The permuted generator hypothesis for the origin of a genetic code

NASA Technical Reports Server (NTRS)

Folsome, C.

1977-01-01

Protocells had no known means of ensuring that their randomly collected proteins would be duplicated. A possible, albeit inexact, mechanism for protein synthesis in a primitive t-RNA is presented, whereby an oligonucleotide (12 units) in a circular configuration is able to align a generator site with amino acid discriminator sites. In this way, unique anticodons could be specified for each site and replication could occur.

Arrays of carbon nanofibers as a platform for biosensing at the molecular level and for tissue engineering and implantation.

PubMed

Koehne, Jessica E; Chen, Hua; Cassell, Alan; Liu, Gang-yu; Li, Jun; Meyyappan, M

2009-01-01

Arrays of Carbon nanofibers (CNFs) harness the advantages of individual CNF as well the collective property of assemblies, which made them promising materials in biosensing and tissue engineering or implantation. Here, we report two studies to explore the applications of vertically aligned CNFs. First, a nanoelectrode array (NEA) based on vertically aligned CNFs embedded in SiO(2) is used for ultrasensitive DNA detection. Oligonucleotide probes are selectively functionalized at the open ends of the CNFs and specifically hybridized with oligonucleotide targets. The guanine groups are employed as the signal moieties in the electrochemical measurements. Ru(bpy)(3)(2+) mediator is used to further amplify the guanine oxidation signal. The hybridization of less than approximately 1000 molecules of PCR amplified DNA targets are detected electrochemically by combining the CNF nanoelectrode array with the Ru(bpy)(3)(2+) amplification mechanism. Second, the SiO(2) matrix was etched back to produce needle-like protruding nanoelectrode arrays to be used as cell interfacing fibers for investigating gene transfection, electrical stimulation and detection of cellular processes. Our goal is to take advantage of the nanostructure of CNFs for unconventional biomolecular studies requiring ultrahigh sensitivity, high-degree of miniaturization and selective biofunctionalization.

Exploring Alignment of Community College Students for Preparedness and Achievement of Basic Skills

ERIC Educational Resources Information Center

Jeffcoat, Kendra; Weisblat, Irina A.; Bresciani, Marilee J.; Sly, Robert W.; Tucker, Mark; Herrin, Bridget; Cao, LiuHui

2014-01-01

This mixed-method study explored the alignment of expected student learning outcomes (SLOs) and expected student entrance skills, as stated within "course outlines of record" (CORs), for basic skills courses in one California community college district. Researchers evaluated consistencies and discrepancies in course alignment. There were…

Use of rDNA polymorphism for identification of Heterophyidae infecting freshwater fishes.

PubMed

Dzikowski, R; Levy, M G; Poore, M F; Flowers, J R; Paperna, I

2004-04-21

Infections by trematodes are among the most common fish-borne zoonoses. Metacercariae of the Family Heterophyidae in marine and freshwater fishes are nonfastidious in their choice of definitive hosts, and therefore, cause infections in human and domestic animals. In the present study, species-specific polymerase chain reaction (PCR) assays were developed for identifying and differentiating the various species examined. Sequencing and aligning the 18S (SSU) rDNA revealed interspecific variation for which species-specific DNA oligonucleotides were designed and used for the identification of 6 heterophyid species recovered from piscivorous birds. The oligonucleotides were further used to evaluate the various stages (cercariae recovered from snails, metacercariae recovered from fish and adult trematodes) of the digeneans. By applying this method we elucidated for the first time the life cycle of Pygidiopsis genata. The phylogenetic interrelationship among the newly sequenced species of Heterophyidae is outlined.

Molecular characterization of a 40 kDa OmpC-like porin from Serratia marcescens.

PubMed

Hutsul, J A; Worobec, E

1994-02-01

An oligonucleotide that encodes the N-terminal portion of a 41 kDa porin of Serratia marcescens was used to probe S. marcescens UOC-51 genomic DNA. An 11 kb EcoRI fragment which hybridized with the oligonucleotide was subcloned into Escherichia coli, examined for expression, and sequenced. The product expressed by the cloned gene was 40 kDa. The nucleotide sequence has an ORF of 1.13 kb. When the deduced amino acid sequence was aligned and compared to other enterobacterial porins the cloned S. marcescens porin most closely resembled E. coli OmpC. Although we did not detect osmoregulation or thermoregulation of any porins in S. marcescens UOC-51, sequences analogous to the E. coli osmoregulator OmpR-binding regions are seen upstream to the cloned gene. We examined the regulation of the S. marcescens porin in E. coli and found that its expression increased in a high salt environment. A micF gene, whose transcriptional product functions to inhibit synthesis of OmpF by hybridizing with the ompF transcript, was also seen upstream of the S. marcescens ompC. An alignment with the E. coli micF gene revealed that the functional region of the S. marcescens micF gene is conserved. Based on the results obtained we have determined that S. marcescens UOC-51 produces a 40 kDa porin similar to the E. coli OmpC porin.

Oligonucleotide probes to the 16S ribosomal RNA: implications of sequence homology and secondary structure with particular reference to the oral species Prevotella intermedia and Prevotella nigrescens.

PubMed

Shah, H N; Gharbia, S E; Scully, C; Finegold, S M

1995-03-01

Eight oligonucleotides based upon regions of the small subunit 16S ribosomal RNA gene sequences were analysed against a background of their position within the molecule and their two-dimensional structure to rationalise their use in recognising Prevotella intermedia and Prevotella nigrescens. The 41 clinical isolates from both oral and respiratory sites and two reference strains were subjected to DNA-DNA hybridisation and multilocus enzyme electrophoresis to confirm their identity. Alignment of oligonucleotide probes designated I Bi-2 to I Bi-6 (for P. intermedia) and 2Bi-2 (for P. nigrescens) with the 16S rRNA suggested that these probes lacked specificity or were constructed from hypervariable regions. A 52-mer oligonucleotide (designated Bi) reliably detected both species. Because of the high degree of concordance between the 16S rRNAs of both species, it was necessary to vary the stringency of hybridisation conditions for detection of both species. Thus probe I Bi-I recognised P. intermedia while I Bi-I detected both P. intermedia and P. nigrescens at low stringency. However, under conditions of high stringency only P. nigrescens was recognised by probe 2Bi-I. These probes were highly specific and did not hybridise with DNA from the closely related P. corporis, nor other periodontal pathogens such as Fusobacterium nucleatum, Actinobacillus actinomycetemcomitans, Treponema denticola and several pigmented species such as Prevotella melaninogenica, P. denticola, P. loescheii, Porphyromonas asaccharolytica, Py. endodontalis, Py. gingivalis, Py. levii, and Py. macacae.

Adult Basic Education: Aligning Adult Basic Education and Postsecondary Education

ERIC Educational Resources Information Center

Texas Higher Education Coordinating Board, 2008

2008-01-01

In 2007, the 80th Texas Legislature included a rider to the General Appropriations Act for the Texas Higher Education Coordinating Board. The rider directed the agency to coordinate with the Texas Education Agency to develop and implement plans to align adult basic education with postsecondary education. The Coordinating Board, in collaboration…

Pharmacokinetic Profiling of Conjugated Therapeutic Oligonucleotides: A High-Throughput Method Based Upon Serial Blood Microsampling Coupled to Peptide Nucleic Acid Hybridization Assay.

PubMed

Godinho, Bruno M D C; Gilbert, James W; Haraszti, Reka A; Coles, Andrew H; Biscans, Annabelle; Roux, Loic; Nikan, Mehran; Echeverria, Dimas; Hassler, Matthew; Khvorova, Anastasia

2017-12-01

Therapeutic oligonucleotides, such as small interfering RNAs (siRNAs), hold great promise for the treatment of incurable genetically defined disorders by targeting cognate toxic gene products for degradation. To achieve meaningful tissue distribution and efficacy in vivo, siRNAs must be conjugated or formulated. Clear understanding of the pharmacokinetic (PK)/pharmacodynamic behavior of these compounds is necessary to optimize and characterize the performance of therapeutic oligonucleotides in vivo. In this study, we describe a simple and reproducible methodology for the evaluation of in vivo blood/plasma PK profiles and tissue distribution of oligonucleotides. The method is based on serial blood microsampling from the saphenous vein, coupled to peptide nucleic acid hybridization assay for quantification of guide strands. Performed with minimal number of animals, this method allowed unequivocal detection and sensitive quantification without the need for amplification, or further modification of the oligonucleotides. Using this methodology, we compared plasma clearances and tissue distribution profiles of two different hydrophobically modified siRNAs (hsiRNAs). Notably, cholesterol-hsiRNA presented slow plasma clearances and mainly accumulated in the liver, whereas, phosphocholine-docosahexaenoic acid-hsiRNA was rapidly cleared from the plasma and preferably accumulated in the kidney. These data suggest that the PK/biodistribution profiles of modified hsiRNAs are determined by the chemical nature of the conjugate. Importantly, the method described in this study constitutes a simple platform to conduct pilot assessments of the basic clearance and tissue distribution profiles, which can be broadly applied for evaluation of new chemical variants of siRNAs and micro-RNAs.

Visualization of genome signatures of eukaryote genomes by batch-learning self-organizing map with a special emphasis on Drosophila genomes.

PubMed

Abe, Takashi; Hamano, Yuta; Ikemura, Toshimichi

2014-01-01

A strategy of evolutionary studies that can compare vast numbers of genome sequences is becoming increasingly important with the remarkable progress of high-throughput DNA sequencing methods. We previously established a sequence alignment-free clustering method "BLSOM" for di-, tri-, and tetranucleotide compositions in genome sequences, which can characterize sequence characteristics (genome signatures) of a wide range of species. In the present study, we generated BLSOMs for tetra- and pentanucleotide compositions in approximately one million sequence fragments derived from 101 eukaryotes, for which almost complete genome sequences were available. BLSOM recognized phylotype-specific characteristics (e.g., key combinations of oligonucleotide frequencies) in the genome sequences, permitting phylotype-specific clustering of the sequences without any information regarding the species. In our detailed examination of 12 Drosophila species, the correlation between their phylogenetic classification and the classification on the BLSOMs was observed to visualize oligonucleotides diagnostic for species-specific clustering.

Carbon Nanotube Nanoelectrode Array for Ultrasensitive DNA Detection

NASA Technical Reports Server (NTRS)

Li, Jun; Koehne, Jessica; Chen, Hua; Cassell, Alan; Ng, Hou Tee; Fan, Wendy; Ye, Qi; Han, Jie; Meyyappan, M.

2003-01-01

A reliable nanoelectrode array based on vertically aligned multi-walled carbon nanotubes (MWNTs) embedded in SiO2 is used for ultrasensitive DNA detection. Characteristic nanoelectrode behavior is observed using low-density MWNT arrays for measuring both bulk and surface immobilized redox species such as K4Fe(CN)6. The open-end of MWNTs present similar properties as graphite edge-plane electrodes with wide potential window, flexible chemical functionalities, and good biocompatibility. Oligonucleotide probes are selectively functionalized at the open ends cf the nanotube array and specifically hybridized with oligonucleotide targets. The guanine groups are employed as the signal moieties in the electrochemical measurements. Ru(bpy)3(2+) mediator is used to further amplify the guanine oxidation signal. The hybridization of subattomoles of PCR amplified DNA targets is detected electrochemically by combining the MWNT nanoelectrode array with the Ru(bpy)32' amplification mechanism. This system provides a general platform of molecular diagnostics for applications requiring ultrahigh sensitivity, high-degree of miniaturization, and simple sample preparations.

A high-throughput and quantitative method to assess the mutagenic potential of translesion DNA synthesis

PubMed Central

Taggart, David J.; Camerlengo, Terry L.; Harrison, Jason K.; Sherrer, Shanen M.; Kshetry, Ajay K.; Taylor, John-Stephen; Huang, Kun; Suo, Zucai

2013-01-01

Cellular genomes are constantly damaged by endogenous and exogenous agents that covalently and structurally modify DNA to produce DNA lesions. Although most lesions are mended by various DNA repair pathways in vivo, a significant number of damage sites persist during genomic replication. Our understanding of the mutagenic outcomes derived from these unrepaired DNA lesions has been hindered by the low throughput of existing sequencing methods. Therefore, we have developed a cost-effective high-throughput short oligonucleotide sequencing assay that uses next-generation DNA sequencing technology for the assessment of the mutagenic profiles of translesion DNA synthesis catalyzed by any error-prone DNA polymerase. The vast amount of sequencing data produced were aligned and quantified by using our novel software. As an example, the high-throughput short oligonucleotide sequencing assay was used to analyze the types and frequencies of mutations upstream, downstream and at a site-specifically placed cis–syn thymidine–thymidine dimer generated individually by three lesion-bypass human Y-family DNA polymerases. PMID:23470999

Drop drying on surfaces determines chemical reactivity - the specific case of immobilization of oligonucleotides on microarrays

PubMed Central

2013-01-01

Background Drop drying is a key factor in a wide range of technical applications, including spotted microarrays. The applied nL liquid volume provides specific reaction conditions for the immobilization of probe molecules to a chemically modified surface. Results We investigated the influence of nL and μL liquid drop volumes on the process of probe immobilization and compare the results obtained to the situation in liquid solution. In our data, we observe a strong relationship between drop drying effects on immobilization and surface chemistry. In this work, we present results on the immobilization of dye labeled 20mer oligonucleotides with and without an activating 5′-aminoheptyl linker onto a 2D epoxysilane and a 3D NHS activated hydrogel surface. Conclusions Our experiments identified two basic processes determining immobilization. First, the rate of drop drying that depends on the drop volume and the ambient relative humidity. Oligonucleotides in a dried spot react unspecifically with the surface and long reaction times are needed. 3D hydrogel surfaces allow for immobilization in a liquid environment under diffusive conditions. Here, oligonucleotide immobilization is much faster and a specific reaction with the reactive linker group is observed. Second, the effect of increasing probe concentration as a result of drop drying. On a 3D hydrogel, the increasing concentration of probe molecules in nL spotting volumes accelerates immobilization dramatically. In case of μL volumes, immobilization depends on whether the drop is allowed to dry completely. At non-drying conditions, very limited immobilization is observed due to the low oligonucleotide concentration used in microarray spotting solutions. The results of our study provide a general guideline for microarray assay development. They allow for the initial definition and further optimization of reaction conditions for the immobilization of oligonucleotides and other probe molecule classes to different surfaces in dependence of the applied spotting and reaction volume. PMID:23758982

DNA Nanotubes for NMR Structure Determination of Membrane Proteins

PubMed Central

Bellot, Gaëtan; McClintock, Mark A.; Chou, James J; Shih, William M.

2013-01-01

Structure determination of integral membrane proteins by solution NMR represents one of the most important challenges of structural biology. A Residual-Dipolar-Coupling-based refinement approach can be used to solve the structure of membrane proteins up to 40 kDa in size, however, a weak-alignment medium that is detergent-resistant is required. Previously, availability of media suitable for weak alignment of membrane proteins was severely limited. We describe here a protocol for robust, large-scale synthesis of detergent-resistant DNA nanotubes that can be assembled into dilute liquid crystals for application as weak-alignment media in solution NMR structure determination of membrane proteins in detergent micelles. The DNA nanotubes are heterodimers of 400nm-long six-helix bundles each self-assembled from a M13-based p7308 scaffold strand and >170 short oligonucleotide staple strands. Compatibility with proteins bearing considerable positive charge as well as modulation of molecular alignment, towards collection of linearly independent restraints, can be introduced by reducing the negative charge of DNA nanotubes via counter ions and small DNA binding molecules. This detergent-resistant liquid-crystal media offers a number of properties conducive for membrane protein alignment, including high-yield production, thermal stability, buffer compatibility, and structural programmability. Production of sufficient nanotubes for 4–5 NMR experiments can be completed in one week by a single individual. PMID:23518667

DNA nanotubes for NMR structure determination of membrane proteins.

PubMed

Bellot, Gaëtan; McClintock, Mark A; Chou, James J; Shih, William M

2013-04-01

Finding a way to determine the structures of integral membrane proteins using solution nuclear magnetic resonance (NMR) spectroscopy has proved to be challenging. A residual-dipolar-coupling-based refinement approach can be used to resolve the structure of membrane proteins up to 40 kDa in size, but to do this you need a weak-alignment medium that is detergent-resistant and it has thus far been difficult to obtain such a medium suitable for weak alignment of membrane proteins. We describe here a protocol for robust, large-scale synthesis of detergent-resistant DNA nanotubes that can be assembled into dilute liquid crystals for application as weak-alignment media in solution NMR structure determination of membrane proteins in detergent micelles. The DNA nanotubes are heterodimers of 400-nm-long six-helix bundles, each self-assembled from a M13-based p7308 scaffold strand and >170 short oligonucleotide staple strands. Compatibility with proteins bearing considerable positive charge as well as modulation of molecular alignment, toward collection of linearly independent restraints, can be introduced by reducing the negative charge of DNA nanotubes using counter ions and small DNA-binding molecules. This detergent-resistant liquid-crystal medium offers a number of properties conducive for membrane protein alignment, including high-yield production, thermal stability, buffer compatibility and structural programmability. Production of sufficient nanotubes for four or five NMR experiments can be completed in 1 week by a single individual.

Active oligonucleotides incorporating alkylating an agent as potential sequence- and base selective modifier of gene expression.

PubMed

Sasaki, S

2001-04-01

A number of cross-linking (alkylating) agents have been developed and incorporated into the oligonulceotides for sequence selective control of gene expression. Recently, potential application of such active oligonucleotides has been expanding from use for improvement of inhibition efficiency to new biotechnology that may enable chemical alteration of genetic information. These interests in active oligonucleotides have encouraged the generation of new cross-linking agents that exhibit high efficiency for application of either in vitro or in vivo. This mini review summarizes structures of alkylating agents, in particular, a new basic skeleton for cross-linking, a 2'-deoxyribose derivative of 2-amino-6-vinylpurine that has been recently developed by the author's group. The 2-amino-6-vinylpurine has been shown to form a complex with cytidine under acidic conditions, and brings the vinyl and the amino reactive groups into proximity to achieve efficient alkylation. A new strategy was designed so that the reactivity of 2-amino-6-vinylpurine can be induced from the corresponding phenylsulfoxide derivative within a duplex with the complementary strand. The validity of the new strategy has been proven by achievement of cytidine-selective cross-linking with remarkably efficiency.

The updated experimental proteinoid model

NASA Technical Reports Server (NTRS)

Fox, S. W.; Nakashima, T.; Przybylski, A.; Syren, R. M.

1982-01-01

The experimental proteinoid model includes new results indicating that polymers sufficiently rich in basic amino acid catalyze the synthesis of peptides from ATP and amino acids and of oligonucleotides from ATP. The need for simulation syntheses of amino acids yielding significant proportions of basic amino acids is now in focus. The modeled simultaneous protocellular synthesis of peptides and polynucleotides is part of a more comprehensive proposal for the origin of the coded genetic mechanism. The finding of membrane and action potentials in proteinoid microspheres, with or without added lecithin, is reported. The crucial nature of a nonrandom matrix for protocells is developed.

Antisense oligonucleotide therapeutics for iron-sulphur cluster deficiency myopathy.

PubMed

Kollberg, Gittan; Holme, Elisabeth

2009-12-01

Iron-sulphur cluster deficiency myopathy is caused by a deep intronic mutation in ISCU resulting in inclusion of a cryptic exon in the mature mRNA. ISCU encodes the iron-sulphur cluster assembly protein IscU. Iron-sulphur clusters are essential for most basic redox transformations including the respiratory-chain function. Most patients are homozygous for the mutation with a phenotype characterized by a non-progressive myopathy with childhood onset of early fatigue, dyspnoea and palpitation on trivial exercise. A more severe phenotype with early onset of a slowly progressive severe muscle weakness, severe exercise intolerance and cardiomyopathy is caused by a missense mutation in compound with the intronic mutation. Treatment of cultured fibroblasts derived from three homozygous patients with an antisense phosphorodiamidate morpholino oligonucleotide for 48 h resulted in 100% restoration of the normal splicing pattern. The restoration was stable and after 21 days the correctly spliced mRNA still was the dominating RNA species.

Versatile design and synthesis platform for visualizing genomes with Oligopaint FISH probes

PubMed Central

Beliveau, Brian J.; Joyce, Eric F.; Apostolopoulos, Nicholas; Yilmaz, Feyza; Fonseka, Chamith Y.; McCole, Ruth B.; Chang, Yiming; Li, Jin Billy; Senaratne, Tharanga Niroshini; Williams, Benjamin R.; Rouillard, Jean-Marie; Wu, Chao-ting

2012-01-01

A host of observations demonstrating the relationship between nuclear architecture and processes such as gene expression have led to a number of new technologies for interrogating chromosome positioning. Whereas some of these technologies reconstruct intermolecular interactions, others have enhanced our ability to visualize chromosomes in situ. Here, we describe an oligonucleotide- and PCR-based strategy for fluorescence in situ hybridization (FISH) and a bioinformatic platform that enables this technology to be extended to any organism whose genome has been sequenced. The oligonucleotide probes are renewable, highly efficient, and able to robustly label chromosomes in cell culture, fixed tissues, and metaphase spreads. Our method gives researchers precise control over the sequences they target and allows for single and multicolor imaging of regions ranging from tens of kilobases to megabases with the same basic protocol. We anticipate this technology will lead to an enhanced ability to visualize interphase and metaphase chromosomes. PMID:23236188

Finding Protein and Nucleotide Similarities with FASTA

PubMed Central

Pearson, William R.

2016-01-01

The FASTA programs provide a comprehensive set of rapid similarity searching tools ( fasta36, fastx36, tfastx36, fasty36, tfasty36), similar to those provided by the BLAST package, as well as programs for slower, optimal, local and global similarity searches ( ssearch36, ggsearch36) and for searching with short peptides and oligonucleotides ( fasts36, fastm36). The FASTA programs use an empirical strategy for estimating statistical significance that accommodates a range of similarity scoring matrices and gap penalties, improving alignment boundary accuracy and search sensitivity (Unit 3.5). The FASTA programs can produce “BLAST-like” alignment and tabular output, for ease of integration into existing analysis pipelines, and can search small, representative databases, and then report results for a larger set of sequences, using links from the smaller dataset. The FASTA programs work with a wide variety of database formats, including mySQL and postgreSQL databases (Unit 9.4). The programs also provide a strategy for integrating domain and active site annotations into alignments and highlighting the mutational state of functionally critical residues. These protocols describe how to use the FASTA programs to characterize protein and DNA sequences, using protein:protein, protein:DNA, and DNA:DNA comparisons. PMID:27010337

Finding Protein and Nucleotide Similarities with FASTA.

PubMed

Pearson, William R

2016-03-24

The FASTA programs provide a comprehensive set of rapid similarity searching tools (fasta36, fastx36, tfastx36, fasty36, tfasty36), similar to those provided by the BLAST package, as well as programs for slower, optimal, local, and global similarity searches (ssearch36, ggsearch36), and for searching with short peptides and oligonucleotides (fasts36, fastm36). The FASTA programs use an empirical strategy for estimating statistical significance that accommodates a range of similarity scoring matrices and gap penalties, improving alignment boundary accuracy and search sensitivity. The FASTA programs can produce "BLAST-like" alignment and tabular output, for ease of integration into existing analysis pipelines, and can search small, representative databases, and then report results for a larger set of sequences, using links from the smaller dataset. The FASTA programs work with a wide variety of database formats, including mySQL and postgreSQL databases. The programs also provide a strategy for integrating domain and active site annotations into alignments and highlighting the mutational state of functionally critical residues. These protocols describe how to use the FASTA programs to characterize protein and DNA sequences, using protein:protein, protein:DNA, and DNA:DNA comparisons. Copyright © 2016 John Wiley & Sons, Inc.

AlignMiner: a Web-based tool for detection of divergent regions in multiple sequence alignments of conserved sequences

PubMed Central

2010-01-01

Background Multiple sequence alignments are used to study gene or protein function, phylogenetic relations, genome evolution hypotheses and even gene polymorphisms. Virtually without exception, all available tools focus on conserved segments or residues. Small divergent regions, however, are biologically important for specific quantitative polymerase chain reaction, genotyping, molecular markers and preparation of specific antibodies, and yet have received little attention. As a consequence, they must be selected empirically by the researcher. AlignMiner has been developed to fill this gap in bioinformatic analyses. Results AlignMiner is a Web-based application for detection of conserved and divergent regions in alignments of conserved sequences, focusing particularly on divergence. It accepts alignments (protein or nucleic acid) obtained using any of a variety of algorithms, which does not appear to have a significant impact on the final results. AlignMiner uses different scoring methods for assessing conserved/divergent regions, Entropy being the method that provides the highest number of regions with the greatest length, and Weighted being the most restrictive. Conserved/divergent regions can be generated either with respect to the consensus sequence or to one master sequence. The resulting data are presented in a graphical interface developed in AJAX, which provides remarkable user interaction capabilities. Users do not need to wait until execution is complete and can.even inspect their results on a different computer. Data can be downloaded onto a user disk, in standard formats. In silico and experimental proof-of-concept cases have shown that AlignMiner can be successfully used to designing specific polymerase chain reaction primers as well as potential epitopes for antibodies. Primer design is assisted by a module that deploys several oligonucleotide parameters for designing primers "on the fly". Conclusions AlignMiner can be used to reliably detect divergent regions via several scoring methods that provide different levels of selectivity. Its predictions have been verified by experimental means. Hence, it is expected that its usage will save researchers' time and ensure an objective selection of the best-possible divergent region when closely related sequences are analysed. AlignMiner is freely available at http://www.scbi.uma.es/alignminer. PMID:20525162

Tracing common origins of Genomic Islands in prokaryotes based on genome signature analyses.

PubMed

van Passel, Mark Wj

2011-09-01

Horizontal gene transfer constitutes a powerful and innovative force in evolution, but often little is known about the actual origins of transferred genes. Sequence alignments are generally of limited use in tracking the original donor, since still only a small fraction of the total genetic diversity is thought to be uncovered. Alternatively, approaches based on similarities in the genome specific relative oligonucleotide frequencies do not require alignments. Even though the exact origins of horizontally transferred genes may still not be established using these compositional analyses, it does suggest that compositionally very similar regions are likely to have had a common origin. These analyses have shown that up to a third of large acquired gene clusters that reside in the same genome are compositionally very similar, indicative of a shared origin. This brings us closer to uncovering the original donors of horizontally transferred genes, and could help in elucidating possible regulatory interactions between previously unlinked sequences.

IMGT, the International ImMunoGeneTics database.

PubMed Central

Lefranc, M P; Giudicelli, V; Busin, C; Bodmer, J; Müller, W; Bontrop, R; Lemaitre, M; Malik, A; Chaume, D

1998-01-01

IMGT, the international ImMunoGeneTics database, is an integrated database specialising in Immunoglobulins (Ig), T cell Receptors (TcR) and Major Histocompatibility Complex (MHC) of all vertebrate species, created by Marie-Paule Lefranc, CNRS, Montpellier II University, Montpellier, France (lefranc@ligm.crbm.cnrs-mop.fr). IMGT includes three databases: LIGM-DB (for Ig and TcR), MHC/HLA-DB and PRIMER-DB (the last two in development). IMGT comprises expertly annotated sequences and alignment tables. LIGM-DB contains more than 23 000 Immunoglobulin and T cell Receptor sequences from 78 species. MHC/HLA-DB contains Class I and Class II Human Leucocyte Antigen alignment tables. An IMGT tool, DNAPLOT, developed for Ig, TcR and MHC sequence alignments, is also available. IMGT works in close collaboration with the EMBL database. IMGT goals are to establish a common data access to all immunogenetics data, including nucleotide and protein sequences, oligonucleotide primers, gene maps and other genetic data of Ig, TcR and MHC molecules, and to provide a graphical user friendly data access. IMGT has important implications in medical research (repertoire in autoimmune diseases, AIDS, leukemias, lymphomas), therapeutical approaches (antibody engineering), genome diversity and genome evolution studies. IMGT is freely available at http://imgt.cnusc.fr:8104 PMID:9399859

DNA impedance biosensor for detection of cancer, TP53 gene mutation, based on gold nanoparticles/aligned carbon nanotubes modified electrode.

PubMed

Fayazfar, H; Afshar, A; Dolati, M; Dolati, A

2014-07-11

For the first time, a new platform based on electrochemical growth of Au nanoparticles on aligned multi-walled carbon nanotubes (A-MWCNT) was developed for sensitive lable-free DNA detection of the TP53 gene mutation, one of the most popular genes in cancer research. Electrochemical impedance spectroscopy (EIS) was used to monitor the sequence-specific DNA hybridization events related to TP53 gene. Compared to the bare Ta or MWCNT/Ta electrodes, the synergistic interactions of vertically aligned MWCNT array and gold nanoparticles at modified electrode could improve the density of the probe DNA attachment and resulting the sensitivity of the DNA sensor greatly. Using EIS, over the extended DNA concentration range, the change of charge transfer resistance was found to have a linear relationship in respect to the logarithm of the complementary oligonucleotides sequence concentrations in the wide range of 1.0×10(-15)-1.0×10(-7)M, with a detection limit of 1.0×10(-17)M (S/N=3). The prepared sensor also showed good stability (14 days), reproducibility (RSD=2.1%) and could be conveniently regenerated via dehybridization in hot water. The significant improvement in sensitivity illustrates that combining gold nanoparticles with the on-site fabricated aligned MWCNT array represents a promising platform for achieving sensitive biosensor for fast mutation screening related to most human cancer types. Copyright © 2014. Published by Elsevier B.V.

Recommendations of the Oligonucleotide Safety Working Group's Formulated Oligonucleotide Subcommittee for the Safety Assessment of Formulated Oligonucleotide-Based Therapeutics.

PubMed

Marlowe, Jennifer L; Akopian, Violetta; Karmali, Priya; Kornbrust, Douglas; Lockridge, Jennifer; Semple, Sean

2017-08-01

The use of lipid formulations has greatly improved the ability to effectively deliver oligonucleotides and has been instrumental in the rapid expansion of therapeutic development programs using oligonucleotide drugs. However, the development of such complex multicomponent therapeutics requires the implementation of unique, scientifically sound approaches to the nonclinical development of these drugs, based upon a hybrid of knowledge and experiences drawn from small molecule, protein, and oligonucleotide therapeutic drug development. The relative paucity of directly applicable regulatory guidance documents for oligonucleotide therapeutics in general has resulted in the generation of multiple white papers from oligonucleotide drug development experts and members of the Oligonucleotide Safety Working Group (OSWG). The members of the Formulated Oligonucleotide Subcommittee of the OSWG have utilized their collective experience working with a variety of formulations and their associated oligonucleotide payloads, as well as their insights into regulatory considerations and expectations, to generate a series of consensus recommendations for the pharmacokinetic characterization and nonclinical safety assessment of this unique class of therapeutics. It should be noted that the focus of Subcommittee discussions was on lipid nanoparticle and other types of particulate formulations of therapeutic oligonucleotides and not on conjugates or other types of modifications of oligonucleotide structure intended to facilitate delivery.

EvOligo: A Novel Software to Design and Group Libraries of Oligonucleotides Applicable for Nucleic Acid-Based Experiments.

PubMed

Milewski, Marek C; Kamel, Karol; Kurzynska-Kokorniak, Anna; Chmielewski, Marcin K; Figlerowicz, Marek

2017-10-01

Experimental methods based on DNA and RNA hybridization, such as multiplex polymerase chain reaction, multiplex ligation-dependent probe amplification, or microarray analysis, require the use of mixtures of multiple oligonucleotides (primers or probes) in a single test tube. To provide an optimal reaction environment, minimal self- and cross-hybridization must be achieved among these oligonucleotides. To address this problem, we developed EvOligo, which is a software package that provides the means to design and group DNA and RNA molecules with defined lengths. EvOligo combines two modules. The first module performs oligonucleotide design, and the second module performs oligonucleotide grouping. The software applies a nearest-neighbor model of nucleic acid interactions coupled with a parallel evolutionary algorithm to construct individual oligonucleotides, and to group the molecules that are characterized by the weakest possible cross-interactions. To provide optimal solutions, the evolutionary algorithm sorts oligonucleotides into sets, preserves preselected parts of the oligonucleotides, and shapes their remaining parts. In addition, the oligonucleotide sets can be designed and grouped based on their melting temperatures. For the user's convenience, EvOligo is provided with a user-friendly graphical interface. EvOligo was used to design individual oligonucleotides, oligonucleotide pairs, and groups of oligonucleotide pairs that are characterized by the following parameters: (1) weaker cross-interactions between the non-complementary oligonucleotides and (2) more uniform ranges of the oligonucleotide pair melting temperatures than other available software products. In addition, in contrast to other grouping algorithms, EvOligo offers time-efficient sorting of paired and unpaired oligonucleotides based on various parameters defined by the user.

Advanced surface-enhanced Raman gene probe systems and methods thereof

DOEpatents

Vo-Dinh, Tuan

2001-01-01

The subject invention is a series of methods and systems for using the Surface-Enhanced Raman (SER)-labeled Gene Probe for hybridization, detection and identification of SER-labeled hybridized target oligonucleotide material comprising the steps of immobilizing SER-labeled hybridized target oligonucleotide material on a support means, wherein the SER-labeled hybridized target oligonucleotide material comprise a SER label attached either to a target oligonucleotide of unknown sequence or to a gene probe of known sequence complementary to the target oligonucleotide sequence, the SER label is unique for the target oligonucleotide strands of a particular sequence wherein the SER-labeled oligonucleotide is hybridized to its complementary oligonucleotide strand, then the support means having the SER-labeled hybridized target oligonucleotide material adsorbed thereon is SERS activated with a SERS activating means, then the support means is analyzed.

[Study toward practical use of oligonucleotide therapeutics].

PubMed

Inoue, Takao; Yoshida, Tokuyuki

2014-01-01

Over the past decade, oligonucleotide-based therapeutics such as antisense oligonucleotides and small interfering RNAs (siRNAs) have been developed extensively. For example, mipomersen (Kynamro; ISIS Pharmaceuticals), which is a second-generation antisense oligonucleotide administered by subcutaneous injection, has recently been approved by the FDA for the treatment of homozygous familial hypercholesterolemia. On the other hands, methods for the evaluation of quality, efficacy and safety of oligonucleotide therapeutics have not been fully discussed. Furthermore, the regulatory guidance specific for oligonucleotide therapeutics has not been established yet. Under these circumstances, we started to collaborate with Osaka University and PMDA to discuss regulatory science focused on oligonucleotide therapeutics. Through the collaboration, we would like to propose the possible design of quality evaluation and preclinical safety-evaluation of oligonucleotide therapeutics.

Enzymatic production of 'monoclonal stoichiometric' single-stranded DNA oligonucleotides.

PubMed

Ducani, Cosimo; Kaul, Corinna; Moche, Martin; Shih, William M; Högberg, Björn

2013-07-01

Single-stranded oligonucleotides are important as research tools, as diagnostic probes, in gene therapy and in DNA nanotechnology. Oligonucleotides are typically produced via solid-phase synthesis, using polymer chemistries that are limited relative to what biological systems produce. The number of errors in synthetic DNA increases with oligonucleotide length, and the resulting diversity of sequences can be a problem. Here we present the 'monoclonal stoichiometric' (MOSIC) method for enzyme-mediated production of DNA oligonucleotides. We amplified oligonucleotides from clonal templates derived from single bacterial colonies and then digested cutter hairpins in the products, which released pools of oligonucleotides with precisely controlled relative stoichiometric ratios. We prepared 14-378-nucleotide MOSIC oligonucleotides either by in vitro rolling-circle amplification or by amplification of phagemid DNA in Escherichia coli. Analyses of the formation of a DNA crystal and folding of DNA nanostructures confirmed the scalability, purity and stoichiometry of the produced oligonucleotides.

Enzymatic Production of Monoclonal Stoichiometric Single-Stranded DNA Oligonucleotides

PubMed Central

Ducani, Cosimo; Kaul, Corinna; Moche, Martin; Shih, William M.; Högberg, Björn

2013-01-01

Single-stranded oligonucleotides are important as research tools as probes for diagnostics and gene therapy. Today, production of oligonucleotides is done via solid-phase synthesis. However, the capabilities of current polymer chemistry are limited in comparison to what can be produced in biological systems. The errors in synthetic DNA increases with oligonucleotide length, and sequence diversity can often be a problem. Here, we present the Monoclonal Stoichiometric (MOSIC) method for enzymatic DNA oligonucleotide production. Using this method, we amplify oligonucleotides from clonal templates followed by digestion of a cutter-hairpin, resulting in pools of monoclonal oligonucleotides with precisely controlled relative stoichiometric ratios. We present data where MOSIC oligonucleotides, 14–378 nt long, were prepared either by in vitro rolling-circle amplification, or by amplification in Escherichia coli in the form of phagemid DNA. The formation of a DNA crystal and folding of DNA nanostructures confirmed the scalability, purity and stoichiometry of the produced oligonucleotides. PMID:23727986

Genotypic variations in field isolates of Theileria species infecting giraffes (Giraffa camelopardalis tippelskirchi and Giraffa camelopardalis reticulata) in Kenya.

PubMed

Githaka, Naftaly; Konnai, Satoru; Skilton, Robert; Kariuki, Edward; Kanduma, Esther; Murata, Shiro; Ohashi, Kazuhiko

2013-10-01

Recently, mortalities among giraffes, attributed to infection with unique species of piroplasms were reported in South Africa. Although haemoparasites are known to occur in giraffes of Kenya, the prevalence, genetic diversity and pathogenicity of these parasites have not been investigated. In this study, blood samples from 13 giraffes in Kenya were investigated microscopically and genomic DNA extracted. PCR amplicons of the hyper-variable region 4 (V4) of Theileria spp. small subunit ribosomal RNA (18S rRNA) gene were hybridized to a panel of genus- and species-specific oligonucleotide probes by reverse line blot (RLB). Two newly designed oligonucleotide probes specific for previously identified Theileria spp. of giraffes found single infections in eight of the specimens and mixed infections in the remaining five samples. Partial 18S rRNA genes were successfully amplified from 9 samples and the PCR amplicons were cloned. A total of 28 plasmid clones representing the Kenyan isolates were analyzed in the present study and compared with those of closely-related organisms retrieved from GenBank. In agreement with RLB results, the nucleotide sequence alignment indicated the presence of mixed infections in the giraffes. In addition, sequence alignment with the obtained 18S rRNA gene sequences revealed extensive microheterogeneities within and between isolates, characterized by indels in the V4 regions and point mutations outside this region. Phylogeny with 18S rRNA gene sequences from the detected parasites and those of related organisms places Theileria of giraffes into two major groups, within which are numerous clades that include the isolates reported in South Africa. Collectively, these data suggest the existence of at least two distinct Theileria species among giraffes, and extensive genetic diversity within the two parasite groups. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Syntheses of prodrug-type phosphotriester oligonucleotides responsive to intracellular reducing environment for improvement of cell membrane permeability and nuclease resistance.

PubMed

Hayashi, Junsuke; Samezawa, Yusuke; Ochi, Yosuke; Wada, Shun-Ichi; Urata, Hidehito

2017-07-15

We synthesized prodrug-type phosphotriester (PTE) oligonucleotides containing the six-membered cyclic disulfide moiety by using phosphoramidite chemistry. Prodrug-type oligonucleotides named "Reducing-Environment-Dependent Uncatalyzed Chemical Transforming (REDUCT) PTE oligonucleotides" were converted into natural oligonucleotides under cytosol-mimetic reductive condition. Furthermore, the REDUCT PTE oligonucleotides were robust to nuclease digestion and exhibited good cell membrane permeability. Copyright © 2017 Elsevier Ltd. All rights reserved.

A basic analysis toolkit for biological sequences

PubMed Central

Giancarlo, Raffaele; Siragusa, Alessandro; Siragusa, Enrico; Utro, Filippo

2007-01-01

This paper presents a software library, nicknamed BATS, for some basic sequence analysis tasks. Namely, local alignments, via approximate string matching, and global alignments, via longest common subsequence and alignments with affine and concave gap cost functions. Moreover, it also supports filtering operations to select strings from a set and establish their statistical significance, via z-score computation. None of the algorithms is new, but although they are generally regarded as fundamental for sequence analysis, they have not been implemented in a single and consistent software package, as we do here. Therefore, our main contribution is to fill this gap between algorithmic theory and practice by providing an extensible and easy to use software library that includes algorithms for the mentioned string matching and alignment problems. The library consists of C/C++ library functions as well as Perl library functions. It can be interfaced with Bioperl and can also be used as a stand-alone system with a GUI. The software is available at under the GNU GPL. PMID:17877802

Receptor-Mediated Uptake of Phosphorothioate Antisense Oligonucleotides in Different Cell Types of the Liver.

PubMed

Miller, Colton M; Tanowitz, Michael; Donner, Aaron J; Prakash, Thazha P; Swayze, Eric E; Harris, Edward N; Seth, Punit P

2018-06-01

Oligonucleotide therapeutics have emerged as a third distinct platform for drug discovery within the pharmaceutical industry. Five oligonucleotide-based drugs have been approved by the US FDA and over 100 oligonucleotides drugs are currently at different stages of human trials. Several of these oligonucleotide drugs are modified using the phosphorothioate (PS) backbone modification where one of the nonbridging oxygen atoms of the phosphodiester linkage is replaced with sulfur. In this review, we summarize our knowledge on receptor-mediated uptake of PS antisense oligonucleotides (ASOs) within different cell types of the liver-a privileged organ for the discovery of oligonucleotide-based therapeutics.

DNA-programmable nanoparticle crystallization.

PubMed

Park, Sung Yong; Lytton-Jean, Abigail K R; Lee, Byeongdu; Weigand, Steven; Schatz, George C; Mirkin, Chad A

2008-01-31

It was first shown more than ten years ago that DNA oligonucleotides can be attached to gold nanoparticles rationally to direct the formation of larger assemblies. Since then, oligonucleotide-functionalized nanoparticles have been developed into powerful diagnostic tools for nucleic acids and proteins, and into intracellular probes and gene regulators. In contrast, the conceptually simple yet powerful idea that functionalized nanoparticles might serve as basic building blocks that can be rationally assembled through programmable base-pairing interactions into highly ordered macroscopic materials remains poorly developed. So far, the approach has mainly resulted in polymerization, with modest control over the placement of, the periodicity in, and the distance between particles within the assembled material. That is, most of the materials obtained thus far are best classified as amorphous polymers, although a few examples of colloidal crystal formation exist. Here, we demonstrate that DNA can be used to control the crystallization of nanoparticle-oligonucleotide conjugates to the extent that different DNA sequences guide the assembly of the same type of inorganic nanoparticle into different crystalline states. We show that the choice of DNA sequences attached to the nanoparticle building blocks, the DNA linking molecules and the absence or presence of a non-bonding single-base flexor can be adjusted so that gold nanoparticles assemble into micrometre-sized face-centred-cubic or body-centred-cubic crystal structures. Our findings thus clearly demonstrate that synthetically programmable colloidal crystallization is possible, and that a single-component system can be directed to form different structures.

Static magnetic field reduced exogenous oligonucleotide uptake by spermatozoa using magnetic nanoparticle gene delivery system

NASA Astrophysics Data System (ADS)

Katebi, Samira; Esmaeili, Abolghasem; Ghaedi, Kamran

2016-03-01

Spermatozoa could introduce exogenous oligonucleotides of interest to the oocyte. The most important reason of low efficiency of sperm mediated gene transfer (SMGT) is low uptake of exogenous DNA by spermatozoa. The aim of this study was to evaluate the effects of static magnetic field on exogenous oligonucleotide uptake of spermatozoa using magnetofection method. Magnetic nanoparticles (MNPs) associated with the labeled oligonucleotides were used to increase the efficiency of exogenous oligonucleotide uptake by rooster spermatozoa. We used high-field/high-gradient magnet (NdFeB) to enhance and accelerate exogenous DNA sedimentation at the spermatozoa surface. Flow cytometry analysis was performed to measure viability and percentage of exogenous oligonucleotide uptake by sperm. Flow cytometry analysis showed a significant increase in exogenous oligonucleotide uptake by rooster spermatozoa (P<0.001) when spermatozoa were incubated in exogenous oligonucleotide solution and MNPs. However, by applying static magnetic field during magnetofection method, a significant decrease in exogenous oligonucleotide uptake was observed (P<0.05). Findings of this study showed that MNPs were effective to increase exogenous oligonucleotide uptake by rooster spermatozoa; however unlike others studies, static magnetic field, was not only ineffective to enhance exogenous oligonucleotide uptake by rooster spermatozoa but also led to reduction in efficiency of magnetic nanoparticles in gene transfer.

A novel universal DNA labeling and amplification system for rapid microarray-based detection of 117 antibiotic resistance genes in Gram-positive bacteria.

PubMed

Strauss, Christian; Endimiani, Andrea; Perreten, Vincent

2015-01-01

A rapid and simple DNA labeling system has been developed for disposable microarrays and has been validated for the detection of 117 antibiotic resistance genes abundant in Gram-positive bacteria. The DNA was fragmented and amplified using phi-29 polymerase and random primers with linkers. Labeling and further amplification were then performed by classic PCR amplification using biotinylated primers specific for the linkers. The microarray developed by Perreten et al. (Perreten, V., Vorlet-Fawer, L., Slickers, P., Ehricht, R., Kuhnert, P., Frey, J., 2005. Microarray-based detection of 90 antibiotic resistance genes of gram-positive bacteria. J.Clin.Microbiol. 43, 2291-2302.) was improved by additional oligonucleotides. A total of 244 oligonucleotides (26 to 37 nucleotide length and with similar melting temperatures) were spotted on the microarray, including genes conferring resistance to clinically important antibiotic classes like β-lactams, macrolides, aminoglycosides, glycopeptides and tetracyclines. Each antibiotic resistance gene is represented by at least 2 oligonucleotides designed from consensus sequences of gene families. The specificity of the oligonucleotides and the quality of the amplification and labeling were verified by analysis of a collection of 65 strains belonging to 24 species. Association between genotype and phenotype was verified for 6 antibiotics using 77 Staphylococcus strains belonging to different species and revealed 95% test specificity and a 93% predictive value of a positive test. The DNA labeling and amplification is independent of the species and of the target genes and could be used for different types of microarrays. This system has also the advantage to detect several genes within one bacterium at once, like in Staphylococcus aureus strain BM3318, in which up to 15 genes were detected. This new microarray-based detection system offers a large potential for applications in clinical diagnostic, basic research, food safety and surveillance programs for antimicrobial resistance. Copyright © 2014 Elsevier B.V. All rights reserved.

Structural alignment sensor. [laser applications and interferometry

NASA Technical Reports Server (NTRS)

Davis, L.; Buholz, N. E.; Gillard, C. W.; Huang, C. C.; Wells, W. M., III

1978-01-01

Comparative Michelson interferometers are discussed as well as the operating range potential of a structural alignment sensor (SAS) which requires only one laser mode. Schematics are presented for the distance measurement logic, the basic SAS system, the SAS optical layout, the coarse measurement signal processor, and the measured range resolution.

Pentopyranosyl Oligonucleotide Systems. Part 11: Systems with Shortened Backbones: D)-beta-Ribopyranosyl-(4 yields 3 )- and (L)-alpha - Lyxopyranosyl-(4 yields 3 )-oligonucleotides

NASA Technical Reports Server (NTRS)

Wippo, Harald; Reck, Folkert; Kudick, Rene; Ramaseshan, Mahesh; Ceulemans, Griet; Bolli, Martin; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

2001-01-01

The (L)-a-lyxopyranosyl-(4'yields 3')-oligonucleotide system-a member of a pentopyranosyl oligonucleotide family containing a shortened backbone-is capable of cooperative base-pairing and of cross-pairing with DNA and RNA. In contrast, corresponding (D)-beta-ribopyransoyl-(4' yields 3')-oligonucleotides do not show base-pairing under similar conditions. We conclude that oligonucleotide systems can violate the six-bonds-per-backbone-unit rule by having five bonds instead, if their vicinally bound phosphodiester bridges can assume an antiperiplanar conformation. An additional structural feature that seems relevant to the cross-pairing capability of the (L)-a-lyxopyranosyl-(4' yields 3')-oligonucleotide system is its (small) backbone/basepair axes inclination. An inclination which is similar to that in B-DNA seems to be a prerequisite for an oligonucleotide system s capability to cross-pair with DNA.

Aligning CASAS Competencies and Assessments to Basic Skills Content Standards. Second Edition

ERIC Educational Resources Information Center

CASAS - Comprehensive Adult Student Assessment Systems (NJ1), 2009

2009-01-01

Since its inception, the Comprehensive Adult Student Assessment System (CASAS) has focused on teaching and assessing basic skills in contexts that are relevant and important to adult learners. CASAS has developed and continues to refine a highly formalized hierarchy of competencies, the application of basic skills that adults need to be fully…

Genome-wide inference of transcription factor-DNA binding specificity in cell regeneration using a combination strategy.

PubMed

Wang, Xiaofeng; Zhang, Aiqun; Ren, Weizheng; Chen, Caiyu; Dong, Jiahong

2012-11-01

The cell growth, development, and regeneration of tissue and organ are associated with a large number of gene regulation events, which are mediated in part by transcription factors (TFs) binding to cis-regulatory elements involved in the genome. Predicting the binding affinity and inferring the binding specificity of TF-DNA interactions at the genomic level would be fundamentally helpful for our understanding of the molecular mechanism and biological implication underlying sequence-specific TF-DNA recognition. In this study, we report the development of a combination method to characterize the interaction behavior of a 11-mer oligonucleotide segment and its mutations with the Gcn4p protein, a homodimeric, basic leucine zipper TF, and to predict the binding affinity and specificity of potential Gcn4p binders in the genome-wide scale. In this procedure, a position-mutated energy matrix is created based on molecular modeling analysis of native and mutated Gcn4p-DNA complex structures to describe the position-independent interaction energy profile of Gcn4p with different nucleotide types at each position of the oligonucleotide, and the energy terms extracted from the matrix and their interactives are then correlated with experimentally measured affinities of 19268 distinct oligonucleotides using statistical modeling methodology. Subsequently, the best one of built regression models is successfully applied to screen those of potential high-affinity Gcn4p binders from the complete genome. The findings arising from this study are briefly listed below: (i) The 11 positions of oligonucleotides are highly interactive and non-additive in contribution to Gcn4p-DNA binding affinity; (ii) Indirect conformational effects upon nucleotide mutations as well as associated subtle changes in interfacial atomic contacts, but not the direct nonbonded interactions, are primarily responsible for the sequence-specific recognition; (iii) The intrinsic synergistic effects among the sequence positions of oligonucleotides determine Gcn4p-DNA binding affinity and specificity; (iv) Linear regression models in conjunction with variable selection seem to perform fairly well in capturing the internal dependences hidden in the Gcn4p-DNA system, albeit ignoring nonlinear factors may lead the models to systematically underestimate and overestimate high- and low-affinity samples, respectively. © 2012 John Wiley & Sons A/S.

MALDI MS analysis of oligonucleotides: desalting by functional magnetite beads using microwave-assisted extraction.

PubMed

Chen, Wei-Yu; Chen, Yu-Chie

2007-11-01

The presence of alkali cation adductions of oligonucleotides commonly deteriorates matrix-assisted laser desorption/ionization (MALDI) mass spectra. Thus, desalting is required for oligonucleotide samples prior to MALDI MS analysis in order to prevent the mass spectra from developing poor quality. In this paper, we demonstrate a new approach to extract traces of oligonucleotides from aqueous solutions containing high concentrations of salts using microwave-assisted extraction. The C18-presenting magnetite beads, capable of absorbing microwave irradiation, are used as affinity probes for oligonucleotides with the addition of triethylammonium acetate as the counterions. This new microwave-assisted extraction approach using magnetite beads as the trapping agents and as microwave-absorbers has been demonstrated to be very effective in the selective binding of oligonucleotides from aqueous solutions. The extraction of oligonucleotides from solutions onto the C18-presenting magnetite beads takes only 30 s to enrich oligonucleotides in sufficient quantities for MALDI MS analysis. After using this desalting approach, alkali cation adductions of oligonucleotides are dramatically reduced in the MALDI mass spectra. The presence of saturated NaCl (approximately 6 M) in the oligonucleotide sample is tolerated without degrading the mass spectra. The detection limit for d(A)6 is approximately 2.8 fmol.

[Impact of Delivery Method on Antiviral Activity of Phosphodiester, Phosphorothioate, and Phosphoryl Guanidine Oligonucleotides in MDCK Cells Infected with H5N1 Bird Flu Virus].

PubMed

Levina, A S; Repkova, M N; Chelobanov, B P; Bessudnova, E V; Mazurkova, N A; Stetsenko, D A; Zarytova, V F

2017-01-01

We have previously described nanocomposites containing conjugates or complexes of native oligodeoxyribonucleotides with poly-L-lysine and TiO2 nanoparticles. We have shown that these nanocomposites efficiently suppressed influenza A virus reproduction in MDCK cells. Here, we have synthesized previously undescribed nanocomposites that consist of TiO2 nanoparticles and polylysine conjugates with oligonucleotides that contain phosphoryl guanidine or phosphorothioate internucleotide groups. These nanocomposites have been shown to exhibit antiviral activity in MDCK cells infected with H5N1 influenza A virus. The nanocomposites containing phosphorothioate oligonucleotides inhibited virus replication ~130-fold. More potent inhibition, i.e., ~5000-fold or ~4600-fold, has been demonstrated by nanocomposites that contain phosphoryl guanidine or phosphodiester oligonucleotides, respectively. Free oligonucleotides have been nearly inactive. The antiviral activity of oligonucleotides of all three types, when delivered by Lipofectamine, has been significantly lower compared to the oligonucleotides delivered in the nanocomposites. In the former case, the phosphoryl guanidine oligonucleotide has appeared to be the most efficient; it has inhibited the virus replication by a factor of 400. The results make it possible to consider phosphoryl guanidine oligonucleotides, along with other oligonucleotide derivatives, as potential antiviral agents against H5N1 avian flu virus.

Modification of the 5' terminus of oligodeoxyribonucleotides for conjugation with ligands.

PubMed

Asseline, U; Thuong, N T

2001-08-01

Ligands can be introduced at the 5' terminus of an oligonucleotide by adding a linker to the ligand and modifying the 5' terminus of the oligonucleotide. These are then reacted to give the ligand-oligonucleotide conjugate. This unit describes the addition of carboxylated and aminoalkylated linkers, and phosphorothioate, phosphate, and masked thiol groups to the 5' terminus of an oligonucleotide. The addition of linkers to ligands and the final reaction that produces the ligand-conjugated oligonucleotide are described elsewhere in the series. This approach is particularly useful when there is a limited amount of ligand available, when the ligand is sensitive to chemical conditions required for oligonucleotide deprotection, or when the ligand is weakly soluble in solvents required for phosphoramidite- or H-phosphonate-mediated oligonucleotide synthesis.

Nucleic acid sequence detection using multiplexed oligonucleotide PCR

DOEpatents

Nolan, John P [Santa Fe, NM; White, P Scott [Los Alamos, NM

2006-12-26

Methods for rapidly detecting single or multiple sequence alleles in a sample nucleic acid are described. Provided are all of the oligonucleotide pairs capable of annealing specifically to a target allele and discriminating among possible sequences thereof, and ligating to each other to form an oligonucleotide complex when a particular sequence feature is present (or, alternatively, absent) in the sample nucleic acid. The design of each oligonucleotide pair permits the subsequent high-level PCR amplification of a specific amplicon when the oligonucleotide complex is formed, but not when the oligonucleotide complex is not formed. The presence or absence of the specific amplicon is used to detect the allele. Detection of the specific amplicon may be achieved using a variety of methods well known in the art, including without limitation, oligonucleotide capture onto DNA chips or microarrays, oligonucleotide capture onto beads or microspheres, electrophoresis, and mass spectrometry. Various labels and address-capture tags may be employed in the amplicon detection step of multiplexed assays, as further described herein.

Data basic to the engineering of reconstituted flakeboard

Treesearch

Robert L. Geimer

1979-01-01

Flakeboards made with uniform densities throughout their thickness and different degrees of flake alignment were used to establish relationships between bending, tension, and compression values of modulus of elasticity or modulus of rupture (or stress to maximum load) and the variables of specific gravity and flake alignment. An equation using sonic velocity as an...

Challenges of Adopting Constructive Alignment in Action Learning Education

ERIC Educational Resources Information Center

Remneland Wikhamn, Björn

2017-01-01

This paper will critically examine how the two influential pedagogical approaches of action-based learning and constructive alignment relate to each other, and how they may differ in focus and basic assumptions. From the outset, they are based on similar underpinnings, with the student and the learning outcomes in the center. Drawing from…

Predicting oligonucleotide affinity to nucleic acid targets.

PubMed Central

Mathews, D H; Burkard, M E; Freier, S M; Wyatt, J R; Turner, D H

1999-01-01

A computer program, OligoWalk, is reported that predicts the equilibrium affinity of complementary DNA or RNA oligonucleotides to an RNA target. This program considers the predicted stability of the oligonucleotide-target helix and the competition with predicted secondary structure of both the target and the oligonucleotide. Both unimolecular and bimolecular oligonucleotide self structure are considered with a user-defined concentration. The application of OligoWalk is illustrated with three comparisons to experimental results drawn from the literature. PMID:10580474

Template-Directed Ligation of Peptides to Oligonucleotides

NASA Technical Reports Server (NTRS)

Bruick, Richard K.; Dawson, Philip E.; Kent, Stephen BH; Usman, Nassim; Joyce, Gerald F.

1996-01-01

Synthetic oligonucleotides and peptides have enjoyed a wide range of applications in both biology and chemistry. As a consequence, oligonucleotide-peptide conjugates have received considerable attention, most notably in the development of antisense constructs with improved pharmacological properties. In addition, oligonucleotide-peptide conjugates have been used as molecular tags, in the assembly of supramolecular arrays and in the construction of encoded combinatorial libraries. To make these chimeric molecules more accessible for a broad range of investigations, we sought to develop a facile method for joining fully deprotected oligonucleotides and peptides through a stable amide bond linkage. Furthermore, we wished to make this ligation reaction addressable, enabling one to direct the ligation of specific oligonucleotide and peptide components.To confer specificity and accelerate the rate of the reaction, the ligation process was designed to be dependent on the presence of a complementary oligonucleotide template.

Clay catalysis of oligonucleotide formation: kinetics of the reaction of the 5'-phosphorimidazolides of nucleotides with the non-basic heterocycles uracil and hypoxanthine

NASA Technical Reports Server (NTRS)

Kawamura, K.; Ferris, J. P.

1999-01-01

The montmorillonite clay catalyzed condensation of activated monocleotides to oligomers of RNA is a possible first step in the formation of the proposed RNA world. The rate constants for the condensation of the phosphorimidazolide of adenosine were measured previously and these studies have been extended to the phosphorimidazolides of inosine and uridine in the present work to determine of substitution of neutral heterocycles for the basic adenine ring changes the reaction rate or regioselectivity. The oligomerization reactions of the 5'-phosphoromidazolides of uridine (ImpU) and inosine (ImpI) on montmorillonite yield oligo(U)s and oligo(I)s as long as heptamers. The rate constants for oligonucleotide formation were determined by measuring the rates of formation of the oligomers by HPLC. Both the apparent rate constants in the reaction mixture and the rate constants on the clay surface were calculated using the partition coefficients of the oligomers between the aqueous and clay phases. The rate constants for trimer formation are much greater than those dimer synthesis but there was little difference in the rate constants for the formation of trimers and higher oligomers. The overall rates of oligomerization of the phosphorimidazolides of purine and pyrimidine nucleosides in the presence of montmorillonite clay are the same suggesting that RNA formed on the primitive Earth could have contained a variety of heterocyclic bases. The rate constants for oligomerization of pyrimidine nucleotides on the clay surface are significantly higher than those of purine nucleotides since the pyrimidine nucleotides bind less strongly to the clay than do the purine nucleotides. The differences in the binding is probably due to Van der Waals interactions between the purine bases and the clay surface. Differences in the basicity of the heterocyclic ring in the nucleotide have little effect on the oligomerization process.

Recombinant transfer in the basic genome of E. coli

DOE PAGES

Dixit, Purushottam; Studier, F. William; Pang, Tin Yau; ...

2015-07-07

An approximation to the ~4-Mbp basic genome shared by 32 strains of E. coli representing six evolutionary groups has been derived and analyzed computationally. A multiple-alignment of the 32 complete genome sequences was filtered to remove mobile elements and identify the most reliable ~90% of the aligned length of each of the resulting 496 basic-genome pairs. Patterns of single bp mutations (SNPs) in aligned pairs distinguish clonally inherited regions from regions where either genome has acquired DNA fragments from diverged genomes by homologous recombination since their last common ancestor. Such recombinant transfer is pervasive across the basic genome, mostly betweenmore » genomes in the same evolutionary group, and generates many unique mosaic patterns. The six least-diverged genome-pairs have one or two recombinant transfers of length ~40–115 kbp (and few if any other transfers), each containing one or more gene clusters known to confer strong selective advantage in some environments. Moderately diverged genome pairs (0.4–1% SNPs) show mosaic patterns of interspersed clonal and recombinant regions of varying lengths throughout the basic genome, whereas more highly diverged pairs within an evolutionary group or pairs between evolutionary groups having >1.3% SNPs have few clonal matches longer than a few kbp. Many recombinant transfers appear to incorporate fragments of the entering DNA produced by restriction systems of the recipient cell. A simple computational model can closely fit the data. As a result, most recombinant transfers seem likely to be due to generalized transduction by co-evolving populations of phages, which could efficiently distribute variability throughout bacterial genomes.« less

Recombinant transfer in the basic genome of E. coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dixit, Purushottam; Studier, F. William; Pang, Tin Yau

An approximation to the ~4-Mbp basic genome shared by 32 strains of E. coli representing six evolutionary groups has been derived and analyzed computationally. A multiple-alignment of the 32 complete genome sequences was filtered to remove mobile elements and identify the most reliable ~90% of the aligned length of each of the resulting 496 basic-genome pairs. Patterns of single bp mutations (SNPs) in aligned pairs distinguish clonally inherited regions from regions where either genome has acquired DNA fragments from diverged genomes by homologous recombination since their last common ancestor. Such recombinant transfer is pervasive across the basic genome, mostly betweenmore » genomes in the same evolutionary group, and generates many unique mosaic patterns. The six least-diverged genome-pairs have one or two recombinant transfers of length ~40–115 kbp (and few if any other transfers), each containing one or more gene clusters known to confer strong selective advantage in some environments. Moderately diverged genome pairs (0.4–1% SNPs) show mosaic patterns of interspersed clonal and recombinant regions of varying lengths throughout the basic genome, whereas more highly diverged pairs within an evolutionary group or pairs between evolutionary groups having >1.3% SNPs have few clonal matches longer than a few kbp. Many recombinant transfers appear to incorporate fragments of the entering DNA produced by restriction systems of the recipient cell. A simple computational model can closely fit the data. As a result, most recombinant transfers seem likely to be due to generalized transduction by co-evolving populations of phages, which could efficiently distribute variability throughout bacterial genomes.« less

Versatile Method for the Site-Specific Modification of DNA with Boron Clusters: Anti-Epidermal Growth Factor Receptor (EGFR) Antisense Oligonucleotide Case.

PubMed

Ebenryter-Olbińska, Katarzyna; Kaniowski, Damian; Sobczak, Milena; Wojtczak, Błażej A; Janczak, Sławomir; Wielgus, Ewelina; Nawrot, Barbara; Leśnikowski, Zbigniew J

2017-11-21

A general and convenient approach for the incorporation of different types of boron clusters into specific locations of the DNA-oligonucleotide chain based on the automated phosphoramidite method of oligonucleotide synthesis and post-synthetic "click chemistry" modification has been developed. Pronounced effects of boron-cluster modification on the physico- and biochemical properties of the antisense oligonucleotides were observed. The silencing activity of antisense oligonucleotides bearing a single boron cluster modification in the middle of the oligonucleotide chain was substantially higher than that of unmodified oligonucleotides. This finding may be of importance for the design of therapeutic nucleic acids with improved properties. The proposed synthetic methodology broadens the availability of nucleic acid-boron cluster conjugates and opens up new avenues for their potential practical use. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Scalable amplification of strand subsets from chip-synthesized oligonucleotide libraries

PubMed Central

Schmidt, Thorsten L.; Beliveau, Brian J.; Uca, Yavuz O.; Theilmann, Mark; Da Cruz, Felipe; Wu, Chao-Ting; Shih, William M.

2015-01-01

Synthetic oligonucleotides are the main cost factor for studies in DNA nanotechnology, genetics and synthetic biology, which all require thousands of these at high quality. Inexpensive chip-synthesized oligonucleotide libraries can contain hundreds of thousands of distinct sequences, however only at sub-femtomole quantities per strand. Here we present a selective oligonucleotide amplification method, based on three rounds of rolling-circle amplification, that produces nanomole amounts of single-stranded oligonucleotides per millilitre reaction. In a multistep one-pot procedure, subsets of hundreds or thousands of single-stranded DNAs with different lengths can selectively be amplified and purified together. These oligonucleotides are used to fold several DNA nanostructures and as primary fluorescence in situ hybridization probes. The amplification cost is lower than other reported methods (typically around US$ 20 per nanomole total oligonucleotides produced) and is dominated by the use of commercial enzymes. PMID:26567534

Using structure to explore the sequence alignment space of remote homologs.

PubMed

Kuziemko, Andrew; Honig, Barry; Petrey, Donald

2011-10-01

Protein structure modeling by homology requires an accurate sequence alignment between the query protein and its structural template. However, sequence alignment methods based on dynamic programming (DP) are typically unable to generate accurate alignments for remote sequence homologs, thus limiting the applicability of modeling methods. A central problem is that the alignment that is "optimal" in terms of the DP score does not necessarily correspond to the alignment that produces the most accurate structural model. That is, the correct alignment based on structural superposition will generally have a lower score than the optimal alignment obtained from sequence. Variations of the DP algorithm have been developed that generate alternative alignments that are "suboptimal" in terms of the DP score, but these still encounter difficulties in detecting the correct structural alignment. We present here a new alternative sequence alignment method that relies heavily on the structure of the template. By initially aligning the query sequence to individual fragments in secondary structure elements and combining high-scoring fragments that pass basic tests for "modelability", we can generate accurate alignments within a small ensemble. Our results suggest that the set of sequences that can currently be modeled by homology can be greatly extended.

Simple and rapid enzymatic method for the synthesis of single-strand oligonucleotides containing trifluorothymidine.

PubMed

Suzuki, Norihiko; Fukushima, Masakazu

2010-11-01

To investigate the mechanism of trifluorothymidine (TFT)-induced DNA damage, we developed an enzymatic method for the synthesis of single-strand oligonucleotides containing TFT-monophosphate residues. Sixteen-mer oligonucleotides and 14-mer 5'-phosphorylated oligonucleotides were annealed to the template of 25-mer, so as to empty one nucleotide site. TFT-triphosphate was incorporated into the site by DNA polymerase and then ligated to 5'-phosphorylated oligonucleotides by DNA ligase. The synthesized 31-mer oligonucleotides containing TFT residues were isolated from the 25-mer complementary template by denaturing polyacrylamide electrophoresis. Using these single-strand oligonucleotides containing TFT residues, the cleavage of TFT residues from DNA, using mismatch uracil-DNA glycosylase (MUG) of E.coli origin, was compared with that of 5-fluorouracil (5FU) and 5-bromodeoxyuridine (BrdU). The TFT/A pair was not cleaved by MUG, while the other pairs, namely, 5FU/A, 5FU/G, BrdU/A, BrdU/G, and TFT/G, were easily cleaved from each synthesized DNA. Thus, this method is useful for obtaining some site-specifically modified oligonucleotides.

Intravenous administration of stabilized antisense lipid particles (SALP) leads to activation and expansion of liver natural killer cells.

PubMed

Bramson, J L; Bodner, C A; Johnson, J; Semple, S; Hope, M J

2000-06-01

Stabilized antisense lipid particles (SALP) have been developed for the systemic delivery of oligonucleotides. The impact of intravenous SALP administration was measured with respect to activation of natural killer (NK) and NK1.1+ T (NKT) cells in the livers of immunocompetent mice. Treatment with a SALP containing a highly mitogenic oligonucleotide (INX-6295) generated an increase in NK cytolytic activity and cell number within the liver but did not appear to affect the number of hepatic NKT cells or their cytolytic activity. The same results were observed after intravenous administration of the mitogenic oligonucleotide alone. Interestingly, treatment with a SALP containing a weakly mitogenic oligonucleotide (INX-6300) also activated the liver NK cells, whereas the oligonucleotide alone was unable to elicit these effects. The NK stimulatory activity of a SALP containing INX-6300 required both lipid and oligonucleotide components. These results demonstrate that in addition to modifying the pharmacokinetics and biodistribution of intravenously administered oligonucleotides, SALP possess immunostimulatory activity independent of oligonucleotide mitogenicity, which can serve as an adjuvant to antisense therapies for cancer.

The chemical evolution of oligonucleotide therapies of clinical utility

PubMed Central

Khvorova, Anastasia; Watts, Jonathan K.

2017-01-01

After nearly 40 years of development, oligonucleotide therapeutics are nearing meaningful clinical productivity. One of the key advantages of oligonucleotide drugs is that their delivery and potency properties are derived primarily from the chemical structure of the oligonucleotide, while their target is defined by the base sequence. Thus, as oligonucleotides with a particular chemical design demonstrate appropriate distribution and safety profiles for clinical gene silencing in a particular tissue, this will open the door to the rapid development of additional drugs targeting other disease-associated genes in the same tissue. To achieve clinical productivity, the chemical architecture of the oligonucleotide needs to be optimized as a whole, using a combination of sugar, backbone, nucleobase and 3′/5′-terminal modifications. A portfolio of chemistries can be used to confer drug like properties onto the oligonucleotide as a whole, with minor chemical changes often translating into major improvements in clinical efficacy. Outstanding challenges in oligonucleotide chemical development include optimization of chemical architectures to ensure long-term safety and to enable robust clinical activity beyond the liver. PMID:28244990

High-speed all-optical DNA local sequence alignment based on a three-dimensional artificial neural network.

