes particularly important in fully coupled climate system models (CSMs), where river transport is required to close and realistically represent the global water cycle. The development of a river transport algorithm requires knowledge of watersheds and river networks at a scale that is appropriate for use in CSMs. These data must be derived largely from global digital topographic information. The purpose of this paper is to describe a new data set of watersheds and river networks, which is derived primarily from the TerrainBase 5' Global DTM (digital terrain model) and the CIA World Data Bank II. These data serve as a base map for routing continental runoff to the appropriate coast and therefore into the appropriate ocean or inland sea. Using this data set, the runoff produced in any grid cell, when coupled with a routing algorithm, can easily be transported to the appropriate water body and distributed across that water body as desired. The data set includes watershed and flow direction information, as well as supporting hydrologic data at 5', 1/2°, and 1° resolutions globally. It will be useful in fully coupled land-ocean-atmosphere models, in terrestrial ecosystem models, or in stand-alone macroscale hydrologic-modeling studies.

  5. Numerical Modeling of One-Dimensional Steady-State Flow and Contaminant Transport in a Horizontally Heterogeneous Unconfined Aquifer with an Uneven Base

    EPA Science Inventory

    Algorithms and a short description of the D1_Flow program for numerical modeling of one-dimensional steady-state flow in horizontally heterogeneous aquifers with uneven sloping bases are presented. The algorithms are based on the Dupuit-Forchheimer approximations. The program per...

  6. Effect of Natural Abiotic Colloids on the Transport of Lindane (gamma-hexachlorocyclohexane) through Saturated Porous Media: Laboratory Experiments and Model-Based Analysis

    NASA Astrophysics Data System (ADS)

    Ngueleu Kamangou, S.; Cirpka, O. A.; Grathwohl, P.

    2012-04-01

    In many developing countries, the hygienic situation has improved by changing from surface-water bodies to groundwater as drinking water resource. However, failures have frequently been reported, presumably caused by wrong design of groundwater extraction (e.g., wells too close to open-water bodies, landfill leachates or agricultural areas). Moreover threat to groundwater pollution is enhanced when colloidal particles in the subsurface can act as carriers for adsorbing contaminants such as hydrophobic chlorinated organic contaminants. In this study, the main objective was to investigate the influence of particles in the size range of colloids on the subsurface transport of pesticides which are known to cause severe health problems. The model pesticide was gamma-hexachlorocyclohexane, a representative hydrophobic insecticide which is still used mainly in tropical countries. Colloid-facilitated transport was carried out by considering a first case where the adsorption of the contaminant to the particles is at equilibrium before getting simultaneously transported, and a second case where this equilibrium was not reached before their transport. Another focus besides colloid-facilitated transport was placed on the release of the contaminant from trapped colloids. Data analysis was done with the help of numerical modeling and the minimum model complexity needed to simulate such transports was examined.

  7. Economic Analysis Framework for Freight Transportation Based on Florida Statewide Multi-Modal Freight Model

    DOT National Transportation Integrated Search

    2018-02-01

    Freight transportation plays a vital role in local and regional economy. The markets and businesses from different regions and locations can be connected through freight movements. But it is difficult to quantify the economic contribution of freight ...

  8. Modeling of flux, binding and substitution of urea molecules in the urea transporter dvUT.

    PubMed

    Zhang, Hai-Tian; Wang, Zhe; Yu, Tao; Sang, Jian-Ping; Zou, Xian-Wu; Zou, Xiaoqin

    2017-09-01

    Urea transporters (UTs) are transmembrane proteins that transport urea molecules across cell membranes and play a crucial role in urea excretion and water balance. Modeling the functional characteristics of UTs helps us understand how their structures accomplish the functions at the atomic level, and facilitates future therapeutic design targeting the UTs. This study was based on the crystal structure of Desulfovibrio vulgaris urea transporter (dvUT). To model the binding behavior of urea molecules in dvUT, we constructed a cooperative binding model. To model the substitution of urea by the urea analogue N,N'-dimethylurea (DMU) in dvUT, we calculated the occupation probability of DMU along the urea pore and the ratio of the occupation probabilities of DMU at the external (S ext ) and internal (S int ) binding sites, and we established the mutual substitution rule for binding and substitution of urea and DMU. Based on these calculations and modelings, together with the use of the Monte Carlo (MC) method, we further modeled the urea flux in dvUT, equilibrium urea binding to dvUT, and the substitution of urea by DMU in the dvUT. Our modeling results are in good agreement with the existing experimental functional data. Furthermore, the modelings have discovered the microscopic process and mechanisms of those functional characteristics. The methods and the results would help our future understanding of the underlying mechanisms of the diseases associated with impaired UT functions and rational drug design for the treatment of these diseases. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Coupling a basin erosion and river sediment transport model into a large scale hydrological model: an application in the Amazon basin

    NASA Astrophysics Data System (ADS)

    Buarque, D. C.; Collischonn, W.; Paiva, R. C. D.

    2012-04-01

    This study presents the first application and preliminary results of the large scale hydrodynamic/hydrological model MGB-IPH with a new module to predict the spatial distribution of the basin erosion and river sediment transport in a daily time step. The MGB-IPH is a large-scale, distributed and process based hydrological model that uses a catchment based discretization and the Hydrological Response Units (HRU) approach. It uses physical based equations to simulate the hydrological processes, such as the Penman Monteith model for evapotranspiration, and uses the Muskingum Cunge approach and a full 1D hydrodynamic model for river routing; including backwater effects and seasonal flooding. The sediment module of the MGB-IPH model is divided into two components: 1) prediction of erosion over the basin and sediment yield to river network; 2) sediment transport along the river channels. Both MGB-IPH and the sediment module use GIS tools to display relevant maps and to extract parameters from SRTM DEM (a 15" resolution was adopted). Using the catchment discretization the sediment module applies the Modified Universal Soil Loss Equation to predict soil loss from each HRU considering three sediment classes defined according to the soil texture: sand, silt and clay. The effects of topography on soil erosion are estimated by a two-dimensional slope length (LS) factor which using the contributing area approach and a local slope steepness (S), both estimated for each DEM pixel using GIS algorithms. The amount of sediment releasing to the catchment river reach in each day is calculated using a linear reservoir. Once the sediment reaches the river they are transported into the river channel using an advection equation for silt and clay and a sediment continuity equation for sand. A sediment balance based on the Yang sediment transport capacity, allowing to compute the amount of erosion and deposition along the rivers, is performed for sand particles as bed load, whilst no erosion or deposition is allowed for silt and clay. The model was first applied on the Madeira River basin, one of the major tributaries of the Amazon River (~1.4*106 km2) accounting for 35% of the suspended sediment amount annually transported for the Amazon river to the ocean. Model results agree with observed data, mainly for monthly and annual time scales. The spatial distribution of soil erosion within the basin showed a large amount of sediment being delivered from the Andean regions of Bolivia and Peru. Spatial distribution of mean annual sediment along the river showed that Madre de Dios, Mamoré and Beni rivers transport the major amount of sediment. Simulated daily suspended solid discharge agree with observed data. The model is able to provide temporaly and spatialy distributed estimates of soil loss source over the basin, locations with tendency for erosion or deposition along the rivers, and to reproduce long term sediment yield at several locations. Despite model results are encouraging, further effort is needed to validate the model considering the scarcity of data at large scale.

  10. Ammonia transport in the kidney by Rhesus glycoproteins

    PubMed Central

    Verlander, Jill W.

    2014-01-01

    Renal ammonia metabolism is a fundamental element of acid-base homeostasis, comprising a major component of both basal and physiologically altered renal net acid excretion. Over the past several years, a fundamental change in our understanding of the mechanisms of renal epithelial cell ammonia transport has occurred, replacing the previous model which was based upon diffusion equilibrium for NH3 and trapping of NH4+ with a new model in which specific and regulated transport of both NH3 and NH4+ across renal epithelial cell membranes via specific membrane proteins is required for normal ammonia metabolism. A major advance has been the recognition that members of a recently recognized transporter family, the Rhesus glycoprotein family, mediate critical roles in renal and extrarenal ammonia transport. The erythroid-specific Rhesus glycoprotein, Rh A Glycoprotein (Rhag), was the first Rhesus glycoprotein recognized as an ammonia-specific transporter. Subsequently, the nonerythroid Rh glycoproteins, Rh B Glycoprotein (Rhbg) and Rh C Glycoprotein (Rhcg), were cloned and identified as ammonia transporters. They are expressed in specific cell populations and membrane domains in distal renal epithelial cells, where they facilitate ammonia secretion. In this review, we discuss the distribution of Rhbg and Rhcg in the kidney, the regulation of their expression and activity in physiological disturbances, the effects of genetic deletion on renal ammonia metabolism, and the molecular mechanisms of Rh glycoprotein-mediated ammonia transport. PMID:24647713

  11. Radiation Transport and Shielding for Space Exploration and High Speed Flight Transportation

    NASA Technical Reports Server (NTRS)

    Maung, Khin Maung; Trapathi, R. K.

