Science.gov

Sample records for beta 2-microglobulin gene

  1. Beta-2 Microglobulin Tumor Marker

    MedlinePlus

    ... limited. Home Visit Global Sites Search Help? Beta-2 Microglobulin Tumor Marker Share this page: Was this page helpful? Also known as: B2M; B 2 M; β2-Microglobulin; Thymotaxin Formal name: Beta 2 ...

  2. Structure and expression of the mouse beta 2-microglobulin gene isolated from somatic and non-expressing teratocarcinoma cells.

    PubMed Central

    Daniel, F; Morello, D; Le Bail, O; Chambon, P; Cayre, Y; Kourilsky, P

    1983-01-01

    Mouse teratocarcinoma cells express neither H-2 heavy chains nor beta 2-microglobulin (beta 2-m). We have constructed two genomic libraries, one from PCC4-aza-RI embryonal carcinoma cells and the other from their adult syngenic counterpart 129/Sv liver cells (H-2bc). The libraries were screened with a full length mouse beta 2-m cDNA probe which we isolated and sequenced. Two cosmid clones carrying the entire beta 2-m gene were isolated, one from each library. There was no detectable difference in structure between the two genes. Furthermore, both were shown to be active and to restore beta 2-m synthesis upon transfer into mutant cells deficient in beta 2-m. Irreversible DNA alterations in or around the beta 2-m gene are thus unlikely to account for the lack of beta 2-m gene expression in embryonal teratocarcinoma cells. Images Fig. 3. Fig. 4. Fig. 6. PMID:6354707

  3. [beta][sub 2]-microglobulin gene mutations: A study of established colorectal cell lines and fresh tumors

    SciTech Connect

    Bicknell, D.C. ); Rowan, A.; Bodmer, W.F. )

    1994-05-24

    The technique of single-strand conformation polymorphism (SSCP) was used to screen a series of 37 established colorectal cell lines, 22 fresh tumor samples, and 22 normal DNA samples for mutations in the [beta][sub 2]-microglobulin gene. Exon 1 (including the leader peptide sequence) and exon 2 were screened separately. Six of 37 colorectal cell lines and 2 of 22 fresh tumors were shown to contain mutations, whereas no mutations were detected in the normal DNA samples. Sequencing of these mutations showed that an 8-bp CT repeat in the leader peptide sequence was particularly variable, since 3 of the cell lines and one fresh tumor sample have deletions in this region. In the related cell lines, DLD-1 and HCT-15, two similar mutations were identified, a C [yields] A substitution in codon 10 and a G [yields] T mutation in the splice sequence of intron 1. Expression of [beta][sub 2]-microglobulin was examined using a series of monoclonal antibodies in an ELISA system. Reduced expression correlated with a mutation in one allele of [beta][sub 2]-microglobulin, whereas loss of expression was seen in instances where a line was homozygous for a mutation or heterozygous for two mutations.

  4. [Beta 2 microglobulin in children with neuroinfections].

    PubMed

    Murawska, E; Szychowska, Z; Jarno, A

    1997-01-01

    CSF and plasma beta2 microglobulin (B2M) concentrations were determined by an enzyme linked fluorescent assay (ELFA) (Vidas-bioMerieux) in children with bacterial (B2M), viral (mumps and enteroviral) meningitis and in the controls. CSF B2M concentrations in children with B2M at admission, at 24-48 hrs of treatment and at recovery (day 10), in children with viral meningitis at admission and at recovery were significantly higher in comparison with the control group of children with non-pleiocytic CSF. The levels of CSF B2M at 24-48 hrs of treatment of B2M cases were significantly higher than those at the beginning of both mumps and enteroviral meningitis cases which may be helpful in differential diagnosis of meningitis, especially in cases of retarded diagnosis or partially treated B2M. Plasma levels of B2M during bacterial and mumps meningitis did not differ from those in healthy children but in children with enteroviral meningitis were significantly higher. There was a positive correlation between CSF B2M at the beginning of B2M and some laboratory findings of inflammatory response (CRP, ERS). The CSF B2M levels were significantly higher than its plasma levels in patients with B2M at 24-48 hours (second stage) of disease, mumps meningitis on admission and recovery which may suggest intrathecal production of B2M during central nervous system infection.

  5. Theiler's virus infection of beta 2-microglobulin-deficient mice.

    PubMed Central

    Fiette, L; Aubert, C; Brahic, M; Rossi, C P

    1993-01-01

    Theiler's virus, a murine picornavirus, persists in the central nervous systems of susceptible mice and induces a chronic demyelinating disease. Susceptibility or resistance to this disease is controlled in part by the H2-D locus of the major histocompatibility complex (MHC). For this reason, it has been proposed that CD8+ class I-restricted cytotoxic T cells play a main role in the pathogenesis of this viral infection. We recently reported the existence of anti-virus CD8+ cytotoxic T cells in the course of Theiler's virus infection. In the present study, we examined the role of these effector cells in mice in which the beta 2-microglobulin gene had been disrupted. These mice fail to express class I MHC molecules and therefore lack CD8+ T cells. The mice are derived from a C57BL/6 x 129/Ola cross and are H-2b, a haplotype associated with resistance to Theiler's virus infection. beta 2-Microglobulin-deficient mice (beta 2m-/-mice) failed to clear the virus, developed demyelination, and, interestingly, did not succumb to early infection. These results demonstrate that CD8+ T cells are required to clear Theiler's virus infection. In contrast with a current hypothesis, they also demonstrate that CD8+ T cells are not major mediators of the demyelinating disease. Images PMID:8416386

  6. Folding and fibrillogenesis: clues from beta2-microglobulin.

    PubMed

    Rennella, Enrico; Corazza, Alessandra; Giorgetti, Sofia; Fogolari, Federico; Viglino, Paolo; Porcari, Riccardo; Verga, Laura; Stoppini, Monica; Bellotti, Vittorio; Esposito, Gennaro

    2010-08-13

    Renal failure impairs the clearance of beta(2)-microglobulin from the serum, with the result that this protein accumulates in joints under the form of amyloid fibrils. While the molecular mechanism leading to deposition of amyloid in vivo is not totally understood, some organic compounds, such as trifluoroethanol (TFE), are commonly used to promote the elongation of amyloid fibrils in vitro. This article gives some insights into the structural properties and the conformational states of beta(2)-microglobulin in the presence of TFE, using both the wild-type protein and the mutant Trp60Gly. The structure of the native state of the protein is rather insensitive to the presence of the alcohol, but the stability of this state is lowered in comparison to some other conformational states. In particular, a native-like folding intermediate is observed in the presence of moderate concentrations of TFE. Instead, at higher concentrations of the alcohol, the population of a disordered native-unlike state is dominant and correlates with the ability to elongate fibrils. PMID:20558175

  7. 21 CFR 866.5630 - Beta-2-microglobulin immunological test system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Beta-2-microglobulin immunological test system. 866.5630 Section 866.5630 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... beta-2-microglobulin (a protein molecule) in serum, urine, and other body fluids. Measurement of...

  8. Clearance and synthesis rates of beta 2-microglobulin in patients undergoing hemodialysis and in normal subjects

    SciTech Connect

    Floege, J.; Bartsch, A.; Schulze, M.; Shaldon, S.; Koch, K.M.; Smeby, L.C. )

    1991-08-01

    Retention of {beta} 2-microglobulin in patients undergoing hemodialysis is associated with a {beta} 2-microglobulin-derived amyloidosis. Removal of {beta} 2-microglobulin by renal replacement therapy has been proposed for the prevention of this amyloidosis. Currently, however, data on the {beta} 2-microglobulin synthesis rate in patients undergoing hemodialysis are scarce, and consequently it remains speculative how much removal would be necessary to counterbalance synthesis. The plasma kinetics of iodine 131-labeled {beta} 2-microglobulin were therefore examined in 11 patients with anuria who were undergoing long-term hemodialysis. Five healthy persons served as controls. Kinetic modeling of the plasma curves showed that the data fitted a two-pool model (r2 greater than 0.96) consisting of a rapid 2 to 4 hour distribution phase followed by a less steep curve, described by the plasma (metabolic) clearance (Clp). Synthetic rates were calculated from Clp and the {beta} 2-microglobulin steady state plasma concentration (plus {beta} 2-microglobulin removal during hemodialysis in the case of high flux hemodialysis). The results showed a significantly higher Clp in normal controls as compared with patients undergoing hemodialysis (65.5 {plus minus} 12.8 ml/min (mean {plus minus} SD) versus 3.4 {plus minus} 0.7 ml/min). In contrast, the {beta} 2-microglobulin synthesis rate in the patient group (3.10 {plus minus} 0.79 mg/kg/day) was not significantly different from that of normal controls (2.40 {plus minus} 0.67 mg/kg/day), which was due to markedly elevated {beta} 2-microglobulin plasma concentrations in the patients (37.6 {plus minus} 14.1 mg/L vs 1.92 {plus minus} 0.27 mg/L). These findings suggest that the presence of end-stage renal disease does not have a significant impact on the beta 2-microglobulin generation rate.

  9. Clearance of beta-2-microglobulin and middle molecules in haemodiafiltration.

    PubMed

    Tattersall, James

    2007-01-01

    Middle molecules, consisting mostly of peptides and small proteins with molecular weight the range of 500-60,000 Da, accumulate in renal failure and contribute to the uraemic toxic state. Beta2-microglobulin (beta2-MG) with a molecular weight of 11,000 is considered representative of these middle molecules. These solutes are not well cleared by low-flux dialysis. High-flux dialysis will clear middle molecules, partly by internal filtration. This convective component of high-flux dialysis can be enhanced in a predictable way by haemodiafiltration (HDF). The convective and diffusive clearance rates of any middle molecule across any haemodiafilter can be predicted from known or measurable factors such as its sieving coefficient, bound fraction and molecular weight. The removal of middle molecules is also influenced by factors within the patient. Beta2-MG is distributed within the extracellular fluid. During HDF, beta2-MG must transfer into the intravascular compartment across the capillary walls. This transcapillary transfer at a rate of approximately 100 ml/min slows beta2-MG removal from the body. Continuing transfer after the end of a treatment session results in a significant rebound of beta2-MG levels. This intercompartment transfer and its effect on beta2-MG clearance and concentration can be predicted by a 2-compartment model. By extrapolation, the behaviour of other middle molecules can be predicted. The 2-compartment model, which takes non-dialytic beta2-MG clearance at a rate of 3 ml/min and beta2-MG generation at a rate of 0.1 mg/min into account, can predict the effect of any HDF schedule on beta2-MG levels. Low-flux dialysis results in a beta2-MG level of around 40 mg/l. Three times weekly, 4-hour HDF can reduce beta2-MG levels to around 20 mg/l. Long (nocturnal) HDF can reduce beta2-MG levels to around 10 mg/l, compared to physiological levels of less than 5 mg/l.

  10. Urinary beta 2-microglobulin concentration and mortality in a cadmium-polluted area

    SciTech Connect

    Nakagawa, H.; Nishijo, M.; Morikawa, Y.; Tabata, M.; Senma, M.; Kitagawa, Y.; Kawano, S.; Ishizaki, M.; Sugita, N.; Nishi, M. )

    1993-11-01

    A 9-y follow-up study of 3,178 persons who lived in a cadmium-polluted area was conducted to assess the influence of environmental cadmium exposure on long-term outcome. The standardized mortality ratios of the urinary beta 2-microglobulin-positive subjects (> 1,000 micrograms/g creatinine) of both sexes were higher than those of the general Japanese population, whereas the cumulative survival curves were lower than those of the urinary beta 2-microglobulin-negative group. A significant association was also found between urinary beta 2-microglobulin and mortality, using a Cox's proportional hazards model. Moreover, mortality rates increased in proportion to increases in the amount of urinary beta 2-microglobulin excreted. These results suggest that the prognosis for cadmium-exposed subjects with proximal tubular dysfunction is unfavorable. The mortality rate tended to become higher as the severity of renal dysfunction progressed.

  11. [Serum beta 2 microglobulin (beta 2M) following renal transplantation].

    PubMed

    Pacheco-Silva, A; Nishida, S K; Silva, M S; Ramos, O L; Azjen, H; Pereira, A B

    1994-01-01

    Although there was an important improvement in graft and patient survival the last 10 years, graft rejection continues to be a major barrier to the success of renal transplantation. Identification of a laboratory test that could help to diagnose graft rejection would facilitate the management of renal transplanted patients. PURPOSE--To evaluate the utility of monitoring serum beta 2M in recently transplanted patients. METHODS--We daily determined serum beta 2M levels in 20 receptors of renal grafts (10 from living related and 10 from cadaveric donors) and compared them to their clinical and laboratory evolution. RESULTS--Eight patients who presented immediate good renal function following grafting and did not have rejection had a mean serum beta 2M of 3.7 mg/L on the 4th day post transplant. The sensitivity of the test for the diagnosis of acute rejection was 87.5%, but the specificity was only 46%. Patients who presented acute tubular necrosis (ATN) without rejection had a progressive decrease in their serum levels of beta 2M, while their serum creatinine changed as they were dialyzed. In contrast, patients with ATN and concomitance of acute rejection or CSA nephrotoxicity presented elevated beta 2M and creatinine serum levels. CONCLUSION--Daily monitoring of serum beta 2M does not improve the ability to diagnose acute rejection in patients with good renal function. However, serum beta 2M levels seemed to be useful in diagnosing acute rejection or CSA nephrotoxicity in patients with ATN.

  12. [Serum beta 2 microglobulin (beta 2M) following renal transplantation].