PubMed

Maleki, Ehsan; Babashah, Hossein; Koohi, Somayyeh; Kavehvash, Zahra

2017-07-01

This paper presents an optical processing approach for exploring a large number of genome sequences. Specifically, we propose an optical correlator for global alignment and an extended moiré matching technique for local analysis of spatially coded DNA, whose output is fed to a novel three-dimensional artificial neural network for local DNA alignment. All-optical implementation of the proposed 3D artificial neural network is developed and its accuracy is verified in Zemax. Thanks to its parallel processing capability, the proposed structure performs local alignment of 4 million sequences of 150 base pairs in a few seconds, which is much faster than its electrical counterparts, such as the basic local alignment search tool.

Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

PubMed

Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

2004-03-01

A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson-Crick base pair in SECIS element plays an important role in the selenocysteine expression by UGA codon.

Parental alignments and rejection: an empirical study of alienation in children of divorce.

PubMed

Johnston, Janet R

2003-01-01

This study of family relationships after divorce examined the frequency and extent of child-parent alignments and correlates of children's rejection of a parent, these being basic components of the controversial idea of "parental alienation syndrome." The sample consisted of 215 children from the family courts and general community two to three years after parental separation. The findings indicate that children's attitudes toward their parents range from positive to negative, with relatively few being extremely aligned or rejecting. Rejection of a parent has multiple determinants, with both the aligned and rejected parents contributing to the problem, in addition to vulnerabilities within children themselves.

Sensitive detection of unlabeled oligonucleotides using a paired surface plasma waves biosensor.

PubMed

Li, Ying-Chang; Chiou, Chiuan-Chian; Luo, Ji-Dung; Chen, Wei-Ju; Su, Li-Chen; Chang, Ying-Feng; Chang, Yu-Sun; Lai, Chao-Sung; Lee, Cheng-Chung; Chou, Chien

2012-05-15

Detection of unlabeled oligonucleotides using surface plasmon resonance (SPR) is difficult because of the oligonucleotides' relatively lower molecular weight compared with proteins. In this paper, we describe a method for detecting unlabeled oligonucleotides at low concentration using a paired surface plasma waves biosensor (PSPWB). The biosensor uses a sensor chip with an immobilized probe to detect a target oligonucleotide via sequence-specific hybridization. PSPWB measures the demodulated amplitude of the heterodyne signal in real time. In the meantime, the ratio of the amplitudes between the detected output signal and reference can reduce the excess noise from the laser intensity fluctuation. Also, the common-path propagation of p and s waves cancels the common phase noise induced by temperature variation. Thus, a high signal-to-noise ratio (SNR) of the heterodyne signal is detected. The sequence specificity of oligonucleotide hybridization ensures that the platform is precisely discriminating between target and non-target oligonucleotides. Under optimized experimental conditions, the detected heterodyne signal increases linearly with the logarithm of the concentration of target oligonucleotide over the range 0.5-500 pM. The detection limit is 0.5 pM in this experiment. In addition, the non-target oligonucleotide at concentrations of 10 pM and 10nM generated signals only slightly higher than background, indicating the high selectivity and specificity of this method. Different length of perfectly matched oligonucleotide targets at 10-mer, 15-mer and 20-mer were identified at the concentration of 150 pM. Copyright © 2012 Elsevier B.V. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sun, Zhen; Department of Biochemistry and Molecular Biology, Program in Molecular Cell Biology, Zhejiang University School of Medicine, Hangzhou, Zhejiang 310058; Xiang, Wenqing

Highlights: {yields} LNA-modified oligonucleotides can pass through the plasma membrane of cultured cells even without using transfection machinery. {yields} LNA-modified oligonucleotides passed efficiently across the cell membrane, and lipid-coating facilitated translocation from the cytoplasm to the nucleus. {yields} LNA-oligonucleotide designed to target nuclear HBV DNA efficiently suppresses HBV replication and transcription in cultured hepatic cells. -- Abstract: Silencing target genes with small regulatory RNAs is widely used to investigate gene function and therapeutic drug development. Recently, triplex-based approaches have provided another attractive means to achieve targeted gene regulation and gene manipulation at the molecular and cellular levels. Nuclear entry ofmore » oligonucleotides and enhancement of their affinity to the DNA targets are key points of such approaches. In this study, we developed lipid-based transport of a locked-nucleic-acid (LNA)-modified oligonucleotide for hepatitis B virus (HBV) DNA interference in human hepatocytes expressing HBV genomic DNA. In these cells, the LNA-modified oligonucleotides passed efficiently across the cell membrane, and lipid-coating facilitated translocation from the cytoplasm to the nucleus. The oligonucleotide specifically targeting HBV DNA clearly interfered with HBV DNA transcription as shown by a block in pregenomic RNA (pgRNA) production. The HBV DNA-targeted oligonucleotide suppressed HBV DNA replication and HBV protein production more efficiently than small interfering RNAs directed to the pgRNA. These results demonstrate that fusion with lipid can carry LNA-modified oligonucleotides to the nucleus where they regulate gene expression. Interfering with HBV DNA transcription by LNA-modified oligonucleotides has strong potential as a new strategy for HBV inhibition.« less

Oligonucleotide-based pharmaceuticals: Non-clinical and clinical safety signals and non-clinical testing strategies.

PubMed

Mustonen, Enni-Kaisa; Palomäki, Tiina; Pasanen, Markku

2017-11-01

Antisense oligonucleotides, short interfering RNAs (siRNAs) and aptamers are oligonucleotide-based pharmaceuticals with a promising role in targeted therapies. Currently, five oligonucleotide-based pharmaceuticals have achieved marketing authorization in Europe or USA and many more are undergoing clinical testing. However, several safety concerns have been raised in non-clinical and clinical studies. Oligonucleotides share properties with both chemical and biological pharmaceuticals and therefore they pose challenges also from the regulatory point of view. We have analyzed the safety data of oligonucleotides and evaluated the applicability of current non-clinical toxicological guidelines for assessing the safety of oligonucleotide-based pharmaceuticals. Oligonucleotide-based pharmaceuticals display a similar toxicological profile, exerting adverse effects on liver and kidney, evoking hematological alterations, as well as causing immunostimulation and prolonging the coagulation time. It is possible to extrapolate some of these effects from non-clinical studies to humans. However, evaluation strategies for genotoxicity testing of "non-natural" oligonucleotides should be revised. Additionally, the selective use of surrogates and prediction of clinical endpoints for non-clinically observed immunostimulation is complicated by its multiple potential manifestations, demanding improvements in the testing strategies. Utilizing more relevant and mechanistic-based approaches and taking better account of species differences, could possibly improve the prediction of relevant immunological/proinflammatory effects in humans. Copyright © 2017 Elsevier Inc. All rights reserved.

The chemical evolution of oligonucleotide therapies of clinical utility.

PubMed

Khvorova, Anastasia; Watts, Jonathan K

2017-03-01

After nearly 40 years of development, oligonucleotide therapeutics are nearing meaningful clinical productivity. One of the key advantages of oligonucleotide drugs is that their delivery and potency are derived primarily from the chemical structure of the oligonucleotide whereas their target is defined by the base sequence. Thus, as oligonucleotides with a particular chemical design show appropriate distribution and safety profiles for clinical gene silencing in a particular tissue, this will open the door to the rapid development of additional drugs targeting other disease-associated genes in the same tissue. To achieve clinical productivity, the chemical architecture of the oligonucleotide needs to be optimized with a combination of sugar, backbone, nucleobase, and 3'- and 5'-terminal modifications. A portfolio of chemistries can be used to confer drug-like properties onto the oligonucleotide as a whole, with minor chemical changes often translating into major improvements in clinical efficacy. One outstanding challenge in oligonucleotide chemical development is the optimization of chemical architectures to ensure long-term safety. There are multiple designs that enable effective targeting of the liver, but a second challenge is to develop architectures that enable robust clinical efficacy in additional tissues.

Time-series oligonucleotide count to assign antiviral siRNAs with long utility fit in the big data era.

PubMed

Wada, K; Wada, Y; Iwasaki, Y; Ikemura, T

2017-10-01

Oligonucleotides are key elements of nucleic acid therapeutics such as small interfering RNAs (siRNAs). Influenza and Ebolaviruses are zoonotic RNA viruses mutating very rapidly, and their sequence changes must be characterized intensively to design therapeutic oligonucleotides with long utility. Focusing on a total of 182 experimentally validated siRNAs for influenza A, B and Ebolaviruses compiled by the siRNA database, we conducted time-series analyses of occurrences of siRNA targets in these viral genomes. Reflecting their high mutation rates, occurrences of target oligonucleotides evidently fluctuate in viral populations and often disappear. Time-series analysis of the one-base changed sequences derived from each original target identified the oligonucleotide that shows a compensatory increase and will potentially become the 'awaiting-type oligonucleotide'; the combined use of this oligonucleotide with the original can provide therapeutics with long utility. This strategy is also useful for assigning diagnostic reverse transcription-PCR primers with long utility.

miRNA-based therapies: Strategies and delivery platforms for oligonucleotide and non-oligonucleotide agents

PubMed Central

Baumann, V; Winkler, J

2015-01-01

The discovery of microRNAs as important regulatory agents for gene expression has expanded the therapeutic opportunities for oligonucleotides. In contrast to siRNA, miRNA-targeted therapy is able to influence not only a single gene, but entire cellular pathways or processes. It is possible to supplement down regulated or non-functional miRNAs by synthetic oligonucleotides, as well as alleviating effects caused by overexpression of malignant miRNAs through artificial antagonists, either oligonucleotides or small molecules. Chemical oligonucleotide modifications together with an efficient delivery system seem to be mandatory for successful therapeutic application. While miRNA-based therapy benefits from the decades of research spent on other therapeutic oligonucleotides, there are some specific challenges associated with miRNA therapy, mainly caused by the short target sequence. The current status and recent progress of miRNA-targeted therapeutics is described and future challenges and potential applications in treatment of cancer and viral infections are discussed. PMID:25495987

Methods for the analysis of HIV-1 nucleocapsid protein interactions with oligonucleotides.

PubMed

Stephen, Andrew G; Fisher, Robert J

2009-01-01

HIV-1 Nucleocapsid protein (NC) is a small basic protein that contains two retroviral zinc fingers. It is a highly effective nucleic acid chaperone that plays a critical role in viral replication acting as a cofactor in reverse transcription as well as other aspects of the viral lifecycle. We have used a variety of biophysical techniques to characterize the high affinity binding of NC to a short deoxyoligonucleotide (d(TG)(4)). Here we outline in detail the use of fluorescence anisotropy and surface plasmon resonance spectroscopy to study the binding of NC to d(TG)(4).

2'-modified nucleosides for site-specific labeling of oligonucleotides

NASA Technical Reports Server (NTRS)

Krider, Elizabeth S.; Miller, Jeremiah E.; Meade, Thomas J.

2002-01-01

We report the synthesis of 2'-modified nucleosides designed specifically for incorporating labels into oligonucleotides. Conversion of these nucleosides to phosphoramidite and solid support-bound derivatives proceeds in good yield. Large-scale synthesis of 11-mer oligonucleotides possessing the 2'-modified nucleosides is achieved using these derivatives. Thermal denaturation studies indicate that the presence of 2'-modified nucleosides in 11-mer duplexes has minimal destabilizing effects on the duplex structure when the nucleosides are placed at the duplex termini. The powerful combination of phosphoramidite and support-bound derivatives of 2'-modified nucleosides affords the large-scale preparation of an entirely new class of oligonucleotides. The ability to synthesize oligonucleotides containing label attachment sites at 3', intervening, and 5' locations of a duplex is a significant advance in the development of oligonucleotide conjugates.

BatMis: a fast algorithm for k-mismatch mapping.

PubMed

Tennakoon, Chandana; Purbojati, Rikky W; Sung, Wing-Kin

2012-08-15

Second-generation sequencing (SGS) generates millions of reads that need to be aligned to a reference genome allowing errors. Although current aligners can efficiently map reads allowing a small number of mismatches, they are not well suited for handling a large number of mismatches. The efficiency of aligners can be improved using various heuristics, but the sensitivity and accuracy of the alignments are sacrificed. In this article, we introduce Basic Alignment tool for Mismatches (BatMis)--an efficient method to align short reads to a reference allowing k mismatches. BatMis is a Burrows-Wheeler transformation based aligner that uses a seed and extend approach, and it is an exact method. Benchmark tests show that BatMis performs better than competing aligners in solving the k-mismatch problem. Furthermore, it can compete favorably even when compared with the heuristic modes of the other aligners. BatMis is a useful alternative for applications where fast k-mismatch mappings, unique mappings or multiple mappings of SGS data are required. BatMis is written in C/C++ and is freely available from http://code.google.com/p/batmis/

Attitude sensor alignment calibration for the solar maximum mission

NASA Technical Reports Server (NTRS)

Pitone, Daniel S.; Shuster, Malcolm D.

1990-01-01

An earlier heuristic study of the fine attitude sensors for the Solar Maximum Mission (SMM) revealed a temperature dependence of the alignment about the yaw axis of the pair of fixed-head star trackers relative to the fine pointing Sun sensor. Here, new sensor alignment algorithms which better quantify the dependence of the alignments on the temperature are developed and applied to the SMM data. Comparison with the results from the previous study reveals the limitations of the heuristic approach. In addition, some of the basic assumptions made in the prelaunch analysis of the alignments of the SMM are examined. The results of this work have important consequences for future missions with stringent attitude requirements and where misalignment variations due to variations in the temperature will be significant.

Dynamic interferometer alignment and its utility in UV Fourier transform spectrometer systems

NASA Technical Reports Server (NTRS)

Dorval, Rick K.; Engel, James R.; Wyntjes, Geert J.

1993-01-01

Dynamic alignment has been demonstrated as a practical approach to alignment maintenance for systems in the infrared region of the spectrum. On the basis of work done by OPTRA, this technique was introduced in commercial Fourier transform spectrometer systems in 1982 and in various forms is now available from a number of manufacturers. This paper reports on work by OPTRA to extend the basic technique to systems operating in the ultraviolet. In addition, this paper reports the preliminary results of the development of an alignment system using a laser diode in place of a gas laser normally found in dynamic alignment systems. A unique optical system and spatial heterodyne technique allows for achievement of a metrology system with characteristics that fully satisfy the requirements of an ultraviolet spectrometer system.

Assessing the Interplay between the Physicochemical Parameters of Ion-Pairing Reagents and the Analyte Sequence on the Electrospray Desorption Process for Oligonucleotides

NASA Astrophysics Data System (ADS)

Basiri, Babak; Murph, Mandi M.; Bartlett, Michael G.

2017-08-01

Alkylamines are widely used as ion-pairing agents during LC-MS of oligonucleotides. In addition to a better chromatographic separation, they also assist with the desorption of oligonucleotide ions into the gas phase, cause charge state reduction, and decrease cation adduction. However, the choice of such ion-pairing agents has considerable influence on the MS signal intensity of oligonucleotides as they can also cause significant ion suppression. Interestingly, optimal ion-pairing agents should be selected on a case by case basis as their choice is strongly influenced by the sequence of the oligonucleotide under investigation. Despite imposing major practical difficulties to analytical method development, such a highly variable system that responds very strongly to the nuances of the electrospray composition provides an excellent opportunity for a fundamental study of the electrospray ionization process. Our investigations using this system quantitatively revealed the major factors that influenced the ESI ionization efficiency of oligonucleotides. Parameters such as boiling point, proton affinity, partition coefficient, water solubility, and Henry's law constants for the ion-pairing reagents and the hydrophobic thymine content of the oligonucleotides were found to be the most significant contributors. Identification of these parameters also allowed for the development of a statistical predictive algorithm that can assist with the choice of an optimum IP agent for each particular oligonucleotide sequence. We believe that research in the field of oligonucleotide bioanalysis will significantly benefit from this algorithm (included in Supplementary Material) as it advocates for the use of lesser-known but more suitable ion-pair alternatives to TEA for many oligonucleotide sequences.

Measuring the binding stoichiometry of HIV-1 Gag to very-low-density oligonucleotide surfaces using surface plasmon resonance spectroscopy.

PubMed

Stephen, Andrew G; Datta, Siddhartha A K; Worthy, Karen M; Bindu, Lakshman; Fivash, Matthew J; Turner, Kevin B; Fabris, Daniele; Rein, Alan; Fisher, Robert J

2007-09-01

The interaction of the HIV Gag polyprotein with nucleic acid is a critical step in the assembly of viral particles. The Gag polyprotein is composed of the matrix (MA), capsid (CA), and nucleocapsid (NC) domains. The NC domain is required for nucleic acid interactions, and the CA domain is required for Gag-Gag interactions. Previously, we have investigated the binding of the NC protein to d(TG)(n) oligonucleotides using surface plasmon resonance (SPR) spectroscopy. We found a single NC protein is able to bind to more than one immobilized oligonucleotide, provided that the oligonucleotides are close enough together. As NC is believed to be the nucleic acid binding domain of Gag, we might expect Gag to show the same complex behavior. We wished to analyze the stoichiometry of Gag binding to oligonucleotides without this complication due to tertiary complex formation. We have therefore analyzed Gag binding to extremely low oligonucleotide density on SPR chips. Such low densities of oligonucleotides are difficult to accurately quantitate. We have determined by Fourier transform ion cyclotron (FTICR) mass spectrometry that four molecules of NC bind to d(TG)(10) (a 20-base oligonucleotide). We developed a method of calibrating low-density surfaces using NC calibration injections. Knowing the maximal response and the stoichiometry of binding, we can precisely determine the amount of oligonucleotide immobilized at these very-low-density surfaces (<1 Response Unit). Using this approach, we have measured the binding of Gag to d(TG)(10). Gag binds to a 20-mer with a stoichiometry of greater than 4. This suggests that once Gag is bound to the immobilized oligonucleotide, additional Gag molecules can bind to this complex.

RNA therapeutics: Beyond RNA interference and antisense oligonucleotides

PubMed Central

Kole, Ryszard; Krainer, Adrian R.; Altman, Sidney

2016-01-01

Here we discuss three RNA therapeutic technologies exploiting various oligonucleotides that bind RNA by base-pairing in a sequence-specific manner yet have different mechanisms of action and effects. RNA interference and antisense oligonucleotides downregulate gene expression by enzyme-dependent degradation of targeted mRNA. Steric blocking oligonucleotides block access of cellular machinery to pre-mRNA and mRNA without degrading the RNA. Through this mechanism, blocking oligonucleotides can redirect alternative splicing, repair defective RNA, restore protein production or also downregulate gene expression. Moreover, they can be extensively chemically modified, resulting in more drug-like properties. The ability of RNA blocking oligonucleotides to restore gene function makes them suited for treatment of genetic disorders. Positive results from clinical trials for the treatment of Duchenne muscular dystrophy show that this technology is close to realizing its clinical potential. PMID:22262036

Design of oligonucleotides for microarrays and perspectives for design of multi-transcriptome arrays.

PubMed

Nielsen, Henrik Bjørn; Wernersson, Rasmus; Knudsen, Steen

2003-07-01

Optimal design of oligonucleotides for microarrays involves tedious and laborious work evaluating potential oligonucleotides relative to a series of parameters. The currently available tools for this purpose are limited in their flexibility and do not present the oligonucleotide designer with an overview of these parameters. We present here a flexible tool named OligoWiz for designing oligonucleotides for multiple purposes. OligoWiz presents a set of parameter scores in a graphical interface to facilitate an overview for the user. Additional custom parameter scores can easily be added to the program to extend the default parameters: homology, DeltaTm, low-complexity, position and GATC-only. Furthermore we present an analysis of the limitations in designing oligonucleotide sets that can detect transcripts from multiple organisms. OligoWiz is available at www.cbs.dtu.dk/services/OligoWiz/.

Modification of antisense phosphodiester oligodeoxynucleotides by a 5' cholesteryl moiety increases cellular association and improves efficacy.

PubMed

Krieg, A M; Tonkinson, J; Matson, S; Zhao, Q; Saxon, M; Zhang, L M; Bhanja, U; Yakubov, L; Stein, C A

1993-02-01

Phosphodiester oligodeoxynucleotides bearing a 5' cholesteryl (chol) modification bind to low density lipoprotein (LDL), apparently by partitioning the chol-modified oligonucleotides into the lipid layer. Both HL60 cells and primary mouse spleen T and B cells incubated with fluorescently labeled chol-modified oligonucleotide showed substantially increased cellular association by flow cytometry and increased internalization by confocal microscopy compared to an identical molecule not bearing the chol group. Cellular internalization of chol-modified oligonucleotide occurred at least partially through the LDL receptor; it was increased in mouse spleen cells by cell culture in lipoprotein-deficient medium and/or lovastatin, and it was decreased by culture in high serum medium. To determine whether chol-modified oligonucleotides are more potent antisense agents, we titered antisense unmodified phosphodiester and chol-modified oligonucleotides targeted against a mouse immunosuppressive protein. Murine spleen cells cultured with 20 microM phosphodiester antisense oligonucleotides had a 2-fold increase in RNA synthesis, indicating the expected lymphocyte activation. Antisense chol-modified oligonucleotides showed an 8-fold increase in relative potency: they caused a 2-fold increase in RNA synthesis at just 2.5 microM. The increased efficacy was blocked by heparin and was further increased by cell culture in 1% (vs. 10%) fetal bovine serum, suggesting that the effect may, at least in part, be mediated via the LDL receptor. Antisense chol-modified oligonucleotides are sequence specific and have increased potency as compared to unmodified oligonucleotides.

A New Oligonucleotide Microarray for Detection of Pathogenic and Non-Pathogenic Legionella spp.

PubMed Central

Cao, Boyang; Liu, Xiangqian; Yu, Xiang; Chen, Min; Feng, Lu; Wang, Lei

2014-01-01

Legionella pneumophila has been recognized as the major cause of legionellosis since the discovery of the deadly disease. Legionella spp. other than L. pneumophila were later found to be responsible to many non-pneumophila infections. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this report, we have sequenced the 16S-23S rRNA gene internal transcribed spacer (ITS) of 10 Legionella species and subspecies, including L. anisa, L. bozemanii, L. dumoffii, L. fairfieldensis, L. gormanii, L. jordanis, L. maceachernii, L. micdadei, L. pneumophila subspp. fraseri and L. pneumophila subspp. pasculleii, and developed a rapid oligonucleotide microarray detection technique accordingly to identify 12 most common Legionella spp., which consist of 11 pathogenic species of L. anisa, L. bozemanii, L. dumoffii, L. gormanii, L. jordanis, L. longbeachae, L. maceachernii, L. micdadei, and L. pneumophila (including subspp. pneumophila, subspp. fraseri, and subspp. pasculleii) and one non-pathogenic species, L. fairfieldensis. Twenty-nine probes that reproducibly detected multiple Legionella species with high specificity were included in the array. A total of 52 strains, including 30 target pathogens and 22 non-target bacteria, were used to verify the oligonucleotide microarray assay. The sensitivity of the detection was at 1.0 ng with genomic DNA or 13 CFU/100 mL with Legionella cultures. The microarray detected seven samples of air conditioner-condensed water with 100% accuracy, validating the technique as a promising method for applications in basic microbiology, clinical diagnosis, food safety, and epidemiological surveillance. The phylogenetic study based on the ITS has also revealed that the non-pathogenic L. fairfieldensis is the closest to L. pneumophila than the nine other pathogenic Legionella spp. PMID:25469776

A new oligonucleotide microarray for detection of pathogenic and non-pathogenic Legionella spp.

PubMed

Cao, Boyang; Liu, Xiangqian; Yu, Xiang; Chen, Min; Feng, Lu; Wang, Lei

2014-01-01

Legionella pneumophila has been recognized as the major cause of legionellosis since the discovery of the deadly disease. Legionella spp. other than L. pneumophila were later found to be responsible to many non-pneumophila infections. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this report, we have sequenced the 16S-23S rRNA gene internal transcribed spacer (ITS) of 10 Legionella species and subspecies, including L. anisa, L. bozemanii, L. dumoffii, L. fairfieldensis, L. gormanii, L. jordanis, L. maceachernii, L. micdadei, L. pneumophila subspp. fraseri and L. pneumophila subspp. pasculleii, and developed a rapid oligonucleotide microarray detection technique accordingly to identify 12 most common Legionella spp., which consist of 11 pathogenic species of L. anisa, L. bozemanii, L. dumoffii, L. gormanii, L. jordanis, L. longbeachae, L. maceachernii, L. micdadei, and L. pneumophila (including subspp. pneumophila, subspp. fraseri, and subspp. pasculleii) and one non-pathogenic species, L. fairfieldensis. Twenty-nine probes that reproducibly detected multiple Legionella species with high specificity were included in the array. A total of 52 strains, including 30 target pathogens and 22 non-target bacteria, were used to verify the oligonucleotide microarray assay. The sensitivity of the detection was at 1.0 ng with genomic DNA or 13 CFU/100 mL with Legionella cultures. The microarray detected seven samples of air conditioner-condensed water with 100% accuracy, validating the technique as a promising method for applications in basic microbiology, clinical diagnosis, food safety, and epidemiological surveillance. The phylogenetic study based on the ITS has also revealed that the non-pathogenic L. fairfieldensis is the closest to L. pneumophila than the nine other pathogenic Legionella spp.

Current Challenges in Delivery and Cytosolic Translocation of Therapeutic RNAs

PubMed Central

Lucchino, Marco

2018-01-01

RNA interference (RNAi) is a fundamental cellular process for the posttranscriptional regulation of gene expression. RNAi can exogenously be modulated by small RNA oligonucleotides, such as microRNAs (miRNAs) and small interfering RNAs (siRNAs), or by antisense oligonucleotides. These small oligonucleotides provided the scientific community with powerful and versatile tools to turn off the expression of genes of interest, and hold out the promise of new therapeutic solutions against a wide range of gene-associated pathologies. However, unmodified nucleic acids are highly instable in biological systems, and their weak interaction with plasma proteins confers an unfavorable pharmacokinetics. In this review, we first provide an overview of the most efficient chemical strategies that, over the past 30 years, have been used to significantly improve the therapeutic potential of oligonucleotides. Oligonucleotides targeting and delivery technologies are then presented, including covalent conjugates between oligonucleotides and targeting ligand, and noncovalent association with lipid or polymer nanoparticles. Finally, we specifically focus on the endosomal escape step, which represents a major stumbling block for the effective use of oligonucleotides as therapeutic agents. The need for approaches to quantitatively measure endosomal escape and cytosolic arrival of biomolecules is discussed in the context of the development of efficient oligonucleotide targeting and delivery vectors. PMID:29883296

Identification of sequence motifs in oligonucleotides whose presence is correlated with antisense activity

PubMed Central

Matveeva, O. V.; Tsodikov, A. D.; Giddings, M.; Freier, S. M.; Wyatt, J. R.; Spiridonov, A. N.; Shabalina, S. A.; Gesteland, R. F.; Atkins, J. F.

2000-01-01

Design of antisense oligonucleotides targeting any mRNA can be much more efficient when several activity-enhancing motifs are included and activity-decreasing motifs are avoided. This conclusion was made after statistical analysis of data collected from >1000 experiments with phosphorothioate-modified oligonucleotides. Highly significant positive correlation between the presence of motifs CCAC, TCCC, ACTC, GCCA and CTCT in the oligonucleotide and its antisense efficiency was demonstrated. In addition, negative correlation was revealed for the motifs GGGG, ACTG, AAA and TAA. It was found that the likelihood of activity of an oligonucleotide against a desired mRNA target is sequence motif content dependent. PMID:10908347

Electric-dipole effect of defects on the energy band alignment of rutile and anatase TiO₂.

PubMed

Zhang, Daoyu; Yang, Minnan; Dong, Shuai

2015-11-21

Titanium dioxide materials have been studied intensively and extensively for photocatalytic applications. A long-standing open question is the energy band alignment of rutile and anatase TiO2 phases, which can affect the photocatalytic process in the composite system. There are basically two contradictory viewpoints about the alignment of these two TiO2 phases supported by the respective experiments: (1) straddling type and (2) staggered type. In this work, our DFT plus U calculations show that the perfect rutile(110) and anatase(101) surfaces have the straddling type band alignment, whereas the surfaces with defects can turn the band alignment into the staggered type. The electric dipoles induced by defects are responsible for the reversal of band alignment. Thus the defects introduced during the preparation and post-treatment processes of materials are probably the answer to the above open question regarding the band alignment, which can be considered in real practice to tune the photocatalytic activity of materials.

Oligonucleotide and Parylene Surface Coating of Polystyrene and ePTFE for Improved Endothelial Cell Attachment and Hemocompatibility

PubMed Central

Schleicher, Martina; Hansmann, Jan; Elkin, Bentsian; Kluger, Petra J.; Liebscher, Simone; Huber, Agnes J. T.; Fritze, Olaf; Schille, Christine; Müller, Michaela; Schenke-Layland, Katja; Seifert, Martina; Walles, Heike; Wendel, Hans-Peter; Stock, Ulrich A.

2012-01-01

In vivo self-endothelialization by endothelial cell adhesion on cardiovascular implants is highly desirable. DNA-oligonucleotides are an intriguing coating material with nonimmunogenic characteristics and the feasibility of easy and rapid chemical fabrication. The objective of this study was the creation of cell adhesive DNA-oligonucleotide coatings on vascular implant surfaces. DNA-oligonucleotides immobilized by adsorption on parylene (poly(monoaminomethyl-para-xylene)) coated polystyrene and ePTFE were resistant to high shear stress (9.5 N/m2) and human blood serum for up to 96 h. Adhesion of murine endothelial progenitor cells, HUVECs and endothelial cells from human adult saphenous veins as well as viability over a period of 14 days of HUVECs on oligonucleotide coated samples under dynamic culture conditions was significantly enhanced (P < 0.05). Oligonucleotide-coated surfaces revealed low thrombogenicity and excellent hemocompatibility after incubation with human blood. These properties suggest the suitability of immobilization of DNA-oligonucleotides for biofunctionalization of blood vessel substitutes for improved in vivo endothelialization. PMID:22481939

Carbon Nanotube Nanoelectrode Array as an Electronic Chip for Ultrasensitive Label-free DNA Detection

NASA Technical Reports Server (NTRS)

Li, Jun; Koehne, Jessica; Chen, Hua; Cassell, Alan; Ng, Hou Tee; Fan, Wendy; Ye, Qi; Han, Jie; Meyyappan, M.

2003-01-01

A reliable nanoelectrode array based on vertically aligned multi-walled carbon nanotubes (MWNTs) embedded in SiO2 is used for ultrasensitive DNA detection. Characteristic nanoelectrode behavior is observed using low-density MWNT arrays for measuring both bulk and surface immobilized redox species such as K4Fe(CN)6 and ferrocene derivatives. The open-end of MWNTs are found to present similar properties as graphite edge-plane electrodes with wide potential window, flexible chemical functionalities, and good biocompatibility. BRCA1 related oligonucleotide probes with 18 bp are selectively functionalized at the open ends of the nanotube array and specifically hybridized with oligonucleotide targets incorporated with a polyG tag. The guanine groups are employed as the signal moieties in the electrochemical measurements. R(bpy)(sup 2+, sub 3) mediator is used to further amplify the guanine oxidation signal. The hybridization of sub-attomoles of DNA targets is detected electrochemically by combining the MWNT nanoelectrode array with the R(bpy)(sup 2+, sub 3) amplification mechanism. This technique was employed for direct electrochemical detection of label-free PCR amplicon from a healthy donor through specific hybridization with the BRCA1 probe. The detection limit is estimated to be less than 1000 DNA molecules since abundant guanine bases in the PCR amplicon provides a large signal. This system provides a general platform for rapid molecular diagnostics in applications requiring ultrahigh sensitivity, high-degree of miniaturization, and simple sample preparation, and low-cost operation.

The basic helix-loop-helix region of the transcriptional repressor hairy and enhancer of split 1 is preorganized to bind DNA.

PubMed

Popovic, Matija; Wienk, Hans; Coglievina, Maristella; Boelens, Rolf; Pongor, Sándor; Pintar, Alessandro

2014-04-01

Hairy and enhancer of split 1, one of the main downstream effectors in Notch signaling, is a transcriptional repressor of the basic helix-loop-helix (bHLH) family. Using nuclear magnetic resonance methods, we have determined the structure and dynamics of a recombinant protein, H1H, which includes an N-terminal segment, b1, containing functionally important phosphorylation sites, the basic region b2, required for binding to DNA, and the HLH domain. We show that a proline residue in the sequence divides the protein in two parts, a flexible and disordered N-terminal region including b1 and a structured, mainly helical region comprising b2 and the HLH domain. Binding of H1H to a double strand DNA oligonucleotide was monitored through the chemical shift perturbation of backbone amide resonances, and showed that the interaction surface involves not only the b2 segment but also several residues in the b1 and HLH regions. Copyright © 2014 Wiley Periodicals, Inc.

Oligonucleotide assisted light-emitting Alq3 microrods: energy transfer effect with fluorescent dyes.

PubMed

Cui, Chunzhi; Park, Dong Hyuk; Kim, Jeongyong; Joo, Jinsoo; Ahn, Dong June

2013-06-14

Oligonucleotide assisted tri(8-hydroxyquinoline) aluminium (Alq3) microrods were prepared for the first time. When hybridized with oligonucleotide labeled by Cy3 fluorescent dye, a significant photoluminescence variation of the Alq3 microrods was observed due to Förster resonance energy transfer, unlike when Cy5-oligonucleotide was used. Versatile nucleotide manipulation would open up wider applications of Alq3-based materials, based on this fundamental observation.

Direct fluorescence in situ hybridization on human metaphase chromosomes using quantum dot-platinum labeled DNA probes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hwang, Gyoyeon; Biological Chemistry, Korea University of Science and Technology, 217, Gajeong-ro, Yuseong-gu, Deajeon; Lee, Hansol

The telomere shortening in chromosomes implies the senescence, apoptosis, or oncogenic transformation of cells. Since detecting telomeres in aging and diseases like cancer, is important, the direct detection of telomeres has been a very useful biomarker. We propose a telomere detection method using a newly synthesized quantum dot (QD) based probe with oligonucleotide conjugation and direct fluorescence in situ hybridization (FISH). QD-oligonucleotides were prepared with metal coordination bonding based on platinum-guanine binding reported in our previous work. The QD-oligonucleotide conjugation method has an advantage where any sequence containing guanine at the end can be easily bound to the starting QD-Ptmore » conjugate. A synthesized telomeric oligonucleotide was bound to the QD-Pt conjugate successfully and this probe hybridized specifically on the telomere of fabricated MV-4-11 and MOLT-4 chromosomes. Additionally, the QD-telomeric oligonucleotide probe successfully detected the telomeres on the CGH metaphase slide. Due to the excellent photostability and high quantum yield of QDs, the QD-oligonucleotide probe has high fluorescence intensity when compared to the organic dye-oligonucleotide probe. Our QD-oligonucleotide probe, conjugation method of this QD probe, and hybridization protocol with the chromosomes can be a useful tool for chromosome painting and FISH. - Highlights: • We prepared a probe linked between QD and telomeric oligonucleotide with platinum-guanine bonding. • Telomeres were detected by our new telomere probes successfully in three different human metaphase chromosomes. • QDPt-DNA probe has high fluorescence intensity in comparison with organic dye-DNA probe.« less

Intelligent nanomedicine integrating diagnosis and therapy

NASA Technical Reports Server (NTRS)

Li, Na (Inventor); Tan, Winny (Inventor)

2012-01-01

A method of controlling the activity of a biologically active compound. The method concerns an oligonucleotide-based compound, comprising a hairpin-forming oligonucleotide, an effector moiety physically associated with the oligonucleotide, where the effector moiety possesses a biological activity, and a regulating moiety physically associated with the oligonucleotide, where the regulating moiety controls the biological activity of the effector moiety by interacting with the effector moiety. The oligonucleotide can assume a hairpin configuration, where the effector and regulating moieties interact, or an open configuration, where the effector and regulating moieties fail to interact. Depending on the nature of the effector and regulating moieties, either configuration can result in the expression of the biological activity of the effector moiety.

Oligonucleotide labeling methods. 3. Direct labeling of oligonucleotides employing a novel, non-nucleosidic, 2-aminobutyl-1,3-propanediol backbone.

PubMed Central

Nelson, P S; Kent, M; Muthini, S

1992-01-01

Novel CE-phosphoramidite (7a-e) and CPG (8a, c, d, e) reagents have been prepared from a unique 2-aminobutyl-1,3-propanediol backbone. The reagents have been used to directly label oligonucleotides with fluorescein, acridine, and biotin via automated DNA synthesis. The versatile 2-aminobutyl-1,3-propanediol backbone allows for labeling at any position (5', internal, and 3') during solid phase oligonucleotide synthesis. Multiple labels can be achieved by repetitive coupling cycles. Furthermore, the 3-carbon atom internucleotide phosphate distance is retained when inserted internally. Using this method, individual oligonucleotides possessing two and three different reporter molecules have been prepared. PMID:1475185

Alteration in oligonucleotide fingerprint patterns of the viral genome in poliovirus type 2 isolated from paralytic patients.

PubMed Central

Yoneyama, T; Hagiwara, A; Hara, M; Shimojo, H

1982-01-01

A close relationship was demonstrated by oligonucleotide fingerprinting between genomes of the poliovirus type 2 Sabin vaccine strain and recent isolates from paralytic cases associated with vaccination in Japan. The oligonucleotide maps of isolates from an agammaglobulinemic patient, who continued to excrete poliovirus type 2 for 3.5 years after the administration of oral vaccine, showed that the genomic alteration proceeded gradually, retaining the majority of the oligonucleotides characteristic of the vaccine strain for a long period, indicating vaccine origin for the isolates. The final isolate at month 41, however, lost the majority of these oligonucleotides. The heterologous antigenic relationship between the final isolate and the previous isolates was also observed. The serial alteration in electrophoretic mobility of the major structural proteins (VP1, VP2, and VP3) was observed throughout the excreting period. These results indicate that the population of the virus in this individual changed markedly during the last short period (about 3 months), in which the treatment with secretory immunoglobulin A was carried out. Genome comparisons in oligonucleotide maps show that some oligonucleotides in the genome of the vaccine strain are highly mutable after passage in humans. Images PMID:6179881

Method of identifying hairpin DNA probes by partial fold analysis

DOEpatents

Miller, Benjamin L [Penfield, NY; Strohsahl, Christopher M [Saugerties, NY

2009-10-06

Method of identifying molecular beacons in which a secondary structure prediction algorithm is employed to identify oligonucleotide sequences within a target gene having the requisite hairpin structure. Isolated oligonucleotides, molecular beacons prepared from those oligonucleotides, and their use are also disclosed.

Method of identifying hairpin DNA probes by partial fold analysis

DOEpatents

Miller, Benjamin L.; Strohsahl, Christopher M.

2008-10-28

Methods of identifying molecular beacons in which a secondary structure prediction algorithm is employed to identify oligonucleotide sequences within a target gene having the requisite hairpin structure. Isolated oligonucleotides, molecular beacons prepared from those oligonucleotides, and their use are also disclosed.

Synthesis of 3'-, or 5'-, or internal methacrylamido-modified oligonucleotides

DOEpatents

Golova, Julia B.; Chernov, Boris K.

2010-04-27

New modifiers were synthesized for incorporation of a methacrylic function in 3'-, 5'- and internal positions of oligonucleotides during solid phase synthesis. A modifier was used for synthesis of 5'-methacrylated oligonucleotides for preparation of microarrays by a co-polymerization method.

Targeted delivery of an antisense oligonucleotide in the retina: uptake, distribution, stability, and effect.

PubMed

Rakoczy, P E; Lai, M C; Watson, M; Seydel, U; Constable, I

1996-01-01

In this article, we describe the preliminary results of the development of an animal model that will enable us to study the effect of photoreceptor-derived debris accumulation on the normal function of the retina in vivo. An antisense oligonucleotide (Cat 5), saline, and two control oligonucleotides were injected into the vitreous of 7-week-old RCS-rdy+ rats. The uptake, distribution, and persistence of the antisense oligonucleotide in the retina was demonstrated by fluorescent confocal microscopy, and the stability of the oligonucleotide was shown by GeneScan analysis using a fluorescein-labeled derivative of Cat 5 (Cat 5F). The accumulation of photoreceptor-derived debris was monitored by the number of undigested phagosomes in the RPE layer by light microscopy. Following intravitreal injection of Cat 5F, penetration of the oligonucleotide was observed in the ganglion cell layer in 2 hours and in the photoreceptor and pigment epithelial layers 3 days later. However, at 7, 28, and 56 days postinjection, only the RPE layer had significant amounts of Cat 5F present. Using GeneScan analysis, it was demonstrated that the fluorescein-labeled oligonucleotide present in the RPE layer was not degraded and it retained its original 19-mer length. There was no statistically significant difference in the number of phagosomes found in the RPE layer of control uninjected, saline-injected, and two sense and two antisense oligonucleotides-injected animals at 7 and 28 days postinjection. In contrast, the number of phagosomes was significantly higher (p < 0.001) in the RPE layer of Cat 5 antisense oligonucleotide-injected animals at 7 and 28 days postinjection. This difference, however, disappeared by 56 days postinjection. The inner nuclear layers of the retina of control and experimental animals were not affected by the injections.

Oligonucleotide-based theranostic nanoparticles in cancer therapy

PubMed Central

Shahbazi, Reza; Ozpolat, Bulent; Ulubayram, Kezban

2016-01-01

Theranostic approaches, combining the functionality of both therapy and imaging, have shown potential in cancer nanomedicine. Oligonucleotides such as small interfering RNA and microRNA, which are powerful therapeutic agents, have been effectively employed in theranostic systems against various cancers. Nanoparticles are used to deliver oligonucleotides into tumors by passive or active targeting while protecting the oligonucleotides from nucleases in the extracellular environment. The use of quantum dots, iron oxide nanoparticles and gold nanoparticles and tagging with contrast agents, like fluorescent dyes, optical or magnetic agents and various radioisotopes, has facilitated early detection of tumors and evaluation of therapeutic efficacy. In this article, we review the advantages of theranostic applications in cancer therapy and imaging, with special attention to oligonucleotide-based therapeutics. PMID:27102380

Clays in prebiological chemistry

NASA Technical Reports Server (NTRS)

Rao, M.; Oro, J.; Odom, D. G.

1980-01-01

The ways in which clays have been utilized in studies of prebiological chemistry are reviewed, and an assessment is given of the possible role of clays in prebiological systems. The adsorption of organic molecules on clays has been demonstrated, as has the synthesis of bioorganic monomers in the presence of clays. For instance, amino acids, purines and pyrimidines have been obtained from carbon monoxide and nitric acid in the presence of clays at relatively high temperatures (250-325 C). The oligomerization of biochemical monomers, mediated by clays, has also been shown to result in the formation of polymer molecules basic to life. Clays have also been found to affect the condensation of mononucleotides to oligonucleotides.

Derivatized versions of ligase enzymes for constructing DNA sequences

DOEpatents

Mariella, Jr., Raymond P.; Christian, Allen T [Tracy, CA; Tucker, James D [Novi, MN; Dzenitis, John M [Livermore, CA; Papavasiliou, Alexandros P [Oakland, CA

2006-08-15

A method of making very long, double-stranded synthetic poly-nucleotides. A multiplicity of short oligonucleotides is provided. The short oligonucleotides are sequentially hybridized to each other. Enzymatic ligation of the oligonucleotides provides a contiguous piece of PCR-ready DNA of predetermined sequence.

Voltage-gated calcium channel and antisense oligonucleotides thereto

NASA Technical Reports Server (NTRS)

Friedman, Peter A. (Inventor); Duncan, Randall L. (Inventor); Hruska, Keith A. (Inventor); Barry, Elizabeth L. R. (Inventor)

1998-01-01

An antisense oligonucleotide of 10 to 35 nucleotides in length that can hybridize with a region of the .alpha..sub.1 subunit of the SA-Cat channel gene DNA or mRNA is provided, together with pharmaceutical compositions containing and methods utilizing such antisense oligonucleotide.

NAA-modified DNA oligonucleotides with zwitterionic backbones: stereoselective synthesis of A-T phosphoramidite building blocks.

PubMed

Schmidtgall, Boris; Höbartner, Claudia; Ducho, Christian

2015-01-01

Modifications of the nucleic acid backbone are essential for the development of oligonucleotide-derived bioactive agents. The NAA-modification represents a novel artificial internucleotide linkage which enables the site-specific introduction of positive charges into the otherwise polyanionic backbone of DNA oligonucleotides. Following initial studies with the introduction of the NAA-linkage at T-T sites, it is now envisioned to prepare NAA-modified oligonucleotides bearing the modification at X-T motifs (X = A, C, G). We have therefore developed the efficient and stereoselective synthesis of NAA-linked 'dimeric' A-T phosphoramidite building blocks for automated DNA synthesis. Both the (S)- and the (R)-configured NAA-motifs were constructed with high diastereoselectivities to furnish two different phosphoramidite reagents, which were employed for the solid phase-supported automated synthesis of two NAA-modified DNA oligonucleotides. This represents a significant step to further establish the NAA-linkage as a useful addition to the existing 'toolbox' of backbone modifications for the design of bioactive oligonucleotide analogues.

Synthesis and hybridization of a series of biotinylated oligonucleotides.

PubMed Central

Cook, A F; Vuocolo, E; Brakel, C L

1988-01-01

A series of oligonucleotides containing biotin-11-dUMP at various positions were synthesized and compared in quantitative, colorimetric hybridization-detection studies. A deoxyuridine phosphoramidite containing a protected allylamino sidearm was synthesized and used in standard, automated synthesis cycles to prepare oligonucleotides with allylamino residues at various positions within a standard 17-base sequence. Biotin substituents were subsequently attached to the allylamino sidearms by reaction with N-biotinyl-6-aminocaproic acid N-hydroxysuccinimide ester. These oligomers were hybridized to target DNA immobilized on microtiter wells (ELISA plates), and were detected with a streptavidin-biotinylated horseradish peroxidase complex using hydrogen peroxide as substrate and o-phenylenediamine as chromogen. We found that the sensitivity of detection of target DNA by biotin-labeled oligonucleotide probes was strongly dependent upon the position of the biotin label. Oligonucleotides containing biotin labels near or off the ends of the hybridizing sequence were more effective probes than oligonucleotides containing internal biotin labels. An additive effect of increasing numbers of biotin-dUMP residues was found for some labeling configurations. PMID:3375076

Synthesis, properties, and NMR studies of a C8-phenylguanine modified oligonucleotide that preferentially adopts the Z DNA conformation.

PubMed

Gannett, Peter M; Heavner, Sue; Daft, Jonathan R; Shaughnessy, Kevin H; Epperson, Jon D; Greenbaum, Nancy L

2003-10-01

Carcinogenic aryl hydrazines produce C8-arylated purine adducts. The effect of these adducts on DNA conformation and their role in hydrazine carcinogenesis are unknown. Here, we describe a new synthetic route to produce these adducts that is also compatible with the synthesis of the corresponding phosphoramidites needed for oligonucleotide synthesis. Two oligonucleotides were prepared, an unmodified oligonucleotide, d((5)(')CGCGCGCGCG(3)(')), and a C8-phenylguanine modified oligonucleotide, d((5)(')CGCGCGCGCG(3)(')) (G = 8-phenylguanine). These oligonucleotides were compared using thermal denaturation, circular dichroism, NMR, and molecular modeling. The phenyl modification destabilizes the B DNA form and stabilizes the Z DNA form such that the B:Z ratio is near one under physiological conditions. In light of recent studies that show a role for Z DNA in gene expression and cell transformation, Z DNA stabilization by C8-arylguanine formation from aryl hydrazines may be relevant to their role in carcinogenesis.

Time-series oligonucleotide count to assign antiviral siRNAs with long utility fit in the big data era

PubMed Central

Wada, K; Wada, Y; Iwasaki, Y; Ikemura, T

2017-01-01

Oligonucleotides are key elements of nucleic acid therapeutics such as small interfering RNAs (siRNAs). Influenza and Ebolaviruses are zoonotic RNA viruses mutating very rapidly, and their sequence changes must be characterized intensively to design therapeutic oligonucleotides with long utility. Focusing on a total of 182 experimentally validated siRNAs for influenza A, B and Ebolaviruses compiled by the siRNA database, we conducted time-series analyses of occurrences of siRNA targets in these viral genomes. Reflecting their high mutation rates, occurrences of target oligonucleotides evidently fluctuate in viral populations and often disappear. Time-series analysis of the one-base changed sequences derived from each original target identified the oligonucleotide that shows a compensatory increase and will potentially become the ‘awaiting-type oligonucleotide’ the combined use of this oligonucleotide with the original can provide therapeutics with long utility. This strategy is also useful for assigning diagnostic reverse transcription-PCR primers with long utility. PMID:28905886

Oligonucleotide recombination in corynebacteria without the expression of exogenous recombinases.

PubMed

Krylov, Alexander A; Kolontaevsky, Egor E; Mashko, Sergey V

2014-10-01

Brevibacterium lactofermentum and Corynebacterium glutamicum are important biotechnology species of the genus Corynebacterium. The single-strand DNA annealing protein (SSAP)-independent oligonucleotide-mediated recombination procedure was successfully applied to the commonly used wild-type strains B. lactofermentum AJ1511 and C. glutamicum ATCC13032. When the rpsL gene was used as a target, the optimized protocol yielded up to (1.4±0.3)×10(3) and (6.7±1.3)×10(3) streptomycin-resistant colonies per 10(8) viable cells for the corresponding strains. We tested the influence of several parameters that are known to enhance the efficiency of oligonucleotide-mediated recombination in other bacterial species. Among them, increasing the concentration of oligonucleotides and targeting the lagging strand of the chromosome have proven to have positive effects on both of the tested species. No difference in the efficiency of recombination was observed between the oligonucleotides phosphorothiorated at the 5' ends and the unmodified oligonucleotides or between the oligonucleotides with four mutated nucleotides and those with one mutated nucleotide. The described approach demonstrates that during the adaptation of the recombineering technique, testing SSAP-independent oligonucleotide-mediated recombination could be a good starting point. Such testing could decrease the probability of an incorrect interpretation of the effect of exogenous protein factors (such as SSAP and/or corresponding exonucleases) due to non-optimal experimental conditions. In addition, SSAP-independent recombination itself could be useful in combination with suitable selection/enrichment methods. Copyright © 2014 Elsevier B.V. All rights reserved.

Degradation product characterization of therapeutic oligonucleotides using liquid chromatography mass spectrometry.

PubMed

Elzahar, N M; Magdy, N; El-Kosasy, Amira M; Bartlett, Michael G

2018-05-01

Synthetic antisense phosphorothioate oligonucleotides (PS) have undergone rapid development as novel therapeutic agents. The increasing significance of this class of drugs requires significant investment in the development of quality control methods. The determination of the many degradation pathways of such complex molecules presents a significant challenge. However, an understanding of the potential impurities that may arise is necessary to continue to advance these powerful new therapeutics. In this study, four different antisense oligonucleotides representing several generations of oligonucleotide therapeutic agents were evaluated under various stress conditions (pH, thermal, and oxidative stress) using ion-pairing reversed-phase liquid chromatography tandem mass spectrometry (IP-RPLC-MS/MS) to provide in-depth characterization and identification of the degradation products. The oligonucleotide samples were stressed under different pH values at 45 and 90 °C. The main degradation products were observed to be losses of nucleotide moieties from the 3'- and 5'-terminus, depurination, formation of terminal phosphorothioates, and production of ribose, ribophosphorothioates (Rp), and phosphoribophosphorothioates (pRp). Moreover, the effects of different concentrations of hydrogen peroxide were studied resulting in primarily extensive desulfurization and subsequent oxidation of the phosphorothioate linkage to produce the corresponding phosphodiester. The reaction kinetics for the degradation of the oligonucleotides under the different stress conditions were studied and were found to follow pseudo-first-order kinetics. Differences in rates exist even for oligonucleotides of similar length but consisting of different sequences. Graphical abstract Identification of degradation products across several generations of oligonucleotide therapeutics using LC-MS.

2′-O-[2-[(N,N-dimethylamino)oxy]ethyl]-modified oligonucleotides inhibit expression of mRNA in vitro and in vivo

PubMed Central

Prakash, Thazha P.; Johnston, Joseph F.; Graham, Mark J.; Condon, Thomas P.; Manoharan, Muthiah

2004-01-01

Synthesis and antisense activity of oligonucleotides modified with 2′-O-[2-[(N,N-dimethylamino)oxy] ethyl] (2′-O-DMAOE) are described. The 2′-O-DMAOE-modified oligonucleotides showed superior metabolic stability in mice. The phosphorothioate oligonucleotide ‘gapmers’, with 2′-O-DMAOE- modified nucleoside residues at the ends and 2′-deoxy nucleosides residues in the central region, showed dose-dependent inhibition of mRNA expression in cell culture for two targets. ‘Gapmer’ oligonucleotides have one or two 2′-O-modified regions and a 2′-deoxyoligonucleotide phosphorothioate region that allows RNase H digestion of target mRNA. To determine the in vivo potency and efficacy, BalbC mice were treated with 2′-O-DMAOE gapmers and a dose-dependent reduction in the targeted C-raf mRNA expression was observed. Oligonucleotides with 2′-O-DMAOE modifications throughout the sequences reduced the intercellular adhesion molecule-1 (ICAM-1) protein expression very efficiently in HUVEC cells with an IC50 of 1.8 nM. The inhibition of ICAM-1 protein expression by these uniformly modified 2′-O-DMAOE oligonucleotides may be due to selective interference with the formation of the translational initiation complex. These results demonstrate that 2′-O-DMAOE- modified oligonucleotides are useful for antisense-based therapeutics when either RNase H-dependent or RNase H-independent target reduction mechanisms are employed. PMID:14762210

A fluorescent radioiodinated oligonucleotidic photoaffinity probe for protein labeling: synthesis and photolabeling of thrombin.

PubMed

Berens, C; Courtoy, P J; Sonveaux, E

1999-01-01

To study the interactions between oligonucleotides and proteins, an original photoaffinity radiolabeling probe has been synthesized. Starting with a 5'-pyridyldithio-3'-amino-oligonucleotide, the photophore benzophenone was first coupled to the 3' end, through acylation by an activated ester of benzoylbenzoic acid. A fluorescein molecule was grafted by alkylation of the free 5'-SH. This compound was finally radiolabeled with 125I using IodoBeads. The selective photolabeling of thrombin in a complex protein mixture by the radioiodinated probe validates this strategy to identify oligonucleotide-binding proteins.

Synthesis of high quality phosphorothioate oligonucleotides as antisense drugs. Use of I-linker in the elimination of 3'-terminal phosphorothioate monoesters.

PubMed

Ravikumar, Vasulinga T; Kumar, R Krishna; Capaldi, Daniel C; Cole, Douglas L

2003-01-01

Detritylation of a 5'-O-DMT-2'-deoxyadenosine moiety attached to solid support under acidic condition leads to depurination during oligonucleotide synthesis. Deprotection followed by reversed phase HPLC purification leads to desired oligonucleotide contaminated with significant levels of 3'-terminal phosphorothiaote (3'-TPT) monoester (n-1)-mer. However, it is demonstrated that attachment of dA nucleoside through its exocyclic amino group to solid support leads to substantial reduction of 3'-TPT formation thereby improving the quality of oligonucleotide synthesized.

The Use of Gel Electrophoresis to Study the Reactions of Activated Amino Acids with Oligonucleotides

NASA Technical Reports Server (NTRS)

Zieboll, Gerhard; Orgel, Leslie E.

1994-01-01

We have used gel electrophoresis to study the primary covalent addition of amino acids to oligonu-cleotides or their analogs and the subsequent addition of further molecules of the amino acids to generate peptides covalently linked to the oligonucleotides. We have surveyed the reactions of a variety of amino acids with the phosphoramidates derived from oligonucleotide 5 inches phosphates and ethylenediamine. We find that arginine and amino acids can interact with oligonucleotidesl through stacking interactions react most efficiently. D- and L-amino acids give indistinguishable families of products.

Methods for immobilizing nucleic acids on a gel substrate

DOEpatents

Mirzabekov, Andrei Darievich; Proudnikov, Dimitri Y.; Timofeev, Edward N.; Kochetkova, Svetlana V.; Florentiev, Vladimir L.; Shick, Valentine V.

1999-01-01

A method for labeling oligonucleotide molecules, and for immobilizing oligonucleotide and DNA molecules is provided comprising modifying the molecules to create a chemically active group, and contacting activated fluorescent dyes to the region. A method for preparing an immobilization substrate is also provided comprising modifying a gel to contain desired functional groups which covalently interact with certain moieties of the oligonucleotide molecules. A method for immobilizing biomolecules and other molecules within a gel by copolymerization of allyl-substituted oligonucleotides, DNA and proteins with acrylamide is also provided.

Synthetic Method for Oligonucleotide Block by Using Alkyl-Chain-Soluble Support.

PubMed

Matsuno, Yuki; Shoji, Takao; Kim, Shokaku; Chiba, Kazuhiro

2016-02-19

A straightforward method for the synthesis of oligonucleotide blocks using a Cbz-type alkyl-chain-soluble support (Z-ACSS) attached to the 3'-OH group of 3'-terminal nucleosides was developed. The Z-ACSS allowed for the preparation of fully protected deoxyribo- and ribo-oligonucleotides without chromatographic purification and released dimer- to tetramer-size oligonucleotide blocks via hydrogenation using a Pd/C catalyst without significant loss or migration of protective groups such as 5'-end 4,4'-dimethoxtrityl, 2-cyanoethyl on internucleotide bonds, or 2'-TBS.

A novel computational method to simulate non-enzymatic self-replication. [Abstract only

NASA Technical Reports Server (NTRS)

Navarro-Gonzalez, Rafael; Reggia, James A.; Wu, Jayoung; Chou, Hui-Hsien

1994-01-01

Non-enzymatic, template-directed synthesis of oligonucleotides has been extensively studied in the laboratory as a model to understand the kind of chemical processes that might have contributed to the origin of life on Earth. Several oligonucleotides have been shown to catalyze the synthesis of their complements from activated mononucleotides; however, a restricted number of them have been found to self-replicate. Recently we developed an efficient modified cellular automata method that supports the study of self-replicating oligonucleotides. With this method the oligonucleotide molecules are represented as active cells imbedded in a two-dimensional array of inactive cells symbolizing the environment. Random movements and probability-governed chemical reactions occurring in a cellular space can effectively simulate the experimental behavior observed in self-directed replication of oligonucleotides.

Quantitative surface-enhanced resonance Raman scattering of phthalocyanine-labelled oligonucleotides

PubMed Central

Macaskill, A.; Chernonosov, A. A.; Koval, V. V.; Lukyanets, E. A.; Fedorova, O. S.; Smith, W. E.; Faulds, K.; Graham, D.

2007-01-01

The evaluation of phthalocyanine labels for the surface-enhanced resonance Raman scattering (SERRS) detection of oligonucleotides is reported. Three phthalocyanine-labelled oligonucleotides were assessed, each containing a different metal centre. Detection limits for each labelled oligonucleotide were determined using two excitation frequencies where possible. Limits of detection as low as 2.8 × 10−11 mol. dm−3 were obtained which are comparable to standard fluorescently labelled probes used in previous SERRS studies. The identification of two phthalocyanine-labelled oligonucleotides without separation was also demonstrated indicating their suitability for multiplexing. This study extends the range of labels suitable for quantitative surface-enhanced resonance Raman scattering with silver nanoparticles and offers more flexibility and choice when considering SERRS for quantitative DNA detection. PMID:17289751

Oligonucleotide-based biosensors for in vitro diagnostics and environmental hazard detection.

PubMed

Jung, Il Young; Lee, Eun Hee; Suh, Ah Young; Lee, Seung Jin; Lee, Hyukjin

2016-04-01

Oligonucleotide-based biosensors have drawn much attention because of their broad applications in in vitro diagnostics and environmental hazard detection. They are particularly of interest to many researchers because of their high specificity as well as excellent sensitivity. Recently, oligonucleotide-based biosensors have been used to achieve not only genetic detection of targets but also the detection of small molecules, peptides, and proteins. This has further broadened the applications of these sensors in the medical and health care industry. In this review, we highlight various examples of oligonucleotide-based biosensors for the detection of diseases, drugs, and environmentally hazardous chemicals. Each example is provided with detailed schematics of the detection mechanism in addition to the supporting experimental results. Furthermore, future perspectives and new challenges in oligonucleotide-based biosensors are discussed.

As Technologies for Nucleotide Therapeutics Mature, Products Emerge.

PubMed

Beierlein, Jennifer M; McNamee, Laura M; Ledley, Fred D

2017-12-15

The long path from initial research on oligonucleotide therapies to approval of antisense products is not unfamiliar. This lag resembles those encountered with monoclonal antibodies, gene therapies, and many biological targets and is consistent with studies of innovation showing that technology maturation is a critical determinant of product success. We previously described an analytical model for the maturation of biomedical research, demonstrating that the efficiency of targeted and biological development is connected to metrics of technology growth. The present work applies this model to characterize the advance of oligonucleotide therapeutics. We show that recent oligonucleotide product approvals incorporate technologies and targets that are past the established point of technology growth, as do most of the oligonucleotide products currently in phase 3. Less mature oligonucleotide technologies, such as miRNAs and some novel gene targets, have not passed the established point and have not yielded products. This analysis shows that oligonucleotide product development has followed largely predictable patterns of innovation. While technology maturation alone does not ensure success, these data show that many oligonucleotide technologies are sufficiently mature to be considered part of the arsenal for therapeutic development. These results demonstrate the importance of technology assessment in strategic management of biomedical technologies. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Synthesis of high-quality libraries of long (150mer) oligonucleotides by a novel depurination controlled process

PubMed Central

LeProust, Emily M.; Peck, Bill J.; Spirin, Konstantin; McCuen, Heather Brummel; Moore, Bridget; Namsaraev, Eugeni; Caruthers, Marvin H.

2010-01-01

We have achieved the ability to synthesize thousands of unique, long oligonucleotides (150mers) in fmol amounts using parallel synthesis of DNA on microarrays. The sequence accuracy of the oligonucleotides in such large-scale syntheses has been limited by the yields and side reactions of the DNA synthesis process used. While there has been significant demand for libraries of long oligos (150mer and more), the yields in conventional DNA synthesis and the associated side reactions have previously limited the availability of oligonucleotide pools to lengths <100 nt. Using novel array based depurination assays, we show that the depurination side reaction is the limiting factor for the synthesis of libraries of long oligonucleotides on Agilent Technologies’ SurePrint® DNA microarray platform. We also demonstrate how depurination can be controlled and reduced by a novel detritylation process to enable the synthesis of high quality, long (150mer) oligonucleotide libraries and we report the characterization of synthesis efficiency for such libraries. Oligonucleotide libraries prepared with this method have changed the economics and availability of several existing applications (e.g. targeted resequencing, preparation of shRNA libraries, site-directed mutagenesis), and have the potential to enable even more novel applications (e.g. high-complexity synthetic biology). PMID:20308161

Feed-forward alignment correction for advanced overlay process control using a standalone alignment station "Litho Booster"

NASA Astrophysics Data System (ADS)

Yahiro, Takehisa; Sawamura, Junpei; Dosho, Tomonori; Shiba, Yuji; Ando, Satoshi; Ishikawa, Jun; Morita, Masahiro; Shibazaki, Yuichi

2018-03-01

One of the main components of an On-Product Overlay (OPO) error budget is the process induced wafer error. This necessitates wafer-to-wafer correction in order to optimize overlay accuracy. This paper introduces the Litho Booster (LB), standalone alignment station as a solution to improving OPO. LB can execute high speed alignment measurements without throughput (THP) loss. LB can be installed in any lithography process control loop as a metrology tool, and is then able to provide feed-forward (FF) corrections to the scanners. In this paper, the detailed LB design is described and basic LB performance and OPO improvement is demonstrated. Litho Booster's extendibility and applicability as a solution for next generation manufacturing accuracy and productivity challenges are also outlined

Length of encapsidated cargo impacts stability and structure of in vitro assembled alphavirus core-like particles

NASA Astrophysics Data System (ADS)

Rayaprolu, Vamseedhar; Moore, Alan; Che-Yen Wang, Joseph; Goh, Boon Chong; Perilla, Juan R.; Zlotnick, Adam; Mukhopadhyay, Suchetana

2017-12-01

In vitro assembly of alphavirus nucleocapsid cores, called core-like particles (CLPs), requires a polyanionic cargo. There are no sequence or structure requirements to encapsidate single-stranded nucleic acid cargo. In this work, we wanted to determine how the length of the cargo impacts the stability and structure of the assembled CLPs. We hypothesized that cargo neutralizes the basic region of the alphavirus capsid protein and if the cargo is long enough, it will also act to scaffold the CP monomers together. Experimentally we found that CLPs encapsidating short 27mer oligonucleotides were less stable than CLPs encapsidating 48mer or 90mer oligonucleotides under different chemical and thermal conditions. Furthermore, cryo-EM studies showed there were structural differences between CLPs assembled with 27mer and 48mer cargo. To mimic the role of the cargo in CLP assembly we made a mutant (4D) where we substituted a cluster of four Lys residues in the CP with four Asp residues. We found that these few amino acid substitutions were enough to initiate CLP assembly in the absence of cargo. The cargo-free 4D CLPs show higher resistance to ionic strength and increased temperature compared to wild-type cargo containing CLPs suggesting their CLP assembly mechanism might also be different.

Experimental analysis of oligonucleotide microarray design criteria to detect deletions by comparative genomic hybridization.

PubMed

Flibotte, Stephane; Moerman, Donald G

2008-10-21

Microarray comparative genomic hybridization (CGH) is currently one of the most powerful techniques to measure DNA copy number in large genomes. In humans, microarray CGH is widely used to assess copy number variants in healthy individuals and copy number aberrations associated with various diseases, syndromes and disease susceptibility. In model organisms such as Caenorhabditis elegans (C. elegans) the technique has been applied to detect mutations, primarily deletions, in strains of interest. Although various constraints on oligonucleotide properties have been suggested to minimize non-specific hybridization and improve the data quality, there have been few experimental validations for CGH experiments. For genomic regions where strict design filters would limit the coverage it would also be useful to quantify the expected loss in data quality associated with relaxed design criteria. We have quantified the effects of filtering various oligonucleotide properties by measuring the resolving power for detecting deletions in the human and C. elegans genomes using NimbleGen microarrays. Approximately twice as many oligonucleotides are typically required to be affected by a deletion in human DNA samples in order to achieve the same statistical confidence as one would observe for a deletion in C. elegans. Surprisingly, the ability to detect deletions strongly depends on the oligonucleotide 15-mer count, which is defined as the sum of the genomic frequency of all the constituent 15-mers within the oligonucleotide. A similarity level above 80% to non-target sequences over the length of the probe produces significant cross-hybridization. We recommend the use of a fairly large melting temperature window of up to 10 degrees C, the elimination of repeat sequences, the elimination of homopolymers longer than 5 nucleotides, and a threshold of -1 kcal/mol on the oligonucleotide self-folding energy. We observed very little difference in data quality when varying the oligonucleotide length between 50 and 70, and even when using an isothermal design strategy. We have determined experimentally the effects of varying several key oligonucleotide microarray design criteria for detection of deletions in C. elegans and humans with NimbleGen's CGH technology. Our oligonucleotide design recommendations should be applicable for CGH analysis in most species.

Synthesis of Bipartite Tetracysteine PNA Probes for DNA In Situ Fluorescent Labeling.

PubMed

Fang, Ge-Min; Seitz, Oliver

2017-12-24

"Label-free" fluorescent probes that avoid additional steps or building blocks for conjugation of fluorescent dyes with oligonucleotides can significantly reduce the time and cost of parallel bioanalysis of a large number of nucleic acid samples. A method for the synthesis of "label-free" bicysteine-modified PNA probes using solid-phase synthesis and procedures for sequence-specific DNA in situ fluorescent labeling is described here. The concept is based on the adjacent alignment of two bicysteine-modified peptide nucleic acids on a DNA target to form a structurally optimized bipartite tetracysteine motif, which induces a sequence-specific fluorogenic reaction with commercially available biarsenic dyes, even in complex media such as cell lysate. This unit will help researchers to quickly synthesize bipartite tetracysteine PNA probes and carry out low-cost DNA in situ fluorescent labeling experiments. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

Defined presentation of carbohydrates on a duplex DNA scaffold.