    1997-01-01

    Transportation of ions and neutrons in matter is of direct interest in several technologically important and scientific areas, including space radiation, cosmic ray propagation studies in galactic medium, nuclear power plants and radiological effects that impact industrial and public health. For the proper assessment of radiation exposure, both reliable transport codes and accurate data are needed. Nuclear cross section data is one of the essential inputs into the transport codes. In order to obtain an accurate parametrization of cross section data, theoretical input is indispensable especially for processes where there is little or no experimental data available. In this grant period work has been done on the studies of the use of relativistic equations and their one-body limits. The results will be useful in choosing appropriate effective one-body equation for reaction calculations. Work has also been done to improve upon the data base needed for the transport codes used in the studies of radiation transport and shielding for space exploration and high speed flight transportation. A phenomenological model was developed for the total absorption cross sections valid for any system of charged and/or uncharged collision pairs for the entire energy range. The success of the model is gratifying. It is being used by other federal agencies, national labs and universities. A list of publications based on the work during the grant period is given below and copies are enclosed with this report.

  12. Charge-spin Transport in Surface-disordered Three-dimensional Topological Insulators

    NASA Astrophysics Data System (ADS)

    Peng, Xingyue

    As one of the most promising candidates for the building block of the novel spintronic circuit, the topological insulator (TI) has attracted world-wide interest of study. Robust topological order protected by time-reversal symmetry (TRS) makes charge transport and spin generation in TIs significantly different from traditional three-dimensional (3D) or two-dimensional (2D) electronic systems. However, to date, charge transport and spin generation in 3D TIs are still primarily modeled as single-surface phenomena, happening independently on top and bottom surfaces. In this dissertation, I will demonstrate via both experimental findings and theoretical modeling that this "single surface'' theory neither correctly describes a realistic 3D TI-based device nor reveals the amazingly distinct physical picture of spin transport dynamics in 3D TIs. Instead, I present a new viewpoint of the spin transport dynamics where the role of the insulating yet topologically non-trivial bulk of a 3D TI becomes explicit. Within this new theory, many mysterious transport and magneto-transport anomalies can be naturally explained. The 3D TI system turns out to be more similar to its low dimensional sibling--2D TI rather than some other systems sharing the Dirac dispersion, such as graphene. This work not only provides valuable fundamental physical insights on charge-spin transport in 3D TIs, but also offers important guidance to the design of 3D TI-based spintronic devices.

  13. Constraints on vertical transport near the polar summer mesopause from PMC observations and modelling

    NASA Astrophysics Data System (ADS)

    Wilms, H.; Rapp, M.; Kirsch, A.

    2016-12-01

    The comparison of microphysical simulations of polar mesospheric cloud properties with ground based and satellite borne observations suggests that vertical wind variance imposed by gravity waves is an important prerequisite to realistically model PMC properties. This paper reviews the available observational evidence of vertical wind measurements at the polar summer mesopause (including their frequency content). Corresponding results are compared to vertical wind variance from several global models and implications for the transport of trace constituents in this altitude region are discussed.

  14. A model for the topology of excitatory amino acid transporters determined by the extracellular accessibility of substituted cysteines.

    PubMed

    Seal, R P; Leighton, B H; Amara, S G

    2000-03-01

    Excitatory amino acid transporters (EAATs) function as both substrate transporters and ligand-gated anion channels. Characterization of the transporter's general topology is the first requisite step in defining the structural bases for these distinct activities. While the first six hydrophobic domains can be readily modeled as conventional transmembrane segments, the organization of the C-terminal hydrophobic domains, which have been implicated in both substrate and ion interactions, has been controversial. Here, we report the results of a comprehensive evaluation of the C-terminal topology of EAAT1 determined by the chemical modification of introduced cysteine residues. Our data support a model in which two membrane-spanning domains flank a central region that is highly accessible to the extracellular milieu and contains at least one reentrant loop domain.

  15. Energy content of stormtime ring current from phase space mapping simulations

    NASA Technical Reports Server (NTRS)

    Chen, Margaret W.; Schulz, Michael; Lyons, Larry R.

    1993-01-01

    We perform a phase space mapping study to estimate the enhancement in energy content that results from stormtime particle transport in the equatorial magnetosphere. Our pre-storm phase space distribution is based on a steady-state transport model. Using results from guiding-center simulations of ion transport during model storms having main phases of 3 hr, 6 hr, and 12 hr, we map phase space distributions of ring current protons from the pre-storm distribution in accordance with Liouville's theorem. We find that transport can account for the entire ten to twenty-fold increase in magnetospheric particle energy content typical of a major storm if a realistic stormtime enhancement of the phase space density f is imposed at the nightside tail plasma sheet (represented by an enhancement of f at the neutral line in our model).

  16. Ultimate scaling of TiN/ZrO2/TiN capacitors: Leakage currents and limitations due to electrode roughness

    NASA Astrophysics Data System (ADS)

    Jegert, Gunther; Kersch, Alfred; Weinreich, Wenke; Lugli, Paolo

    2011-01-01

    In this paper, we investigate the influence of electrode roughness on the leakage current in TiN/high-κ ZrO2/TiN (TZT) thin-film capacitors which are used in dynamic random access memory cells. Based on a microscopic transport model, which is expanded to incorporate electrode roughness, we assess the ultimate scaling potential of TZT capacitors in terms of equivalent oxide thickness, film smoothness, thickness fluctuations, defect density and distribution, and conduction band offset (CBO). The model is based on three-dimensional, fully self-consistent, kinetic Monte Carlo transport simulations. Tunneling transport in the bandgap of the dielectric is treated, which includes defect-assisted transport mechanisms. Electrode roughness is described in the framework of fractal geometry. While the short-range roughness of the electrodes is found not to influence significantly the leakage current, thickness fluctuations of the dielectric have a major impact. For thinner dielectric films they cause a transformation of the dominant transport mechanism from Poole-Frenkel conduction to trap-assisted tunneling. Consequently, the sensitivity of the leakage current on electrode roughness drastically increases on downscaling. Based on the simulations, optimization of the CBO is suggested as the most viable strategy to extend the scalability of TZT capacitors over the next chip generations.

  17. Modeling of Glycerol-3-Phosphate Transporter Suggests a Potential ‘Tilt’ Mechanism involved in its Function

    PubMed Central

    Tsigelny, Igor F.; Greenberg, Jerry; Kouznetsova, Valentina; Nigam, Sanjay K.

    2009-01-01

    Many major facilitator superfamily (MFS) transporters have similar 12-transmembrane α-helical topologies with two six-helix halves connected by a long loop. In humans, these transporters participate in key physiological processes and are also, as in the case of members of the organic anion transporter (OAT) family, of pharmaceutical interest. Recently, crystal structures of two bacterial representatives of the MFS family — the glycerol-3-phosphate transporter (GlpT) and lac-permease (LacY) — have been solved and, because of assumptions regarding the high structural conservation of this family, there is hope that the results can be applied to mammalian transporters as well. Based on crystallography, it has been suggested that a major conformational “switching” mechanism accounts for ligand transport by MFS proteins. This conformational switch would then allow periodic changes in the overall transporter configuration, resulting in its cyclic opening to the periplasm or cytoplasm. Following this lead, we have modeled a possible “switch” mechanism in GlpT, using the concept of rotation of protein domains as in the DynDom program17 and membranephilic constraints predicted by the MAPAS program.23 We found that the minima of energies of intersubunit interactions support two alternate positions consistent with their transport properties. Thus, for GlpT, a “tilt” of 9°–10° rotation had the most favorable energetics of electrostatic interaction between the two halves of the transporter; moreover, this confirmation was sufficient to suggest transport of the ligand across the membrane. We conducted steered molecular dynamics simulations of the GlpT-ligand system to explore how glycerol-3-phosphate would be handled by the “tilted” structure, and obtained results generally consistent with experimental mutagenesis data. While biochemical data remain most consistent with a single-site alternating access model, our results raise the possibility that, while the “rocker switch” may apply to certain MFS transporters, intermediate “tilted” states may exist under certain circumstances or as transitional structures. While wet lab experimental confirmation is required, our results suggest that transport mechanisms in this transporter family should probably not be assumed to be conserved simply based on standard structural homology considerations. Furthermore, steered molecular dynamics elucidating energetic interactions of ligands with amino acid residues in an appropriately modeled transporter may have predictive value in understanding the impact of mutations and/or polymorphisms on transporter function. PMID:18942157

  18. A model and simulation of fast space charge pulses in polymers

    NASA Astrophysics Data System (ADS)

    Lv, Zepeng; Rowland, Simon M.; Wu, Kai

    2017-11-01

    The transport of space charge packets across polyethylene and epoxy resin in high electric fields has been characterized as fast or slow depending on packet mobility. Several explanations for the formation and transport of slow space charge packets have been proposed, but the origins of fast space charge pulses, with mobilities above 10-11 m2 V-1 s-1, are unclear. In one suggested model, it is assumed that the formation of fast charge pulses is due to discontinuous electromechanical compression and charge injection at the electrode-insulation interface, and their transport is related to corresponding relaxation processes. In that model, charges travel as a pulse because of group polarization. This paper provides an alternative model based on the reduction of charge carrier activation energy due to charge density triggered polymer chain movement and subsequent chain relaxation times. The generation and transport of fast charge pulses are readily simulated by a bipolar charge transport model with three additional parameters: reduced activation energy, charge density threshold, and chain relaxation time. Such a model is shown to reproduce key features of fast space charge pulses including speed, duration, repetition rate and pulse size. This model provides the basis for a deep understanding of the physical origins of fast space charge pulses in polymers.