    PubMed

    Pacheco-Silva, A; Nishida, S K; Silva, M S; Ramos, O L; Azjen, H; Pereira, A B

    1994-01-01

    Although there was an important improvement in graft and patient survival the last 10 years, graft rejection continues to be a major barrier to the success of renal transplantation. Identification of a laboratory test that could help to diagnose graft rejection would facilitate the management of renal transplanted patients. PURPOSE--To evaluate the utility of monitoring serum beta 2M in recently transplanted patients. METHODS--We daily determined serum beta 2M levels in 20 receptors of renal grafts (10 from living related and 10 from cadaveric donors) and compared them to their clinical and laboratory evolution. RESULTS--Eight patients who presented immediate good renal function following grafting and did not have rejection had a mean serum beta 2M of 3.7 mg/L on the 4th day post transplant. The sensitivity of the test for the diagnosis of acute rejection was 87.5%, but the specificity was only 46%. Patients who presented acute tubular necrosis (ATN) without rejection had a progressive decrease in their serum levels of beta 2M, while their serum creatinine changed as they were dialyzed. In contrast, patients with ATN and concomitance of acute rejection or CSA nephrotoxicity presented elevated beta 2M and creatinine serum levels. CONCLUSION--Daily monitoring of serum beta 2M does not improve the ability to diagnose acute rejection in patients with good renal function. However, serum beta 2M levels seemed to be useful in diagnosing acute rejection or CSA nephrotoxicity in patients with ATN. PMID:7787867

  13. Role of IL-1 beta and prostaglandins in beta 2-microglobulin-induced bone mineral dissolution.

    PubMed

    Moe, S M; Hack, B K; Cummings, S A; Sprague, S M

    1995-02-01

    beta 2-microglobulin (beta 2m) induces an osteoclast-mediated net calcium efflux from neonatal mouse calvariae which occurs only after 48 hours of incubation, suggesting that beta 2m acts via other growth factors. To further test this hypothesis, calvariae were incubated with and without beta 2m in the presence of the prostaglandin inhibitor indomethacin, anti-interleukin-1 beta antibody (anti-IL-1 beta), or interleukin-1 beta receptor antagonist (IL-1 beta RA). The addition of beta 2m to the culture medium stimulated, whereas indomethacin inhibited basal calcium efflux following 48 hours. However, the difference (delta) between the calcium efflux induced in calvariae incubated with and without beta 2m in basal medium and that in calvariae incubated with and without beta 2m in indomethacin supplemented medium was similar, suggesting a prostaglandin independent mechanism. There was a time dependent increase in PGE2 in basal medium which was unaffected by beta 2m. In contrast, pre-incubating calvariae with either anti-IL-1 beta or IL-1 beta RA did not alter basal calcium efflux but completely blocked the beta 2m induced calcium efflux. Anti-IL-1 beta had no effect on the basal release of beta-glucuronidase but partially blocked the beta 2m induced release of beta-glucuronidase. Thus, the beta 2m-induced calcium efflux observed in neonatal mouse calvariae is dependent on interleukin-1 beta but not prostaglandins.

  14. Target cell lysis by natural killer cells is influenced by beta 2-microglobulin expression.

    PubMed

    Müllbacher, A; King, N J

    1989-07-01

    Natural killer (NK) cells form part of the vertebrate defence against viruses and tumours, but show only limited specificity. The molecule(s) recognized by NK cells on target cells are at present unknown. Major histocompatibility complex (MHC) class I antigen concentration on target cells is inversely correlated with NK cell lysis. Here we show that MHC class I-unassociated beta 2-microglobulin (beta 2-m) expression is involved in NK cell-target cell interaction. Two human MHC class I negative cell lines, Daudi and K562, are differentially susceptible to NK cell lysis. Daudi cells are beta 2-m-negative and resistant to NK lysis, K562 are beta 2-m-positive and highly susceptible to lysis by NK cells. Interferon (IFN) treatment augments beta 2-m expression and NK lysis of K562, but not in Daudi cells. NK cell lysis of K562, but not YAC-1 cells, can be inhibited by monoclonal anti-human beta 2-m antibody. Furthermore, susceptibility of mouse embryo fibroblasts (MEF) to NK lysis can be increased by infection with recombinant vaccinia virus expressing the human beta 2-m gene.

  15. Tissue-specific and cell surface expression of human major histocompatibility complex class I heavy (HLA-B7) and light (beta 2-microglobulin) chain genes in transgenic mice.

    PubMed Central

    Chamberlain, J W; Nolan, J A; Conrad, P J; Vasavada, H A; Vasavada, H H; Ploegh, H L; Ganguly, S; Janeway, C A; Weissman, S M

    1988-01-01

    We introduced the human genes HLA-B7 and B2M encoding the heavy (HLA-B7) and light [beta 2-microglobulin (beta 2m)] chains of a human major histocompatibility complex class I antigen into separate lines of transgenic mice. The tissue-specific pattern of HLA-B7 RNA expression was similar to that of endogenous class I H-2 genes, although the HLA-B7 gene was about 10-fold underexpressed in liver. Identical patterns of RNA expression were detected whether the HLA-B7 gene contained 12 or 0.66 kilobase(s) (kb) of 5' flanking sequence. The level of expression was copy number dependent and as efficient as that of H-2 genes; gamma interferon enhanced HLA-B7 RNA expression in parallel to that of H-2. In addition to the mechanism(s) responsible for gamma interferon-enhanced expression, there must be at least one other tissue-specific mechanism controlling the constitutive levels of class I RNA. Tissue-specific human beta 2m RNA expression was similar to that of mouse beta 2m, including high-level expression in liver. Cell surface HLA-B7 increased 10- to 17-fold on T cells and on a subset of thymocytes from HLA-B7/B2M doubly transgenic mice compared to HLA-B7 singly transgenic mice. The pattern of expression of HLA-B7 on thymocytes resembled that of H-2K as opposed to H-2D. These results confirm that coexpression of both human chains is required for efficient surface expression and that HLA-B7 may share a regulatory mechanism with H-2K, which distinguishes it from H-2D. Images PMID:2459712

  16. Renal handling of beta-2-microglobulin, amylase and albumin in acute pancreatitis.

    PubMed

    Karlsson, F A; Jacobson, G

    1979-01-01

    The renal handling of beta-2-microglobulin, amylase and albumin was studied in patients with acute pancreatitis. The data were compared with results obtained from patients with glomerular proteinuria and from patients with tubular proteinuria. Initially during acute pancreatitis, the clearance ratio (clearance protein/clearance creatinine) for beta-2-microglobulin was increased dramatically (77-fold) compared to normals. After four to seven days this ratio had fallen and was elevated only 7-fold. The corresponding figures for amylase were 3.3 and 1.8 times and for albumin 9 and 5 times respectively. In glomerular disease, the clearance ratios for beta-2-microglobulin, amylase and albumin were increased 6, 1.1, and 154 times and in tubular disease 448, 1.1, and 28 times, respectively. The electrophoretic pattern of the urinary proteins during pancreatitis was mostly normal. In a few cases, slight tubular proteinuria was noticed. Amylase activity in serum and urine from patients with pancreatitis was found to sediment, (S20,W = 4.6) in a sucrose gradient, identical to amylase from normal serum and urine. The marked increase in the excretion of beta-2-microglobulin probably reflects interference of the kidney function at the proximal tubular level. Determinations of this protein in urine may be of value in studies of kidney dysfunction that can accompany pancreatitis.

  17. 21 CFR 866.5630 - Beta-2-microglobulin immunological test system.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Beta-2-microglobulin immunological test system. 866.5630 Section 866.5630 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Immunological Test Systems §...

  18. 21 CFR 866.5630 - Beta-2-microglobulin immunological test system.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Beta-2-microglobulin immunological test system. 866.5630 Section 866.5630 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Immunological Test Systems §...

  19. 21 CFR 866.5630 - Beta-2-microglobulin immunological test system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Beta-2-microglobulin immunological test system. 866.5630 Section 866.5630 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Immunological Test Systems §...

  20. 21 CFR 866.5630 - Beta-2-microglobulin immunological test system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Beta-2-microglobulin immunological test system. 866.5630 Section 866.5630 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Immunological Test Systems §...

  1. Beta 2-microglobulin amyloidosis presenting as esophageal perforation in a hemodialysis patient.

    PubMed

    Khan, G A; Lewis, F I; Dasgupta, M

    1997-01-01

    A 45-year-old male with hypertensive end-stage renal disease and on maintenance hemodialysis for 13 years is reported. He presented with life-threatening hematemesis, secondary to esophageal rupture. Immunohistological staining and electron microscopy examination of the esophageal perforation showed depositions of beta 2-microglobulin (beta 2-M) amyoloid. The unique aspect presented here is the localized esophageal involvement with beta 2-M amyloidosis. This is the first reported patient with esophageal perforation, due to the deposition and infiltration of the lower esophagus with beta 2-M which predisposed to its rupture. PMID:9426849

  2. Beta 2-microglobulin and neopterin: predictive markers for human immunodeficiency virus type 1 infection in children?

    PubMed Central

    Chan, M M; Campos, J M; Josephs, S; Rifai, N

    1990-01-01

    The value of beta 2-microglobulin and neopterin concentrations in serum for early diagnosis of infants born to human immunodeficiency virus type 1 (HIV-1)-infected mothers was assessed. Concentrations of both markers were measured in serum samples from pediatric patients (Centers for Disease Control classifications P0, P1, and P2), as well as in age-matched normal subjects. Both beta 2-microglobulin and neopterin were significantly increased in HIV-1-infected symptomatic subjects (P2) compared to controls. Seventy-five percent of asymptomatic patients (P1) also had increased values. On the other hand, a significant overlap in concentrations of both markers in serum was found between controls and P0 patients. Thirty-eight percent of the P0 patients had values comparable to those of the P2 group. Persistently high concentrations of both markers in P0 patients may be indicative of HIV-1 infection. PMID:2229344

  3. Induction of assembly of MHC class I heavy chains with beta 2microglobulin by interferon-gamma.

    PubMed Central

    Klar, D; Hämmerling, G J

    1989-01-01

    Assembly of histocompatibility class I heavy chains with beta 2microglobulin (beta 2m) is known to be necessary for cell surface expression. Studies on the H-2 class I deficient but interferon-gamma (IFN-gamma) inducible fibrosarcoma BC2 and the lung carcinoma CMT 64.5 showed that after transfection with allogeneic H-2 class I genes the class I proteins are expressed, but only intracellularly and not on the cell surface. In spite of the presence of beta 2m in the cells no association of the transfected class I chain with beta 2m was observed. However, stimulation with IFN-gamma induced assembly and subsequent surface expression. These findings show that the assembly of class I heavy chains with beta 2m is not a spontaneous event but appears to be regulated by cellular mechanisms the nature of which is still unknown. Images PMID:2498080

  4. Beta(2)-microglobulin as a negative growth regulator of myeloma cells.

    PubMed

    Min, Rui; Li, Zhongkui; Epstein, Joshua; Barlogie, Bart; Yi, Qing

    2002-08-01

    High beta(2)-microglobulin (beta(2)m) levels in myeloma correlate with poor prognosis. We hypothesized that beta(2)m may affect myeloma cell growth and survival. In this study, we examined the in vitro effects of beta(2)m on myeloma cells. Primary myeloma cells freshly isolated from patients and myeloma cell lines were used, cultured in the presence of beta(2)m, and monitored for growth and survival. Beta(2)m suppressed the growth of primary tumour cells and myeloma cell lines (ARK-RS, ARP-1, RPMI-8226, U266, ARH-77 and IM-9). High concentrations of beta(2)m induced apoptosis and cell cycle arrest. Beta(2)m-induced apoptosis was dependent on activation of a caspase cascade, inhibited by interleukin 6, and did not involve the surface death receptors, as receptor-neutralizing antibodies had no inhibitory effect. Beta(2)m-induced growth arrest was associated with downregulation of cyclins A and D2. Surprisingly, anti-beta(2)m antibodies did not block the effect of beta(2)m but were synergistic with beta(2)m, resulting in 90% growth inhibition and 70% apoptosis of myeloma cells. Whereas beta(2)m treatment resulted in slight upregulation of surface beta(2)m and major histocompatibility complex class I alpha-chain expression, treatment of myeloma cells with anti-beta(2)m antibodies alone or with beta(2)m resulted in significant downregulation of surface beta(2)m and class I molecules, suggesting that class I molecules may be involved in signal transduction. Our data demonstrate that beta(2)m plays an important role in regulating the growth and survival of myeloma cells in vitro and warrants further investigation to delineate the mechanisms of beta(2)m and anti-beta(2)m antibody-induced growth regulation of myeloma cells.

  5. On the association of human beta 2 microglobulin with cell culture-grown human cytomegalovirus (HCMV).

    PubMed

    Yamashita, Y; Shimokata, K; Nishiyama, Y

    1992-09-01

    We studied the production of human beta 2 microglobulin (beta 2m) in mock-infected or human cytomegalovirus (HCMV) infected human embryonic lung fibroblasts (HEL) and the association of human beta 2m with HCMV virions. Titration of beta 2m by two-step sandwich enzyme immunoassay revealed that HEL released considerable amounts of human beta 2m into the culture medium and that the production of beta 2m was significantly enhanced by HCMV infection. The concentration of human beta 2m in the culture medium of HCMV-infected HEL reached 500 to 600 ng/ml, which corresponded to 7- to 12-fold of levels found in healthy adult urine. Immunoprecipitation assays showed that HEL-grown HCMV bound a significant amount of endogenous beta 2m, but the viruses were efficiently neutralized by either human hyperimmune anti-HCMV globulin or anti-HCMV monoclonal antibody even when treated with a large amount of human beta 2m or with dialysed urine. Thus it seems unlikely that the binding of beta 2m by HCMV is involved in masking the viral antigenic site necessary for neutralization.

  6. A {beta}{sub 2}-microglobulin cleavage variant fibrillates at near-physiological pH

    SciTech Connect

    Corlin, Dorthe B. Johnsen, Christina K.; Nissen, Mogens H.; Heegaard, Niels H.H.

    2009-04-03

    {beta}{sub 2}-microglobulin ({beta}{sub 2}m) deposits as amyloid in dialysis-related amyloidosis (DRA), predominantly in joints. The molecular mechanisms underlying the amyloidogenicity of {beta}{sub 2}m are still largely unknown. In vitro, acidic conditions, pH < 4.5, induce amyloid fibrillation of native {beta}{sub 2}m within several days. Here, we show that amyloid fibrils are generated in less than an hour when a cleavage variant of {beta}{sub 2}m-found in the circulation of many dialysis patients-is exposed to pH levels (pH 6.6) occurring in joints during inflammation. Aggregation and fibrillation, including seeding effects with intact, native {beta}{sub 2}m were studied by Thioflavin T fluorescence spectroscopy, turbidimetry, capillary electrophoresis, and electron microscopy. We conclude that a biologically relevant variant of {beta}{sub 2}m is amyloidogenic at slightly acidic pH. Also, only a very small amount of preformed fibrils of this variant is required to induce fibrillation of native {beta}{sub 2}m. This may explain the apparent lack of detectable amounts of the variant {beta}{sub 2}m in extracts of amyloid from DRA patients.