PubMed

Schlegel, Mark K; Hütter, Julia; Eriksson, Magdalena; Lepenies, Bernd; Seeberger, Peter H

2011-12-16

A new method for the spatially defined alignment of carbohydrates on a duplex DNA scaffold is presented. The use of an N-hydroxysuccinimide (NHS)-ester phosphoramidite along with carbohydrates containing an alkylamine linker allows for on-column labeling during solid-phase oligonucleotide synthesis. This modification method during solid-phase synthesis only requires the use of minimal amounts of complex carbohydrates. The covalently attached carbohydrates are presented in the major groove of the B-form duplex DNA as potential substrates for murine type II C-type lectin receptors mMGL1 and mMGL2. CD spectroscopy and thermal melting revealed only minimal disturbance of the overall helical structure. Surface plasmon resonance and cellular uptake studies with bone-marrow-derived dendritic cells were used to assess the capability of these carbohydrate-modified duplexes to bind to mMGL receptors. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Optimized synthesis of phosphorothioate oligodeoxyribonucleotides substituted with a 5′-protected thiol function and a 3′-amino group

PubMed Central

Aubert, Yves; Bourgerie, Sylvain; Meunier, Laurent; Mayer, Roger; Roche, Annie-Claude; Monsigny, Michel; Thuong, Nguyen T.; Asseline, Ulysse

2000-01-01

A new deprotection procedure enables a medium scale preparation of phosphodiester and phosphorothioate oligonucleotides substituted with a protected thiol function at their 5′-ends and an amino group at their 3′-ends in good yield (up to 72 OD units/µmol for a 19mer phosphorothioate). Syntheses of 3′-amino-substituted oligonucleotides were carried out on a modified support. A linker containing the thioacetyl moiety was manually coupled in two steps by first adding its phosphoramidite derivative in the presence of tetrazole followed by either oxidation or sulfurization to afford the bis-derivatized oligonucleotide bound to the support. Deprotection was achieved by treating the fully protected oligonucleotide with a mixture of 2,2′-dithiodipyridine and concentrated aqueous ammonia in the presence of phenol and methanol. This procedure enables (i) cleavage of the oligonucleotide from the support, releasing the oligonucleotide with a free amino group at its 3′-end, (ii) deprotection of the phosphate groups and the amino functions of the nucleic bases, as well as (iii) transformation of the 5′-terminal S-acetyl function into a dithiopyridyl group. The bis-derivatized phosphorothioate oligomer was further substituted through a two-step procedure: first, the 3′-amino group was reacted with fluorescein isothiocyanate to yield a fluoresceinylated oligonucleotide; the 5′-dithiopyridyl group was then quantitatively reduced to give a free thiol group which was then substituted by reaction with an Nα-bromoacetyl derivative of a signal peptide containing a KDEL sequence to afford a fluoresceinylated peptide–oligonucleotide conjugate. PMID:10637335

STAT3 Oligonucleotide Inhibits Tumor Angiogenesis in Preclinical Models of Squamous Cell Carcinoma

PubMed Central

Klein, Jonah D.; Sano, Daisuke; Sen, Malabika; Myers, Jeffrey N.; Grandis, Jennifer R.; Kim, Seungwon

2014-01-01

Purpose Signal transducer and activator of transcription 3 (STAT3) has shown to play a critical role in head and neck squamous cell carcinoma (HNSCC) and we have recently completed clinical trials of STAT3 decoy oligonucleotide in patients with recurrent or metastatic HNSCC. However, there is limited understanding of the role of STAT3 in modulating other aspects of tumorigenesis such as angiogenesis. In this study, we aimed to examine the effects of STAT3 decoy oligonucleotide on tumor angiogenesis. Experimental Design A STAT3 decoy oligonucleotide and small interfering RNA (siRNA) were used to inhibit STAT3 in endothelial cells in vitro and in vivo. The biochemical effects of STAT3 inhibition were examined in conjunction with the consequences on proliferation, migration, apoptotic staining, and tubule formation. Additionally, we assessed the effects of STAT3 inhibition on tumor angiogenesis using murine xenograft models. Results STAT3 decoy oligonucleotide decreased proliferation, induces apoptosis, decreased migration, and decreased tubule formation of endothelial cells in vitro. The STAT3 decoy oligonucleotide also inhibited tumor angiogenesis in murine tumor xenografts. Lastly, our data suggest that the antiangiogenic effects of STAT3 decoy oligonucleotide were mediatedthrough the inhibition of both STAT3 and STAT1. Conclusions The STAT3 decoy oligonucleotidewas found to be an effective antiangiogenic agent, which is likely to contribute to the overall antitumor effects of this agent in solid tumors.Taken together with the previously demonstrated antitumor activity of this agent, STAT3 decoy oligonucleotide represents a promising single agent approach to targeting both the tumor and vascular compartments in various malignancies. PMID:24404126

Improved strategies for postoligomerization synthesis of oligodeoxynucleotides bearing structurally defined adducts at the N2 position of deoxyguanosine.

PubMed

DeCorte, B L; Tsarouhtsis, D; Kuchimanchi, S; Cooper, M D; Horton, P; Harris, C M; Harris, T M

1996-01-01

Improved methodology has been developed for preparation of oligodeoxynucleotides bearing adducts on the N2 position of guanine in which the adduction reaction is carried out in homogeneous solution rather than while the oligonucleotide is immobilized on a solid matrix. The methodology utilizes a new synthon, 2-fluoro-O6-(trimethylsilylethyl)-2'-deoxyinosine (3). Nucleoside 3 is stable to the conditions of oligonucleotide synthesis, but the O6 protection is eliminated under very mild conditions following displacement of the 2-fluoro group by amine nucleophiles. Oligonucleotides containing 3 could be removed from the solid support by treatment with 0.1 M NaOH (8 h, rt) without disruption of 3. Reaction of the crude, partially deprotected oligonucleotide with (R)-2-amino-2-phenylethanol in homogeneous solution, followed by removal of the remaining protective groups with NH4OH (60 degrees C, 8 h) and then 0.1% acetic acid, gave the adducted oligonucleotide in good purity and yield. Alternatively, fully deprotected oligonucleotide containing 3 could be prepared by use of labile phenoxyacetyl-type protecting groups on the exocyclic amino groups.

Detection with synthetic oligonucleotide probes of nucleotide sequence variations in the genes encoding enterotoxins of Escherichia coli.

PubMed Central

Nishibuchi, M; Murakami, A; Arita, M; Jikuya, H; Takano, J; Honda, T; Miwatani, T

1989-01-01

We examined variations in the genes encoding heat-stable enterotoxin (ST) and heat-labile enterotoxin (LT) in 88 strains of Escherichia coli isolated from individuals with traveler's diarrhea to find suitable sequences for use as oligonucleotide probes. Four oligonucleotide probes of the gene encoding ST of human origin (STIb or STh), one oligonucleotide probe of the gene encoding ST of porcine origin (STIa or STp), and three oligonucleotide probes of the gene encoding LT of human origin (LTIh) were used in DNA colony hybridization tests. In 15 of 22 strains possessing the STh gene and 28 of 42 strains producing LT, the sequences of all regions tested were identical to the published sequences. One region in the STh gene examined with a 18-mer probe was relatively well conserved and was shown to be closely associated with the enterotoxicity of the E. coli strains in suckling mice. This oligonucleotide, however, hybridized with strains of Vibrio cholerae O1, V. parahaemolyticus, and Yersinia enterocolitica that gave negative results in the suckling mouse assay. PMID:2685027

Circular DNA by "Bis-Click" Ligation: Template-Independent Intramolecular Circularization of Oligonucleotides with Terminal Alkynyl Groups Utilizing Bifunctional Azides.

PubMed

Yang, Haozhe; Seela, Frank

2016-01-22

A highly effective and convenient "bis-click" strategy was developed for the template-independent circularization of single-stranded oligonucleotides by employing copper(I)-assisted azide-alkyne cycloaddition. Terminal triple bonds were incorporated at both ends of linear oligonucleotides. Alkynylated 7-deaza-2'-deoxyadenosine and 2'-deoxyuridine residues with different side chains were used in solid-phase synthesis with phosphoramidite chemistry. The bis-click ligation of linear 9- to 36-mer oligonucleotides with 1,4-bis(azidomethyl)benzene afforded circular DNA in a simple and selective way; azido modification of the oligonucleotide was not necessary. Short ethynyl side chains were compatible with the circularization of longer oligonucleotides, whereas octadiynyl residues were used for short 9-mers. Compared with linear duplexes, circular bis-click constructs exhibit a significantly increased duplex stability over their linear counterparts. The intramolecular bis-click ligation protocol is not limited to DNA, but may also be suitable for the construction of other macrocycles, such as circular RNAs, peptides, or polysaccharides. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

DNA - peptide polyelectrolyte complexes: Phase control by hybridization

NASA Astrophysics Data System (ADS)

Vieregg, Jeffrey; Lueckheide, Michael; Marciel, Amanda; Leon, Lorraine; Tirrell, Matthew

DNA is one of the most highly-charged molecules known, and interacts strongly with charged molecules in the cell. Condensation of long double-stranded DNA is one of the classic problems of biophysics, but the polyelectrolyte behavior of short and/or single-stranded nucleic acids has attracted far less study despite its importance for both biological and engineered systems. We report here studies of DNA oligonucleotides complexed with cationic peptides and polyamines. As seen previously for longer sequences, double-stranded oligonucleotides form solid precipitates, but single-stranded oligonucleotides instead undergo liquid-liquid phase separation to form coacervate droplets. Complexed oligonucleotides remain competent for hybridization, and display sequence-dependent environmental response. We observe similar behavior for RNA oligonucleotides, and methylphosphonate substitution of the DNA backbone indicates that nucleic acid charge density controls whether liquid or solid complexes are formed. Liquid-liquid phase separations of this type have been implicated in formation of membraneless organelles in vivo, and have been suggested as protocells in early life scenarios; oligonucleotides offer an excellent method to probe the physics controlling these phenomena.

Rapid method to detect duplex formation in sequencing by hybridization methods

DOEpatents

Mirzabekov, A.D.; Timofeev, E.N.; Florentiev, V.L.; Kirillov, E.V.

1999-01-19

A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided. A plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex. Each duplex facilitates intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface and exposing the light-sensitive fluid to a light pattern. This causes the fluid exposed to the light to coalesce into discrete units and adhere to the surface. This places each of the units in contact with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units. 13 figs.

In situ oligonucleotide synthesis on poly(dimethylsiloxane): a flexible substrate for microarray fabrication

PubMed Central

Moorcroft, Matthew J.; Meuleman, Wouter R. A.; Latham, Steven G.; Nicholls, Thomas J.; Egeland, Ryan D.; Southern, Edwin M.

2005-01-01

In this paper, we demonstrate in situ synthesis of oligonucleotide probes on poly(dimethylsiloxane) (PDMS) microchannels through use of conventional phosphoramidite chemistry. PDMS polymer was moulded into a series of microchannels using standard soft lithography (micro-moulding), with dimensions <100 μm. The surface of the PDMS was derivatized by exposure to ultraviolet/ozone followed by vapour phase deposition of glycidoxypropyltrimethoxysilane and reaction with poly(ethylene glycol) spacer, resulting in a reactive surface for oligonucleotide coupling. High, reproducible yields were achieved for both 6mer and 21mer probes as assessed by hybridization to fluorescent oligonucleotides. Oligonucleotide surface density was comparable with that obtained on glass substrates. These results suggest PDMS as a stable and flexible alternative to glass as a suitable substrate in the fabrication and synthesis of DNA microarrays. PMID:15870385

NMR of enzymatically synthesized uniformly 13C15N-labeled DNA oligonucleotides.

PubMed Central

Zimmer, D P; Crothers, D M

1995-01-01

A procedure for the enzymatic synthesis of uniformly 13C15N-labeled DNA oligonucleotides in milligram quantities for NMR studies is described. Deoxynucleotides obtained from microorganisms grown on 13C and 15N nutrient sources are enzymatically phosphorylated to dNTPs, and the dNTPs are incorporated into oligonucleotides using a 3'-5' exonuclease-deficient mutant of Klenow fragment of DNA polymerase I and an oligonucleotide template primer designed for efficient separation of labeled product DNA from unlabeled template. The labeling strategy has been used to uniformly label one or the other oligonucleotide strand in the DNA duplex dGGCAAAACGG.dCCGTTTTGCC in order to facilitate assignment and structure determination by NMR. Application of 15N and 13C heteronuclear NMR experiments to isotopically labeled DNA is presented. Images Fig. 2 Fig. 3 Fig. 4 PMID:7724521

Rapid method to detect duplex formation in sequencing by hybridization methods

DOEpatents

Mirzabekov, Andrei Darievich; Timofeev, Edward Nikolaevich; Florentiev, Vladimer Leonidovich; Kirillov, Eugene Vladislavovich

1999-01-01

A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided whereby a plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex so as to facilitate intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface, exposing said light-sensitive fluid to a light pattern so as to cause the fluid exposed to the light to coalesce into discrete units and adhere to the surface; and contacting each of the units with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units.

Tritium labeling of antisense oligonucleotides by exchange with tritiated water.

PubMed Central

Graham, M J; Freier, S M; Crooke, R M; Ecker, D J; Maslova, R N; Lesnik, E A

1993-01-01

We describe a simple, efficient, procedure for labeling oligonucleotides to high specific activity (< 1 x 10(8) cpm/mumol) by hydrogen exchange with tritiated water at the C8 positions of purines in the presence of beta-mercaptoethanol, an effective radical scavenger. Approximately 90% of the starting material is recovered as intact, labeled oligonucleotide. The radiolabeled compounds are stable in biological systems; greater than 90% of the specific activity is retained after 72 hr incubation at 37 degrees C in serum-containing media. Data obtained from in vitro cellular uptake experiments using oligonucleotides labeled by this method are similar to those obtained using 35S or 14C-labeled compounds. Because this protocol is solely dependent upon the existence of purine residues, it should be useful for radiolabeling modified as well as unmodified phosphodiester oligonucleotides. Images PMID:8367289

Systematic validation and atomic force microscopy of non-covalent short oligonucleotide barcode microarrays.

PubMed

Cook, Michael A; Chan, Chi-Kin; Jorgensen, Paul; Ketela, Troy; So, Daniel; Tyers, Mike; Ho, Chi-Yip

2008-02-06

Molecular barcode arrays provide a powerful means to analyze cellular phenotypes in parallel through detection of short (20-60 base) unique sequence tags, or "barcodes", associated with each strain or clone in a collection. However, costs of current methods for microarray construction, whether by in situ oligonucleotide synthesis or ex situ coupling of modified oligonucleotides to the slide surface are often prohibitive to large-scale analyses. Here we demonstrate that unmodified 20mer oligonucleotide probes printed on conventional surfaces show comparable hybridization signals to covalently linked 5'-amino-modified probes. As a test case, we undertook systematic cell size analysis of the budding yeast Saccharomyces cerevisiae genome-wide deletion collection by size separation of the deletion pool followed by determination of strain abundance in size fractions by barcode arrays. We demonstrate that the properties of a 13K unique feature spotted 20 mer oligonucleotide barcode microarray compare favorably with an analogous covalently-linked oligonucleotide array. Further, cell size profiles obtained with the size selection/barcode array approach recapitulate previous cell size measurements of individual deletion strains. Finally, through atomic force microscopy (AFM), we characterize the mechanism of hybridization to unmodified barcode probes on the slide surface. These studies push the lower limit of probe size in genome-scale unmodified oligonucleotide microarray construction and demonstrate a versatile, cost-effective and reliable method for molecular barcode analysis.

Gallium-68-labelled NOTA-oligonucleotides: an optimized method for their preparation.

PubMed

Gijs, Marlies; Dammicco, Sylvestre; Warnier, Corentin; Aerts, An; Impens, Nathalie R E N; D'Huyvetter, Matthias; Léonard, Marc; Baatout, Sarah; Luxen, André

2016-02-01

One of the most essential aspects to the success of radiopharmaceuticals is an easy and reliable radiolabelling protocol to obtain pure and stable products. In this study, we optimized the bioconjugation and gallium-68 ((68) Ga) radiolabelling conditions for a single-stranded 40-mer DNA oligonucleotide, in order to obtain highly pure and stable radiolabelled oligonucleotides. Quantitative bioconjugation was obtained for a disulfide-functionalized oligonucleotide conjugated to the macrocylic bifunctional chelator MMA-NOTA (maleimido-mono-amide (1,4,7-triazanonane-1,4,7-triyl)triacetic acid). Next, this NOTA-oligonucleotide bioconjugate was radiolabelled at room temperature with purified and pre-concentrated (68) Ga with quantitative levels of radioactive incorporation and high radiochemical and chemical purity. In addition, high chelate stability was observed in physiological-like conditions (37 °C, PBS and serum), in the presence of a transchelator (EDTA) and transferrin. A specific activity of 51.1 MBq/nmol was reached using a 1470-fold molar excess bioconjugate over (68) Ga. This study presents a fast, straightforward and reliable protocol for the preparation of (68) Ga-radiolabelled DNA oligonucleotides under mild reaction conditions and without the use of organic solvents. The methodology herein developed will be applied to the preparation of oligonucleotidic sequences (aptamers) targeting the human epidermal growth factor receptor 2 (HER2) for cancer imaging. Copyright © 2015 John Wiley & Sons, Ltd.

In vitro transcription in the presence of DNA oligonucleotides can generate strong anomalous initiation sites.

PubMed

Chow, C W; Clark, M P; Rinaldo, J E; Chalkley, R

1996-03-01

In the present study, we have explored an unexpected observation in transcription initiation that is mediated by single-stranded oligonucleotides. Initially, our goal was to understand the function of different upstream regulatory elements/initiation sites in the rat xanthine dehydrogenase/oxidase (XDH/XO) promoter. We performed in vitro transcription with HeLa nuclear extracts in the presence of different double-stranded oligonucleotides against upstream elements as competitors. A new and unusual transcription initiation site was detected by primer extension. This new initiation site maps to the downstream region of the corresponding competitor. Subsequent analyses have indicated that the induction of a new transcription initiation site is anomalous which is due to the presence of a small amount of single-stranded oligonucleotide in the competitor. We found that this anomalous initiation site is insensitive to the orientation of the promoter and requires only a small amount of single-stranded oligonucleotide (< 2-fold molar excess relative to template). We surmise that a complementary interaction between the single-stranded oligonucleotide and transiently denatured promoter template may be responsible for this sequence-specific transcription initiation artifact. To study the regulation of transcription initiation by in vitro transcription approaches, we propose that one should probe the effect of removing transacting factors by adding an excess of a cognate oligonucleotide which does not bear exact sequence identity to the template.

Angubindin-1 opens the blood-brain barrier in vivo for delivery of antisense oligonucleotide to the central nervous system.

PubMed

Zeniya, Satoshi; Kuwahara, Hiroya; Daizo, Kaiichi; Watari, Akihiro; Kondoh, Masuo; Yoshida-Tanaka, Kie; Kaburagi, Hidetoshi; Asada, Ken; Nagata, Tetsuya; Nagahama, Masahiro; Yagi, Kiyohito; Yokota, Takanori

2018-05-17

Within the field of RNA therapeutics, antisense oligonucleotide-based therapeutics are a potentially powerful means of treating intractable diseases. However, if these therapeutics are used for the treatment of neurological disorders, safe yet efficient methods of delivering antisense oligonucleotides across the blood-brain barrier to the central nervous system must be developed. Here, we examined the use of angubindin-1, a binder to the tricellular tight junction, to modulate paracellular transport between brain microvascular endothelial cells in the blood-brain barrier for the delivery of antisense oligonucleotides to the central nervous system. This proof-of-concept study demonstrated that intravenously injected angubindin-1 increased the permeability of the blood-brain barrier and enabled transient delivery of subsequently administered antisense oligonucleotides into the mouse brain and spinal cord, leading to silencing of a target RNA without any overt adverse effects. We also found that two bicellular tight junction modulators did not produce such a silencing effect, suggesting that the tricellular tight junction is likely a better target for the delivery of antisense oligonucleotides than the bicellular tight junction. Our delivery strategy of modulating the tricellular tight junction in the blood-brain barrier via angubindin-1 provides a novel avenue of research for the development of antisense oligonucleotide-based therapeutics for the treatment of neurological disorders. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Accurate and rapid modeling of iron-bleomycin-induced DNA damage using tethered duplex oligonucleotides and electrospray ionization ion trap mass spectrometric analysis.

PubMed

Harsch, A; Marzilli, L A; Bunt, R C; Stubbe, J; Vouros, P

2000-05-01

Bleomycin B(2)(BLM) in the presence of iron [Fe(II)] and O(2)catalyzes single-stranded (ss) and double-stranded (ds) cleavage of DNA. Electrospray ionization ion trap mass spectrometry was used to monitor these cleavage processes. Two duplex oligonucleotides containing an ethylene oxide tether between both strands were used in this investigation, allowing facile monitoring of all ss and ds cleavage events. A sequence for site-specific binding and cleavage by Fe-BLM was incorporated into each analyte. One of these core sequences, GTAC, is a known hot-spot for ds cleavage, while the other sequence, GGCC, is a hot-spot for ss cleavage. Incubation of each oligo-nucleotide under anaerobic conditions with Fe(II)-BLM allowed detection of the non-covalent ternary Fe-BLM/oligonucleotide complex in the gas phase. Cleavage studies were then performed utilizing O(2)-activated Fe(II)-BLM. No work-up or separation steps were required and direct MS and MS/MS analyses of the crude reaction mixtures confirmed sequence-specific Fe-BLM-induced cleavage. Comparison of the cleavage patterns for both oligonucleotides revealed sequence-dependent preferences for ss and ds cleavages in accordance with previously established gel electrophoresis analysis of hairpin oligonucleotides. This novel methodology allowed direct, rapid and accurate determination of cleavage profiles of model duplex oligonucleotides after exposure to activated Fe-BLM.

Gene Silencing by Gold Nanoshell-Mediated Delivery and Laser-Triggered Release of Antisense Oligonucleotide and siRNA

PubMed Central

Huschka, Ryan; Barhoumi, Aoune; Liu, Qing; Roth, Jack A.; Ji, Lin; Halas, Naomi J.

2013-01-01

The approach of RNA interference (RNAi)- using antisense DNA or RNA oligonucleotides to silence activity of a specific pathogenic gene transcript and reduce expression of the encoded protein- is very useful in dissecting genetic function and holds significant promise as a molecular therapeutic. A major obstacle in achieving gene silencing with RNAi technology is the systemic delivery of therapeutic oligonucleotides. Here we demonstrate an engineered gold nanoshell (NS)-based therapeutic oligonucleotide delivery vehicle, designed to release its cargo on demand upon illumination with a near-infrared (NIR) laser. A poly(L)lysine peptide (PLL) epilayer covalently attached to the NS surface (NS-PLL) is used to capture intact, single-stranded antisense DNA oligonucleotides, or alternatively, double-stranded short-interfering RNA (siRNA) molecules. Controlled release of the captured therapeutic oligonucleotides in each case is accomplished by continuous wave NIR laser irradiation at 800 nm, near the resonance wavelength of the nanoshell. Fluorescently tagged oligonucleotides were used to monitor the time-dependent release process and light-triggered endosomal release. A green fluorescent protein (GFP)-expressing human lung cancer H1299 cell line was used to determine cellular uptake and gene silencing mediated by the NS-PLL carrying GFP gene-specific single-stranded DNA antisense oligonucleotide (AON-GFP), or a double-stranded siRNA (siRNA-GFP), in vitro. Light-triggered delivery resulted in ∼ 47% and ∼49% downregulation of the targeted GFP expression by AON-GFP and siRNA-GFP, respectively. Cytotoxicity induced by both the NS-PLL delivery vector and by laser irradiation is minimal, as demonstrated by a XTT cell proliferation assay. PMID:22862291

Rapid method to detect duplex formation in sequencing by hybridization methods, a method for constructing containment structures for reagent interaction

DOEpatents

Mirzabekov, Andrei Darievich; Yershov, Gennadiy Moiseyevich; Guschin, Dmitry Yuryevich; Gemmell, Margaret Anne; Shick, Valentine V.; Proudnikov, Dmitri Y.; Timofeev, Edward N.

2002-01-01

A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided whereby a plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex so as to facilitate intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface, exposing said light-sensitive fluid to a light pattern so as to cause the fluid exposed to the light to polymerize into discrete units and adhere to the surface; and contacting each of the units with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units.

Oligonucleotides complementary to a promoter over the region -8...+2 as transcription primers for E. coli RNA polymerase.

PubMed Central

Grachev, M A; Zaychikov, E F; Ivanova, E M; Komarova, N I; Kutyavin, I V; Sidelnikova, N P; Frolova, I P

1984-01-01

Primer-dependent transcription by E. coli RNA polymerase on T7 promoter A2 has been studied. Synthetic deoxyribonucleotides complementary to the promoter over the region -8...+2 were taken as primers. A ribonucleoside residue was present at the 3'-end of some of these oligonucleotides. The octanucleotide complementary to the region -8...-1 appeared to be an active primer. Oligonucleotides having lengths from 3 to 6 nucleotide residues complementary to the promoter over the region -4...+2 also exhibited primer activity. The latter was some 5-10 times greater in the case of oligonucleotides having a ribonucleoside residue at the 3'-end. Oligonucleotides which on complementary binding do not reach the center of phosphodiester bond synthesis, as well as the decanucleotides (-8...+2) and octanucleotides (-6...+2) of both the ribo- and deoxyribo-series were inactive as primers. Images PMID:6390344

Non-nucleoside building blocks for copper-assisted and copper-free click chemistry for the efficient synthesis of RNA conjugates.

PubMed

Jayaprakash, K N; Peng, Chang Geng; Butler, David; Varghese, Jos P; Maier, Martin A; Rajeev, Kallanthottathil G; Manoharan, Muthiah

2010-12-03

Novel non-nucleoside alkyne monomers compatible with oligonucleotide synthesis were designed, synthesized, and efficiently incorporated into RNA and RNA analogues during solid-phase synthesis. These modifications allowed site-specific conjugation of ligands to the RNA oligonucleotides through copper-assisted (CuAAC) and copper-free strain-promoted azide-alkyne cycloaddition (SPAAC) reactions. The SPAAC click reactions of cyclooctyne-oligonucleotides with various classes of azido-functionalized ligands in solution phase and on solid phase were efficient and quantitative and occurred under mild reaction conditions. The SPAAC reaction provides a method for the synthesis of oligonucleotide-ligand conjugates uncontaminated with copper ions.

Synthesis and biophysical properties of 5'-thio-2',4'-BNA/LNA oligonucleotide.

PubMed

Islam, Md Ariful; Fujisaka, Aki; Mori, Shohei; Ito, Kosuke Ramon; Yamaguchi, Takao; Obika, Satoshi

2018-07-23

Phosphorothioate modification of oligonucleotides is one of the most promising chemical modifications in nucleic acid therapeutics. Structurally similar 5'-thio or phosphorothiolate-modified nucleotides, in which the 5'-bridging oxygen atom is replaced with a sulfur atom, are attracting attention and gaining importance in oligonucleotide-based research. In our present study, we synthesized 5'-thio-2',4'-BNA/LNA monomers bearing thymine or 5-methylcytosine nucleobase. The 5'-thio-2',4'-BNA/LNA monomers were successfully incorporated into target oligonucleotides, and their nuclease stability and binding affinity with complementary strands were evaluated. Copyright © 2018 Elsevier Ltd. All rights reserved.

2'-O-[2-[2-(N,N-Dimethylamino)ethoxy]ethyl] Modified Antisense Oligonucleotides: Symbiosis of Charge Interaction Factors and Stereoelectronic Effects

DOE Office of Scientific and Technical Information (OSTI.GOV)

Prhavc, M.; Prakash, T.P.; Minasov, G.

Oligonucleotides with a novel, 2'-O-[2-[2-(N,N-dimethylamino)ethoxy]ethyl] (2'-O-DMAEOE) modification have been synthesized. This modification, a cationic analogue of the 2'-O-(2-methoxyethyl) (2'-O-MOE) modification, exhibits high binding affinity to target RNA (but not to DNA) and exceptional resistance to nuclease degradation. Analysis of the crystal structure of a self-complementary oligonucleotide containing a single 2'-O-DMAEOE modification explains the importance of charge factors and gauche effects on the observed antisense properties. 2'-O-DMAEOE modified oligonucleotides are ideal candidates for antisense drugs.

The identification of complete domains within protein sequences using accurate E-values for semi-global alignment

PubMed Central

Kann, Maricel G.; Sheetlin, Sergey L.; Park, Yonil; Bryant, Stephen H.; Spouge, John L.

2007-01-01

The sequencing of complete genomes has created a pressing need for automated annotation of gene function. Because domains are the basic units of protein function and evolution, a gene can be annotated from a domain database by aligning domains to the corresponding protein sequence. Ideally, complete domains are aligned to protein subsequences, in a ‘semi-global alignment’. Local alignment, which aligns pieces of domains to subsequences, is common in high-throughput annotation applications, however. It is a mature technique, with the heuristics and accurate E-values required for screening large databases and evaluating the screening results. Hidden Markov models (HMMs) provide an alternative theoretical framework for semi-global alignment, but their use is limited because they lack heuristic acceleration and accurate E-values. Our new tool, GLOBAL, overcomes some limitations of previous semi-global HMMs: it has accurate E-values and the possibility of the heuristic acceleration required for high-throughput applications. Moreover, according to a standard of truth based on protein structure, two semi-global HMM alignment tools (GLOBAL and HMMer) had comparable performance in identifying complete domains, but distinctly outperformed two tools based on local alignment. When searching for complete protein domains, therefore, GLOBAL avoids disadvantages commonly associated with HMMs, yet maintains their superior retrieval performance. PMID:17596268

Aligning the NWEA RIT Scale with the Nevada Criterion Referenced Assessment and the Iowa Test of Basic Skills

ERIC Educational Resources Information Center

Cronin, John; Bowe, Branin

2004-01-01

Each year, Nevada students in grades 3, 4, 5, and 7 participate in testing as part of the Nevada assessment program. Students in grades 3 and 5 take the Nevada Criterion Referenced Assessment (Nevada CRT) while students in grades 4 and 7 take the Iowa Test of Basic Skills (ITBS). These tests serve as an important measure of student achievement for…

Systematic Validation and Atomic Force Microscopy of Non-Covalent Short Oligonucleotide Barcode Microarrays

PubMed Central

Cook, Michael A.; Chan, Chi-Kin; Jorgensen, Paul; Ketela, Troy; So, Daniel; Tyers, Mike; Ho, Chi-Yip

2008-01-01

Background Molecular barcode arrays provide a powerful means to analyze cellular phenotypes in parallel through detection of short (20–60 base) unique sequence tags, or “barcodes”, associated with each strain or clone in a collection. However, costs of current methods for microarray construction, whether by in situ oligonucleotide synthesis or ex situ coupling of modified oligonucleotides to the slide surface are often prohibitive to large-scale analyses. Methodology/Principal Findings Here we demonstrate that unmodified 20mer oligonucleotide probes printed on conventional surfaces show comparable hybridization signals to covalently linked 5′-amino-modified probes. As a test case, we undertook systematic cell size analysis of the budding yeast Saccharomyces cerevisiae genome-wide deletion collection by size separation of the deletion pool followed by determination of strain abundance in size fractions by barcode arrays. We demonstrate that the properties of a 13K unique feature spotted 20 mer oligonucleotide barcode microarray compare favorably with an analogous covalently-linked oligonucleotide array. Further, cell size profiles obtained with the size selection/barcode array approach recapitulate previous cell size measurements of individual deletion strains. Finally, through atomic force microscopy (AFM), we characterize the mechanism of hybridization to unmodified barcode probes on the slide surface. Conclusions/Significance These studies push the lower limit of probe size in genome-scale unmodified oligonucleotide microarray construction and demonstrate a versatile, cost-effective and reliable method for molecular barcode analysis. PMID:18253494

Effect of competing self-structure on triplex formation with purine-rich oligodeoxynucleotides containing GA repeats.

PubMed Central

Noonberg, S B; François, J C; Garestier, T; Hélène, C

1995-01-01

Competition between triplex formation with double-stranded DNA and oligonucleotide self-association was investigated in 23mer GA and GT oligonucleotides containing d(GA)5 or d(GT)5 repeats. Whereas triplex formation with GT oligonucleotides was diminished when temperature increased from 4 to 37 degrees C, triplex formation with GA oligonucleotides was enhanced when temperature increased within the same range due to the presence of competing intermolecular GA oligonucleotide self-structure. This self-structure was determined to be a homoduplex stabilized by the internal GA repeats. UV spectroscopy of these homoduplexes demonstrated a single sharp transition with rapid kinetics (Tm = 38.5-43.5 degrees C over strand concentrations of 0.5-4 microM, respectively, with transition enthalpy, delta H = -89 +/- 7 kcal/mol) in 10 mM MgCl2, 100 mM NaCl, pH 7.0. Homoduplex formation was strongly stabilized by multivalent cations (spermine > Mg2+ = Ca2+) and destabilized by low concentrations of monovalent cations (K+ = Li+ = Na+) in the presence of divalent cations. However, unlike GA or GT oligonucleotide-containing triplexes, the homoduplex formed even in the absence of multivalent cations, stabilized by only moderate concentrations of monovalent cations (Li+ > Na+ > K+). Through the development of multiple equilibrium states and the resulting depletion of free oligonucleotide, it was found that the presence of competing self-structure could decrease triplex formation under a variety of experimental conditions. Images PMID:7596824

Selective Amplification of SPR Biosensor Signal for Recognition of rpoB Gene Fragments by Use of Gold Nanoparticles Modified by Thiolated DNA

NASA Astrophysics Data System (ADS)

Matsishin, M.; Rachkov, A.; Lopatynskyi, A.; Chegel, V.; Soldatkin, A.; El'skaya, A.

2017-04-01

An experimental approach for improving the sensitivity of the surface plasmon resonance (SPR) DNA hybridization sensor using gold nanoparticles (GNPs), modified by specific oligonucleotides, was elaborated. An influence of the ionic strength on the aggregation stability of unmodified GNPs and GNPs modified by the thiolated oligonucleotides was investigated by monitoring a value of light extinction at 520 nm that can be considered as a measure of a quantity of the non-aggregated GNPs. While the unmodified GNPs started to aggregate in 0.2 × saline-sodium citrate (SSC), GNPs modified by the negatively charged oligonucleotides were more stable at increasing ionic strength up to 0.5 × SSC. A bioselective element of the SPR DNA hybridization sensor was formed by immobilization on the gold sensor surface of the thiolated oligonucleotides P2, the sequence of which is a fragment of the rpoB gene of Mycobacterium tuberculosis. The injections into the measuring flow cell of the SPR spectrometer of various concentrations of GNPs modified by the complementary oligonucleotides T2-18m caused the pronounced concentration-dependent sequence-specific sensor responses. The magnitude of the sensor responses was much higher than in the case of the free standing complementary oligonucleotides. According to the obtained experimental data, the usage of GNPs modified by specific oligonucleotides can amplify the sensor response of the SPR DNA hybridization sensor in 1200 times.

Lipophilic oligonucleotides spontaneously insert into lipid membranes, bind complementary DNA strands, and sequester into lipid-disordered domains.

PubMed

Bunge, Andreas; Kurz, Anke; Windeck, Anne-Kathrin; Korte, Thomas; Flasche, Wolfgang; Liebscher, Jürgen; Herrmann, Andreas; Huster, Daniel

2007-04-10

For the development of surface functionalized bilayers, we have synthesized lipophilic oligonucleotides to combine the molecular recognition mechanism of nucleic acids and the self-assembly characteristics of lipids in planar membranes. A lipophilic oligonucleotide consisting of 21 thymidine units and two lipophilic nucleotides with an alpha-tocopherol moiety as a lipophilic anchor was synthesized using solid-phase methods with a phosphoramadite strategy. The interaction of the water soluble lipophilic oligonucleotide with vesicular lipid membranes and its capability to bind complementary DNA strands was studied using complementary methods such as NMR, EPR, DSC, fluorescence spectroscopy, and fluorescence microscopy. This oligonucleotide inserted stably into preformed membranes from the aqueous phase. Thereby, no significant perturbation of the lipid bilayer and its stability was observed. However, the non-lipidated end of the oligonucleotide is exposed to the aqueous environment, is relatively mobile, and is free to interact with complementary DNA strands. Binding of the complementary single-stranded DNA molecules is fast and accomplished by the formation of Watson-Crick base pairs, which was confirmed by 1H NMR chemical shift analysis and fluorescence resonance energy transfer. The molecular structure of the membrane bound DNA double helix is very similar to the free double-stranded DNA. Further, the membrane bound DNA double strands also undergo regular melting. Finally, in raft-like membrane mixtures, the lipophilic oligonucleotide was shown to preferentially sequester into liquid-disordered membrane domains.

Effect on embryos of injection of phosphorothioate-modified oligonucleotides into pregnant mice.

PubMed

Gaudette, M F; Hampikian, G; Metelev, V; Agrawal, S; Crain, W R

1993-01-01

Phosphorothioate-modified oligonucleotides were injected into pregnant female mice to assess the effect on developing embryos. Injections were carried out during two different time periods, one when embryos were in preimplantation stages of development (about 3.5 days of development) and the other after implantation, when both a fetus and placenta are present (from days 9.5 to 11.5 of development). Three different phosphorothioate-modified oligonucleotides were injected. One, which had a sequence not present in the mouse genome, was used to ask whether nonspecific toxic or teratogenic effects on embryos result from treatment of the mother. A second was complementary to the mRNA of the testis-determining factor gene Sry and was used to ask whether a specific developmental pathway (i.e., sex determination) could be disrupted in embryos in vivo. The third was the complement of the anti-Sry sequence. None of these oligonucleotides reduced the frequency of successful pregnancy after mating or the average litter size from that observed in controls animals. Furthermore, examination of 291 pups or fetuses from all oligonucleotide-injected pregnant females revealed no developmental defects regardless of which sequence was used. It is concluded that injection of phosphorothioate-modified oligonucleotides into pregnant females according to the protocols described here is not toxic or teratogenic to embryos in a nonspecific way. Also, anti-Sry oligonucleotides did not influence sex determination in embryos, although there are several possible explanations for this.

Making parks make a difference: poor alignment of policy, planning and management with protected-area impact, and ways forward

PubMed Central

Pressey, Robert L.; Visconti, Piero; Ferraro, Paul J.

2015-01-01

Policy and practice around protected areas are poorly aligned with the basic purpose of protection, which is to make a difference. The difference made by protected areas is their impact, defined in program evaluation as the outcomes arising from protection relative to the counterfactual of no protection or a different form of protection. Although impact evaluation of programs is well established in fields such as medicine, education and development aid, it is rare in nature conservation. We show that the present weak alignment with impact of policy targets and operational objectives for protected areas involves a great risk: targets and objectives can be achieved while making little difference to the conservation of biodiversity. We also review potential ways of increasing the difference made by protected areas, finding a poor evidence base for the use of planning and management ‘levers’ to better achieve impact. We propose a dual strategy for making protected areas more effective in their basic role of saving nature, outlining ways of developing targets and objectives focused on impact while also improving the evidence for effective planning and management. PMID:26460132

Phylogenetic analyses of the genus Aeromonas based on housekeeping gene sequencing and its influence on systematics.

PubMed

Navarro, Aaron; Martínez-Murcia, Antonio

2018-04-19

The phylogenies derived from housekeeping gene sequence alignments, although mere evolutionary hypotheses, have increased our knowledge about the Aeromonas genetic diversity, providing a robust species delineation framework invaluable for reliable, easy and fast species identification. Previous classifications of Aeromonas, have been fully surpassed by recently developed phylogenetic (natural) classification obtained from the analysis of so-called "molecular chronometers". Despite ribosomal RNAs cannot split all known Aeromonas species, the conserved nature of 16S rRNA offers reliable alignments containing mosaics of sequence signatures which may serve as targets of genus-specific oligonucleotides for subsequent identification/detection tests in samples without culturing. On the contrary, some housekeeping genes coding for proteins show a much better chronometric capacity to discriminate highly related strains. Although both, species and loci, do not all evolve at exactly the same rate, published Aeromonas phylogenies were congruent to each other, indicating that, phylogenetic markers are synchronized and a concatenated multi-gene phylogeny, may be "the mirror" of the entire genomic relationships. Thanks to MLPA approaches, the discovery of new Aeromonas species and strains of rarely isolated species is today more frequent and, consequently, should be extensively promoted for isolate screening and species identification. Although, accumulated data still should be carefully catalogued to inherit a reliable database. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Oligonucleotides Containing Aminated 2'-Amino-LNA Nucleotides: Synthesis and Strong Binding to Complementary DNA and RNA.

PubMed

Lou, Chenguang; Samuelsen, Simone V; Christensen, Niels Johan; Vester, Birte; Wengel, Jesper

2017-04-19

Mono- and diaminated 2'-amino-LNA monomers were synthesized and introduced into oligonucleotides. Each modification imparts significant stabilization of nucleic acid duplexes and triplexes, excellent sequence selectivity, and significant nuclease resistance. Molecular modeling suggested that structural stabilization occurs via intrastrand electrostatic attraction between the protonated amino groups of the aminated 2'-amino-LNA monomers and the host oligonucleotide backbone.

Phosphorothioate oligonucleotides inhibit the intrinsic tenase complex.

PubMed

Sheehan, J P; Lan, H C

1998-09-01

Systemic administration of ISIS 2302, a 20-mer antisense phosphorothioate oligonucleotide targeting human intercellular adhesion molecule-1 mRNA, causes prolongation of plasma clotting times in both monkey and human studies. The anticoagulant effects of ISIS 2302 were investigated with both in vitro coagulation assays in human plasma and purified enzyme systems. At high oligonucleotide plasma concentrations (>100 microgram/mL), prolongation of the prothrombin and thrombin times was observed. In a thrombin time assay using purified components, high concentrations of ISIS 2302 inhibited thrombin clotting activity both by stimulating inhibition by heparin cofactor II and directly competing with fibrinogen for binding to anion binding exosite I. In contrast, low concentrations of ISIS 2302 (<100 microgram/mL) showed a selective, linear prolongation of the activated partial thromboplastin time (PTT). The rate limiting effect of 50 microgram/mL ISIS 2302, which prolonged the PTT to 1.5 times control, was identified by sequential modification of the clotting assay. Delaying addition of oligonucleotide until after contact activation failed to correct prolongation of the PTT. The calcium-dependent steps of the intrinsic pathway were individually assessed by adding sufficient activated coagulation factor to correct the PTT in plasma deficient in that specific factor. Addition of factor XIa, IXa, VIIIa, or Va failed to correct the PTT in the presence of ISIS 2302. In contrast, 0.2 nmol/L factor Xa corrected prolongation of the PTT in factor X-deficient plasma with or without oligonucleotide present. ISIS 2302 (50 microgram/mL) did not prolong a modified Russel viper venom time, suggesting no significant inhibition of prothrombinase. Thus, 50 microgram/mL ISIS 2302 prolonged the PTT by selectively inhibiting intrinsic tenase activity. ISIS 2302 showed partial inhibition of intrinsic tenase activity (to approximately 35% of control) at clinically relevant oligonucleotide concentrations in a chromogenic assay. This activity was oligonucleotide sequence-independent but required the phosphorothioate backbone, suggesting that inhibition of intrinsic tenase is a general property of this class of oligonucleotides. These results are relevant to both the therapeutic use of phosphorothioate oligonucleotides and the potential design of inhibitors of the intrinsic tenase complex, a novel target for anticoagulation. Copyright 1998 by The American Society of Hematology.

Biocompatible artificial DNA linker that is read through by DNA polymerases and is functional in Escherichia coli

PubMed Central

El-Sagheer, Afaf H.; Sanzone, A. Pia; Gao, Rachel; Tavassoli, Ali; Brown, Tom

2011-01-01

A triazole mimic of a DNA phosphodiester linkage has been produced by templated chemical ligation of oligonucleotides functionalized with 5′-azide and 3′-alkyne. The individual azide and alkyne oligonucleotides were synthesized by standard phosphoramidite methods and assembled using a straightforward ligation procedure. This highly efficient chemical equivalent of enzymatic DNA ligation has been used to assemble a 300-mer from three 100-mer oligonucleotides, demonstrating the total chemical synthesis of very long oligonucleotides. The base sequences of the DNA strands containing this artificial linkage were copied during PCR with high fidelity and a gene containing the triazole linker was functional in Escherichia coli. PMID:21709264

Chemoselective covalent coupling of oligonucleotide probes to self-assembled monolayers.

PubMed

Devaraj, Neal K; Miller, Gregory P; Ebina, Wataru; Kakaradov, Boyko; Collman, James P; Kool, Eric T; Chidsey, Christopher E D

2005-06-22

A chemoselective route to routinely and rapidly attach oligonucleotide probes to well-defined surfaces is presented. Cu(I) tris(benzyltriazolylmethyl)amine-catalyzed coupling of terminal acetylenes to azides on a self-assembled monolayer is used instead of traditional nucleophilic-electrophilic coupling reactions. The reaction proceeds well even in the presence of purposely introduced nucleophilic and electrophilic impurities. The density of oligonucleotide probes can be controlled by controlling the amount of azide functionality. Although most of our work was done on gold surfaces, this technique should be readily applicable to any surface on which an azide-containing monolayer can be assembled as we have preliminarily demonstrated by derivatizing azidotrimethoxysilane-modified glass slides with fluorescein-containing oligonucleotides.

A statistical learning approach to the modeling of chromatographic retention of oligonucleotides incorporating sequence and secondary structure data

PubMed Central

Sturm, Marc; Quinten, Sascha; Huber, Christian G.; Kohlbacher, Oliver

2007-01-01

We propose a new model for predicting the retention time of oligonucleotides. The model is based on ν support vector regression using features derived from base sequence and predicted secondary structure of oligonucleotides. Because of the secondary structure information, the model is applicable even at relatively low temperatures where the secondary structure is not suppressed by thermal denaturing. This makes the prediction of oligonucleotide retention time for arbitrary temperatures possible, provided that the target temperature lies within the temperature range of the training data. We describe different possibilities of feature calculation from base sequence and secondary structure, present the results and compare our model to existing models. PMID:17567619

Cellular Internalization of Therapeutic Oligonucleotides by Peptide Amphiphile Nanofibers and Nanospheres.

PubMed

Mumcuoglu, Didem; Sardan Ekiz, Melis; Gunay, Gokhan; Tekinay, Turgay; Tekinay, Ayse B; Guler, Mustafa O

2016-05-11

Oligonucleotides are promising drug candidates due to the exceptionally high specificity they exhibit toward their target DNA and RNA sequences. However, their poor pharmacokinetic and pharmacodynamic properties, in conjunction with problems associated with their internalization by cells, necessitates their delivery through specialized carrier systems for efficient therapy. Here, we investigate the effects of carrier morphology on the cellular internalization mechanisms of oligonucleotides by using self-assembled fibrous or spherical peptide nanostructures. Size and geometry were both found to be important parameters for the oligonucleotide internalization process; direct penetration was determined to be the major mechanism for the internalization of nanosphere carriers, whereas nanofibers were internalized by clathrin- and dynamin-dependent endocytosis pathways. We further showed that glucose conjugation to carrier nanosystems improved cellular internalization in cancer cells due to the enhanced glucose metabolism associated with oncogenesis, and the internalization of the glucose-conjugated peptide/oligonucleotide complexes was found to be dependent on glucose transporters present on the surface of the cell membrane.

A facile inhibitor screening of SARS coronavirus N protein using nanoparticle-based RNA oligonucleotide.

PubMed

Roh, Changhyun

2012-01-01

Hundreds of million people worldwide have been infected with severe acute respiratory syndrome (SARS), and the rate of global death from SARS has remarkably increased. Hence, the development of efficient drug treatments for the biological effects of SARS is highly needed. We have previously shown that quantum dots (QDs)-conjugated RNA oligonucleotide is sensitive to the specific recognition of the SARS-associated coronavirus (SARS-CoV) nucleocapsid (N) protein. In this study, we found that a designed biochip could analyze inhibitors of the SARS-CoV N protein using nanoparticle-based RNA oligonucleotide. Among the polyphenolic compounds examined, (-)-catechin gallate and (-)-gallocatechin gallate demonstrated a remarkable inhibition activity on SARS-CoV N protein. (-)-catechin gallate and (-)-gallocatechin gallate attenuated the binding affinity in a concentrated manner as evidenced by QDs-conjugated RNA oligonucleotide on a designed biochip. At a concentration of 0.05 μg mL(-1), (-)-catechin gallate and (-)-gallocatechin gallate showed more than 40% inhibition activity on a nanoparticle-based RNA oligonucleotide biochip system.

Methods of DNA sequencing by hybridization based on optimizing concentration of matrix-bound oligonucleotide and device for carrying out same

DOEpatents

Khrapko, Konstantin R [Moscow, RU; Khorlin, Alexandr A [Moscow, RU; Ivanov, Igor B [Moskovskaya, RU; Ershov, Gennady M [Moscow, RU; Lysov, Jury P [Moscow, RU; Florentiev, Vladimir L [Moscow, RU; Mirzabekov, Andrei D [Moscow, RU

1996-09-03

A method for sequencing DNA by hybridization that includes the following steps: forming an array of oligonucleotides at such concentrations that either ensure the same dissociation temperature for all fully complementary duplexes or allows hybridization and washing of such duplexes to be conducted at the same temperature; hybridizing said oligonucleotide array with labeled test DNA; washing in duplex dissociation conditions; identifying single-base substitutions in the test DNA by analyzing the distribution of the dissociation temperatures and reconstructing the DNA nucleotide sequence based on the above analysis. A device for carrying out the method comprises a solid substrate and a matrix rigidly bound to the substrate. The matrix contains the oligonucleotide array and consists of a multiplicity of gel portions. Each gel portion contains one oligonucleotide of desired length. The gel portions are separated from one another by interstices and have a thickness not exceeding 30 .mu.m.

Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis.

PubMed

Kalendar, Ruslan; Lee, David; Schulman, Alan H

2011-08-01

The polymerase chain reaction is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. We have developed and tested efficient tools for PCR primer and probe design, which also predict oligonucleotide properties based on experimental studies of PCR efficiency. The tools provide comprehensive facilities for designing primers for most PCR applications and their combinations, including standard, multiplex, long-distance, inverse, real-time, unique, group-specific, bisulphite modification assays, Overlap-Extension PCR Multi-Fragment Assembly, as well as a programme to design oligonucleotide sets for long sequence assembly by ligase chain reaction. The in silico PCR primer or probe search includes comprehensive analyses of individual primers and primer pairs. It calculates the melting temperature for standard and degenerate oligonucleotides including LNA and other modifications, provides analyses for a set of primers with prediction of oligonucleotide properties, dimer and G-quadruplex detection, linguistic complexity, and provides a dilution and resuspension calculator. Copyright © 2011 Elsevier Inc. All rights reserved.

Antisense phosphorothioate oligonucleotides: selective killing of the intracellular parasite Leishmania amazonensis.

PubMed

Ramazeilles, C; Mishra, R K; Moreau, S; Pascolo, E; Toulmé, J J

1994-08-16

We targeted the mini-exon sequence, present at the 5' end of every mRNA of the protozoan parasite Leishmania amazonensis, by phosphorothioate oligonucleotides. A complementary 16-mer (16PS) was able to kill amastigotes--the intracellular stage of the parasite--in murine macrophages in culture. After 24 hr of incubation with 10 microM 16PS, about 30% infected macrophages were cured. The oligomer 16PS acted through antisense hybridization in a sequence-dependent way; no effect on parasites was observed with noncomplementary phosphorothioate oligonucleotides. The antisense oligonucleotide 16PS was a selective killer of the protozoans without any detrimental effect to the host macrophage. Using 16PS linked to a palmitate chain, which enabled it to complex with low density lipoproteins, improved the leishmanicidal efficiency on intracellular amastigotes, probably due to increased endocytosis. Phosphorothioate oligonucleotides complementary to the intron part of the mini-exon pre-RNA were also effective, suggesting that antisense oligomers could prevent trans-splicing in these parasites.

Incorporation of an aldehyde function in oligonucleotides.

PubMed

Tilquin, J M; Dechamps, M; Sonveaux, E

2001-01-01

A nucleotide-like phosphoramidite building block that has the nucleic base replaced by the tert-butyldimethylsilyl-protected styrene glycol was synthesized. After the automatic synthesis of an oligonucleotide incorporating this synthon, the benzaldehyde function was generated by fluoride deprotection and oxidation by sodium periodate. In a similar manner, an oligonucleotide where a nucleic base was replaced by the (CH2)8CH=O chain was synthesized and conjugated with biotin derivatives.

Efficient self-assembly of DNA-functionalized fluorophores and gold nanoparticles with DNA functionalized silicon surfaces: the effect of oligomer spacers

PubMed Central

Milton, James A.; Patole, Samson; Yin, Huabing; Xiao, Qiang; Brown, Tom; Melvin, Tracy

2013-01-01

Although strategies for the immobilization of DNA oligonucleotides onto surfaces for bioanalytical and top-down bio-inspired nanobiofabrication approaches are well developed, the effect of introducing spacer molecules between the surface and the DNA oligonucleotide for the hybridization of nanoparticle–DNA conjugates has not been previously assessed in a quantitative manner. The hybridization efficiency of DNA oligonucleotides end-labelled with gold nanoparticles (1.4 or 10 nm diameter) with DNA sequences conjugated to silicon surfaces via hexaethylene glycol phosphate diester oligomer spacers (0, 1, 2, 6 oligomers) was found to be independent of spacer length. To quantify both the density of DNA strands attached to the surfaces and hybridization with the surface-attached DNA, new methodologies have been developed. Firstly, a simple approach based on fluorescence has been developed for determination of the immobilization density of DNA oligonucleotides. Secondly, an approach using mass spectrometry has been created to establish (i) the mean number of DNA oligonucleotides attached to the gold nanoparticles and (ii) the hybridization density of nanoparticle–oligonucleotide conjugates with the silicon surface–attached complementary sequence. These methods and results will be useful for application with nanosensors, the self-assembly of nanoelectronic devices and the attachment of nanoparticles to biomolecules for single-molecule biophysical studies. PMID:23361467

A Novel Bioinformatics Strategy to Analyze Microbial Big Sequence Data for Efficient Knowledge Discovery: Batch-Learning Self-Organizing Map (BLSOM).

PubMed

Iwasaki, Yuki; Abe, Takashi; Wada, Kennosuke; Wada, Yoshiko; Ikemura, Toshimichi

2013-11-20

With the remarkable increase of genomic sequence data of microorganisms, novel tools are needed for comprehensive analyses of the big sequence data available. The self-organizing map (SOM) is an effective tool for clustering and visualizing high-dimensional data, such as oligonucleotide composition on one map. By modifying the conventional SOM, we developed batch-learning SOM (BLSOM), which allowed classification of sequence fragments (e.g., 1 kb) according to phylotypes, solely depending on oligonucleotide composition. Metagenomics studies of uncultivable microorganisms in clinical and environmental samples should allow extensive surveys of genes important in life sciences. BLSOM is most suitable for phylogenetic assignment of metagenomic sequences, because fragmental sequences can be clustered according to phylotypes, solely depending on oligonucleotide composition. We first constructed oligonucleotide BLSOMs for all available sequences from genomes of known species, and by mapping metagenomic sequences on these large-scale BLSOMs, we can predict phylotypes of individual metagenomic sequences, revealing a microbial community structure of uncultured microorganisms, including viruses. BLSOM has shown that influenza viruses isolated from humans and birds clearly differ in oligonucleotide composition. Based on this host-dependent oligonucleotide composition, we have proposed strategies for predicting directional changes of virus sequences and for surveilling potentially hazardous strains when introduced into humans from non-human sources.

Oligonucleotide-arrayed TFT photosensor applicable for DNA chip technology.

PubMed

Tanaka, Tsuyoshi; Hatakeyama, Keiichi; Sawaguchi, Masahiro; Iwadate, Akihito; Mizutani, Yasushi; Sasaki, Kazuhiro; Tateishi, Naofumi; Takeyama, Haruko; Matsunaga, Tadashi

2006-09-05

A thin film transistor (TFT) photosensor fabricated by semiconductor integrated circuit (IC) technology was applied to DNA chip technology. The surface of the TFT photosensor was coated with TiO2 using a vapor deposition technique for the fabrication of optical filters. The immobilization of thiolated oligonucleotide probes onto a TiO2-coated TFT photosensor using gamma-aminopropyltriethoxysilane (APTES) and N-(gamma-maleimidobutyloxy) sulfosuccinimide ester (GMBS) was optimized. The coverage value of immobilized oligonucleotides reached a plateau at 33.7 pmol/cm2, which was similar to a previous analysis using radioisotope-labeled oligonucleotides. The lowest detection limits were 0.05 pmol/cm2 for quantum dot and 2.1 pmol/cm2 for Alexa Fluor 350. Furthermore, single nucleotide polymorphism (SNP) detection was examined using the oligonucleotide-arrayed TFT photosensor. A SNP present in the aldehyde dehydrogenase 2 (ALDH2) gene was used as a target. The SNPs in ALDH2*1 and ALDH2*2 target DNA were detected successfully using the TFT photosensor. DNA hybridization in the presence of both ALDH2*1 and ALDH2*2 target DNA was observed using both ALDH2*1 and ALDH2*2 detection oligonucleotides-arrayed TFT photosensor. Use of the TFT photosensor will allow the development of a disposable photodetecting device for DNA chip systems. (c) 2006 Wiley Periodicals, Inc.

Applied Problems and Use of Technology in an Aligned Way in Basic Courses in Probability and Statistics for Engineering Students--A Way to Enhance Understanding and Increase Motivation

ERIC Educational Resources Information Center

Zetterqvist, Lena

2017-01-01

Researchers and teachers often recommend motivating exercises and use of mathematics or statistics software for the teaching of basic courses in probability and statistics. Our courses are given to large groups of engineering students at Lund Institute of Technology. We found that the mere existence of real-life data and technology in a course…

Charge-induced geometrical reorganization of DNA oligonucleotides studied by tandem mass spectrometry and ion mobility.

PubMed

Ickert, Stefanie; Hofmann, Johanna; Riedel, Jens; Beck, Sebastian; Pagel, Kevin; Linscheid, Michael W

2018-04-01

Mass spectrometry is applied as a tool for the elucidation of molecular structures. This premises that gas-phase structures reflect the original geometry of the analytes, while it requires a thorough understanding and investigation of the forces controlling and affecting the gas-phase structures. However, only little is known about conformational changes of oligonucleotides in the gas phase. In this study, a series of multiply charged DNA oligonucleotides (n = 15-40) has been subjected to a comprehensive tandem mass spectrometric study to unravel transitions between different ionic gas-phase structures. The nucleobase sequence and the chain length were varied to gain insights into their influence on the geometrical oligonucleotide organization. Altogether, 23 oligonucleotides were analyzed using collision-induced fragmentation. All sequences showed comparable correlation regarding the characteristic collision energy. This value that is also a measure for stability, strongly correlates with the net charge density of the precursor ions. With decreasing charge of the oligonucleotides, an increase in the fragmentation energy was observed. At a distinct charge density, a deviation from linearity was observed for all studied species, indicating a structural reorganization. To corroborate the proposed geometrical change, collisional cross-sections of the oligonucleotides at different charge states were determined using ion mobility-mass spectrometry. The results clearly indicate that an increase in charge density and thus Coulomb repulsion results in the transition from a folded, compact form to elongated structures of the precursor ions. Our data show this structural transition to depend mainly on the charge density, whereas sequence and size do not have an influence.

Oligonucleotide arrays vs. metaphase-comparative genomic hybridisation and BAC arrays for single-cell analysis: first applications to preimplantation genetic diagnosis for Robertsonian translocation carriers.

PubMed

Ramos, Laia; del Rey, Javier; Daina, Gemma; García-Aragonés, Manel; Armengol, Lluís; Fernandez-Encinas, Alba; Parriego, Mònica; Boada, Montserrat; Martinez-Passarell, Olga; Martorell, Maria Rosa; Casagran, Oriol; Benet, Jordi; Navarro, Joaquima

2014-01-01

Comprehensive chromosome analysis techniques such as metaphase-Comparative Genomic Hybridisation (CGH) and array-CGH are available for single-cell analysis. However, while metaphase-CGH and BAC array-CGH have been widely used for Preimplantation Genetic Diagnosis, oligonucleotide array-CGH has not been used in an extensive way. A comparison between oligonucleotide array-CGH and metaphase-CGH has been performed analysing 15 single fibroblasts from aneuploid cell-lines and 18 single blastomeres from human cleavage-stage embryos. Afterwards, oligonucleotide array-CGH and BAC array-CGH were also compared analysing 16 single blastomeres from human cleavage-stage embryos. All three comprehensive analysis techniques provided broadly similar cytogenetic profiles; however, non-identical profiles appeared when extensive aneuploidies were present in a cell. Both array techniques provided an optimised analysis procedure and a higher resolution than metaphase-CGH. Moreover, oligonucleotide array-CGH was able to define extra segmental imbalances in 14.7% of the blastomeres and it better determined the specific unbalanced chromosome regions due to a higher resolution of the technique (≈ 20 kb). Applicability of oligonucleotide array-CGH for Preimplantation Genetic Diagnosis has been demonstrated in two cases of Robertsonian translocation carriers 45,XY,der(13;14)(q10;q10). Transfer of euploid embryos was performed in both cases and pregnancy was achieved by one of the couples. This is the first time that an oligonucleotide array-CGH approach has been successfully applied to Preimplantation Genetic Diagnosis for balanced chromosome rearrangement carriers.

Oligonucleotide Arrays vs. Metaphase-Comparative Genomic Hybridisation and BAC Arrays for Single-Cell Analysis: First Applications to Preimplantation Genetic Diagnosis for Robertsonian Translocation Carriers

PubMed Central

Ramos, Laia; del Rey, Javier; Daina, Gemma; García-Aragonés, Manel; Armengol, Lluís; Fernandez-Encinas, Alba; Parriego, Mònica; Boada, Montserrat; Martinez-Passarell, Olga; Martorell, Maria Rosa; Casagran, Oriol; Benet, Jordi; Navarro, Joaquima

2014-01-01

Comprehensive chromosome analysis techniques such as metaphase-Comparative Genomic Hybridisation (CGH) and array-CGH are available for single-cell analysis. However, while metaphase-CGH and BAC array-CGH have been widely used for Preimplantation Genetic Diagnosis, oligonucleotide array-CGH has not been used in an extensive way. A comparison between oligonucleotide array-CGH and metaphase-CGH has been performed analysing 15 single fibroblasts from aneuploid cell-lines and 18 single blastomeres from human cleavage-stage embryos. Afterwards, oligonucleotide array-CGH and BAC array-CGH were also compared analysing 16 single blastomeres from human cleavage-stage embryos. All three comprehensive analysis techniques provided broadly similar cytogenetic profiles; however, non-identical profiles appeared when extensive aneuploidies were present in a cell. Both array techniques provided an optimised analysis procedure and a higher resolution than metaphase-CGH. Moreover, oligonucleotide array-CGH was able to define extra segmental imbalances in 14.7% of the blastomeres and it better determined the specific unbalanced chromosome regions due to a higher resolution of the technique (≈20 kb). Applicability of oligonucleotide array-CGH for Preimplantation Genetic Diagnosis has been demonstrated in two cases of Robertsonian translocation carriers 45,XY,der(13;14)(q10;q10). Transfer of euploid embryos was performed in both cases and pregnancy was achieved by one of the couples. This is the first time that an oligonucleotide array-CGH approach has been successfully applied to Preimplantation Genetic Diagnosis for balanced chromosome rearrangement carriers. PMID:25415307

Desulfurization of phosphorothioate oligonucleotides via the sulfur-by-oxygen replacement induced by the hydroxyl radical during negative electrospray ionization mass spectrometry.

PubMed

Wu, Lianming; White, David E; Ye, Connie; Vogt, Frederick G; Terfloth, Gerald J; Matsuhashi, Hayao

2012-07-01

While the occurrence of desulfurization of phosphorothioate oligonucleotides in solution is well established, this study represents the first attempt to investigate the basis of the unexpected desulfurization via the net sulfur-by-oxygen (S-O) replacement during negative electrospray ionization (ESI). The current work, facilitated by quantitative mass deconvolution, demonstrates that considerable desulfurization can take place even under common negative ESI operating conditions. The extent of desulfurization is dependent on the molar phosphorothioate oligonucleotide-to-hydroxyl radical ratio, which is consistent with the corona discharge-induced origin of the hydroxyl radical leading to the S-O replacement. This hypothesis is supported by the fact that an increase of the high-performance liquid chromatography (HPLC) flow rate and the on-column concentration of a phosphorothioate oligonucleotide, as well as a decrease of the electrospray voltage reduce the degree of desulfurization. Comparative LC-tandem mass spectrometry (MS/MS) sequencing of a phosphorothioate oligonucleotide and its corresponding desulfurization product revealed evidence that the S-O replacement occurs at multiple phosphorothioate internucleotide linkage sites. In practice, the most convenient and effective strategy for minimizing this P = O artifact is to increase the LC flow rate and the on-column concentration of phosphorothioate oligonucleotides. Another approach to mitigate possible detrimental effects of the undesired desulfurization is to operate the ESI source at a very low electrospray voltage to diminish the corona discharge; however this will significantly compromise sensitivity when analyzing the low-level P = O impurities in phosphorothioate oligonucleotides. Copyright © 2012 John Wiley & Sons, Ltd.

Mapping of RNA accessible sites by extension of random oligonucleotide libraries with reverse transcriptase.

PubMed Central

Allawi, H T; Dong, F; Ip, H S; Neri, B P; Lyamichev, V I

2001-01-01

A rapid and simple method for determining accessible sites in RNA that is independent of the length of target RNA and does not require RNA labeling is described. In this method, target RNA is allowed to hybridize with sequence-randomized libraries of DNA oligonucleotides linked to a common tag sequence at their 5'-end. Annealed oligonucleotides are extended with reverse transcriptase and the extended products are then amplified by using PCR with a primer corresponding to the tag sequence and a second primer specific to the target RNA sequence. We used the combination of both the lengths of the RT-PCR products and the location of the binding site of the RNA-specific primer to determine which regions of the RNA molecules were RNA extendible sites, that is, sites available for oligonucleotide binding and extension. We then employed this reverse transcription with the random oligonucleotide libraries (RT-ROL) method to determine the accessible sites on four mRNA targets, human activated ras (ha-ras), human intercellular adhesion molecule-1 (ICAM-1), rabbit beta-globin, and human interferon-gamma (IFN-gamma). Our results were concordant with those of other researchers who had used RNase H cleavage or hybridization with arrays of oligonucleotides to identify accessible sites on some of these targets. Further, we found good correlation between sites when we compared the location of extendible sites identified by RT-ROL with hybridization sites of effective antisense oligonucleotides on ICAM-1 mRNA in antisense inhibition studies. Finally, we discuss the relationship between RNA extendible sites and RNA accessibility. PMID:11233988

A sense oligonucleotide to inducible nitric oxide synthase mRNA increases the survival rate of rats in septic shock.

PubMed

Okuyama, Tetsuya; Nakatake, Richi; Kaibori, Masaki; Okumura, Tadayoshi; Kon, Masanori; Nishizawa, Mikio

2018-01-30

Natural antisense transcripts (asRNAs) that do not encode proteins are transcribed from rat, mouse, and human genes, encoding inducible nitric oxide synthase (iNOS), which catalyzes the production of the inflammatory mediator nitric oxide (NO). In septic shock, NO is excessively produced in hepatocytes and macrophages. The iNOS asRNA interacts with and stabilizes iNOS mRNA. We found that single-stranded 'sense' oligonucleotides corresponding to the iNOS mRNA sequence reduced iNOS mRNA levels by interfering with the mRNA-asRNA interactions in rat hepatocytes. The iNOS sense oligonucleotides that were substituted with phosphorothioate bonds and locked nucleic acids efficiently decreased the levels of iNOS mRNA and iNOS protein. In this study, the gene expression patterns in the livers of two endotoxemia model rats with acute liver failure were compared. Next, we optimized the sequence and modification of the iNOS sense oligonucleotides in interleukin 1β-treated rat hepatocytes. When a sense oligonucleotide was simultaneously administered with d-galactosamine and bacterial lipopolysaccharide (LPS) to rats, their survival rate significantly increased compared to the rats administered d-galactosamine and LPS alone. In the livers of the sense oligonucleotide-administered rats, apoptosis in the hepatocytes markedly decreased. These results suggest that natural antisense transcript-targeted regulation technology using iNOS sense oligonucleotides may be used to treat human inflammatory diseases, such as sepsis and septic shock. Copyright © 2017 Elsevier Inc. All rights reserved.

DETECTING LOW-LEVEL SYNTHESIS IMPURITIES IN MODIFIED PHOSPHOROTHIOATE OLIGONUCLEOTIDES USING LIQUID CHROMATOGRAPHY – HIGH RESOLUTION MASS SPECTROMETRY

PubMed Central

Nikcevic, Irena; Wyrzykiewicz, Tadeusz K.; Limbach, Patrick A.

2010-01-01

Summary An LC-MS method based on the use of high resolution Fourier transform ion cyclotron resonance mass spectrometry (FTIRCMS) for profiling oligonucleotides synthesis impurities is described. Oligonucleotide phosphorothioatediesters (phosphorothioate oligonucleotides), in which one of the non-bridging oxygen atoms at each phosphorus center is replaced by a sulfur atom, are now one of the most popular oligonucleotide modifications due to their ease of chemical synthesis and advantageous pharmacokinetic properties. Despite significant progress in the solid-phase oligomerization chemistry used in the manufacturing of these oligonucleotides, multiple classes of low-level impurities always accompany synthetic oligonucleotides. Liquid chromatography-mass spectrometry has emerged as a powerful technique for the identification of these synthesis impurities. However, impurity profiling, where the entire complement of low-level synthetic impurities is identified in a single analysis, is more challenging. Here we present an LC-MS method based the use of high resolution-mass spectrometry, specifically Fourier transform ion cyclotron resonance mass spectrometry (FTIRCMS or FTMS). The optimal LC-FTMS conditions, including the stationary phase and mobile phases for the separation and identification of phosphorothioate oligonucleotides, were found. The characteristics of FTMS enable charge state determination from single m/z values of low-level impurities. Charge state information then enables more accurate modeling of the detected isotopic distribution for identification of the chemical composition of the detected impurity. Using this approach, a number of phosphorothioate impurities can be detected by LC-FTMS including failure sequences carrying 3′-terminal phosphate monoester and 3′-terminal phosphorothioate monoester, incomplete backbone sulfurization and desulfurization products, high molecular weight impurities, and chloral, isobutyryl, and N3 (2-cyanoethyl) adducts of the full length product. When compared with low resolution LC-MS, ~60% more impurities can be identified when charge state and isotopic distribution information is available and used for impurity profiling. PMID:21811394

Biominetic High Density Lipoproteins for the Delivery of Therapeutic Oligonucleotides

NASA Astrophysics Data System (ADS)

Tripathy, Sushant

Advances in nanotechnology have brought about novel inorganic and hybrid nanoparticles with unique physico-chemical properties that make them suitable for a broad range of applications---from nano-circuitry to drug delivery. A significant part of those advancements have led to ground-breaking discoveries that have changed the approaches to formulation of therapeutics against diseases, such as cancer. Now-a-days the focus does not lie solely on finding a candidate small-molecule therapeutic with minimal adverse effects, but researchers are looking up to nanoparticles to improve biodistribution and biocompatibility profile of clinically proven therapeutics. The plethora of conjugation chemistries offered by currently extant inorganic nanoparticles have, in recent years, led to great leaps in the field of biomimicry---a modality that promises high biocompatibility. Further, in the pursuit of highly specific therapeutic molecules, researchers have turned to silencing oligonucleotides and some have already brought together the strengths of nanoparticles and silencing oligonucleotides in search of an efficacious therapy for cancer with minimal adverse effects. This dissertation work focuses on such a biomimetic platform---a gold nanoparticle based high density lipoprotein biomimetic (HDL NP), for the delivery of therapeutic oligonucleotides. The first chapter of this body of work introduces the molecular target of the silencing oligonucleotides---VEGFR2, and its role in the progression of solid tumor cancers. The background information also covers important aspects of natural high density lipoproteins (HDL), especially their innate capacity to bind and deliver exogenous and endogenous silencing oligonucleotides to tissues that express their high affinity receptor SRB1. We subsequently describe the synthesis of the biomimetic HDL NP and its oligonucleotide conjugates, and establish their biocompatibility. Further on, experimental data demonstrate the efficacy of silencing oligonucleotides conjugated HDL NPs in regulating the expression and function of VEGFR2 in cultured endothelial cells. Finally, the efficacy of the conjugates in two animal models of angiogenesis is presented.