  19. Probing Reliability of Transport Phenomena Based Heat Transfer and Fluid Flow Analysis in Autogeneous Fusion Welding Process

    NASA Astrophysics Data System (ADS)

    Bag, S.; de, A.

    2010-09-01

    The transport phenomena based heat transfer and fluid flow calculations in weld pool require a number of input parameters. Arc efficiency, effective thermal conductivity, and viscosity in weld pool are some of these parameters, values of which are rarely known and difficult to assign a priori based on the scientific principles alone. The present work reports a bi-directional three-dimensional (3-D) heat transfer and fluid flow model, which is integrated with a real number based genetic algorithm. The bi-directional feature of the integrated model allows the identification of the values of a required set of uncertain model input parameters and, next, the design of process parameters to achieve a target weld pool dimension. The computed values are validated with measured results in linear gas-tungsten-arc (GTA) weld samples. Furthermore, a novel methodology to estimate the overall reliability of the computed solutions is also presented.

  20. Pesticide regulations for agriculture: Chemically flawed regulatory practice.

    PubMed

    Gamble, Donald S; Bruccoleri, Aldo G

    2016-08-02

    Two categories of pesticide soil models now exist. Government regulatory agencies use pesticide fate and transport hydrology models, including versions of PRZM.gw. They have good descriptions of pesticide transport by water flow. Their descriptions of chemical mechanisms are unrealistic, having been postulated using the universally accepted but incorrect pesticide soil science. The objective of this work is to report experimental tests of a pesticide soil model in use by regulatory agencies and to suggest possible improvements. Tests with experimentally based data explain why PRZM.gw predictions can be wrong by orders of magnitude. Predictive spreadsheet models are the other category. They are experimentally based, with chemical stoichiometry applied to integral kinetic rate laws for sorption, desorption, intra-particle diffusion, and chemical reactions. They do not account for pesticide transport through soils. Each category of models therefore lacks what the other could provide. They need to be either harmonized or replaced. Some preliminary tests indicate that an experimental mismatch between the categories of models will have to be resolved. Reports of pesticides in the environment and the medical problems that overlap geographically indicate that government regulatory practice needs to account for chemical kinetics and mechanisms. Questions about possible cause and effect links could then be investigated.

  1. Application of a Physiologically Based Pharmacokinetic Model to Predict OATP1B1-Related Variability in Pharmacodynamics of Rosuvastatin

    PubMed Central

    Rose, R H; Neuhoff, S; Abduljalil, K; Chetty, M; Rostami-Hodjegan, A; Jamei, M

    2014-01-01

    Typically, pharmacokinetic–pharmacodynamic (PK/PD) models use plasma concentration as the input that drives the PD model. However, interindividual variability in uptake transporter activity can lead to variable drug concentrations in plasma without discernible impact on the effect site organ concentration. A physiologically based PK/PD model for rosuvastatin was developed that linked the predicted liver concentration to the PD response model. The model was then applied to predict the effect of genotype-dependent uptake by the organic anion-transporting polypeptide 1B1 (OATP1B1) transporter on the pharmacological response. The area under the plasma concentration–time curve (AUC0–∞) was increased by 63 and 111% for the c.521TC and c.521CC genotypes vs. the c.521TT genotype, while the PD response remained relatively unchanged (3.1 and 5.8% reduction). Using local concentration at the effect site to drive the PD response enabled us to explain the observed disconnect between the effect of the OATP1B1 c521T>C polymorphism on rosuvastatin plasma concentration and the cholesterol synthesis response. PMID:25006781

  2. Approximate models for the ion-kinetic regime in inertial-confinement-fusion capsule implosions

    DOE PAGES

    Hoffman, Nelson M.; Zimmerman, George B.; Molvig, Kim; ...

    2015-05-19

    “Reduced” (i.e., simplified or approximate) ion-kinetic (RIK) models in radiation-hydrodynamic simulations permit a useful description of inertial-confinement-fusion (ICF) implosions where kinetic deviations from hydrodynamic behavior are important. For implosions in or near the kinetic regime (i.e., when ion mean free paths are comparable to the capsule size), simulations using a RIK model give a detailed picture of the time- and space-dependent structure of imploding capsules, allow an assessment of the relative importance of various kinetic processes during the implosion, enable explanations of past and current observations, and permit predictions of the results of future experiments. The RIK simulation method describedmore » here uses moment-based reduced kinetic models for transport of mass, momentum, and energy by long-mean-free-path ions, a model for the decrease of fusion reactivity owing to the associated modification of the ion distribution function, and a model of hydrodynamic turbulent mixing. Transport models are based on local gradient-diffusion approximations for the transport of moments of the ion distribution functions, with coefficients to impose flux limiting or account for transport modification. After calibration against a reference set of ICF implosions spanning the hydrodynamic-to-kinetic transition, the method has useful, quantifiable predictive ability over a broad range of capsule parameter space. Calibrated RIK simulations show that an important contributor to ion species separation in ICF capsule implosions is the preferential flux of longer-mean-free-path species out of the fuel and into the shell, leaving the fuel relatively enriched in species with shorter mean free paths. Also, the transport of ion thermal energy is enhanced in the kinetic regime, causing the fuel region to have a more uniform, lower ion temperature, extending over a larger volume, than implied by clean simulations. Furthermore, we expect that the success of our simple approach will motivate continued theoretical research into the development of first-principles-based, comprehensive, self-consistent, yet useable models of kinetic multispecies ion behavior in ICF plasmas.« less

  3. Lattice hydrodynamic model based traffic control: A transportation cyber-physical system approach

    NASA Astrophysics Data System (ADS)

    Liu, Hui; Sun, Dihua; Liu, Weining

    2016-11-01

    Lattice hydrodynamic model is a typical continuum traffic flow model, which describes the jamming transition of traffic flow properly. Previous studies in lattice hydrodynamic model have shown that the use of control method has the potential to improve traffic conditions. In this paper, a new control method is applied in lattice hydrodynamic model from a transportation cyber-physical system approach, in which only one lattice site needs to be controlled in this control scheme. The simulation verifies the feasibility and validity of this method, which can ensure the efficient and smooth operation of the traffic flow.

  4. Mesh quality oriented 3D geometric vascular modeling based on parallel transport frame.

    PubMed

    Guo, Jixiang; Li, Shun; Chui, Yim Pan; Qin, Jing; Heng, Pheng Ann

    2013-08-01

    While a number of methods have been proposed to reconstruct geometrically and topologically accurate 3D vascular models from medical images, little attention has been paid to constantly maintain high mesh quality of these models during the reconstruction procedure, which is essential for many subsequent applications such as simulation-based surgical training and planning. We propose a set of methods to bridge this gap based on parallel transport frame. An improved bifurcation modeling method and two novel trifurcation modeling methods are developed based on 3D Bézier curve segments in order to ensure the continuous surface transition at furcations. In addition, a frame blending scheme is implemented to solve the twisting problem caused by frame mismatch of two successive furcations. A curvature based adaptive sampling scheme combined with a mesh quality guided frame tilting algorithm is developed to construct an evenly distributed, non-concave and self-intersection free surface mesh for vessels with distinct radius and high curvature. Extensive experiments demonstrate that our methodology can generate vascular models with better mesh quality than previous methods in terms of surface mesh quality criteria. Copyright © 2013 Elsevier Ltd. All rights reserved.

  5. Sediment transport simulation in an armoured stream

    USGS Publications Warehouse

    Milhous, Robert T.; Bradley, Jeffrey B.; Loeffler, Cindy L.

    1986-01-01

    Improved methods of calculating bed material stability and transport must be developed for a gravel bed stream having an armoured surface in order to use the HEC-6 model to examine channel change. Good possibilities exist for use of a two layer model based on the Schoklitsch and the Einstein-Brown transport equations. In Einstein-Brown the D35 of the armour is used for stabilities and the D50 of the bed (sub-surface) is used for transport. Data on the armour and sub-surface size distribution needs to be obtained as part of a bed material study in a gravel bed river; a "shovel" sample is not adequate. The Meyer-Peter, Muller equation should not be applied to a gravel bed stream with an armoured surface to estimate the initiation of transport or for calculation of transport at low effective bed shear stress.

  6. Introduction of Shear-Based Transport Mechanisms in Radial-Axial Hybrid Hall Thruster Simulations

    NASA Astrophysics Data System (ADS)

    Scharfe, Michelle; Gascon, Nicolas; Scharfe, David; Cappelli, Mark; Fernandez, Eduardo

    2007-11-01

    Electron diffusion across magnetic field lines in Hall effect thrusters is experimentally observed to be higher than predicted by classical diffusion theory. Motivated by theoretical work for fusion applications and experimental measurements of Hall thrusters, numerical models for the electron transport are implemented in radial-axial hybrid simulations in order to compute the electron mobility using simulated plasma properties and fitting parameters. These models relate the cross-field transport to the imposed magnetic field distribution through shear suppression of turbulence-enhanced transport. While azimuthal waves likely enhance cross field mobility, axial shear in the electron fluid may reduce transport due to a reduction in turbulence amplitudes and modification of phase shifts between fluctuating properties. The sensitivity of the simulation results to the fitting parameters is evaluated and an examination is made of the transportability of these parameters to several Hall thruster devices.