  7. beta 2-Microglobulin levels in serum and urine of rheumatoid arthritis patients on gold therapy.

    PubMed Central

    Latt, D; Weiss, J B; Jayson, M I

    1981-01-01

    The levels of beta 2-microglobulin (beta 2-m) in serum and urine of 24 seropositive patients with rheumatoid arthritis (RA) treated with regular gold (sodium aurothiomalate) injections have been investigated. The values obtained were compared with levels from 20 seropositive patients with RA treated only with nonsteroidal anti-inflammatory drugs and 20 age and sex matched normal controls who had received no medication. A significant increase of urinary beta 2-m levels was found in the gold-treated RA group. No correlation between dose of gold received and the levels of beta 2-m in the urine could be established. There was also no correlation between the erythrocyte sedimentation rate (ESR) or total lymphocyte count and beta 2-m levels in serum or urine. We conclude that serum and urinary beta 2-m levels appear to be poor indices of joint inflammation, but sequential urinary beta 2-m levels may prove valuable in monitoring the development of renal tubular lesions due to gold therapy. PMID:6164344

  8. Beta(2)-microglobulin identified as an apoptosis-inducing factor and its characterization.

    PubMed

    Mori, M; Terui, Y; Ikeda, M; Tomizuka, H; Uwai, M; Kasahara, T; Kubota, N; Itoh, T; Mishima, Y; Douzono-Tanaka, M; Yamada, M; Shimamura, S; Kikuchi, J; Furukawa, Y; Ishizaka, Y; Ikeda, K; Mano, H; Ozawa, K; Hatake, K

    1999-10-15

    Major histocompatibility complex (MHC) molecules play an important role in antigen presentation for induction of tumor as well as cellular and humoral immunities. Recent studies using anti-MHC antibodies demonstrated that antibodies specific for HLA class I molecules induced cellular activation and a type of apoptosis that may be distinct from Fas-dependent or TNFR (tumor necrosis factor-alpha receptor)-dependent processes. We purified a previously untested apoptosis-inducing factor from HL-60 human leukemic cell-conditioned media to homogeneity and sequenced it. It was identified as beta(2)-microglobulin (beta(2)m), which has been previously known as thymotaxin and is a part of the HLA class I antigen complex. beta(2)m acts on both T-leukemic cells and myeloid leukemic cells to induce apoptosis, which then activates caspase 1 and 3. Cross-linking studies showed that biotinilated beta(2)m recognized an epitope distinct from those recognized by the anti-HLA class I antibody, as reported previously. We demonstrated that beta(2)m plays a previously unrecognized and important role in regulating the elimination of tumor cells, which occurs as a result of the action of beta(2)m as an apoptosis-inducing factor.

  9. [beta subsccript 2]-microglobulin forms three-dimensional domain-swapped amyloid fibrils with disulfide linkages

    SciTech Connect

    Liu, Cong; Sawaya, Michael R.; Eisenberg, David

    2011-08-09

    {beta}{sub 2}-microglobulin ({beta}{sub 2}-m) is the light chain of the type I major histocompatibility complex. It deposits as amyloid fibrils within joints during long-term hemodialysis treatment. Despite the devastating effects of dialysis-related amyloidosis, full understanding of how fibrils form from soluble {beta}{sub 2}-m remains elusive. Here we show that {beta}{sub 2}-m can oligomerize and fibrillize via three-dimensional domain swapping. Isolating a covalently bound, domain-swapped dimer from {beta}{sub 2}-m oligomers on the pathway to fibrils, we were able to determine its crystal structure. The hinge loop that connects the swapped domain to the core domain includes the fibrillizing segment LSFSKD, whose atomic structure we also determined. The LSFSKD structure reveals a class 5 steric zipper, akin to other amyloid spines. The structures of the dimer and the zipper spine fit well into an atomic model for this fibrillar form of {beta}{sub 2}-m, which assembles slowly under physiological conditions.

  10. K3 fragment of amyloidogenic beta(2)-microglobulin forms ion channels: implication for dialysis related amyloidosis.

    PubMed

    Mustata, Mirela; Capone, Ricardo; Jang, Hyunbum; Arce, Fernando Teran; Ramachandran, Srinivasan; Lal, Ratnesh; Nussinov, Ruth

    2009-10-21

    Beta(2)-microglobulin (beta(2)m) amyloid deposits are linked to dialysis-related amyloidosis (DRA) in hemodialysis patients. The mechanism by which beta(2)m causes DRA is not understood. It is also unclear whether only the full-length beta(2)m induces pathophysiology or if proteolytic fragments are sufficient for inducing this effect. Ser20-Lys41 (K3) is a digestion fragment of full-length beta(2)m. Solid state NMR (ssNMR) combined with X-ray diffraction and atomic force microscopy (AFM) revealed the characteristic oligomeric amyloid conformation of the U-turn beta-strand-turn-beta-strand motif stacked in parallel and stabilized by intermolecular interactions also shown by Abeta(9-40)/Abeta(17-42) and the CA150 WW domain. Here we use the K3 U-turn atomic coordinates and molecular dynamic (MD) simulations to model K3 channels in the membrane. Consistent with previous AFM imaging of other amyloids that show channel-like structures in the membrane, in the simulations K3 also forms ion channels with 3-6 loosely attached mobile subunits. We carry out AFM, single channel electrical recording, and fluorescence imaging experiments. AFM images display 3D ion channel topography with shapes, morphologies, and dimensions consistent with the theoretical model. Electrical conductance measurements indicate multiple single channel conductances, suggesting that various K3 oligomer sizes can constitute the channel structure. Fluorescence measurements in kidney cells show channel-mediated cell calcium uptake. These results suggest that the beta(2)m-induced DRA can be mediated by ion channels formed by its K3 fragment. Because the beta-strand-turn-beta-strand motif appears to be a universal amyloid feature, its ability to form ion channels further suggests that the motif may play a generic role in toxicity.

  11. Mass spectrometric characterization of conformational preludes to [beta]2-microglobulin aggregation

    NASA Astrophysics Data System (ADS)

    Jørgensen, Thomas J. D.; Cheng, Lei; Heegaard, Niels H. H.

    2007-12-01

    Characterization of protein folding and unfolding is an important issue for basic biological science, for understanding the devastating amyloid diseases, and for the manufacture and use of biological therapeutics. Unlike nuclear magnetic resonance spectroscopy, the use of mass spectrometry to monitor amide hydrogen (1H/2H) exchange kinetics (HX-MS) allows characterization of structural dynamics even when only limited amounts of protein is available. As an adjunct technique, requiring even less material and very well suited for serial monitoring of folding phenomena in a single solution under native conditions capillary electrophoresis may also be very informative. These approaches are here used to examine the small (99 amino acid residues) protein [beta]2-microglobulin ([beta]2m) which is prone to amyloidogenic unfolding especially after cleavage at its lysine-58 residue. The propensity for unfolding of native, non-cleaved [beta]2m and lysine-58 cleaved [beta]2m variants as well as the effect of acetonitrile on the conformational equilibria could be addressed by these approaches. At physiological conditions, intact [beta]2m and the lysine-58 cleaved variants undergo a transient unfolding that exhibit an EX1 type hydrogen exchange behaviour. We have measured the unfolding rate constants for the cleaved variant where Lys-58 is removed ([Delta]K58-[beta]2m) and the cleaved variant where this residue is preserved (cK58-[beta]2m) at various temperatures. Below 37 °C, the variant devoid of Lys-58 ([Delta]K58-[beta]2m) has a higher unfolding rate than cK58-[beta]2m and this correlates with the observation that [Delta]K58-[beta]2m has a higher propensity to aggregate. The results of our studies provide valuable insight into the early conformational perturbations involved in rendering this protein insoluble and amyloidogenic. The approaches used in this study should be useful also for the characterization of other conformationally unstable proteins.

  12. Expression of beta 2-microglobulin by human benign and malignant mesenchymal and neurogenic tumours.

    PubMed Central

    Petersen, B. L.; Braendstrup, O.

    1993-01-01

    Human myosarcomas, liposarcomas, meningosarcomas, glioblastomas and malignant schwannomas, their benign counterparts and normal cells from which these tumours derive, were examined for the expression of beta 2-microglobulin (beta 2m). Formalin fixed specimens from these tumours were studied by light microscopy employing the immunoperoxidase method with the use of antibodies directed towards beta 2m. The malignant tumours showed a broad spectrum from unstained to strongly stained tumours, most pronounced among myosarcomas. In addition, most stained tumours displayed a mosaic staining pattern in that unstained areas alternated with stained. There was a tendency towards increased staining for beta 2m in malignant compared to normal cells; this was also observed in the benign tumours although to a lesser degree. The results differ from most earlier studies, mainly of carcinomas which have shown a tendency towards down-regulation of MHC I molecules on the tumour cells. The results are discussed in relation to concepts of immune surveillance of tumours. Images Figure 1 Figure 2 PMID:8398813

  13. Removal of the N-terminal hexapeptide from human beta2-microglobulin facilitates protein aggregation and fibril formation.

    PubMed Central

    Esposito, G.; Michelutti, R.; Verdone, G.; Viglino, P.; Hernández, H.; Robinson, C. V.; Amoresano, A.; Dal Piaz, F.; Monti, M.; Pucci, P.; Mangione, P.; Stoppini, M.; Merlini, G.; Ferri, G.; Bellotti, V.

    2000-01-01

    The solution structure and stability of N-terminally truncated beta2-microglobulin (deltaN6beta2-m), the major modification in ex vivo fibrils, have been investigated by a variety of biophysical techniques. The results show that deltaN6beta2-m has a free energy of stabilization that is reduced by 2.5 kcal/mol compared to the intact protein. Hydrogen exchange of a mixture of the truncated and full-length proteins at microM concentrations at pH 6.5 monitored by electrospray mass spectrometry reveals that deltaN6beta2-m is significantly less protected than its wild-type counterpart. Analysis of deltaN6beta2-m by NMR shows that this loss of protection occurs in beta strands I, III, and part of II. At mM concentration gel filtration analysis shows that deltaN6beta2-m forms a series of oligomers, including trimers and tetramers, and NMR analysis indicates that strand V is involved in intermolecular interactions that stabilize this association. The truncated species of beta2-microglobulin was found to have a higher tendency to self-associate than the intact molecule, and unlike wild-type protein, is able to form amyloid fibrils at physiological pH. Limited proteolysis experiments and analysis by mass spectrometry support the conformational modifications identified by NMR and suggest that deltaN6beta2-m could be a key intermediate of a proteolytic pathway of beta2-microglobulin. Overall, the data suggest that removal of the six residues from the N-terminus of beta2-microglobulin has a major effect on the stability of the overall fold. Part of the tertiary structure is preserved substantially by the disulfide bridge between Cys25 and Cys80, but the pairing between beta-strands far removed from this constrain is greatly perturbed. PMID:10850793

  14. Amino acid sequences in the alpha 1 domain and not glycosylation are important in HLA-A2/beta 2-microglobulin association and cell surface expression.

    PubMed Central

    Santos-Aguado, J; Biro, P A; Fuhrmann, U; Strominger, J L; Barbosa, J A

    1987-01-01

    The role of the single carbohydrate moiety present on the HLA-A2 molecule was studied by introducing several amino acid substitutions (by site-directed mutagenesis of the HLA-A2 gene) in the consensus glycosylation sequence Asn-X-Ser. Two different amino acid substitutions of the asparagine residue at position 86 (glutamine and aspartic acid) resulted in the synthesis of ca. 39,000-molecular-weight nonglycosylated heavy chains that were detected in the cytoplasm but not on the surface of mouse L-cell transfectants. However, a low level of surface expression was detected following transfection of human (rhabdomyosarcoma) cells or mouse L cells containing human beta 2-microglobulin. The defect in surface expression was not due to the absence of the glycan moiety, since the substitution of a glycine for a serine at amino acid 88 did not have the same drastic effect in the presence of human beta 2-microglobulin. These and other data suggest that the asparagine residue may play a critical role in the conformation of the HLA heavy chain and its interaction with beta 2-microglobulin. Immunofluorescence microscopy following permeabilization of the transfectants demonstrated that the unglycosylated HLA heavy chains are sequestered in an unidentified cellular compartment that is different from the Golgi structure. Images PMID:3550437

  15. Quantitative analysis of beta-actin, beta-2-microglobulin and porphobilinogen deaminase mRNA and their comparison as control transcripts for RT-PCR.

    PubMed

    Lupberger, J; Kreuzer, K A; Baskaynak, G; Peters, U R; le Coutre, P; Schmidt, C A

    2002-02-01

    Quantitation of target mRNAs using the reverse-transcription polymerase chain reaction found a widespread field of application in diverse biomedical diagnostic assays. However, the problem of varying sample quality has to be solved by correcting target molecule amounts through detection of an endogenous control template. The choice of an appropriate reference gene is still object of debate as pseudogene co-amplification and expression level variations may limit the usefulness of some currently used reference reactions. We compared quantitative expression levels of the commonly used endogenous reference genes beta-actin (beta-actin), beta-2-microglobulin (beta2-MG) and porphobilinogen deaminase (PBDG) using the TaqMan chemistry. With these assays we investigated the respective expression patterns in K562 cells and leucocytes of normal individuals as well as of malignoma patients. In K562 cells 1544+246 beta-actin, 65+30 beta2-MG and 22+/-8 PBDG copies/cell were detected. In normal leucocytes 491+/-97 beta-actin, 40+/-17 beta2-MG and <1 PBDG copies/cell were quantified. Leucocytes of various malignancies exhibited 84+/-51 beta-actin, 106+/-8 beta2-MG and <1 PBDG copies/cell. We conclude that beta2-MG is the most suitable reference gene tested as its variation between different sample origins and within distinct cell types was acceptable low.