‘Protected DNA Probes’ capable of strong hybridization without removal of base protecting groups

PubMed Central

Ohkubo, Akihiro; Kasuya, Rintaro; Sakamoto, Kazushi; Miyata, Kenichi; Taguchi, Haruhiko; Nagasawa, Hiroshi; Tsukahara, Toshifumi; Watanobe, Takuma; Maki, Yoshiyuki; Seio, Kohji; Sekine, Mitsuo

2008-01-01

We propose a new strategy called the ‘Protected DNA Probes (PDP) method’ in which appropriately protected bases selectively bind to the complementary bases without the removal of their base protecting groups. Previously, we reported that 4-N-acetylcytosine oligonucleotides (ac4C) exhibited a higher hybridization affinity for ssDNA than the unmodified oligonucleotides. For the PDP strategy, we created a modified adenine base and synthesized an N-acylated deoxyadenosine mimic having 6-N-acetyl-8-aza-7-deazaadenine (ac6az8c7A). It was found that PDP containing ac4C and ac6az8c7A exhibited higher affinity for the complementary ssDNA than the corresponding unmodified DNA probes and showed similar base recognition ability. Moreover, it should be noted that this PDP strategy could guarantee highly efficient synthesis of DNA probes on controlled pore glass (CPG) with high purity and thereby could eliminate the time-consuming procedures for isolating DNA probes. This strategy could also avoid undesired base-mediated elimination of DNA probes from CPG under basic conditions such as concentrated ammonia solution prescribed for removal of base protecting groups in the previous standard approach. Here, several successful applications of this strategy to single nucleotide polymorphism detection are also described in detail using PDPs immobilized on glass plates and those prepared on CPG plates, suggesting its potential usefulness. PMID:18272535

Angiogenesis alteration by defibrotide: implications for its mechanism of action in severe hepatic veno-occlusive disease.

PubMed

Benimetskaya, Luba; Wu, Sijian; Voskresenskiy, Anatoliy M; Echart, Cinara; Zhou, Jin-Feng; Shin, Joongho; Iacobelli, Massimo; Richardson, Paul; Ayyanar, Kanyalakshmi; Stein, C A

2008-11-15

Defibrotide (DF) is a mixture of porcine-derived single-stranded phosphodiester oligonucleotides (9-80-mer; average, 50-mer) that has been successfully used to treat severe hepatic veno-occlusive disease (sVOD) with multiorgan failure (MOF) in patients who have received cytotoxic chemotherapy in preparation for bone marrow transplantation. However, its mechanism of action is unknown. Herein, we show that DF and phosphodiester oligonucleotides can bind to heparin-binding proteins (eg, basic fibroblast growth factor [bFGF] but not vascular endothelial growth factor [VEGF] 165) with low nanomolar affinity. This binding occurred in a length- and concentration-dependent manner. DF can mobilize proangiogenic factors such as bFGF from their depot or storage sites on bovine corneal endothelial matrix. However, these molecules do not interfere with high-affinity binding of bFGF to FGFR1 IIIc but can replace heparin as a required cofactor for binding and hence cellular mitogenesis. DF also protects bFGF against digestion by trypsin and chymotrypsin and from air oxidation. In addition, DF binds to collagen I with low nanomolar affinity and can promote human microvascular endothelial cell-1 (HMEC-1) cell mitogenesis and tubular morphogenesis in three-dimensional collagen I gels. Thus, our data suggest that DF may provide a stimulus to the sinusoidal endothelium of a liver that has suffered a severe angiotoxic event, thus helping to ameliorate the clinical sVOD/MOF syndrome.

Ultrasensitive Label-free Electronic Chip for DNA Analysis Using Carbon Nanotube Nanoelectrode Arrays

NASA Technical Reports Server (NTRS)

Li, Jun; Koehne, Jessica; Chen, Hua; Cassell, Alan; Ng, Hou Tee; Ye, Qi; Han, Jie; Meyyappan, M.

2004-01-01

There is a strong need for faster, cheaper, and simpler methods for nucleic acid analysis in today s clinical tests. Nanotechnologies can potentially provide solutions to these requirements by integrating nanomaterials with biofunctionalities. Dramatic improvement in the sensitivity and multiplexing can be achieved through the high-degree miniaturization. Here, we present our study in the development of an ultrasensitive label-free electronic chip for DNA/RNA analysis based on carbon nanotube nanoelectrode arrays. A reliable nanoelectrode array based on vertically aligned multi-walled carbon nanotubes (MWNTs) embedded in a SiO2 matrix is fabricated using a bottom-up approach. Characteristic nanoelectrode behavior is observed with a low-density MWNT nanoelectrode array in measuring both the bulk and surface immobilized redox species. The open-end of MWNTs are found to present similar properties as graphite edge-plane electrodes, with a wide potential window, flexible chemical functionalities, and good biocompatibility. A BRCA1 related oligonucleotide probe with 18 bases is covalently functionalized at the open ends of the MWNTs and specifically hybridized with an oligonucleotide target as well as a PCR amplicon. The guanine bases in the target molecules are employed as the signal moieties for the electrochemical measurements. Ru(bpy)3(2+) mediator is used to further amplify the guanine oxidation signal. This technique has been employed for direct electrochemical detection of label-free PCR amplicon through specific hybridization with the BRCAl probe. The detection limit is estimated to be less than approximately 1000 DNA molecules, approaching the limit of the sensitivity by laser-based fluorescence techniques in DNA microarray. This system provides a general electronic platform for rapid molecular diagnostics in applications requiring ultrahigh sensitivity, high-degree of miniaturization, simple sample preparation, and low- cost operation.

AntiClustal: Multiple Sequence Alignment by antipole clustering and linear approximate 1-median computation.

PubMed

Di Pietro, C; Di Pietro, V; Emmanuele, G; Ferro, A; Maugeri, T; Modica, E; Pigola, G; Pulvirenti, A; Purrello, M; Ragusa, M; Scalia, M; Shasha, D; Travali, S; Zimmitti, V

2003-01-01

In this paper we present a new Multiple Sequence Alignment (MSA) algorithm called AntiClusAl. The method makes use of the commonly use idea of aligning homologous sequences belonging to classes generated by some clustering algorithm, and then continue the alignment process ina bottom-up way along a suitable tree structure. The final result is then read at the root of the tree. Multiple sequence alignment in each cluster makes use of the progressive alignment with the 1-median (center) of the cluster. The 1-median of set S of sequences is the element of S which minimizes the average distance from any other sequence in S. Its exact computation requires quadratic time. The basic idea of our proposed algorithm is to make use of a simple and natural algorithmic technique based on randomized tournaments which has been successfully applied to large size search problems in general metric spaces. In particular a clustering algorithm called Antipole tree and an approximate linear 1-median computation are used. Our algorithm compared with Clustal W, a widely used tool to MSA, shows a better running time results with fully comparable alignment quality. A successful biological application showing high aminoacid conservation during evolution of Xenopus laevis SOD2 is also cited.

A CpG Oligonucleotide Can Protect Mice From a Low Aerosol Challenge Dose of Burkholderia mallei

DTIC Science & Technology

2006-03-01

may protect victims of a biological attack from glanders . Burkholderia mallei , the causative agent of glanders , natu- rally infects equines, but it can...attack from glanders . 15. SUBJECT TERMS Burkholderia mallei , glanders , oligonucleotides, CpG motif, efficacy, laboratory animals, mice 16...Society for Microbiology. All Rights Reserved. A CpG Oligonucleotide Can Protect Mice from a Low Aerosol Challenge Dose of Burkholderia mallei David M

Fluorescence energy transfer as a probe for nucleic acid structures and sequences.

PubMed Central

Mergny, J L; Boutorine, A S; Garestier, T; Belloc, F; Rougée, M; Bulychev, N V; Koshkin, A A; Bourson, J; Lebedev, A V; Valeur, B

1994-01-01

The primary or secondary structure of single-stranded nucleic acids has been investigated with fluorescent oligonucleotides, i.e., oligonucleotides covalently linked to a fluorescent dye. Five different chromophores were used: 2-methoxy-6-chloro-9-amino-acridine, coumarin 500, fluorescein, rhodamine and ethidium. The chemical synthesis of derivatized oligonucleotides is described. Hybridization of two fluorescent oligonucleotides to adjacent nucleic acid sequences led to fluorescence excitation energy transfer between the donor and the acceptor dyes. This phenomenon was used to probe primary and secondary structures of DNA fragments and the orientation of oligodeoxynucleotides synthesized with the alpha-anomers of nucleoside units. Fluorescence energy transfer can be used to reveal the formation of hairpin structures and the translocation of genes between two chromosomes. PMID:8152922

[Oligonucleotide derivatives in the nucleic acid hybridization analysis. III. Synthesis and investigation of properties of oligonucleotides, bearing bifunctional non-nucleotide insert].

PubMed

Kupriushkin, M S; Pyshnyĭ, D V

2012-01-01

Non-nucleotide phosporamidites were synthetized, having branched backbone with different position of functional groups. Obtained phosphoramidite monomers contain intercalator moiety--6-chloro-2-methoxyacridine, and additional hydroxyl residue protected with dimethoxytrityl group or with tert-butyldimethylsilyl group for post-synthetic modification. Synthesized oligothymidilates contain one or more modified units in different positions of sequence. Melting temperature and thermodynamic parameters of formation of complementary duplexes formed by modified oligonucleotides was defined (change in enthalpy and entropy). The introduction of intercalating residue causes a significant stabilization of DNA duplexes. It is shown that the efficiency of the fluorescence of acridine residue in the oligonucleotide conjugate significantly changes upon hybridization with DNA.

Preparation of a DNA matrix via an electrochemically directed copolymerization of pyrrole and oligonucleotides bearing a pyrrole group.

PubMed Central

Livache, T; Roget, A; Dejean, E; Barthet, C; Bidan, G; Téoule, R

1994-01-01

A new methodology for the preparation of addressed DNA matrices is described. The process includes an electrochemically directed copolymerization of pyrrole and oligonucleotides bearing on their 5' end a pyrrole moiety introduced by phosphoramidite chemistry. The electro-controlled synthesis of the copolymer (poly-pyrrole) gives, in one step, a solid conducting film deposited on the surface of an electrode. The resulting polymer consists of pyrrole chains bearing covalently linked oligonucleotide. The polymer growth is limited to the electrode surface, so that it is possible to prepare a DNA matrix on a multiple electrode device by successive copolymerizations. A support bearing four oligonucleotides was used to detect three ras mutations on a synthetic DNA fragment. PMID:8065902

Stability Measurements for Alignment of the NIF Neutron Imaging System Pinhole Array

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fittinghoff, D N; Bower, D E; Drury, O B

2011-03-29

The alignment system for the National Ignition Facility's neutron imaging system has been commissioned and measurements of the relative stability of the 90-315 DIM, the front and the back of the neutron imaging pinhole array and an exploding pusher target have been made using the 90-135 and the 90-258 opposite port alignment systems. Additionally, a laser beam shot from the neutron-imaging Annex and reflected from a mirror at the back of the pinhole array was used to monitor the pointing of the pinhole. Over a twelve hour period, the relative stability of these parts was found to be within {approx}more » {+-}18 {micro}m rms even when using manual methods for tracking the position of the objects. For highly visible features, use of basic particle tracking techniques found that the front of the pinhole array was stable relative to the 90-135 opposite port alignment camera to within {+-}3.4 {micro}m rms. Reregistration, however, of the opposite port alignment systems themselves using the target alignment sensor was found to change the expected position of target chamber center by up to 194 {micro}m.« less

Molecular Identification and Databases in Fusarium

USDA-ARS?s Scientific Manuscript database

DNA sequence-based methods for identifying pathogenic and mycotoxigenic Fusarium isolates have become the gold standard worldwide. Moreover, fusarial DNA sequence data are increasing rapidly in several web-accessible databases for comparative purposes. Unfortunately, the use of Basic Alignment Sea...

Evaluation of floating-point sum or difference of products in carry-save domain

NASA Technical Reports Server (NTRS)

Wahab, A.; Erdogan, S.; Premkumar, A. B.

1992-01-01

An architecture to evaluate a 24-bit floating-point sum or difference of products using modified sequential carry-save multipliers with extensive pipelining is described. The basic building block of the architecture is a carry-save multiplier with built-in mantissa alignment for the summation during the multiplication cycles. A carry-save adder, capable of mantissa alignment, correctly positions products with the current carry-save sum. Carry propagation in individual multipliers is avoided and is only required once to produce the final result.

Monovalent Streptavidin that Senses Oligonucleotides**

PubMed Central

Wang, Jingxian; Kostic, Natasa; Stojanovic, Milan N.

2013-01-01

We report a straightforward chemical route to monovalent streptavidin, a valuable reagent for imaging. The one-step process is based on a (tris)biotinylated-oligonucleotide blocking three of streptavidin’s four biotin binding sites. Further, the complex is highly sensitive to single-base differences - whereby perfectly matched oligonucleotides trigger dissociation of the biotin-streptavidin interaction at higher rates than single-base mismatches. Unique properties and ease of synthesis open wide opportunities for practical applications in imaging and biosensing. PMID:23606329

Ferrocene conjugated oligonucleotide for electrochemical detection of DNA base mismatch.

PubMed

Hasegawa, Yusuke; Takada, Tadao; Nakamura, Mitsunobu; Yamana, Kazushige

2017-08-01

We describe the synthesis, binding, and electrochemical properties of ferrocene-conjugated oligonucleotides (Fc-oligos). The key step for the preparation of Fc-oligos contains the coupling of vinylferrocene to 5-iododeoxyuridine via Heck reaction. The Fc-conjugated deoxyuridine phosphoramidite was used in the Fc-oligonucleotide synthesis. We show that thiol-modified Fc-oligos deposited onto gold electrodes possess potential ability in electrochemical detection of DNA base mismatch. Copyright © 2017 Elsevier Ltd. All rights reserved.

Systemic peptide-mediated oligonucleotide therapy improves long-term survival in spinal muscular atrophy

PubMed Central

Hazell, Gareth; Shabanpoor, Fazel; Saleh, Amer F.; Bowerman, Melissa; Meijboom, Katharina E.; Zhou, Haiyan; Muntoni, Francesco; Talbot, Kevin; Gait, Michael J.; Wood, Matthew J. A.

2016-01-01

The development of antisense oligonucleotide therapy is an important advance in the identification of corrective therapy for neuromuscular diseases, such as spinal muscular atrophy (SMA). Because of difficulties of delivering single-stranded oligonucleotides to the CNS, current approaches have been restricted to using invasive intrathecal single-stranded oligonucleotide delivery. Here, we report an advanced peptide-oligonucleotide, Pip6a-morpholino phosphorodiamidate oligomer (PMO), which demonstrates potent efficacy in both the CNS and peripheral tissues in severe SMA mice following systemic administration. SMA results from reduced levels of the ubiquitously expressed survival motor neuron (SMN) protein because of loss-of-function mutations in the SMN1 gene. Therapeutic splice-switching oligonucleotides (SSOs) modulate exon 7 splicing of the nearly identical SMN2 gene to generate functional SMN protein. Pip6a-PMO yields SMN expression at high efficiency in peripheral and CNS tissues, resulting in profound phenotypic correction at doses an order-of-magnitude lower than required by standard naked SSOs. Survival is dramatically extended from 12 d to a mean of 456 d, with improvement in neuromuscular junction morphology, down-regulation of transcripts related to programmed cell death in the spinal cord, and normalization of circulating insulin-like growth factor 1. The potent systemic efficacy of Pip6a-PMO, targeting both peripheral as well as CNS tissues, demonstrates the high clinical potential of peptide-PMO therapy for SMA. PMID:27621445

Synthesis and fluorescence studies of multiple labeled oligonucleotides containing dansyl fluorophore covalently attached at 2'-terminus of cytidine via carbamate linkage.

PubMed

Misra, Arvind; Mishra, Satyendra; Misra, Krishna

2004-01-01

Synthesis of modified oligonucleotides in which the specific cytidine nucleoside analogues linked at 2'-OH position via a carbamate bond with an amino ethyl derivative of dansyl fluorophore is reported. For the multiple labeling of oligonucleotides, a strategy involving prelabeling at the monomeric level followed by solid phase assembly of oligonucleotides to obtain regiospecifically labeled probes has been described. The labeled monomer was phosphitylated using 2-cyanoethyl-N,N,N',N'-tetraisopropyl-phosphoramidite (Bis-reagent) and pyridiniumtrifluoro acetate (Py.TFA) as an activator. To ascertain the minimal number of labeled monomers required for a specific length of oligonucleotide for detection and also to assess the effect of carbamate linkage on hybridization, hexamer and 20-mer sequences were selected. Both were labeled with 1, 2, and 3 monomers at the 5'-end and hybridized with normal (unmodified) complementary sequences. As compared to midsequence or 3'-terminal labeling reported earlier, the 5'-terminal labeling has been found to have minimal contact-mediated quenching on duplex formation. This may be due to complementary deoxyguanosine (dG) rich oligonucleotide sequences or CG base pairs at a terminus that is known to yield stronger binding. This is one reason for selecting cytidine for labeling. The results may aid rational design of multiple fluorescent DNA probes for nonradioactive detection of nucleic acids.

A High-throughput Assay for mRNA Silencing in Primary Cortical Neurons in vitro with Oligonucleotide Therapeutics.

PubMed

Alterman, Julia F; Coles, Andrew H; Hall, Lauren M; Aronin, Neil; Khvorova, Anastasia; Didiot, Marie-Cécile

2017-08-20

Primary neurons represent an ideal cellular system for the identification of therapeutic oligonucleotides for the treatment of neurodegenerative diseases. However, due to the sensitive nature of primary cells, the transfection of small interfering RNAs (siRNA) using classical methods is laborious and often shows low efficiency. Recent progress in oligonucleotide chemistry has enabled the development of stabilized and hydrophobically modified small interfering RNAs (hsiRNAs). This new class of oligonucleotide therapeutics shows extremely efficient self-delivery properties and supports potent and durable effects in vitro and in vivo . We have developed a high-throughput in vitro assay to identify and test hsiRNAs in primary neuronal cultures. To simply, rapidly, and accurately quantify the mRNA silencing of hundreds of hsiRNAs, we use the QuantiGene 2.0 quantitative gene expression assay. This high-throughput, 96-well plate-based assay can quantify mRNA levels directly from sample lysate. Here, we describe a method to prepare short-term cultures of mouse primary cortical neurons in a 96-well plate format for high-throughput testing of oligonucleotide therapeutics. This method supports the testing of hsiRNA libraries and the identification of potential therapeutics within just two weeks. We detail methodologies of our high throughput assay workflow from primary neuron preparation to data analysis. This method can help identify oligonucleotide therapeutics for treatment of various neurological diseases.

A continuous process to align electrospun nanofibers into parallel and crossed arrays

NASA Astrophysics Data System (ADS)

Laudenslager, Michael J.; Sigmund, Wolfgang M.

2013-04-01

Electrical, optical, and mechanical properties of nanofibers are strongly affected by their orientation. Electrospinning is a nanofiber processing technique that typically produces nonwoven meshes of randomly oriented fibers. While several alignment techniques exist, they are only able to produce either a very thin layer of aligned fibers or larger quantities of fibers with less control over their alignment and orientation. The technique presented herein fills the gap between these two methods allowing one to produce thick meshes of highly oriented nanofibers. In addition, this technique is not limited to collection of fibers along a single axis. Modifications to the basic setup allow collection of crossed fibers without stopping and repositioning the apparatus. The technique works for a range of fiber sizes. In this study, fiber diameters ranged from 100 nm to 1 micron. This allows a few fibers at a time to rapidly deposit in alternating directions creating an almost woven structure. These aligned nanofibers have the potential to improve the performance of energy storage and thermoelectric devices and hold great promise for directed cell growth applications.

Review on investigations of antisense oligonucleotides with the use of mass spectrometry.

PubMed

Studzińska, Sylwia

2018-01-01

Antisense oligonucleotides have been investigated as potential drugs for years. They inhibit target gene or protein expression. The present review summarizes their modifications, modes of action, and applications of liquid chromatography coupled with mass spectrometry for qualitative and quantitative analysis of these compounds. The most recent reports on a given topic were given prominence, while some early studies were reviewed in order to provide a theoretical background. The present review covers the issues of using ion-exchange chromatography, ion-pair reversed-phase high performance liquid chromatography and hydrophilic interaction chromatography for the separation of antisense oligonucleotides. The application of mass spectrometry was described with regard to the ionization type used for the determination of these potential therapeutics. Moreover, the current approaches and applications of mass spectrometry for quantitative analysis of antisense oligonucleotides and their metabolites as well as their impurities during in vitro and in vivo studies were discussed. Finally, certain conclusions and perspectives on the determination of therapeutic oligonucleotides in various samples were briefly described. Copyright © 2017 Elsevier B.V. All rights reserved.

Evolution of thermophilic DNA polymerases for the recognition and amplification of C2ʹ-modified DNA

NASA Astrophysics Data System (ADS)

Chen, Tingjian; Hongdilokkul, Narupat; Liu, Zhixia; Adhikary, Ramkrishna; Tsuen, Shujian S.; Romesberg, Floyd E.

2016-06-01

The PCR amplification of oligonucleotides enables the evolution of sequences called aptamers that bind specific targets with antibody-like affinity. However, in many applications the use of these aptamers is limited by nuclease-mediated degradation. In contrast, oligonucleotides that are modified at their sugar C2ʹ positions with methoxy or fluorine substituents are stable to nucleases, but they cannot be synthesized by natural polymerases. Here we report the development of a polymerase-evolution system and its use to evolve thermostable polymerases that efficiently interconvert C2ʹ-OMe-modified oligonucleotides and their DNA counterparts via ‘transcription’ and ‘reverse transcription’ or, more importantly, that PCR-amplify partially C2ʹ-OMe- or C2ʹ-F-modified oligonucleotides. A mechanistic analysis demonstrates that the ability to amplify the modified oligonucleotides evolved by optimizing interdomain interactions that stabilize the catalytically competent closed conformation of the polymerase. The evolved polymerases should find practical applications and the developed evolution system should be a powerful tool for tailoring polymerases to have other types of novel function.

An oligonucleotide array for the identification and differentiation of bacteria pathogenic on potato.

PubMed

Fessehaie, Anania; De Boer, Solke H; Lévesque, C André

2003-03-01

ABSTRACT Oligonucleotides, 16 to 24 bases long, were selected from the 3' end of the 16S gene and the 16S-23S intergenic spacer regions of bacteria pathogenic on potato, including Clavibacter michiganensis subsp. sepedonicus, Ralstonia solanacearum, and the pectolytic erwinias, including Erwinia carotovora subsp. atroseptica and carotovora and E. chrysanthemi. Oligonucleotides were designed and formatted into an array by pin spotting on nylon membranes. Genomic DNA from bacterial cultures was amplified by polymerase chain reaction using conserved ribosomal primers and labeled simultaneously with digoxigenin-dUTP. Hybridization of amplicons to the array and subsequent serological detection of digoxigenin label revealed different hybridization patterns that were distinct for each species and subspecies tested. Hybridization of amplicons generally was restricted to appropriate homologous oligonucleotides and cross-hybridization with heterologous oligonucleotides was rare. Hybridization patterns were recorded as separate gray values for each hybridized spot and revealed a consistent pattern for multiple strains of each species or subspecies isolated from diverse geographical regions. In preliminary tests, bacteria could be correctly identified and detected by hybridizing to the array amplicons from mixed cultures and inoculated potato tissue.

A reliable confirmation of the chemical structure of synthetic oligonucleotides: Detection of active protons in DNA oligomers by low-temperature FT infrared spectroscopy

NASA Astrophysics Data System (ADS)

Rozenberg, M.; Shoham, G.

2009-01-01

Cooling the samples allowed us to characterize solid oligonucleotides such as dimers, trimers and pentamers of cytidine, for the first time, in the IR range of the out-of-plane bending molecular modes (1000-400 cm -1) at 20 K. Especially interesting are the narrow IR bands of the out-of-plane bending ν4 NH 2 proton mode, which are apparently invisible at room temperature. This unequivocally defined and well-resolved NH 2 bending band should provide important information on the exact chemical form and hydrogen bonding interactions of cytidine amine groups. As such, this unique IR spectroscopy is suggested as a practical analytical tool to validate and characterize synthetic DNA bases and oligonucleotides. Using an approach of this type it was found that desalted oligonucleotide samples of the same nominal composition, but which had been produced by three different manufacturers, differ significantly in their IR spectra. These data suggest that the presumably identical oligonucleotides are in fact different, at least with respect to the content and nature of their NH protons.

A reliable confirmation of the chemical structure of synthetic oligonucleotides: detection of active protons in DNA oligomers by low-temperature FT infrared spectroscopy.

PubMed

Rozenberg, M; Shoham, G

2009-01-01

Cooling the samples allowed us to characterize solid oligonucleotides such as dimers, trimers and pentamers of cytidine, for the first time, in the IR range of the out-of-plane bending molecular modes (1000-400 cm(-1)) at 20K. Especially interesting are the narrow IR bands of the out-of-plane bending nu(4) NH(2) proton mode, which are apparently invisible at room temperature. This unequivocally defined and well-resolved NH(2) bending band should provide important information on the exact chemical form and hydrogen bonding interactions of cytidine amine groups. As such, this unique IR spectroscopy is suggested as a practical analytical tool to validate and characterize synthetic DNA bases and oligonucleotides. Using an approach of this type it was found that desalted oligonucleotide samples of the same nominal composition, but which had been produced by three different manufacturers, differ significantly in their IR spectra. These data suggest that the presumably identical oligonucleotides are in fact different, at least with respect to the content and nature of their NH protons.

Chimeric RNase H–Competent Oligonucleotides Directed to the HIV-1 Rev Response Element

PubMed Central

Prater, Chrissy E.; Saleh, Anthony D.; Wear, Maggie P.; Miller, Paul S.

2007-01-01

Chimeric oligo-2′-O-methylribonucleotides containing centrally located patches of contiguous 2′-deoxyribonucleotides and terminating in a nuclease resistant 3′-methylphosphonate internucleotide linkage were prepared. The oligonucleotides were targeted to the 3′-side of HIV Rev response element (RRE) stem-loop IIB RNA, which is adjacent to the high affinity Rev protein binding site and is critical to virus function. Thermal denaturation experiments showed that chimeric oligonucleotides form very stable duplexes with a complementary single-stranded RNA, and gel electrophoretic mobility shift assays (EMSA) showed that they bind with high affinity and specificity to RRE stem-loop II RNA (KD approximately 200 nM). The chimeric oligonucleotides promote RNase H-mediated hydrolysis of RRE stem-loop II RNA and have half lives exceeding 24 h when incubated in cell culture medium containing 10% fetal calf serum. One of the chimeric oligonucleotides inhibited RRE mediated expression of chloramphenicol acetyl transferase (CAT) approximately 60% at a concentration of 300 nM in HEK 293T cells co-transfected with p-RRE/CAT and p-Rev mammalian expression vectors. PMID:17566743

Oligonucleotide-Gold Nanoparticle Networks for Detection of Cryptosporidium parvum Heat Shock Protein 70 mRNA ▿

PubMed Central

Javier, David J.; Castellanos-Gonzalez, Alejandro; Weigum, Shannon E.; White, A. Clinton; Richards-Kortum, Rebecca

2009-01-01

We report on a novel strategy for the detection of mRNA targets derived from Cryptosporidium parvum oocysts by the use of oligonucleotide-gold nanoparticles. Gold nanoparticles are functionalized with oligonucleotides which are complementary to unique sequences present on the heat shock protein 70 (HSP70) DNA/RNA target. The results indicate that the presence of HPS70 targets of increasing complexity causes the formation of oligonucleotide-gold nanoparticle networks which can be visually monitored via a simple colorimetric readout measured by a total internal reflection imaging setup. Furthermore, the induced expression of HSP70 mRNA in Cryptosporidium parvum oocysts via a simple heat shock process provides nonenzymatic amplification such that the HSP70 mRNA derived from as few as 5 × 103 purified C. parvum oocysts was successfully detected. Taken together, these results support the use of oligonucleotide-gold nanoparticles for the molecular diagnosis of cryptosporidiosis, offering new opportunities for the further development of point-of-care diagnostic assays with low-cost, robust reagents and simple colorimetric detection. PMID:19828740

[Evaluation of transfection effectiveness using fluorescein-labelled oligonucleotides and entraster-R siRNA transfection into Plasmodium falciparum].

PubMed

Zhou, Hong-Chang; Gao, Yu-Hui; Shao, Sheng-Wen; Zhang, Hui; Zhang, Ting

2013-12-01

The cultured Plasmodium falciparum parasites were synchronized twice by 5% sorbitol treatment twice (8-hour window), and then incubated at 37 degrees C for 16 h. Parasites were transfected with fluorescein-labelled oligonucleotides (group A) or fluorescein-labelled oligonucleotides+Entranster-R siRNA transfection reagent (group B). After 5 h a part of parasites was evaluated by fluorescence microscopy and flow cytometry. The rest of parasites were washed with RPMI 1640 medium, and then incubated with 500 microl new medium containing 2% fresh erythrocytes for another 12 h, and detected by flow cytometry. The fluorescein-labelled oligonucleotides were localized in erythrocytes in group B, but nearly no fluorescence was observed for group A. Flow cytometry analysis indicated that the transfection efficiency of group B [(47.40 +/- 3.39)%] was higher than that of group A [(0.60 +/- 0.27)%]. In the second cell cycle, the transfection efficiency in group B was (26.85 +/- 2.90)%, while that of group A was nearly zero. The results indicated that Entranster-R siRNA transfection reagent may increase the oligonucleotides transfection efficiency.

Safety of antisense oligonucleotide and siRNA-based therapeutics.

PubMed

Chi, Xuan; Gatti, Philip; Papoian, Thomas

2017-05-01

Oligonucleotide-based therapy is an active area of drug development designed to treat a variety of gene-specific diseases. Two of the more promising platforms are the antisense oligonucleotides (ASOs) and short interfering RNAs (siRNAs), both of which are often directed against similar targets. In light of recent reports on clinical trials of severe thrombocytopenia with two different ASO drugs and increased peripheral neuropathy with an siRNA drug, we compared and contrasted the specific safety characteristics of these two classes of oligonucleotide therapeutic. The objectives were to assess factors that could contribute to the specific toxicities observed with these two classes of promising drugs, and get a better understanding of the potential mechanism(s) responsible for these rare, but serious, adverse events. Published by Elsevier Ltd.

Incorporation of terminal phosphorothioates into oligonucleotides.

PubMed Central

Alefelder, S; Patel, B K; Eckstein, F

1998-01-01

Considerable effort has been directed towards studying the structure and function of oligonucleotides and several approaches rely on the attachment of reporter groups to oligonucleotides. We report here the introduction of 3'- and 5'-terminal phosphorothioates into heptameric oligonucleotides and their post-synthetic modification with several reporter groups. The synthesis of terminal phosphorothioates is based on the coupling of a ribonucleoside phosphoramidite at the first or last nucleotide, respectively, which, after sulphurization, is removed by sequential oxidation of the vicinal hydroxyl groups and then beta-elimination. Product formation is of the order of 95%. The ratio of phosphorothioate- versus phosphate-terminated oligodeoxynucleotides as analysed by electrophoresis on a Hg2+gel is in general 85/15. Examples for the reactivity of the terminal phosphorothioates for conjugation with cholesterol, bimane and for sulphydryl exchange are described. PMID:9776763

Targeted self-assembly of functionalized carbon nanotubes on tumors

DOEpatents

Scheinberg, David A.; McDevitt, Michael R.; Villa, Carlos H.; Mulvey, J. Justin

2018-05-22

Provided herein are methods for delivering a molecule in situ to a cell and for treating a cancer via the in situ delivery. The methods comprise contacting or administering to the cell, as two separate components, a morpholino oligonucleotide comprising a targeting moiety followed by a single wall nanotube construct comprising second morpholino oligonucleotides complementary to the first morpholino oligonucleotides and one or both of a therapeutic or diagnostic payload molecule linked to the single wall nanotube construct. Upon self-assembly of a single wall nanotube complex via hybridization of the first morpholino and second complementary morpholino oligonucleotides at the cell, the payload molecule is delivered. Also provided is the two component self-assembly single wall nanotube system and the single wall nanotube construct comprising the second component.

A facile one-step fluorescence method for the quantitation of low-content single base deamination impurity in synthetic oligonucleotides.

PubMed

Su, Xiaoye; Liang, Ruiting; Stolee, Jessica A

2018-06-05

Oligonucleotides are being researched and developed as potential drug candidates for the treatment of a broad spectrum of diseases. The characterization of antisense oligonucleotide (ASO) impurities caused by base mutations (e.g. deamination) which are closely related to the target ASO is a significant analytical challenge. Herein, we describe a novel one-step method, utilizing a strategy that combines fluorescence-ON detection with competitive hybridization, to achieve single base mutation quantitation in extensively modified synthetic ASOs. Given that this method is highly specific and sensitive (LoQ = 4 nM), we envision that it will find utility for screening other impurities as well as sequencing modified oligonucleotides. Copyright © 2018 Elsevier B.V. All rights reserved.

Rapid and accurate synthesis of TALE genes from synthetic oligonucleotides.

PubMed

Wang, Fenghua; Zhang, Hefei; Gao, Jingxia; Chen, Fengjiao; Chen, Sijie; Zhang, Cuizhen; Peng, Gang

2016-01-01

Custom synthesis of transcription activator-like effector (TALE) genes has relied upon plasmid libraries of pre-fabricated TALE-repeat monomers or oligomers. Here we describe a novel synthesis method that directly incorporates annealed synthetic oligonucleotides into the TALE-repeat units. Our approach utilizes iterative sets of oligonucleotides and a translational frame check strategy to ensure the high efficiency and accuracy of TALE-gene synthesis. TALE arrays of more than 20 repeats can be constructed, and the majority of the synthesized constructs have perfect sequences. In addition, this novel oligonucleotide-based method can readily accommodate design changes to the TALE repeats. We demonstrated an increased gene targeting efficiency against a genomic site containing a potentially methylated cytosine by incorporating non-conventional repeat variable di-residue (RVD) sequences.

Cross reactive arrays of three-way junction sensors for steroid determination

NASA Technical Reports Server (NTRS)

Stojanovic, Milan N. (Inventor); Nikic, Dragan B. (Inventor); Landry, Donald (Inventor)

2008-01-01

This invention provides analyte sensitive oligonucleotide compositions for detecting and analyzing analytes in solution, including complex solutions using cross reactive arrays of analyte sensitive oligonucleotide compositions.

Ultrasensitive Hybridization-Based ELISA Method for the Determination of Phosphorodiamidate Morpholino Oligonucleotides in Biological samples.

PubMed

Burki, Umar; Straub, Volker

2017-01-01

Determining the concentration of oligonucleotide in biological samples such as tissue lysate and serum is essential for determining the biodistribution and pharmacokinetic profile, respectively. ELISA-based assays have shown far greater sensitivities compared to other methods such as HPLC and LC/MS. Here, we describe a novel ultrasensitive hybridization-based ELISA method for quantitating morpholino oligonucleotides in mouse tissue lysate and serum samples. The assay has a linear detection range of 5-250 pM (R2 > 0.99).

Horseradish peroxidase-labeled oligonucleotides and fluorescent tyramides for rapid detection of chromosome-specific repeat sequences.

PubMed

van Gijlswijk, R P; Wiegant, J; Vervenne, R; Lasan, R; Tanke, H J; Raap, A K

1996-01-01

We present a sensitive and rapid fluorescence in situ hybridization (FISH) strategy for detecting chromosome-specific repeat sequences. It uses horseradish peroxidase (HRP)-labeled oligonucleotide sequences in combination with fluorescent tyramide-based detection. After in situ hybridization, the HRP conjugated to the oligonucleotide probe is used to deposit fluorescently labeled tyramide molecules at the site of hybridization. The method features full chemical synthesis of probes, strong FISH signals, and short processing periods, as well as multicolor capabilities.

VRP09 Reduction of Corneal Scarring Following Blast and Burn Injuries to Cornea Using siRNAs Targeting TGFb and CTGF

DTIC Science & Technology

2013-03-01

oligonucleotide-based drug approaches (better than ribozymes, antisense oligonucleotides ( ASO ), or microRNAs). (4) To accomplish these objectives, we...negative control scrambled ASO (designated NC). The combination of siRNAs T1 and R1 produced a knockdown of ~80% of TGFb1 protein in the conditioned...sequences (antisense oligonucleotides, ASOs ) into rabbit corneal cells and found that technique was very effective in delivering ASOs into the stroma and

VRP09 Reduction of Corneal Scarring Following Blast and Burn Injuries to Cornea Using siRNAs Targeting TGFb and CTGF

DTIC Science & Technology

2012-10-01

selective of all gene-targeted, oligonucleotide-based drug approaches (better than ribozymes, antisense oligonucleotides ( ASO ), or microRNAs).(4) We will...respect to a scrambled siRNA control. For the migration assay, a circular region in the middle of the well was removed using a gel removal solution...oligonucleotides, ASOs ) into rabbit corneal cells and found that technique was very effective in delivering ASOs into the stroma and even into the endothelial cell

Modeling of connections between substructures

NASA Technical Reports Server (NTRS)

Butler, Thomas G.

1991-01-01

It is demonstrated here that complete checkout of a basic substructure can be done under the special circumstance of a sliding connection with offsets. Stiff bar connectors make this possible so long as the bar coordinates are aligned with the displacement coordinates at the sliding surface.

Diesel Technology: Introduction.

ERIC Educational Resources Information Center

Joerschke, John D.; Eichhorn, Lane C.

Competency-based teacher and student materials are provided for an introductory course on diesel technology. Twelve units of instruction cover the following topics: workplace tools, common materials, and basic related principles. The materials are based on the curriculum-alignment concept of first stating the objectives, then developing…

Analyses of deep mammalian sequence alignments and constraint predictions for 1% of the human genome

PubMed Central

Margulies, Elliott H.; Cooper, Gregory M.; Asimenos, George; Thomas, Daryl J.; Dewey, Colin N.; Siepel, Adam; Birney, Ewan; Keefe, Damian; Schwartz, Ariel S.; Hou, Minmei; Taylor, James; Nikolaev, Sergey; Montoya-Burgos, Juan I.; Löytynoja, Ari; Whelan, Simon; Pardi, Fabio; Massingham, Tim; Brown, James B.; Bickel, Peter; Holmes, Ian; Mullikin, James C.; Ureta-Vidal, Abel; Paten, Benedict; Stone, Eric A.; Rosenbloom, Kate R.; Kent, W. James; Bouffard, Gerard G.; Guan, Xiaobin; Hansen, Nancy F.; Idol, Jacquelyn R.; Maduro, Valerie V.B.; Maskeri, Baishali; McDowell, Jennifer C.; Park, Morgan; Thomas, Pamela J.; Young, Alice C.; Blakesley, Robert W.; Muzny, Donna M.; Sodergren, Erica; Wheeler, David A.; Worley, Kim C.; Jiang, Huaiyang; Weinstock, George M.; Gibbs, Richard A.; Graves, Tina; Fulton, Robert; Mardis, Elaine R.; Wilson, Richard K.; Clamp, Michele; Cuff, James; Gnerre, Sante; Jaffe, David B.; Chang, Jean L.; Lindblad-Toh, Kerstin; Lander, Eric S.; Hinrichs, Angie; Trumbower, Heather; Clawson, Hiram; Zweig, Ann; Kuhn, Robert M.; Barber, Galt; Harte, Rachel; Karolchik, Donna; Field, Matthew A.; Moore, Richard A.; Matthewson, Carrie A.; Schein, Jacqueline E.; Marra, Marco A.; Antonarakis, Stylianos E.; Batzoglou, Serafim; Goldman, Nick; Hardison, Ross; Haussler, David; Miller, Webb; Pachter, Lior; Green, Eric D.; Sidow, Arend

2007-01-01

A key component of the ongoing ENCODE project involves rigorous comparative sequence analyses for the initially targeted 1% of the human genome. Here, we present orthologous sequence generation, alignment, and evolutionary constraint analyses of 23 mammalian species for all ENCODE targets. Alignments were generated using four different methods; comparisons of these methods reveal large-scale consistency but substantial differences in terms of small genomic rearrangements, sensitivity (sequence coverage), and specificity (alignment accuracy). We describe the quantitative and qualitative trade-offs concomitant with alignment method choice and the levels of technical error that need to be accounted for in applications that require multisequence alignments. Using the generated alignments, we identified constrained regions using three different methods. While the different constraint-detecting methods are in general agreement, there are important discrepancies relating to both the underlying alignments and the specific algorithms. However, by integrating the results across the alignments and constraint-detecting methods, we produced constraint annotations that were found to be robust based on multiple independent measures. Analyses of these annotations illustrate that most classes of experimentally annotated functional elements are enriched for constrained sequences; however, large portions of each class (with the exception of protein-coding sequences) do not overlap constrained regions. The latter elements might not be under primary sequence constraint, might not be constrained across all mammals, or might have expendable molecular functions. Conversely, 40% of the constrained sequences do not overlap any of the functional elements that have been experimentally identified. Together, these findings demonstrate and quantify how many genomic functional elements await basic molecular characterization. PMID:17567995

Therapeutic Oligonucleotides Targeting Liver Disease: TTR Amyloidosis.

PubMed

Niemietz, Christoph; Chandhok, Gursimran; Schmidt, Hartmut

2015-09-30

The liver has become an increasingly interesting target for oligonucleotide therapy. Mutations of the gene encoding transthyretin (TTR), expressed in vast amounts by the liver, result in a complex degenerative disease, termed familial amyloid polyneuropathy (FAP). Misfolded variants of TTR are linked to the establishment of extracellular protein deposition in various tissues, including the heart and the peripheral nervous system. Recent progress in the chemistry and formulation of antisense (ASO) and small interfering RNA (siRNA) designed for a knockdown of TTR mRNA in the liver has allowed to address the issue of gene-specific molecular therapy in a clinical setting of FAP. The two therapeutic oligonucleotides bind to RNA in a sequence specific manner but exploit different mechanisms. Here we describe major developments that have led to the advent of therapeutic oligonucleotides for treatment of TTR-related disease.

Current progress on aptamer-targeted oligonucleotide therapeutics

PubMed Central

Dassie, Justin P; Giangrande, Paloma H

2014-01-01

Exploiting the power of the RNAi pathway through the use of therapeutic siRNA drugs has remarkable potential for treating a vast array of human disease conditions. However, difficulties in delivery of these and similar nucleic acid-based pharmacological agents to appropriate organs or tissues, remains a major impediment to their broad clinical application. Synthetic nucleic acid ligands (aptamers) have emerged as effective delivery vehicles for therapeutic oligonucleotides, including siRNAs. In this review, we summarize recent attractive developments in creatively employing cell-internalizing aptamers to deliver therapeutic oligonucleotides (e.g., siRNAs, miRNAs, anti-miRs and antisense oligos) to target cells. We also discuss advancements in aptamer-siRNA chimera technology, as well as, aptamer-functionalized nanoparticles for siRNA delivery. In addition, the challenges and future prospects of aptamer-targeted oligonucleotide drugs for clinical translation are further highlighted. PMID:24304250

Resolving prokaryotic taxonomy without rRNA: longer oligonucleotide word lengths improve genome and metagenome taxonomic classification.

PubMed

Alsop, Eric B; Raymond, Jason

2013-01-01

Oligonucleotide signatures, especially tetranucleotide signatures, have been used as method for homology binning by exploiting an organism's inherent biases towards the use of specific oligonucleotide words. Tetranucleotide signatures have been especially useful in environmental metagenomics samples as many of these samples contain organisms from poorly classified phyla which cannot be easily identified using traditional homology methods, including NCBI BLAST. This study examines oligonucleotide signatures across 1,424 completed genomes from across the tree of life, substantially expanding upon previous work. A comprehensive analysis of mononucleotide through nonanucleotide word lengths suggests that longer word lengths substantially improve the classification of DNA fragments across a range of sizes of relevance to high throughput sequencing. We find that, at present, heptanucleotide signatures represent an optimal balance between prediction accuracy and computational time for resolving taxonomy using both genomic and metagenomic fragments. We directly compare the ability of tetranucleotide and heptanucleotide world lengths (tetranucleotide signatures are the current standard for oligonucleotide word usage analyses) for taxonomic binning of metagenome reads. We present evidence that heptanucleotide word lengths consistently provide more taxonomic resolving power, particularly in distinguishing between closely related organisms that are often present in metagenomic samples. This implies that longer oligonucleotide word lengths should replace tetranucleotide signatures for most analyses. Finally, we show that the application of longer word lengths to metagenomic datasets leads to more accurate taxonomic binning of DNA scaffolds and have the potential to substantially improve taxonomic assignment and assembly of metagenomic data.

Combined in vitro transcription and reverse transcription to amplify and label complex synthetic oligonucleotide probe libraries.

PubMed

Murgha, Yusuf; Beliveau, Brian; Semrau, Kassandra; Schwartz, Donald; Wu, Chao-Ting; Gulari, Erdogan; Rouillard, Jean-Marie

2015-06-01

Oligonucleotide microarrays allow the production of complex custom oligonucleotide libraries for nucleic acid detection-based applications such as fluorescence in situ hybridization (FISH). We have developed a PCR-free method to make single-stranded DNA (ssDNA) fluorescent probes through an intermediate RNA library. A double-stranded oligonucleotide library is amplified by transcription to create an RNA library. Next, dye- or hapten-conjugate primers are used to reverse transcribe the RNA to produce a dye-labeled cDNA library. Finally the RNA is hydrolyzed under alkaline conditions to obtain the single-stranded fluorescent probes library. Starting from unique oligonucleotide library constructs, we present two methods to produce single-stranded probe libraries. The two methods differ in the type of reverse transcription (RT) primer, the incorporation of fluorescent dye, and the purification of fluorescent probes. The first method employs dye-labeled reverse transcription primers to produce multiple differentially single-labeled probe subsets from one microarray library. The fluorescent probes are purified from excess primers by oligonucleotide-bead capture. The second method uses an RNA:DNA chimeric primer and amino-modified nucleotides to produce amino-allyl probes. The excess primers and RNA are hydrolyzed under alkaline conditions, followed by probe purification and labeling with amino-reactive dyes. The fluorescent probes created by the combination of transcription and reverse transcription can be used for FISH and to detect any RNA and DNA targets via hybridization.

PNA-COMBO-FISH: From combinatorial probe design in silico to vitality compatible, specific labelling of gene targets in cell nuclei

DOE Office of Scientific and Technical Information (OSTI.GOV)

Müller, Patrick; Rößler, Jens; Schwarz-Finsterle, Jutta

Recently, advantages concerning targeting specificity of PCR constructed oligonucleotide FISH probes in contrast to established FISH probes, e.g. BAC clones, have been demonstrated. These techniques, however, are still using labelling protocols with DNA denaturing steps applying harsh heat treatment with or without further denaturing chemical agents. COMBO-FISH (COMBinatorial Oligonucleotide FISH) allows the design of specific oligonucleotide probe combinations in silico. Thus, being independent from primer libraries or PCR laboratory conditions, the probe sequences extracted by computer sequence data base search can also be synthesized as single stranded PNA-probes (Peptide Nucleic Acid probes). Gene targets can be specifically labelled with atmore » least about 20 PNA-probes obtaining visibly background free specimens. By using appropriately designed triplex forming oligonucleotides, the denaturing procedures can completely be omitted. These results reveal a significant step towards oligonucleotide-FISH maintaining the 3D-nanostructure and even the viability of the cell target. The method is demonstrated with the detection of Her2/neu and GRB7 genes, which are indicators in breast cancer diagnosis and therapy. - Highlights: • Denaturation free protocols preserve 3D architecture of chromosomes and nuclei. • Labelling sets are determined in silico for duplex and triplex binding. • Probes are produced chemically with freely chosen backbones and base variants. • Peptide nucleic acid backbones reduce hindering charge interactions. • Intercalating side chains stabilize binding of short oligonucleotides.« less

Performance measures from the explorer platform berthing experiment

NASA Technical Reports Server (NTRS)

Leake, Stephen

1993-01-01

The Explorer Platform is a Modular Mission Spacecraft: it has several subunits that are designed to be replaced on orbit. The Goddard Space Flight Center Robotics Lab undertook an experiment to evaluate various robotic approaches to replacing one of the units; a large (approximately 1 meter by 1 meter by 0.5 meter) power box. The hardware consists of a Robotics Research Corporation K-1607 (RRC) manipulator mounted on a large gantry robot, a Kraft handcontroller for teleoperation of RRC, a Lightweight Servicing Tool (LST) mounted on the RRC, and an Explorer Platform mockup (EP) with a removable box (MMS) that has fixtures that mate with the LST. Sensors include a wrist wrench sensor on the RRC and Capaciflectors mounted on the LST and the MMS. There are also several cameras, but no machine vision is used. The control system for the RRC is entirely written by Goddard; it consists of Ada code on three Multibus I 386/387 CPU boards doing the real-time robot control, and C on a 386 PC processing Capaciflector data. The gantry is not moved during this experiment. The task is the exchange of the MMS; it is removed and replaced. This involves four basic steps: mating the LST to the MMS, demating the MMS from the EP, mating the MMS to the EP, and demating the LST form the MMS. Each of the mating steps must be preceeded by an alignment to bring the mechanical fixtures within their capture range. Two basic approaches to alignment are explored: teleoperation with the operator viewing thru cameras, and Capaciflector based autonomy. To evaluate the two alignment approaches, several runs were run with each approach and the final pose was recorded. Comparing this to the ideal alignment pose gives accuracy and repeatability data. In addition the wrenches exerted during the mating tasks were recorded; this gives information on how the alignment step affects the mating step. There are also two approaches to mating; teleoperation, and impedance based autonomy. The wrench data taken during mating using these two approaches is used to evaluate them. Section 2 describes the alignment results, section 3 describes the mating results, and finally Section 4 gives some conclusions.

Comparison of small molecules and oligonucleotides that target a toxic, non-coding RNA.

PubMed

Costales, Matthew G; Rzuczek, Suzanne G; Disney, Matthew D

2016-06-01

Potential RNA targets for chemical probes and therapeutic modalities are pervasive in the transcriptome. Oligonucleotide-based therapeutics are commonly used to target RNA sequence. Small molecules are emerging as a modality to target RNA structures selectively, but their development is still in its infancy. In this work, we compare the activity of oligonucleotides and several classes of small molecules that target the non-coding r(CCUG) repeat expansion (r(CCUG)(exp)) that causes myotonic dystrophy type 2 (DM2), an incurable disease that is the second-most common cause of adult onset muscular dystrophy. Small molecule types investigated include monomers, dimers, and multivalent compounds synthesized on-site by using RNA-templated click chemistry. Oligonucleotides investigated include phosphorothioates that cleave their target and vivo-morpholinos that modulate target RNA activity via binding. We show that compounds assembled on-site that recognize structure have the highest potencies amongst small molecules and are similar in potency to a vivo-morpholino modified oligonucleotide that targets sequence. These studies are likely to impact the design of therapeutic modalities targeting other repeats expansions that cause fragile X syndrome and amyotrophic lateral sclerosis, for example. Copyright © 2016. Published by Elsevier Ltd.

Chemical synthesis of oligonucleotides containing a free sulphydryl group and subsequent attachment of thiol specific probes.

PubMed Central

Connolly, B A; Rider, P

1985-01-01

Oligonucleotides containing a free sulphydryl group at their 5'-termini have been synthesised and further derivatised with thiol specific probes. The nucleotide sequence required is prepared using standard solid phase phosphoramidite techniques and an extra round of synthesis is then performed using the S-triphenylmethyl O-methoxymorpholinophosphite derivatives of 2-mercaptoethanol, 3-mercaptopropan (1) ol or 6-mercaptohexan (1) ol. After cleavage from the resin and removal of the phosphate and base protecting groups, this yields an oligonucleotide containing an S-triphenylmethyl group attached to the 5'-phosphate group via a two, three or six carbon chain. The triphenylmethyl group can be readily removed with silver nitrate to give the free thiol. With the three and six carbon chain oligonucleotides, this thiol can be used, at pH 8, for the attachment of thiol specific probes as illustrated by the reaction with fluorescent conjugates of iodoacetates and maleiimides. However, oligonucleotides containing a thiol attached to the 5'-phosphate group via a two carbon chain are unstable at pH 8 decomposing to the free 5'-phosphate and so are unsuitable for further derivatisation. PMID:4011448

PNA-COMBO-FISH: From combinatorial probe design in silico to vitality compatible, specific labelling of gene targets in cell nuclei.

PubMed

Müller, Patrick; Rößler, Jens; Schwarz-Finsterle, Jutta; Schmitt, Eberhard; Hausmann, Michael

2016-07-01

Recently, advantages concerning targeting specificity of PCR constructed oligonucleotide FISH probes in contrast to established FISH probes, e.g. BAC clones, have been demonstrated. These techniques, however, are still using labelling protocols with DNA denaturing steps applying harsh heat treatment with or without further denaturing chemical agents. COMBO-FISH (COMBinatorial Oligonucleotide FISH) allows the design of specific oligonucleotide probe combinations in silico. Thus, being independent from primer libraries or PCR laboratory conditions, the probe sequences extracted by computer sequence data base search can also be synthesized as single stranded PNA-probes (Peptide Nucleic Acid probes) or TINA-DNA (Twisted Intercalating Nucleic Acids). Gene targets can be specifically labelled with at least about 20 probes obtaining visibly background free specimens. By using appropriately designed triplex forming oligonucleotides, the denaturing procedures can completely be omitted. These results reveal a significant step towards oligonucleotide-FISH maintaining the 3d-nanostructure and even the viability of the cell target. The method is demonstrated with the detection of Her2/neu and GRB7 genes, which are indicators in breast cancer diagnosis and therapy. Copyright © 2016. Published by Elsevier Inc.

Biological and molecular characterization of cellular differentiation in Tetrahymena vorax: a potential biocontrol protozoan.

PubMed

Green, M M; LeBoeuf, R D; Churchill, P F

2000-01-01

Tetrahymena vorax (T. vorax) is an indigenous fresh water protozoan with the natural biological potential to maintain a specific aquatic microbial flora by ingesting and eliminating specific microorganism. To investigate the molecular mechanisms controlling Tetrahymena vorax (T. vorax) cellular differentiation from a small-mouth vegetative cell to a voracious large-mouth carnivore capable of ingesting prey ciliates and bacteria from aquatic environments, we use DNA subtraction and gene discovery techniques to identify and isolate T. vorax differentiation-specific genes. The physiological necessity for one newly discovered gene, SUBII-TG, was determined in vivo using an antisense oligonucleotide directed against the 5' SUBII-TG DNA sequence. The barriers to delivering antisense oligonucleotides to the cytoplasm of T. vorax were circumvented by employing a new but simple procedure of processing the oligonucleotide with the differentiation stimulus, stomatin. In these studies, the antisense oligonucleotide down-regulated SUBII-TG mRNA expression, and blocked differentiation and ingestion of prey ciliates. The ability to down-regulate SUBII-TG expression with the antisense oligonucleotide suggests that the molecular mechanisms controlling the natural biological activities of T. vorax can be manipulated to further study its cellular differentiation and potential as a biocontrol microorganism.

Stable Gene Targeting in Human Cells Using Single-Strand Oligonucleotides with Modified Bases

PubMed Central

Rios, Xavier; Briggs, Adrian W.; Christodoulou, Danos; Gorham, Josh M.; Seidman, Jonathan G.; Church, George M.

2012-01-01

Recent advances allow multiplexed genome engineering in E. coli, employing easily designed oligonucleotides to edit multiple loci simultaneously. A similar technology in human cells would greatly expedite functional genomics, both by enhancing our ability to test how individual variants such as single nucleotide polymorphisms (SNPs) are related to specific phenotypes, and potentially allowing simultaneous mutation of multiple loci. However, oligo-mediated targeting of human cells is currently limited by low targeting efficiencies and low survival of modified cells. Using a HeLa-based EGFP-rescue reporter system we show that use of modified base analogs can increase targeting efficiency, in part by avoiding the mismatch repair machinery. We investigate the effects of oligonucleotide toxicity and find a strong correlation between the number of phosphorothioate bonds and toxicity. Stably EGFP-corrected cells were generated at a frequency of ~0.05% with an optimized oligonucleotide design combining modified bases and reduced number of phosphorothioate bonds. We provide evidence from comparative RNA-seq analysis suggesting cellular immunity induced by the oligonucleotides might contribute to the low viability of oligo-corrected cells. Further optimization of this method should allow rapid and scalable genome engineering in human cells. PMID:22615794

Correlating In Vitro Splice Switching Activity With Systemic In Vivo Delivery Using Novel ZEN-modified Oligonucleotides.

PubMed

Hammond, Suzan M; McClorey, Graham; Nordin, Joel Z; Godfrey, Caroline; Stenler, Sofia; Lennox, Kim A; Smith, C I Edvard; Jacobi, Ashley M; Varela, Miguel A; Lee, Yi; Behlke, Mark A; Wood, Matthew J A; Andaloussi, Samir E L

2014-11-25

Splice switching oligonucleotides (SSOs) induce alternative splicing of pre-mRNA and typically employ chemical modifications to increase nuclease resistance and binding affinity to target pre-mRNA. Here we describe a new SSO non-base modifier (a naphthyl-azo group, "ZEN™") to direct exon exclusion in mutant dystrophin pre-mRNA to generate functional dystrophin protein. The ZEN modifier is placed near the ends of a 2'-O-methyl (2'OMe) oligonucleotide, increasing melting temperature and potency over unmodified 2'OMe oligonucleotides. In cultured H2K cells, a ZEN-modified 2'OMe phosphorothioate (PS) oligonucleotide delivered by lipid transfection greatly enhanced dystrophin exon skipping over the same 2'OMePS SSO lacking ZEN. However, when tested using free gymnotic uptake in vitro and following systemic delivery in vivo in dystrophin deficient mdx mice, the same ZEN-modified SSO failed to enhance potency. Importantly, we show for the first time that in vivo activity of anionic SSOs is modelled in vitro only when using gymnotic delivery. ZEN is thus a novel modifier that enhances activity of SSOs in vitro but will require improved delivery methods before its in vivo clinical potential can be realized.

Computer Vision Evidence Supporting Craniometric Alignment of Rat Brain Atlases to Streamline Expert-Guided, First-Order Migration of Hypothalamic Spatial Datasets Related to Behavioral Control

PubMed Central

Khan, Arshad M.; Perez, Jose G.; Wells, Claire E.; Fuentes, Olac

2018-01-01

The rat has arguably the most widely studied brain among all animals, with numerous reference atlases for rat brain having been published since 1946. For example, many neuroscientists have used the atlases of Paxinos and Watson (PW, first published in 1982) or Swanson (S, first published in 1992) as guides to probe or map specific rat brain structures and their connections. Despite nearly three decades of contemporaneous publication, no independent attempt has been made to establish a basic framework that allows data mapped in PW to be placed in register with S, or vice versa. Such data migration would allow scientists to accurately contextualize neuroanatomical data mapped exclusively in only one atlas with data mapped in the other. Here, we provide a tool that allows levels from any of the seven published editions of atlases comprising three distinct PW reference spaces to be aligned to atlas levels from any of the four published editions representing S reference space. This alignment is based on registration of the anteroposterior stereotaxic coordinate (z) measured from the skull landmark, Bregma (β). Atlas level alignments performed along the z axis using one-dimensional Cleveland dot plots were in general agreement with alignments obtained independently using a custom-made computer vision application that utilized the scale-invariant feature transform (SIFT) and Random Sample Consensus (RANSAC) operation to compare regions of interest in photomicrographs of Nissl-stained tissue sections from the PW and S reference spaces. We show that z-aligned point source data (unpublished hypothalamic microinjection sites) can be migrated from PW to S space to a first-order approximation in the mediolateral and dorsoventral dimensions using anisotropic scaling of the vector-formatted atlas templates, together with expert-guided relocation of obvious outliers in the migrated datasets. The migrated data can be contextualized with other datasets mapped in S space, including neuronal cell bodies, axons, and chemoarchitecture; to generate data-constrained hypotheses difficult to formulate otherwise. The alignment strategies provided in this study constitute a basic starting point for first-order, user-guided data migration between PW and S reference spaces along three dimensions that is potentially extensible to other spatial reference systems for the rat brain. PMID:29765309

General Electronics Technician: Basic Electronics.

ERIC Educational Resources Information Center

Hilley, Robert

These instructional materials include a teacher's guide designed to assist instructors in organizing and presenting an introductory course in general electronics and a student guide. The materials are based on the curriculum-alignment concept of first stating the objectives, developing instructional strategies for teaching those objectives, and…

Expanding the species and chemical diversity of Penicillium section Cinnamopurpurea

USDA-ARS?s Scientific Manuscript database

A set of isolates genetically similar to or potentially conspecific with an unidentified Penicillium isolate NRRL 735, was assembled using a Basic Local Alignment Search Tool (BLAST) search of internal transcribed spacer (ITS) similarity among described (GenBank) and undescribed Penicillium isolates...

Studying internal and external magnetic fields in Japan using MAGSAT data

NASA Technical Reports Server (NTRS)

Fukushima, N. (Principal Investigator); Maeda, H.; Yukutake, T.; Tanaka, M.; Oshima, S.; Ogawa, K.; Kawamura, M.; Miyazaki, Y.; Uyeda, S.; Kobayashi, K.

1980-01-01

Examination of the total intensity data of CHRONIT on a few paths over Japan and its neighboring sea shows MAGSAT is extremely useful for studying the local magnetic anomaly. In high latitudes, the signatures of field aligned currents are clearly recognized. These include (1) the persistent basic pattern of current flow; (2) the more intense currents in the summer hemisphere than in the winter hemisphere; (3) more fluctuations in current intensities in summer dawn hours; and (4) apparent dawn-dusk asymmetry in the field-aligned current intensity between the north and south polar regions.

The inhibition of methane hydrate formation by water alignment underneath surface adsorption of surfactants

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nguyen, Ngoc N.; Nguyen, Anh V.; Dang, Liem X.

Sodium dodecyl sulfate (SDS) has been widely shown to strongly promote the formation of methane hydrate. Here we show that SDS displays an extraordinary inhibition effect on methane hydrate formation when the surfactant is used in sub-millimolar concentration (around 0.3 mM). We have also employed Sum Frequency Generation vibrational spectroscopy (SFG) and molecular dynamics simulation (MDS) to elucidate the molecular mechanism of this inhibition. The SFG and MDS results revealed a strong alignment of water molecules underneath surface adsorption of SDS in its sub-millimolar solution. Interestingly, both the alignment of water and the inhibition effect (in 0.3 mM SDS solution)more » went vanishing when an oppositely-charged surfactant (tetra-n-butylammonium bromide, TBAB) was suitably added to produce a mixed solution of 0.3 mM SDS and 3.6 mM TBAB. Combining structural and kinetic results, we pointed out that the alignment of water underneath surface adsorption of dodecyl sulfate (DS-) anions gave rise to the unexpected inhibition of methane hydration formation in sub-millimolar solution of SDS. The adoption of TBAB mitigated the SDS-induced electrostatic field at the solution’s surface and, therefore, weakened the alignment of interfacial water which, in turn, erased the inhibition effect. We discussed this finding using the concept of activation energy of the interfacial formation of gas hydrate. The main finding of this work is to reveal the interplay of interfacial water in governing gas hydrate formation which sheds light on a universal molecular-scale understanding of the influence of surfactants on gas hydrate formation. This work was supported by the U.S. Department of Energy, Office of Science, Office of Basic Energy Sciences, Division of Chemical Sciences, Geosciences, and Biosciences. The calculations were carried out using computer resources provided by the Office of Basic Energy Sciences.« less

Oligonucleotides as antivirals: dream or realistic perspective?

PubMed

Van Aerschot, Arthur

2006-09-01

Many reports have been published on antiviral activity of synthetic oligonucleotides, targeted to act either by a true antisense effect or via non-sequence specific interactions. This short review will try to evaluate the current status of the field by focusing on the effects as reported for inhibition of either HSV-1, HCMV or HIV-1. Following an introduction with a historical background and a brief discussion on the different types of constructs and mechanisms of action, the therapeutic potential of antisense oligonucleotides as antivirals, as well as possible pitfalls upon their evaluation will be discussed.

CD studies on ribonuclease A - oligonucleotides interactions.

PubMed Central

White, M D; Keren-Zur, M; Lapidot, Y

1977-01-01

The interaction of ApU, Aps4U, Aps4Up, ApAps4Up and Gps4U with RNase A was studied by CD difference spectroscopy. The use of 4-thiouridine (s4U) containing oligonucleotides enables to distinguish between the interaction of the different components of the ligand with the enzyme. The mode of binding of the oligonucleotides to the enzyme is described. From this mode of binding it is explained why Aps4U, for example, inhibits RNase A, while s4UpA serves as a substrate. PMID:866194

Rapid purification of circular DNA by triplex-mediated affinity capture

DOEpatents

Ji, Huamin; Smith, Lloyd M.

1997-01-01

A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support.

Customized oligonucleotide microchips that convert multiple genetic information to simple patterns, are portable and reusable

DOEpatents

Mirzabekov, Andrei; Guschin, Dmitry Y.; Chik, Valentine; Drobyshev, Aleksei; Fotin, Alexander; Yershov, Gennadiy; Lysov, Yuri

2002-01-01

This invention relates to using customized oligonucleotide microchips as biosensors for the detection and identification of nucleic acids specific for different genes, organisms and/or individuals in the environment, in food and in biological samples. The microchips are designed to convert multiple bits of genetic information into simpler patterns of signals that are interpreted as a unit. Because of an improved method of hybridizing oligonucleotides from samples to microchips, microchips are reusable and transportable. For field study, portable laser or bar code scanners are suitable.

Functional regulation of RNA-induced silencing complex by photoreactive oligonucleotides.

PubMed

Matsuyama, Yohei; Yamayoshi, Asako; Kobori, Akio; Murakami, Akira

2014-02-01

We developed a novel method for regulation of RISC function by photoreactive oligonucleotides (Ps-Oligo) containing 2'-O-psoralenylmethoxyethyl adenosine (Aps). We observed that inhibitory effects of Ps-Oligos on RISC function were enhanced by UV-irradiation compared with 2'-O-methyl-oligonucleotide without Aps. These results suggest Ps-Oligo inhibited RISC function by cross-linking effect, and we propose that the concept described in this report may be promising and applicable one to regulate the small RNA-mediated post-transcriptional regulation. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

Oligonucleotide Array for Identification and Detection of Pythium Species†

PubMed Central

Tambong, J. T.; de Cock, A. W. A. M.; Tinker, N. A.; Lévesque, C. A.

2006-01-01

A DNA array containing 172 oligonucleotides complementary to specific diagnostic regions of internal transcribed spacers (ITS) of more than 100 species was developed for identification and detection of Pythium species. All of the species studied, with the exception of Pythium ostracodes, exhibited a positive hybridization reaction with at least one corresponding species-specific oligonucleotide. Hybridization patterns were distinct for each species. The array hybridization patterns included cluster-specific oligonucleotides that facilitated the recognition of species, including new ones, belonging to groups such as those producing filamentous or globose sporangia. BLAST analyses against 500 publicly available Pythium sequences in GenBank confirmed that species-specific oligonucleotides were unique to all of the available strains of each species, of which there were numerous economically important ones. GenBank entries of newly described species that are not putative synonyms showed no homology to sequences of the spotted species-specific oligonucleotides, but most new species did match some of the cluster-specific oligonucleotides. Further verification of the specificity of the DNA array was done with 50 additional Pythium isolates obtained by soil dilution plating. The hybridization patterns obtained were consistent with the identification of these isolates based on morphology and ITS sequence analyses. In another blind test, total DNA of the same soil samples was amplified and hybridized on the array, and the results were compared to those of 130 Pythium isolates obtained by soil dilution plating and root baiting. The 13 species detected by the DNA array corresponded to the isolates obtained by a combination of soil dilution plating and baiting, except for one new species that was not represented on the array. We conclude that the reported DNA array is a reliable tool for identification and detection of the majority of Pythium species in environmental samples. Simultaneous detection and identification of multiple species of soilborne pathogens such as Pythium species could be a major step forward for epidemiological and ecological studies. PMID:16597974

In Silico Screening Based on Predictive Algorithms as a Design Tool for Exon Skipping Oligonucleotides in Duchenne Muscular Dystrophy

PubMed Central

Echigoya, Yusuke; Mouly, Vincent; Garcia, Luis; Yokota, Toshifumi; Duddy, William

2015-01-01

The use of antisense ‘splice-switching’ oligonucleotides to induce exon skipping represents a potential therapeutic approach to various human genetic diseases. It has achieved greatest maturity in exon skipping of the dystrophin transcript in Duchenne muscular dystrophy (DMD), for which several clinical trials are completed or ongoing, and a large body of data exists describing tested oligonucleotides and their efficacy. The rational design of an exon skipping oligonucleotide involves the choice of an antisense sequence, usually between 15 and 32 nucleotides, targeting the exon that is to be skipped. Although parameters describing the target site can be computationally estimated and several have been identified to correlate with efficacy, methods to predict efficacy are limited. Here, an in silico pre-screening approach is proposed, based on predictive statistical modelling. Previous DMD data were compiled together and, for each oligonucleotide, some 60 descriptors were considered. Statistical modelling approaches were applied to derive algorithms that predict exon skipping for a given target site. We confirmed (1) the binding energetics of the oligonucleotide to the RNA, and (2) the distance in bases of the target site from the splice acceptor site, as the two most predictive parameters, and we included these and several other parameters (while discounting many) into an in silico screening process, based on their capacity to predict high or low efficacy in either phosphorodiamidate morpholino oligomers (89% correctly predicted) and/or 2’O Methyl RNA oligonucleotides (76% correctly predicted). Predictions correlated strongly with in vitro testing for sixteen de novo PMO sequences targeting various positions on DMD exons 44 (R2 0.89) and 53 (R2 0.89), one of which represents a potential novel candidate for clinical trials. We provide these algorithms together with a computational tool that facilitates screening to predict exon skipping efficacy at each position of a target exon. PMID:25816009

Voltammetric behaviour of free DNA bases, methylcytosine and oligonucleotides at disposable screen printed graphite electrode platforms.