  7. A nonequilibrium model for reactive contaminant transport through fractured porous media: Model development and semianalytical solution

    NASA Astrophysics Data System (ADS)

    Joshi, Nitin; Ojha, C. S. P.; Sharma, P. K.

    2012-10-01

    In this study a conceptual model that accounts for the effects of nonequilibrium contaminant transport in a fractured porous media is developed. Present model accounts for both physical and sorption nonequilibrium. Analytical solution was developed using the Laplace transform technique, which was then numerically inverted to obtain solute concentration in the fracture matrix system. The semianalytical solution developed here can incorporate both semi-infinite and finite fracture matrix extent. In addition, the model can account for flexible boundary conditions and nonzero initial condition in the fracture matrix system. The present semianalytical solution was validated against the existing analytical solutions for the fracture matrix system. In order to differentiate between various sorption/transport mechanism different cases of sorption and mass transfer were analyzed by comparing the breakthrough curves and temporal moments. It was found that significant differences in the signature of sorption and mass transfer exists. Applicability of the developed model was evaluated by simulating the published experimental data of Calcium and Strontium transport in a single fracture. The present model simulated the experimental data reasonably well in comparison to the model based on equilibrium sorption assumption in fracture matrix system, and multi rate mass transfer model.

  8. Modeling effect of cover condition and soil type on rotavirus transport in surface flow.

    PubMed

    Bhattarai, Rabin; Davidson, Paul C; Kalita, Prasanta K; Kuhlenschmidt, Mark S

    2017-08-01

    Runoff from animal production facilities contains various microbial pathogens which pose a health hazard to both humans and animals. Rotavirus is a frequently detected pathogen in agricultural runoff and the leading cause of death among children around the world. Diarrheal infection caused by rotavirus causes more than two million hospitalizations and death of more than 500,000 children every year. Very little information is available on the environmental factors governing rotavirus transport in surface runoff. The objective of this study is to model rotavirus transport in overland flow and to compare the model results with experimental observations. A physically based model, which incorporates the transport of infective rotavirus particles in both liquid (suspension or free-floating) and solid phase (adsorbed to soil particles), has been used in this study. Comparison of the model results with experimental results showed that the model could reproduce the recovery kinetics satisfactorily but under-predicted the virus recovery in a few cases when multiple peaks were observed during experiments. Similarly, the calibrated model had a good agreement between observed and modeled total virus recovery. The model may prove to be a promising tool for developing effective management practices for controlling microbial pathogens in surface runoff.

  9. Maximum likelihood Bayesian model averaging and its predictive analysis for groundwater reactive transport models

    DOE PAGES

    Lu, Dan; Ye, Ming; Curtis, Gary P.

    2015-08-01

    While Bayesian model averaging (BMA) has been widely used in groundwater modeling, it is infrequently applied to groundwater reactive transport modeling because of multiple sources of uncertainty in the coupled hydrogeochemical processes and because of the long execution time of each model run. To resolve these problems, this study analyzed different levels of uncertainty in a hierarchical way, and used the maximum likelihood version of BMA, i.e., MLBMA, to improve the computational efficiency. Our study demonstrates the applicability of MLBMA to groundwater reactive transport modeling in a synthetic case in which twenty-seven reactive transport models were designed to predict themore » reactive transport of hexavalent uranium (U(VI)) based on observations at a former uranium mill site near Naturita, CO. Moreover, these reactive transport models contain three uncertain model components, i.e., parameterization of hydraulic conductivity, configuration of model boundary, and surface complexation reactions that simulate U(VI) adsorption. These uncertain model components were aggregated into the alternative models by integrating a hierarchical structure into MLBMA. The modeling results of the individual models and MLBMA were analyzed to investigate their predictive performance. The predictive logscore results show that MLBMA generally outperforms the best model, suggesting that using MLBMA is a sound strategy to achieve more robust model predictions relative to a single model. MLBMA works best when the alternative models are structurally distinct and have diverse model predictions. When correlation in model structure exists, two strategies were used to improve predictive performance by retaining structurally distinct models or assigning smaller prior model probabilities to correlated models. Since the synthetic models were designed using data from the Naturita site, the results of this study are expected to provide guidance for real-world modeling. Finally, limitations of applying MLBMA to the synthetic study and future real-world modeling are discussed.« less

  10. Applying Advanced Ground-Based Remote Sensing in the Southeast Asian Maritime Continent to Characterize Regional Proficiencies in Smoke Transport Modeling

    NASA Technical Reports Server (NTRS)

    Campbell, James R.; Ge, Cui; Wang, Jun; Welton, Ellsworth J.; Bucholtz, Anthony; Hyer, Edward J.; Reid, Elizabeth A.; Chew, Boon Ning; Liew, Soo-Chin; Salinas, Santo V.; hide

    2015-01-01

    This work describes some of the most extensive ground-based observations of the aerosol profile collected in Southeast Asia to date, highlighting the challenges in simulating these observations with a mesoscale perspective. An 84-h WRF Model coupled with chemistry (WRF-Chem) mesoscale simulation of smoke particle transport at Kuching, Malaysia, in the southern Maritime Continent of Southeast Asia is evaluated relative to a unique collection of continuous ground-based lidar, sun photometer, and 4-h radiosonde profiling. The period was marked by relatively dry conditions, allowing smoke layers transported to the site unperturbed by wet deposition to be common regionally. The model depiction is reasonable overall. Core thermodynamics, including landsea-breeze structure, are well resolved. Total model smoke extinction and, by proxy, mass concentration are low relative to observation. Smoke emissions source products are likely low because of undersampling of fires in infrared sun-synchronous satellite products, which is exacerbated regionally by endemic low-level cloud cover. Differences are identified between the model mass profile and the lidar profile, particularly during periods of afternoon convective mixing. A static smoke mass injection height parameterized for this study potentially influences this result. The model does not resolve the convective mixing of aerosol particles into the lower free troposphere or the enhancement of near-surface extinction from nighttime cooling and hygroscopic effects.

  11. The Aliso Canyon Natural Gas Leak : Large Eddy Simulations for Modeling Atmospheric Dynamics and Interpretation of Observations.

    NASA Astrophysics Data System (ADS)

    Prasad, K.; Thorpe, A. K.; Duren, R. M.; Thompson, D. R.; Whetstone, J. R.

    2016-12-01

    The National Institute of Standards and Technology (NIST) has supported the development and demonstration of a measurement capability to accurately locate greenhouse gas sources and measure their flux to the atmosphere over urban domains. However, uncertainties in transport models which form the basis of all top-down approaches can significantly affect our capability to attribute sources and predict their flux to the atmosphere. Reducing uncertainties between bottom-up and top-down models will require high resolution transport models as well as validation and verification of dispersion models over an urban domain. Tracer experiments involving the release of Perfluorocarbon Tracers (PFTs) at known flow rates offer the best approach for validating dispersion / transport models. However, tracer experiments are limited by cost, ability to make continuous measurements, and environmental concerns. Natural tracer experiments, such as the leak from the Aliso Canyon underground storage facility offers a unique opportunity to improve and validate high resolution transport models, test leak hypothesis, and to estimate the amount of methane released.High spatial resolution (10 m) Large Eddy Simulations (LES) coupled with WRF atmospheric transport models were performed to simulate the dynamics of the Aliso Canyon methane plume and to quantify the source. High resolution forward simulation results were combined with aircraft and tower based in-situ measurements as well as data from NASA airborne imaging spectrometers. Comparison of simulation results with measurement data demonstrate the capability of the LES models to accurately model transport and dispersion of methane plumes over urban domains.

  12. Characterization and simulation of fate and transport of selected volatile organic compounds in the vicinities of the Hadnot Point Industrial Area and landfill: Chapter A Supplement 6 in Analyses and historical reconstruction of groundwater flow, contaminant fate and transport, and distribution of drinking water within the service areas of the Hadnot Point and Holcomb Boulevard Water Treatment Plants and vicinities, U.S. Marine Corps Base Camp Lejeune, North Carolina

    USGS Publications Warehouse

    Jones, L. Elliott; Suárez-Soto, René J.; Anderson, Barbara A.; Maslia, Morris L.

    2013-01-01

    This supplement of Chapter A (Supplement 6) describes the reconstruction (i.e. simulation) of historical concentrations of tetrachloroethylene (PCE), trichloroethylene (TCE), and benzene3 in production wells supplying water to the Hadnot Base (USMCB) Camp Lejeune, North Carolina (Figure S6.1). A fate and transport model (i.e., MT3DMS [Zheng and Wang 1999]) was used to simulate contaminant migration from source locations through the groundwater system and to estimate mean contaminant concentrations in water withdrawn from water-supply wells in the vicinity of the Hadnot Point Industrial Area (HPIA) and the Hadnot Point landfill (HPLF) area.4 The reconstructed contaminant concentrations were subsequently input into a flow-weighted, materials mass balance (mixing) model (Masters 1998) to estimate monthly mean concentrations of the contaminant in finished water 5 at the HPWTP (Maslia et al. 2013). The calibrated fate and transport models described herein were based on and used groundwater velocities derived from groundwater-flow models that are described in Suárez-Soto et al. (2013). Information data pertinent to historical operations of water-supply wells are described in Sautner et al. (2013) and Telci et al. (2013).