  16. Abrogation of resistance to Theiler's virus-induced demyelination in H-2b mice deficient in beta 2-microglobulin.

    PubMed

    Rodriguez, M; Dunkel, A J; Thiemann, R L; Leibowitz, J; Zijlstra, M; Jaenisch, R

    1993-07-01

    Intracerebral infection of susceptible strains of mice with Theiler's virus, a picornavirus, results in central nervous system demyelination, which is similar to multiple sclerosis. Immunogenetic experiments indicate that the MHC (H-2) and, in particular, the D region that controls class I-restricted immune responses, is an important determinant to development of demyelination. We tested whether disruption of beta 2-microglobulin (beta 2-m) would abrogate resistance to demyelinating disease normally observed in H-2b mice. All (C57BI/6 x 129)F3 mice transgenic for homozygous beta 2-m gene disruption (-/-) developed chronic demyelination after Theiler's murine encephalomyelitis virus infection, whereas none of the infected littermates with normal expression of class I MHC (beta 2-m, +/+) developed demyelination. Demyelinated lesions showed class II MHC expression, macrophages, and TNF but no class I MHC expression or CD8+ T cells. No correlation was observed between development of demyelination and delayed-type hypersensitivity responses to virus Ag. Despite the presence of demyelinating lesions, none of the infected beta 2-m (-/-) mice developed neurologic deficits. Infectious virus and virus Ag persisted in the central nervous systems of infected beta 2-m (-/-) mice but not in beta 2-m (+/+) mice. These experiments support the hypothesis that a class I immune response mediated by CD8+ T cells is important in resistance to Theiler's murine encephalomyelitis virus-induced demyelination. Development of chronic neurologic deficits as observed in immunocompetent susceptible strains of mice may be dependent on the presence of class I MHC and CD8+ T cells.

  17. [INTERACTION OF THE DYE CONGO RED WITH FIBRILS OF LYSOZYME, BETA2-MICROGLOBULIN AND TRANSTHYRETIN].

    PubMed

    Antimonova, O I; Grudinina, N A; Egorov, V V; Polyakov, D S; Iljin, V V; Shavlovsky, M M

    2016-01-01

    By means of spectrophotometric assay we investigated interaction of the dye Congo red (CR) with fibrils of model proteins--hen egg white lysozyme, recombinant human beta2-microglobulin (b2M) and recombinant human transthyretin (TTR). The commercial dye sample was found to contain a significant amount of impurities. Methods for the dye purification are disclosed and CR molar extinction coefficient at 490 nm (ε490) was determined to be 3.3 x 10(4) M(-1) x cm(-1) at pH above 6.0. Formation of the CR-fibril complex results in changes in the dye visible absorption spectrum. According to the data on titration of fibril solutions with excess of the dye, CR binds to lysozyme fibrils at a ratio of about 5 molecules per protein monomer within fibril structure, to b2M fibrils--about 4 molecules per monomer, to TTR fibrils--about 4 molecules per subunit of the protein. PMID:27228663

  18. Imaging of dialysis-related amyloid (AB-amyloid) deposits with sup 131 I-beta 2-microglobulin

    SciTech Connect

    Floege, J.; Burchert, W.; Brandis, A.; Gielow, P.; Nonnast-Daniel, B.; Spindler, E.; Hundeshagen, H.; Shaldon, S.; Koch, K.M. )

    1990-12-01

    The diagnosis of dialysis-related amyloid (AB-amyloid) has been based usually on clinical and radiological criteria. Following the discovery that beta 2-microglobulin was the major protein of this amyloid, we isolated and radiolabelled uremic plasma beta 2-microglobulin. After intravenous injection, gamma-camera images of selected joint areas were obtained from 42 patients who were on regular hemodialysis therapy. Positive scans involving the shoulder, hip, knee and carpal regions were found in 13 of 14 patients treated for more than 10 years and 10 of 16 patients treated for 5 to 10 years. Patients treated for less time had negative scans. Specificity was indicated by negative scans in non-amyloid inflammatory lesions in control hemodialysis patients. Up to 48-fold tracer enrichment was detected in excised AB-amyloid containing tissue as compared to amyloid-free tissue. These findings suggest that circulating radiolabelled beta 2-microglobulin is taken up by the amyloid deposits. This method may non-invasively detect tissue infiltrates of amyloid. It may also permit prospective evaluation of the efficacy of prophylactic dialysis strategies which are designed to prevent or delay the onset of this complication of long-term dialysis.

  19. Association Between Plasma Beta-2 Microglobulin Level and Cardiac Performance in Patients With Chronic Kidney Disease

    PubMed Central

    Sedighi, Omid; Abediankenari, Saeid; Omranifar, Batoul

    2014-01-01

    Background: Beta-2 microglobulin (B2M) is considered as a surrogate marker for middle molecule uremic toxins and a key component in dialysis-related amyloidosis. However, few studies have evaluated role of B2M in patients with chronic kidney disease (CKD). Objectives: The purpose of this study was to evaluate the association of plasma B2M level with some metabolic and cardiac performance factors in patients with CKD. Patients and Methods: In this case-control study, we measured plasma B2M level in 86 patients with different stages of CKD and 78 age- and sex-matched individuals, as healthy control group. Then we investigated the association between plasma B2M level and left ventricular hypertrophy, ejection fraction (EF), and left ventricular end-diastolic diameter (LVEDD) in echocardiography and some inflammatory and metabolic factors in patients with CKD. Results: Mean plasma B2M level was significantly higher in patients with CKD than in control group (P < 0.001). It was directly correlated with serum C-reactive protein (r = 0.167, P < 0.001), phosphate (r = 0.112, P < 0.001) levels, and left ventricular mass index (r = 0.438, P < 0.001) and LVEDD (r = 0.275, P < 0.001) in echocardiography. It was also inversely correlated with glomerular filtration rate (r = -0.033, P < 0.001), albumin (r = -0.521, P < 0.001), hemoglobin (r = -0.748, P < 0.001), and EF (r = -0.625, P < 0.001). Conclusions: Our findings suggested that plasma B2M level is inversely associated with GFR and EF and directly correlated with some metabolic and cardiac performance factors. PMID:25738124

  20. Pseudotumoral amyloidosis of beta 2-microglobulin origin in the buttock of a patient receiving long term haemodialysis.

    PubMed Central

    Fernández-Alonso, J; Rios-Camacho, C; Valenzuela-Castaño, A; Rocha-Castilla, J L

    1993-01-01

    A 52 year old man who had been receiving haemodialysis for 13 years, with a history of renal tuberculosis, right ischial tuberculous osteomyelitis, and dialysis arthropathy, developed a soft tissue tumour in his left buttock. Histological analysis, immunohistological staining, and electron microscopic examination of the surgically removed tumour showed massive deposits of beta 2-microglobulin (beta 2-M) amyloid. This case shows the expanding clinical spectrum of this type of amyloidosis, and it is suggested that amyloid infiltration should be considered in the differential diagnosis of gluteal tumours in these patients. Images PMID:8408708

  1. Structural model of the amyloid fibril formed by beta(2)-microglobulin #21-31 fragment based on vibrational spectroscopy.

    PubMed

    Hiramatsu, Hirotsugu; Goto, Yuji; Naiki, Hironobu; Kitagawa, Teizo

    2005-06-01

    A structural model of amyloid fibril formed by the #21-31 fragment of beta2-microglobulin is proposed from microscope IR measurements on specifically 13C-labeled peptide fibrils and Raman spectra of the dispersed fibril solution. The 13C-shifted amide frequency indicated the secondary structure of the labeled residues. The IR spectra have demonstrated that the region between F22 and V27 forms the core part with the extended beta-sheet structure. Raman spectra indicated the formation of a dimer with a disulfide bridge between C25 residues.

  2. Prevalence of anti-beta-2 microglobulin autoantibodies in sera of rheumatoid arthritis patients with extra-articular manifestations.

    PubMed Central

    Falus, A; Merétey, K; Bozsóky, S

    1981-01-01

    The frequency and concentration of specific factors binding beta 2 microglobulin were investigated in sera and synovial fluids of patients and in sera of normal controls. High anti-beta 2 m activity was detected in the sera of adult RA patients, particularly in those of with extra-articular disease. Similarly, anti-beta 2 m was present in the synovial fluids of RA but not of osteoarthrosis patients. Both the binding of anti-beta 2 m activity to the Sepharose staphylococcal protein A and its elution position in the second 'IgG' peak after Sephadex G-200 gel filtration suggest the antibody nature of the activity. The possibility of differences not only in titre but also in the specificity of heterologous and homologous anti-beta 2 m antibodies are discussed. PMID:6167213

  3. Effect of tetracyclines on the dynamics of formation and destructuration of beta2-microglobulin amyloid fibrils.

    PubMed

    Giorgetti, Sofia; Raimondi, Sara; Pagano, Katiuscia; Relini, Annalisa; Bucciantini, Monica; Corazza, Alessandra; Fogolari, Federico; Codutti, Luca; Salmona, Mario; Mangione, Palma; Colombo, Lino; De Luigi, Ada; Porcari, Riccardo; Gliozzi, Alessandra; Stefani, Massimo; Esposito, Gennaro; Bellotti, Vittorio; Stoppini, Monica

    2011-01-21

    The discovery of methods suitable for the conversion in vitro of native proteins into amyloid fibrils has shed light on the molecular basis of amyloidosis and has provided fundamental tools for drug discovery. We have studied the capacity of a small library of tetracycline analogues to modulate the formation or destructuration of β2-microglobulin fibrils. The inhibition of fibrillogenesis of the wild type protein was first established in the presence of 20% trifluoroethanol and confirmed under a more physiologic environment including heparin and collagen. The latter conditions were also used to study the highly amyloidogenic variant, P32G. The NMR analysis showed that doxycycline inhibits β2-microglobulin self-association and stabilizes the native-like species through fast exchange interactions involving specific regions of the protein. Cell viability assays demonstrated that the drug abolishes the natural cytotoxic activity of soluble β2-microglobulin, further strengthening a possible in vivo therapeutic exploitation of this drug. Doxycycline can disassemble preformed fibrils, but the IC(50) is 5-fold higher than that necessary for the inhibition of fibrillogenesis. Fibril destructuration is a dynamic and time-dependent process characterized by the early formation of cytotoxic protein aggregates that, in a few hours, convert into non-toxic insoluble material. The efficacy of doxycycline as a drug against dialysis-related amyloidosis would benefit from the ability of the drug to accumulate just in the skeletal system where amyloid is formed. In these tissues, the doxycycline concentration reaches values several folds higher than those resulting in inhibition of amyloidogenesis and amyloid destructuration in vitro. PMID:21068391

  4. Beta 2-microglobulin is not required for cell surface expression of the murine class I histocompatibility antigen H-2Db or of a truncated H-2Db.

    PubMed

    Allen, H; Fraser, J; Flyer, D; Calvin, S; Flavell, R

    1986-10-01

    beta 2-Microglobulin (beta 2m) has been thought essential for transport of all major histocompatibility complex class I antigens to the cell surface. Here, we show that the mouse class I antigen H-2Db is expressed at the cell surface even when there is no beta 2m present within the cell. This was established by transfecting the H-2Db gene into the R1E cell line, which lacks beta 2m. The conformation of the Db antigen expressed by the R1E transfectant is very different from that of the native molecule. This Db antigen is not recognized by Db-allospecific and Db-restricted cytotoxic T lymphocytes or by most monoclonal antibodies to the native Db. We show further that a deletion construct of the Db gene, which consists of exon 1 linked to exons 4-8, expresses a truncated Db antigen lacking domains 1 and 2 [Db-(1 + 2)] at the cell surface after transfection into the R1E line. Previous biochemical and crystallographic data have indicated that domain 3 is associated with beta 2m; unexpectedly, Db-(1 + 2) does not associate with beta 2m when the mouse beta 2mb gene is transfected into the R1E transfectant expressing the truncated Db. This suggests that interactions with domains 1 and 2 are important for the paired association of domain 3 and beta 2m in the native Db antigen.

  5. Mouse model to study human A beta2M amyloidosis: generation of a transgenic mouse with excessive expression of human beta2-microglobulin.

    PubMed

    Zhang, Pengyao; Fu, Xiaoying; Sawashita, Jinko; Yao, Junjie; Zhang, Beiru; Qian, Jinze; Tomozawa, Hiroshi; Mori, Masayuki; Ando, Yukio; Naiki, Hironobu; Higuchi, Keiichi

    2010-06-01

    Patients on long-term hemodialysis can develop dialysis-related amyloidosis (DRA) due to deposition of beta(2)-microglobulin (beta(2)m) into amyloid fibrils (Abeta(2)M). Despite intensive biochemical studies, the pathogenesis of amyloid deposition in DRA patients remains poorly understood. To elucidate the mechanisms that underlie Abeta(2)M fibril formation in DRA, we generated transgenic mice that overexpress human beta(2)m protein in a mouse beta(2)m gene knockout background (hB2MTg(+/+) mB2m(+/+)). The hB2MTg(+/+)mB2m(-/-) mice express a high level of human beta(2)m protein in many tissues as well as a high plasma beta(2)m concentration (192.8 mg/L). This concentration is >100 times higher than that observed in healthy humans and >4 times higher than that detected in patients on dialysis. We examined spontaneous and amyloid fibril-induced amyloid deposition in these mice. Amyloid deposition of beta(2)m protein was not observed in aged or amyloid fibril injected animals. However, mouse senile apolipoprotein A-II amyloidosis (AApoAII) was detected, particularly in the joints of mice that were injected with AApoAII amyloid fibrils. This study demonstrates that this mouse model could be valuable in studying the components and conditions that promote DRA, and indicates that high plasma concentrations of hbeta(2)m as well as seeding with pre-existing amyloid fibrils may not be sufficient to induce Abeta(2)M.

  6. 'Dialysis related arthropathy': a survey of 95 patients receiving chronic haemodialysis with special reference to beta 2 microglobulin related amyloidosis.