PubMed

Brotons, Ariadna; Mas, Luis Alcaraz; Metters, Jonathan P; Banks, Craig E; Iniesta, Jesús

2013-09-21

Improvements in analytical methods for the determination and quantification of methylcytosine in DNA are vital since it has the potential to be used as a biomarker to detect different diseases in the first stage such as in the case of carcinomas and sterility. In this work we utilized screen printed graphite electrodes (SPGE) for studying the electrochemical response of all free DNA bases, methylcytosine and short oligonucleotides by cyclic voltammetry (CV) and square wave voltammetry (SWV). CV and SWV responses of free DNA bases and methylcytosine have been investigated by using SPGE platforms and the feasibility of detecting and quantifying cytosine and methylcytosine as free DNA moieties has been evaluated as a function of pH, concentration and the presence of the other free DNA bases in solution simultaneously. Repeatability of using SWV has been performed for the electrochemical behavior of both 250 μM cytosine and 250 μM methylcytosine in the presence of 25 μM guanine, with coefficient of variations of 6.9% and 2.6% respectively based upon peak current (N = 5). Six-mer oligonucleotides with a sequence 5'-XXXCGC-3', where the XXX motif corresponds to TTT, TTA, TAA and AAA have been performed using SWV in 0.1 M acetate buffer pH 5.0 to explore how the DNA base position effects the electrooxidation of guanine and cytosine into the oligonucleotide. Furthermore SWV comparisons of the electrooxidation of the oligonucleotides 5'-CGCGCG-3' and its methylated 5'-mCGmCGmCG-3' have been performed with concentrations in acetate buffer solutions, and the interaction of both oligonucleotides with the graphitic surface of the SPGE has been demonstrated by fitting well-known adsorption models such as Freundlich and Langmuir kinetics according to the SWV current response of guanine, cytosine and methylcytosine into the oligonucleotide.

Non-Enzymatic Detection of Bacterial Genomic DNA Using the Bio-Barcode Assay

PubMed Central

Hill, Haley D.; Vega, Rafael A.; Mirkin, Chad A.

2011-01-01

The detection of bacterial genomic DNA through a non-enzymatic nanomaterials based amplification method, the bio-barcode assay, is reported. The assay utilizes oligonucleotide functionalized magnetic microparticles to capture the target of interest from the sample. A critical step in the new assay involves the use of blocking oligonucleotides during heat denaturation of the double stranded DNA. These blockers bind to specific regions of the target DNA upon cooling, and prevent the duplex DNA from re-hybridizing, which allows the particle probes to bind. Following target isolation using the magnetic particles, oligonucleotide functionalized gold nanoparticles act as target recognition agents. The oligonucleotides on the nanoparticle (barcodes) act as amplification surrogates. The barcodes are then detected using the Scanometric method. The limit of detection for this assay was determined to be 2.5 femtomolar, and this is the first demonstration of a barcode type assay for the detection of double stranded, genomic DNA. PMID:17927207

Persistence and breakdown of strand symmetry in the human genome.

PubMed

Zhang, Shang-Hong

2015-04-07

Afreixo, V., Bastos, C.A.C., Garcia, S.P., Rodrigues, J.M.O.S., Pinho, A.J., Ferreira, P.J.S.G., 2013. The breakdown of the word symmetry in the human genome. J. Theor. Biol. 335, 153-159 analyzed the word symmetry (strand symmetry or the second parity rule) in the human genome. They concluded that strand symmetry holds for oligonucleotides up to 6 nt and is no longer statistically significant for oligonucleotides of higher orders. However, although they provided some new results for the issue, their interpretation would not be fully justified. Also, their conclusion needs to be further evaluated. Further analysis of their results, especially those of equivalence tests and word symmetry distance, shows that strand symmetry would persist for higher-order oligonucleotides up to 9 nt in the human genome, at least for its overall frequency framework (oligonucleotide frequency pattern). Copyright © 2015 Elsevier Ltd. All rights reserved.

Use of continuous/contiguous stacking hybridization as a diagnostic tool

DOEpatents

Mirzabekov, Andrei Darievich; Yershov, Gennadiy Moseyevich; Kirillov, Eugene Vladislavovich; Parinov, Sergei Valeryevich; Barski, Victor Evgenievich; Lysov, Yuri Petrovich

1999-01-01

A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates.

Use of continuous/contiguous stacking hybridization as a diagnostic tool

DOEpatents

Mirzabekov, A.D.; Yershov, G.M.; Kirillov, E.V.; Parinov, S.V.; Barski, V.E.; Lysov, Y.P.

1999-06-01

A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates. 5 figs.

Oligonucleotide primers, probes and molecular methods for the environmental monitoring of methanogenic archaea

PubMed Central

Narihiro, Takashi; Sekiguchi, Yuji

2011-01-01

Summary For the identification and quantification of methanogenic archaea (methanogens) in environmental samples, various oligonucleotide probes/primers targeting phylogenetic markers of methanogens, such as 16S rRNA, 16S rRNA gene and the gene for the α‐subunit of methyl coenzyme M reductase (mcrA), have been extensively developed and characterized experimentally. These oligonucleotides were designed to resolve different groups of methanogens at different taxonomic levels, and have been widely used as hybridization probes or polymerase chain reaction primers for membrane hybridization, fluorescence in situ hybridization, rRNA cleavage method, gene cloning, DNA microarray and quantitative polymerase chain reaction for studies in environmental and determinative microbiology. In this review, we present a comprehensive list of such oligonucleotide probes/primers, which enable us to determine methanogen populations in an environment quantitatively and hierarchically, with examples of the practical applications of the probes and primers. PMID:21375721

Toward a new paradigm of DNA writing using a massively parallel sequencing platform and degenerate oligonucleotide

PubMed Central

Hwang, Byungjin; Bang, Duhee

2016-01-01

All synthetic DNA materials require prior programming of the building blocks of the oligonucleotide sequences. The development of a programmable microarray platform provides cost-effective and time-efficient solutions in the field of data storage using DNA. However, the scalability of the synthesis is not on par with the accelerating sequencing capacity. Here, we report on a new paradigm of generating genetic material (writing) using a degenerate oligonucleotide and optomechanical retrieval method that leverages sequencing (reading) throughput to generate the desired number of oligonucleotides. As a proof of concept, we demonstrate the feasibility of our concept in digital information storage in DNA. In simulation, the ability to store data is expected to exponentially increase with increase in degenerate space. The present study highlights the major framework change in conventional DNA writing paradigm as a sequencer itself can become a potential source of making genetic materials. PMID:27876825

Preparation and Analysis of Oligonucleotides Containing the C4′-Oxidized Abasic Site and Related Mechanistic Probes

PubMed Central

Kim, Jaeseung; Kreller, Cortney R.; Greenberg, Marc M.

2005-01-01

The C4′-oxidized abasic site (C4-AP) is produced by a variety of DNA damaging agents. This alkali labile lesion can exist in up to four diastereomeric cyclic forms, in addition to the acyclic keto-aldehyde. Synthetic oligonucleotides containing the lesion were prepared from a stable photochemical precursor. Chemical integrity of the lesion containing oligonucleotides was probed using phosphodiesterase lability. Analysis of the 3′,5′-phosphate diester of the monomeric lesion released from single diastereomers of photolabile precursors by 1H NMR indicates that isomerization of the hemiacetal and/or hemiketal is rapid. The syntheses and characterization of oligonucleotides containing configurationally stable analogues of C4-AP, which serve as mechanistic probes for deciphering the structural basis of the biochemical and biological effects of the C4′-oxidized abasic lesion, are also described. PMID:16277338

Toward a new paradigm of DNA writing using a massively parallel sequencing platform and degenerate oligonucleotide.

PubMed

Hwang, Byungjin; Bang, Duhee

2016-11-23

All synthetic DNA materials require prior programming of the building blocks of the oligonucleotide sequences. The development of a programmable microarray platform provides cost-effective and time-efficient solutions in the field of data storage using DNA. However, the scalability of the synthesis is not on par with the accelerating sequencing capacity. Here, we report on a new paradigm of generating genetic material (writing) using a degenerate oligonucleotide and optomechanical retrieval method that leverages sequencing (reading) throughput to generate the desired number of oligonucleotides. As a proof of concept, we demonstrate the feasibility of our concept in digital information storage in DNA. In simulation, the ability to store data is expected to exponentially increase with increase in degenerate space. The present study highlights the major framework change in conventional DNA writing paradigm as a sequencer itself can become a potential source of making genetic materials.

Silver Nanoparticle Oligonucleotide Conjugates Based on DNA with Triple Cyclic Disulfide Moieties

PubMed Central

Lee, Jae-Seung; Lytton-Jean, Abigail K. R.; Hurst, Sarah J.; Mirkin, Chad A.

2011-01-01

We report a new strategy for preparing silver nanoparticle oligonucleotide conjugates that are based upon DNA with cyclic disulfide-anchoring groups. These particles are extremely stable and can withstand NaCl concentrations up to 1.0 M. When silver nanoparticles functionalized with complementary sequences are combined, they assemble to form DNA-linked nanoparticle networks. This assembly process is reversible with heating and is associated with a red-shifting of the particle surface plasmon resonance and a concomitant color change from yellow to pale red. Analogous to the oligonucleotide-functionalized gold nanoparticles, these particles also exhibit highly cooperative binding properties with extremely sharp melting transitions. This work is an important step towards being able to use silver nanoparticle oligonucleotide conjugates for a variety of purposes, including molecular diagnostic labels, synthons in programmable materials synthesis approaches, and functional components for nanoelectronic and plasmonic devices. PMID:17571909

Secondary binding sites for heavily modified triplex forming oligonucleotides

PubMed Central

Cardew, Antonia S.; Brown, Tom; Fox, Keith R.

2012-01-01

In order to enhance DNA triple helix stability synthetic oligonucleotides have been developed that bear amino groups on the sugar or base. One of the most effective of these is bis-amino-U (B), which possesses 5-propargylamino and 2′-aminoethoxy modifications. Inclusion of this modified nucleotide not only greatly enhances triplex stability, but also increases the affinity for related sequences. We have used a restriction enzyme protection, selection and amplification assay (REPSA) to isolate sequences that are bound by the heavily modified 9-mer triplex-forming oligonucleotide B6CBT. The isolated sequences contain An tracts (n = 6), suggesting that the 5′-end of this TFO was responsible for successful triplex formation. DNase I footprinting with these sequences confirmed triple helix formation at these secondary targets and demonstrated no interaction with similar oligonucleotides containing T or 5-propargylamino-dU. PMID:22180535

Gene silencing by siRNAs and antisense oligonucleotides in the laboratory and the clinic

PubMed Central

Watts, Jonathan K.; Corey, David R.

2014-01-01

Synthetic nucleic acids are commonly used laboratory tools for modulating gene expression and have the potential to be widely used in the clinic. Progress towards nucleic acid drugs, however, has been slow and many challenges remain to be overcome before their full impact on patient care can be understood. Antisense oligonucleotides (ASOs) and small interfering RNAs (siRNAs) are the two most widely used strategies for silencing gene expression. We first describe these two approaches and contrast their relative strengths and weaknesses for laboratory applications. We then review the choices faced during development of clinical candidates and the current state of clinical trials. Attitudes towards clinical development of nucleic acid silencing strategies have repeatedly swung from optimism to depression during the past twenty years. Our goal is to provide the information needed to design robust studies with oligonucleotides, making use of the strengths of each oligonucleotide technology. PMID:22069063

Repair of Thalassemic Human β -globin mRNA in Mammalian Cells by Antisense Oligonucleotides

NASA Astrophysics Data System (ADS)

Sierakowska, Halina; Sambade, Maria J.; Agrawal, Sudhir; Kole, Ryszard

1996-11-01

In one form of β -thalassemia, a genetic blood disorder, a mutation in intron 2 of the β -globin gene (IVS2-654) causes aberrant splicing of β -globin pre-mRNA and, consequently, β -globin deficiency. Treatment of mammalian cells stably expressing the IVS2-654 human β -globin gene with antisense oligonucleotides targeted at the aberrant splice sites restored correct splicing in a dose-dependent fashion, generating correct human β -globin mRNA and polypeptide. Both products persisted for up to 72 hr posttreatment. The oligonucleotides modified splicing by a true antisense mechanism without overt unspecific effects on cell growth and splicing of other pre-mRNAs. This novel approach in which antisense oligonucleotides are used to restore rather than to down-regulate the activity of the target gene is applicable to other splicing mutants and is of potential clinical interest.

Enzymatic production of single-molecule FISH and RNA capture probes.

PubMed

Gaspar, Imre; Wippich, Frank; Ephrussi, Anne

2017-10-01

Arrays of singly labeled short oligonucleotides that hybridize to a specific target revolutionized RNA biology, enabling quantitative, single-molecule microscopy analysis and high-efficiency RNA/RNP capture. Here, we describe a simple and efficient method that allows flexible functionalization of inexpensive DNA oligonucleotides by different fluorescent dyes or biotin using terminal deoxynucleotidyl transferase and custom-made functional group conjugated dideoxy-UTP. We show that (i) all steps of the oligonucleotide labeling-including conjugation, enzymatic synthesis, and product purification-can be performed in a standard biology laboratory, (ii) the process yields >90%, often >95% labeled product with minimal carryover of impurities, and (iii) the oligonucleotides can be labeled with different dyes or biotin, allowing single-molecule FISH, RNA affinity purification, and Northern blot analysis to be performed. © 2017 Gaspar et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Universal Oligonucleotide Microarray for Sub-Typing of Influenza A Virus

PubMed Central

Ryabinin, Vladimir A.; Kostina, Elena V.; Maksakova, Galiya A.; Neverov, Alexander A.; Chumakov, Konstantin M.; Sinyakov, Alexander N.

2011-01-01

A universal microchip was developed for genotyping Influenza A viruses. It contains two sets of oligonucleotide probes allowing viruses to be classified by the subtypes of hemagglutinin (H1–H13, H15, H16) and neuraminidase (N1–N9). Additional sets of probes are used to detect H1N1 swine influenza viruses. Selection of probes was done in two steps. Initially, amino acid sequences specific to each subtype were identified, and then the most specific and representative oligonucleotide probes were selected. Overall, between 19 and 24 probes were used to identify each subtype of hemagglutinin (HA) and neuraminidase (NA). Genotyping included preparation of fluorescently labeled PCR amplicons of influenza virus cDNA and their hybridization to microarrays of specific oligonucleotide probes. Out of 40 samples tested, 36 unambiguously identified HA and NA subtypes of Influenza A virus. PMID:21559081

Synthesis of nucleosides and oligonucleotides containing adducts of acrolein and vinyl chloride.

PubMed

Nechev, L V; Harris, C M; Harris, T M

2000-05-01

Vinyl chloride and acrolein are important industrial chemicals. Both form DNA adducts, vinyl chloride after enzymatic oxidation to chlorooxirane and acrolein by direct reaction. Reaction at the N(2) position of guanine is a major pathway. The resulting 2-oxoethyl and 3-oxopropyl adducts cyclize spontaneously to hydroxyethano and hydroxypropano derivatives, respectively. The two cyclic adducts have been detected in DNA exposed to these mutagens. A new method has been developed for the synthesis of deoxyguanosine adducts of chlorooxirane and acrolein, as well as oligonucleotides containing these adducts. Reaction of O(6)-[(trimethylsilyl)ethyl]-2-fluoro-2'-deoxyinosine with the appropriate aminodiol followed by oxidative cleavage of the diol with NaIO(4) gave the adducts in excellent yields. Reaction of oligonucleotides containing the halonucleoside with the aminodiols followed by NaIO(4) efficiently created the nucleosides in the oligonucleotides. Deoxyadenosine adducts were created similarly using 6-chloropurine 9-(2'-deoxyriboside).

Genome-wide comparison of paired fresh frozen and formalin-fixed paraffin-embedded gliomas by custom BAC and oligonucleotide array comparative genomic hybridization: facilitating analysis of archival gliomas.

PubMed

Mohapatra, Gayatry; Engler, David A; Starbuck, Kristen D; Kim, James C; Bernay, Derek C; Scangas, George A; Rousseau, Audrey; Batchelor, Tracy T; Betensky, Rebecca A; Louis, David N

2011-04-01

Array comparative genomic hybridization (aCGH) is a powerful tool for detecting DNA copy number alterations (CNA). Because diffuse malignant gliomas are often sampled by small biopsies, formalin-fixed paraffin-embedded (FFPE) blocks are often the only tissue available for genetic analysis; FFPE tissues are also needed to study the intratumoral heterogeneity that characterizes these neoplasms. In this paper, we present a combination of evaluations and technical advances that provide strong support for the ready use of oligonucleotide aCGH on FFPE diffuse gliomas. We first compared aCGH using bacterial artificial chromosome (BAC) arrays in 45 paired frozen and FFPE gliomas, and demonstrate a high concordance rate between FFPE and frozen DNA in an individual clone-level analysis of sensitivity and specificity, assuring that under certain array conditions, frozen and FFPE DNA can perform nearly identically. However, because oligonucleotide arrays offer advantages to BAC arrays in genomic coverage and practical availability, we next developed a method of labeling DNA from FFPE tissue that allows efficient hybridization to oligonucleotide arrays. To demonstrate utility in FFPE tissues, we applied this approach to biphasic anaplastic oligoastrocytomas and demonstrate CNA differences between DNA obtained from the two components. Therefore, BAC and oligonucleotide aCGH can be sensitive and specific tools for detecting CNAs in FFPE DNA, and novel labeling techniques enable the routine use of oligonucleotide arrays for FFPE DNA. In combination, these advances should facilitate genome-wide analysis of rare, small and/or histologically heterogeneous gliomas from FFPE tissues.

Conductivity and band alignment of LaCrO3/SrTiO3 (111) heterostructure

NASA Astrophysics Data System (ADS)

Hong, Yan-Peng; Wang, Xin-Xin; Qu, Guo-Liang; Li, Cheng-Jian; Xue, Hong-Xia; Liu, Ke-Jian; Li, Yong-Chun; Xiong, Chang-Min; Dou, Rui-Fen; He, Lin; Nie, Jia-Cai

2018-04-01

Not Available Project supported by the National Natural Science Foundation of China (Grant Nos. 11674031, 11474022 11474024, 11422430, and 11374035) and the National Basic Research Program of China (Grant Nos. 2014CB920903, 2013CB921701, and 2013CBA01603).

Math: Basic Skills Content Standards

ERIC Educational Resources Information Center

CASAS - Comprehensive Adult Student Assessment Systems (NJ1), 2008

2008-01-01

This document presents content standards tables for math. [CASAS content standards tables are designed for educators at national, state and local levels to inform the alignment of content standards, instruction and assessment. The Content Standards along with the CASAS Competencies form the basis of the CASAS integrated assessment and curriculum…

PRACTICAL STRATEGIES FOR PROCESSING AND ANALYZING SPOTTED OLIGONUCLEOTIDE MICROARRAY DATA

EPA Science Inventory

Thoughtful data analysis is as important as experimental design, biological sample quality, and appropriate experimental procedures for making microarrays a useful supplement to traditional toxicology. In the present study, spotted oligonucleotide microarrays were used to profile...

Editorial Commentary: A Model for Shoulder Rotator Cuff Repair and for Basic Science Investigations.

PubMed

Brand, Jefferson C

2018-04-01

"Breaking the fourth wall" is a theater convention where the narrator or character speaks directly to the audience. As an Assistant Editor-in-Chief, as I comment on a recent basic science study investigating rotator cuff repair, I break the fourth wall and articulate areas of basic science research excellence that align with the vision that we hold for our journal. Inclusion of a powerful video strengthens the submission. We prefer to publish clinical videos in our companion journal, Arthroscopy Techniques, and encourage basic science video submissions to Arthroscopy. Basic science research requires step-by-tedious-step analogous to climbing a mountain. Establishment of a murine rotator cuff repair model was rigorous and research intensive, biomechanically, radiographically, histologically, and genetically documented, a huge step toward the bone-to-tendon healing research summit. This research results in a model for both rotator cuff repair and the pinnacle of quality, basic science research. Copyright © 2018 Arthroscopy Association of North America. Published by Elsevier Inc. All rights reserved.

Base-Pairing Systems Related to TNA: alpha-Threofuranosyl Oligonucleotides Containing Phosphoramidate Linkages

NASA Technical Reports Server (NTRS)

Meyer, Michael (Technical Monitor); Wu, Xiaolin; Guntha, Sreenivasulu; Ferenclc, Mathias; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

2002-01-01

(3'NH)- and (2'NH)-TNA, two isomeric phosphoramidate analogues of TNA (alpha-threofuranosyl-(3'-2') oligonucleotides), are shown to be efficient Watson-Crick base-pairing systems and to undergo intersystem crosspairing with TNA, RNA, and DNA.

Validation of the Swine Protein-Annotated Oligonucleotide Microarray

USDA-ARS?s Scientific Manuscript database

The specificity and utility of the Swine Protein-Annotated Oligonucleotide Microarray, or Pigoligoarray (www.pigoligoarray.org), has been evaluated by profiling the expression of transcripts from four porcine tissues. Tools for comparative analyses of expression on the Pigoligoarray were developed i...

Identifying members of the domain Archaea with rRNA-targeted oligonucleotide probes.

PubMed

Burggraf, S; Mayer, T; Amann, R; Schadhauser, S; Woese, C R; Stetter, K O

1994-09-01

Two 16S rRNA-targeted oligonucleotide probes were designed for the archaeal kingdoms Euryachaeota and Crenarchaeota. Probe specificities were evaluated by nonradioactive dot blot hybridization against selected reference organisms. The successful application of fluorescent-probe derivatives for whole-cell hybridization required organism-specific optimizations of fixation and hybridization conditions to assure probe penetration and morphological integrity of the cells. The probes allowed preliminary grouping of three new hyperthermophilic isolates. Together with other group-specific rRNA-targeted oligonucleotide probes, these probes will facilitate rapid in situ monitoring of the populations present in hydrothermal systems and support cultivation attempts.

Nucleic acid amplification using modular branched primers

DOEpatents

Ulanovsky, Levy; Raja, Mugasimangalam C.

2001-01-01

Methods and compositions expand the options for making primers for use in amplifying nucleic acid segments. The invention eliminates the step of custom synthesis of primers for Polymerase Chain Reactions (PCR). Instead of being custom-synthesized, a primer is replaced by a combination of several oligonucleotide modules selected from a pre-synthesized library. A modular combination of just a few oligonucleotides essentially mimics the performance of a conventional, custom-made primer by matching the sequence of the priming site in the template. Each oligonucleotide module has a segment that matches one of the stretches within the priming site.

Rapid purification of circular DNA by triplex-mediated affinity capture

DOEpatents

Ji, H.; Smith, L.M.

1997-01-07

A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support. 3 figs.

Fluorescent triplex-forming DNA oligonucleotides labeled with a thiazole orange dimer unit

PubMed Central

Ikeda, Shuji; Yanagisawa, Hiroyuki; Yuki, Mizue; Okamoto, Akimitsu

2013-01-01

Fluorescent probes for the detection of a double-stranded DNA were prepared by labeling a triplex-forming DNA oligonucleotide with a thiazole orange (TO) dimer unit. They belong to ECHO (exciton-controlled hybridization-sensitive fluorescent oligonucleotide) probes which we have previously reported. The excitonic interaction between the two TO molecules was expected to effectively suppress the background fluorescence of the probes. The applicability of the ECHO probes for the detection of double-stranded DNA was confirmed by examining the thermal stability and photophysical and kinetic properties of the DNA triplexes formed by the ECHO probes. PMID:23445822

Polynucleotides. XXXII. Further studies on the synthesis of oligonucleotides containing 8,2'-S-cycloadenosine.

PubMed Central

Ikehara, M; Tezuka, T

1975-01-01

A dinucleoside monophosphate, 8,2'-anhydro-8-mercapto-9-beta-D-arabinofuranosyladenine phosphoryl-(3'-5')-inosine (AspI) was synthesized by the condensation of protected 8-mercapto-adenosine 2',3'-cyclic phosphate and 2',3'-isopropylideneinosine with diphenylphosphorochloridate. 8-Mercaptoadenosine 2',3'-cyclic phosphate was polymerized by using tetraphenyl pyrophosphate as the condensing reagent. As oligonucleotides, thus obtained, contained some uncyclized 8-mercaptoadenosine residues and were cleaved at these sites with 0.3N KOH. As 5'-phosphate was synthesized and polymerized with DCC to give oligonucleotides with chain lengths 2 to 9. PMID:170595

Nucleoside-O-Methyl-(H)-Phosphinates: Novel Monomers for the Synthesis of Methylphosphonate Oligonucleotides Using H-Phosphonate Chemistry.

PubMed

Kostov, Ondřej; Páv, Ondřej; Rosenberg, Ivan

2017-09-18

This unit comprises the straightforward synthesis of protected 2'-deoxyribonucleoside-O-methyl-(H)-phosphinates in both 3'- and 5'-series. These compounds represent a new class of monomers compatible with the solid-phase synthesis of oligonucleotides using H-phosphonate chemistry and are suitable for the preparation of both 3'- and 5'-O-methylphosphonate oligonucleotides. The synthesis of 4-toluenesulfonyloxymethyl-(H)-phosphinic acid as a new reagent for the preparation of O-methyl-(H)-phosphinic acid derivatives is described. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

FDA-Approved Oligonucleotide Therapies in 2017.

PubMed

Stein, Cy A; Castanotto, Daniela

2017-05-03

Oligonucleotides (oligos) have been under clinical development for approximately the past 30 years, beginning with antisense oligonucleotides (ASOs) and apatmers and followed about 15 years ago by siRNAs. During that lengthy period of time, numerous clinical trials have been performed and thousands of trial participants accrued onto studies. Of all the molecules evaluated as of January 2017, the regulatory authorities assessed that six provided clear clinical benefit in rigorously controlled trials. The story of these six is given in this review. Copyright © 2017 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.

An oral oligonucleotide delivery system based on a thiolated polymer: Development and in vitro evaluation.

PubMed

Martien, Ronny; Hoyer, Herbert; Perera, Glen; Schnürch, Andreas Bernkop

2011-08-01

The purpose of this study was to develop and evaluate an oral oligonucleotide delivery system based on a thiolated polymer/reduced glutathione (GSH) system providing a protective effect toward nucleases and permeation enhancement. A polycarbophil-cysteine conjugate (PCP-Cys) was synthesized. Enzymatic degradation of a model oligonucleotide by DNase I and within freshly collected intestinal fluid was investigated in the absence and presence of PCP-Cys. Permeation studies with PCP-Cys/GSH versus control were performed in vitro on Caco-2 cell monolayers and ex vivo on rat intestinal mucosa. PCP-Cys displayed 223 ± 13.8 μmol thiol groups per gram polymer. After 4h, 61% of the free oligonucleotides were degraded by DNase I and 80% within intestinal fluid. In contrast, less than 41% (DNase I) and 60% (intestinal fluid) were degraded in the presence of 0.02% (m/v) PCP-Cys. Permeation studies revealed an 8-fold (Caco-2) and 10-fold (intestinal mucosa) increase in apparent permeability compared to buffer control. Hence, this PCP-Cys/GSH system might be a promising tool for the oral administration of oligonucleotides as it allows a significant protection toward degrading enzymes and facilitates their transport across intestinal membranes. Copyright © 2011 Elsevier B.V. All rights reserved.

Development of species-specific rDNA probes for Giardia by multiple fluorescent in situ hybridization combined with immunocytochemical identification of cyst wall antigens.

PubMed

Erlandsen, Stanley L; Jarroll, Edward; Wallis, Peter; van Keulen, Harry

2005-08-01

In this study, we describe the development of fluorescent oligonucleotide probes to variable regions in the small subunit of 16S rRNA in three distinct Giardia species. Sense and antisense probes (17-22 mer) to variable regions 1, 3, and 8 were labeled with digoxygenin or selected fluorochomes (FluorX, Cy3, or Cy5). Optimal results were obtained with fluorochome-labeled oligonucleotides for detection of rRNA in Giardia cysts. Specificity of fluorescent in situ hybridization (FISH) was shown using RNase digestion and high stringency to diminish the hybridization signal, and oligonucleotide probes for rRNA in Giardia lamblia, Giardia muris, and Giardia ardeae were shown to specifically stain rRNA only within cysts or trophozoites of those species. The fluorescent oligonucleotide specific for rRNA in human isolates of Giardia was positive for ten different strains. A method for simultaneous FISH detection of cysts using fluorescent antibody (genotype marker) and two oligonucleotide probes (species marker) permitted visualization of G. lamblia and G. muris cysts in the same preparation. Testing of an environmental water sample revealed the presence of FISH-positive G. lamblia cysts with a specific rDNA probe for rRNA, while negative cysts were presumed to be of animal or bird origin.

A dual-colored ratiometric-fluorescent oligonucleotide probe for the detection of human telomerase RNA in cell extracts.

PubMed

Ning, Dianhua; He, Changtian; Liu, Zhengjie; Liu, Cui; Wu, Qilong; Zhao, TingTing; Liu, Renyong

2017-05-21

Human telomerase RNA (hTR), which is one component of telomerase, was deemed to be a biomarker to monitor tumor cells due to its different expression levels in tumor cells and normal somatic cells. Thus far, plentiful fluorescent probes have been designed to investigate nucleic acids. However, most of them are limited since they are time-consuming, require professional operators and even result in false positive signals in the cellular environment. Herein, we report a dual-colored ratiometric-fluorescent oligonucleotide probe to achieve the reliable detection of human telomerase RNA in cell extracts. The probe is constructed using a dual-labeled fluorescent oligonucleotide hybridized with target-complemented Dabcyl-labeled oligonucleotide. In the presence of the target, the dual-labeled fluorescent oligonucleotide translates into a hairpin structure, which leads to the generation of the fluorescence resonance energy transfer (FRET) phenomenon under UV excitation. Compared to conventional methods, this strategy could effectively avoid false positive signals, and it not only possesses the advantages of simplicity and high specificity but also has the merits of signal stability and distinguishable color variation. Moreover, the quantitative assay of hTR would have a far-reaching impact on the telomerase mechanism and even tumor diagnosis research.

Single-Cell in Situ RNA Analysis With Switchable Fluorescent Oligonucleotides.

PubMed

Xiao, Lu; Guo, Jia

2018-01-01

Comprehensive RNA analyses in individual cells in their native spatial contexts promise to transform our understanding of normal physiology and disease pathogenesis. Here we report a single-cell in situ RNA analysis approach using switchable fluorescent oligonucleotides (SFO). In this method, transcripts are first hybridized by pre-decoding oligonucleotides. These oligonucleotides subsequently recruit SFO to stain their corresponding RNA targets. After fluorescence imaging, all the SFO in the whole specimen are simultaneously removed by DNA strand displacement reactions. Through continuous cycles of target staining, fluorescence imaging, and SFO removal, a large number of different transcripts can be identified by unique fluorophore sequences and visualized at the optical resolution. To demonstrate the feasibility of this approach, we show that the hybridized SFO can be efficiently stripped by strand displacement reactions within 30 min. We also demonstrate that this SFO removal process maintains the integrity of the RNA targets and the pre-decoding oligonucleotides, and keeps them hybridized. Applying this approach, we show that transcripts can be restained in at least eight hybridization cycles with high analysis accuracy, which theoretically would enable the whole transcriptome to be quantified at the single molecule sensitivity in individual cells. This in situ RNA analysis technology will have wide applications in systems biology, molecular diagnosis, and targeted therapies.

Teachers' Basic Knowledge of Reading Instruction: Insights from a Teacher Preparation Program

ERIC Educational Resources Information Center

Berkeley, Sheri; Regan, Kelley; Dimitrov, Dimiter; Guckert, Mary; Ray, Sharon

2016-01-01

Effective reading instruction is essential for all students, and especially students with disabilities; however, studies have indicated that both pre-service and in-service teachers lack an adequate knowledge of reading. To ensure adequate teacher knowledge, teacher preparation reform advocates suggest purposeful alignment of teacher preparation…

Add Yoga to Your Singing Warm-Ups

ERIC Educational Resources Information Center

Kuhn, Ivana Pinho

2006-01-01

Yoga has much to contribute to singing. The main physical disciplines of yoga are strength, flexibility, alignment, body awareness through breath control, and concentration. These basics also constitute the core of good singing. With instruction incorporated into the regular warm-up, one can introduce beginning yoga ideas into choir practice. Yoga…

Matters of the Heart: Bringing the Values to Life at Eastman Kodak Company.

ERIC Educational Resources Information Center

Tette, Rick; Murray, Mark

1997-01-01

Describes the rationale and implementation of the Eastman Kodak Company's "Fundamentals for Kodak Renewal" employee program. Using adventure activities, employees move through awareness, agreement, and alignment stages to integrate the company's basic values of respect for the dignity of the individual, uncompromising integrity, trust,…

Thermodynamics of Oligonucleotide Duplex Melting

ERIC Educational Resources Information Center

Schreiber-Gosche, Sherrie; Edwards, Robert A.

2009-01-01

Melting temperatures of oligonucleotides are useful for a number of molecular biology applications, such as the polymerase chain reaction (PCR). Although melting temperatures are often calculated with simplistic empirical equations, application of thermodynamics provides more accurate melting temperatures and an opportunity for students to apply…

Gas-phase Reactivity of meta-Benzyne Analogs Toward Small Oligonucleotides of Differing Lengths

NASA Astrophysics Data System (ADS)

Widjaja, Fanny; Max, Joann P.; Jin, Zhicheng; Nash, John J.; Kenttämaa, Hilkka I.

2017-07-01

The gas-phase reactivity of two aromatic carbon-centered σ,σ-biradicals ( meta-benzyne analogs) and a related monoradical towards small oligonucleotides of differing lengths was investigated in a Fourier-transform ion cyclotron resonance (FT-ICR) mass spectrometer coupled with laser-induced acoustic desorption (LIAD). The mono- and biradicals were positively charged to allow for manipulation in the mass spectrometer. The oligonucleotides were evaporated into the gas phase as intact neutral molecules by using LIAD. One of the biradicals was found to be unreactive. The reactive biradical reacts with dinucleoside phosphates and trinucleoside diphosphates mainly by addition to a nucleobase moiety followed by cleavage of the glycosidic bond, leading to a nucleobase radical (e.g., base-H) abstraction. In some instances, after the initial cleavage, the unquenched radical site of the biradical abstracts a hydrogen atom from the neutral fragment, which results in a net nucleobase abstraction. In sharp contrast, the related monoradical mainly undergoes facile hydrogen atom abstraction from the sugar moiety. As the size of the oligonucleotides increases, the rate of hydrogen atom abstraction from the sugar moiety by the monoradical was found to increase due to the presence of more hydrogen atom donor sites, and it is the only reaction observed for tetranucleoside triphosphates. Hence, the monoradical only attacks sugar moieties in these substrates. The biradical also shows significant attack at the sugar moiety for tetranucleoside triphosphates. This drastic change in reactivity indicates that the size of the oligonucleotides plays a key role in the outcome of these reactions. This finding is attributed to more compact conformations in the gas phase for the tetranucleoside triphosphates than for the smaller oligonucleotides, which result from stronger stabilizing interactions between the nucleobases.

Identification of characteristic oligonucleotides in the bacterial 16S ribosomal RNA sequence dataset

NASA Technical Reports Server (NTRS)

Zhang, Zhengdong; Willson, Richard C.; Fox, George E.

2002-01-01

MOTIVATION: The phylogenetic structure of the bacterial world has been intensively studied by comparing sequences of 16S ribosomal RNA (16S rRNA). This database of sequences is now widely used to design probes for the detection of specific bacteria or groups of bacteria one at a time. The success of such methods reflects the fact that there are local sequence segments that are highly characteristic of particular organisms or groups of organisms. It is not clear, however, the extent to which such signature sequences exist in the 16S rRNA dataset. A better understanding of the numbers and distribution of highly informative oligonucleotide sequences may facilitate the design of hybridization arrays that can characterize the phylogenetic position of an unknown organism or serve as the basis for the development of novel approaches for use in bacterial identification. RESULTS: A computer-based algorithm that characterizes the extent to which any individual oligonucleotide sequence in 16S rRNA is characteristic of any particular bacterial grouping was developed. A measure of signature quality, Q(s), was formulated and subsequently calculated for every individual oligonucleotide sequence in the size range of 5-11 nucleotides and for 15mers with reference to each cluster and subcluster in a 929 organism representative phylogenetic tree. Subsequently, the perfect signature sequences were compared to the full set of 7322 sequences to see how common false positives were. The work completed here establishes beyond any doubt that highly characteristic oligonucleotides exist in the bacterial 16S rRNA sequence dataset in large numbers. Over 16,000 15mers were identified that might be useful as signatures. Signature oligonucleotides are available for over 80% of the nodes in the representative tree.

Iontophoretic transport of oligonucleotides across human epidermal membrane: a study of the Nernst-Planck model.

PubMed

Li, S K; Ghanem, A H; Teng, C L; Hardee, G E; Higuchi, W I

2001-07-01

The objective of this study was to investigate the transport behavior of a series of oligonucleotides with human epidermal membrane (HEM) and to examine the applicability of the modified NERNST-PLANCK model to transdermal iontophoresis of these macromolecules. Iontophoretic transport experiments were first carried out in a synthetic model membrane system (Nuclepore membranes) with a four-electrode potentiostat to examine the baseline modified NERNST-PLANCK model. The modified NERNST-PLANCK model derived from the Einstein relation and the Stokes-Einstein equation taken from previous work did not hold for the oligonucleotides. Results obtained in the Nuclepore studies were, however, consistent with predictions of the modified NERNST-PLANCK model using the experimentally determined electromobilities and diffusion coefficients. The electromobilities of the oligonucleotides (determined by capillary electrophoresis) were found to be more than a factor of two smaller than expected from the Einstein relation between electromobilities and diffusion coefficients (the latter determined in diffusion cell experiments). A correlation between these electromobilities and the theoretical electromobilities estimated by considering the effects of counterion binding and the effects of mobility reduction according to colloid theory was also observed. These results suggest that the modified NERNST-PLANCK model predictions are satisfactory only when the electromobilities and the effective molecular size of the oligonucleotides are known and are used directly to predict the iontophoretically enhanced transport. Results with the HEM experiments generally agreed with model predictions based on the experimental electromobilities. The oligonucleotide HEM flux data also suggest the existence of pores with effective pore radii greater than the effective radii estimated in previous studies with small molecular weight model permeants.

In vitro evaluation of phosphorothioate oligonucleotides targeted to the E2 mRNA of papillomavirus: potential treatment for genital warts.

PubMed Central

Cowsert, L M; Fox, M C; Zon, G; Mirabelli, C K

1993-01-01

Papillomaviruses induce benign proliferative lesions, such as genital warts, in humans. The E2 gene product is thought to play a major role in the regulation of viral transcription and DNA replication and may represent a rational target for an antisense oligonucleotide drug action. Phosphorothioate oligonucleotides complementary to E2 mRNAs were synthesized and tested in a series of in vitro bovine papillomavirus (BPV) and human papillomavirus (HPV) models for the ability to inhibit E2 transactivation and virus-induced focus formation. The most active BPV-specific compounds were complementary to the mRNA cap region (ISIS 1751), the translation initiation region for the full-length E2 transactivator (ISIS 1753), and the translation initiation region for the E2 transrepressor mRNA (ISIS 1755). ISIS 1751 and ISIS 1753 were found to reduce E2-dependent transactivation and viral focus formation in a sequence-specific and concentration-dependent manner. ISIS 1755 increased E2 transactivation in a dose-dependent manner but had no effect on focus formation. Oligonucleotides with a chain length of 20 residues had optimal activity in the E2 transactivation assay. On the basis of the above observations, ISIS 2105, a 20-residue phosphorothioate oligonucleotide targeted to the translation initiation of both HPV type 6 (HPV-6) and HPV-11 E2 mRNA, was designed and shown to inhibit E2-dependent transactivation by HPV-11 E2 expressed from a surrogate promoter. These observations support the rationale of E2 as a target for antiviral therapy against papillomavirus infections and specifically identify ISIS 2105 as a candidate antisense oligonucleotide for the treatment of genital warts induced by HPV-6 and HPV-11. Images PMID:8383937

The component alignment model: a new approach to health care information technology strategic planning.

PubMed

Martin, J B; Wilkins, A S; Stawski, S K

1998-08-01

The evolving health care environment demands that health care organizations fully utilize information technologies (ITs). The effective deployment of IT requires the development and implementation of a comprehensive IT strategic plan. A number of approaches to health care IT strategic planning exist, but they are outdated or incomplete. The component alignment model (CAM) introduced here recognizes the complexity of today's health care environment, emphasizing continuous assessment and realignment of seven basic components: external environment, emerging ITs, organizational infrastructure, mission, IT infrastructure, business strategy, and IT strategy. The article provides a framework by which health care organizations can develop an effective IT strategic planning process.

Alignment and Distortion-Free Integration of Lightweight Mirrors into Meta-Shells for High-Resolution Astronomical X-Ray Optics

NASA Technical Reports Server (NTRS)

Chan, Kai-Wing; Zhang, William W.; Schofield, Mark J.; Numata, Ai; Mazzarella, James R.; Saha, Timo T.; Biskach, Michael P.; McCelland, Ryan S.; Niemeyer, Jason; Sharpe, Marton V.;

Application of ERTS imagery to geological mapping

NASA Technical Reports Server (NTRS)

Fernandez, A.; Aranibar, O.; Ballon, P.

1973-01-01

The author has identified the following significant results. In comparing the interpretation of the imagery with that of photomosaics, the following results were derived. The drainage networks of the RBV images show information in greater detail than the photomosaics, and maps, yet maintain scale differences. However, for the basins the mosaics and maps provide better information. The geomorphology is best interpreted in the images of the ERTS-1, not only for the regional countryside, but also for the morphological formations. It was concluded that the satellite images offer the better possibility for identifying the alignment of joints and faults. In the images the relation is 4 to 1. The considered N-S alignments were identified in both systems with a ratio of 2 to 1. The E-W alignments for the areas considered in the ERTS-1 images show a basic Paleozoic formation not previously detected.

INTEGRATED SPEED ESTIMATION MODEL FOR MULTILANE EXPREESSWAYS

NASA Astrophysics Data System (ADS)

Hong, Sungjoon; Oguchi, Takashi

In this paper, an integrated speed-estimation model is developed based on empirical analyses for the basic sections of intercity multilane expressway un der the uncongested condition. This model enables a speed estimation for each lane at any site under arb itrary highway-alignment, traffic (traffic flow and truck percentage), and rainfall conditions. By combin ing this model and a lane-use model which estimates traffic distribution on the lanes by each vehicle type, it is also possible to es timate an average speed across all the lanes of one direction from a traffic demand by vehicle type under specific highway-alignment and rainfall conditions. This model is exp ected to be a tool for the evaluation of traffic performance for expressways when the performance me asure is travel speed, which is necessary for Performance-Oriented Highway Planning and Design. Regarding the highway-alignment condition, two new estimators, called effective horizo ntal curvature and effective vertical grade, are proposed in this paper which take into account the influence of upstream and downstream alignment conditions. They are applied to the speed-estimation model, and it shows increased accuracy of the estimation.

KISS for STRAP: user extensions for a protein alignment editor.

PubMed

Gille, Christoph; Lorenzen, Stephan; Michalsky, Elke; Frömmel, Cornelius

2003-12-12

The Structural Alignment Program STRAP is a comfortable comprehensive editor and analyzing tool for protein alignments. A wide range of functions related to protein sequences and protein structures are accessible with an intuitive graphical interface. Recent features include mapping of mutations and polymorphisms onto structures and production of high quality figures for publication. Here we address the general problem of multi-purpose program packages to keep up with the rapid development of bioinformatical methods and the demand for specific program functions. STRAP was remade implementing a novel design which aims at Keeping Interfaces in STRAP Simple (KISS). KISS renders STRAP extendable to bio-scientists as well as to bio-informaticians. Scientists with basic computer skills are capable of implementing statistical methods or embedding existing bioinformatical tools in STRAP themselves. For bio-informaticians STRAP may serve as an environment for rapid prototyping and testing of complex algorithms such as automatic alignment algorithms or phylogenetic methods. Further, STRAP can be applied as an interactive web applet to present data related to a particular protein family and as a teaching tool. JAVA-1.4 or higher. http://www.charite.de/bioinf/strap/

Delivery of gene biotechnologies to plants: Pathogen and pest control

USDA-ARS?s Scientific Manuscript database

Treatment of oligonucleotides to plants for host delivered suppression of microbes and insect pests of citrus was successful. FANA_ASO, (2'-deoxy-2'-fluoro-D- arabinonucleic acid)_( antisense oligonucleotides- AUM LifeTech) designed to: Asian citrus psyllid; Citrus plant bacterial pathogen of citru...

A regenerated electrochemical biosensor for label-free detection of glucose and urea based on conformational switch of i-motif oligonucleotide probe.

PubMed

Gao, Zhong Feng; Chen, Dong Mei; Lei, Jing Lei; Luo, Hong Qun; Li, Nian Bing

2015-10-15

Improving the reproducibility of electrochemical signal remains a great challenge over the past decades. In this work, i-motif oligonucleotide probe-based electrochemical DNA (E-DNA) sensor is introduced for the first time as a regenerated sensing platform, which enhances the reproducibility of electrochemical signal, for label-free detection of glucose and urea. The addition of glucose or urea is able to activate glucose oxidase-catalyzed or urease-catalyzed reaction, inducing or destroying the formation of i-motif oligonucleotide probe. The conformational switch of oligonucleotide probe can be recorded by electrochemical impedance spectroscopy. Thus, the difference of electron transfer resistance is utilized for the quantitative determination of glucose and urea. We further demonstrate that the E-DNA sensor exhibits high selectivity, excellent stability, and remarkable regenerated ability. The human serum analysis indicates that this simple and regenerated strategy holds promising potential in future biosensing applications. Copyright © 2015 Elsevier B.V. All rights reserved.

The estimation of quantitative parameters of oligonucleotides immobilization on mica surface

NASA Astrophysics Data System (ADS)

Sharipov, T. I.; Bakhtizin, R. Z.

2017-05-01

Immobilization of nucleic acids on the surface of various materials is increasingly being used in research and some practical applications. Currently, the DNA chip technology is rapidly developing. The basis of the immobilization process can be both physical adsorption and chemisorption. A useful way to control the immobilization of nucleic acids on a surface is to use atomic force microscopy. It allows you to investigate the topography of the surface by its direct imaging with high resolution. Usually, to fix the DNA on the surface of mica are used cations which mediate the interaction between the mica surface and the DNA molecules. In our work we have developed a method for estimation of quantitative parameter of immobilization of oligonucleotides is their degree of aggregation depending on the fixation conditions on the surface of mica. The results on study of aggregation of oligonucleotides immobilized on mica surface will be presented. The single oligonucleotides molecules have been imaged clearly, whereas their surface areas have been calculated and calibration curve has been plotted.

Specific DNA duplex formation at an artificial lipid bilayer: towards a new DNA biosensor technology.

PubMed

Werz, Emma; Korneev, Sergei; Montilla-Martinez, Malayko; Wagner, Richard; Hemmler, Roland; Walter, Claudius; Eisfeld, Jörg; Gall, Karsten; Rosemeyer, Helmut

2012-02-01

A novel technique is described which comprises a base-specific DNA duplex formation at a lipid bilayer-H(2) O-phase boundary layer. Two different probes of oligonucleotides both carrying a double-tailed lipid at the 5'-terminus were incorporated into stable artificial lipid bilayers separating two compartments (cis/trans-channel) of an optically transparent microfluidic sample carrier with perfusion capabilities. Both the cis- and trans-channels are filled with saline buffer. Injection of a cyanine-5-labeled target DNA sequence, which is complementary to only one of the oligonucleotide probes, into the cis-channel, followed by a thorough perfusion, leads to an immobilization of the labeled complementary oligonucleotide on the membrane as detected by single-molecule fluorescence spectroscopy and microscopy. In the case of fluorescent but non-complementary DNA sequences, no immobilized fluorescent oligonucleotide duplex could be detected on the membrane. This clearly verifies a specific duplex formation at the membrane interface. Copyright © 2012 Verlag Helvetica Chimica Acta AG, Zürich.

OCaPPI-Db: an oligonucleotide probe database for pathogen identification through hybridization capture.

PubMed

Gasc, Cyrielle; Constantin, Antony; Jaziri, Faouzi; Peyret, Pierre

2017-01-01

The detection and identification of bacterial pathogens involved in acts of bio- and agroterrorism are essential to avoid pathogen dispersal in the environment and propagation within the population. Conventional molecular methods, such as PCR amplification, DNA microarrays or shotgun sequencing, are subject to various limitations when assessing environmental samples, which can lead to inaccurate findings. We developed a hybridization capture strategy that uses a set of oligonucleotide probes to target and enrich biomarkers of interest in environmental samples. Here, we present Oligonucleotide Capture Probes for Pathogen Identification Database (OCaPPI-Db), an online capture probe database containing a set of 1,685 oligonucleotide probes allowing for the detection and identification of 30 biothreat agents up to the species level. This probe set can be used in its entirety as a comprehensive diagnostic tool or can be restricted to a set of probes targeting a specific pathogen or virulence factor according to the user's needs. : http://ocappidb.uca.works. © The Author(s) 2017. Published by Oxford University Press.

Peroxide-mediated desulfurization of phosphorothioate oligonucleotides and its prevention.

PubMed

Krotz, Achim H; Mehta, Rahul C; Hardee, Gregory E

2005-02-01

Desulfurization at the internucleotide phosphorothioate linkage of antisense oligonucleotides (ASOs) in dermatological formulations has been investigated using strong ion exchange chromatography and mass spectroscopy. The formation of phosphate diester linkages appeared to arise from a reaction between the phosphorothioate oligonucleotide and a potent oxidizing agent. Screening of excipients used in the formulation indicated that the cause of desulfurization was related to the presence of polyethylene glycol-derived nonionic surfactants MYRJ 52 or BRIJ 58. Autoxidation of the polyethylene glycol chain is suggested as the probable origin for the observed incompatibility. The ability of various antioxidants to prevent oxidative degradation of ASO-1 in simple test systems and in oil-in-water emulsions is described. It is found that in test systems both lipophilic and hydrophilic antioxidants are effective. However, in cream formulation (oil-in-water emulsions) of ASO-1 the addition of hydrophilic antioxidants L-cysteine or DL-alpha-lipoic acid has been shown to be superior in protecting the oligonucleotide from desulfurization upon storage. Copyright 2004 Wiley-Liss, Inc.

Modulating nanoparticle superlattice structure using proteins with tunable bond distributions

DOE PAGES

McMillan, Janet R.; Brodin, Jeffrey D.; Millan, Jaime A.; ...

2017-01-25

Here, we investigate the use of proteins with tunable DNA modification distributions to modulate nanoparticle superlattice structure. Using Beta-galactosidase (βgal) as a model system, we have employed the orthogonal chemical reactivities of surface amines and thiols to synthesize protein-DNA conjugates with 36 evenly distributed or 8 specifically positioned oligonucleotides. When assembled into crystalline superlattices with AuNPs, we find that the distribution of DNA modifications modulates the favored structure: βgal with uniformly distributed DNA bonding elements results in body-centered cubic crystals, whereas DNA functionalization of cysteines results in AB 2 packing. We probe the role of protein oligonucleotide number and conjugatemore » size on this observation, which revealed the importance of oligonucleotide distribution and number in this observed assembly behavior. These results indicate that proteins with defined DNA-modification patterns are powerful tools to control the nanoparticle superlattices architecture, and establish the importance of oligonucleotide distribution in the assembly behavior of protein-DNA conjugates.« less

DNA/RNA heteroduplex oligonucleotide for highly efficient gene silencing

PubMed Central

Nishina, Kazutaka; Piao, Wenying; Yoshida-Tanaka, Kie; Sujino, Yumiko; Nishina, Tomoko; Yamamoto, Tsuyoshi; Nitta, Keiko; Yoshioka, Kotaro; Kuwahara, Hiroya; Yasuhara, Hidenori; Baba, Takeshi; Ono, Fumiko; Miyata, Kanjiro; Miyake, Koichi; Seth, Punit P.; Low, Audrey; Yoshida, Masayuki; Bennett, C. Frank; Kataoka, Kazunori; Mizusawa, Hidehiro; Obika, Satoshi; Yokota, Takanori

2015-01-01

Antisense oligonucleotides (ASOs) are recognized therapeutic agents for the modulation of specific genes at the post-transcriptional level. Similar to any medical drugs, there are opportunities to improve their efficacy and safety. Here we develop a short DNA/RNA heteroduplex oligonucleotide (HDO) with a structure different from double-stranded RNA used for short interfering RNA and single-stranded DNA used for ASO. A DNA/locked nucleotide acid gapmer duplex with an α-tocopherol-conjugated complementary RNA (Toc-HDO) is significantly more potent at reducing the expression of the targeted mRNA in liver compared with the parent single-stranded gapmer ASO. Toc-HDO also improves the phenotype in disease models more effectively. In addition, the high potency of Toc-HDO results in a reduction of liver dysfunction observed in the parent ASO at a similar silencing effect. HDO technology offers a novel concept of therapeutic oligonucleotides, and the development of this molecular design opens a new therapeutic field. PMID:26258894

Selective Detection of Peptide-Oligonucleotide Heteroconjugates Utilizing Capillary HPLC-ICPMS

NASA Astrophysics Data System (ADS)

Catron, Brittany; Caruso, Joseph A.; Limbach, Patrick A.

2012-06-01

A method for the selective detection and quantification of peptide:oligonucleotide heteroconjugates, such as those generated by protein:nucleic acid cross-links, using capillary reversed-phase high performance liquid chromatography (cap-RPHPLC) coupled with inductively coupled plasma mass spectrometry detection (ICPMS) is described. The selective detection of phosphorus as 31P+, the only natural isotope, in peptide-oligonucleotide heteroconjugates is enabled by the elemental detection capabilities of the ICPMS. Mobile phase conditions that allow separation of heteroconjugates while maintaining ICPMS compatibility were investigated. We found that trifluoroacetic acid (TFA) mobile phases, used in conventional peptide separations, and hexafluoroisopropanol/triethylamine (HFIP/TEA) mobile phases, used in conventional oligonucleotide separations, both are compatible with ICPMS and enable heteroconjugate separation. The TFA-based separations yielded limits of detection (LOD) of ~40 ppb phosphorus, which is nearly seven times lower than the LOD for HFIP/TEA-based separations. Using the TFA mobile phase, 1-2 pmol of a model heteroconjugate were routinely separated and detected by this optimized capLC-ICPMS method.

In Situ Identification of Cyanobacteria with Horseradish Peroxidase-Labeled, rRNA-Targeted Oligonucleotide Probes

PubMed Central

Schönhuber, Wilhelm; Zarda, Boris; Eix, Stella; Rippka, Rosmarie; Herdman, Michael; Ludwig, Wolfgang; Amann, Rudolf

1999-01-01

Individual cyanobacterial cells are normally identified in environmental samples only on the basis of their pigmentation and morphology. However, these criteria are often insufficient for the differentiation of species. Here, a whole-cell hybridization technique is presented that uses horseradish peroxidase (HRP)-labeled, rRNA-targeted oligonucleotides for in situ identification of cyanobacteria. This indirect method, in which the probe-conferred enzyme has to be visualized in an additional step, was necessary since fluorescently monolabeled oligonucleotides were insufficient to overstain the autofluorescence of the target cells. Initially, a nonfluorescent detection assay was developed and successfully applied to cyanobacterial mats. Later, it was demonstrated that tyramide signal amplification (TSA) resulted in fluorescent signals far above the level of autofluorescence. Furthermore, TSA-based detection of HRP was more sensitive than that based on nonfluorescent substrates. Critical points of the assay, such as cell fixation and permeabilization, specificity, and sensitivity, were systematically investigated by using four oligonucleotides newly designed to target groups of cyanobacteria. PMID:10049892

Effect of Molecular Crowding and Ionic Strength on the Isothermal Hybridization of Oligonucleotides

PubMed Central

Markarian, Marie Z.; Schlenoff, Joseph B.

2010-01-01

The isothermal hybridization of complimentary oligonucleotides, 15-mer, 25-mer, 35-mer, and a molecular beacon, was investigated under varying conditions of molecular crowding and ionic strength, using hypochromicity to follow strand pairing and polyethylene glycol as a crowding agent. Thermodynamic analysis of the results revealed the addition of counterions to the oligonucleotide backbones, Δψ, to be dependent on the strand G-C content and the molecular crowding. A decrease in Δψ was observed with both increasing GC% and solution PEG content. In contrast, the number of bound water molecules depended on the activity of Na+, where two regimes were observed. At aNa+⟨0.05 and increasing molecular crowding, water molecules were released into the DNA solutions and oligonucleotide pairing was favored with both increasing hydrophobic forces, while at aNa+≥0.05, water molecules were bound to the strands and the extent of double strand formation decreased with increasing PEG wt%. PMID:20701389

Therapeutic Antisense Oligonucleotides against Cancer: Hurdling to the Clinic

NASA Astrophysics Data System (ADS)

Moreno, Pedro; Pêgo, Ana

2014-10-01

Under clinical development since the early 90’s and with two successfully approved drugs (Fomivirsen and Mipomersen), oligonucleotide-based therapeutics have not yet delivered a clinical drug to the market in the cancer field. Whilst many pre-clinical data has been generated, a lack of understanding still exists on how to efficiently tackle all the different challenges presented for cancer targeting in a clinical setting. Namely, effective drug vectorization, careful choice of target gene or synergistic multi-gene targeting are surely decisive, while caution must be exerted to avoid potential toxic, often misleading off-target-effects. Here a brief overview will be given on the nucleic acid chemistry advances that established oligonucleotide technologies as a promising therapeutic alternative and ongoing cancer related clinical trials. Special attention will be given towards a perspective on the hurdles encountered specifically in the cancer field by this class of therapeutic oligonucleotides and a view on possible avenues for success is presented, with particular focus on the contribution from nanotechnology to the field.

Therapeutic antisense oligonucleotides against cancer: hurdling to the clinic

PubMed Central

Moreno, Pedro M. D.; Pêgo, Ana P.

2014-01-01

Under clinical development since the early 90's and with two successfully approved drugs (Fomivirsen and Mipomersen), oligonucleotide-based therapeutics has not yet delivered a clinical drug to the market in the cancer field. Whilst many pre-clinical data has been generated, a lack of understanding still exists on how to efficiently tackle all the different challenges presented for cancer targeting in a clinical setting. Namely, effective drug vectorization, careful choice of target gene or synergistic multi-gene targeting are surely decisive, while caution must be exerted to avoid potential toxic, often misleading off-target-effects. Here a brief overview will be given on the nucleic acid chemistry advances that established oligonucleotide technologies as a promising therapeutic alternative and ongoing cancer related clinical trials. Special attention will be given toward a perspective on the hurdles encountered specifically in the cancer field by this class of therapeutic oligonucleotides and a view on possible avenues for success is presented, with particular focus on the contribution from nanotechnology to the field. PMID:25353019

Mucin-mediated nanocarrier disassembly for triggered uptake of oligonucleotides as a delivery strategy for the potential treatment of mucosal tumours

NASA Astrophysics Data System (ADS)

Martirosyan, A.; Olesen, M. J.; Fenton, R. A.; Kjems, J.; Howard, K. A.

2016-06-01

This work demonstrates gastric mucin-triggered nanocarrier disassembly for release of antisense oligonucleotides and consequent unassisted cellular entry as a novel oral delivery strategy. A fluorescence activation-based reporter system was used to investigate the interaction and mucin-mediated disassembly of chitosan-based nanocarriers containing a 13-mer DNA oligonucleotide with a flanked locked RNA nucleic acid gapmer design. Gastric mucins were shown to trigger gapmer release from nanocarriers that was dependent on the interaction time, mucin concentration and N : P ratio with a maximal release at N : P 10. In contrast to siRNA, naked gapmers exhibited uptake into mucus producing HT-MTX mono-cultures and HT-MTX co-cultured with the carcinoma epithelial cell line Caco-2. Importantly, in vivo gapmer uptake was observed in epithelial tissue 30 min post-injection in murine intestinal loops. The findings present a mucosal design-based system tailored for local delivery of oligonucleotides that may maximize the effectiveness of gene silencing therapeutics within tumours at mucosal sites.This work demonstrates gastric mucin-triggered nanocarrier disassembly for release of antisense oligonucleotides and consequent unassisted cellular entry as a novel oral delivery strategy. A fluorescence activation-based reporter system was used to investigate the interaction and mucin-mediated disassembly of chitosan-based nanocarriers containing a 13-mer DNA oligonucleotide with a flanked locked RNA nucleic acid gapmer design. Gastric mucins were shown to trigger gapmer release from nanocarriers that was dependent on the interaction time, mucin concentration and N : P ratio with a maximal release at N : P 10. In contrast to siRNA, naked gapmers exhibited uptake into mucus producing HT-MTX mono-cultures and HT-MTX co-cultured with the carcinoma epithelial cell line Caco-2. Importantly, in vivo gapmer uptake was observed in epithelial tissue 30 min post-injection in murine intestinal loops. The findings present a mucosal design-based system tailored for local delivery of oligonucleotides that may maximize the effectiveness of gene silencing therapeutics within tumours at mucosal sites. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr07206a

Kinetic and mechanistic analysis of dinucleotide and oligonucleotide formation from the 5'-phosphorimidazolide of adenosine on Na(+)-montmorillonite

NASA Technical Reports Server (NTRS)

Kawamura, K.; Ferris, J. P.

1994-01-01

The rate constants for the condensation reaction of the 5'-phosphorimidazolide of adenosine (ImpA) to form dinucleotides and oligonucleotides have been measured in the presence of Na(+)-volclay (a Na(+)-montmorillonite) in pH 8 aqueous solution at 25 degrees C. The rates of the reaction of ImpA with an excess of adenosine 5'-monophosphoramidate (NH2pA), P1,P2-diadenosine 5',5'-pyrophosphate (A5'ppA), or adenosine 5'-monophosphate (5'-AMP or pA) in the presence of the montmorillonite to form NH2pA3'pA, A5'ppA3'pA, and pA3'pA, respectively, were measured. Only 3',5'-linked products were observed. The magnitude of the rate constants decrease in the order NH2pA3'pA > A5'-ppA3'pA > pA3'pA. The binding of ImpA to montmorillonite was measured, and the adsorption isotherm was determined. The binding of ImpA to montmorillonite and the formation of higher oligonucleotides is not observed in the absence of salts. Mg2+ enhances binding and oligonucleotide formation more than Ca2+ and Na+. The rate constants for the oligonucleotide formation were determined from the reaction products formed from 10 to 40 mM ImpA in the presence of Na(+)-montmorillonite using the computer program SIMFIT. The magnitudes of the rate constants for the formation of oligonucleotides increased in the order 2-mer < 3-mer < 4-mer ... 7-mer. The rate constants for dinucleotide and trinucleotide formation are more than 1000 times larger than those measured in the absence of montmorillonite. The rate constants for the formation of dinucleotide, trinucleotide, and tetranucleotide are 41,2.6, and 3.7 times larger than those for the formation of oligo(G)s with a poly(C) template. The hydrolysis of ImpA was accelerated 35 times in the presence of the montmorillonite. The catalytic ability of montmorillonite to form dinucleotides and oligonucleotides is quantitatively evaluated and possible pathways for oligo(A) formation are proposed.

The basic tilted helix bundle domain of the prolyl isomerase FKBP25 is a novel double-stranded RNA binding module

PubMed Central

Dilworth, David; Bonnafous, Pierre; Edoo, Amiirah Bibi; Bourbigot, Sarah; Pesek-Jardim, Francy; Gudavicius, Geoff; Serpa, Jason J.; Petrotchenko, Evgeniy V.; Borchers, Christoph H.

2017-01-01

Abstract Prolyl isomerases are defined by a catalytic domain that facilitates the cis–trans interconversion of proline residues. In most cases, additional domains in these enzymes add important biological function, including recruitment to a set of protein substrates. Here, we report that the N-terminal basic tilted helix bundle (BTHB) domain of the human prolyl isomerase FKBP25 confers specific binding to double-stranded RNA (dsRNA). This binding is selective over DNA as well as single-stranded oligonucleotides. We find that FKBP25 RNA-association is required for its nucleolar localization and for the vast majority of its protein interactions, including those with 60S pre-ribosome and early ribosome biogenesis factors. An independent mobility of the BTHB and FKBP catalytic domains supports a model by which the N-terminus of FKBP25 is anchored to regions of dsRNA, whereas the FKBP domain is free to interact with neighboring proteins. Apart from the identification of the BTHB as a new dsRNA-binding module, this domain adds to the growing list of auxiliary functions used by prolyl isomerases to define their primary cellular targets. PMID:29036638

Oligonucleotide-based therapy for neurodegenerative diseases.

PubMed

Magen, Iddo; Hornstein, Eran

2014-10-10

Molecular genetics insight into the pathogenesis of several neurodegenerative diseases, such as Alzheimer׳s disease, Parkinson׳s disease, Huntington׳s disease and amyotrophic lateral sclerosis, encourages direct interference with the activity of neurotoxic genes or the molecular activation of neuroprotective pathways. Oligonucleotide-based therapies are recently emerging as an efficient strategy for drug development and these can be employed as new treatments of neurodegenerative states. Here we review advances in this field in recent years which suggest an encouraging assessment that oligonucleotide technologies for targeting of RNAs will enable the development of new therapies and will contribute to preservation of brain integrity. Copyright © 2014 Elsevier B.V. All rights reserved.

Inhibition of B cell proliferation by antisense DNA to both alpha and beta forms of Fc epsilon R II.

PubMed

Bhatti, L; Behle, K; Stevens, R H

1992-10-01

Epstein-Barr Virus (EBV) infection activates B lymphocyte proliferation through partially understood mechanisms, resulting in phenotypic changes, including the appearance of new antigens. One such antigen is Fc epsilon R II/CD-23 which may be relevant for B cell proliferation. We have used anti-sense oligonucleotides to study the importance of the two forms of this molecule for proliferation in the EBV-transformed, Fc epsilon R II +ve lymphoblastoid B cell line, RPMI 8866. Anti-sense oligodeoxynucleotides were generated to the two forms of Fc epsilon R II; Fc epsilon R IIa (alpha) and IIb (beta) which differ only in their intracytoplasmic domains. Addition of increasing concentrations of anti-sense oligonucleotides, ranging from 1 to 30 microM, significantly decreased cellular proliferation as measured by the incorporation of [3H]thymidine (inhibition range 8-88%). Optimum inhibition of cellular proliferation was apparent at 15 microM concentration of both anti-sense Fc epsilon R IIa and IIb (Fc epsilon R IIa, mean +/- SE = 75 +/- 7% inhibition, p less than 0.001; Fc epsilon R IIb, mean +/- SE = 71 +/- 7% inhibition, p less than 0.001). Anti-sense oligonucleotides complementary to the common part of Fc epsilon R II resulted in a similar inhibition of proliferation. Sense oligonucleotides did not induce significant inhibition. Preincubation of sense and anti-sense oligonucleotides resulted in an abrogation of proliferation inhibition. Moreover, none of these oligonucleotides had any effect on a Fc epsilon R II -ve cell line. Incubation with both anti-sense IIa and IIb resulted in additive, but not synergistic inhibition of proliferation. Addition of soluble Fc epsilon R II did not reverse inhibition of proliferation, suggesting that membrane-bound or intracellular rather than soluble Fc epsilon R II was important for the induced proliferation. Analysis of cell surface expression for Fc epsilon II indicated that while there was a pronounced effect on cell number following incubation with anti-sense oligonucleotides, surface expression of Fc epsilon R II was consistent as measured over different time points. PCR analysis revealed that while most cells expressed either the alpha or the beta form of Fc epsilon R II, EBV-transformed cell lines, particularly RPMI 8866, were found to express both alpha and beta forms simultaneously. This may constitute a mechanism whereby EBV infection confers an immortal state to the cell, resulting in its uncontrolled proliferation. Cell lines expressing only one receptor form, either alpha or beta, were unaffected after incubation with anti-sense oligonucleotides.(ABSTRACT TRUNCATED AT 400 WORDS)

Liver as a target for oligonucleotide therapeutics.