  13. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    NASA Astrophysics Data System (ADS)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  14. Implementation and Evaluation of Multiple Adaptive Control Technologies for a Generic Transport Aircraft Simulation

    NASA Technical Reports Server (NTRS)

    Campbell, Stefan F.; Kaneshige, John T.; Nguyen, Nhan T.; Krishakumar, Kalmanje S.

    2010-01-01

    Presented here is the evaluation of multiple adaptive control technologies for a generic transport aircraft simulation. For this study, seven model reference adaptive control (MRAC) based technologies were considered. Each technology was integrated into an identical dynamic-inversion control architecture and tuned using a methodology based on metrics and specific design requirements. Simulation tests were then performed to evaluate each technology s sensitivity to time-delay, flight condition, model uncertainty, and artificially induced cross-coupling. The resulting robustness and performance characteristics were used to identify potential strengths, weaknesses, and integration challenges of the individual adaptive control technologies

  15. A space transportation system operations model

    NASA Technical Reports Server (NTRS)

    Morris, W. Douglas; White, Nancy H.

    1987-01-01

    Presented is a description of a computer program which permits assessment of the operational support requirements of space transportation systems functioning in both a ground- and space-based environment. The scenario depicted provides for the delivery of payloads from Earth to a space station and beyond using upper stages based at the station. Model results are scenario dependent and rely on the input definitions of delivery requirements, task times, and available resources. Output is in terms of flight rate capabilities, resource requirements, and facility utilization. A general program description, program listing, input requirements, and sample output are included.

  16. Modeling of the Contaminated Sediment in the Erft River

    NASA Astrophysics Data System (ADS)

    Hu, Wei; Westrich, Bernhard; Rode, Michael

    2010-05-01

    Sediment transport processes play an important role in the surface water systems coupled with rainfall-runoff and contaminant transport. Pollutants like heavy metals adsorbed mainly by fine sediment particles can be deposited, eroded or transported further downstream. When the toxic pollutants deposited before and covered by cleaner sediment are remobilized by large flow events such as floods, they pose a hidden threat to the human health and environment. In the Erft River, due to mining activities in the past, the heavy metals release from the tributary Veybach on the downstream water and sediment quality is significant. Recent measurements prove the decreasing concentration trend of heavy metals in the river bed sediment from the Veybach. One-dimensional hydrodynamic model COSMOS is used to model the complicated water flow, sediment erosion, deposition and contaminant mixing and transport in the mainstream of the Erft River. It is based on a finite-difference formulation and consists of one-dimensional, unsteady sub-model of flow and transport, coupled with a sub-model of the layered sediment bed. The model accounts for the following governing physical-chemical processes: convective and dispersive transport, turbulent mixing deposited sediment surface, deposition, consolidation, aging and erosion of sediment, adsorption-desorption of pollutants to suspended particles and losses of pollutants due to decay or volatilization. The results reproduce the decreasing profile of the pollutant concentration in the river bed sediment nicely. Further modeling is to analysis the influence of the mixing process at the water-riverbed interface on the contaminant transport, hydrological scenarios impact on the remobilization of the sink of pollutant and its negative consequences on the river basin.

  17. Model of the transient neurovascular response based on prompt arterial dilation

    PubMed Central

    Kim, Jung Hwan; Khan, Reswanul; Thompson, Jeffrey K; Ress, David

    2013-01-01

    Brief neural stimulation results in a stereotypical pattern of vascular and metabolic response that is the basis for popular brain-imaging methods such as functional magnetic resonance imagine. However, the mechanisms of transient oxygen transport and its coupling to cerebral blood flow (CBF) and oxygen metabolism (CMRO2) are poorly understood. Recent experiments show that brief stimulation produces prompt arterial vasodilation rather than venous vasodilation. This work provides a neurovascular response model for brief stimulation based on transient arterial effects using one-dimensional convection–diffusion transport. Hemoglobin oxygen dissociation is included to enable predictions of absolute oxygen concentrations. Arterial CBF response is modeled using a lumped linear flow model, and CMRO2 response is modeled using a gamma function. Using six parameters, the model successfully fit 161/166 measured extravascular oxygen time courses obtained for brief visual stimulation in cat cerebral cortex. Results show how CBF and CMRO2 responses compete to produce the observed features of the hemodynamic response: initial dip, hyperoxic peak, undershoot, and ringing. Predicted CBF and CMRO2 response amplitudes are consistent with experimental measurements. This model provides a powerful framework to quantitatively interpret oxygen transport in the brain; in particular, its intravascular oxygen concentration predictions provide a new model for fMRI responses. PMID:23756690

  18. Vadose Zone Transport Field Study: Summary Report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ward, Andy L.; Conrad, Mark E.; Daily, William D.

    2006-07-31

    From FY 2000 through FY 2003, a series of vadose zone transport field experiments were conducted as part of the U.S. Department of Energy’s Groundwater/Vadose Zone Integration Project Science and Technology Project, now known as the Remediation and Closure Science Project, and managed by the Pacific Northwest National Laboratory (PNNL). The series of experiments included two major field campaigns, one at a 299-E24-11 injection test site near PUREX and a second at a clastic dike site off Army Loop Road. The goals of these experiments were to improve our understanding of vadose zone transport processes; to develop data sets tomore » validate and calibrate vadose zone flow and transport models; and to identify advanced monitoring techniques useful for evaluating flow-and-transport mechanisms and delineating contaminant plumes in the vadose zone at the Hanford Site. This report summarizes the key findings from the field studies and demonstrates how data collected from these studies are being used to improve conceptual models and develop numerical models of flow and transport in Hanford’s vadose zone. Results of these tests have led to a better understanding of the vadose zone. Fine-scale geologic heterogeneities, including grain fabric and lamination, were observed to have a strong effect on the large-scale behavior of contaminant plumes, primarily through increased lateral spreading resulting from anisotropy. Conceptual models have been updated to include lateral spreading and numerical models of unsaturated flow and transport have revised accordingly. A new robust model based on the concept of a connectivity tensor was developed to describe saturation-dependent anisotropy in strongly heterogeneous soils and has been incorporated into PNNL’s Subsurface Transport Over Multiple Phases (STOMP) simulator. Application to field-scale transport problems have led to a better understanding plume behavior at a number of sites where lateral spreading may have dominated waste migration (e.g. BC Cribs and Trenches). The improved models have been also coupled with inverse models and newly-developed parameter scaling techniques to allow estimation of field-scale and effective transport parameters for the vadose zone. The development and utility of pedotransfer functions for describing fine-scale hydrogeochemical heterogeneity and for incorporating this heterogeneity into reactive transport models was explored. An approach based on grain-size statistics appears feasible and has been used to describe heterogeneity in hydraulic properties and sorption properties, such as the cation exchange capacity and the specific surface area of Hanford sediments. This work has also led to the development of inverse modeling capabilities for time-dependent, subsurface, reactive transport with transient flow fields using an automated optimization algorithm. In addition, a number of geophysical techniques investigated for their potential to provide detailed information on the subtle changes in lithology and bedding surfaces; plume delineation, leak detection. High-resolution resistivity is now being used for detecting saline plumes at several waste sites at Hanford, including tank farms. Results from the field studies and associated analysis have appeared in more than 46 publications generated over the past 4 years. These publications include test plans and status reports, in addition to numerous technical notes and peer reviewed papers.« less

  19. Regional Atmospheric Transport Code for Hanford Emission Tracking (RATCHET). Hanford Environmental Dose Reconstruction Project

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ramsdell, J.V. Jr.; Simonen, C.A.; Burk, K.W.