    PubMed Central

    Hurst, N P; van den Berg, R; Disney, A; Alcock, M; Albertyn, L; Green, M; Pascoe, V

    1989-01-01

    Ninety five patients receiving chronic haemodialysis (CHD) were surveyed to determine the prevalence of rheumatic disease and, where possible, its aetiology. At least three distinct rheumatic syndromes were identified--a group of patients with a syndrome consisting of large and medium joint synovial swelling, restricted hips and shoulders, tenosynovitis, carpal tunnel syndrome, and bone cysts due to deposition of beta 2 microglobulin related amyloid (AM beta 2m); a second group with erosive azotaemic osteoarthropathy; and a third group with age related degenerative disease of small, large, and axial joints. The data presented suggest that in patients receiving CHD (a) the prevalence of AM beta 2m deposition and the associated syndrome increases with duration of dialysis, but in patients who have been dialysed for more than 10 years the risk of developing AM beta 2m is related to age; (b) AM beta 2m deposition in subchondral cysts, but not synovium, causes joint destruction; also, AM beta 2m may be more prone to deposition in synovium of joints already damaged by other processes; (c) in the absence of synovial iron deposition synovial AM beta 2m is not associated with an inflammatory infiltrate; (d) hyperparathyroidism and perhaps other factors such as synovial iron deposition are probably more important than AM beta 2m as causes of peripheral joint degeneration and destructive spondyloarthropathy in patients receiving CHD. Images PMID:2658876

  7. Lacking prognostic significance of beta 2-microglobulin, MHC class I and class II antigen expression in breast carcinomas.

    PubMed Central

    Wintzer, H. O.; Benzing, M.; von Kleist, S.

    1990-01-01

    To evaluate the impact of MHC antigen expression on the survival of patients with cancer, 77 human breast carcinomas were investigated for the expression of beta 2-microglobulin (beta 2m), HLA-A,B,C and HLA-DR. Thirty-one benign breast tumours were stained for comparison. The results for the carcinomas were related to the survival data of the cancer patients. The expression of beta 2m, HLA-A,B,C and HLA-DR was significantly lower in malignant tumours compared to the benign lesions. Whereas all benign tumours were positive for beta 2m and HLA-A,B,C and 28/31 positive for HLA-DR the following positivity rates were found in carcinomas: 74/77 for beta 2m, 57/77 for HLA-A,B,C and 10/77 for HLA-DR. The follow-up (median 45 months) of 66 cancer patients for overall survival and of 65 patients for disease-free survival revealed no influence of beta 2m, HLA-A,B,C or HLA-DR expression on the prognosis of this cancer. In conclusion, experimental data indicating the importance of MHC antigens in anti-tumour responses are not confirmed by the analysis of cancer patient survival data. Images Figure 1 Figure 2 Figure 3 Figure 4 PMID:2201398

  8. Reassociation with beta 2-microglobulin is necessary for Db class I major histocompatibility complex binding of an exogenous influenza peptide.

    PubMed Central

    Rock, K L; Gamble, S; Rothstein, L; Benacerraf, B

    1991-01-01

    A synthetic peptide corresponding to residues 365-380 of the influenza nucleoprotein (NP365-380) has been previously shown to associate with class I major histocompatibility complex-encoded molecules and to stimulate cytotoxic T lymphocytes [Townsend, A. R. M., Rothbard, J., Gotch, F. M., Bahadur, G., Wraith, D. & McMichael, A. J. (1986) Cell 44, 959-968]. We find that intact Db class I heterodimers on the cell surface are unreceptive to binding this antigen. However, NP365-380 readily associates with Db molecules on the plasma membrane in the presence of exogenous beta 2-microglobulin. In addition, there is a second pathway through which this peptide associates with class I molecules that requires energy and de novo protein synthesis. These findings have implications for maintaining the immunological identity of cells and for the use of peptides as vaccines for priming cytolytic T-cell immunity. Images PMID:1986378

  9. Relationship of beta 2 microglobulin and CD4 counts to neuropsychological performance in HIV-1-infected intravenous drug users.

    PubMed

    Boccellari, A A; Chambers, D B; Dilley, J W; Shore, M D; Tauber, M A; Moss, A R; Osmond, D H

    1994-10-01

    This study explores the relationship of immune dysfunction to the neuropsychological performance of i.v. drug users (IVDUs) infected with HIV-1. Ninety-seven HIV-positive and 45 HIV-negative former IVDUs on methadone maintenance were evaluated using neuropsychological measures, physical examinations, and measures of immune function, including absolute CD4 counts and beta 2 microglobulin (beta 2-M). There were no significant differences between the HIV-positive and HIV-negative subjects on any single neuropsychological domain. There was, however, a significant group difference on a composite indicator of neuropsychological impairment, with 32% of HIV-positive subjects demonstrating some degree of overall impairment compared with only 13% of HIV-negative subjects. HIV-positive subjects were then stratified according to the Centers for Disease Control (CDC) symptom groupings: group II, asymptomatic, n = 29; group III, lymphadenopathy, n = 30; and group IV A or C-2, symptomatic, non-AIDS, n = 38. There were no significant neuropsychological differences among the three CDC groups. The HIV-positive subjects were also stratified on absolute CD4 counts (< or = 200, 201-400, and > 400) and beta 2-M (> or = 5, 3-5, and < 3). Individuals with greater immune compromise (CD4, < 200, beta 2-M, > or = 5) were more impaired on measures of motor functioning. beta 2-M was found to be a better predictor than CD4 count of impaired neuropsychological performance. Furthermore, individuals with beta 2-M values > or = 5 have more than a threefold increase in the incidence of neuropsychological impairment than those with beta 2-M values < 3.0. These results suggest that beta 2-M may serve as a useful clinical marker for the development of neuropsychological impairment and that the risk of such impairment increases as the immune system weakens.

  10. alpha1-Microglobulin as a promising marker of cadmium-induced tubular dysfunction, possibly better than beta2-microglobulin.

    PubMed

    Moriguchi, J; Ezaki, T; Tsukahara, T; Furuki, K; Fukui, Y; Okamoto, S; Ukai, H; Sakurai, H; Ikeda, M

    2004-03-14

    The purpose of the present study was to evaluate the validity of alpha1-microglobulin (alpha1-MG) in comparison with popularly used beta2-microglobulin (beta2-MG). A database on 8975 cases of never-smoking adult women was revisited; the data were based on spot urine samples from the women in 10 prefectures all over Japan. The validity of alpha1-MG was examined following essentially the same protocol as beta2-MG was examined in a previous study. Comparisons were made for alpha1-MG as observed (e.g. alpha1-MG(ob)), as corrected for creatinine (CR or cr) (e.g. alpha1-MGcr) and as corrected for a specific gravity (SG or sg) of 1.016 (e.g. alpha1-MGsg). A cut-off value of 5.0 mg alpha1-MG/g cr or l was deduced from 400 microg beta2-MG/g cr taking advantage of the regression equation between alpha1-MG and beta2-MG. The prevalence of alph1-microglobulinuria as corrected for a specific gravity of 1.016 (or alpha1-MGsg-uria in short) was essentially unchanged irrespective of SG, except for in very dense or very thin urine samples. alpha1-MGcr-uria prevalence decreased at higher CR. Comparison of the present observation with previous findings on beta2-MG-uria prevalence showed that the variation in prevalence of MG-uria as a function of urine density was smaller for alpha1-MGsg whereas it was substantially larger for beta2-MGcr, and thus it appeared prudent to consider alpha1-MGsg rather than beta2-MGcr as a marker of tubular dysfunction.

  11. Unusual association of beta 2-microglobulin with certain class I heavy chains of the murine major histocompatibility complex.

    PubMed Central

    Bushkin, Y; Tung, J S; Pinter, A; Michaelson, J; Boyse, E A

    1986-01-01

    Class I products of the major histocompatibility complex (MHC) comprise a heavy chain of about 45 kDa noncovalently linked to a 12-kDa beta 2-microglobulin (beta 2m) light chain encoded on a different chromosome. We find that class I products of some mouse strains include an additional 62-kDa molecule which on the following evidence consists of a heavy chain linked covalently with beta 2m. Production of the 62-kDa protein invariably accorded with the occurrence of cysteine at position 121 of the heavy chain (Kb,Kbm1,Kbm3,Dd, and Ld). Substitution of arginine at position 121 invariably accorded with absence of the 62-kDa protein (Kbm6,Kbm7,Kbm9,Kd, and Db). On the basis of observed production versus nonproduction of the 62-kDa molecule, predictions are made regarding residue 121 in class I products for which this is not yet known; namely, Kk, Ks, and Dk, which produce the 62-kDa molecule, as compared with Kj, Qa-2, and TL, which do not. Reported differences in immunologic reactivity between Kb mutant strains with Arg-121 in place of Cys-121 imply that the occurrence of 62-kDa class I products in mice of Cys-121 genotype has functional consequences. Images PMID:3510435

  12. Cellular expression or binding of desLys58-beta2 microglobulin is not dependent on the presence of the tri-molecular MHC class I complex.

    PubMed

    Wang, M; Corlin, D B; Heegaard, N H H; Claesson, M H; Nissen, M H

    2008-02-01

    The monoclonal antibody 332-01 is a newly developed antibody which specifically recognizes human desLys58-beta2 microglobulin (dbeta2m). In the present study, we characterized the binding of 332-01 to peripheral blood mononuclear cells (PBMC), a number of human leukaemic and monocytic cell lines, and beta2m gene-deleted murine lymphocytes. dbeta2m was found to be expressed on non-activated and activated monocytes. When cells were pre-exposed to dbeta2m, 332-01 also bound to non-activated T lymphocytes. dbeta2m was expressed on the monocytic cell lines U937 and TIB-202, and binding was significantly increased when cells were pre-incubated with dbeta2m and when TIB-202 cells were exposed to lipopolysaccharide. dbeta2m was also expressed on T leukaemic Jurkat cells as well as on low HLA-expressing erythroleukaemic K562 cells. beta2m gene-deleted murine splenocytes only bound 332-01 after pre-exposure to dbeta2m. Binding of 332-01 antibody could not be displaced by addition of high concentrations of native beta2m. In conclusion, our data indicate that dbeta2m - in contrast to native beta2m - binds to a hitherto unknown cell surface receptor independent of classical MHC class I molecules. As beta2m has previously been shown to display biological activities such as the induction of both growth promotion and apoptosis, C1 complement activity, shown to mediate cleavage of beta2m, could be involved in these processes.

  13. Serum and urinary beta-2-microglobulin among cadmium-exposed workers

    SciTech Connect

    Iwao, S.; Tsuchiya, K.; Sakurai, H.

    1980-06-01

    The effect of ten years' cadmium (Cd) exposure was investigated among a total of 18 workers (ten with previous heavy exposure, three with recent lower exposure and five control workers) by comparing indicators of previous exposure (blood and urinary Cd and ..beta..2-M) with clinical estimates of renal tubular function. The ten workers still excreted higher concentration of Cd than did the other three workers with low exposure, even after cessation of exposure. Estimates of renal function indicated that most workers among the ten and the three workers did not always exhibit dysfunction. Elevated blood Cd was significantly correlated with elevated serum ..beta..2-M. The study demonstrated that increased ..beta..2-M in urine is not necessarily due to tubular impairment, but may be the result of the increased ..beta..2-M in plasma exceeding the renal threshold.

  14. Unusual association of. beta. /sub 2/-microglobulin with certain class I heavy chains of the murine major histocompatibility complex

    SciTech Connect

    Bushkin, Y.; Tung, J.S.; Pinter, A.; Michaelson, J.; Boyse, E.A.

    1986-01-01

    Class I products of the major histocompatibility complex (MHC) comprise a heavy chain of about 45 kDa noncovalently linked to a 12-kDa ..beta../sub 2/-microglobulin (..beta../sub 2/m) light chain encoded on a different chromosome. The authors find that class I products of some mouse strains include an additional 62-kDa molecule which on the following evidence consists of a heavy chain linked covalently with ..beta../sub 2/m. Production of the 62-kDa protein invariably accorded with the occurrence of cysteine at position 121 of the heavy chain (K/sup b/, K/sup bm3/, D/sup d/, and L/sup d/). Substitution of arginine at position 121 invariably accorded with absence of the 62-kDa protein (K/sup bm6/, K/sup bm7/, K/sup bm9/, K/sup d/, and D/sup b/). On the basis of observed production versus nonproduction of the 62-kDa molecule, predictions are made regarding residue 121 in class I products for which this is not yet known; namely, K/sup k/, K/sup s/, and D/sup k/, which produce the 62-kDa molecule, as compared with K/sup j/, Qa-2, and TL, which do not. Reported differences in immunologic reactivity between K/sup b/ mutant strains with Arg-121 in place of Cys-121 imply that the occurrence of 62-kDa class I products in mice of Cys-121 genotype has functional consequences. Lymph node cells were labelled with (/sup 35/S)cysteine and Na/sup 125/I.

  15. Serum clara-cell protein and beta2-microglobulin as early markers of occupational exposure to nitric oxides.

    PubMed

    Hałatek, T; Gromadzińska, J; Wasowicz, W; Rydzyński, K

    2005-02-01

    Biochemical effects of NOx on 60 workers (both genders) of nitric acid production were studied. The control group consisted of 61 nonexposed people employed elsewhere in the plant. Although the actual threshold limit valuetime weighted averages (TLV-TWA) were not exceeded in the specific conditions of our study, the subjects were exposed to NO2 and NO during several exposure episodes with peak maximal concentrations of 140 ppm and 515 ppm, respectively. Additional cross-week evaluation of several biochemical biomarkers in 15 NOx-exposed workers from one shift was performed. The objective of the study was to evaluate the value of serum Clara-cell protein (CC16) as a marker of bronchoalveolar epithelium activity. Antioxidant status was assessed by measuring activity of enzymes: glutathione peroxidase (GSH-Px), ceruloplasmin (Cp) in plasma, or superoxide dismutase (SOD), gluthatione S-transferase (GST), and nonenzymatic alpha-tocopherol in erythrocytes and thiobarbituric acid-reactive substances (TBARS) in plasma. Serum hyaluronic acid (HA) determining the connective tissue matrix status of airways, and beta2-microglobulin in serum (beta2M-S) and urine (beta2M-U) as a marker of renal function in occupational exposure to NOx were also employed. Exposure to NOx initiates peroxidative chain depleting of lipoprotein pool (alpha-tocopherol) in blood. Serum CC16 levels in NOx-exposed workers were found to be closely connected with alpha-tocopherol content. In NOx-exposed workers, the beta2M-S level was significantly higher than in the nonexposed ones, with the exception of smokers. Results of the cross-week study confirm cumulative systemic effects of NOx on several examined biomarkers. SOD and GST were found to be depleted. A transient higher level of HA after a 5-d shift significantly inversely correlated with CC16 level. The data imply that NOx-depleted levels of CC16 are detectable already after an 8-h shift. Our results demonstrate that even low NOx human exposure can

  16. beta-2 Microglobulin values among human immunodeficiency virus (HIV)-negative, HIV-positive asymptomatic, and HIV-positive symptomatic Ugandans.