PubMed

Sehgal, Alfica; Vaishnaw, Akshay; Fitzgerald, Kevin

2013-12-01

Oligonucleotide-based therapeutics are an emerging class of drugs that hold the promise for silencing "un-druggable" targets,thus creating unique opportunities for innovative medicines. As opposed to gene therapy, oligonucleotides are considered to be more akin to small molecule therapeutics because they are small,completely synthetic in origin, do not integrate into the host genome,and have a defined duration of therapeutic activity after which effects recover to baseline. They offer a high degree of specificity at the genetic level, thereby reducing off-target effects.At the same time, they provide a strategy for targeting any gene in the genome, including transcripts that produce mutated proteins.Oligonucleotide-based therapeutics include short interfering RNA (siRNA), that degrade target mRNA through RISC mediated RNAi; anti-miRs, that target miRNAs; miRNA mimics, that regulate target mRNA; antisense oligonucleotides, that may be working through RNAseH mediated mRNA decay; mRNA upregulation,by targeting long non-coding RNAs; and oligonucleotides induced alternative splicing [1]. All these approaches require some minimal degree of homology at the nucleic acid sequence level for them to be functional. The different mechanisms of action and their relevant activity are outlined in Fig. 1. Besides homology,RNA secondary structure has also been exploited in the case of ribozymes and aptamers, which act by binding to nucleic acids or proteins, respectively. While there have been many reports of gene knockdown and gene modulation in cell lines and mice with all these methods, very few have advanced to clinical stages.The main obstacle to date has been the safe and effective intracellular delivery of these compounds in higher species, including humans. Indeed, their action requires direct interaction with DNA/RNA within the target cell so even when one solves the issues of tissue and cellular access, intracellular/intranuclear location represents yet another barrier to overcome. To date,hepatic delivery of oligonucleotides has been the area with greatest progress, and thus we have focused on liver-targeted therapeutics that have shown promise at the preclinical and/or clinical level.The liver is the largest internal organ in the body, playing a central role in metabolism, detoxification, synthesis, and secretion of major plasma proteins (carrier proteins, coagulation factors,complement components, hormones, and apolipoproteins),and iron homeostasis. It is therefore not surprising that a large number of disease targets reside in the liver where they are susceptible to modulation by oligonucleotide therapies.

The high stability of the triple helices formed between short purine oligonucleotides and SIV/HIV-2 vpx genes is determined by the targeted DNA structure.

PubMed Central

Svinarchuk, F; Monnot, M; Merle, A; Malvy, C; Fermandjian, S

1995-01-01

In our previous works we have shown that the oligonucleotides 5'-GGGGAGGGGGAGG-3' and 5'-GGAGGGGGAGGGG-3' give very stable and specific triplexes with their target double stranded DNAs [Svinarchuk, F., Bertrand, J.-R. and Malvy, C. (1994) Nucleic Acids Res., 22, 3742-3747; Svinarchuk, F., Paoletti, J. and Malvy, C. (1995) J. Biol. Chem., 270, 14 068-14,071]. The target for the invariable part of these oligonucleotides, 5'-GGAGGGGGAGG-3', is found in a highly conserved 20 bp long purine/pyrimidine tract of the vpx gene of the SIV and HIV-2 viruses and could be a target for oligonucleotide directed antivirus therapy. Here were report on the ability of four purine oligonucleotides with different lengths (11-, 14-, 17- and 20-mer) to form triplexes with the purine/pyrimidine stretch of the vpx gene. Triplex formation was tested by joint dimethyl sulfate (DMS) footprint, gel-retardation assay, circular dichroism (CD) and UV-melting studies. Dimethyl sulfate footprint studies revealed the antiparallel orientation of the third strand to the purine strand of the Watson-Crick duplex. However, the protection of the guanines at the ends of the target sequence decreased as the length of the third strand oligonucleotide increased. Melting temperature studies provided profiles with only one transition for all of the triplexes. The melting temperatures of the triplexes were found to be the same as for the targeted duplex in the case of the 11- and 14-mer third strands while for the 17- and 20-mer third strands the melting temperature of the triplexes were correspondingly 4 and 8 degrees C higher than for the duplex. Heating and cooling melting curves were reversible for all of the tested triplexes except one with the 20-mer third strand oligonucleotide. Circular dichroism spectra showed the ability of the target DNA to adopt an A-like DNA conformation. Upon triplex formation the A-DNA form becomes even more pronounced. This effect depends on the length of the third strand oligonucleotide: the CD spectrum shows a 'classical' A-DNA shape with the 20-mer. This is not observed with the purine/pyrimidine stretch of the HIV-1 DNA which keeps a B-like spectrum even after triplex formation. We suggest, that an A-like duplex DNA is required for the formation of a stable DNA purine(purine-pyrimidine) triplex. Images PMID:7479024

The clinical potential of Enhanced-ice-COLD-PCR.

PubMed

Tost, Jörg

2016-01-01

Enhanced-ice-COLD-PCR (E-ice-COLD-PCR) is a novel assay format that allows for the efficient enrichment and sensitive detection of all mutations in a region of interest using a chemically modified blocking oligonucleotide, which impedes the amplification of wild-type sequences. The assay is compatible with DNA extracted from tissue and cell-free circulating DNA. The main features of E-ice-COLD-PCR are the simplicity of the setup and the optimization of the assay, the use of standard laboratory equipment and the very short time to results (~4 h including DNA extraction, enrichment and sequence-based identification of mutations). E-ice-COLD-PCR is therefore a highly promising technology for a number of basic research as well as clinical applications including detection of clinically relevant mutated subclones and monitoring of treatment response or disease recurrence.

Enhancing the efficacy of cytotoxic agents for cancer therapy using photochemical internalisation

PubMed Central

Moore, Caroline M.; Loizidou, Marilena; MacRobert, Alexander J.; Woodhams, Josephine H.

2016-01-01

Photochemical internalisation (PCI) is a technique for improving cellular delivery of certain bioactive agents which are prone to sequestration within endolysosomes. There is a wide range of agents suitable for PCI‐based delivery including toxins, oligonucleotides, genes and immunoconjugates which demonstrates the versatility of this technique. The basic mechanism of PCI involves triggering release of the agent from endolysosomes within the target cells using a photosensitiser which is selectively retained with the endolysosomal membranes. Excitation of the photosensitiser by visible light leads to disruption of the membranes via photooxidative damage thereby releasing the agent into the cytosol. This treatment enables the drugs to reach their intended subcellular target more efficiently and improves their efficacy. In this review we summarise the applications of this technique with the main emphasis placed on cancer chemotherapy. PMID:25758607

Pyrophosphorolytic dismutation of oligodeoxy-nucleotides by terminal deoxynucleotidyltransferase.

PubMed Central

Anderson, R S; Bollum, F J; Beattie, K L

1999-01-01

Terminal transferase (TdT), when incubated with a purified(32)P-5"-end-labeled oligonucleotide of defined length in the presence of Co(2+), Mn(2+)or Mg(2+)and 2-mercaptoethanol in cacodylate or HEPES buffer, pH 7.2, exhibits the ability to remove a 3"-nucleotide from one oligonucleotide and add it to the 3"-end of another. When analyzed by urea-PAGE, this activity is observed as a disproportionation of the starting oligonucleotide into a ladder of shorter and longer oligonucleotides distributed around the starting material. Optimal metal ion concentration is 1-2 mM. All three metal ions support this activity with Co(2+)> Mn(2+) congruent with Mg(2+). Oligonucleotides p(dT) and p(dA) are more efficient substrates than p(dG) and p(dC) because the latter may form secondary structures. The dismutase activity is significant even in the presence of dNTP concentrations comparable to those that exist in the nucleus during the G(1)phase of the cell cycle. Using BetaScope image analysis the rate of pyrophosphorolytic dismutase activity was found to be only moderately slower than the poly-merization activity. These results may help explain the GC-richness of immunoglobulin gene segment joins (N regions) and the loss of bases that occur during gene rearrangements in pre-B and pre-T cells. PMID:10454617

The illusion of specific capture: surface and solution studies of suboptimal oligonucleotide hybridization

PubMed Central

2013-01-01

Background Hybridization based assays and capture systems depend on the specificity of hybridization between a probe and its intended target. A common guideline in the construction of DNA microarrays, for instance, is that avoiding complementary stretches of more than 15 nucleic acids in a 50 or 60-mer probe will eliminate sequence specific cross-hybridization reactions. Here we present a study of the behavior of partially matched oligonucleotide pairs with complementary stretches starting well below this threshold complementarity length – in silico, in solution, and at the microarray surface. The modeled behavior of pairs of oligonucleotide probes and their targets suggests that even a complementary stretch of sequence 12 nt in length would give rise to specific cross-hybridization. We designed a set of binding partners to a 50-mer oligonucleotide containing complementary stretches from 6 nt to 21 nt in length. Results Solution melting experiments demonstrate that stable partial duplexes can form when only 12 bp of complementary sequence are present; surface hybridization experiments confirm that a signal close in magnitude to full-strength signal can be obtained from hybridization of a 12 bp duplex within a 50mer oligonucleotide. Conclusions Microarray and other molecular capture strategies that rely on a 15 nt lower complementarity bound for eliminating specific cross-hybridization may not be sufficiently conservative. PMID:23445545

Retention of nucleic acids in ion-pair reversed-phase high-performance liquid chromatography depends not only on base composition but also on base sequence.

PubMed

Qiao, Jun-Qin; Liang, Chao; Wei, Lan-Chun; Cao, Zhao-Ming; Lian, Hong-Zhen

2016-12-01

The study on nucleic acid retention in ion-pair reversed-phase high-performance liquid chromatography mainly focuses on size-dependence, however, other factors influencing retention behaviors have not been comprehensively clarified up to date. In this present work, the retention behaviors of oligonucleotides and double-stranded DNAs were investigated on silica-based C 18 stationary phase by ion-pair reversed-phase high-performance liquid chromatography. It is found that the retention of oligonucleotides was influenced by base composition and base sequence as well as size, and oligonucleotides prone to self-dimerization have weaker retention than those not prone to self-dimerization but with the same base composition. However, homo-oligonucleotides are suitable for the size-dependent separation as a special case of oligonucleotides. For double-stranded DNAs, the retention is also influenced by base composition and base sequence, as well as size. This may be attributed to the interaction of exposed bases in major or minor grooves with the hydrophobic alky chains of stationary phase. In addition, no specific influence of guanine and cytosine content was confirmed on retention of double-stranded DNAs. Notably, the space effect resulted from the stereostructure of nucleic acids also influences the retention behavior in ion-pair reversed-phase high-performance liquid chromatography. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Stabilizing effect of propionic acid derivative of anthraquinone--polyamine conjugate incorporated into α-β chimeric oligonucleotides on the alternate-stranded triple helix.

PubMed

Moriguchi, Tomohisa; Azam, A T M Zafrul; Shinozuka, Kazuo

2011-06-15

Two types of anthraquinone conjugates were synthesized as non-nucleosidic oligonucleotide components. These include an anthraquinone derivative conjugated with 2,2-bis(hydroxymethyl)propionic acid and an anthraquinone--polyamine derivative conjugated with 2,2-bis(hydroxymethyl)propionic acid. The conjugates were successfully incorporated into the "linking-region" of the α-β chimeric oligonucleotides via phosphoramidite method as non-nucleosidic backbone units. The resultant novel α-β chimeric oligonucleotides possessed two diastereomers that were generated by the introduction of the anthraquinone conjugate with a stereogenic carbon atom. The isomers were successfully separated by a reversed-phase HPLC. UV-melting experiments revealed that both stereoisomers formed a substantially stable alternate-strand triple helix, irrespective of the stereochemistry of the incorporated non-nucleosidic backbone unit. However, the enhancing effect on thermal stability depended on the length of the alkyl linker connecting anthraquinone moiety and the propionic acid moiety. The sequence discrimination ability of the chimeric oligonucleotides toward mismatch target duplex was also examined. The T(m) values of the triplexes containing the mismatch target were substantially lower than the T(m) values of those containing the full-match target. The thermodynamic parameters (ΔH°, ΔS°, and ΔG°) required for the dissociation of the triplexes into the third strand and target duplex were also measured.

Identification of clinically relevant viridans streptococci by an oligonucleotide array.

PubMed

Chen, Chao Chien; Teng, Lee Jene; Kaiung, Seng; Chang, Tsung Chain

2005-04-01

Viridans streptococci (VS) are common etiologic agents of subacute infective endocarditis and are capable of causing a variety of pyogenic infections. Many species of VS are difficult to differentiate by phenotypic traits. An oligonucleotide array based on 16S-23S rRNA gene intergenic spacer (ITS) sequences was developed to identify 11 clinically relevant VS. These 11 species were Streptococcus anginosus, S. constellatus, S. gordonii, S. intermedius, S. mitis, S. mutans, S. oralis, S. parasanguinis, S. salivarius, S. sanguinis, and S. uberis. The method consisted of PCR amplification of the ITS regions by using a pair of universal primers, followed by hybridization of the digoxigenin-labeled PCR products to a panel of species-specific oligonucleotides immobilized on a nylon membrane. After 120 strains of the 11 species of VG and 91 strains of other bacteria were tested, the sensitivity and specificity of the oligonucleotide array were found to be 100% (120 of 120 strains) and 95.6% (87 of 91 strains), respectively. S. pneumoniae cross-hybridized to the probes used for the identification of S. mitis, and simple biochemical tests such as optochin susceptibility or bile solubility should be used to differentiate S. pneumoniae from S. mitis. In conclusion, identification of species of VS by use of the present oligonucleotide array is accurate and could be used as an alternative reliable method for species identification of strains of VS.

PCSK9 LNA antisense oligonucleotides induce sustained reduction of LDL cholesterol in nonhuman primates.

PubMed

Lindholm, Marie W; Elmén, Joacim; Fisker, Niels; Hansen, Henrik F; Persson, Robert; Møller, Marianne R; Rosenbohm, Christoph; Ørum, Henrik; Straarup, Ellen M; Koch, Troels

2012-02-01

Proprotein convertase subtilisin/kexin type 9 (PCSK9) has emerged as a therapeutic target for the reduction of low-density lipoprotein cholesterol (LDL-C). PCSK9 increases the degradation of the LDL receptor, resulting in high LDL-C in individuals with high PCSK9 activity. Here, we show that two locked nucleic acid (LNA) antisense oligonucleotides targeting PCSK9 produce sustained reduction of LDL-C in nonhuman primates after a loading dose (20 mg/kg) and four weekly maintenance doses (5 mg/kg). PCSK9 messenger RNA (mRNA) and serum PCSK9 protein were reduced by 85% which resulted in a 50% reduction in circulating LDL-C. Serum total cholesterol (TC) levels were reduced to the same extent as LDL-C with no reduction in high-density lipoprotein levels, demonstrating a specific pharmacological effect on LDL-C. The reduction in hepatic PCSK9 mRNA correlated with liver LNA oligonucleotide content. This verified that anti-PCSK9 LNA oligonucleotides regulated LDL-C through an antisense mechanism. The compounds were well tolerated with no observed effects on toxicological parameters (liver and kidney histology, alanine aminotransferase, aspartate aminotransferase, urea, and creatinine). The pharmacologic evidence and initial safety profile of the compounds used in this study indicate that LNA antisense oligonucleotides targeting PCSK9 provide a viable therapeutic strategy and are potential complements to statins in managing high LDL-C.

A Model for Integrating Assessment across an Undergraduate Political Science Major

ERIC Educational Resources Information Center

Mills, Shala; Bennett, Bryan; Crawford, C. B.; Gould, Lawrence

2009-01-01

A call to engagement at Fort Hays State University (FHSU) led to significant curricular and assessment changes in the university's Department of Political Science. The university unveiled the Year of the Department (YOTD) as "an ongoing strategic initiative for orchestrating change and aligning people, systems and culture at the basic unit…

Curriculum Alignment, Globalization, and Quality Assurance in South African Higher Education

ERIC Educational Resources Information Center

McDonald, Ria; van der Horst, Helen

2007-01-01

The democratization of South Africa has necessitated a transformation of the education system. The current transformational landscape of higher education in South Africa requires that basic curriculum concepts, and principles be rediscovered and, rethought with a view to ensuring that future educational practice is based on sound, and proven…

Enhancing Student Motivation in College and University Physical Activity Courses Using Instructional Alignment Practices

ERIC Educational Resources Information Center

Kim, MooSong; Cardinal, Bradley J.; Yun, Joonkoo

2015-01-01

Motivation is a key factor in promoting students' active engagement in regular physical activity. According to self-determination theory -- one of the prominent motivational theories -- for this to occur, students' basic psychological needs must be met (i.e., their need for autonomy, competence and relatedness). Students' self-determined…

Aligning Literacy Practices in Secondary History Classes with Research on Learning

ERIC Educational Resources Information Center

Nokes, Jeffery D.

2008-01-01

Literacy is a basic element of the discipline of history and of traditional secondary history instruction. However neither the growing body of research on learning with texts nor modern learning theories support the traditional literacy practices that are taking place in many secondary history classrooms. Nor are classroom literacy practices a…

An Implementation of the Action Space Concept in Behavioral Analysis.

ERIC Educational Resources Information Center

Higgs, Gary K.

The Contact Action Space (CAS) of an individual, or group of individuals, has a significant impact on the location of activities and the organization of the use of space. Beginning with the most basic components of a CAS, the individual behavior pattern element is developed, and operational variations affecting alignment and configuration are…

Integration of Skills and Competencies in the Missouri Marketing Education Core Curriculum. Section II.

ERIC Educational Resources Information Center

Ruhland, Sheila K.; Wilkinson, Richard F.

This publication contains teaching activities for the Fundamentals of Marketing and Advanced Marketing curriculum. Chapter 1 presents an alignment of the marketing education core competencies within the nine curriculum units for Fundamentals of Marketing and Advanced Marketing as they relate to the basic academic skills, advanced academic skills,…

The Color TV; Radio and Television Service 3: 9787.04.

ERIC Educational Resources Information Center

Dade County Public Schools, Miami, FL.

The 135 hour course is the terminus of the series of radio and television service courses. The basic course includes a study of color signal demodulation and matrix circuits, the color-picture tube, alignment and trouble shooting of a color television receiver. Laboratory experiments and live production work on color television receivers…

Community Schools: Improving Student Learning/Strengthening Schools, Families, and Communities. A Handbook for State Policy Leaders.

ERIC Educational Resources Information Center

Coalition for Community Schools, Washington, DC.

This handbook is designed to help state leaders form vital connections between schools and communities to improve student learning. It explains that community schools are beneficial because they meet students' basic needs, including safety; offer high quality curriculum and teaching aligned with academic standards; provide learning experiences…

Mechanistic Studies of Oligonucleotide Aptamers With Potent Antiproliferative and Pro-Apoptotic Activity Against Prostate Cancer Cells

DTIC Science & Technology

2007-05-01

AD_________________ Award Number: W81XWH-04-1-0183 TITLE: Mechanistic Studies of Oligonucleotide...Ph.D. CONTRACTING ORGANIZATION: University of Louisville...Louisville, KY 40292-0001 REPORT DATE: May 2007 TYPE OF REPORT: Final PREPARED FOR: U.S. Army Medical Research and Materiel Command

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yeo, Hyun Koo; Lee, Jae Young

2012-04-18

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

PubMed

Yeo, Hyun Koo; Lee, Jae Young

2010-05-01

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

Laboratory Experiments on Rotation and Alignment of the Analogs of Interstellar Dust Grains by Radiation

NASA Technical Reports Server (NTRS)

Abbas, M. M.; Craven, P. D.; Spann, J. F.; Tankosic, D.; LeClair, A.; Gallagher, D. L.; West, E. A.; Weingartner, J. C.; Witherow, W. K.; Tielens, A. G. G. M.

2004-01-01

The processes and mechanisms involved in the rotation and alignment of interstellar dust grains have been of great interest in astrophysics ever since the surprising discovery of the polarization of starlight more than half a century ago. Numerous theories, detailed mathematical models and numerical studies of grain rotation and alignment with respect to the Galactic magnetic field have been presented in the literature. In particular, the subject of grain rotation and alignment by radiative torques has been shown to be of particular interest in recent years. However, despite many investigations, a satisfactory theoretical understanding of the processes involved in grain rotation and alignment has not been achieved. As there appears to be no experimental data available on this subject, we have carried out some unique experiments to illuminate the processes involved in rotation of dust grains in the interstellar medium. In this paper we present the results of some preliminary laboratory experiments on the rotation of individual micron/submicron size nonspherical dust grains levitated in an electrodynamic balance evacuated to pressures of approximately 10(exp -3) to 10(exp -5) torr. The particles are illuminated by laser light at 5320 Angstroms, and the grain rotation rates are obtained by analyzing the low frequency (approximately 0-100 kHz) signal of the scattered light detected by a photodiode detector. The rotation rates are compared with simple theoretical models to retrieve some basic rotational parameters. The results are examined in the light of the current theories of alignment.

A Systolic Array-Based FPGA Parallel Architecture for the BLAST Algorithm

PubMed Central

Guo, Xinyu; Wang, Hong; Devabhaktuni, Vijay

2012-01-01

A design of systolic array-based Field Programmable Gate Array (FPGA) parallel architecture for Basic Local Alignment Search Tool (BLAST) Algorithm is proposed. BLAST is a heuristic biological sequence alignment algorithm which has been used by bioinformatics experts. In contrast to other designs that detect at most one hit in one-clock-cycle, our design applies a Multiple Hits Detection Module which is a pipelining systolic array to search multiple hits in a single-clock-cycle. Further, we designed a Hits Combination Block which combines overlapping hits from systolic array into one hit. These implementations completed the first and second step of BLAST architecture and achieved significant speedup comparing with previously published architectures. PMID:25969747

GRIL: genome rearrangement and inversion locator.

PubMed

Darling, Aaron E; Mau, Bob; Blattner, Frederick R; Perna, Nicole T

2004-01-01

GRIL is a tool to automatically identify collinear regions in a set of bacterial-size genome sequences. GRIL uses three basic steps. First, regions of high sequence identity are located. Second, some of these regions are filtered based on user-specified criteria. Finally, the remaining regions of sequence identity are used to define significant collinear regions among the sequences. By locating collinear regions of sequence, GRIL provides a basis for multiple genome alignment using current alignment systems. GRIL also provides a basis for using current inversion distance tools to infer phylogeny. GRIL is implemented in C++ and runs on any x86-based Linux or Windows platform. It is available from http://asap.ahabs.wisc.edu/gril

ASSESSMENT OF THE SWINE PROTEIN-ANNOTATED OLIGONUCLEOTIDE MICROARRAY AND UTILITY OF THE ARRAYS FOR EQTL AND TRANSCRIPTIONAL PROFILING STUDIES

USDA-ARS?s Scientific Manuscript database

We have evaluated the new Swine Protein-Annotated Oligonucleotide Microarray (http://www.pigoligoarray.org) by analyzing transcriptional profiles for longissimus dorsi muscle (LD), Bronchial lymph node (BLN) and Lung. Four LD samples were used to assess the stringency of hybridization conditions com...

Protein-RNA crosslinking in Escherichia coli 30S ribosomal subunits. Identification of a 16S rRNA fragment crosslinked to protein S12 by the use of the chemical crosslinking reagent 1-ethyl-3-dimethyl-aminopropylcarbodiimide.

PubMed Central

Chiaruttini, C; Expert-Bezançon, A; Hayes, D; Ehresmann, B

1982-01-01

1-ethyl-3-dimethyl aminopropylcarbodiimide (EDC) was used to cross-link 30S ribosomal proteins to 16S rRNA within the E. coli 3OS ribosomal subunit. Covalently linked complexes containing 30S proteins and 16S rRNA, isolated by sedimentation of dissociated crosslinked 30S subunits through SDS containing sucrose gradients, were digested with RNase T1, and the resulting oligonucleotide-protein complexes were fractionated on SDS containing polyacrylamide gels. Eluted complexes containing 30S proteins S9 and S12 linked to oligonucleotides were obtained in pure form. Oligonucleotide 5'terminal labelling was successful in the case of S12 containing but not of the S9 containing complex and led to identification of the S12 bound oligonucleotide as CAACUCG which is located at positions 1316-1322 in the 16S rRNA sequence. Protein S12 is crosslinked to the terminal G of this heptanucleotide. Images PMID:6760129

Structural properties of oligonucleotide monolayers on gold surfaces probed by fluorescence investigations.

PubMed

Rant, Ulrich; Arinaga, Kenji; Fujita, Shozo; Yokoyama, Naoki; Abstreiter, Gerhard; Tornow, Marc

2004-11-09

We present optical investigations on the conformation of oligonucleotide layers on Au surfaces. Our studies concentrate on the effect of varying surface coverage densities on the structural properties of layers of 12- and 24mer single-stranded DNA, tethered to the Au surface at one end while being labeled with a fluorescent marker at the opposing end. The distance-dependent energy transfer from the marker dye to the metal surface, which causes quenching of the observed fluorescence, is used to provide information on the orientation of the DNA strands relative to the surface. Variations in the oligonucleotide coverage density, as determined from electrochemical quantification, over 2 orders of magnitude are achieved by employing different preparation conditions. The observed enhancement in fluorescence intensity with increasing DNA coverage can be related to a model involving mutual steric interactions of oligonucleotides on the surface, as well as fluorescence quenching theory. Finally, the applicability of the presented concepts for investigations of heterogeneous monolayers is demonstrated by means of studying the coadsorption of mercaptohexanol onto DNA-modified Au surfaces.

Discrimination of heterogenous mRNAs encoding strychnine-sensitive glycine receptors in Xenopus oocytes by antisense oligonucleotides.

PubMed Central

Akagi, H; Patton, D E; Miledi, R

1989-01-01

Three synthetic oligodeoxynucleotides complementary to different parts of an RNA encoding a glycine receptor subunit were used to discriminate heterogenous mRNAs coding for glycine receptors in adult and neonatal rat spinal cord. Injection of the three antisense oligonucleotides into Xenopus oocytes specifically inhibited the expression of glycine receptors by adult spinal cord mRNA. In contrast, the antisense oligonucleotides were much less potent in inhibiting the expression of glycine receptors encoded by neonatal spinal cord mRNA. Northern blot analysis revealed that the oligonucleotides hybridized mostly to an adult cord transcript of approximately 10 kilobases in size. This band was also present in neonatal spinal cord mRNA but its density was about one-fourth of the adult cord message. There was no intense band in the low molecular weight position (approximately 2 kilobases), the existence of which was expected from electrophysiological studies with size-fractionated mRNA of neonatal spinal cord. Our results suggest that in the rat spinal cord there are at least three different types of mRNAs encoding functional strychnine-sensitive glycine receptors. Images PMID:2479016

Use of continuous/contiguous stacking hybridization as a diagnostic tool

DOEpatents

Mirzabekov, Andrei Darievich; Kirillov, Eugene Vladislavovich; Parinov, Sergei Valeryevich; Barski, Victor Evgenievich; Dubiley, Svetlana Alekseevna

2002-01-01

A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates. A method is also provided for determining the length of a repeat sequence in DNA or RNA, and also for determining the base sequence of unknown DNA or RNA.

Use of continuous/contiguous stacking hybridization as a diagnostic tool

DOEpatents

Mirzabekov, Andrei Darievich; Kirillov, Eugene Vladislavovich; Parinov, Sergei Valeryevich; Barski, Victor Evgenievich; Dubiley, Svetlana Alekseevna

2000-01-01

A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates. A method is also provided for determining the length of a repeat sequence in DNA or RNA, and also for determining the base sequence of unknown DNA or RNA.

Targeting the r(CGG) repeats that cause FXTAS with modularly assembled small molecules and oligonucleotides.

PubMed

Tran, Tuan; Childs-Disney, Jessica L; Liu, Biao; Guan, Lirui; Rzuczek, Suzanne; Disney, Matthew D

2014-04-18

We designed small molecules that bind the structure of the RNA that causes fragile X-associated tremor ataxia syndrome (FXTAS), an incurable neuromuscular disease. FXTAS is caused by an expanded r(CGG) repeat (r(CGG)(exp)) that inactivates a protein regulator of alternative pre-mRNA splicing. Our designed compounds modulate r(CGG)(exp) toxicity in cellular models of FXTAS, and pull-down experiments confirm that they bind r(CGG)(exp) in vivo. Importantly, compound binding does not affect translation of the downstream open reading frame (ORF). We compared molecular recognition properties of our optimal compound to oligonucleotides. Studies show that r(CGG)(exp)'s self-structure is a significant energetic barrier for oligonucleotide binding. A fully modified 2'-OMethyl phosphorothioate is incapable of completely reversing an FXTAS-associated splicing defect and inhibits translation of the downstream ORF, which could have deleterious effects. Taken together, these studies suggest that a small molecule that recognizes structure may be more well suited for targeting highly structured RNAs that require strand invasion by a complementary oligonucleotide.

Targeting the r(CGG) Repeats That Cause FXTAS with Modularly Assembled Small Molecules and Oligonucleotides

PubMed Central

2015-01-01

We designed small molecules that bind the structure of the RNA that causes fragile X-associated tremor ataxia syndrome (FXTAS), an incurable neuromuscular disease. FXTAS is caused by an expanded r(CGG) repeat (r(CGG)exp) that inactivates a protein regulator of alternative pre-mRNA splicing. Our designed compounds modulate r(CGG)exp toxicity in cellular models of FXTAS, and pull-down experiments confirm that they bind r(CGG)expin vivo. Importantly, compound binding does not affect translation of the downstream open reading frame (ORF). We compared molecular recognition properties of our optimal compound to oligonucleotides. Studies show that r(CGG)exp’s self-structure is a significant energetic barrier for oligonucleotide binding. A fully modified 2′-OMethyl phosphorothioate is incapable of completely reversing an FXTAS-associated splicing defect and inhibits translation of the downstream ORF, which could have deleterious effects. Taken together, these studies suggest that a small molecule that recognizes structure may be more well suited for targeting highly structured RNAs that require strand invasion by a complementary oligonucleotide. PMID:24506227

Analytical Devices Based on Direct Synthesis of DNA on Paper.

PubMed

Glavan, Ana C; Niu, Jia; Chen, Zhen; Güder, Firat; Cheng, Chao-Min; Liu, David; Whitesides, George M

2016-01-05

This paper addresses a growing need in clinical diagnostics for parallel, multiplex analysis of biomarkers from small biological samples. It describes a new procedure for assembling arrays of ssDNA and proteins on paper. This method starts with the synthesis of DNA oligonucleotides covalently linked to paper and proceeds to assemble microzones of DNA-conjugated paper into arrays capable of simultaneously capturing DNA, DNA-conjugated protein antigens, and DNA-conjugated antibodies. The synthesis of ssDNA oligonucleotides on paper is convenient and effective with 32% of the oligonucleotides cleaved and eluted from the paper substrate being full-length by HPLC for a 32-mer. These ssDNA arrays can be used to detect fluorophore-linked DNA oligonucleotides in solution, and as the basis for DNA-directed assembly of arrays of DNA-conjugated capture antibodies on paper, detect protein antigens by sandwich ELISAs. Paper-anchored ssDNA arrays with different sequences can be used to assemble paper-based devices capable of detecting DNA and antibodies in the same device and enable simple microfluidic paper-based devices.

Method for performing site-specific affinity fractionation for use in DNA sequencing

DOEpatents

Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

1999-01-01

A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

Miniaturized reaction vessel system, method for performing site-specific biochemical reactions and affinity fractionation for use in DNA sequencing

DOEpatents

Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

2000-01-01

A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

G-Quadruplex Forming Oligonucleotides as Anti-HIV Agents.

PubMed

Musumeci, Domenica; Riccardi, Claudia; Montesarchio, Daniela

2015-09-22

Though a variety of different non-canonical nucleic acids conformations have been recognized, G-quadruplex structures are probably the structural motifs most commonly found within known oligonucleotide-based aptamers. This could be ascribed to several factors, as their large conformational diversity, marked responsiveness of their folding/unfolding processes to external stimuli, high structural compactness and chemo-enzymatic and thermodynamic stability. A number of G-quadruplex-forming oligonucleotides having relevant in vitro anti-HIV activity have been discovered in the last two decades through either SELEX or rational design approaches. Improved aptamers have been obtained by chemical modifications of natural oligonucleotides, as terminal conjugations with large hydrophobic groups, replacement of phosphodiester linkages with phosphorothioate bonds or other surrogates, insertion of base-modified monomers, etc. In turn, detailed structural studies have elucidated the peculiar architectures adopted by many G-quadruplex-based aptamers and provided insight into their mechanism of action. An overview of the state-of-the-art knowledge of the relevance of putative G-quadruplex forming sequences within the viral genome and of the most studied G-quadruplex-forming aptamers, selectively targeting HIV proteins, is here presented.

Formation of oligonucleotide adducts in pharmaceutical formulations.

PubMed

Krotz, Achim H; Gaus, Hans; Hardee, Gregory E

2005-01-01

During preformulation studies, we observed that oligonucleotide extracted from topical formulations contained considerable amounts of covalently modified oligonucleotide adducts. In this report, we describe the identification and characterization of reaction products that form when PS-oligodeoxyribonucleotide ISIS 2302 (1) is brought into contact with aqueous solutions of glycerol-derived excipients. Compatibility tests showed that the presence of certain glycerides in the formulation lead to adduct formation (1+58x amu, 1+72x amu, 1+58x+72y amu, x, and y are the number of modifications on one oligonucleotide strand). No adduct formation was observed in the presence of triglycerides or propylene glycol-derived excipients used in the study. Using nucleosides as model compounds, two modifications of deoxyguanosine were isolated by preparative reversed phase (RP)-high pressure liquid chromatography (HPLC) and characterized by nuclear magnetic resonance (NMR) and HPLC-mass spectrometry (MS). Modifications were identified as N2-(1-carboxymethyl)- and N2-(1-carboxyethyl) derivatives of 2'-deoxyguanosine. The mechanism of formation of these adducts may involve advanced glycation reactions possibly caused by excipient impurities or degradation products such as glyceraldehyde or glyceraldehyde derivatives.

Regulation of the activity of the promoter of RNA-induced silencing, C3PO.

PubMed

Sahu, Shriya; Williams, Leo; Perez, Alberto; Philip, Finly; Caso, Giuseppe; Zurawsky, Walter; Scarlata, Suzanne

2017-09-01

RNA-induced silencing is a process which allows cells to regulate the synthesis of specific proteins. RNA silencing is promoted by the protein C3PO (component 3 of RISC). We have previously found that phospholipase Cβ, which increases intracellular calcium levels in response to specific G protein signals, inhibits C3PO activity towards certain genes. Understanding the parameters that control C3PO activity and which genes are impacted by G protein activation would help predict which genes are more vulnerable to downregulation. Here, using a library of 10 18 oligonucleotides, we show that C3PO binds oligonucleotides with structural specificity but little sequence specificity. Alternately, C3PO hydrolyzes oligonucleotides with a rate that is sensitive to substrate stability. Importantly, we find that oligonucleotides with higher Tm values are inhibited by bound PLCβ. This finding is supported by microarray analysis in cells over-expressing PLCβ1. Taken together, this study allows predictions of the genes whose post-transcriptional regulation is responsive to the G protein/phospholipase Cβ/calcium signaling pathway. © 2017 The Protein Society.

Assembly of a biocompatible triazole-linked gene by one-pot click-DNA ligation

NASA Astrophysics Data System (ADS)

Kukwikila, Mikiembo; Gale, Nittaya; El-Sagheer, Afaf H.; Brown, Tom; Tavassoli, Ali

2017-11-01

The chemical synthesis of oligonucleotides and their enzyme-mediated assembly into genes and genomes has significantly advanced multiple scientific disciplines. However, these approaches are not without their shortcomings; enzymatic amplification and ligation of oligonucleotides into genes and genomes makes automation challenging, and site-specific incorporation of epigenetic information and/or modified bases into large constructs is not feasible. Here we present a fully chemical one-pot method for the assembly of oligonucleotides into a gene by click-DNA ligation. We synthesize the 335 base-pair gene that encodes the green fluorescent protein iLOV from ten functionalized oligonucleotides that contain 5ʹ-azide and 3ʹ-alkyne units. The resulting click-linked iLOV gene contains eight triazoles at the sites of chemical ligation, and yet is fully biocompatible; it is replicated by DNA polymerases in vitro and encodes a functional iLOV protein in Escherichia coli. We demonstrate the power and potential of our one-pot gene-assembly method by preparing an epigenetically modified variant of the iLOV gene.

A Targeted Oligonucleotide Enhancer of SMN2 Exon 7 Splicing Forms Competing Quadruplex and Protein Complexes in Functional Conditions

PubMed Central

Smith, Lindsay D.; Dickinson, Rachel L.; Lucas, Christian M.; Cousins, Alex; Malygin, Alexey A.; Weldon, Carika; Perrett, Andrew J.; Bottrill, Andrew R.; Searle, Mark S.; Burley, Glenn A.; Eperon, Ian C.

2014-01-01

Summary The use of oligonucleotides to activate the splicing of selected exons is limited by a poor understanding of the mechanisms affected. A targeted bifunctional oligonucleotide enhancer of splicing (TOES) anneals to SMN2 exon 7 and carries an exonic splicing enhancer (ESE) sequence. We show that it stimulates splicing specifically of intron 6 in the presence of repressing sequences in intron 7. Complementarity to the 5′ end of exon 7 increases U2AF65 binding, but the ESE sequence is required for efficient recruitment of U2 snRNP. The ESE forms at least three coexisting discrete states: a quadruplex, a complex containing only hnRNP F/H, and a complex enriched in the activator SRSF1. Neither hnRNP H nor quadruplex formation contributes to ESE activity. The results suggest that splicing limited by weak signals can be rescued by rapid exchange of TOES oligonucleotides in various complexes and raise the possibility that SR proteins associate transiently with ESEs. PMID:25263560

Diamond cubic phase of monoolein and water as an amphiphilic matrix for electrophoresis of oligonucleotides.

PubMed

Carlsson, Nils; Winge, Ann-Sofie; Engström, Sven; Akerman, Björn

2005-10-06

We used a cubic liquid crystal formed by the nonionic monoglyceride monoolein and water as a porous matrix for the electrophoresis of oligonucleotides. The diamond cubic phase is thermodynamically stable when in contact with a water-rich phase, which we exploit to run the electrophoresis in the useful submarine mode. Oligonucleotides are separated according to size and secondary structure by migration through the space-filling aqueous nanometer pores of the regular liquid crystal, but the comparatively slow migration means the cubic phase will not be a replacement for the conventional DNA gels. However, our demonstration that the cubic phase can be used in submarine electrophoresis opens up the possibility for a new matrix for electrophoresis of amphiphilic molecules. From this perspective, the results on the oligonucleotides show that water-soluble particles of nanometer size, typical for the hydrophilic parts of membrane-bound proteins, may be a useful separation motif. A charged contamination in the commercial sample of monoolein, most likely oleic acid that arises from its hydrolysis, restricts useful buffer conditions to a pH below 5.6.

Method for performing site-specific affinity fractionation for use in DNA sequencing

DOEpatents

Mirzabekov, A.D.; Lysov, Y.P.; Dubley, S.A.

1999-05-18

A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between the cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting the extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to the extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from the array. 14 figs.

[Inheritable phenotypic normalization of rodent cells transformed by simian adenovirus SA7 E1 oncogenes by singled-stranded oligonucleotides complementary to a long region of integrated oncogenes].

PubMed

Grineva, N I; Borovkova, T V; Sats, N V; Kurabekova, R M; Rozhitskaia, O S; Solov'ev, G Ia; Pantin, V I

1995-08-01

G11 mouse cells and SH2 rat cells transformed with simian adenovirus SA7 DNA showed inheritable oncogen-specific phenotypic normalization when treated with sense and antisense oligonucleotides complementary to long RNA sequences, plus or minus strands of the integrated adenovirus oncogenes E1A and E1B. Transitory treatment of the cells with the oligonucleotides in the absence of serum was shown to cause the appearance of normalized cell lines with fibroblastlike morphology, slower cell proliferation, and lack of ability to form colonies in soft agar. Proliferative activity and adhesion of the normalized cells that established cell lines were found to depend on the concentration of growth factors in the cultural medium. In some of the cell lines, an inhibition of transcription of the E1 oncogenes was observed. The normalization also produced cells that divided 2 - 5 times and died and cells that reverted to a transformed phenotype in 2 - 10 days. The latter appeared predominantly upon the action of the antisense oligonucleotides.

Particle-Based Microarrays of Oligonucleotides and Oligopeptides.

PubMed

Nesterov-Mueller, Alexander; Maerkle, Frieder; Hahn, Lothar; Foertsch, Tobias; Schillo, Sebastian; Bykovskaya, Valentina; Sedlmayr, Martyna; Weber, Laura K; Ridder, Barbara; Soehindrijo, Miriam; Muenster, Bastian; Striffler, Jakob; Bischoff, F Ralf; Breitling, Frank; Loeffler, Felix F

2014-10-28

In this review, we describe different methods of microarray fabrication based on the use of micro-particles/-beads and point out future tendencies in the development of particle-based arrays. First, we consider oligonucleotide bead arrays, where each bead is a carrier of one specific sequence of oligonucleotides. This bead-based array approach, appearing in the late 1990s, enabled high-throughput oligonucleotide analysis and had a large impact on genome research. Furthermore, we consider particle-based peptide array fabrication using combinatorial chemistry. In this approach, particles can directly participate in both the synthesis and the transfer of synthesized combinatorial molecules to a substrate. Subsequently, we describe in more detail the synthesis of peptide arrays with amino acid polymer particles, which imbed the amino acids inside their polymer matrix. By heating these particles, the polymer matrix is transformed into a highly viscous gel, and thereby, imbedded monomers are allowed to participate in the coupling reaction. Finally, we focus on combinatorial laser fusing of particles for the synthesis of high-density peptide arrays. This method combines the advantages of particles and combinatorial lithographic approaches.

Particle-Based Microarrays of Oligonucleotides and Oligopeptides

PubMed Central

Nesterov-Mueller, Alexander; Maerkle, Frieder; Hahn, Lothar; Foertsch, Tobias; Schillo, Sebastian; Bykovskaya, Valentina; Sedlmayr, Martyna; Weber, Laura K.; Ridder, Barbara; Soehindrijo, Miriam; Muenster, Bastian; Striffler, Jakob; Bischoff, F. Ralf; Breitling, Frank; Loeffler, Felix F.

2014-01-01

In this review, we describe different methods of microarray fabrication based on the use of micro-particles/-beads and point out future tendencies in the development of particle-based arrays. First, we consider oligonucleotide bead arrays, where each bead is a carrier of one specific sequence of oligonucleotides. This bead-based array approach, appearing in the late 1990s, enabled high-throughput oligonucleotide analysis and had a large impact on genome research. Furthermore, we consider particle-based peptide array fabrication using combinatorial chemistry. In this approach, particles can directly participate in both the synthesis and the transfer of synthesized combinatorial molecules to a substrate. Subsequently, we describe in more detail the synthesis of peptide arrays with amino acid polymer particles, which imbed the amino acids inside their polymer matrix. By heating these particles, the polymer matrix is transformed into a highly viscous gel, and thereby, imbedded monomers are allowed to participate in the coupling reaction. Finally, we focus on combinatorial laser fusing of particles for the synthesis of high-density peptide arrays. This method combines the advantages of particles and combinatorial lithographic approaches. PMID:27600347

TGF-beta antisense oligonucleotides reduce mRNA expression of matrix metalloproteinases in cultured wound-healing-related cells.

PubMed

Philipp, Katrin; Riedel, Frank; Germann, Günter; Hörmann, Karl; Sauerbier, Michael

2005-02-01

The pathology of chronic dermal ulcers is characterized by excessive proteolytic activity which degrades extracellular matrix. The transforming growth factor-beta (TGF-beta) has been identified as an important component of wound healing. Recent developments in molecular therapy offer exciting prospects for the modulation of wound healing, specifically those targeting TGF-beta. We investigated the effect of TGF-beta antisense oligonucleotides on the mRNA expression of matrix metalloproteinases in cultured human keratinocytes, fibroblasts and endothelial cells using multiplex RT-PCR. The treatment of keratinocytes and fibroblasts with TGF-beta antisense oligonucleotides resulted in a significant decrease of expression of mRNA of MMP-1 and MMP-9 compared to controls. Accordingly, a decreased expression of MMP-1 mRNA in endothelial cells was detectable. Other MMPs were not affected. Affecting all dermal wound-healing-related cell types, TGF-beta antisense oligonucleotide technology may be a potential therapeutic option for the inhibition of proteolytic tissue destruction in chronic wounds. Pharmaceutical intervention in this area ultimately may help clinicians to proactively intervene in an effort to prevent normal wounds from becoming chronic.

Structures of bacterial polynucleotide kinase in a Michaelis complex with GTP•Mg2+ and 5'-OH oligonucleotide and a product complex with GDP•Mg2+ and 5'-PO4 oligonucleotide reveal a mechanism of general acid-base catalysis and the determinants of phosphoacceptor recognition.

PubMed

Das, Ushati; Wang, Li Kai; Smith, Paul; Jacewicz, Agata; Shuman, Stewart

2014-01-01

Clostridium thermocellum polynucleotide kinase (CthPnk), the 5' end-healing module of a bacterial RNA repair system, catalyzes reversible phosphoryl transfer from an NTP donor to a 5'-OH polynucleotide acceptor. Here we report the crystal structures of CthPnk-D38N in a Michaelis complex with GTP•Mg(2+) and a 5'-OH oligonucleotide and a product complex with GDP•Mg(2+) and a 5'-PO4 oligonucleotide. The O5' nucleophile is situated 3.0 Å from the GTP γ phosphorus in the Michaelis complex, where it is coordinated by Asn38 and is apical to the bridging β phosphate oxygen of the GDP leaving group. In the product complex, the transferred phosphate has undergone stereochemical inversion and Asn38 coordinates the 5'-bridging phosphate oxygen of the oligonucleotide. The D38N enzyme is poised for catalysis, but cannot execute because it lacks Asp38-hereby implicated as the essential general base catalyst that abstracts a proton from the 5'-OH during the kinase reaction. Asp38 serves as a general acid catalyst during the 'reverse kinase' reaction by donating a proton to the O5' leaving group of the 5'-PO4 strand. The acceptor strand binding mode of CthPnk is distinct from that of bacteriophage T4 Pnk.

High-Throughput Identification of Combinatorial Ligands for DNA Delivery in Cell Culture

NASA Astrophysics Data System (ADS)

Svahn, Mathias G.; Rabe, Kersten S.; Barger, Geoffrey; EL-Andaloussi, Samir; Simonson, Oscar E.; Didier, Boturyn; Olivier, Renaudet; Dumy, Pascal; Brandén, Lars J.; Niemeyer, Christof M.; Smith, C. I. Edvard

2008-10-01

Finding the optimal combinations of ligands for tissue-specific delivery is tedious even if only a few well-established compounds are tested. The cargo affects the receptor-ligand interaction, especially when it is charged like DNA. The ligand should therefore be evaluated together with its cargo. Several viruses have been shown to interact with more than one receptor, for efficient internalization. We here present a DNA oligonucleotide-based method for inexpensive and rapid screening of biotin labeled ligands for combinatorial effects on cellular binding and uptake. The oligonucleotide complex was designed as a 44 bp double-stranded DNA oligonucleotide with one central streptavidin molecule and a second streptavidin at the terminus. The use of a highly advanced robotic platform ensured stringent processing and execution of the experiments. The oligonucleotides were fluorescently labeled and used for detection and analysis of cell-bound, internalized and intra-cellular compartmentalized constructs by an automated line-scanning confocal microscope, IN Cell Analyzer 3000. All possible combinations of 22 ligands were explored in sets of 2 and tested on 6 different human cell lines in triplicates. In total, 10 000 transfections were performed on the automation platform. Cell-specific combinations of ligands were identified and their relative position on the scaffold oligonucleotide was found to be of importance. The ligands were found to be cargo dependent, carbohydrates were more potent for DNA delivery whereas cell penetrating peptides were more potent for delivery of less charged particles.

Contribution of the first K-homology domain of poly(C)-binding protein 1 to its affinity and specificity for C-rich oligonucleotides

PubMed Central

Yoga, Yano M. K.; Traore, Daouda A. K.; Sidiqi, Mahjooba; Szeto, Chris; Pendini, Nicole R.; Barker, Andrew; Leedman, Peter J.; Wilce, Jacqueline A.; Wilce, Matthew C. J.

2012-01-01

Poly-C-binding proteins are triple KH (hnRNP K homology) domain proteins with specificity for single stranded C-rich RNA and DNA. They play diverse roles in the regulation of protein expression at both transcriptional and translational levels. Here, we analyse the contributions of individual αCP1 KH domains to binding C-rich oligonucleotides using biophysical and structural methods. Using surface plasmon resonance (SPR), we demonstrate that KH1 makes the most stable interactions with both RNA and DNA, KH3 binds with intermediate affinity and KH2 only interacts detectibly with DNA. The crystal structure of KH1 bound to a 5′-CCCTCCCT-3′ DNA sequence shows a 2:1 protein:DNA stoichiometry and demonstrates a molecular arrangement of KH domains bound to immediately adjacent oligonucleotide target sites. SPR experiments, with a series of poly-C-sequences reveals that cytosine is preferred at all four positions in the oligonucleotide binding cleft and that a C-tetrad binds KH1 with 10 times higher affinity than a C-triplet. The basis for this high affinity interaction is finally detailed with the structure determination of a KH1.W.C54S mutant bound to 5′-ACCCCA-3′ DNA sequence. Together, these data establish the lead role of KH1 in oligonucleotide binding by αCP1 and reveal the molecular basis of its specificity for a C-rich tetrad. PMID:22344691

Contribution of the first K-homology domain of poly(C)-binding protein 1 to its affinity and specificity for C-rich oligonucleotides.

PubMed

Yoga, Yano M K; Traore, Daouda A K; Sidiqi, Mahjooba; Szeto, Chris; Pendini, Nicole R; Barker, Andrew; Leedman, Peter J; Wilce, Jacqueline A; Wilce, Matthew C J

2012-06-01

Poly-C-binding proteins are triple KH (hnRNP K homology) domain proteins with specificity for single stranded C-rich RNA and DNA. They play diverse roles in the regulation of protein expression at both transcriptional and translational levels. Here, we analyse the contributions of individual αCP1 KH domains to binding C-rich oligonucleotides using biophysical and structural methods. Using surface plasmon resonance (SPR), we demonstrate that KH1 makes the most stable interactions with both RNA and DNA, KH3 binds with intermediate affinity and KH2 only interacts detectibly with DNA. The crystal structure of KH1 bound to a 5'-CCCTCCCT-3' DNA sequence shows a 2:1 protein:DNA stoichiometry and demonstrates a molecular arrangement of KH domains bound to immediately adjacent oligonucleotide target sites. SPR experiments, with a series of poly-C-sequences reveals that cytosine is preferred at all four positions in the oligonucleotide binding cleft and that a C-tetrad binds KH1 with 10 times higher affinity than a C-triplet. The basis for this high affinity interaction is finally detailed with the structure determination of a KH1.W.C54S mutant bound to 5'-ACCCCA-3' DNA sequence. Together, these data establish the lead role of KH1 in oligonucleotide binding by αCP1 and reveal the molecular basis of its specificity for a C-rich tetrad.

nuID: a universal naming scheme of oligonucleotides for Illumina, Affymetrix, and other microarrays

PubMed Central

Du, Pan; Kibbe, Warren A; Lin, Simon M

2007-01-01

Background Oligonucleotide probes that are sequence identical may have different identifiers between manufacturers and even between different versions of the same company's microarray; and sometimes the same identifier is reused and represents a completely different oligonucleotide, resulting in ambiguity and potentially mis-identification of the genes hybridizing to that probe. Results We have devised a unique, non-degenerate encoding scheme that can be used as a universal representation to identify an oligonucleotide across manufacturers. We have named the encoded representation 'nuID', for nucleotide universal identifier. Inspired by the fact that the raw sequence of the oligonucleotide is the true definition of identity for a probe, the encoding algorithm uniquely and non-degenerately transforms the sequence itself into a compact identifier (a lossless compression). In addition, we added a redundancy check (checksum) to validate the integrity of the identifier. These two steps, encoding plus checksum, result in an nuID, which is a unique, non-degenerate, permanent, robust and efficient representation of the probe sequence. For commercial applications that require the sequence identity to be confidential, we have an encryption schema for nuID. We demonstrate the utility of nuIDs for the annotation of Illumina microarrays, and we believe it has universal applicability as a source-independent naming convention for oligomers. Reviewers This article was reviewed by Itai Yanai, Rong Chen (nominated by Mark Gerstein), and Gregory Schuler (nominated by David Lipman). PMID:17540033

The hormone response element mimic sequence of GAS5 lncRNA is sufficient to induce apoptosis in breast cancer cells

PubMed Central

Pickard, Mark R.; Williams, Gwyn T.

2016-01-01

Growth arrest-specific 5 (GAS5) lncRNA promotes apoptosis, and its expression is down-regulated in breast cancer. GAS5 lncRNA is a decoy of glucocorticoid/related receptors; a stem-loop sequence constitutes the GAS5 hormone response element mimic (HREM), which is essential for the regulation of breast cancer cell apoptosis. This preclinical study aimed to determine if the GAS5 HREM sequence alone promotes the apoptosis of breast cancer cells. Nucleofection of hormone-sensitive and –insensitive breast cancer cell lines with a GAS5 HREM DNA oligonucleotide increased both basal and ultraviolet-C-induced apoptosis, and decreased culture viability and clonogenic growth, similar to GAS5 lncRNA. The HREM oligonucleotide demonstrated similar sequence specificity to the native HREM for its functional activity and had no effect on endogenous GAS5 lncRNA levels. Certain chemically modified HREM oligonucleotides, notably DNA and RNA phosphorothioates, retained pro-apoptotic. activity. Crucially the HREM oligonucleotide could overcome apoptosis resistance secondary to deficient endogenous GAS5 lncRNA levels. Thus, the GAS5 lncRNA HREM sequence alone is sufficient to induce apoptosis in breast cancer cells, including triple-negative breast cancer cells. These findings further suggest that emerging knowledge of structure/function relationships in the field of lncRNA biology can be exploited for the development of entirely novel, oligonucleotide mimic-based, cancer therapies. PMID:26862727

Telomeric repeat-containing RNA/G-quadruplex-forming sequences cause genome-wide alteration of gene expression in human cancer cells in vivo.

PubMed

Hirashima, Kyotaro; Seimiya, Hiroyuki

2015-02-27

Telomere erosion causes cell mortality, suggesting that longer telomeres enable more cell divisions. In telomerase-positive human cancer cells, however, telomeres are often kept shorter than those of surrounding normal tissues. Recently, we showed that cancer cell telomere elongation represses innate immune genes and promotes their differentiation in vivo. This implies that short telomeres contribute to cancer malignancy, but it is unclear how such genetic repression is caused by elongated telomeres. Here, we report that telomeric repeat-containing RNA (TERRA) induces a genome-wide alteration of gene expression in telomere-elongated cancer cells. Using three different cell lines, we found that telomere elongation up-regulates TERRA signal and down-regulates innate immune genes such as STAT1, ISG15 and OAS3 in vivo. Ectopic TERRA oligonucleotides repressed these genes even in cells with short telomeres under three-dimensional culture conditions. This appeared to occur from the action of G-quadruplexes (G4) in TERRA, because control oligonucleotides had no effect and a nontelomeric G4-forming oligonucleotide phenocopied the TERRA oligonucleotide. Telomere elongation and G4-forming oligonucleotides showed similar gene expression signatures. Most of the commonly suppressed genes were involved in the innate immune system and were up-regulated in various cancers. We propose that TERRA G4 counteracts cancer malignancy by suppressing innate immune genes. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Synthetic oligonucleotide separations by mixed-mode reversed-phase/weak anion-exchange liquid chromatography.

PubMed

Zimmermann, Aleksandra; Greco, Roberto; Walker, Isabel; Horak, Jeannie; Cavazzini, Alberto; Lämmerhofer, Michael

2014-08-08

Synthetic oligonucleotides gain increasing importance in new therapeutic concepts and as probes in biological sciences. If pharmaceutical-grade purities are required, chromatographic purification using ion-pair reversed-phase chromatography is commonly carried out. However, separation selectivity for structurally closely related impurities is often insufficient, especially at high sample loads. In this study, a "mixed-mode" reversed-phase/weak anion exchanger stationary phase has been investigated as an alternative tool for chromatographic separation of synthetic oligonucleotides with minor sequence variations. The employed mixed-mode phase shows great flexibility in method development. It has been run in various gradient elution modes, viz. one, two or three parameter (mixed) gradients (altering buffer pH, buffer concentration, and organic modifier) to find optimal elution conditions and gain further insight into retention mechanisms. Compared to ion-pair reversed-phase and mere anion-exchange separation, enhanced selectivities were observed with the mixed-mode phase for 20-23 nucleotide (nt) long oligonucleotides with similar sequences. Oligonucleotides differing by 1, 2 or 3 nucleotides in length could be readily resolved and separation factors for single nucleotide replacements declined in the order Cytosine (C)/Guanine (G)>Adenine (A)/Guanine∼Guanine/Thymine (T)>Adenine/Cytosine∼Cytosine/Thymine>Adenine/Thymine. Selectivities were larger when the modification was at the 3' terminal-end, declined when it was in the middle of the sequence and was smallest when it was located at the 5' terminus. Due to the lower surface area of the 200Å pore size mixed-mode stationary phase compared to the corresponding 100Å material, lower retention times with equal selectivities under milder elution conditions were achievable. Considering high sample loading capacities of the mixed-mode anion-exchanger phase, it should have great potential for chromatographic oligonucleotide separation and purification. Copyright © 2014 Elsevier B.V. All rights reserved.

Microenvironmental Effect of 2'-O-(1-Pyrenylmethyl)uridine Modified Fluorescent Oligonucleotide Probes on Sensitive and Selective Detection of Target RNA.

PubMed

Imincan, Gülnur; Pei, Fen; Yu, Lijia; Jin, Hongwei; Zhang, Liangren; Yang, Xiaoda; Zhang, Lihe; Tang, XinJing

2016-04-19

2'-O-(1-Pyrenylmethyl)uridine modified oligoribonucleotides provide highly sensitive pyrene fluorescent probes for detecting specific nucleotide mutation of RNA targets. To develop more stable and cost-effective oligonucleotide probes, we investigated the local microenvironmental effects of nearby nucleobases on pyrene fluorescence in duplexes of RNAs and 2'-O-(1-pyrenylmethyl)uridine modified oligonucleotides. By incorporation of deoxyribonucleotides, ribonucleotides, 2'-MeO-nucleotides and 2'-F-nucleotides at both sides of 2'-O-(1-pyrenylmethyl)uridine (U(p)) in oligodeoxynucleotide probes, we synthesized a series of pyrene modified oligonucleotide probes. Their pyrene fluorescence emission spectra indicated that only two proximal nucleotides have a substantial effect on the pyrene fluorescence properties of these oligonucleotide probes hybridized with target RNA with an order of fluorescence sensitivity of 2'-F-nucleotides > 2'-MeO-nucleotides > ribonucleotides ≫ deoxyribonucleotides. While based on circular dichroism spectra, overall helix conformations (either A- or B-form) of the duplexes have marginal effects on the sensitivity of the probes. Instead, the local substitution reflected the propensity of the nucleotide sugar ring to adopt North type conformation and, accordingly, shifted their helix geometry toward a more A-type like conformation in local microenvironments. Thus, higher enhancement of pyrene fluorescence emission favored local A-type helix structures and more polar and hydrophobic environments (F > MeO > OH at 2' substitution) of duplex minor grooves of probes with the target RNA. Further dynamic simulation revealed that local microenvironmental effect of 2'-F-nucleotides or ribonucleotides was enough for pyrene moiety to move out of nucleobases to the minor groove of duplexes; in addition, 2'-F-nucleotide had less effect on π-stack of pyrene-modified uridine with upstream and downstream nucleobases. The present oligonucleotide probes successfully distinguished target RNA from single-mutated RNA analyte during an in vitro assay of RNA synthesis.

Aligning High School and College Instruction: Preparing Students for Success in College Level Mathematics

ERIC Educational Resources Information Center

Alexander, Julie

2013-01-01

Across the United States, students are entering college with a need for improvement in basic mathematics and communication skills. In 2008, the Florida Legislature passed Senate Bill 1908 which changed the expectations for the senior year of high school for many students. Students who score within certain levels on the mandatory high school…

Name that Gene: A Meaningful Computer-Based Genetics Classroom Activity that Incorporates Tolls Used by Real Research Scientists

ERIC Educational Resources Information Center

Wefer, Stephen H.

2003-01-01

"Name That Gene" is a simple classroom activity that incorporates bioinformatics (available biological information) into the classroom using "Basic Logical Alignment Search Tool (BLAST)." An excellent classroom activity involving bioinformatics and "BLAST" has been previously explored using sequences from bacteria, but it is tailored for college…

Templo Mayor, Tenochtitlan - Calendar and Astronomy

NASA Astrophysics Data System (ADS)

Galindo Trejo, Jesús

The Templo Mayor of Tenochtitlan was the principal symbol of political power and religious control of the Mexicas. Its orientation was chosen according to ancestral calendrical traditions that considered the Mesoamerican calendar as a sacred concern. The solar alignments incorporated into this emblematic building symbolized moments that divided the solar year according to basic properties of the Mesoamerican calendar.

Oligoribonucleotide map and protein of CMII: detection of conserved and nonconserved genetic elements in avian acute leukemia viruses CMII, MC29, and MH2.

PubMed Central

Bister, K; Löliger, H C; Duesberg, P H

1979-01-01

RNA and protein of the defective avian acute leukemia virus CMII, which causes myelocytomas in chickens, and of CMII-associated helper virus (CMIIAV) were investigated. The RNA of CMII measured 6 kilobases (kb) and that of CMIIAV measured 8.5 kb. By comparing more than 20 mapped oligonucleotides of CMII RNA with mapped and nonmapped oligonucleotides of acute leukemia viruses MC29 and MH2 and with mapped oligonucleotides of CMIIAV and other nondefective avian tumor viruses, three segments were distinguished in the oligonucleotide map of CMII RNA: (i) a 5' group-specific segment of 1.5 kb which was conserved among CMII, MC29, and MH2 and also homologous with gag-related oligonucleotides of CMIIAV and other helper viruses (hence, group specific); (ii) an internal segment of 2 kb which was conserved specifically among CMII, MC29, and MH2 and whose presence in CMII lends new support to the view that this class of genetic elements is essential for oncogenicity, because it was absent from an otherwise isogenic, nontransforming helper, CMIIAV; and (iii) a 3' group-specific segment of 2.5 kb which shared 13 of 14 oligonucleotides with CMIIAV and included env oligonucleotides of other nondefective viruses of the avian tumor virus group (hence, group specific). This segment and analogous map segments of MC29 and MH2 were not conserved at the level of shared oligonucleotides. CMII-transformed cells contained a nonstructural, gag gene-related protein of 90,000 daltons, distinguished by its size from 110,000-daltom MC29 and 100,000-dalton MH2 counterparts. The gag relatedness and similarity to the 110,000-dalton MC29 counterpart indicated that the 90,000-dalton CMII protein is translated from the 5' and internal segments of CMII RNA. The existence of conserved 5' and internal RNA segments and conserved nonstructural protein products in CMII, MC29, and MH2 indicates that these viruses belong to a related group, termed here the MC29 group. Viruses of the MC29 group differ from one another mainly in their 3' RNA segments and in minor variations of their conserved RNA segments as well as by strain-specific size markers of their gag-related proteins. Because (i) the conserved 5' gag-related and internal RNA segments and their gag-related, nonvirion protein products correlate with the conserved oncogenic spectra of the MC29 group of viruses and because (ii) the internal RNA sequences and nonvirion proteins are not found in nondefective viruses, we propose that the conserved RNA and protein elements are necessary for oncogenicity and probably are the onc gene products of the MC29 group of viruses. Images PMID:232172

Anchoring a Defined Sequence to the 55' Ends of mRNAs : The Bolt to Clone Rare Full Length mRNAs and Generate cDNA Libraries porn a Few Cells.

PubMed

Baptiste, J; Milne Edwards, D; Delort, J; Mallet, J

1993-01-01

Among numerous applications, the polymerase chain reaction (PCR) (1,2) provides a convenient means to clone 5' ends of rare mRNAs and to generate cDNA libraries from tissue available in amounts too low to be processed by conventional methods. Basically, the amplification of cDNAs by the PCR requires the availability of the sequences of two stretches of the molecule to be amplified. A sequence can easily be imposed at the 5' end of the first-strand cDNAs (corresponding to the 3' end of the mRNAs) by priming the reverse transcription with a specific primer (for cloning the 5' end of rare messenger) or with an oligonucleotide tailored with a poly (dT) stretch (for cDNA library construction), taking advantage of the poly (A) sequence that is located at the 3' end of mRNAs. Several strategies have been devised to tag the 3' end of the ss-cDNAs (corresponding to the 55' end of the mRNAs). We (3) and others have described strategies based on the addition of a homopolymeric dG (4,5) or dA (6,7) tail using terminal deoxyribonucleotide transferase (TdT) ("anchor-PCR" [4]). However, this strategy has important limitations. The TdT reaction is difficult to control and has a low efficiency (unpublished observations). But most importantly, the return primers containing a homopolymeric (dC or dT) tail generate nonspecific amplifications, a phenomenon that prevents the isolation of low abundance mRNA species and/or interferes with the relative abundance of primary clones in the library. To circumvent these drawbacks, we have used two approaches. First, we devised a strategy based on a cRNA enrichment procedure, which has been useful to eliminate nonspecific-PCR products and to allow detection and cloning of cDNAs of low abundance (3). More recently, to avoid the nonspecific amplification resulting from the annealing of the homopolymeric tail oligonucleotide, we have developed a novel anchoring strategy that is based on the ligation of an oligonucleotide to the 35' end of ss-cDNAs. This strategy is referred to as SLIC for single-strand ligation to ss-cDNA (8).

Basic Use of SExtractor Catalogs With TweakR eg - I

NASA Astrophysics Data System (ADS)

Lucas, Ray A.; Hilbert, Bryan

2015-05-01

We describe using external SExtractor (v2.8.6) catalogs from crclean.fits images to align ACS/WFC images with DrizzlePac/TweakReg. Note that this example was originally created before a more recent update to ACS/WFC geometric distortion files. At the time of this writing, one must follow the advice on the ACS Geometric Distortion web page as the first step in the process. By late 2015, as part of OPUS 2015.3, this part will be included by default in the standard pipeline processing and this will no longer need to be manually done by the user. We describe the rest of the process of preparing images for SExtractor, running SExtractor, and using the ouput catalogs to feed to the TweakReg task for alignment, and show that reasonably good first-cut results can be obtained with mostly default parameters in SExtractor and TweakReg. Better results may be possible with more exacting methods. This describes a method for quick alignment, not the ultimate best alignment. Note also that the use of crclean.fits images may be more suited to provide better results for ACS/WFC and WFC3/UVIS than for WFC3/IR.

Aligning interprofessional education collaborative sub-competencies to a progression of learning.

PubMed

Patel Gunaldo, Tina; Brisolara, Kari Fitzmorris; Davis, Alison H; Moore, Robert

2017-05-01

In the United States, the Interprofessional Education Collaborative (IPEC) developed four core competencies for interprofessional collaborative practice. Even though the IPEC competencies and respective sub-competencies were not created in a hierarchal manner, one might reflect upon a logical progression of learning as well as learners accruing skills allowing them to master one level of learning and building on the aggregate of skills before advancing to the next level. The Louisiana State University Health-New Orleans Center for Interprofessional Education and Collaborative Practice (CIPECP) determined the need to align the sub-competencies with the level of behavioural expectations in order to simplify the process of developing an interprofessional education experience targeted to specific learning levels. In order to determine the most effective alignment, CIPECP discussions revolved around current programmatic expectations across the institution. Faculty recognised the need to align sub-competencies with student learning objectives. Simultaneously, a progression of learning existing within each of the four IPEC domains was noted. Ultimately, the faculty and staff team agreed upon categorising the sub-competencies in a hierarchical manner for the four domains into either a "basic, intermediate, or advanced" level of competency.

AMAS: a fast tool for alignment manipulation and computing of summary statistics.

PubMed

Borowiec, Marek L

2016-01-01

The amount of data used in phylogenetics has grown explosively in the recent years and many phylogenies are inferred with hundreds or even thousands of loci and many taxa. These modern phylogenomic studies often entail separate analyses of each of the loci in addition to multiple analyses of subsets of genes or concatenated sequences. Computationally efficient tools for handling and computing properties of thousands of single-locus or large concatenated alignments are needed. Here I present AMAS (Alignment Manipulation And Summary), a tool that can be used either as a stand-alone command-line utility or as a Python package. AMAS works on amino acid and nucleotide alignments and combines capabilities of sequence manipulation with a function that calculates basic statistics. The manipulation functions include conversions among popular formats, concatenation, extracting sites and splitting according to a pre-defined partitioning scheme, creation of replicate data sets, and removal of taxa. The statistics calculated include the number of taxa, alignment length, total count of matrix cells, overall number of undetermined characters, percent of missing data, AT and GC contents (for DNA alignments), count and proportion of variable sites, count and proportion of parsimony informative sites, and counts of all characters relevant for a nucleotide or amino acid alphabet. AMAS is particularly suitable for very large alignments with hundreds of taxa and thousands of loci. It is computationally efficient, utilizes parallel processing, and performs better at concatenation than other popular tools. AMAS is a Python 3 program that relies solely on Python's core modules and needs no additional dependencies. AMAS source code and manual can be downloaded from http://github.com/marekborowiec/AMAS/ under GNU General Public License.

Surface-enhanced Raman scattering detection of DNA derived from the West Nile virus genome using magnetic capture of Raman-active gold nanoparticles

USDA-ARS?s Scientific Manuscript database

A model paramagnetic nanoparticle (MNP) assay is demonstrated for surface-enhanced Raman scattering (SERS) detection of DNA oligonucleotides derived from the West Nile virus (WNV) genome. Detection is based on the capture of WNV target sequences by hybridization with complementary oligonucleotide pr...