    1994-02-01

    The purpose of the Hanford Environmental Dose Reconstruction (HEDR) Project is to estimate radiation doses that individuals may have received from operations at the Hanford Site since 1944. This report deals specifically with the atmospheric transport model, Regional Atmospheric Transport Code for Hanford Emission Tracking (RATCHET). RATCHET is a major rework of the MESOILT2 model used in the first phase of the HEDR Project; only the bookkeeping framework escaped major changes. Changes to the code include (1) significant changes in the representation of atmospheric processes and (2) incorporation of Monte Carlo methods for representing uncertainty in input data, model parameters,more » and coefficients. To a large extent, the revisions to the model are based on recommendations of a peer working group that met in March 1991. Technical bases for other portions of the atmospheric transport model are addressed in two other documents. This report has three major sections: a description of the model, a user`s guide, and a programmer`s guide. These sections discuss RATCHET from three different perspectives. The first provides a technical description of the code with emphasis on details such as the representation of the model domain, the data required by the model, and the equations used to make the model calculations. The technical description is followed by a user`s guide to the model with emphasis on running the code. The user`s guide contains information about the model input and output. The third section is a programmer`s guide to the code. It discusses the hardware and software required to run the code. The programmer`s guide also discusses program structure and each of the program elements.« less

  20. Watershed erosion modeling using the probability of sediment connectivity in a gently rolling system

    NASA Astrophysics Data System (ADS)

    Mahoney, David Tyler; Fox, James Forrest; Al Aamery, Nabil

    2018-06-01

    Sediment connectivity has been shown in recent years to explain how the watershed configuration controls sediment transport. However, we find no studies develop a watershed erosion modeling framework based on sediment connectivity, and few, if any, studies have quantified sediment connectivity for gently rolling systems. We develop a new predictive sediment connectivity model that relies on the intersecting probabilities for sediment supply, detachment, transport, and buffers to sediment transport, which is integrated in a watershed erosion model framework. The model predicts sediment flux temporally and spatially across a watershed using field reconnaissance results, a high-resolution digital elevation models, a hydrologic model, and shear-based erosion formulae. Model results validate the capability of the model to predict erosion pathways causing sediment connectivity. More notably, disconnectivity dominates the gently rolling watershed across all morphologic levels of the uplands, including, microtopography from low energy undulating surfaces across the landscape, swales and gullies only active in the highest events, karst sinkholes that disconnect drainage areas, and floodplains that de-couple the hillslopes from the stream corridor. Results show that sediment connectivity is predicted for about 2% or more the watershed's area 37 days of the year, with the remaining days showing very little or no connectivity. Only 12.8 ± 0.7% of the gently rolling watershed shows sediment connectivity on the wettest day of the study year. Results also highlight the importance of urban/suburban sediment pathways in gently rolling watersheds, and dynamic and longitudinal distributions of sediment connectivity might be further investigated in future work. We suggest the method herein provides the modeler with an added tool to account for sediment transport criteria and has the potential to reduce computational costs in watershed erosion modeling.

  1. ECHMERIT: A new on-line global mercury-chemistry model

    NASA Astrophysics Data System (ADS)

    Jung, G.; Hedgecock, I. M.; Pirrone, N.

    2009-04-01

    Mercury is a volatile metal, that is of concern because when deposited and transformed to methylmercury accumulates within the food-web. Due to the long lifetime of elemental mercury, which is the dominant fraction of mercury species in the atmosphere, mercury is prone to long-range transport and therefore distributed over the globe, transported and hence deposited even in regions far from anthropogenic emission sources. Mercury is released to the atmosphere from a variety of natural and anthropogenic sources, in elementary and oxidised forms, and as particulate mercury. It is then transported, but also transformed chemically in the gaseous phase, as well as in aqueous phase within cloud and rain droplets. Mercury (particularly its oxidised forms) is removed from the atmosphere though wet and dry deposition processes, a large fraction of deposited mercury is, after chemical or biological reduction, re-emitted to the atmosphere as elementary mercury. To investigate mercury chemistry and transport processes on the global scale, the new, global model ECHMERIT has been developed. ECHMERIT simulates meteorology, transport, deposition, photolysis and chemistry on-line. The general circulation model on which ECHMERIT is based is ECHAM5. Sophisticated chemical modules have been implemented, including gas phase chemistry based on the CBM-Z chemistry mechanism, as well as aqueous phase chemistry, both of which have been adapted to include Hg chemistry and Hg species gas-droplet mass transfer. ECHMERIT uses the fast-J photolysis routine. State-of-the-art procedures simulating wet and dry deposition and emissions were adapted and included in the model as well. An overview of the model structure, development, validation and sensitivity studies is presented.

  2. Transporter-Enzyme Interplay: Deconvoluting Effects of Hepatic Transporters and Enzymes on Drug Disposition Using Static and Dynamic Mechanistic Models.

    PubMed

    Varma, Manthena V; El-Kattan, Ayman F

    2016-07-01

    A large body of evidence suggests hepatic uptake transporters, organic anion-transporting polypeptides (OATPs), are of high clinical relevance in determining the pharmacokinetics of substrate drugs, based on which recent regulatory guidances to industry recommend appropriate assessment of investigational drugs for the potential drug interactions. We recently proposed an extended clearance classification system (ECCS) framework in which the systemic clearance of class 1B and 3B drugs is likely determined by hepatic uptake. The ECCS framework therefore predicts the possibility of drug-drug interactions (DDIs) involving OATPs and the effects of genetic variants of SLCO1B1 early in the discovery and facilitates decision making in the candidate selection and progression. Although OATP-mediated uptake is often the rate-determining process in the hepatic clearance of substrate drugs, metabolic and/or biliary components also contribute to the overall hepatic disposition and, more importantly, to liver exposure. Clinical evidence suggests that alteration in biliary efflux transport or metabolic enzymes associated with genetic polymorphism leads to change in the pharmacodynamic response of statins, for which the pharmacological target resides in the liver. Perpetrator drugs may show inhibitory and/or induction effects on transporters and enzymes simultaneously. It is therefore important to adopt models that frame these multiple processes in a mechanistic sense for quantitative DDI predictions and to deconvolute the effects of individual processes on the plasma and hepatic exposure. In vitro data-informed mechanistic static and physiologically based pharmacokinetic models are proven useful in rationalizing and predicting transporter-mediated DDIs and the complex DDIs involving transporter-enzyme interplay. © 2016, The American College of Clinical Pharmacology.

  3. Development of a multicriteria assessment model for ranking biomass feedstock collection and transportation systems.

    PubMed

    Kumar, Amit; Sokhansanj, Shahab; Flynn, Peter C

    2006-01-01

    This study details multicriteria assessment methodology that integrates economic, social, environmental, and technical factors in order to rank alternatives for biomass collection and transportation systems. Ranking of biomass collection systems is based on cost of delivered biomass, quality of biomass supplied, emissions during collection, energy input to the chain operations, and maturity of supply system technologies. The assessment methodology is used to evaluate alternatives for collecting 1.8 x 10(6) dry t/yr based on assumptions made on performance of various assemblies of biomass collection systems. A proposed collection option using loafer/ stacker was shown to be the best option followed by ensiling and baling. Ranking of biomass transport systems is based on cost of biomass transport, emissions during transport, traffic congestion, and maturity of different technologies. At a capacity of 4 x 10(6) dry t/yr, rail transport was shown to be the best option, followed by truck transport and pipeline transport, respectively. These rankings depend highly on assumed maturity of technologies and scale of utilization. These may change if technologies such as loafing or ensiling (wet storage) methods are proved to be infeasible for large-scale collection systems.

  4. Hydrothermal transport and deposition of the rare earth elements by fluorine-bearing aqueous liquids

    NASA Astrophysics Data System (ADS)

    Migdisov, Art A.; Williams-Jones, A. E.

    2014-12-01

    New technologies, particularly those designed to address environmental concerns, have created a great demand for the rare earth elements (REE), and focused considerable attention on the processes by which they are concentrated to economically exploitable levels in the Earth's crust. There is widespread agreement that hydrothermal fluids played an important role in the formation of the world's largest economic REE deposit, i.e. Bayan Obo, China. Until recently, many researchers have assumed that hydrothermal transport of the REE in fluorine-bearing ore-forming systems occurs mainly due to the formation of REE-fluoride complexes. Consequently, hydrothermal models for REE concentration have commonly involved depositional mechanisms based on saturation of the fluid with REE minerals due to destabilization of REE-fluoride complexes. Here, we demonstrate that these complexes are insignificant in REE transport, and that the above models are therefore flawed. The strong association of H+ and F- as HF° and low solubility of REE-F solids greatly limit transport of the REE as fluoride complexes. However, this limitation does not apply to REE-chloride complexes. Because of this, the high concentration of Cl- in the ore fluids, and the relatively high stability of REE-chloride complexes, the latter can transport appreciable concentrations of REE at low pH. The limitation also does not apply to sulphate complexes and in some fluids, the concentration of sulphate may be sufficient to transport significant concentrations of REE as sulphate complexes, particularly at weakly acidic pH. This article proposes new models for hydrothermal REE deposition based on the transport of the REE as chloride and sulphate complexes.

  5. Application of Local Discretization Methods in the NASA Finite-Volume General Circulation Model

    NASA Technical Reports Server (NTRS)

    Yeh, Kao-San; Lin, Shian-Jiann; Rood, Richard B.

    2002-01-01

    We present the basic ideas of the dynamics system of the finite-volume General Circulation Model developed at NASA Goddard Space Flight Center for climate simulations and other applications in meteorology. The dynamics of this model is designed with emphases on conservative and monotonic transport, where the property of Lagrangian conservation is used to maintain the physical consistency of the computational fluid for long-term simulations. As the model benefits from the noise-free solutions of monotonic finite-volume transport schemes, the property of Lagrangian conservation also partly compensates the accuracy of transport for the diffusion effects due to the treatment of monotonicity. By faithfully maintaining the fundamental laws of physics during the computation, this model is able to achieve sufficient accuracy for the global consistency of climate processes. Because the computing algorithms are based on local memory, this model has the advantage of efficiency in parallel computation with distributed memory. Further research is yet desirable to reduce the diffusion effects of monotonic transport for better accuracy, and to mitigate the limitation due to fast-moving gravity waves for better efficiency.

  6. Semianalytical Solutions for Transport in Aquifer and Fractured Clay Matrix System

    EPA Science Inventory

    A three-dimensional mathematical model that describes transport of contaminant in a horizontal aquifer with simultaneous diffusion into a fractured clay formation is proposed. A group of analytical solutions is derived based on specific initial and boundary conditions as well as ...