    PubMed Central

    Piwowar, E M; Tugume, S B; Grant, R M; Lutalo, T; Pattishall, K; Katongole-Mbidde, E

    1995-01-01

    Mean serum beta-2 microglobulin levels among healthy human immunodeficiency virus-seronegative and asymptomatic and symptomatic human immunodeficiency virus-seropositive Ugandans were found to be 2.35, 3.75, and 5.06 mg/liter, respectively (P < 0.001). The upper limit of the normal range (3.5 mg/liter) is higher in this African population than that reported elsewhere. PMID:7697536

  17. [Clinical usefulness of Beta2microglobulin in patients with Primary Sjögren Syndrome].

    PubMed

    Rozzatti, M S; Fontaneto, E; Pedano, V; Racca, A; Pelosso, M; Gobbi, C; Alba, P; Demarchi, M

    2015-01-01

    Las manifestaciones extranglandulares y desórdenes linfoproliferativos son complicaciones que pueden comprometer el curso benigno del Síndrome de Sjögren Primario (SSp). Existen escasos marcadores serológicos con comprobada utilidad para predecirlas y/o diagnosticarlas. Objetivos: Evaluar la utilidad de Beta2microglobulina (β2m) en pacientes con SSp y correlacionarlos con parámetros séricos predictivos de manifestaciones extraglandulares y enfermedades linfoproliferativas (Factor Reumatoideo (FR), Inmunoglobulinas séricas (Igs), C3 y C4). Materiales y métodos: Se realizó una revisión retrospectiva de historias clínicas de pacientes que consultaron en la Unidad de Reumatología del Hospital Córdoba desde enero de 2010 a octubre 2013 y que fueron derivados a la Sección de Inmunología del Servicio de Bioquímica para la determinación de pruebas de laboratorio . Los pacientes fueron clasificados de acuerdo a los Criterios Diagnósticos de patologías autoinmunes en pacientes con diagnóstico de SSp según el Grupo Consenso Americano-Europeo, otras enfermedades autoinmunes y los controles sanos. Se estudiaron las IgG, IgA e IgM, factores del complemento C3, C4 séricos y FR por inmunoturbidimetría y β2m por ELISA. Resultados: 19 pacientes con SSp (Grupo SSp), 28 pacientes con patologías autoinmunes distintas a SSp (Grupo PAD), y 24 controles sanos (Grupo C) fueron incluidos en este estudio. Se evidenció un aumento estadísticamente significativo de β2m en el Grupo SSp respecto al Grupo C (6.19mg/dl vs 2.53mg/dl p<0.001) y respecto al Grupo PAD (6.19 vs 4.38mg/dl p<0.01). En el grupo SSp se observó aumento estadísticamente significativo de IgA (p<0.05) y G (p<0.001) y disminución de C4 (p<0.05) respecto al Grupo C. No se observó correlación entre β2m y el resto de parámetros séricos determinados. Conclusión: β2m permitió discriminar pacientes con SSp de aquellos con otras patologías autoinmunes y sujetos sanos. El aumento de β2m en

  18. Usefulness of Beta2-Microglobulin as a Predictor of All-Cause and Nonculprit Lesion-Related Cardiovascular Events in Acute Coronary Syndromes (from the PROSPECT Study).

    PubMed

    Möckel, Martin; Muller, Reinhold; Searle, Julia; Slagman, Anna; De Bruyne, Bernard; Serruys, Patrick; Weisz, Giora; Xu, Ke; Holert, Fabian; Müller, Christian; Maehara, Akiko; Stone, Gregg W

    2015-10-01

    In the Providing Regional Observations to Study Predictors of Events in the Coronary Tree (PROSPECT) study, plaque burden, plaque composition, and minimal luminal area were associated with an increased risk of adverse cardiovascular events arising from untreated atherosclerotic lesions (vulnerable plaques) in patients with acute coronary syndromes (ACS). We sought to evaluate the utility of biomarker profiling and clinical risk factors to predict 3-year all-cause and nonculprit lesion-related major adverse cardiac events (MACEs). Of 697 patients who underwent successful percutaneous coronary intervention (PCI) for ACS, an array of 28 baseline biomarkers was analyzed. Median follow-up was 3.4 years. Beta2-microglobulin displayed the strongest predictive power of all variables assessed for all-cause and nonculprit lesion-related MACE. In a classification and regression tree analysis, patients with beta2-microglobulin >1.92 mg/L had an estimated 28.7% 3-year incidence of all-cause MACE; C-peptide <1.32 ng/ml was associated with a further increase in MACE to 51.2%. In a classification and regression tree analysis for untreated nonculprit lesion-related MACE, beta2-microglobulin >1.92 mg/L identified a cohort with a 3-year rate of 18.5%, and C-peptide <2.22 ng/ml was associated with a further increase to 25.5%. By multivariable analysis, beta2-microglobulin was the strongest predictor of all-cause and nonculprit MACE during follow-up. High-density lipoprotein (HDL), transferrin, and history of angina pectoris were also independent predictors of all-cause MACE, and HDL was an independent predictor of nonculprit MACE. In conclusion, in the PROSPECT study, beta2-microglobulin strongly predicted all-cause and nonculprit lesion-related MACE within 3 years after PCI in ACS. C-peptide and HDL provided further risk stratification to identify angiographically mild nonculprit lesions prone to future MACE.

  19. Usefulness of Beta2-Microglobulin as a Predictor of All-Cause and Nonculprit Lesion-Related Cardiovascular Events in Acute Coronary Syndromes (from the PROSPECT Study).

    PubMed

    Möckel, Martin; Muller, Reinhold; Searle, Julia; Slagman, Anna; De Bruyne, Bernard; Serruys, Patrick; Weisz, Giora; Xu, Ke; Holert, Fabian; Müller, Christian; Maehara, Akiko; Stone, Gregg W

    2015-10-01

    In the Providing Regional Observations to Study Predictors of Events in the Coronary Tree (PROSPECT) study, plaque burden, plaque composition, and minimal luminal area were associated with an increased risk of adverse cardiovascular events arising from untreated atherosclerotic lesions (vulnerable plaques) in patients with acute coronary syndromes (ACS). We sought to evaluate the utility of biomarker profiling and clinical risk factors to predict 3-year all-cause and nonculprit lesion-related major adverse cardiac events (MACEs). Of 697 patients who underwent successful percutaneous coronary intervention (PCI) for ACS, an array of 28 baseline biomarkers was analyzed. Median follow-up was 3.4 years. Beta2-microglobulin displayed the strongest predictive power of all variables assessed for all-cause and nonculprit lesion-related MACE. In a classification and regression tree analysis, patients with beta2-microglobulin >1.92 mg/L had an estimated 28.7% 3-year incidence of all-cause MACE; C-peptide <1.32 ng/ml was associated with a further increase in MACE to 51.2%. In a classification and regression tree analysis for untreated nonculprit lesion-related MACE, beta2-microglobulin >1.92 mg/L identified a cohort with a 3-year rate of 18.5%, and C-peptide <2.22 ng/ml was associated with a further increase to 25.5%. By multivariable analysis, beta2-microglobulin was the strongest predictor of all-cause and nonculprit MACE during follow-up. High-density lipoprotein (HDL), transferrin, and history of angina pectoris were also independent predictors of all-cause MACE, and HDL was an independent predictor of nonculprit MACE. In conclusion, in the PROSPECT study, beta2-microglobulin strongly predicted all-cause and nonculprit lesion-related MACE within 3 years after PCI in ACS. C-peptide and HDL provided further risk stratification to identify angiographically mild nonculprit lesions prone to future MACE. PMID:26254706

  20. Beta 2-microglobulin-, CD8+ T-cell-deficient mice survive inoculation with high doses of vaccinia virus and exhibit altered IgG responses.

    PubMed Central

    Spriggs, M K; Koller, B H; Sato, T; Morrissey, P J; Fanslow, W C; Smithies, O; Voice, R F; Widmer, M B; Maliszewski, C R

    1992-01-01

    Transgenic mice lacking an intact beta 2-microglobulin (beta 2m) gene fail to express major histocompatibility complex (MHC) class I proteins on the cell surface and, as a result, are virtually devoid of CD4- CD8+ lymphocytes. These animals provide a unique model system for directly assessing the role of CD8+ lymphocytes in the modulation of viral infection in vivo. beta 2m- CD8- mice and their normal littermates were inoculated at the base of the tail with the WR strain of vaccinia virus and monitored for serum antibody and lesion formation. Both groups developed similar lesions in response to a broad virus dose range, and all animals had completely recovered by day 28 after inoculation. Isotype-specific immunoglobulin levels were determined for each animal on day 7 and day 14 after primary inoculation, and again 7 days after a virus challenge. The virus-specific IgG1, IgG2a, and IgG2b levels were significantly different in the beta 2m-/- group (20-, 9-, and 30-fold lower, respectively, on day 7 after challenge) compared with the beta 2m+/- group. Virus-specific serum IgM levels for both groups remained similar throughout the experiment. In a separate experiment, beta 2m-/- mice were immunized with a nonviral antigen, 2,4,6-trinitrophenyl-conjugated keyhole limpet hemocyanin, and both total and antigen-specific isotype-specific immunoglobulin titers were determined. Total IgG1, IgG2a, IgG2b, and IgG3 tended to be lower overall in the beta 2m-/- mice compared with beta 2m+/- littermates. In contrast, total and antigen-specific IgE titers were similar in the two groups. These data indicate that CD8+ lymphocytes are not required to clear high doses of vaccinia virus, and they suggest that beta 2m-/- mice are less efficient at antigen-specific IgG production than their beta 2m+/- littermates. PMID:1631092

  1. Contributions of beta2-microglobulin-dependent molecules and lymphocytes to iron regulation: insights from HfeRag1(-/-) and beta2mRag1(-/-) double knock-out mice.

    PubMed

    Miranda, Carlos J; Makui, Hortence; Andrews, Nancy C; Santos, Manuela M

    2004-04-01

    Genetic causes of hereditary hemochromatosis (HH) include mutations in the HFE gene, coding for a beta2-microglobulin (beta2m)-associated major histocompatibility complex class I-like protein. However, iron accumulation in patients with HH can be highly variable. Previously, analysis of beta2mRag1(-/-) double-deficient mice, lacking all beta2m-dependent molecules and lymphocytes, demonstrated increased iron accumulation in the pancreas and heart compared with beta2m single knock-out mice. To evaluate whether the observed phenotype in beta2mRag1(-/-) mice was due solely to the absence of Hfe or to other beta2m-dependent molecules, we generated HfeRag1(-/-) double-deficient mice. Our studies revealed that introduction of Rag1 deficiency in Hfe knock-out mice leads to heightened iron overload, mainly in the liver, whereas the heart and pancreas are relatively spared compared with beta2mRag1(-/-) mice. These results suggest that other beta2m-interacting protein(s) may be involved in iron regulation and that in the absence of functional Hfe molecules lymphocyte numbers may influence iron overload severity.

  2. Major histocompatibility complex class I-specific and -restricted killing of beta 2-microglobulin-deficient cells by CD8+ cytotoxic T lymphocytes.

    PubMed Central

    Glas, R; Franksson, L; Ohlén, C; Höglund, P; Koller, B; Ljunggren, H G; Kärre, K

    1992-01-01

    Cytotoxic T lymphocytes (CTLs) recognize major histocompatibility complex (MHC) class I molecules, normally composed of a heavy chain, a beta 2-microglobulin (beta 2m), and peptide antigens. beta 2m is considered essential for the assembly and intracellular transport of MHC class I molecules as well as their peptide presentation to CTLs. Contrary to this dogma, we now report the generation of allospecific and restricted CD8+ and TCR alpha beta+ CTLs (where TCR is T-cell receptor) capable of killing beta 2m-deficient cells. Such CTLs were obtained by priming mice with live allogeneic beta 2m- spleen cells or mutant lymphoma cells producing MHC class I protein but no detectable beta 2m. Although both beta 2m- and beta 2m-expressing lymphoma cells were rejected in allogeneic mice, only the former were efficient inducers of CTLs recognizing beta 2m- cells. These CTLs were MHC class I (H-2Kb or Db)-specific and CD8-dependent and did not require serum as a source of external beta 2m in the culture. They could be induced across major and minor histocompatibility barriers. The H-2-restricted CTLs generated in the latter case failed to kill the antigen-processing-deficient target RMA-S cells. The results show that MHC class I heavy chains in beta 2m- cells can be transported to the cell surface and act as antigens or antigen-presenting molecules to allospecific and MHC-restricted CTLs. PMID:1454824

  3. Separation and characterisation of beta2-microglobulin folding conformers by ion-exchange liquid chromatography and ion-exchange liquid chromatography-mass spectrometry.

    PubMed

    Bertoletti, Laura; Regazzoni, Luca; Aldini, Giancarlo; Colombo, Raffaella; Abballe, Franco; Caccialanza, Gabriele; De Lorenzi, Ersilia

    2013-04-10

    In this work we present for the first time the use of ion-exchange liquid chromatography to separate the native form and a partially structured intermediate of the folding of the amyloidogenic protein beta2-microglobulin. Using a strong anion-exchange column that accounts for the differences in charge exposure of the two conformers, a LC-UV method is initially optimised in terms of mobile phase pH, composition and temperature. The preferred mobile phase conditions that afford useful information were found to be 35 mM ammonium formate, pH 7.4 at 25°C. The dynamic equilibrium of the two species is demonstrated upon increasing the concentration of acetonitrile in the protein sample. Then, the chromatographic method is transferred to MS detection and the respective charge state distributions of the separated conformers are identified. The LC-MS results demonstrate that one of the conformers is partially unfolded, compared with the native and more compact species. The correspondence with previous results obtained in free solution by capillary electrophoresis suggest that strong ion exchange LC-MS does not alter beta2-microglobulin conformation and maintains the dynamic equilibrium already observed between the native protein and its folding intermediate. PMID:23522119

  4. Antitumor effect of beta2-microglobulin in leukemic cell-bearing mice via apoptosis-inducing activity: activation of caspase-3 and nuclear factor-kappaB.