Microelectroporation device for genomic screening

DOEpatents

Perroud, Thomas D.; Renzi, Ronald F.; Negrete, Oscar; Claudnic, Mark R.

2014-09-09

We have developed an microelectroporation device that combines microarrays of oligonucleotides, microfluidic channels, and electroporation for cell transfection and high-throughput screening applications (e.g. RNA interference screens). Microarrays allow the deposition of thousands of different oligonucleotides in microscopic spots. Microfluidic channels and microwells enable efficient loading of cells into the device and prevent cross-contamination between different oligonucleotides spots. Electroporation allows optimal transfection of nucleic acids into cells (especially hard-to-transfect cells such as primary cells) by minimizing cell death while maximizing transfection efficiency. This invention has the advantage of a higher throughput and lower cost, while preventing cross-contamination compared to conventional screening technologies. Moreover, this device does not require bulky robotic liquid handling equipment and is inherently safer given that it is a closed system.

Analysis of new charge-neutral DNA/RNA analogues phosphoryl guanidine oligonucleotides (PGO) by gel electrophoresis.

PubMed

Fokina, Alesya; Wang, Meiling; Ilyina, Anna; Klabenkova, Kristina; Burakova, Ekaterina; Chelobanov, Boris; Stetsenko, Dmitry

2018-06-02

Analysis and isolation of new charge-neutral phosphoryl guanidine oligonucleotides (PGO) by vertical slab electrophoresis were tested at different pH values (3-11) or in the presence of SDS as a micelle-forming agent. The most convenient way to analyze and purify phosphoryl guanidine oligonucleotides was by denaturing PAGE (8 M urea) at pH 3. The mobility of PGO is dependent on their A + C content. To analyze PGO containing only G, T or U, denaturing PAGE at pH 11 can be used, although the conditions need to be optimized. Bands were visualized by UV shadowing or Coomassie Brilliant Blue staining. Copyright © 2018. Published by Elsevier Inc.

Introduction to the Theme "New Methods and Novel Therapeutic Approaches in Pharmacology and Toxicology".

PubMed

Insel, Paul A; Amara, Susan G; Blaschke, Terrence F; Meyer, Urs A

2017-01-06

Major advances in scientific discovery and insights can result from the development and use of new techniques, as exemplified by the work of Solomon Snyder, who writes a prefatory article in this volume. The Editors have chosen "New Methods and Novel Therapeutic Approaches in Pharmacology and Toxicology" as the Theme for a number of articles in this volume. These include ones that review the development and use of new experimental tools and approaches (e.g., nanobodies and techniques to explore protein-protein interactions), new types of therapeutics (e.g., aptamers and antisense oligonucleotides), and systems pharmacology, which assembles (big) data derived from omics studies together with information regarding drugs and patients. The application of these new methods and therapeutic approaches has the potential to have a major impact on basic and clinical research in pharmacology and toxicology as well as on patient care.

HAL: a hierarchical format for storing and analyzing multiple genome alignments.

PubMed

Hickey, Glenn; Paten, Benedict; Earl, Dent; Zerbino, Daniel; Haussler, David

2013-05-15

Large multiple genome alignments and inferred ancestral genomes are ideal resources for comparative studies of molecular evolution, and advances in sequencing and computing technology are making them increasingly obtainable. These structures can provide a rich understanding of the genetic relationships between all subsets of species they contain. Current formats for storing genomic alignments, such as XMFA and MAF, are all indexed or ordered using a single reference genome, however, which limits the information that can be queried with respect to other species and clades. This loss of information grows with the number of species under comparison, as well as their phylogenetic distance. We present HAL, a compressed, graph-based hierarchical alignment format for storing multiple genome alignments and ancestral reconstructions. HAL graphs are indexed on all genomes they contain. Furthermore, they are organized phylogenetically, which allows for modular and parallel access to arbitrary subclades without fragmentation because of rearrangements that have occurred in other lineages. HAL graphs can be created or read with a comprehensive C++ API. A set of tools is also provided to perform basic operations, such as importing and exporting data, identifying mutations and coordinate mapping (liftover). All documentation and source code for the HAL API and tools are freely available at http://github.com/glennhickey/hal. hickey@soe.ucsc.edu or haussler@soe.ucsc.edu Supplementary data are available at Bioinformatics online.

Laboratory Experiments on Rotation and Alignment of the Analogs of Interstellar Dust Grains by Radiation

NASA Technical Reports Server (NTRS)

Abbas, M. M.; Craven, P. D.; Spann, J. F.; Tankosic, D.; LeClair, A.; Gallagher, D. L.; West, E. A.; Weingartner, J. C.; Witherow, W. K.; Tielens, A. G. G. M.

2004-01-01

The processes and mechanisms involved in the rotation and alignment of interstellar dust grains have been of great interest in astrophysics ever since the surprising discovery of the polarization of starlight more than half a century ago. Numerous theories, detailed mathematical models, and numerical studies of grain rotation and alignment with respect to the Galactic magnetic field have been presented in the literature. In particular, the subject of grain rotation and alignment by radiative torques has been shown to be of particular interest in recent years. However, despite many investigations, a satisfactory theoretical understanding of the processes involved in subject, we have carried out some unique experiments to illuminate the processes involved in the rotation of dust grains in the interstellar medium. In this paper we present the results of some preliminary laboratory experiments on the rotation of individual micron/submicron-sized, nonspherical dust grains levitated in an electrodynamic balance evacuated to pressures of approximately 10(exp -3) to 10(exp -5) torr. The particles are illuminated by laser light at 5320 A, and the grain rotation rates are obtained by analyzing the low-frequency (approximately 0 - 100 kHz) signal of the scattered light detected by a photodiode detector. The rotation rates are compared with simple theoretical models to retrieve some basic rotational parameters. The results are examined in light of the current theories of alignment.

Hartman Testing of X-Ray Telescopes

NASA Technical Reports Server (NTRS)

Saha, Timo T.; Biskasch, Michael; Zhang, William W.

2013-01-01

Hartmann testing of x-ray telescopes is a simple test method to retrieve and analyze alignment errors and low-order circumferential errors of x-ray telescopes and their components. A narrow slit is scanned along the circumference of the telescope in front of the mirror and the centroids of the images are calculated. From the centroid data, alignment errors, radius variation errors, and cone-angle variation errors can be calculated. Mean cone angle, mean radial height (average radius), and the focal length of the telescope can also be estimated if the centroid data is measured at multiple focal plane locations. In this paper we present the basic equations that are used in the analysis process. These equations can be applied to full circumference or segmented x-ray telescopes. We use the Optical Surface Analysis Code (OSAC) to model a segmented x-ray telescope and show that the derived equations and accompanying analysis retrieves the alignment errors and low order circumferential errors accurately.

Efficiency, error and yield in light-directed maskless synthesis of DNA microarrays

PubMed Central

2011-01-01

Background Light-directed in situ synthesis of DNA microarrays using computer-controlled projection from a digital micromirror device--maskless array synthesis (MAS)--has proved to be successful at both commercial and laboratory scales. The chemical synthetic cycle in MAS is quite similar to that of conventional solid-phase synthesis of oligonucleotides, but the complexity of microarrays and unique synthesis kinetics on the glass substrate require a careful tuning of parameters and unique modifications to the synthesis cycle to obtain optimal deprotection and phosphoramidite coupling. In addition, unintended deprotection due to scattering and diffraction introduce insertion errors that contribute significantly to the overall error rate. Results Stepwise phosphoramidite coupling yields have been greatly improved and are now comparable to those obtained in solid phase synthesis of oligonucleotides. Extended chemical exposure in the synthesis of complex, long oligonucleotide arrays result in lower--but still high--final average yields which approach 99%. The new synthesis chemistry includes elimination of the standard oxidation until the final step, and improved coupling and light deprotection. Coupling Insertions due to stray light are the limiting factor in sequence quality for oligonucleotide synthesis for gene assembly. Diffraction and local flare are by far the largest contributors to loss of optical contrast. Conclusions Maskless array synthesis is an efficient and versatile method for synthesizing high density arrays of long oligonucleotides for hybridization- and other molecular binding-based experiments. For applications requiring high sequence purity, such as gene assembly, diffraction and flare remain significant obstacles, but can be significantly reduced with straightforward experimental strategies. PMID:22152062

5' modification of duplex DNA with a ruthenium electron donor-acceptor pair using solid-phase DNA synthesis

NASA Technical Reports Server (NTRS)

Frank, Natia L.; Meade, Thomas J.

2003-01-01

Incorporation of metalated nucleosides into DNA through covalent modification is crucial to measurement of thermal electron-transfer rates and the dependence of these rates with structure, distance, and position. Here, we report the first synthesis of an electron donor-acceptor pair of 5' metallonucleosides and their subsequent incorporation into oligonucleotides using solid-phase DNA synthesis techniques. Large-scale syntheses of metal-containing oligonucleotides are achieved using 5' modified phosporamidites containing [Ru(acac)(2)(IMPy)](2+) (acac is acetylacetonato; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (3) and [Ru(bpy)(2)(IMPy)](2+) (bpy is 2,2'-bipyridine; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (4). Duplexes formed with the metal-containing oligonucleotides exhibit thermal stability comparable to the corresponding unmetalated duplexes (T(m) of modified duplex = 49 degrees C vs T(m) of unmodified duplex = 47 degrees C). Electrochemical (3, E(1/2) = -0.04 V vs NHE; 4, E(1/2) = 1.12 V vs NHE), absorption (3, lambda(max) = 568, 369 nm; 4, lambda(max) = 480 nm), and emission (4, lambda(max) = 720 nm, tau = 55 ns, Phi = 1.2 x 10(-)(4)) data for the ruthenium-modified nucleosides and oligonucleotides indicate that incorporation into an oligonucleotide does not perturb the electronic properties of the ruthenium complex or the DNA significantly. In addition, the absence of any change in the emission properties upon metalated duplex formation suggests that the [Ru(bpy)(2)(IMPy)](2+)[Ru(acac)(2)(IMPy)](2+) pair will provide a valuable probe for DNA-mediated electron-transfer studies.

High Boron-loaded DNA-Oligomers as Potential Boron Neutron Capture Therapy and Antisense Oligonucleotide Dual-Action Anticancer Agents.

PubMed

Kaniowski, Damian; Ebenryter-Olbińska, Katarzyna; Sobczak, Milena; Wojtczak, Błażej; Janczak, Sławomir; Leśnikowski, Zbigniew J; Nawrot, Barbara

2017-08-23

Boron cluster-modified therapeutic nucleic acids with improved properties are of interest in gene therapy and in cancer boron neutron capture therapy (BNCT). High metallacarborane-loaded antisense oligonucleotides (ASOs) targeting epidermal growth factor receptor (EGFR) were synthesized through post-synthetic Cu (I)-assisted "click" conjugation of alkyne-modified DNA-oligonucleotides with a boron cluster alkyl azide component. The obtained oligomers exhibited increased lipophilicity compared to their non-modified precursors, while their binding affinity to complementary DNA and RNA strands was slightly decreased. Multiple metallacarborane residues present in the oligonucleotide chain, each containing 18 B-H groups, enabled the use of IR spectroscopy as a convenient analytical method for these oligomers based on the diagnostic B-H signal at 2400-2650 cm -1 . The silencing activity of boron cluster-modified ASOs used at higher concentrations was similar to that of unmodified oligonucleotides. The screened ASOs, when used in low concentrations (up to 50 μM), exhibited pro-oxidative properties by inducing ROS production and an increase in mitochondrial activities in HeLa cells. In contrast, when used at higher concentrations, the ASOs exhibited anti-oxidative properties by lowering ROS species levels. In the HeLa cells (tested in the MTT assay) treated (without lipofectamine) or transfected with the screened compounds, the mitochondrial activity remained equal to the control level or only slightly changed (±30%). These findings may be useful in the design of dual-action boron cluster-modified therapeutic nucleic acids with combined antisense and anti-oxidant properties.

Antisense Oligonucleotide Therapy for Patients with Advanced Cancer | Center for Cancer Research

Cancer.gov

Colorectal cancer (CRC) is the second leading cause of cancer-related death in the U.S. Improvements in therapy have increased the survival of patients with CRC from 10 months to two years, but for patients who stop responding to treatments, such as irinotecan, options for additional therapy are limited. Antisense oligonucleotides (ASOs) may offer advantages over traditional

Development of a general methodology for labelling peptide-morpholino oligonucleotide conjugates using alkyne-azide click chemistry.

PubMed

Shabanpoor, Fazel; Gait, Michael J

2013-11-11

We describe a general methodology for fluorescent labelling of peptide conjugates of phosphorodiamidate morpholino oligonucleotides (PMOs) by alkyne functionalization of peptides, subsequent conjugation to PMOs and labelling with a fluorescent compound (Cy5-azide). Two peptide-PMO (PPMO) examples are shown. No detrimental effect of such labelled PMOs was seen in a biological assay.

Antisense Oligonucleotides Modulating Activation of a Nonsense-Mediated RNA Decay Switch Exon in the ATM Gene.

PubMed

Kralovicova, Jana; Moreno, Pedro M D; Cross, Nicholas C P; Pêgo, Ana Paula; Vorechovsky, Igor

2016-12-01

ATM (ataxia-telangiectasia, mutated) is an important cancer susceptibility gene that encodes a key apical kinase in the DNA damage response pathway. ATM mutations in the germ line result in ataxia-telangiectasia (A-T), a rare genetic syndrome associated with hypersensitivity to double-strand DNA breaks and predisposition to lymphoid malignancies. ATM expression is limited by a tightly regulated nonsense-mediated RNA decay (NMD) switch exon (termed NSE) located in intron 28. In this study, we identify antisense oligonucleotides that modulate NSE inclusion in mature transcripts by systematically targeting the entire 3.1-kb-long intron. Their identification was assisted by a segmental deletion analysis of transposed elements, revealing NSE repression upon removal of a distant antisense Alu and NSE activation upon elimination of a long terminal repeat transposon MER51A. Efficient NSE repression was achieved by delivering optimized splice-switching oligonucleotides to embryonic and lymphoblastoid cells using chitosan-based nanoparticles. Together, these results provide a basis for possible sequence-specific radiosensitization of cancer cells, highlight the power of intronic antisense oligonucleotides to modify gene expression, and demonstrate transposon-mediated regulation of NSEs.

Identifying of meat species using polymerase chain reaction (PCR)

NASA Astrophysics Data System (ADS)

Foong, Chow Ming; Sani, Norrakiah Abdullah

2013-11-01

Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one's diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

A novel bioinformatics method for efficient knowledge discovery by BLSOM from big genomic sequence data.

PubMed

Bai, Yu; Iwasaki, Yuki; Kanaya, Shigehiko; Zhao, Yue; Ikemura, Toshimichi

2014-01-01

With remarkable increase of genomic sequence data of a wide range of species, novel tools are needed for comprehensive analyses of the big sequence data. Self-Organizing Map (SOM) is an effective tool for clustering and visualizing high-dimensional data such as oligonucleotide composition on one map. By modifying the conventional SOM, we have previously developed Batch-Learning SOM (BLSOM), which allows classification of sequence fragments according to species, solely depending on the oligonucleotide composition. In the present study, we introduce the oligonucleotide BLSOM used for characterization of vertebrate genome sequences. We first analyzed pentanucleotide compositions in 100 kb sequences derived from a wide range of vertebrate genomes and then the compositions in the human and mouse genomes in order to investigate an efficient method for detecting differences between the closely related genomes. BLSOM can recognize the species-specific key combination of oligonucleotide frequencies in each genome, which is called a "genome signature," and the specific regions specifically enriched in transcription-factor-binding sequences. Because the classification and visualization power is very high, BLSOM is an efficient powerful tool for extracting a wide range of information from massive amounts of genomic sequences (i.e., big sequence data).

Oligonucleotide-genotyping as a method of detecting the HLA-DR2 (DRw15)-Dw2, -DR2 (DRw15)-Dw12, -DR4-Dw15, and -DR4-D"KT2" haplotypes in the Japanese population.

PubMed

Obata, F; Ito, I; Kaneko, T; Ohkubo, M; Ishimoto, A L; Abe, A; Kashiwagi, N

1989-05-01

We synthesized pairs of four different oligonucleotides, F22, F29, F42, and F158, to analyse the HLA-DR2 (DRw15) and -DR4 haplotypes in the Japanese population. After enzymatically amplifying the HLA-DRB1 gene, we hybridized the oligonucleotide probes with DNA extracted from 42 donors. Hybridization was completed between F22 and the DNA of haplotype DR2 (DRw15)-Dw2, between F29 and the DNA of DR2 (DRw15)-Dw12, between F42 and the DNA of DR4-D"KT2", and between F158 and the DNA of DR4-Dw15. In keeping with the nucleotide sequences of the probes, F29 hybridized also with DNA from the DR9-Dw23 haplotype and F158 with that from some of the DRw8 haplotypes (DRw8-Dw8.3) in the Japanese population. Results of this study demonstrate that the four oligonucleotides make useful probes for detecting the haplotypes above.

Metallo-Phthalocyanine Near-IR Fluorophores: Oligonucleotide Conjugates and Their Applications in PCR Assays

PubMed Central

Nesterova, Irina V.; Verdree, Vera T.; Pakhomov, Serhii; Strickler, Karen L.; Allen, Michael W.; Hammer, Robert P.; Soper, Steven A.

2011-01-01

Water soluble, metallo-pthalocyanine (MPc) near-IR fluorophores were designed, synthesized, and evaluated as highly stable and sensitive reporters for fluorescence assays. Their conjugation to oligonucleotides was achieved via succinimidyl ester-amino coupling chemistry with the conditions for conjugation extensively examined and optimized. In addition, various conjugate purification and isolation techniques were evaluated as well. Results showed that under proper conditions and following purification using reverse-phase ion-pair chromatography, labeling efficiencies near 80% could be achieved using ZnPc (Zn phthalocyanine) as the labeling fluorophore. Absorption and fluorescence spectra accumulated for the conjugates indicated that the intrinsic fluorescence properties of the MPc’s were not significantly altered by covalent attachment to oligonucleotides. As an example of the utility of MPc reporters, we used the MPc–oligonucleotide conjugates as primers for PCR (polymerase chain reaction) amplifications with the products sorted via electrophoresis and detected using near-IR fluorescence (λex = 680 nm). The MPc dyes were found to be more chemically stable under typical thermal cycling conditions used for PCR compared to the carbocyanine-based near-IR reporter systems typically used and produced single and narrow bands in the electrophoretic traces, indicative of producing a single PCR product during amplification. PMID:18030995

Identifying of meat species using polymerase chain reaction (PCR)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Foong, Chow Ming; Sani, Norrakiah Abdullah

Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reactionmore » (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.« less

Typing of artiodactyl MHC-DRB genes with the help of intronic simple repeated DNA sequences.

PubMed

Schwaiger, F W; Buitkamp, J; Weyers, E; Epplen, J T

1993-02-01

An efficient oligonucleotide typing method for the highly polymorphic MHC-DRB genes is described for artiodactyls like cattle, sheep and goat. By means of the polymerase chain reaction, the second exon of MHC-DRB is amplified as well as part of the adjacent intron containing a mixed simple repeat sequence. Using this primer combination we were able to amplify the MHC-DRB exons 2 and adjacent introns from all of the investigated 10 species of the family of Bovidae and giraffes. Therefore, the DRB genes of novel artiodactyl species can also be readily studied. Oligonucleotide probes specific for the polymorphisms of ungulate DRB genes are used with which sequences differing in at least one single base can be distinguished. Exonic polymorphism was found to be correlated with the allele lengths and the patterns of the repeat structures. Hence oligonucleotide probes specific for different simple repeats and polymorphic positions serve also for typing across species barriers. The strict correlation of sequence length and exonic polymorphism permits a preselection of specific oligonucleotides for hybridization. Thus more than 20 alleles can already be differentiated from each of the three species.

Electron stimulated desorption of anions from native and brominated single stranded oligonucleotide trimers

PubMed Central

Polska, Katarzyna; Rak, Janusz; Bass, Andrew D.; Cloutier, Pierre; Sanche, Léon

2013-01-01

We measured the low energy electron stimulated desorption (ESD) of anions from thin films of native (TXT) and bromine monosubstituted (TBrXT) oligonucleotide trimers deposited on a gold surface (T = thymidine, X = T, deoxycytidine (C), deoxyadenosine (A) or deoxyguanosine (G), Br = bromine). The desorption of H−, CH3−/NH−, O−/NH2−, OH−, CN−, and Br− was induced by 0 to 20 eV electrons. Dissociative electron attachment, below 12 eV, and dipolar dissociation, above 12 eV, are responsible for the formation of these anions. The comparison of the results obtained for the native and brominated trimers suggests that the main pathways of TBrXT degradation correspond to the release of the hydride and bromide anions. Significantly, the presence of bromine in oligonucleotide trimers blocks the electron-induced degradation of nuclobases as evidenced by a dramatic decrease in CN− desorption. An increase in the yields of OH− is also observed. The debromination yield of particular oligonucleotides diminishes in the following order: BrdU > BrdA > BrdG > BrdC. Based on these results, 5-bromo-2′-deoxyuridine appears to be the best radiosensitizer among the studied bromonucleosides. PMID:22360262

Electron stimulated desorption of anions from native and brominated single stranded oligonucleotide trimers.

PubMed

Polska, Katarzyna; Rak, Janusz; Bass, Andrew D; Cloutier, Pierre; Sanche, Léon

2012-02-21

We measured the low energy electron stimulated desorption (ESD) of anions from thin films of native (TXT) and bromine monosubstituted (TBrXT) oligonucleotide trimers deposited on a gold surface (T = thymidine, X = T, deoxycytidine (C), deoxyadenosine (A) or deoxyguanosine (G), Br = bromine). The desorption of H(-), CH(3)(-)/NH(-), O(-)/NH(2)(-), OH(-), CN(-), and Br(-) was induced by 0 to 20 eV electrons. Dissociative electron attachment, below 12 eV, and dipolar dissociation, above 12 eV, are responsible for the formation of these anions. The comparison of the results obtained for the native and brominated trimers suggests that the main pathways of TBrXT degradation correspond to the release of the hydride and bromide anions. Significantly, the presence of bromine in oligonucleotide trimers blocks the electron-induced degradation of nuclobases as evidenced by a dramatic decrease in CN(-) desorption. An increase in the yields of OH(-) is also observed. The debromination yield of particular oligonucleotides diminishes in the following order: BrdU > BrdA > BrdG > BrdC. Based on these results, 5-bromo-2(')-deoxyuridine appears to be the best radiosensitizer among the studied bromonucleosides. © 2012 American Institute of Physics

Electron stimulated desorption of anions from native and brominated single stranded oligonucleotide trimers

NASA Astrophysics Data System (ADS)

Polska, Katarzyna; Rak, Janusz; Bass, Andrew D.; Cloutier, Pierre; Sanche, Léon

2012-02-01

We measured the low energy electron stimulated desorption (ESD) of anions from thin films of native (TXT) and bromine monosubstituted (TBrXT) oligonucleotide trimers deposited on a gold surface (T = thymidine, X = T, deoxycytidine (C), deoxyadenosine (A) or deoxyguanosine (G), Br = bromine). The desorption of H-, CH3-/NH-, O-/NH2-, OH-, CN-, and Br- was induced by 0 to 20 eV electrons. Dissociative electron attachment, below 12 eV, and dipolar dissociation, above 12 eV, are responsible for the formation of these anions. The comparison of the results obtained for the native and brominated trimers suggests that the main pathways of TBrXT degradation correspond to the release of the hydride and bromide anions. Significantly, the presence of bromine in oligonucleotide trimers blocks the electron-induced degradation of nuclobases as evidenced by a dramatic decrease in CN- desorption. An increase in the yields of OH- is also observed. The debromination yield of particular oligonucleotides diminishes in the following order: BrdU > BrdA > BrdG > BrdC. Based on these results, 5-bromo-2'-deoxyuridine appears to be the best radiosensitizer among the studied bromonucleosides.

probeBase—an online resource for rRNA-targeted oligonucleotide probes and primers: new features 2016

PubMed Central

Greuter, Daniel; Loy, Alexander; Horn, Matthias; Rattei, Thomas

2016-01-01

probeBase http://www.probebase.net is a manually maintained and curated database of rRNA-targeted oligonucleotide probes and primers. Contextual information and multiple options for evaluating in silico hybridization performance against the most recent rRNA sequence databases are provided for each oligonucleotide entry, which makes probeBase an important and frequently used resource for microbiology research and diagnostics. Here we present a major update of probeBase, which was last featured in the NAR Database Issue 2007. This update describes a complete remodeling of the database architecture and environment to accommodate computationally efficient access. Improved search functions, sequence match tools and data output now extend the opportunities for finding suitable hierarchical probe sets that target an organism or taxon at different taxonomic levels. To facilitate the identification of complementary probe sets for organisms represented by short rRNA sequence reads generated by amplicon sequencing or metagenomic analysis with next generation sequencing technologies such as Illumina and IonTorrent, we introduce a novel tool that recovers surrogate near full-length rRNA sequences for short query sequences and finds matching oligonucleotides in probeBase. PMID:26586809

Finite element analyses of two dimensional, anisotropic heat transfer in wood

Treesearch

John F. Hunt; Hongmei Gu

2004-01-01

The anisotropy of wood creates a complex problem for solving heat and mass transfer problems that require analyses be based on fundamental material properties of the wood structure. Inputting basic orthogonal properties of the wood material alone are not sufficient for accurate modeling because wood is a combination of porous fiber cells that are aligned and mis-...

Rate- and duration-of-load behavior of lab-made structural flakeboards

Treesearch

J. D. McNatt

1985-01-01

Tests of structural use panels under different loading conditions provide basic information for establishing design stresses. This paper reports the effects of loading rate in tension and bending and of duration of load in tension on the properties of four lab-made structural flakeboards, (two of which had aligned flakes). The objective was to determine if these panels...

Motor–sensory convergence in object localization: a comparative study in rats and humans

PubMed Central

Horev, Guy; Saig, Avraham; Knutsen, Per Magne; Pietr, Maciej; Yu, Chunxiu; Ahissar, Ehud

2011-01-01

In order to identify basic aspects in the process of tactile perception, we trained rats and humans in similar object localization tasks and compared the strategies used by the two species. We found that rats integrated temporally related sensory inputs (‘temporal inputs’) from early whisk cycles with spatially related inputs (‘spatial inputs’) to align their whiskers with the objects; their perceptual reports appeared to be based primarily on this spatial alignment. In a similar manner, human subjects also integrated temporal and spatial inputs, but relied mainly on temporal inputs for object localization. These results suggest that during tactile object localization, an iterative motor–sensory process gradually converges on a stable percept of object location in both species. PMID:21969688

Freiburg RNA tools: a central online resource for RNA-focused research and teaching.

PubMed

Raden, Martin; Ali, Syed M; Alkhnbashi, Omer S; Busch, Anke; Costa, Fabrizio; Davis, Jason A; Eggenhofer, Florian; Gelhausen, Rick; Georg, Jens; Heyne, Steffen; Hiller, Michael; Kundu, Kousik; Kleinkauf, Robert; Lott, Steffen C; Mohamed, Mostafa M; Mattheis, Alexander; Miladi, Milad; Richter, Andreas S; Will, Sebastian; Wolff, Joachim; Wright, Patrick R; Backofen, Rolf

2018-05-21

The Freiburg RNA tools webserver is a well established online resource for RNA-focused research. It provides a unified user interface and comprehensive result visualization for efficient command line tools. The webserver includes RNA-RNA interaction prediction (IntaRNA, CopraRNA, metaMIR), sRNA homology search (GLASSgo), sequence-structure alignments (LocARNA, MARNA, CARNA, ExpaRNA), CRISPR repeat classification (CRISPRmap), sequence design (antaRNA, INFO-RNA, SECISDesign), structure aberration evaluation of point mutations (RaSE), and RNA/protein-family models visualization (CMV), and other methods. Open education resources offer interactive visualizations of RNA structure and RNA-RNA interaction prediction as well as basic and advanced sequence alignment algorithms. The services are freely available at http://rna.informatik.uni-freiburg.de.

The binding of manganese(II) and zinc(II) to the synthetic oligonucleotide d(C-G-C-G-A-A-T-T-C-G-C-G)2. A 1H NMR study.

PubMed

Frøystein, N A; Sletten, E

1991-03-01

The interaction of the synthetic oligonucleotide d(C-G-C-G-A-A-T-T-C-G-C-G)2 with two different transition-metal ions has been investigated in aqueous solution by means of 1H NMR spectroscopy. The effects on the DNA due to the presence of manganese(II) or zinc(II) have been monitored by observing the paramagnetic broadening and diamagnetic shifts of the non-exchangeable proton resonance lines, respectively. The 1H NMR spectra acquired during the course of the manganese(II) titration show very distinct broadening effects on certain DNA resonance lines. Primarily, the H8 resonance of G4 is affected, but also the H5 and H6 resonances of C3 are clearly affected by the metal. The results imply that the binding of manganese(II) to DNA is sequence specific. The 1H spectra obtained during the zinc(II) titration reveal diamagnetic shift effects which largely conform with the paramagnetic broadening effects due to the presence of manganese(II), although this picture is somewhat more complex. The H8 resonance of G4 displays a clearly visible high-field shift, while for the other guanosine H8 protons this effect is absent. The H1' and H2' protons of C3 show an effect of similar strength, although in the opposite direction, while H5 and H6 of C3 are only slightly affected. Local differences in the structure of the DNA and the basicities of potential binding sites on different base steps in the sequence might account for the observed sequence selectivity.

Current genetic methodologies in the identification of disaster victims and in forensic analysis.

PubMed

Ziętkiewicz, Ewa; Witt, Magdalena; Daca, Patrycja; Zebracka-Gala, Jadwiga; Goniewicz, Mariusz; Jarząb, Barbara; Witt, Michał

2012-02-01

This review presents the basic problems and currently available molecular techniques used for genetic profiling in disaster victim identification (DVI). The environmental conditions of a mass disaster often result in severe fragmentation, decomposition and intermixing of the remains of victims. In such cases, traditional identification based on the anthropological and physical characteristics of the victims is frequently inconclusive. This is the reason why DNA profiling became the gold standard for victim identification in mass-casualty incidents (MCIs) or any forensic cases where human remains are highly fragmented and/or degraded beyond recognition. The review provides general information about the sources of genetic material for DNA profiling, the genetic markers routinely used during genetic profiling (STR markers, mtDNA and single-nucleotide polymorphisms [SNP]) and the basic statistical approaches used in DNA-based disaster victim identification. Automated technological platforms that allow the simultaneous analysis of a multitude of genetic markers used in genetic identification (oligonucleotide microarray techniques and next-generation sequencing) are also presented. Forensic and population databases containing information on human variability, routinely used for statistical analyses, are discussed. The final part of this review is focused on recent developments, which offer particularly promising tools for forensic applications (mRNA analysis, transcriptome variation in individuals/populations and genetic profiling of specific cells separated from mixtures).

Cellular uptake of modified oligonucleotides: fluorescence approach

NASA Astrophysics Data System (ADS)

Kočišová, Eva; Praus, Petr; Rosenberg, Ivan; Seksek, Olivier; Sureau, Franck; Štěpánek, Josef; Turpin, Pierre-Yves

2005-06-01

Cellular uptake and intracellular distribution of the synthetic antisense analogue of dT 15 oligonucleotide (homogenously containing 3'-O-P-CH 2-O-5' internucleotide linkages and labeled with tetramethylrhodamine dye) was studied on B16 melanoma cell line by fluorescence micro-imaging and time-resolved microspectrofluorimetry. By using amphotericin B 3-dimethylaminopropyl amide as an enhancer molecule for the uptake process, homogenous staining of the cells with rather distinct nucleoli staining was achieved after 4 h of incubation. Two spectral components of 2.7 and 1.3 ns lifetime, respectively, were resolved in the emission collected from the cell nucleus. The way of staining and the long-lived component differed from our previous experiments demonstrating complexity of the intracellular oligonucleotide distribution and in particular of the binding inside the nucleus.

Morpholino-mediated Knockdown of DUX4 Toward Facioscapulohumeral Muscular Dystrophy Therapeutics.

PubMed

Chen, Jennifer Cj; King, Oliver D; Zhang, Yuanfan; Clayton, Nicholas P; Spencer, Carrie; Wentworth, Bruce M; Emerson, Charles P; Wagner, Kathryn R

2016-08-01

Derepression of DUX4 in skeletal muscle has emerged as a likely cause of pathology in facioscapulohumeral muscular dystrophy (FSHD). Here we report on the use of antisense phosphorodiamidate morpholino oligonucleotides to suppress DUX4 expression and function in FSHD myotubes and xenografts. The most effective was phosphorodiamidate morpholino oligonucleotide FM10, which targets the polyadenylation signal of DUX4. FM10 had no significant cell toxicity, and RNA-seq analyses of FSHD and control myotubes revealed that FM10 down-regulated many transcriptional targets of DUX4, without overt off-target effects. Electroporation of FM10 into FSHD patient muscle xenografts in mice also down-regulated DUX4 and DUX4 targets. These findings demonstrate the potential of antisense phosphorodiamidate morpholino oligonucleotides as an FSHD therapeutic option.

Synthesis of the Tellurium-Derivatized Phosphoramidites and their Incorporation into DNA Oligonucleotides

PubMed Central

Jiang, Sibo; Sheng, Jia

2015-01-01

Introduction In this unit, an efficient method for the synthesis of 2’-tellerium modified phosphoramidite and its incorporation into oligonucleotide are presented. We choose 5’-O-DMTr-2,2’-anhydro-uridine and -thymidine nucleosides (S.1, S.2) as starting materials due to their easy preparation. The 5’-O-DMTr-2,2’-anhydro-uridine and -thymidine can be converted to corresponding the 2’-tellerium-derivatized nucleosides by treating with the telluride nucleophiles. Subsequently, the 2’-Te-nucleosides can be transformed into 3’-phosphoramidites, which are the building blocks for DNA/RNA synthesis. The DNA synthesis, purification and applications of oligonucleotides containing 2’-Te-U or 2’-Te-T are described in this protocol. PMID:22147418

Junctions between i-motif tetramers in supramolecular structures

PubMed Central

Guittet, Eric; Renciuk, Daniel; Leroy, Jean-Louis

2012-01-01

The symmetry of i-motif tetramers gives to cytidine-rich oligonucleotides the capacity to associate into supramolecular structures (sms). In order to determine how the tetramers are linked together in such structures, we have measured by gel filtration chromatography and NMR the formation and dissociation kinetics of sms built by oligonucleotides containing two short C stretches separated by a non-cytidine-base. We show that a stretch of only two cytidines either at the 3′- or 5′-end is long enough to link the tetramers into sms. The analysis of the properties of sms formed by oligonucleotides differing by the length of the oligo-C stretches, the sequence orientation and the nature of the non-C base provides a model of the junction connecting the tetramers in sms. PMID:22362739

Synthesis, physicochemical and biochemical studies of 1',2'-oxetane constrained adenosine and guanosine modified oligonucleotides, and their comparison with those of the corresponding cytidine and thymidine analogues.

PubMed

Pradeepkumar, Pushpangadan I; Cheruku, Pradeep; Plashkevych, Oleksandr; Acharya, Parag; Gohil, Suresh; Chattopadhyaya, Jyoti

2004-09-22

We have earlier reported the synthesis and antisense properties of the conformationally constrained oxetane-C and -T containing oligonucleotides, which have shown effective down-regulation of the proto-oncogene c-myb mRNA in the K562 human leukemia cells. Here we report on the straightforward syntheses of the oxetane-A and oxetane-G nucleosides as well as their incorporations into antisense oligonucleotides (AONs), and compare their structural and antisense properties with those of the T and C modified AONs (including the thermostability and RNase H recruitment capability of the AON/RNA hybrid duplex by Michaelis-Menten kinetic analyses, their resistance in the human serum, as well as in the presence of exo and endonucleases).

The role of antisense oligonucleotide therapy in patients with familial hypercholesterolemia: risks, benefits, and management recommendations.

PubMed

Agarwala, Anandita; Jones, Peter; Nambi, Vijay

2015-01-01

Antisense oligonucleotide therapy is a promising approach for the treatment of a broad variety of medical conditions. It functions at the cellular level by interfering with RNA function, often leading to degradation of specifically targeted abnormal gene products implicated in the disease process. Mipomersen is a novel antisense oligonucleotide directed at apolipoprotein (apoB)-100, the primary apolipoprotein associated with low-density lipoprotein cholesterol (LDL-C), which has recently been approved for the treatment of familial hypercholesterolemia. A number of clinical studies have demonstrated its efficacy in lowering LDL-C and apoB levels in patients with elevated LDL-C despite maximal medical therapy using conventional lipid-lowering agents. This review outlines the risks and benefits of therapy and provides recommendations on the use of mipomersen.

Endoplasmic Reticulum-Associated Degradation Factor ERLIN2: Oncogenic Roles and Molecular Targeting of Breast Cancer

DTIC Science & Technology

2013-06-01

Chemicals were purchased from Sigma unless indicated otherwise. Synthetic oligonucleotides were purchased from Integrated DNA Technologies. Human insulin was...otherwise. Synthetic oligonucleotides were purchased from Integrated DNA Technolo- gies, Inc. (Coralville, IA). Antibodies against XBP1, C/EBPα, and...component of marijuana , induces human glioma cancer cell death through stimulation of ER stress-associated autophagy [92]. δ- tetrahydrocannabinol can

Solid phase synthesis of phosphorothioate oligonucleotides utilizing diethyldithiocarbonate disulfide (DDD) as an efficient sulfur transfer reagent.

PubMed

Cheruvallath, Zacharia S; Kumar, R Krishna; Rentel, Claus; Cole, Douglas L; Ravikumar, Vasulinga T

2003-04-01

Diethyldithiodicarbonate (DDD), a cheap and easily prepared compound, is found to be a rapid and efficient sulfurizing reagent in solid phase synthesis of phosphorothioate oligodeoxyribonucleotides via the phosphoramidite approach. Product yield and quality based on IP-LC-MS compares well with high quality oligonucleotides synthesized using phenylacetyl disulfide (PADS) which is being used for manufacture of our antisense drugs.

Exploring the Use of a Guanine-Rich Catalytic DNA for Sulfoxide Preparation

PubMed Central

Dellafiore, María A.; Montserrat, Javier M.; Iribarren, Adolfo M.

2015-01-01

A guanine-rich DNA oligonucleotide complexed with hemin was used to catalyze controlled oxygen transfer reactions to different sulfides for sulfoxide preparation in the presence of H2O2. Comparable activities were obtained when using fully modified L-DNA. In addition, oligonucleotide immobilization led to an active catalyst which could be successfully recovered and reused without loss of activity. PMID:26066510

Importance of length and sequence order on magnesium binding to surface-bound oligonucleotides studied by second harmonic generation and atomic force microscopy.

PubMed

Holland, Joseph G; Geiger, Franz M

2012-06-07

The binding of magnesium ions to surface-bound single-stranded oligonucleotides was studied under aqueous conditions using second harmonic generation (SHG) and atomic force microscopy (AFM). The effect of strand length on the number of Mg(II) ions bound and their free binding energy was examined for 5-, 10-, 15-, and 20-mers of adenine and guanine at pH 7, 298 K, and 10 mM NaCl. The binding free energies for adenine and guanine sequences were calculated to be -32.1(4) and -35.6(2) kJ/mol, respectively, and invariant with strand length. Furthermore, the ion density for adenine oligonucleotides did not change as strand length increased, with an average value of 2(1) ions/strand. In sharp contrast, guanine oligonucleotides displayed a linear relationship between strand length and ion density, suggesting that cooperativity is important. This data gives predictive capabilities for mixed strands of various lengths, which we exploit for 20-mers of adenines and guanines. In addition, the role sequence order plays in strands of hetero-oligonucleotides was examined for 5'-A(10)G(10)-3', 5'-(AG)(10)-3', and 5'-G(10)A(10)-3' (here the -3' end is chemically modified to bind to the surface). Although the free energy of binding is the same for these three strands (averaged to be -33.3(4) kJ/mol), the total ion density increases when several guanine residues are close to the 3' end (and thus close to the solid support substrate). To further understand these results, we analyzed the height profiles of the functionalized surfaces with tapping-mode atomic force microscopy (AFM). When comparing the average surface height profiles of the oligonucleotide surfaces pre- and post- Mg(II) binding, a positive correlation was found between ion density and the subsequent height decrease following Mg(II) binding, which we attribute to reductions in Coulomb repulsion and strand collapse once a critical number of Mg(II) ions are bound to the strand.

Abnormal thymic maturation and lymphoproliferation in MRL-Fas lpr/lpr mice can be partially reversed by synthetic oligonucleotides: implications for systemic lupus erythematosus and autoimmune lymphoproliferative syndrome.

PubMed

Ashman, R F; Singh, N; Lenert, P S

2017-06-01

MRL-Fas lpr/lpr mice represent an excellent animal model for studying non-malignant lymphoproliferation, regeneration and systemic autoimmunity. Retro-transposon insertion into the second intron of the pro-apoptotic Fas gene appears to be responsible for both lymphoproliferation and autoimmunity, while other genes are more likely to contribute to the regenerative healing characteristic of this mouse strain. Previous studies have shown that neonatal thymectomy can halt the development of abnormal lymphoproliferation. Whereas at four weeks of age primary and secondary lymphoid organs appear to be grossly intact, vigorous lymphoproliferation and autoantibody production subsequently ensues. This is first noticeable at six weeks of age, at which time lymph nodes, spleens and thymuses, but not the bone marrow, become infiltrated with abnormal B220 + CD3 + CD4 - CD8 - T cells. Around the same time, thymuses show a significant drop in CD4 + CD8 + double-positive T cells generating an abnormal ratio between double-positive and single-positive thymocytes. The objective of current study was to evaluate the effect of synthetic oligonucleotides-toll-like receptor antagonists on early lymphoid development in this strain of mice. Herein, we demonstrate the ability of synthetic oligonucleotides made with the nuclease-resistant phosphorothioate backbone to partially reverse abnormal lymphoproliferation and thymic involution in pre-diseased MRL-Fas lpr/lpr mice when administered intraperitoneally starting from week four of age. This curative effect of oligonucleotides was primary sequence/secondary oligonucleotide structure-independent, suggesting an effect through the toll-like receptor 7. A similar approach may potentially benefit patients with autoimmune lymphoproliferative syndrome who, like MRL-Fas lpr/lpr mice, carry a mutation in the Fas gene.

DNA assembly with error correction on a droplet digital microfluidics platform.

PubMed

Khilko, Yuliya; Weyman, Philip D; Glass, John I; Adams, Mark D; McNeil, Melanie A; Griffin, Peter B

2018-06-01

Custom synthesized DNA is in high demand for synthetic biology applications. However, current technologies to produce these sequences using assembly from DNA oligonucleotides are costly and labor-intensive. The automation and reduced sample volumes afforded by microfluidic technologies could significantly decrease materials and labor costs associated with DNA synthesis. The purpose of this study was to develop a gene assembly protocol utilizing a digital microfluidic device. Toward this goal, we adapted bench-scale oligonucleotide assembly methods followed by enzymatic error correction to the Mondrian™ digital microfluidic platform. We optimized Gibson assembly, polymerase chain reaction (PCR), and enzymatic error correction reactions in a single protocol to assemble 12 oligonucleotides into a 339-bp double- stranded DNA sequence encoding part of the human influenza virus hemagglutinin (HA) gene. The reactions were scaled down to 0.6-1.2 μL. Initial microfluidic assembly methods were successful and had an error frequency of approximately 4 errors/kb with errors originating from the original oligonucleotide synthesis. Relative to conventional benchtop procedures, PCR optimization required additional amounts of MgCl 2 , Phusion polymerase, and PEG 8000 to achieve amplification of the assembly and error correction products. After one round of error correction, error frequency was reduced to an average of 1.8 errors kb - 1 . We demonstrated that DNA assembly from oligonucleotides and error correction could be completely automated on a digital microfluidic (DMF) platform. The results demonstrate that enzymatic reactions in droplets show a strong dependence on surface interactions, and successful on-chip implementation required supplementation with surfactants, molecular crowding agents, and an excess of enzyme. Enzymatic error correction of assembled fragments improved sequence fidelity by 2-fold, which was a significant improvement but somewhat lower than expected compared to bench-top assays, suggesting an additional capacity for optimization.

Introduction on Using the FastPCR Software and the Related Java Web Tools for PCR and Oligonucleotide Assembly and Analysis.

PubMed

Kalendar, Ruslan; Tselykh, Timofey V; Khassenov, Bekbolat; Ramanculov, Erlan M

2017-01-01

This chapter introduces the FastPCR software as an integrated tool environment for PCR primer and probe design, which predicts properties of oligonucleotides based on experimental studies of the PCR efficiency. The software provides comprehensive facilities for designing primers for most PCR applications and their combinations. These include the standard PCR as well as the multiplex, long-distance, inverse, real-time, group-specific, unique, overlap extension PCR for multi-fragments assembling cloning and loop-mediated isothermal amplification (LAMP). It also contains a built-in program to design oligonucleotide sets both for long sequence assembly by ligase chain reaction and for design of amplicons that tile across a region(s) of interest. The software calculates the melting temperature for the standard and degenerate oligonucleotides including locked nucleic acid (LNA) and other modifications. It also provides analyses for a set of primers with the prediction of oligonucleotide properties, dimer and G/C-quadruplex detection, linguistic complexity as well as a primer dilution and resuspension calculator. The program consists of various bioinformatical tools for analysis of sequences with the GC or AT skew, CG% and GA% content, and the purine-pyrimidine skew. It also analyzes the linguistic sequence complexity and performs generation of random DNA sequence as well as restriction endonucleases analysis. The program allows to find or create restriction enzyme recognition sites for coding sequences and supports the clustering of sequences. It performs efficient and complete detection of various repeat types with visual display. The FastPCR software allows the sequence file batch processing that is essential for automation. The program is available for download at http://primerdigital.com/fastpcr.html , and its online version is located at http://primerdigital.com/tools/pcr.html .

Improved DNA hybridization parameters by Twisted Intercalating Nucleic Acid (TINA).

PubMed

Schneider, Uffe Vest

2012-01-01

This thesis establishes oligonucleotide design rules and applications of a novel group of DNA stabilizing molecules collectively called Twisted Intercalating Nucleic Acid - TINA. Three peer-reviewed publications form the basis for the thesis. One publication describes an improved and rapid method for determination of DNA melting points and two publications describe the effects of positioning TINA molecules in parallel triplex helix and antiparallel duplex helix forming DNA structures. The third publication establishes that TINA molecules containing oligonucleotides improve an antiparallel duplex hybridization based capture assay's analytical sensitivity compared to conventionel DNA oligonucleotides. Clinical microbiology is traditionally based on pathogenic microorganisms' culture and serological tests. The introduction of DNA target amplification methods like PCR has improved the analytical sensitivity and total turn around time involved in clinical diagnostics of infections. Due to the relatively weak hybridization between the two strands of double stranded DNA, a number of nucleic acid stabilizing molecules have been developed to improve the sensitivity of DNA based diagnostics through superior binding properties. A short introduction is given to Watson-Crick and Hoogsteen based DNA binding and the derived DNA structures. A number of other nucleic acid stabilizing molecules are described. The stabilizing effect of TINA molecules on different DNA structures is discussed and considered in relation to other nucleic acid stabilizing molecules and in relation to future use of TINA containing oligonucleotides in clinical diagnostics and therapy. In conclusion, design of TINA modified oligonucleotides for antiparallel duplex helixes and parallel triplex helixes follows simple purpose dependent rules. TINA molecules are well suited for improving multiplex PCR assays and can be used as part of novel technologies. Future research should test whether combinations of TINA molecules and other nucleic acid stabilizing molecules can increase analytical sensitivity whilst maintaining nucleobase mismatch discrimination in triplex helix based diagnostic assays.

Assessment of new biocompatible poly(N-(morpholino)ethyl methacrylate)-based copolymers by transfection of immortalized keratinocytes.

PubMed

Van Overstraeten-Schlögel, Nancy; Shim, Yong-Ho; Tevel, Virginie; Piel, Géraldine; Piette, Jacques; Dubois, Philippe; Raes, Martine

2012-02-01

Skin carcinomas are among the most commonly diagnosed tumors in the world. In this study, we investigated the transfection of immortalized keratinocytes, used as an in vitro model for skin carcinoma, using the antisense technology and poly(2-(dimethylamino)ethyl methacrylate) (PDMAEMA)-based copolymers. In order to improve the transfection efficiency of the classic PDMAEMA polymers, copolymers were synthesized including a poly(N-morpholino)ethylmethacrylate) (PMEMA) moiety for an improved proton-sponge effect, intended to favour the release of the oligonucleotide from the acidic endosome. These copolymers were synthesized either statistically (with alternating PDMAEMA and PMEMA fragments) or in blocks (one PDMAEMA block followed by one PMEMA block). MTT assays were performed using the PDMAEMA-PMEMA copolymers and revealed no significant cytotoxicity of these polymers at an N/P ratio of 7.3. Using fluorescent oligonucleotides and analyzing transfection efficiency by flow cytometry, we noticed no significant differences between the two kinds of copolymers. However copolymers with a higher DMAEMA content and a higher Mn were also those displaying the highest vectorization efficiency. Confocal microscopy showed that these copolymers induced a fine granular distribution of the transfected antisense oligonucleotides inside the cells. We also assessed the functionality of the transfected antisense oligonucleotide by transfecting immortalized GFP expressing keratinocytes with a GFP antisense oligonucleotide using these copolymers. A significant silencing was achieved with a PDMAEMA-PMEMA in block copolymer (Mn=41,000, 89 % PDMAEMA). Together, these results suggest that PDMAEMA-PMEMA copolymers combining low toxicity, vectorization and proton sponge properties, can be efficiently used to transfect immortalized keratinocytes and so open new perspectives in the therapy of skin carcinomas as well as of other skin diseases of genetic or immunological origin. © 2012 Informa Healthcare USA, Inc.

Automated detection and quantitation of bacterial RNA by using electrical microarrays.

PubMed

Elsholz, B; Wörl, R; Blohm, L; Albers, J; Feucht, H; Grunwald, T; Jürgen, B; Schweder, T; Hintsche, Rainer

2006-07-15

Low-density electrical 16S rRNA specific oligonucleotide microarrays and an automated analysis system have been developed for the identification and quantitation of pathogens. The pathogens are Escherichia coli, Pseudomonas aeruginosa, Enterococcus faecalis, Staphylococcus aureus, and Staphylococcus epidermidis, which are typically involved in urinary tract infections. Interdigitated gold array electrodes (IDA-electrodes), which have structures in the nanometer range, have been used for very sensitive analysis. Thiol-modified oligonucleotides are immobilized on the gold IDA as capture probes. They mediate the specific recognition of the target 16S rRNA by hybridization. Additionally three unlabeled oligonucleotides are hybridized in close proximity to the capturing site. They are supporting molecules, because they improve the RNA hybridization at the capturing site. A biotin labeled detector oligonucleotide is also allowed to hybridize to the captured RNA sequence. The biotin labels enable the binding of avidin alkaline phophatase conjugates. The phosphatase liberates the electrochemical mediator p-aminophenol from its electrically inactive phosphate derivative. The electrical signals were generated by amperometric redox cycling and detected by a unique multipotentiostat. The read out signals of the microarray are position specific current and change over time in proportion to the analyte concentration. If two additional biotins are introduced into the affinity binding complex via the supporting oligonucleotides, the sensitivity of the assays increase more than 60%. The limit of detection of Escherichia coli total RNA has been determined to be 0.5 ng/microL. The control of fluidics for variable assay formats as well as the multichannel electrical read out and data handling have all been fully automated. The fast and easy procedure does not require any amplification of the targeted nucleic acids by PCR.

Selective Inhibition of the Human tie-1 Promoter with Triplex-Forming Oligonucleotides Targeted to Ets Binding Sites

PubMed Central

Hewett, Peter W; Daft, Emma L; Laughton, Charles A; Ahmad, Shakil; Ahmed, Asif; Murray, J Clifford

2006-01-01

The Tie receptors (Tie-1 and Tie-2/Tek) are essential for angiogenesis and vascular remodeling/integrity. Tie receptors are up-regulated in tumor-associated endothelium, and their inhibition disrupts angiogenesis and can prevent tumor growth as a consequence. To investigate the potential of anti-gene approaches to inhibit tie gene expression for anti-angiogenic therapy, we have examined triple-helical (triplex) DNA formation at 2 tandem Ets transcription factor binding motifs (designated E-1 and E-2) in the human tie-1 promoter. Various tie-1 promoter deletion/mutation luciferase reporter constructs were generated and transfected into endothelial cells to examine the relative activities of E-1 and E-2. The binding of antiparallel and parallel (control) purine motif oligonucleotides (21–22 bp) targeted to E-1 and E-2 was assessed by plasmid DNA fragment binding and electrophoretic mobility shift assays. Triplex-forming oligonucleotides were incubated with tie-1 reporter constructs and transfected into endothelial cells to determine their activity. The Ets binding motifs in the E-1 sequence were essential for human tie-1 promoter activity in endothelial cells, whereas the deletion of E-2 had no effect. Antiparallel purine motif oligonucleotides targeted at E-1 or E-2 selectively formed strong triplex DNA (Kd ~10−7 M) at 37 °C. Transfection of tie-1 reporter constructs with triplex DNA at E-1, but not E-2, specifically inhibited tie-1 promoter activity by up to 75% compared with control oligonucleotides in endothelial cells. As similar multiple Ets binding sites are important for the regulation of several endothelial-restricted genes, this approach may have broad therapeutic potential for cancer and other pathologies involving endothelial proliferation/dysfunction. PMID:16838069

Selective inhibition of the human tie-1 promoter with triplex-forming oligonucleotides targeted to Ets binding sites.

PubMed

Hewett, Peter W; Daft, Emma L; Laughton, Charles A; Ahmad, Shakil; Ahmed, Asif; Murray, J Clifford

2006-01-01

The Tie receptors (Tie-1 and Tie-2/Tek) are essential for angiogenesis and vascular remodeling/integrity. Tie receptors are up-regulated in tumor-associated endothelium, and their inhibition disrupts angiogenesis and can prevent tumor growth as a consequence. To investigate the potential of anti-gene approaches to inhibit tie gene expression for anti-angiogenic therapy, we have examined triple-helical (triplex) DNA formation at 2 tandem Ets transcription factor binding motifs (designated E-1 and E-2) in the human tie-1 promoter. Various tie-1 promoter deletion/mutation luciferase reporter constructs were generated and transfected into endothelial cells to examine the relative activities of E-1 and E-2. The binding of antiparallel and parallel (control) purine motif oligonucleotides (21-22 bp) targeted to E-1 and E-2 was assessed by plasmid DNA fragment binding and electrophoretic mobility shift assays. Triplex-forming oligonucleotides were incubated with tie-1 reporter constructs and transfected into endothelial cells to determine their activity. The Ets binding motifs in the E-1 sequence were essential for human tie-1 promoter activity in endothelial cells, whereas the deletion of E-2 had no effect. Antiparallel purine motif oligonucleotides targeted at E-1 or E-2 selectively formed strong triplex DNA (K(d) approximately 10(-7) M) at 37 degrees C. Transfection of tie-1 reporter constructs with triplex DNA at E-1, but not E-2, specifically inhibited tie-1 promoter activity by up to 75% compared with control oligonucleotides in endothelial cells. As similar multiple Ets binding sites are important for the regulation of several endothelial-restricted genes, this approach may have broad therapeutic potential for cancer and other pathologies involving endothelial proliferation/dysfunction.

Decoy Oligonucleotide Rescues IGF1R Expression from MicroRNA-223 Suppression

PubMed Central

Wang, Rong; He, Bao Mei; Qi, Bing; Xu, Chang Jun; Wu, Xing Zhong

2013-01-01

A mature miRNA generally suppresses hundreds of mRNA targets. To evaluate the selective effect of synthetic oligonucleotide decoys on hsa-miR-223 activity, reporters containing 3’ untranslated regions (UTR) of IGF1R, FOXO1, POLR3G, FOXO3, CDC27, FBXW7 and PAXIP1 mRNAs were constructed for the luciferase assay. The oligonucleotide decoys were designed and synthesized according to mature miR-223 sequence and its target mRNA sequence. Quantitative RT-PCR & western analysis were used to measure miR-223-targeted mRNA expression, Interestingly, apart from the antisense oligonucleotide, decoy nucleotides which were complementary to the 5’, central or 3’ region of mature miR-223 suppressed miR-223 targeting the 3’UTR of IGF1R, FOXO1, FOXO3, CDC27, POLR3G, and FBXW7 mRNAs and rescued the expression of these genes to varying degrees from miR-223 suppression at both mRNA and protein levels. All decoys had no effect on PAXIP1 which was not targeted by miR-223. The decoy 1 that was based on the sequence of IGF1R 3’UTR rescued the expression of IGF1R more significantly than other decoy nucleotides except the antisense decoy 4. Decoy 1 also rescued the expression of FOXO3 and POLR3G of which their 3’UTRs have similar binding sites for miR-223 with IGF1R 3’UTR. However decoy 1 failed to recover Sp1, CDC27 and FBXW7 expression. These data support that the sequence-specific decoy oligonucleotides might represent exogenous competing RNA which selectively inhibits microRNA targeting. PMID:24324762

Decoy oligonucleotide rescues IGF1R expression from MicroRNA-223 suppression.

PubMed

Wu, Li Hui; Cai, Qian Qian; Dong, Yi Wei; Wang, Rong; He, Bao Mei; Qi, Bing; Xu, Chang Jun; Wu, Xing Zhong

2013-01-01

A mature miRNA generally suppresses hundreds of mRNA targets. To evaluate the selective effect of synthetic oligonucleotide decoys on hsa-miR-223 activity, reporters containing 3' untranslated regions (UTR) of IGF1R, FOXO1, POLR3G, FOXO3, CDC27, FBXW7 and PAXIP1 mRNAs were constructed for the luciferase assay. The oligonucleotide decoys were designed and synthesized according to mature miR-223 sequence and its target mRNA sequence. Quantitative RT-PCR & western analysis were used to measure miR-223-targeted mRNA expression, Interestingly, apart from the antisense oligonucleotide, decoy nucleotides which were complementary to the 5', central or 3' region of mature miR-223 suppressed miR-223 targeting the 3'UTR of IGF1R, FOXO1, FOXO3, CDC27, POLR3G, and FBXW7 mRNAs and rescued the expression of these genes to varying degrees from miR-223 suppression at both mRNA and protein levels. All decoys had no effect on PAXIP1 which was not targeted by miR-223. The decoy 1 that was based on the sequence of IGF1R 3'UTR rescued the expression of IGF1R more significantly than other decoy nucleotides except the antisense decoy 4. Decoy 1 also rescued the expression of FOXO3 and POLR3G of which their 3'UTRs have similar binding sites for miR-223 with IGF1R 3'UTR. However decoy 1 failed to recover Sp1, CDC27 and FBXW7 expression. These data support that the sequence-specific decoy oligonucleotides might represent exogenous competing RNA which selectively inhibits microRNA targeting.

H-BLAST: a fast protein sequence alignment toolkit on heterogeneous computers with GPUs.

PubMed

Ye, Weicai; Chen, Ying; Zhang, Yongdong; Xu, Yuesheng

2017-04-15

The sequence alignment is a fundamental problem in bioinformatics. BLAST is a routinely used tool for this purpose with over 118 000 citations in the past two decades. As the size of bio-sequence databases grows exponentially, the computational speed of alignment softwares must be improved. We develop the heterogeneous BLAST (H-BLAST), a fast parallel search tool for a heterogeneous computer that couples CPUs and GPUs, to accelerate BLASTX and BLASTP-basic tools of NCBI-BLAST. H-BLAST employs a locally decoupled seed-extension algorithm for better performance on GPUs, and offers a performance tuning mechanism for better efficiency among various CPUs and GPUs combinations. H-BLAST produces identical alignment results as NCBI-BLAST and its computational speed is much faster than that of NCBI-BLAST. Speedups achieved by H-BLAST over sequential NCBI-BLASTP (resp. NCBI-BLASTX) range mostly from 4 to 10 (resp. 5 to 7.2). With 2 CPU threads and 2 GPUs, H-BLAST can be faster than 16-threaded NCBI-BLASTX. Furthermore, H-BLAST is 1.5-4 times faster than GPU-BLAST. https://github.com/Yeyke/H-BLAST.git. yux06@syr.edu. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

Novel process for production of micro lenses with increased centering accuracy and imaging performance

NASA Astrophysics Data System (ADS)

Wilde, C.; Langehanenberg, P.; Schenk, T.

2017-10-01

For modern production of micro lens systems, such as cementing of doublets or more lenses, precise centering of the lens edge is crucial. Blocking the lens temporarily on a centering arbor ensures that the centers of all optical lens surfaces coincide with the lens edge, while the arbor's axis serves as reference for both alignment and edging process. This theoretical assumption of the traditional cementing technology is not applicable for high-end production. In reality cement wedges between the bottom lens surface and the arbor's ring knife edge may occur and even expensive arbors with single-micron precision suffer from reduced quality of the ring knife edge after multiple usages and cleaning cycles. Consequently, at least the position of the bottom lens surface is undefined and the optical axis does not coincide with the arbor's reference axis! In order to overcome this basic problem in using centering arbors, we present a novel and efficient technique which can measure and align both surfaces of a lens with respect to the arbor axis with high accuracy and furthermore align additional lenses to the optical axis of the bottom lens. This is accomplished by aligning the lens without mechanical contact to the arbor. Thus the lens can be positioned in four degrees of freedom, while the centration errors of all lens surfaces are measured and considered. Additionally the arbor's reference axis is not assumed to be aligned to the rotation axis, but simultaneously measured with high precision.

Laboratory Experiments on Rotation of Micron Size Cosmic Dust Grains with Radiation

NASA Technical Reports Server (NTRS)

Abbas, M. M.; Craven, P. D.; Spann, J. F.; Tankosic, D.; LeClair, A.; Gallagher, D. L.; West, E.; Weingartner, J.; Witherow, W. K.

2004-01-01

The processes and mechanisms involved in the rotation and alignment of interstellar dust grains have been of great interest in astrophysics ever since the surprising discovery of the polarization of starlight more than half a century ago. Numerous theories, detailed mathematical models and numerical studies of grain rotation and alignment along the Galactic magnetic field have been presented in the literature. In particular, the subject of grain rotation and alignment by radiative torques has been shown to be of particular interest in recent years. However, despite many investigations, a satisfactory theoretical understanding of the processes involved in grain rotation and alignment has not been achieved. As there appears to be no experimental data available on this subject, we have carried out some unique experiments to illuminate the processes involved in rotation of dust grains in the interstellar medium. In this paper we present the results of some preliminary laboratory experiments on the rotation of individual micron/submicron size nonspherical dust grains levitated in an electrodynamic balance evacuated to pressures of approx. 10(exp -3) to 10(exp -5) torr. The particles are illuminated by laser light at 5320 A, and the grain rotation rates are obtained by analyzing the low frequency (approx. 0-100 kHz) signal of the scattered light detected by a photodiode detector. The rotation rates are compared with simple theoretical models to retrieve some basic rotational parameters. The results are examined in the light of the current theories of alignment.

Access Based Cost Estimation for Beddown Analysis

DTIC Science & Technology

2006-03-23

logic. This research expands upon the existing research by using Visual Basic for Applications ( VBA ) to further customize and streamline the...methods with the use of VBA . Calculations are completed in either underlying Form VBA code or through global modules accessible throughout the...query and SQL referencing. Attempts were made where possible to align data structures with possible external sources to minimize import errors and

Oligonucleotide aptamers against tyrosine kinase receptors: Prospect for anticancer applications.

PubMed

Camorani, Simona; Crescenzi, Elvira; Fedele, Monica; Cerchia, Laura

2018-04-01

Transmembrane receptor tyrosine kinases (RTKs) play crucial roles in cancer cell proliferation, survival, migration and differentiation. Area of intense research is searching for effective anticancer therapies targeting these receptors and, to date, several monoclonal antibodies and small-molecule tyrosine kinase inhibitors have entered the clinic. However, some of these drugs show limited efficacy and give rise to acquired resistance. Emerging highly selective compounds for anticancer therapy are oligonucleotide aptamers that interact with their targets by recognizing a specific three-dimensional structure. Because of their nucleic acid nature, the rational design of advanced strategies to manipulate aptamers for both diagnostic and therapeutic applications is greatly simplified over antibodies. In this manuscript, we will provide a comprehensive overview of oligonucleotide aptamers as next generation strategies to efficiently target RTKs in human cancers. Copyright © 2018 Elsevier B.V. All rights reserved.

Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.

PubMed

Black, W C; Gorrochotegui-Escalante, N; Duteau, N M

2006-03-01

Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.

Hydrated electrons react with high specificity with cisplatin bound to single-stranded DNA.

PubMed

Behmand, B; Cloutier, P; Girouard, S; Wagner, J R; Sanche, L; Hunting, D J

2013-12-19

Short oligonucleotides TTTTTGTGTTT and TTTTTTTGTTT in solution with and without cisplatin (cisPt) bound to the guanine bases were irradiated with γ-rays at doses varying from 0 to 2500 Gy. To determine the effect of hydrated electrons from water radiolysis on the oligonucleotides, we quenched (•)OH radicals with ethylenediaminetetraacetic acid (EDTA) and displaced oxygen, which reacts with hydrated electrons, by bubbling the solution with wet nitrogen. DNA strand breaks and platinum detachment were quantified by gel electrophoresis. Our results demonstrate that hydrated electrons react almost exclusively at the position of the cisPt adduct, where they induce cisPt detachment from one or both guanines in the oligonucleotide. Given the high yield of hydrated electrons in irradiated tissues, this reaction may be an important step in the mechanism of radiosensitization of DNA by cisPt.

Preparation of genosensor for detection of specific DNA sequence of the hepatitis B virus

NASA Astrophysics Data System (ADS)

Honorato Castro, Ana C.; França, Erick G.; de Paula, Lucas F.; Soares, Marcia M. C. N.; Goulart, Luiz R.; Madurro, João M.; Brito-Madurro, Ana G.

2014-09-01

An electrochemical genosensor was constructed for detection of specific DNA sequence of the hepatitis B virus, based on graphite electrodes modified with poly(4-aminophenol) and incorporating a specific oligonucleotide probe. The modified electrode containing the probe was evaluated by differential pulse voltammetry, before and after incubation with the complementary oligonucleotide target. Detection was performed by monitoring oxidizable DNA bases (direct detection) or using ethidium bromide as indicator of the hybridization process (indirect detection). The device showed a detection limit for the oligonucleotide target of 2.61 nmol L-1. Indirect detection using ethidium bromide was promising in discriminating mismatches, which is a very desirable attribute for detection of disease-related point mutations. In addition, it was possible to observe differences between hybridized and non-hybridized surfaces by atomic force microscopy.

Sieve-based device for MALDI sample preparation. I. Influence of sample deposition conditions in oligonucleotide analysis to achieve significant increases in both sensitivity and resolution.

PubMed

Molin, Laura; Cristoni, Simone; Crotti, Sara; Bernardi, Luigi Rossi; Seraglia, Roberta; Traldi, Pietro

2008-11-01

Spraying of oligonucleotide-matrix solutions through a stainless steel (ss) sieve (38 microm, 450 mesh) leads to the formation, on the matrix-assisted laser desorption/ionization (MALDI) sample holder, of uniformly distributed microcrystals, well separated from each other. When the resulting sample holder surface is irradiated by laser, abundant molecular species form, with a clear increase in both intensity and resolution with respect to values obtained by 'Dried Droplet', 'Double Layer', and 'Sandwich' deposition methods. In addition, unlike the usual situation, the sample is perfectly homogeneous, and identical spectra are obtained by irradiating different areas. On one hand, the data indicate that this method is highly effective for oligonucleotide MALDI analysis, and on the other, that it can be validly employed for fully automated MALDI procedures.

Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

PubMed

Yang, Haozhe; Mei, Hui; Seela, Frank

2015-07-06

Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Validation of the high-throughput marker technology DArT using the model plant Arabidopsis thaliana.

PubMed

Wittenberg, Alexander H J; van der Lee, Theo; Cayla, Cyril; Kilian, Andrzej; Visser, Richard G F; Schouten, Henk J

2005-08-01

Diversity Arrays Technology (DArT) is a microarray-based DNA marker technique for genome-wide discovery and genotyping of genetic variation. DArT allows simultaneous scoring of hundreds of restriction site based polymorphisms between genotypes and does not require DNA sequence information or site-specific oligonucleotides. This paper demonstrates the potential of DArT for genetic mapping by validating the quality and molecular basis of the markers, using the model plant Arabidopsis thaliana. Restriction fragments from a genomic representation of the ecotype Landsberg erecta (Ler) were amplified by PCR, individualized by cloning and spotted onto glass slides. The arrays were then hybridized with labeled genomic representations of the ecotypes Columbia (Col) and Ler and of individuals from an F(2) population obtained from a Col x Ler cross. The scoring of markers with specialized software was highly reproducible and 107 markers could unambiguously be ordered on a genetic linkage map. The marker order on the genetic linkage map coincided with the order on the DNA sequence map. Sequencing of the Ler markers and alignment with the available Col genome sequence confirmed that the polymorphism in DArT markers is largely a result of restriction site polymorphisms.

Formation of oligonucleotide-PNA-chimeras by template-directed ligation

NASA Technical Reports Server (NTRS)

Koppitz, M.; Nielsen, P. E.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

1998-01-01

DNA sequences have previously been reported to act as templates for the synthesis of PNA, and vice versa. A continuous evolutionary transition from an informational replicating system based on one polymer to a system based on the other would be facilitated if it were possible to form chimeras, that is molecules that contain monomers of both types. Here we show that ligation to form chimeras proceeds efficiently both on PNA and on DNA templates. The efficiency of ligation is primarily determined by the number of backbone bonds at the ligation site and the relative orientation of template and substrate strands. The most efficient reactions result in the formation of chimeras with ligation junctions resembling the structures of the backbones of PNA and DNA and with antiparallel alignment of both components of the chimera with the template, that is, ligations involving formation of 3'-phosphoramidate and 5'-ester bonds. However, double helices involving PNA are stable both with antiparallel and parallel orientation of the two strands. Ligation on PNA but not on DNA templates is, therefore, sometimes possible on templates with reversed orientation. The relevance of these findings to discussions of possible transitions between genetic systems is discussed.