  7. Gaining insights into interrill soil erosion processes using rare earth element tracers

    USDA-ARS?s Scientific Manuscript database

    Increasing interest in developing process-based erosion models requires better understanding of the relationships among soil detachment, transportation, and deposition. The objectives are to 1) identify the limiting process between soil detachment and sediment transport for interrill erosion, 2) und...

  8. Prediction of main factors’ values of air transportation system safety based on system dynamics

    NASA Astrophysics Data System (ADS)

    Spiridonov, A. Yu; Rezchikov, A. F.; Kushnikov, V. A.; Ivashchenko, V. A.; Bogomolov, A. S.; Filimonyuk, L. Yu; Dolinina, O. N.; Kushnikova, E. V.; Shulga, T. E.; Tverdokhlebov, V. A.; Kushnikov, O. V.; Fominykh, D. S.

    2018-05-01

    On the basis of the system-dynamic approach [1-8], a set of models has been developed that makes it possible to analyse and predict the values of the main safety indicators for the operation of aviation transport systems.

  9. Grain transport mechanics in shallow flow

    USDA-ARS?s Scientific Manuscript database

    A physical model based on continuum multiphase flow is described to represent saltating transport of grains in shallow overland flows. The two-phase continuum flow of water and sediment considers coupled St.Venant type equations. The interactive cumulative effect of grains is incorporated by a dispe...

  10. Grain transport mechanics in shallow overland flow

    USDA-ARS?s Scientific Manuscript database

    A physical model based on continuum multiphase flow is described to represent saltating transport of grains in shallow overland flow. The two phase continuum flow of water and sediment considers coupled St.Venant type equations. The interactive cumulative effect of grains is incorporated by a disper...

  11. Numerical analysis of the transportation characteristics of a self-running sliding stage based on near-field acoustic levitation.

    PubMed

    Feng, Kai; Liu, Yuanyuan; Cheng, Miaomiao

    2015-12-01

    Owing to its distinct non-contact and oil-free characteristics, a self-running sliding stage based on near-field acoustic levitation can be used in an environment, which demands clean rooms and zero noise. This paper presents a numerical analysis on the lifting and transportation capacity of a non-contact transportation system. Two simplified structure models, namely, free vibration and force vibration models, are proposed for the study of the displacement amplitude distribution of two cases using the finite element method. After coupling the stage displacement into the film thickness, the Reynolds equation is solved by the finite difference method to obtain the lifting and thrusting forces. Parametric analyses of the effects of amplitude, frequency, and standing wave ratio (SWR) on the sliding stage dynamic performance are investigated. Numerical results show good agreement with published experimental values. The predictions also reveal that greater transportation capacity of the self-running sliding stage is generally achieved at less SWR and at higher amplitude.

  12. The Fusion Model of Intelligent Transportation Systems Based on the Urban Traffic Ontology

    NASA Astrophysics Data System (ADS)

    Yang, Wang-Dong; Wang, Tao

    On these issues unified representation of urban transport information using urban transport ontology, it defines the statute and the algebraic operations of semantic fusion in ontology level in order to achieve the fusion of urban traffic information in the semantic completeness and consistency. Thus this paper takes advantage of the semantic completeness of the ontology to build urban traffic ontology model with which we resolve the problems as ontology mergence and equivalence verification in semantic fusion of traffic information integration. Information integration in urban transport can increase the function of semantic fusion, and reduce the amount of data integration of urban traffic information as well enhance the efficiency and integrity of traffic information query for the help, through the practical application of intelligent traffic information integration platform of Changde city, the paper has practically proved that the semantic fusion based on ontology increases the effect and efficiency of the urban traffic information integration, reduces the storage quantity, and improve query efficiency and information completeness.

  13. Development and evaluation of the microbial fate and transport module for the Agricultural Policy/Environmental eXtender (APEX) model

    NASA Astrophysics Data System (ADS)

    Hong, Eun-Mi; Park, Yongeun; Muirhead, Richard; Pachepsky, Yakov

    2017-04-01

    Pathogenic microorganisms in recreational and irrigation waters remain the subject of concern. Water quality models are used to estimate microbial quality of water sources, to evaluate microbial contamination-related risks, to guide the microbial water quality monitoring, and to evaluate the effect of agricultural management on the microbial water quality. The Agricultural Policy/Environmental eXtender (APEX) is the watershed-scale water quality model that includes highly detailed representation of agricultural management. The APEX currently does not have microbial fate and transport simulation capabilities. The objective of this work was to develop the first APEX microbial fate and transport module that could use the APEX conceptual model of manure removal together with recently introduced conceptualizations of the in-stream microbial fate and transport. The module utilizes manure erosion rates found in the APEX. The total number of removed bacteria was set to the concentrations of bacteria in soil-manure mixing layer and eroded manure amount. Bacteria survival in soil-manure mixing layer was simulated with the two-stage survival model. Individual survival patterns were simulated for each manure application date. Simulated in-stream microbial fate and transport processes included the reach-scale passive release of bacteria with resuspended bottom sediment during high flow events, the transport of bacteria from bottom sediment due to the hyporheic exchange during low flow periods, the deposition with settling sediment, and the two-stage survival. Default parameter values were available from recently published databases. The APEX model with the newly developed microbial fate and transport module was applied to simulate seven years of monitoring data for the Toenepi watershed in New Zealand. The stream network of the watershed ran through grazing lands with the daily bovine waste deposition. Based on calibration and testing results, the APEX with the microbe module reproduced well the monitored pattern of E. coli concentrations at the watershed outlet. The APEX with the microbial fate and transport module will be utilized for predicting microbial quality of water under various agricultural practices (grazing, cropping, and manure application), evaluating monitoring protocols, and supporting the selection of management practices based on regulations that rely on fecal indicator bacteria concentrations. Future development should include modeling contributions of wildlife, manure weathering, and weather effects on manure-borne microorganism survival and release.

  14. Modeling of FMISO [F18] nanoparticle PET tracer in normal-cancerous tissue based on real clinical image.

    PubMed

    Asgari, Hanie; Soltani, M; Sefidgar, Mostafa

    2018-07-01

    Hypoxia as one of the principal properties of tumor cells is a reaction to the deprivation of oxygen. The location of tumor cells could be identified by assessment of oxygen and nutrient level in human body. Positron emission tomography (PET) is a well-known non-invasive method that is able to measure hypoxia based on the FMISO (Fluoromisonidazole) tracer dynamic. This paper aims to study the PET tracer concentration through convection-diffusion-reaction equations in a real human capillary-like network. A non-uniform oxygen pressure along the capillary path and convection mechanism for FMISO transport are taken into account to accurately model the characteristics of the tracer. To this end, a multi-scale model consists of laminar blood flow through the capillary network, interstitial pressure, oxygen pressure, FMISO diffusion and FMISO convection transport in the extravascular region is developed. The present model considers both normal and tumor tissue regions in computational domain. The accuracy of numerical model is verified with the experimental results available in the literature. The convection and diffusion types of transport mechanism are employed in order to calculate the concentration of FMISO in the normal and tumor sub-domain. The influences of intravascular oxygen pressure, FMISO transport mechanisms, capillary density and different types of tissue on the FMISO concentration have been investigated. According to result (Table 4) the convection mechanism of FMISO molecules transportation is negligible, but it causes more accuracy of the proposed model. The approach of present study can be employed in order to investigate the effects of various parameters, such as tumor shape, on the dynamic behavior of different PET tracers, such as FDG, can be extended to different case study problems, such as drug delivery. Copyright © 2018 Elsevier Inc. All rights reserved.

  15. Correlated receptor transport processes buffer single-cell heterogeneity

    PubMed Central

    Kallenberger, Stefan M.; Unger, Anne L.; Legewie, Stefan; Lymperopoulos, Konstantinos; Eils, Roland

    2017-01-01

    Cells typically vary in their response to extracellular ligands. Receptor transport processes modulate ligand-receptor induced signal transduction and impact the variability in cellular responses. Here, we quantitatively characterized cellular variability in erythropoietin receptor (EpoR) trafficking at the single-cell level based on live-cell imaging and mathematical modeling. Using ensembles of single-cell mathematical models reduced parameter uncertainties and showed that rapid EpoR turnover, transport of internalized EpoR back to the plasma membrane, and degradation of Epo-EpoR complexes were essential for receptor trafficking. EpoR trafficking dynamics in adherent H838 lung cancer cells closely resembled the dynamics previously characterized by mathematical modeling in suspension cells, indicating that dynamic properties of the EpoR system are widely conserved. Receptor transport processes differed by one order of magnitude between individual cells. However, the concentration of activated Epo-EpoR complexes was less variable due to the correlated kinetics of opposing transport processes acting as a buffering system. PMID:28945754

  16. Simulation of Long Lived Tracers Using an Improved Empirically-Based Two-Dimensional Model Transport Algorithm

    NASA Technical Reports Server (NTRS)

    Fleming, Eric L.; Jackman, Charles H.; Stolarski, Richard S.; Considine, David B.