    PubMed

    Mori, M; Terui, Y; Tanaka, M; Tomizuka, H; Mishima, Y; Ikeda, M; Kasahara, T; Uwai, M; Ueda, M; Inoue, R; Itoh, T; Yamada, M; Hayasawa, H; Furukawa, Y; Ishizaka, Y; Ozawa, K; Hatake, K

    2001-06-01

    We have reported previously that beta2-microglobulin (beta2m) induces apoptosis in leukemic cells in vitro, and that an interaction between beta2m and HLA class I antigen induces apoptosis. Here we examined whether beta2m can induce apoptosis in leukemic cells in vivo and whether it has an antitumor effect in tumor-bearing mice. Daily administration of 50 or 250 microg of beta2m induced apoptosis and an antitumor effect on K562 leukemia cell-bearing mice in the same manner as tumor necrosis factor-alpha. In tumor tissues in beta2m-treated mice, both caspase-3 and nuclear factor-kappaB (NF-kappaB) were stained more strongly than in control mice by anti-caspase-3 and anti-NF-kappaB p65/Rel A polyclonal antibodies. We also observed the in vivo immunological effects of beta2m on lymphoid and hematopoietic organs, such as thymus, bone marrow, Peyer's patches, liver, and spleen in normal mice. Using antibodies against caspase-3 and NF-kappaB, immunohistochemical staining showed that no specific tissues were damaged or stained in normal mice. We conclude that beta2m stimulates caspase-3 and NF-kappaB pathways to induce apoptosis, making it a useful approach to a new therapy for leukemia.

  5. Internalization of coxsackievirus A9 is mediated by {beta}2-microglobulin, dynamin, and Arf6 but not by caveolin-1 or clathrin.

    PubMed

    Heikkilä, Outi; Susi, Petri; Tevaluoto, Tuire; Härmä, Heidi; Marjomäki, Varpu; Hyypiä, Timo; Kiljunen, Saija

    2010-04-01

    Coxsackievirus A9 (CAV9) is a member of the human enterovirus B species within the Enterovirus genus of the family Picornaviridae. It has been shown to utilize alphaV integrins, particularly alphaVbeta6, as its receptors. The endocytic pathway by which CAV9 enters human cells after the initial attachment to the cell surface has so far been unknown. Here, we present a systematic study concerning the internalization mechanism of CAV9 to A549 human lung carcinoma cells. The small interfering RNA (siRNA) silencing of integrin beta6 subunit inhibited virus proliferation, confirming that alphaVbeta6 mediates the CAV9 infection. However, siRNAs against integrin-linked signaling molecules, such as Src, Fyn, RhoA, phosphatidylinositol 3-kinase, and Akt1, did not reduce CAV9 proliferation, suggesting that the internalization of the virus does not involve integrin-linked signaling events. CAV9 endocytosis was independent of clathrin or caveolin-1 but was restrained by dynasore, an inhibitor of dynamin. The RNA interference silencing of beta2-microglobulin efficiently inhibited virus infection and caused CAV9 to accumulate on the cell surface. Furthermore, CAV9 infection was found to depend on Arf6 as both silencing of this molecule by siRNA and the expression of a dominant negative construct resulted in decreased virus infection. In conclusion, the internalization of CAV9 to A549 cells follows an endocytic pathway that is dependent on integrin alphaVbeta6, beta2-microglobulin, dynamin, and Arf6 but independent of clathrin and caveolin-1.

  6. The haemochromatosis protein HFE induces an apparent iron-deficient phenotype in H1299 cells that is not corrected by co-expression of beta 2-microglobulin.

    PubMed

    Wang, Jian; Chen, Guohua; Pantopoulos, Kostas

    2003-03-15

    HFE, an atypical MHC class I type molecule, has a critical, yet still elusive function in the regulation of systemic iron metabolism. HFE mutations are linked to hereditary haemochromatosis type 1, a common autosomal recessive disorder of iron overload. Most patients are homozygous for a C282Y point mutation that abrogates the interaction of HFE with beta(2)-microglobulin (beta(2)M) and, thus, impairs its proper processing and expression on the cell surface. An H63D substitution is also associated with disease. To investigate the function of HFE we have generated clones of human H1299 lung cancer cells that express wild-type, C282Y or H63D HFE under the control of a tetracycline-inducible promoter. Consistent with earlier observations in other cell lines, the expression of wild-type or H63D, but not C282Y, HFE induces an apparent iron-deficient phenotype, manifested in the activation of iron-regulatory protein and concomitant increase in transferrin receptor levels and decrease in ferritin content. This phenotype persists in cells expressing wild-type HFE after transfection with a beta(2)M cDNA. Whereas endogenous beta(2)M is sufficient for the presentation of at least a fraction of chimeric HFE on the cell surface, this effect is stimulated by approx. 2.8-fold in beta(2)M transfectants. The co-expression of exogenous beta(2)M does not significantly affect the half-life of HFE. These results suggest that the apparent iron-deficient phenotype elicited by HFE is not linked to beta(2)M insufficiency.

  7. The CD8+ T cell repertoire in beta 2-microglobulin-deficient mice is biased towards reactivity against self-major histocompatibility class I

    PubMed Central

    1994-01-01

    Beta 2-Microglobulin-deficient (beta 2m -/-) mice are reported to lack cell surface expression of major histocompatibility complex (MHC) class I molecules, CD8+ T cells, and the ability to mount MHC class I- specific T cell responses. We have observed that beta 2m -/- mice possess CD8+ T cells that can be induced to perform strong allospecific cytotoxic responses against nonself-MHC class I by in vivo priming. We report that these beta 2m -/- cytotoxic T lymphocyte (CTL) differ from those induced in beta 2m-positive littermates in that they cross-react and kill cells expressing self-MHC class I at normal ligand density with beta 2m. beta 2m -/- CTL could even be induced in primary mixed lymphocyte culture by self-MHC class I expressing stimulator cells, whereas allogeneic stimulator cells failed to elicit a response under similar conditions. Cells with a reduced cell surface MHC class I expression were less sensitive, while syngeneic beta 2m -/- cells were resistant to the beta 2m -/- CTL. This antiself-MHC reactivity could not be induced when beta 2m -/- T cells matured in an environment with normal MHC class I expression in bone marrow chimeric mice. Antiself- MHC reactivity was also observed against human peptide loading- deficient cells expressing the appropriate murine class I molecules, suggesting that affinity to self-MHC class I may occur irrespective of peptide content. The results fit with a model where positive and negative selection of CD8+ T cells in beta 2m -/- mice is mediated by low levels of MHC class I free heavy chains. In this model, low ligand density on selecting cells leads to positive selection of rare T cells that bind to low levels of MHC class I free heavy chains, resulting in a very small peripheral CD8+ compartment. Due to low density of the selecting ligand, negative selection does not remove T cells recognizing beta 2m-positive cells expressing self-MHC class I at normal ligand density, which generates a T cell repertoire that would

  8. Influence of beta 2-microglobulin expression on gamma interferon secretion and target cell lysis by intraepithelial lymphocytes during intestinal Listeria monocytogenes infection.

    PubMed Central

    Emoto, M; Neuhaus, O; Emoto, Y; Kaufmann, S H

    1996-01-01

    Numerous microbial pathogens, including Listeria monocytogenes, enter the host through the intestine. Although relatively little is known about the biological functions of intestinal intraepithelial lymphocytes (i-IEL), they are generally considered a first line of defense against intestinal infections. In the mouse, the vast majority of i-IEL express the CD8 coreceptor either as a CD8 alpha/alpha homodimer or as a CD8 alpha/beta heterodimer. The CD8 receptor of T-cell receptor TcR gamma/delta i-IEL is exclusively homodimeric, whereas the CD8-expressing TcR alpha/beta i-IEL segregate into equal fractions of CD8 alpha/alpha and CD8 alpha/beta cells. We infected beta 2-microglobulin (beta 2m)+/- mice (possessing all i-IEL populations) and beta 2m -/- mutant mice (lacking all CD8 alpha/beta + i-IEL and having few CD8 alpha/alpha + TcR alpha/beta i-IEL) with L. monocytogenes per os and determined their biological functions after TcR ligation with monoclonal antibodies. Cytolytic activities of TcR alpha/beta and TcR gamma/delta i-IEL from beta 2m +/- mice were not influenced by intestinal listeriosis. Cytolytic activities of TcR alpha/beta i-IEL were impaired in uninfected beta 2m -/- mice, but this reduction was reestablished as a consequence of intestinal listeriosis. Frequencies of gamma interferon (IFN-gamma)-producing TcR alpha/beta i-IEL in uninfected beta 2m -/- mice were reduced, compared with that in their heterozygous controls. Equally low frequencies of IFN-gamma-producing TcR gamma/delta i-IEL in beta 2M +/- and beta 2m-/- mutants were found. Listeriosis increased frequencies of INF-gamma-producing TcR alpha/beta and TcR gamma/delta i-IEL in both mouse strains. Most remarkably, the proportion of IFN-gamma-producing TcR gamma/delta i-IEL was elevated 10-fold in listeria-infected beta 2M -/- mice. Our findings show that the beta 2m-independent CD8 beta- i-IEL expressing either TcR alpha/beta or TcR gamma/delta are stimulated by intestinal listeriosis

  9. Modified human beta 2-microglobulin (desLys(58)) displays decreased affinity for the heavy chain of MHC class I and induces nitric oxide production and apoptosis.

    PubMed

    Wang, M; Harhaji, L; Lamberth, K; Harndahl, M; Buus, S; Heegaard, N H H; Claesson, M H; Nissen, M H

    2009-03-01

    Beta2-microglobulin (beta2m) is the light chain of major histocompatibility complex class I (MHC-I) molecules, and is a prerequisite for the binding of peptides to the heavy chain and their presentation to CD8+ T cells. beta2m can be modified in vivo and in vitro by proteolytic cleavage by complement C1 and subsequent carboxypeptidase B-like activity--processes that lead to the generation of desLys(58) beta2m (dbeta2m). This work aims to study the effect of dbeta2m on peptide binding to MHC-I, the influence of dbeta2m on the binding of beta2m to the MHC-I heavy chain and the biological activity of dbeta2m. Both beta2m and dbeta2m are able to support the generation of MHC-I/peptide complexes at 18 degrees C, but complexes formed in the presence of dbeta2m destabilize at 37 degrees C. Moreover, a 250 times higher concentration of dbeta2m than of beta2m is needed to displace MHC-I associated beta2m from the cell surface. In addition, only beta2m is able to restore MHC-I/peptide complex formation on acid-treated cells whereas dbeta2m appears to bind preferentially to denatured MHC-I heavy chains. In cell cultures, exogenously added dbeta2m, but not beta2m, induces apoptotic cell death in monocytic leukaemic cell lines but spares other kinds of leukaemic cells. Additionally, the presence of dbeta2m, and to a lesser extent beta2m, enhances IFN-gamma-induced NO production by monocytic leukaemic cells. In conclusion, these data show that dbeta2m is not able to support the formation of a stable tri-molecular MHC-I complex at physiological temperature and that dbeta2m exerts other biological functions compared to beta2m when bound to cells.

  10. Interferon-gamma is a strong modulator of NK susceptibility and expression of beta 2-microglobulin but not of transferrin receptors of K562 cells.

    PubMed

    Grönberg, A; Kiessling, R; Fiers, W

    1985-10-01

    The human cell line K562 was treated with human natural leukocyte interferon (IFN-alpha) and recombinant immune interferon (IFN-gamma). Cell cultures exposed to both types of IFNs displayed a reduced susceptibility to the cytotoxic activity of human PBL (NK activity). While this effect occurred preferentially at high doses of IFN-alpha, as little as 10 U/ml of IFN-gamma caused a marked decrease in susceptibility to NK-cell-mediated lysis. Using a monoclonal antibody against human beta2-microglobulin (beta2M) a low level of specific binding to K562 cells was detected. The binding increased after treatment with IFN-alpha (1.4-fold) and IFN-gamma (1.7-fold). The expression of transferrin receptors (TR) was not changed significantly. A hybrid cell line between K562 and a Burkitt's lymphoma-derived cell line displayed a similar pattern of response to IFN-alpha and IFN-gamma as did K562, when effects on NK susceptibility, beta2M expression, and TR expression were studied. The Burkitt's lymphoma line PUT showed no consistent changes in expression of beta2M and TR. These results demonstrate that IFN-gamma is highly efficient in modulating the NK susceptibility, and the expression of beta2M on K562. The presented data do not support a role for expression of TR as the only property that determines the degree of NK susceptibility, since there was no correlation between NK susceptibility and TR expression among the cell lines tested or when IFN-treated and untreated cells were compared.

  11. Peptide-beta2-microglobulin-major histocompatibility complex expressing cells are potent antigen-presenting cells that can generate specific T cells.

    PubMed

    Obermann, Sonja; Petrykowska, Susanne; Manns, Michael P; Korangy, Firouzeh; Greten, Tim F

    2007-09-01

    Adoptive T-cell therapy represents a promising therapeutic approach for the treatment of cancer. Successful adoptive immunotherapy depends on the ex vivo priming and expansion of antigen-specific T cells. However, the in vitro generation of adequate numbers of functional antigen-specific T cell remains a major obstacle. It is important to develop efficient and reproducible methods to generate high numbers of antigen-specific T cells for adoptive T-cell transfer. We have developed a new artificial antigen-presenting cell (aAPC) by transfection of major histocompatibility (MHC) class I negative Daudi cells with a peptide-beta2-microglobulin-MHC fusion construct (single-chain aAPC) ensuring presentation of the peptide-MHC complex of interest. Using this artificial antigen-presenting cell, we could generate up to 9.2 x 10(8) antigen-specific cytotoxic CD8(+) T cells from 10 ml blood. In vitro generated T cells lysed endogenously presented antigens. Direct comparison of the single-chain aAPC with autologous monocyte-derived dendritic cells demonstrated that these cells were equally efficient in stimulation of T cells. Finally, we were able to generate antigen-specific T cell lines from perpheral blood mononuclear cells of patients receiving cytotoxic chemotherapy. The use of single-chain aAPC represent a promising option for the generation of antigen-specific CD8(+) T cells, which could be used for adoptive T-cell therapy.