Targeted Delivery of Therapeutic Oligonucleotides for the Treatment of Prostate Cancer

DTIC Science & Technology

2004-05-01

AD Award Number: DAMD17-01-1-0090 TITLE: Targeted Delivery of Therapeutic Oligonucleotides for the Treatment of Prostate Cancer PRINCIPAL...independence and chemoresistance are the major obstacles in the treatment of patients with advanced prostate cancer (Denis & Murphy, 1993; Oh & Kantoff...independence and chemoresistance in prostate cancer (McDonnell et al., 1992; Colombel et al., 1993; Berchem et al., 1995; Raffo et al., 1995; Bauer et al

Soft Lithography for Oligonucleotide Arrays Fabrication

DTIC Science & Technology

2001-10-25

adenosine; Abbreviated T, C, G, A respectively), the other synthesis reagents and solvents except oxidation agent (seen in Table 1) were purchased...dried by cold blowing before hybridization. Oligonucleotide arrays were hybridized in 200 nM 3’-TCC TCC GAT TCA GAG AGT CC- HEX (PE Biosystems... citrate buffer), 0.1% SDS in 0.1xSSC respectively. The probe array was scanned on the Scanarray Microarray Systems (Packard Biochip Technologies, USA

DNA polymorphism identity determination using flow cytometry

DOEpatents

Nolan, John P.; White, P. Scott; Cai, Hong

2001-01-01

DNA polymorphism identity determination using flow cytometry. Primers designed to be immobilized on microspheres are allowed to anneal to the DNA strand under investigation, and are extended by either DNA polymerase using fluorescent dideoxynucleotides or ligated by DNA ligase to fluorescent reporter oligonucleotides. The fluorescence of either the dideoxynucleotide or the reporter oligonucleotide attached to the immobilized primer is measured by flow cytometry, thereby identifying the nucleotide polymorphism on the DNA strand.

Antisense Oligonucleotide Therapy for Patients with Advanced Cancer | Center for Cancer Research

Cancer.gov

Colorectal cancer (CRC) is the second leading cause of cancer-related death in the U.S. Improvements in therapy have increased the survival of patients with CRC from 10 months to two years, but for patients who stop responding to treatments, such as irinotecan, options for additional therapy are limited. Antisense oligonucleotides (ASOs) may offer advantages over traditional therapies if an appropriate target can be identified.

Co-Administration of an Excipient Oligonucleotide Helps Delineate Pathways of Productive and Nonproductive Uptake of Phosphorothioate Antisense Oligonucleotides in the Liver.

PubMed

Donner, Aaron J; Wancewicz, Edward V; Murray, Heather M; Greenlee, Sarah; Post, Noah; Bell, Melanie; Lima, Walt F; Swayze, Eric E; Seth, Punit P

2017-08-01

Phosphorothioate (PS) modified antisense oligonucleotides (ASOs) have progressed rapidly in the clinic for treating a variety of disease indications. We previously demonstrated that the activity of PS ASOs in the liver can be enhanced by co-infusion of an excipient oligonucleotide (EON). It was posited that the EON saturates a nonproductive uptake pathway(s) thereby permitting accumulation of the PS ASO in a productive tissue compartment. In this report, we measured PS ASO activity following administration by bolus, infusion or co-fusion with EON within hepatocytes and nonparenchymal cells (NPCs), of the liver. This revealed that while ASOs accumulate preferentially in NPCs, they are intrinsically more active in hepatocytes. Furthermore, we show that the EON enhances ASO potency when infused up to 72 h before or after administration of the active ASO suggesting that the EON can saturate and displace the ASO from nonproductive to productive compartments. Physical presence of the EON in tissues was required for optimal potentiation suggesting that there is a dynamic distribution of the ASO and EON between the compartments. Lastly, using a candidate approach, we confirmed Stabilin-2 as a molecular pathway for ASO uptake in sinusoidal endothelial cells and the ASGR as a pathway for ASO uptake into hepatocytes in the liver.

Real-Time and Accurate Identification of Single Oligonucleotide Photoisomers via an Aerolysin Nanopore.

PubMed

Hu, Zheng-Li; Li, Zi-Yuan; Ying, Yi-Lun; Zhang, Junji; Cao, Chan; Long, Yi-Tao; Tian, He

2018-04-03

Identification of the configuration for the photoresponsive oligonucleotide plays an important role in the ingenious design of DNA nanomolecules and nanodevices. Due to the limited resolution and sensitivity of present methods, it remains a challenge to determine the accurate configuration of photoresponsive oligonucleotides, much less a precise description of their photoconversion process. Here, we used an aerolysin (AeL) nanopore-based confined space for real-time determination and quantification of the absolute cis/ trans configuration of each azobenzene-modified oligonucleotide (Azo-ODN) with a single molecule resolution. The two completely separated current distributions with narrow peak widths at half height (<0.62 pA) are assigned to cis/ trans-Azo-ODN isomers, respectively. Due to the high current sensitivity, each isomer of Azo-ODN could be undoubtedly identified, which gives the accurate photostationary conversion values of 82.7% for trans-to- cis under UV irradiation and 82.5% for cis-to- trans under vis irradiation. Further real-time kinetic evaluation reveals that the photoresponsive rate constants of Azo-ODN from trans-to- cis and cis-to -trans are 0.43 and 0.20 min -1 , respectively. This study will promote the sophisticated design of photoresponsive ODN to achieve an efficient and applicable photocontrollable process.

A nonviral transfection approach in vitro: the design of a gold nanoparticle vector joint with microelectromechanical systems.

PubMed

Jen, Chun-Ping; Chen, Yu-Hung; Fan, Chun-sheng; Yeh, Chen-Sheng; Lin, Yu-Cheng; Shieh, Dar-Bin; Wu, Chao-Ling; Chen, Dong-Hwang; Chou, Chen-Hsi

2004-02-17

Au nanoparticles modified with 21-base thiolated-oligonucleotides have been evaluated as delivery vehicles for the development of a nonviral transfection platform. The electromigration combined with electroporation for DNA delivery in an osteoblast like cell was employed to test on microchips. Electroporation introduces foreign materials into cells by applying impulses of electric field to induce multiple transient pores on the cell membrane through dielectric breakdown of the cell membrane. On the basis of the characteristic surface plasmon of the Au particles, UV-vis absorption was utilized to qualitatively judge the efficiency of delivery. Transmission electron microscopy images and atomic absorption measurements (quantitative analysis) provided evidence of the bare Au and Au/oligonucleotide nanoparticles before and after electroporation and electromigration function. The experiments demonstrated that electrophoretic migration followed by electroporation significantly enhanced the transportation efficiency of the nanoparticle-oligonucleotide complexes as compared with electroporation alone. Most interestingly, Au capped with oligonucleotides led to optimal performance. On the other hand, the bare Au colloidal suspensions resulted in aggregation, which might be an obstacle to the internalization process. In addition, analytical results demonstrated an increase in the local particle concentrations on the cell surface that provided additional support for the mechanism underlying the improved Au nanoparticle transportation into cells in the presence of electromigration function.

In vitro selection using a dual RNA library that allows primerless selection

PubMed Central

Jarosch, Florian; Buchner, Klaus; Klussmann, Sven

2006-01-01

High affinity target-binding aptamers are identified from random oligonucleotide libraries by an in vitro selection process called Systematic Evolution of Ligands by EXponential enrichment (SELEX). Since the SELEX process includes a PCR amplification step the randomized region of the oligonucleotide libraries need to be flanked by two fixed primer binding sequences. These primer binding sites are often difficult to truncate because they may be necessary to maintain the structure of the aptamer or may even be part of the target binding motif. We designed a novel type of RNA library that carries fixed sequences which constrain the oligonucleotides into a partly double-stranded structure, thereby minimizing the risk that the primer binding sequences become part of the target-binding motif. Moreover, the specific design of the library including the use of tandem RNA Polymerase promoters allows the selection of oligonucleotides without any primer binding sequences. The library was used to select aptamers to the mirror-image peptide of ghrelin. Ghrelin is a potent stimulator of growth-hormone release and food intake. After selection, the identified aptamer sequences were directly synthesized in their mirror-image configuration. The final 44 nt-Spiegelmer, named NOX-B11-3, blocks ghrelin action in a cell culture assay displaying an IC50 of 4.5 nM at 37°C. PMID:16855281

Electron stimulated desorption of anions from native and brominated single stranded oligonucleotide trimers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Polska, Katarzyna; Rak, Janusz; Bass, Andrew D.

2012-02-21

We measured the low energy electron stimulated desorption (ESD) of anions from thin films of native (TXT) and bromine monosubstituted (TBrXT) oligonucleotide trimers deposited on a gold surface (T = thymidine, X = T, deoxycytidine (C), deoxyadenosine (A) or deoxyguanosine (G), Br = bromine). The desorption of H{sup -}, CH{sub 3}{sup -}/NH{sup -}, O{sup -}/NH{sub 2}{sup -}, OH{sup -}, CN{sup -}, and Br{sup -} was induced by 0 to 20 eV electrons. Dissociative electron attachment, below 12 eV, and dipolar dissociation, above 12 eV, are responsible for the formation of these anions. The comparison of the results obtained for themore » native and brominated trimers suggests that the main pathways of TBrXT degradation correspond to the release of the hydride and bromide anions. Significantly, the presence of bromine in oligonucleotide trimers blocks the electron-induced degradation of nuclobases as evidenced by a dramatic decrease in CN{sup -} desorption. An increase in the yields of OH{sup -} is also observed. The debromination yield of particular oligonucleotides diminishes in the following order: BrdU > BrdA > BrdG > BrdC. Based on these results, 5-bromo-2{sup '}-deoxyuridine appears to be the best radiosensitizer among the studied bromonucleosides.« less

Optical properties and electronic transitions of DNA oligonucleotides as a function of composition and stacking sequence.

PubMed

Schimelman, Jacob B; Dryden, Daniel M; Poudel, Lokendra; Krawiec, Katherine E; Ma, Yingfang; Podgornik, Rudolf; Parsegian, V Adrian; Denoyer, Linda K; Ching, Wai-Yim; Steinmetz, Nicole F; French, Roger H

2015-02-14

The role of base pair composition and stacking sequence in the optical properties and electronic transitions of DNA is of fundamental interest. We present and compare the optical properties of DNA oligonucleotides (AT)10, (AT)5(GC)5, and (AT-GC)5 using both ab initio methods and UV-vis molar absorbance measurements. Our data indicate a strong dependence of both the position and intensity of UV absorbance features on oligonucleotide composition and stacking sequence. The partial densities of states for each oligonucleotide indicate that the valence band edge arises from a feature associated with the PO4(3-) complex anion, and the conduction band edge arises from anti-bonding states in DNA base pairs. The results show a strong correspondence between the ab initio and experimentally determined optical properties. These results highlight the benefit of full spectral analysis of DNA, as opposed to reductive methods that consider only the 260 nm absorbance (A260) or simple purity ratios, such as A260/A230 or A260/A280, and suggest that the slope of the absorption edge onset may provide a useful metric for the degree of base pair stacking in DNA. These insights may prove useful for applications in biology, bioelectronics, and mesoscale self-assembly.

Antisense oligonucleotides as innovative therapeutic strategy in the treatment of high-grade gliomas.

PubMed

Caruso, Gerardo; Caffo, Mariella; Raudino, Giuseppe; Alafaci, Concetta; Salpietro, Francesco M; Tomasello, Francesco

2010-01-01

Despite the intensive recent research in cancer therapy, the prognosis in patients affected by high-grade gliomas is still very unfavorable. The efficacy of classical anti-cancer strategies is seriously limited by lack of specific therapies against malignant cells. The extracellular matrix plays a pivotal role in processes such as differentiation, apoptosis, and migration in both the normal and the pathologic nervous system. Glial tumors seem to be able to create a favorable environment for the invasion of glioma cells in cerebral parenchyma when they combine with the extracellular matrix via cell surface receptors. Glioma cells synthesize matrix proteins, such as tenascin, laminin, fibronectin that facilitate the tumor cell's motility. New treatments have shown to hit the acting molecules in the tumor growth and to increase the efficacy and minimize the toxicity. Antisense oligonucleotides are synthetic stretches of DNA which hybridize with specific mRNA strands. The specificity of hybridization makes antisense method an interesting strategy to selectively modulate the expression of genes involved in tumorigenesis. In this review we will focus on the mechanisms of action of antisense oligonucleotides and report clinical and experimental studies on the treatment of high-grade gliomas. We will also report the patents of preclinical and/or clinical studies that adopt the antisense oligonucleotide therapy list in cerebral gliomas.

Integrated Safety Assessment of 2′-O-Methoxyethyl Chimeric Antisense Oligonucleotides in NonHuman Primates and Healthy Human Volunteers

PubMed Central

Crooke, Stanley T; Baker, Brenda F; Kwoh, T Jesse; Cheng, Wei; Schulz, Dan J; Xia, Shuting; Salgado, Nelson; Bui, Huynh-Hoa; Hart, Christopher E; Burel, Sebastien A; Younis, Husam S; Geary, Richard S; Henry, Scott P; Bhanot, Sanjay

2016-01-01

The common chemical and biological properties of antisense oligonucleotides provide the opportunity to identify and characterize chemical class effects across species. The chemical class that has proven to be the most versatile and best characterized is the 2′-O-methoxyethyl chimeric antisense oligonucleotides. In this report we present an integrated safety assessment of data obtained from controlled dose-ranging studies in nonhuman primates (macaques) and healthy human volunteers for 12 unique 2′-O-methoxyethyl chimeric antisense oligonucleotides. Safety was assessed by the incidence of safety signals in standardized laboratory tests for kidney and liver function, hematology, and complement activation; as well as by the mean test results as a function of dose level over time. At high doses a number of toxicities were observed in nonhuman primates. However, no class safety effects were identified in healthy human volunteers from this integrated data analysis. Effects on complement in nonhuman primates were not observed in humans. Nonhuman primates predicted safe doses in humans, but over predicted risk of complement activation and effects on platelets. Although limited to a single chemical class, comparisons from this analysis are considered valid and accurate based on the carefully controlled setting for the specified study populations and within the total exposures studied. PMID:27357629

VIP Barcoding: composition vector-based software for rapid species identification based on DNA barcoding.

PubMed

Fan, Long; Hui, Jerome H L; Yu, Zu Guo; Chu, Ka Hou

2014-07-01

Species identification based on short sequences of DNA markers, that is, DNA barcoding, has emerged as an integral part of modern taxonomy. However, software for the analysis of large and multilocus barcoding data sets is scarce. The Basic Local Alignment Search Tool (BLAST) is currently the fastest tool capable of handling large databases (e.g. >5000 sequences), but its accuracy is a concern and has been criticized for its local optimization. However, current more accurate software requires sequence alignment or complex calculations, which are time-consuming when dealing with large data sets during data preprocessing or during the search stage. Therefore, it is imperative to develop a practical program for both accurate and scalable species identification for DNA barcoding. In this context, we present VIP Barcoding: a user-friendly software in graphical user interface for rapid DNA barcoding. It adopts a hybrid, two-stage algorithm. First, an alignment-free composition vector (CV) method is utilized to reduce searching space by screening a reference database. The alignment-based K2P distance nearest-neighbour method is then employed to analyse the smaller data set generated in the first stage. In comparison with other software, we demonstrate that VIP Barcoding has (i) higher accuracy than Blastn and several alignment-free methods and (ii) higher scalability than alignment-based distance methods and character-based methods. These results suggest that this platform is able to deal with both large-scale and multilocus barcoding data with accuracy and can contribute to DNA barcoding for modern taxonomy. VIP Barcoding is free and available at http://msl.sls.cuhk.edu.hk/vipbarcoding/. © 2014 John Wiley & Sons Ltd.

Standard and modified administrations of the Iowa Tests of Basic Skills with learning disabled students.

PubMed

Estes, R E; Baum, D L; Bray, N M

1986-04-01

The purpose of this study was to investigate the performance of junior high school learning disabled students on standard and modified administrations of selected subtests from the Iowa Tests of Basic Skills. No significant differences were noted for correlations between types of administration and teachers' ratings on any of the subtest comparisons. Grade placements for Vocabulary and Reading Comprehension using the modified administration were significantly higher than those using the standard administration and more closely aligned with teachers' ratings. Math Concept and Math Problem-solving grade-placement scores did not differ by type of administration; teachers' ratings were higher than those produced by either testing format.

Sustainable Survival for adolescents living with HIV: do SDG-aligned provisions reduce potential mortality risk?

PubMed

Cluver, Lucie; Pantelic, Marija; Orkin, Mark; Toska, Elona; Medley, Sally; Sherr, Lorraine

2018-02-01

The Sustainable Development Goals (SDGs) present a groundbreaking global development agenda to protect the most vulnerable. Adolescents living with HIV in Sub-Saharan Africa continue to experience extreme health vulnerabilities, but we know little about the impacts of SDG-aligned provisions on their health. This study tests associations of provisions aligned with five SDGs with potential mortality risks. Clinical and interview data were gathered from N = 1060 adolescents living with HIV in rural and urban South Africa in 2014 to 2015. All ART-initiated adolescents from 53 government health facilities were identified, and traced in their communities to include those defaulting and lost-to-follow-up. Potential mortality risk was assessed as either: viral suppression failure (1000+ copies/ml) using patient file records, or adolescent self-report of diagnosed but untreated tuberculosis or symptomatic pulmonary tuberculosis. SDG-aligned provisions were measured through adolescent interviews. Provisions aligned with SDGs 1&2 (no poverty and zero hunger) were operationalized as access to basic necessities, social protection and food security; An SDG 3-aligned provision (ensure healthy lives) was having a healthy primary caregiver; An SDG 8-aligned provision (employment for all) was employment of a household member; An SDG 16-aligned provision (protection from violence) was protection from physical, sexual or emotional abuse. Research partners included the South African national government, UNICEF and Pediatric and Adolescent Treatment for Africa. 20.8% of adolescents living with HIV had potential mortality risk - i.e. viral suppression failure, symptomatic untreated TB, or both. All SDG-aligned provisions were significantly associated with reduced potential mortality risk: SDG 1&2 (OR 0.599 CI 0.361 to 0.994); SDG 3 (OR 0.577 CI 0.411 to 0.808); SDG 8 (OR 0.602 CI 0.440 to 0.823) and SDG 16 (OR 0.686 CI 0.505 to 0.933). Access to multiple SDG-aligned provisions showed a strongly graded reduction in potential mortality risk: Among adolescents living with HIV, potential mortality risk was 38.5% with access to no SDG-aligned provisions, and 9.3% with access to all four. SDG-aligned provisions across a range of SDGs were associated with reduced potential mortality risk among adolescents living with HIV. Access to multiple provisions has the potential to substantially improve survival, suggesting the value of connecting and combining SDGs in our response to paediatric and adolescent HIV. © 2018 The Authors. Journal of the International AIDS Society published by John Wiley & sons Ltd on behalf of the International AIDS Society.

Vaccine-induced rabies in a red fox (Vulpes vulpes): isolation of vaccine virus in brain tissue and salivary glands.

PubMed

Hostnik, Peter; Picard-Meyer, Evelyne; Rihtarič, Danijela; Toplak, Ivan; Cliquet, Florence

2014-04-01

Oral vaccination campaigns to eliminate fox rabies were initiated in Slovenia in 1995. In May 2012, a young fox (Vulpes vulpes) with typical rabies signs was captured. Its brain and salivary gland tissues were found to contain vaccine strain SAD B19. The Basic Logical Alignment Search Tool alignment of 589 nucleotides determined from the N gene of the virus isolated from the brain and salivary glands of the affected fox was 100% identical to the GenBank reference SAD B19 strain. Sequence analysis of the N and M genes (4,351 nucleotides) showed two nucleotide modifications at position 1335 (N gene) and 3114 (M gene) in the KC522613 isolate identified in the fox compared to SAD B19.

Terahertz Science and Technology of Macroscopically Aligned Carbon Nanotube Films

NASA Astrophysics Data System (ADS)

Kono, Junichiro

One of the outstanding challenges in nanotechnology is how to assemble individual nano-objects into macroscopic architectures while preserving their extraordinary properties. For example, the one-dimensional character of electrons in individual carbon nanotubes leads to extremely anisotropic transport, optical, and magnetic phenomena, but their macroscopic manifestations have been limited. Here, we describe methods for preparing macroscopic films, sheets, and fibers of highly aligned carbon nanotubes and their applications to basic and applied terahertz studies. Sufficiently thick films act as ideal terahertz polarizers, and appropriately doped films operate as polarization-sensitive, flexible, powerless, and ultra-broadband detectors. Together with recently developed chirality enrichment methods, these developments will ultimately allow us to study dynamic conductivities of interacting one-dimensional electrons in macroscopic single crystals of single-chirality single-wall carbon nanotubes.

Aligning library instruction with the needs of basic sciences graduate students: a case study.

PubMed

O'Malley, Donna; Delwiche, Frances A

2012-10-01

How can an existing library instruction program be reconfigured to reach basic sciences graduate students and other patrons missed by curriculum-based instruction? The setting is an academic health sciences library that serves both the university and its affiliated teaching hospital. The existing program was redesigned to incorporate a series of seven workshops that encompassed the range of information literacy skills that graduate students in the basic sciences need. In developing the new model, the teaching librarians made changes in pedagogy, technology, marketing, and assessment strategies. Total attendance at the sessions increased substantially in the first 2 years of the new model, increasing from an average of 20 per semester to an average of 124. Survey results provided insight about what patrons wanted to learn and how best to teach it. Modifying the program's content and structure resulted in a program that appealed to the target audience.

The Goertler vortex instability mechanism in three-dimensional boundary layers

NASA Technical Reports Server (NTRS)

Hall, P.

1984-01-01

The two dimensional boundary layer on a concave wall is centrifugally unstable with respect to vortices aligned with the basic flow for sufficiently high values of the Goertler number. However, in most situations of practical interest the basic flow is three dimensional and previous theoretical investigations do not apply. The linear stability of the flow over an infinitely long swept wall of variable curvature is considered. If there is no pressure gradient in the boundary layer the instability problem can always be related to an equivalent two dimensional calculation. However, in general, this is not the case and even for small values of the crossflow velocity field dramatic differences between the two and three dimensional problems emerge. When the size of the crossflow is further increased, the vortices in the neutral location have their axes locally perpendicular to the vortex lines of the basic flow.

Large-Scale Direct-Writing of Aligned Nanofibers for Flexible Electronics.

PubMed

Ye, Dong; Ding, Yajiang; Duan, Yongqing; Su, Jiangtao; Yin, Zhouping; Huang, Yong An

2018-05-01

Nanofibers/nanowires usually exhibit exceptionally low flexural rigidities and remarkable tolerance against mechanical bending, showing superior advantages in flexible electronics applications. Electrospinning is regarded as a powerful process for this 1D nanostructure; however, it can only be able to produce chaotic fibers that are incompatible with the well-patterned microstructures in flexible electronics. Electro-hydrodynamic (EHD) direct-writing technology enables large-scale deposition of highly aligned nanofibers in an additive, noncontact, real-time adjustment, and individual control manner on rigid or flexible, planar or curved substrates, making it rather attractive in the fabrication of flexible electronics. In this Review, the ground-breaking research progress in the field of EHD direct-writing technology is summarized, including a brief chronology of EHD direct-writing techniques, basic principles and alignment strategies, and applications in flexible electronics. Finally, future prospects are suggested to advance flexible electronics based on orderly arranged EHD direct-written fibers. This technology overcomes the limitations of the resolution of fabrication and viscosity of ink of conventional inkjet printing, and represents major advances in manufacturing of flexible electronics. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Generation of Soluble Receptor Activator of NF-kappa B Ligand is Critical for Osteolytic Bone Metastasis

DTIC Science & Technology

2009-10-01

differentiation and activation of osteoclast precursors. Targeting RANKL expression with antisense oligonucleotides (RANKL- ASO ) decreased RANKL expression and...1,175 Ci/mmol at 10 mCi/mL). Two microliters of the reaction mixture were separated on a 12% SDS-polyacrylamide gel and subsequently visualized...OPG), a decoy receptor for RANKL, at the TB-interface was also increased. Targeting RANKL expression with antisense oligonucleotides (RANKL- ASO

Detection and identification of intestinal pathogenic bacteria by hybridization to oligonucleotide microarrays

PubMed Central

Jin, Lian-Qun; Li, Jun-Wen; Wang, Sheng-Qi; Chao, Fu-Huan; Wang, Xin-Wei; Yuan, Zheng-Quan

2005-01-01

AIM: To detect the common intestinal pathogenic bacteria quickly and accurately. METHODS: A rapid (<3 h) experimental procedure was set up based upon the gene chip technology. Target genes were amplified and hybridized by oligonucleotide microarrays. RESULTS: One hundred and seventy strains of bacteria in pure culture belonging to 11 genera were successfully discriminated under comparatively same conditions, and a series of specific hybridization maps corresponding to each kind of bacteria were obtained. When this method was applied to 26 divided cultures, 25 (96.2%) were identified. CONCLUSION: Salmonella sp., Escherichia coli, Shigella sp., Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, Proteus sp., Bacillus cereus, Vibrio cholerae, Enterococcus faecalis, Yersinia enterocolitica, and Campylobacter jejuni can be detected and identified by our microarrays. The accuracy, range, and discrimination power of this assay can be continually improved by adding further oligonucleotides to the arrays without any significant increase of complexity or cost. PMID:16437687

A simple physical mechanism enables homeostasis in primitive cells

NASA Astrophysics Data System (ADS)

Engelhart, Aaron E.; Adamala, Katarzyna P.; Szostak, Jack W.

2016-05-01

The emergence of homeostatic mechanisms that enable maintenance of an intracellular steady state during growth was critical to the advent of cellular life. Here, we show that concentration-dependent reversible binding of short oligonucleotides, of both specific and random sequence, can modulate ribozyme activity. In both cases, catalysis is inhibited at high concentrations, and dilution activates the ribozyme via inhibitor dissociation, thus maintaining near-constant ribozyme specific activity throughout protocell growth. To mimic the result of RNA synthesis within non-growing protocells, we co-encapsulated high concentrations of ribozyme and oligonucleotides within fatty acid vesicles, and ribozyme activity was inhibited. Following vesicle growth, the resulting internal dilution produced ribozyme activation. This simple physical system enables a primitive homeostatic behaviour: the maintenance of constant ribozyme activity per unit volume during protocell volume changes. We suggest that such systems, wherein short oligonucleotides reversibly inhibit functional RNAs, could have preceded sophisticated modern RNA regulatory mechanisms, such as those involving miRNAs.

RNA-Catalyzed RNA Ligation on an External RNA Template

NASA Technical Reports Server (NTRS)

McGinness, Kathleen E.; Joyce, Gerald F.

2002-01-01

Variants of the hc ligase ribozyme, which catalyzes ligation of the 3' end of an RNA substrate to the 5' end of the ribozyme, were utilized to evolve a ribozyme that catalyzes ligation reactions on an external RNA template. The evolved ribozyme catalyzes the joining of an oligonucleotide 3'-hydroxyl to the 5'-triphosphate of an RNA hairpin molecule. The ribozyme can also utilize various substrate sequences, demonstrating a largely sequence-independent mechanism for substrate recognition. The ribozyme also carries out the ligation of two oligonucleotides that are bound at adjacent positions on a complementary template. Finally, it catalyzes addition of mononucleoside '5-triphosphates onto the '3 end of an oligonucleotide primer in a template-dependent manner. The development of ribozymes that catalyze polymerase-type reactions contributes to the notion that an RNA world could have existed during the early history of life on Earth.

A multiplex protein-free lateral flow assay for detection of microRNAs based on unmodified molecular beacons.

PubMed

Javani, Atefeh; Javadi-Zarnaghi, Fatemeh; Rasaee, Mohammad Javad

2017-11-15

Lateral flow assays (LFAs) have promising potentials for point-of-care applications. Recently, many LFAs have been reported that are based on hybridization of oligonucleotide strands. Mostly, biotinylated capture DNAs are immobilized on the surface of a nitrocellulose membrane via streptavidin interactions. During the assay, stable colorful complexes get formed that are visible by naked eyes. Here, we present an inexpensive and unique design of LFA that applies unmodified oligonucleotides at capture lines. The presented LFA do not utilize streptavidin or any other affinity protein. We employ structural switch of molecular beacons (MB) in combination with base stacking hybridization (BSH) phenomenon. The unique design of the reported LFA provided high selectivity for target oligonucleotides. We validated potential applications of the system for detection of DNA mimics of two microRNAs in multiplex assays. Copyright © 2017 Elsevier Inc. All rights reserved.

Dose-Dependent Lowering of Mutant Huntingtin Using Antisense Oligonucleotides in Huntington Disease Patients.

PubMed

van Roon-Mom, Willeke M C; Roos, Raymund A C; de Bot, Susanne T

2018-04-01

On December 11 of 2017, Ionis Pharmaceuticals published a press release announcing dose-dependent reductions of mutant huntingtin protein in their HTTRx Phase 1/2a study in Huntington disease (HD) patients. The results from this Ionis trial have gained much attention from the patient community and the oligonucleotide therapeutics field, since it is the first trial targeting the cause of HD, namely the mutant huntingtin protein, using antisense oligonucleotides (ASOs). The press release also states that the primary endpoints of the study (safety and tolerability) were met, but does not contain data. This news follows the approval of another therapeutic ASO nusinersen (trade name Spinraza) for a neurological disease, spinal muscular atrophy, by the U.S. Food and Drug Administration and European Medicines Agency, in 2016 and 2017, respectively. Combined, this offers hope for the development of the HTTRx therapy for HD patients.

Hydrated Electrons React with High Specificity with Cisplatin Bound to Single-Stranded DNA

PubMed Central

Behmand, B.; Cloutier, P.; Girouard, S.; Wagner, J. R.; Sanche, L.; Hunting, D. J.

2015-01-01

Short oligonucleotides TTTTTGTGTTT and TTTTTTTGTTT in solution with and without cisplatin (cisPt) bound to the guanine bases were irradiated with γ-rays at doses varying from 0 to 2500 Gy. To determine the effect of hydrated electrons from water radiolysis on the oligonucleotides, we quenched •OH radicals with ethylenediaminetetraacetic acid (EDTA) and displaced oxygen, which reacts with hydrated electrons, by bubbling the solution with wet nitrogen. DNA strand breaks and platinum detachment were quantified by gel electrophoresis. Our results demonstrate that hydrated electrons react almost exclusively at the position of the cisPt adduct, where they induce cisPt detachment from one or both guanines in the oligonucleotide. Given the high yield of hydrated electrons in irradiated tissues, this reaction may be an important step in the mechanism of radiosensitization of DNA by cisPt. PMID:24205952

Aptamer-Mediated Codelivery of Doxorubicin and NF-κB Decoy Enhances Chemosensitivity of Pancreatic Tumor Cells

PubMed Central

Porciani, David; Tedeschi, Lorena; Marchetti, Laura; Citti, Lorenzo; Piazza, Vincenzo; Beltram, Fabio; Signore, Giovanni

2015-01-01

Aptamers able to bind efficiently cell-surface receptors differentially expressed in tumor and in healthy cells are emerging as powerful tools to perform targeted anticancer therapy. Here, we present a novel oligonucleotide chimera, composed by an RNA aptamer and a DNA decoy. Our assembly is able to (i) target tumor cells via an antitransferrin receptor RNA aptamer and (ii) perform selective codelivery of a chemotherapeutic drug (Doxorubicin) and of an inhibitor of a cell-survival factor, the nuclear factor κB decoy oligonucleotide. Both payloads are released under conditions found in endolysosomal compartments (low pH and reductive environment). Targeting and cytotoxicity of the oligonucleotidic chimera were assessed by confocal microscopy, cell viability, and Western blot analysis. These data indicated that the nuclear factor κB decoy does inhibit nuclear factor κB activity and ultimately leads to an increased therapeutic efficacy of Doxorubicin selectively in tumor cells. PMID:25919089

The Role of the Y-Chromosome in the Establishment of Murine Hybrid Dysgenesis and in the Analysis of the Nucleotide Sequence Organization, Genetic Transmission and Evolution of Repeated Sequences.

NASA Astrophysics Data System (ADS)

Nallaseth, Ferez Soli

The Y-chromosome presents a unique cytogenetic framework for the evolution of nucleotide sequences. Alignment of nine Y-chromosomal fragments in their increasing Y-specific/non Y-specific (male/female) sequence divergence ratios was directly and inversely related to their interspersion on these two respective genomic fractions. Sequence analysis confirmed a direct relationship between divergence ratios and the Alu, LINE-1, Satellite and their derivative oligonucleotide contents. Thus their relocation on the Y-chromosome is followed by sequence divergence rather than the well documented concerted evolution of these non-coding progenitor repeated sequences. Five of the nine Y-chromosomal fragments are non-pseudoautosomal and transcribed into heterogeneous PolyA^+ RNA and thus can be retrotransposed. Evolutionary and computer analysis identified homologous oligonucleotide tracts in several human loci suggesting common and random mechanistic origins. Dysgenic genomes represent the accelerated evolution driving sequence divergence (McClintock, 1984). Sex reversal and sterility characterizing dysgenesis occurs in C57BL/6JY ^{rm Pos} but not in 129/SvY^{rm Pos} derivative strains. High frequency, random, multi-locus deletion products of the feral Y^{ rm Pos}-chromosome are generated in the germlines of F1(C57BL/6J X 129/SvY^{ rm Pos})(male) and C57BL/6JY ^{rm Pos}(male) but not in 129/SvY^{rm Pos}(male). Equal, 10^{-1}, 10^ {-2}, and 0 copies (relative to males) of Y^{rm Pos}-specific deletion products respectively characterize C57BL/6JY ^{rm Pos} (HC), (LC), (T) and (F) females. The testes determining loci of inactive Y^{rm Pos}-chromosomes in C57BL/6JY^{rm Pos} HC females are the preferentially deleted/rearranged Y ^{rm Pos}-sequences. Disruption of regulation of plasma testosterone and hepatic MUP-A mRNA levels, TRD of a 4.7 Kbp EcoR1 fragment suggest disruption of autosomal/X-chromosomal sequences. These data and the highly repeated progenitor (Alu, GATA, LINE-1) sequence content of deletion products confirmed the previously unidentified loss of genetic control of mammalian chromosome biology and hybrid dysgenesis.

Detection and prevention of mycoplasma hominis infection

DOEpatents

DelVecchio, Vito G.; Gallia, Gary L.; McCleskey, Ferne K.

1997-01-21

The present invention is directed to a rapid and sensitive method for detecting Mycoplasma hominis using M. hominis-specific probes, oligonucleotides or antibodies. In particular a target sequence can be amplified by in vitro nucleic acid amplification techniques, detected by nucleic acid hybridization using the subject probes and oligonucleotides or detected by immunoassay using M. hominis-specific antibodies. M. hominis-specific nucleic acids which do not recognize or hybridize to genomic nucleic acid of other Mycoplasma species are also provided.

Phylogenetic relationships within the cyst-forming nematodes (Nematoda, Heteroderidae) based on analysis of sequences from the ITS regions of ribosomal DNA.

PubMed

Subbotin, S A; Vierstraete, A; De Ley, P; Rowe, J; Waeyenberge, L; Moens, M; Vanfleteren, J R

2001-10-01

The ITS1, ITS2, and 5.8S gene sequences of nuclear ribosomal DNA from 40 taxa of the family Heteroderidae (including the genera Afenestrata, Cactodera, Heterodera, Globodera, Punctodera, Meloidodera, Cryphodera, and Thecavermiculatus) were sequenced and analyzed. The ITS regions displayed high levels of sequence divergence within Heteroderinae and compared to outgroup taxa. Unlike recent findings in root knot nematodes, ITS sequence polymorphism does not appear to complicate phylogenetic analysis of cyst nematodes. Phylogenetic analyses with maximum-parsimony, minimum-evolution, and maximum-likelihood methods were performed with a range of computer alignments, including elision and culled alignments. All multiple alignments and phylogenetic methods yielded similar basic structure for phylogenetic relationships of Heteroderidae. The cyst-forming nematodes are represented by six main clades corresponding to morphological characters and host specialization, with certain clades assuming different positions depending on alignment procedure and/or method of phylogenetic inference. Hypotheses of monophyly of Punctoderinae and Heteroderinae are, respectively, strongly and moderately supported by the ITS data across most alignments. Close relationships were revealed between the Avenae and the Sacchari groups and between the Humuli group and the species H. salixophila within Heteroderinae. The Goettingiana group occupies a basal position within this subfamily. The validity of the genera Afenestrata and Bidera was tested and is discussed based on molecular data. We conclude that ITS sequence data are appropriate for studies of relationships within the different species groups and less so for recovery of more ancient speciations within Heteroderidae. Copyright 2001 Academic Press.

Superposition and alignment of labeled point clouds.

PubMed

Fober, Thomas; Glinca, Serghei; Klebe, Gerhard; Hüllermeier, Eyke

2011-01-01

Geometric objects are often represented approximately in terms of a finite set of points in three-dimensional euclidean space. In this paper, we extend this representation to what we call labeled point clouds. A labeled point cloud is a finite set of points, where each point is not only associated with a position in three-dimensional space, but also with a discrete class label that represents a specific property. This type of model is especially suitable for modeling biomolecules such as proteins and protein binding sites, where a label may represent an atom type or a physico-chemical property. Proceeding from this representation, we address the question of how to compare two labeled points clouds in terms of their similarity. Using fuzzy modeling techniques, we develop a suitable similarity measure as well as an efficient evolutionary algorithm to compute it. Moreover, we consider the problem of establishing an alignment of the structures in the sense of a one-to-one correspondence between their basic constituents. From a biological point of view, alignments of this kind are of great interest, since mutually corresponding molecular constituents offer important information about evolution and heredity, and can also serve as a means to explain a degree of similarity. In this paper, we therefore develop a method for computing pairwise or multiple alignments of labeled point clouds. To this end, we proceed from an optimal superposition of the corresponding point clouds and construct an alignment which is as much as possible in agreement with the neighborhood structure established by this superposition. We apply our methods to the structural analysis of protein binding sites.

Measurement of photoluminescence from a twisted-nematic liquid crystal/dye cell for an application in an energy-harvesting display

NASA Astrophysics Data System (ADS)

Ohta, Masamichi; Itaya, Shunsuke; Ozawa, Shintaro; Binti, M. Azmi; Dianah, Nada; Fujieda, Ichiro

2016-09-01

One can convert a Luminescent Solar Concentrator (LSC) to an energy-harvesting display by scanning a laser beam on it. By incorporating a guest-host system of liquid crystal (LC) and dye materials in an LSC, the power of photoluminescence (PL) utilized for either display or energy-harvesting can be adjusted to the changes in ambient lighting conditions. We have measured basic characteristics of an LC/dye cell with twisted-nematic (TN) alignment. These are absorption of the laser light, PL radiation pattern, contrast of luminance, spreading of the PL generated by a narrow laser beam, and their dependencies on the bias. The results are similar to those of the LC/dye cell with antiparallel (AP) alignment with the following exceptions. First, absorption by the TN cell depends on the bias for both polarization components of the excitation light, while the AP cell exhibits a bias dependency only for the component polarized along the alignment direction. Second, the PL from the TN cell is mostly polarized along the alignment direction on the exit side of the cell while the PL from the AP cell is mostly polarized along its alignment direction. These observations can be attributed to the fact that the polarization plane of a linearly polarized light rotates as it propagated the TN-LC layer. For both AP and TN cells, low-intensity PL is observed from the whole cell surfaces. This can degrade the contrast of a displayed image. Bias application to the cell suppresses this effect.

Basic Science Considerations in Primary Total Hip Replacement Arthroplasty

PubMed Central

Mirza, Saqeb B; Dunlop, Douglas G; Panesar, Sukhmeet S; Naqvi, Syed G; Gangoo, Shafat; Salih, Saif

2010-01-01

Total Hip Replacement is one of the most common operations performed in the developed world today. An increasingly ageing population means that the numbers of people undergoing this operation is set to rise. There are a numerous number of prosthesis on the market and it is often difficult to choose between them. It is therefore necessary to have a good understanding of the basic scientific principles in Total Hip Replacement and the evidence base underpinning them. This paper reviews the relevant anatomical and biomechanical principles in THA. It goes on to elaborate on the structural properties of materials used in modern implants and looks at the evidence base for different types of fixation including cemented and uncemented components. Modern bearing surfaces are discussed in addition to the scientific basis of various surface engineering modifications in THA prostheses. The basic science considerations in component alignment and abductor tension are also discussed. A brief discussion on modular and custom designs of THR is also included. This article reviews basic science concepts and the rationale underpinning the use of the femoral and acetabular component in total hip replacement. PMID:20582240

Pressure-Mediated Oligonucleotide Transfection of Rat and Human Cardiovascular Tissues

NASA Astrophysics Data System (ADS)

Mann, Michael J.; Gibbons, Gary H.; Hutchinson, Howard; Poston, Robert S.; Hoyt, E. Grant; Robbins, Robert C.; Dzau, Victor J.

1999-05-01

The application of gene therapy to human disease is currently restricted by the relatively low efficiency and potential hazards of methods of oligonucleotide or gene delivery. Antisense or transcription factor decoy oligonucleotides have been shown to be effective at altering gene expression in cell culture expreriments, but their in vivo application is limited by the efficiency of cellular delivery, the intracellular stability of the compounds, and their duration of activity. We report herein the development of a highly efficient method for naked oligodeoxynucleotide (ODN) transfection into cardiovascular tissues by using controlled, nondistending pressure without the use of viral vectors, lipid formulations, or exposure to other adjunctive, potentially hazardous substances. In this study, we have documented the ability of ex vivo, pressure-mediated transfection to achieve nuclear localization of fluorescent (FITC)-labeled ODN in approximately 90% and 50% of cells in intact human saphenous vein and rat myocardium, respectively. We have further documented that pressure-mediated delivery of antisense ODN can functionally inhibited target gene expression in both of these tissues in a sequence-specific manner at the mRNA and protein levels. This oligonucleotide transfection system may represent a safe means of achieving the intraoperative genetic engineering of failure-resistant human bypass grafts and may provide an avenue for the genetic manipulation of cardiac allograft rejection, allograft vasculopathy, or other transplant diseases.

Bi-specific splice-switching PMO oligonucleotides conjugated via a single peptide active in a mouse model of Duchenne muscular dystrophy

PubMed Central

Shabanpoor, Fazel; McClorey, Graham; Saleh, Amer F.; Järver, Peter; Wood, Matthew J.A.; Gait, Michael J.

2015-01-01

The potential for therapeutic application of splice-switching oligonucleotides (SSOs) to modulate pre-mRNA splicing is increasingly evident in a number of diseases. However, the primary drawback of this approach is poor cell and in vivo oligonucleotide uptake efficacy. Biological activities can be significantly enhanced through the use of synthetically conjugated cationic cell penetrating peptides (CPPs). Studies to date have focused on the delivery of a single SSO conjugated to a CPP, but here we describe the conjugation of two phosphorodiamidate morpholino oligonucleotide (PMO) SSOs to a single CPP for simultaneous delivery and pre-mRNA targeting of two separate genes, exon 23 of the Dmd gene and exon 5 of the Acvr2b gene, in a mouse model of Duchenne muscular dystrophy. Conjugations of PMOs to a single CPP were carried out through an amide bond in one case and through a triazole linkage (‘click chemistry’) in the other. The most active bi-specific CPP–PMOs demonstrated comparable exon skipping levels for both pre-mRNA targets when compared to individual CPP–PMO conjugates both in cell culture and in vivo in the mdx mouse model. Thus, two SSOs with different target sequences conjugated to a single CPP are biologically effective and potentially suitable for future therapeutic exploitation. PMID:25468897

[Oligonucleotide derivatives in the nucleic acid hybridization analysis. I. Covalent immobilization of oligonucleotide probes onto the nylon].

PubMed

Dmitrienko, E V; Pyshnaia, I A; Pyshnyĭ, D V

2010-01-01

The features of UV-induced immobilization of oligonucleotides on a nylon membranes and the effectiveness of enzymatic labeling of immobilized probes at heterophase detection of nucleic acids are studied. Short terminal oligothymidilate (up to 10 nt) sequences are suggested to attach to the probe via a flexible ethylene glycol based linker. The presence of such fragment enhances the intensity of immobilization and reduces UV-dependent degradation of the targeted (sequence-specific) part of the probe by reducing the dose needed for the immobilization of DNA. The optimum dose of UV-irradiation is determined to be ~0.4 J/cm(2) at the wavelength 254 nm. This dose provides high level of hybridization signal for immobilized probes with various nucleotide composition of the sequence specific moiety. The amide groups of the polyamide are shown to play the key role in the photoinduced immobilization of nucleic acids, whereas the primary amino groups in the structure of PA is not the center responsible for the covalent binding of DNA by UV-irradiation, as previously believed. Various additives in the soaking solution during the membrane of UV-dependent immobilization of probes are shown to influence its effectiveness. The use of alternative to UV-irradiation system of radical generation are shown to provide the immobilization of oligonucleotides onto the nylon membrane.

Induction of strand breaks by low-energy electrons (8-68 eV) in a self-assembled monolayer of oligonucleotides: Effective cross sections and attenuation lengths

NASA Astrophysics Data System (ADS)

Cai, Zhongli; Dextraze, Marie-Eve; Cloutier, Pierre; Hunting, Darel; Sanche, Léon

2006-01-01

Self-assembled monolayers of 5'-P32-labeled 3'-thiolated oligonucleotides chemisorbed on gold were bombarded by low-energy electrons (LEE) of 8-68eV. Shorter 5'-P32-oligonucleotides produced by LEE-induced strand breaks were separated with denaturing polyacrylamide gel electrophoresis and quantified by phosphor imaging. The yields of short oligonucleotides (y) decrease exponentially with their length (n), following the equation y =ae-bn, where a and b are constants, which are related to the average effective cross section per nucleotide for DNA strand break (σeff) and the attenuation length (AL=1/b) of LEE, respectively. The AL decreases with LEE energies from 2.5±0.6nm at 8eVto0.8±0.1nm at 68eV, whereas σeff increases from (3±1)×10-18to(5.1±1.6)×10-17cm2 within the same energy range. The energy dependence of σeff shows a resonance peak of (2.8±0.9)×10-17cm2 at 18eV superimposed on a monotonically rising curve. Transient electron attachment to a σ* anion state of the deoxyribose group, followed by dipolar dissociation into H- and the corresponding positive-ion radical, leading to C-O bond cleavage, is proposed to account for this maximum.

Programmable display of DNA-protein chimeras for controlling cell-hydrogel interactions via reversible intermolecular hybridization.

PubMed

Zhang, Zhaoyang; Li, Shihui; Chen, Niancao; Yang, Cheng; Wang, Yong

2013-04-08

Extensive studies have been recently carried out to achieve dynamic control of cell-material interactions primarily through physicochemical stimulation. The purpose of this study was to apply reversible intermolecular hybridization to program cell-hydrogel interactions in physiological conditions based on DNA-antibody chimeras and complementary oligonucleotides. The results showed that DNA oligonucleotides could be captured to and released from the immobilizing DNA-functionalized hydrogels with high specificity via DNA hybridization. Accordingly, DNA-antibody chimeras were captured to the hydrogels, successfully inducing specific cell attachment. The cell attachment to the hydrogels reached the plateau at approximately half an hour after the functionalized hydrogels and the cells were incubated together. The attached cells were rapidly released from the bound hydrogels when triggering complementary oligonucleotides were introduced to the system. However, the capability of the triggering complementary oligonucleotides in releasing cells was affected by the length of intermolecular hybridization. The length needed to be at least more than 20 base pairs in the current experimental setting. Notably, because the procedure of intermolecular hybridization did not involve any harsh condition, the released cells maintained the same viability as that of the cultured cells. The functionalized hydrogels also exhibited the potential to catch and release cells repeatedly. Therefore, this study demonstrates that it is promising to regulate cell-material interactions dynamically through the DNA-programmed display of DNA-protein chimeras.

Specificity tests of an oligonucleotide probe against food-outbreak salmonella for biosensor detection

NASA Astrophysics Data System (ADS)

Chen, I.-H.; Horikawa, S.; Xi, J.; Wikle, H. C.; Barbaree, J. M.; Chin, B. A.

2017-05-01

Phage based magneto-elastic (ME) biosensors have been shown to be able to rapidly detect Salmonella in various food systems to serve food pathogen monitoring purposes. In this ME biosensor platform, the free-standing strip-shaped magneto-elastic sensor is the transducer and the phage probe that recognizes Salmonella in food serves as the bio-recognition element. According to Sorokulova et al. at 2005, a developed oligonucleotide probe E2 was reported to have high specificity to Salmonella enterica Typhimurium. In the report, the specificity tests were focused in most of Enterobacterace groups outside of Salmonella family. Here, to understand the specificity of phage E2 to different Salmonella enterica serotypes within Salmonella Family, we further tested the specificity of the phage probe to thirty-two Salmonella serotypes that were present in the major foodborne outbreaks during the past ten years (according to Centers for Disease Control and Prevention). The tests were conducted through an Enzyme linked Immunosorbent Assay (ELISA) format. This assay can mimic probe immobilized conditions on the magnetoelastic biosensor platform and also enable to study the binding specificity of oligonucleotide probes toward different Salmonella while avoiding phage/ sensor lot variations. Test results confirmed that this oligonucleotide probe E2 was high specific to Salmonella Typhimurium cells but showed cross reactivity to Salmonella Tennessee and four other serotypes among the thirty-two tested Salmonella serotypes.

Lyophilisation and concentration of chitosan/siRNA polyplexes: Influence of buffer composition, oligonucleotide sequence, and hyaluronic acid coating.

PubMed

Veilleux, Daniel; Gopalakrishna Panicker, Rajesh Krishnan; Chevrier, Anik; Biniecki, Kristof; Lavertu, Marc; Buschmann, Michael D

2018-02-15

Chitosan (CS)/siRNA polyplexes have great therapeutic potential for treating multiple diseases by gene silencing. However, clinical application of this technology requires the development of concentrated, hemocompatible, pH neutral formulations for safe and efficient administration. In this study we evaluate physicochemical properties of chitosan polyplexes in various buffers at increasing ionic strengths, to identify conditions for freeze-drying and rehydration at higher doses of uncoated or hyaluronic acid (HA)-coated polyplexes while maintaining physiological compatibility. Optimized formulations are used to evaluate the impact of the siRNA/oligonucleotide sequence on polyplex physicochemical properties, and to measure their in vitro silencing efficiency, cytotoxicity, and hemocompatibility. Specific oligonucleotide sequences influence polyplex physical properties at low N:P ratios, as well as their stability during freeze-drying. Nanoparticles display greater stability for oligodeoxynucleotides ODN vs siRNA; AT-rich vs GC-rich; and overhangs vs blunt ends. Using this knowledge, various CS/siRNA polyplexes are prepared with and without HA coating, freeze-dried and rehydrated at increased concentrations using reduced rehydration volumes. These polyplexes are non-cytotoxic and preserve silencing activity even after rehydration to 20-fold their initial concentration, while HA-coated polyplexes at pH∼7 also displayed increased hemocompatibility. These concentrated formulations represent a critical step towards clinical development of chitosan-based oligonucleotide intravenous delivery systems. Copyright © 2017 Elsevier Inc. All rights reserved.

Precise and selective sensing of DNA-DNA hybridization by graphene/Si-nanowires diode-type biosensors.

PubMed

Kim, Jungkil; Park, Shin-Young; Kim, Sung; Lee, Dae Hun; Kim, Ju Hwan; Kim, Jong Min; Kang, Hee; Han, Joong-Soo; Park, Jun Woo; Lee, Hosun; Choi, Suk-Ho

2016-08-18

Single-Si-nanowire (NW)-based DNA sensors have been recently developed, but their sensitivity is very limited because of high noise signals, originating from small source-drain current of the single Si NW. Here, we demonstrate that chemical-vapor-deposition-grown large-scale graphene/surface-modified vertical-Si-NW-arrays junctions can be utilized as diode-type biosensors for highly-sensitive and -selective detection of specific oligonucleotides. For this, a twenty-seven-base-long synthetic oligonucleotide, which is a fragment of human DENND2D promoter sequence, is first decorated as a probe on the surface of vertical Si-NW arrays, and then the complementary oligonucleotide is hybridized to the probe. This hybridization gives rise to a doping effect on the surface of Si NWs, resulting in the increase of the current in the biosensor. The current of the biosensor increases from 19 to 120% as the concentration of the target DNA varies from 0.1 to 500 nM. In contrast, such biosensing does not come into play by the use of the oligonucleotide with incompatible or mismatched sequences. Similar results are observed from photoluminescence microscopic images and spectra. The biosensors show very-uniform current changes with standard deviations ranging ~1 to ~10% by ten-times endurance tests. These results are very promising for their applications in accurate, selective, and stable biosensing.

Application of a cholesterol stationary phase in the analysis of phosphorothioate oligonucleotides by means of ion pair chromatography coupled with tandem mass spectrometry.

PubMed

Studzińska, Sylwia; Krzemińska, Katarzyna; Szumski, Michał; Buszewski, Bogusław

2016-07-01

The main aim of this study was the investigation of the influence of several ion pair reagents towards both the retention and the mass spectrometry sensitivity of phosphorothioate oligonucleotides. A cholesterol stationary phase was applied for the first time in the analysis of this group of compounds. The mobile phase composition was modified by changing the concentration and the type of amines and acetates or 1,1,1,3,3,3-hexafluoroisopropanol. It has been shown that the increase of amines concentration results in the retention factor increase for each oligonucleotide, on each adsorbent. The only exception was the mobile phase composed of triethylamine and 1,1,1,3,3,3-hexafluoroisopropanol. This is a consequence of interactions taking place between a cholesterol molecule and an alcohol. This effect was convenient when the mass spectrometry detection was applied, since it allowed an increase in the sensitivity. Moreover, optimization of the mobile phase composition and its impact on the efficiency of ionization process and on the sensitivity in mass spectrometry were also presented. The optimization of this new method, based on cholesterol stationary phase coupled with mass spectrometry detection, was finally applied for the determination of phosphorothioate oligonucleotides impurity in a real sample. Copyright © 2016 Elsevier B.V. All rights reserved.

Nanomechanics for specific biological detection

NASA Astrophysics Data System (ADS)

Alvarez, Mar; Carrascosa, Laura G.; Tamayo, Javier; Calle, Ana; Lechuga, Laura M.

2003-04-01

Nanomechanical biosensors have emerged as a promising platform for specific biological. Among the advantages are direct detection without need of labelling with fluorescent or radioactive molecules, very high sensitivity, reduced sensor area, and suitability for integration using silicon technology. Here we have studied the immobilization of oligonucleotide monolayers by monitoring the microcantilever bending. Oligonucleotides were derivatized with thiol molecules for self-assembly on the gold-coated side of a microcantilever. The geometry of the binding and the surface density were studied by mixing derivatized oligonucleotides with spacer self-assembled monolayers and by controlling the oligonucleotide functional group form. These results are compared with fluoresencent and chemiluminescence techniques. Furthermore, we present the first results of direct pesticide detection with microcantilever-based biosensors. Herbicide DDT was detected by performing competitive assays, in which the cantilever was coated with a synthetic DDT hapten, and it was exposured to different rations between the monoclonal antibody and the DDT. A new technique is presented for the detection of the nanomechanical response for biosensing applications, in which the resonant frequency is measured with about two orders of magnitude higher sensitivity. The low quality factor of the microcantilever in liquid is increased up by using an active feedback control, in which the cantilever oscillation is amplified and delayed and it is used as a driving force. The technique has been applied for the detection of ethanol, proteins, and pathogens.

Monolithic poly[(trimethylsilyl-4-methylstyrene)-co- bis(4-vinylbenzyl)dimethylsilane] stationary phases for the fast separation of proteins and oligonucleotides.

PubMed

Jakschitz, Thomas A E; Huck, Christian W; Lubbad, Said; Bonn, Günther K

2007-04-13

In this paper the synthesis, optimisation and application of a silane based monolithic copolymer for the rapid separation of proteins and oligonucleotides is described. The monolith was prepared by thermal initiated in situ copolymerisation of trimethylsilyl-4-methylstyrene (TMSiMS) and bis(4-vinylbenzyl)dimethylsilane (BVBDMSi) in a silanised 200 microm I.D. fused silica column. Different ratios of monomer and crosslinker, as well as different ratios of micro- (toluene) and macro-porogen (2-propanol) were used for optimising the physical properties of the stationary phase regarding separation efficiency. The prepared monolithic stationary phases were characterised by measurement of permeability with different solvents, determination of pore size distribution by mercury intrusion porosimetry (MIP). Morphology was studied by scanning electron microscopy (SEM). Applying optimised conditions, a mixture comprised of five standard proteins ribunuclease A, cytochrome c, alpha-lactalbumine, myoglobine and ovalbumine was separated within 1 min by ion-pair reversed-phase liquid chromatography (IP-RPLC) obtaining half-height peak widths between 1.8 and 2.4 s. Baseline separation of oligonucleotides d(pT)(12-18) was achieved within 1.8 min obtaining half-height peak widths between 3.6 and 5.4 s. The results demonstrate the high potential of this stationary phase for fast separation of high-molecular weight biomolecules such as oligonucleotides and proteins.

New redox-active layer create via epoxy-amine reaction - The base of genosensor for the detection of specific DNA and RNA sequences of avian influenza virus H5N1.

PubMed

Malecka, Kamila; Stachyra, Anna; Góra-Sochacka, Anna; Sirko, Agnieszka; Zagórski-Ostoja, Włodzimierz; Dehaen, Wim; Radecka, Hanna; Radecki, Jerzy

2015-03-15

This paper concerns the development of a redox-active monolayer and its application for the construction of an electrochemical genosensor designed for the detection of specific DNA and RNA oligonucleotide sequences related to the avian influenza virus (AIV) type H5N1. This new redox layer was created on a gold electrode surface step by step. Cyclic Voltammetry, Osteryoung Square-Wave Voltammetry and Differential Pulse Voltammetry were used for its characterization. This new redox-active layer was applied for the construction of the DNA biosensor. The NH2-NC3 probe (20-mer) was covalently attached to the gold electrode surface via a "click" reaction between the amine and an epoxide group. The hybridization process was monitored using the Osteryoung Square-Wave Voltammetry. The 20-mer DNA and ca. 280-mer RNA oligonucleotides were used as the targets. The constructed genosensor was capable to determine complementary oligonucleotide sequences with a detection limit in the pM range. It is able to distinguish the different position of the part RNA complementary to the DNA probe. The genosensor was very selective. The 20-mer DNA as well as the 280-mer RNA oligonucleotides without a complementary sequence generated a weak signal. Copyright © 2014 Elsevier B.V. All rights reserved.

Ultrasensitive Detection of Ebola Virus Oligonucleotide Based on Upconversion Nanoprobe/Nanoporous Membrane System.

PubMed

Tsang, Ming-Kiu; Ye, WeiWei; Wang, Guojing; Li, Jingming; Yang, Mo; Hao, Jianhua

2016-01-26

Ebola outbreaks are currently of great concern, and therefore, development of effective diagnosis methods is urgently needed. The key for lethal virus detection is high sensitivity, since early-stage detection of virus may increase the probability of survival. Here, we propose a luminescence scheme of assay consisting of BaGdF5:Yb/Er upconversion nanoparticles (UCNPs) conjugated with oligonucleotide probe and gold nanoparticles (AuNPs) linked with target Ebola virus oligonucleotide. As a proof of concept, a homogeneous assay was fabricated and tested, yielding a detection limit at picomolar level. The luminescence resonance energy transfer is ascribed to the spectral overlapping of upconversion luminescence and the absorption characteristics of AuNPs. Moreover, we anchored the UCNPs and AuNPs on a nanoporous alumina (NAAO) membrane to form a heterogeneous assay. Importantly, the detection limit was greatly improved, exhibiting a remarkable value at the femtomolar level. The enhancement is attributed to the increased light-matter interaction throughout the nanopore walls of the NAAO membrane. The specificity test suggested that the nanoprobes were specific to Ebola virus oligonucleotides. The strategy combining UCNPs, AuNPs, and NAAO membrane provides new insight into low-cost, rapid, and ultrasensitive detection of different diseases. Furthermore, we explored the feasibility of clinical application by using inactivated Ebola virus samples. The detection results showed great potential of our heterogeneous design for practical application.

Label-Free Electrochemical Detection of the Specific Oligonucleotide Sequence of Dengue Virus Type 1 on Pencil Graphite Electrodes

PubMed Central

Souza, Elaine; Nascimento, Gustavo; Santana, Nataly; Ferreira, Danielly; Lima, Manoel; Natividade, Edna; Martins, Danyelly; Lima-Filho, José

2011-01-01

A biosensor that relies on the adsorption immobilization of the 18-mer single-stranded nucleic acid related to dengue virus gene 1 on activated pencil graphite was developed. Hybridization between the probe and its complementary oligonucleotides (the target) was investigated by monitoring guanine oxidation by differential pulse voltammetry (DPV). The pencil graphite electrode was made of ordinary pencil lead (type 4B). The polished surface of the working electrode was activated by applying a potential of 1.8 V for 5 min. Afterward, the dengue oligonucleotides probe was immobilized on the activated electrode by applying 0.5 V to the electrode in 0.5 M acetate buffer (pH 5.0) for 5 min. The hybridization process was carried out by incubating at the annealing temperature of the oligonucleotides. A time of five minutes and concentration of 1 μM were found to be the optimal conditions for probe immobilization. The electrochemical detection of annealing between the DNA probe (TS-1P) immobilized on the modified electrode, and the target (TS-1T) was achieved. The target could be quantified in a range from 1 to 40 nM with good linearity and a detection limit of 0.92 nM. The specificity of the electrochemical biosensor was tested using non-complementary sequences of dengue virus 2 and 3. PMID:22163916

Molecular beacon-enabled purification of living cells by targeting cell type-specific mRNAs.

PubMed

Wile, Brian M; Ban, Kiwon; Yoon, Young-Sup; Bao, Gang

2014-10-01

Molecular beacons (MBs) are dual-labeled oligonucleotides that fluoresce only in the presence of complementary mRNA. The use of MBs to target specific mRNAs allows sorting of specific cells from a mixed cell population. In contrast to existing approaches that are limited by available surface markers or selectable metabolic characteristics, the MB-based method enables the isolation of a wide variety of cells. For example, the ability to purify specific cell types derived from pluripotent stem cells (PSCs) is important for basic research and therapeutics. In addition to providing a general protocol for MB design, validation and nucleofection into cells, we describe how to isolate a specific cell population from differentiating PSCs. By using this protocol, we have successfully isolated cardiomyocytes differentiated from mouse or human PSCs (hPSCs) with ∼ 97% purity, as confirmed by electrophysiology and immunocytochemistry. After designing MBs, their ordering and validation requires 2 weeks, and the isolation process requires 3 h.

Cross-platform comparison of nucleic acid hybridization: toward quantitative reference standards.

PubMed

Halvorsen, Ken; Agris, Paul F

2014-11-15

Measuring interactions between biological molecules is vitally important to both basic and applied research as well as development of pharmaceuticals. Although a wide and growing range of techniques is available to measure various kinetic and thermodynamic properties of interacting biomolecules, it can be difficult to compare data across techniques of different laboratories and personnel or even across different instruments using the same technique. Here we evaluate relevant biological interactions based on complementary DNA and RNA oligonucleotides that could be used as reference standards for many experimental systems. We measured thermodynamics of duplex formation using isothermal titration calorimetry, differential scanning calorimetry, and ultraviolet-visible (UV-vis) monitored denaturation/renaturation. These standards can be used to validate results, compare data from disparate techniques, act as a teaching tool for laboratory classes, or potentially to calibrate instruments. The RNA and DNA standards have many attractive features, including low cost, high purity, easily measurable concentrations, and minimal handling concerns, making them ideal for use as a reference material. Copyright © 2014 Elsevier Inc. All rights reserved.

Study of hepatitis B virus gene mutations with enzymatic colorimetry-based DNA microarray.

PubMed

Mao, Hailei; Wang, Huimin; Zhang, Donglei; Mao, Hongju; Zhao, Jianlong; Shi, Jian; Cui, Zhichu

2006-01-01

To establish a modified microarray method for detecting HBV gene mutations in the clinic. Site-specific oligonucleotide probes were immobilized to microarray slides and hybridized to biotin-labeled HBV gene fragments amplified from two-step PCR. Hybridized targets were transferred to nitrocellulose membranes, followed by intensity measurement using BCIP/NBT colorimetry. HBV genes from 99 Hepatitis B patients and 40 healthy blood donors were analyzed. Mutation frequencies of HBV pre-core/core and basic core promoter (BCP) regions were found to be significantly higher in the patient group (42%, 40% versus 2.5%, 5%, P < 0.01). Compared with a traditional fluorescence method, the colorimetry method exhibited the same level of sensitivity and reproducibility. An enzymatic colorimetry-based DNA microarray assay was successfully established to monitor HBV mutations. Pre-core/core and BCP mutations of HBV genes could be major causes of HBV infection in HBeAg-negative patients and could also be relevant to chronicity and aggravation of hepatitis B.

Cross-platform comparison of nucleic acid hybridization: toward quantitative reference standardsa

PubMed Central

Halvorsen, Ken; Agris, Paul F.

2014-01-01

Measuring interactions between biological molecules is vitally important to both basic and applied research, as well as development of pharmaceuticals. While a wide and growing range of techniques are available to measure various kinetic and thermodynamic properties of interacting biomolecules, it can be difficult to compare data across techniques of different laboratories and personnel, or even across different instruments using the same technique. Here we evaluate relevant biological interactions based on complementary DNA and RNA oligonucleotides that could be used as reference standards for many experimental systems. We measured thermodynamics of duplex formation using Isothermal Titration Calorimetry, Differential Scanning Calorimetry, and UV-Vis monitored denaturation/renaturation. These standards can be used to validate results, compare data from disparate techniques, act as a teaching tool for laboratory classes, or potentially to calibrate instruments. The RNA and DNA standards have many attractive features including low cost, high purity, easily measureable concentrations, and minimal handling concerns, making them ideal for use as a reference material. PMID:25124363

Structural basis for DNA binding by replication initiator Mcm10

DOE Office of Scientific and Technical Information (OSTI.GOV)

Warren, Eric M.; Vaithiyalingam, Sivaraja; Haworth, Justin

2009-06-30

Mcm10 is an essential eukaryotic DNA replication protein required for assembly and progression of the replication fork. The highly conserved internal domain (Mcm10-ID) has been shown to physically interact with single-stranded (ss) DNA, DNA polymerase alpha, and proliferating cell nuclear antigen (PCNA). The crystal structure of Xenopus laevis Mcm10-ID presented here reveals a DNA binding architecture composed of an oligonucleotide/oligosaccharide-fold followed in tandem by a variant and highly basic zinc finger. NMR chemical shift perturbation and mutational studies of DNA binding activity in vitro reveal how Mcm10 uses this unique surface to engage ssDNA. Corresponding mutations in Saccharomyces cerevisiae resultmore » in increased sensitivity to replication stress, demonstrating the functional importance of DNA binding by this region of Mcm10 to replication. In addition, mapping Mcm10 mutations known to disrupt PCNA, polymerase alpha, and DNA interactions onto the crystal structure provides insight into how Mcm10 might coordinate protein and DNA binding within the replisome.« less

Formation mechanism of glyoxal-DNA adduct, a DNA cross-link precursor.

PubMed

Vilanova, B; Fernández, D; Casasnovas, R; Pomar, A M; Alvarez-Idaboy, J R; Hernández-Haro, N; Grand, A; Adrover, M; Donoso, J; Frau, J; Muñoz, F; Ortega-Castro, J

2017-05-01

DNA nucleobases undergo non-enzymatic glycation to nucleobase adducts which can play important roles in vivo. In this work, we conducted a comprehensive experimental and theoretical kinetic study of the mechanisms of formation of glyoxal-guanine adducts over a wide pH range in order to elucidate the molecular basis for the glycation process. Also, we performed molecular dynamics simulations to investigate how open or cyclic glyoxal-guanine adducts can cause structural changes in an oligonucleotide model. A thermodynamic study of other glycating agents including methylglyoxal, acrolein, crotonaldehyde, 4-hydroxynonenal and 3-deoxyglucosone revealed that, at neutral pH, cyclic adducts were more stable than open adducts; at basic pH, however, the open adducts of 3-deoxyglucosone, methylglyoxal and glyoxal were more stable than their cyclic counterparts. This result can be ascribed to the ability of the adducts to cross-link DNA. The new insights may contribute to improve our understanding of the connection between glycation and DNA cross-linking. Copyright © 2017 Elsevier B.V. All rights reserved.

Adenovirus core protein VII contains distinct sequences that mediate targeting to the nucleus and nucleolus, and colocalization with human chromosomes.

PubMed

Lee, Tim W R; Blair, G Eric; Matthews, David A

2003-12-01

During adenovirus infection, following capsid dissociation, core protein VII enters the host cell nucleus complexed with adenovirus DNA. In order to determine whether protein VII may have an active role in this nuclear import, regions of the preVII gene were amplified by PCR, and further oligonucleotide mutants were designed with site-directed mutation of codons for the basic amino acids arginine and lysine. Fragments were cloned into a mammalian expression plasmid to express the peptides as N-terminal fusions to enhanced green fluorescent protein. Results demonstrate that preVII protein contains both nuclear and nucleolar targeting sequences. Such signals may be important in the delivery of adenovirus DNA to the host cell nucleus during adenovirus infection. Furthermore, the data suggest that protein VII may bind to human chromosomes by means of two distinct domains, one sharing homology with the N-terminal regulatory tail of histone H3.