    1998-01-01

    We have developed a new empirically-based transport algorithm for use in our GSFC two-dimensional transport and chemistry assessment model. The new algorithm contains planetary wave statistics, and parameterizations to account for the effects due to gravity waves and equatorial Kelvin waves. We will present an overview of the new algorithm, and show various model-data comparisons of long-lived tracers as part of the model validation. We will also show how the new algorithm gives substantially better agreement with observations compared to our previous model transport. The new model captures much of the qualitative structure and seasonal variability observed methane, water vapor, and total ozone. These include: isolation of the tropics and winter polar vortex, the well mixed surf-zone region of the winter sub-tropics and mid-latitudes, and the propagation of seasonal signals in the tropical lower stratosphere. Model simulations of carbon-14 and strontium-90 compare fairly well with observations in reproducing the peak in mixing ratio at 20-25 km, and the decrease with altitude in mixing ratio above 25 km. We also ran time dependent simulations of SF6 from which the model mean age of air values were derived. The oldest air (5.5 to 6 years) occurred in the high latitude upper stratosphere during fall and early winter of both hemispheres, and in the southern hemisphere lower stratosphere during late winter and early spring. The latitudinal gradient of the mean ages also compare well with ER-2 aircraft observations in the lower stratosphere.

  17. Bi-Objective Modelling for Hazardous Materials Road–Rail Multimodal Routing Problem with Railway Schedule-Based Space–Time Constraints

    PubMed Central

    Sun, Yan; Lang, Maoxiang; Wang, Danzhu

    2016-01-01

    The transportation of hazardous materials is always accompanied by considerable risk that will impact public and environment security. As an efficient and reliable transportation organization, a multimodal service should participate in the transportation of hazardous materials. In this study, we focus on transporting hazardous materials through the multimodal service network and explore the hazardous materials multimodal routing problem from the operational level of network planning. To formulate this problem more practicably, minimizing the total generalized costs of transporting the hazardous materials and the social risk along the planned routes are set as the optimization objectives. Meanwhile, the following formulation characteristics will be comprehensively modelled: (1) specific customer demands; (2) multiple hazardous material flows; (3) capacitated schedule-based rail service and uncapacitated time-flexible road service; and (4) environmental risk constraint. A bi-objective mixed integer nonlinear programming model is first built to formulate the routing problem that combines the formulation characteristics above. Then linear reformations are developed to linearize and improve the initial model so that it can be effectively solved by exact solution algorithms on standard mathematical programming software. By utilizing the normalized weighted sum method, we can generate the Pareto solutions to the bi-objective optimization problem for a specific case. Finally, a large-scale empirical case study from the Beijing–Tianjin–Hebei Region in China is presented to demonstrate the feasibility of the proposed methods in dealing with the practical problem. Various scenarios are also discussed in the case study. PMID:27483294

  18. Peritoneal Fluid Transport rather than Peritoneal Solute Transport Associates with Dialysis Vintage and Age of Peritoneal Dialysis Patients.

    PubMed

    Waniewski, Jacek; Antosiewicz, Stefan; Baczynski, Daniel; Poleszczuk, Jan; Pietribiasi, Mauro; Lindholm, Bengt; Wankowicz, Zofia

    2016-01-01

    During peritoneal dialysis (PD), the peritoneal membrane undergoes ageing processes that affect its function. Here we analyzed associations of patient age and dialysis vintage with parameters of peritoneal transport of fluid and solutes, directly measured and estimated based on the pore model, for individual patients. Thirty-three patients (15 females; age 60 (21-87) years; median time on PD 19 (3-100) months) underwent sequential peritoneal equilibration test. Dialysis vintage and patient age did not correlate. Estimation of parameters of the two-pore model of peritoneal transport was performed. The estimated fluid transport parameters, including hydraulic permeability (LpS), fraction of ultrasmall pores (α u), osmotic conductance for glucose (OCG), and peritoneal absorption, were generally independent of solute transport parameters (diffusive mass transport parameters). Fluid transport parameters correlated whereas transport parameters for small solutes and proteins did not correlate with dialysis vintage and patient age. Although LpS and OCG were lower for older patients and those with long dialysis vintage, αu was higher. Thus, fluid transport parameters--rather than solute transport parameters--are linked to dialysis vintage and patient age and should therefore be included when monitoring processes linked to ageing of the peritoneal membrane.

  19. Effective pollutant emission heights for atmospheric transport modelling based on real-world information.

    PubMed

    Pregger, Thomas; Friedrich, Rainer

    2009-02-01

    Emission data needed as input for the operation of atmospheric models should not only be spatially and temporally resolved. Another important feature is the effective emission height which significantly influences modelled concentration values. Unfortunately this information, which is especially relevant for large point sources, is usually not available and simple assumptions are often used in atmospheric models. As a contribution to improve knowledge on emission heights this paper provides typical default values for the driving parameters stack height and flue gas temperature, velocity and flow rate for different industrial sources. The results were derived from an analysis of the probably most comprehensive database of real-world stack information existing in Europe based on German industrial data. A bottom-up calculation of effective emission heights applying equations used for Gaussian dispersion models shows significant differences depending on source and air pollutant and compared to approaches currently used for atmospheric transport modelling.

  20. Multiscale image-based modeling and simulation of gas flow and particle transport in the human lungs

    PubMed Central

    Tawhai, Merryn H; Hoffman, Eric A

    2013-01-01

    Improved understanding of structure and function relationships in the human lungs in individuals and sub-populations is fundamentally important to the future of pulmonary medicine. Image-based measures of the lungs can provide sensitive indicators of localized features, however to provide a better prediction of lung response to disease, treatment and environment, it is desirable to integrate quantifiable regional features from imaging with associated value-added high-level modeling. With this objective in mind, recent advances in computational fluid dynamics (CFD) of the bronchial airways - from a single bifurcation symmetric model to a multiscale image-based subject-specific lung model - will be reviewed. The interaction of CFD models with local parenchymal tissue expansion - assessed by image registration - allows new understanding of the interplay between environment, hot spots where inhaled aerosols could accumulate, and inflammation. To bridge ventilation function with image-derived central airway structure in CFD, an airway geometrical modeling method that spans from the model ‘entrance’ to the terminal bronchioles will be introduced. Finally, the effects of turbulent flows and CFD turbulence models on aerosol transport and deposition will be discussed. CFD simulation of airflow and particle transport in the human lung has been pursued by a number of research groups, whose interest has been in studying flow physics and airways resistance, improving drug delivery, or investigating which populations are most susceptible to inhaled pollutants. The three most important factors that need to be considered in airway CFD studies are lung structure, regional lung function, and flow characteristics. Their correct treatment is important because the transport of therapeutic or pollutant particles is dependent on the characteristics of the flow by which they are transported; and the airflow in the lungs is dependent on the geometry of the airways and how ventilation is distributed to the peripheral tissue. The human airway structure spans more than 20 generations, beginning with the extra-thoracic airways (oral or nasal cavity, and through the pharynx and larynx to the trachea), then the conducting airways, the respiratory airways, and to the alveoli. The airways in individuals and sub-populations (by gender, age, ethnicity, and normal vs. diseased states) may exhibit different dimensions, branching patterns and angles, and thickness and rigidity. At the local level, one would like to capture detailed flow characteristics, e.g. local velocity profiles, shear stress, and pressure, for prediction of particle transport in an airway (lung structure) model that is specific to the geometry of an individual, to understand how inter-subject variation in airway geometry (normal or pathological) influences the transport and deposition of particles. In a systems biology – or multiscale modeling – approach, these local flow characteristics can be further integrated with epithelial cell models for the study of mechanotransduction. At the global (organ) level, one would like to match regional ventilation (lung function) that is specific to the individual, thus ensuring that the flow that transports inhaled particles is appropriately distributed throughout the lung model. Computational models that do not account for realistic distribution of ventilation are not capable of predicting realistic particle distribution or targeted drug deposition. Furthermore, the flow in the human lung can be transitional or turbulent in the upper and proximal airways, and becomes laminar in the distal airways. The flows in the laminar, transitional and turbulent regimes have different temporal and spatial scales. Therefore, modeling airway structure and predicting gas flow and particle transport at both local and global levels require image-guided multiscale modeling strategies. In this article, we will review the aforementioned three key aspects of CFD studies of the human lungs: airway structure (conducting airways), lung function (regional ventilation and boundary conditions), and flow characteristics (modeling of turbulent flow and its effect on particle transport). For modeling airway structure, we will focus on the conducting airways, and review both symmetric vs. asymmetric airway models, idealized vs. CT-based airway models, and multiscale subject-specific airway models. Imposition of physiological subject-specific boundary conditions (BCs) in CFD is essential to match regional ventilation in individuals, which is also critical in studying preferential deposition of inhaled aerosols in sub-populations, e.g. normals vs. asthmatics that may exhibit different ventilation patterns. Subject-specific regional ventilation defines flow distributions and characteristics in airway segments and bifurcations, which subsequently determines the transport and deposition of aerosols in the entire lungs. Turbulence models are needed to capture the transient and turbulent nature of the gas flow in the human lungs. Thus, the advantages and disadvantages of different turbulence models as well as their effects on particle transport will be discussed. The ultimate goal of the development is to identify sensitive structural and functional variables in sub-populations of normal and diseased lungs for potential clinical applications. PMID:23843310

Top