  12. [The dynamic level of beta 2-microglobulin, the basic lipid peroxidation indices and middle molecules in the blood and urine in patients with acute calculous pyelonephritis against a background of endovascular helium-neon laser therapy].

    PubMed

    Safafov, R M; Ianenko, E K; Nikitinskaia, L P; Golovanov, S A; Drozhzheva, V V; Kon'kova, T A; Danilkov, A P

    1997-01-01

    The authors present the effect of intravenous He-Ne laser therapy on the changes in beta 2-microglobulin, lipid peroxidation, middle-size molecules in the blood and urine of patients with acute calculous pyelonephritis. Endovascular He-Ne laser therapy was found an effective treatment of acute calculous pyelonephritis. The authors propose to combine hemosorption with endovascular He-Ne laser radiation. PMID:9123656

  13. Suppression of natural killer cell activity by rabbit antibody to human beta 2-microglobulin (beta 2m) is an Fc-mediated phenomenon and is not beta 2m specific.

    PubMed

    Jones, R A; Richards, S J; Patel, D; Scott, C S

    1991-07-01

    Natural killer (NK) cell cytotoxicity constitutes an important component of the host immune defence system. The NK effector cell has been relatively well defined in terms of immunophenotypic characteristics, but in contrast to the functional T-cell receptor molecule associated with major histocompatibility complex (MHC)-restricted cytotoxic activity, the NK cell receptor has not to date been defined. However, several studies have suggested that the beta 2-microglobulin (beta 2m) molecule is functionally associated with NK cell activity. Using various heterospecific and monoclonal antibodies, this study has shown that intact rabbit IgG antibody bound either directly or indirectly to peripheral mononuclear cell (PMNC) effector populations significantly reduced their lytic activity against K562 targets. Substitution of F(ab)2 fragments for rabbit IgG antibodies, or the use of monoclonal antibodies alone, failed to reduce peripheral blood mononuclear cell (PMNC) lytic activity. Addition of non-NK cell components labelled with rabbit anti-beta 2m to purified NK-enriched effector cell populations also suppressed K562 lysis. In contrast, pre-treatment of a NK-enriched PMNC fraction with rabbit anti-beta 2m enhanced target lysis. These results strongly suggest that antibody-induced suppression of PMNC NK activity is mediated via rabbit Fc attached to co-existing non-NK cells in the mononuclear fraction, and are inconsistent with the previously suggested functional association between NK activity and membrane beta 2m.

  14. The ESAT-6 protein of Mycobacterium tuberculosis interacts with beta-2-microglobulin (β2M) affecting antigen presentation function of macrophage.

    PubMed

    Sreejit, Gopalkrishna; Ahmed, Asma; Parveen, Nazia; Jha, Vishwanath; Valluri, Vijaya Lakshmi; Ghosh, Sudip; Mukhopadhyay, Sangita

    2014-10-01

    ESAT-6, an abundantly secreted protein of Mycobacterium tuberculosis (M. tuberculosis) is an important virulence factor, inactivation of which leads to reduced virulence of M. tuberculosis. ESAT-6 alone, or in complex with its chaperone CFP-10 (ESAT-6:CFP-10), is known to modulate host immune responses; however, the detailed mechanisms are not well understood. The structure of ESAT-6 or ESAT-6:CFP-10 complex does not suggest presence of enzymatic or DNA-binding activities. Therefore, we hypothesized that the crucial role played by ESAT-6 in the virulence of mycobacteria could be due to its interaction with some host cellular factors. Using a yeast two-hybrid screening, we identified that ESAT-6 interacts with the host protein beta-2-microglobulin (β2M), which was further confirmed by other assays, like GST pull down, co-immunoprecipitation and surface plasmon resonance. The C-terminal six amino acid residues (90-95) of ESAT-6 were found to be essential for this interaction. ESAT-6, in complex with CFP-10, also interacts with β2M. We found that ESAT-6/ESAT-6:CFP-10 can enter into the endoplasmic reticulum where it sequesters β2M to inhibit cell surface expression of MHC-I-β2M complexes, resulting in downregulation of class I-mediated antigen presentation. Interestingly, the ESAT-6:β2M complex could be detected in pleural biopsies of individuals suffering from pleural tuberculosis. Our data highlight a novel mechanism by which M. tuberculosis may undermine the host adaptive immune responses to establish a successful infection. Identification of such novel interactions may help us in designing small molecule inhibitors as well as effective vaccine design against tuberculosis. PMID:25356553

  15. The ESAT-6 Protein of Mycobacterium tuberculosis Interacts with Beta-2-Microglobulin (β2M) Affecting Antigen Presentation Function of Macrophage

    PubMed Central

    Parveen, Nazia; Jha, Vishwanath; Valluri, Vijaya Lakshmi; Ghosh, Sudip; Mukhopadhyay, Sangita

    2014-01-01

    ESAT-6, an abundantly secreted protein of Mycobacterium tuberculosis (M. tuberculosis) is an important virulence factor, inactivation of which leads to reduced virulence of M. tuberculosis. ESAT-6 alone, or in complex with its chaperone CFP-10 (ESAT-6:CFP-10), is known to modulate host immune responses; however, the detailed mechanisms are not well understood. The structure of ESAT-6 or ESAT-6:CFP-10 complex does not suggest presence of enzymatic or DNA-binding activities. Therefore, we hypothesized that the crucial role played by ESAT-6 in the virulence of mycobacteria could be due to its interaction with some host cellular factors. Using a yeast two-hybrid screening, we identified that ESAT-6 interacts with the host protein beta-2-microglobulin (β2M), which was further confirmed by other assays, like GST pull down, co-immunoprecipitation and surface plasmon resonance. The C-terminal six amino acid residues (90–95) of ESAT-6 were found to be essential for this interaction. ESAT-6, in complex with CFP-10, also interacts with β2M. We found that ESAT-6/ESAT-6:CFP-10 can enter into the endoplasmic reticulum where it sequesters β2M to inhibit cell surface expression of MHC-I-β2M complexes, resulting in downregulation of class I-mediated antigen presentation. Interestingly, the ESAT-6:β2M complex could be detected in pleural biopsies of individuals suffering from pleural tuberculosis. Our data highlight a novel mechanism by which M. tuberculosis may undermine the host adaptive immune responses to establish a successful infection. Identification of such novel interactions may help us in designing small molecule inhibitors as well as effective vaccine design against tuberculosis. PMID:25356553

  16. Revisiting the Middle Molecule Hypothesis of Uremic Toxicity: A Systematic Review of Beta 2 Microglobulin Population Kinetics and Large Scale Modeling of Hemodialysis Trials In Silico

    PubMed Central

    Roumelioti, Maria Eleni; Nolin, Thomas; Unruh, Mark L.; Argyropoulos, Christos

    2016-01-01

    Background Beta-2 Microglobulin (β2M) is a prototypical “middle molecule” uremic toxin that has been associated with a higher risk of death in hemodialysis patients. A quantitative description of the relative importance of factors determining β2M concentrations among patients with impaired kidney function is currently lacking. Methods Herein we undertook a systematic review of existing studies reporting patient level data concerning generation, elimination and distribution of β2M in order to develop a population model of β2M kinetics. We used this model and previously determined relationships between predialysis β2M concentration and survival, to simulate the population distribution of predialysis β2M and the associated relative risk (RR) of death in patients receiving conventional thrice-weekly hemodialysis with low flux (LF) and high flux (HF) dialyzers, short (SD) and long daily (LD) HF hemodialysis sessions and on-line hemodiafiltration at different levels of residual renal function (RRF). Results We identified 9 studies of 106 individuals and 156 evaluations of or more compartmental kinetic parameters of β2M. These studies used a variety of experimental methods to determine β2M kinetics ranging from isotopic dilution to profiling of intra/inter dialytic concentration changes. Most of the patients (74/106) were on dialysis with minimal RRF, thus facilitating the estimation of non-renal elimination kinetics of β2M. In large scale (N = 10000) simulations of individuals drawn from the population of β2M kinetic parameters, we found that, higher dialytic removal materially affects β2M exposures only when RRF (renal clearance of β2M) was below 2 ml/min. In patients initiating conventional HF hemodialysis, total loss of RRF was predicted to be associated with a RR of death of more than 20%. Hemodiafiltration and daily dialysis may decrease the high risk of death of anuric patients by 10% relative to conventional, thrice weekly HF dialysis. Only daily

  17. [Effect of interferon on human cell lines which do not express class I transplantation antigens: K 562 and Daudi. Presence of a pseudo-messenger RNA of beta 2-microglobulin in Daudi cell line].

    PubMed

    Rosa, F; Fellous, M

    1982-10-11

    Human alpha and beta interferons increase the rate of class I human MHC antigens mRNA HLA-A, B, C and beta 2-microglobulin (beta 2m) in most human cells studied so far. The present work studies the effect of those interferons upon cell lines which do not express class I antigen on their membrane: K 562 et Daudi. If beta 2m mRNA is enhanced in K 562 cell by both alpha and beta interferons, those interferons are not able to promote the de novo synthesis of HLA-A, B, c mRNA, which is not detectable in this cell line. On the other hand, HLA-A, B, C mRNA, which is present in Daudi cell, is amplified by both alpha and beta interferons. Furthermore, we could show that, if it has not been possible to detect mature beta 2m protein either in the cytoplasm or on Daudi membrane, there is a poly A+ RNA in it, which hybridizes with a cDNA probe specific for beta 2m.

  18. Estimation of benchmark dose as the threshold levels of urinary cadmium, based on excretion of total protein, {beta} {sub 2}-microglobulin, and N-acetyl-{beta}-D-glucosaminidase in cadmium nonpolluted regions in Japan

    SciTech Connect

    Kobayashi, Etsuko . E-mail: ekoba@faculty.chiba-u.jp; Suwazono, Yasushi; Uetani, Mirei; Inaba, Takeya; Oishi, Mitsuhiro; Kido, Teruhiko; Nishijo, Muneko; Nakagawa, Hideaki; Nogawa, Koji

    2006-07-15

    Previously, we investigated the association between urinary cadmium (Cd) concentration and indicators of renal dysfunction, including total protein, {beta} {sub 2}-microglobulin ({beta} {sub 2}-MG), and N-acetyl-{beta}-D-glucosaminidase (NAG). In 2778 inhabitants {>=}50 years of age (1114 men, 1664 women) in three different Cd nonpolluted areas in Japan, we showed that a dose-response relationship existed between renal effects and Cd exposure in the general environment without any known Cd pollution. However, we could not estimate the threshold levels of urinary Cd at that time. In the present study, we estimated the threshold levels of urinary Cd as the benchmark dose low (BMDL) using the benchmark dose (BMD) approach. Urinary Cd excretion was divided into 10 categories, and an abnormality rate was calculated for each. Cut-off values for urinary substances were defined as corresponding to the 84% and 95% upper limit values of the target population who have not smoked. Then we calculated the BMD and BMDL using a log-logistic model. The values of BMD and BMDL for all urinary substances could be calculated. The BMDL for the 84% cut-off value of {beta} {sub 2}-MG, setting an abnormal value at 5%, was 2.4 {mu}g/g creatinine (cr) in men and 3.3 {mu}g/g cr in women. In conclusion, the present study demonstrated that the threshold level of urinary Cd could be estimated in people living in the general environment without any known Cd-pollution in Japan, and the value was inferred to be almost the same as that in Belgium, Sweden, and China.

  19. Structural Analysis of H2-Db Class I Molecules Containing Two Different Allelic Forms of the type 1 Diabetes Susceptibility Factor beta-2 Microglobulin: Implications for the Mechanism Underlying Viriations in Antigen Presentation

    SciTech Connect

    Roden,M.; Brims, D.; Fedorov, A.; DiLorenzo, T.; Almo, S.; Nathenson, s.; Anovitz, L.; Wesolowski, D.

    2006-01-01

    Beta-2 microglobulin ({beta}2m) is a member of the immunoglobulin-like domain superfamily that is an essential structural subunit of the MHC class I (MHC-I) molecule. {beta}2m was previously identified as a susceptibility factor for the development of type 1 diabetes (T1D) in NOD mice, whereby transgenic expression of the {beta}2m{sup a} variant, but not the {beta}2mb variant, restored diabetes susceptibility to normally resistant NOD.{beta}2m{sup null} mice. Here we report the crystal structures and thermodynamic stabilities of the NOD MHC-I molecule H2-D{sup b} containing these two variants. Our results reveal subtle differences in the structures of the {beta}2m variants, namely in minor loop shifts and in variations in the hydrogen bonding networks at the interfaces between the components of the ternary complex. We also demonstrate that the thermodynamic stabilities of the {beta}2m variants in isolation differ. However, the conformation of the peptide in the MHC cleft is unchanged in {beta}2m allelic Db complexes, as are the TCR recognition surfaces. Thus, despite modest structural differences between allelic complexes, the evidence indicates that D{sup b} peptide presentation of the representative peptide is unchanged in the context of either {beta}2m allelic variant. These data suggest that other mechanisms, such as differential association of MHC-I in multiprotein complexes, are likely responsible for the effect of {beta}2m on T1D development.

  20. The relationship between concentrations of magnesium and oxidized low-density lipoprotein and Beta2-microglobulin in the serum of patients on the end-stage of renal disease.

    PubMed

    Raikou, Vaia D; Kyriaki, Despina

    2016-05-01

    The end-stage of renal disease is associated with increased oxidative stress and oxidative modification of low-density lipoproteins (LDLs). Beta2 microglobulin (beta2M) is accumulated in the serum of dialysis patients. Magnesium (Mg) plays a protective role in the development of oxidative stress in healthy subjects. We studied the relationship between concentrations of magnesium and oxidized LDL (ox-LDL) and beta2M in the serum of patients on the end stage of renal disease. In 96 patients on on-line- predilution hemodiafiltration, beta2M and intact parathormone were measured by radioimmunoassays. High-sensitivity C-reactive protein (hsCRP) and ox-LDL were measured using ΕLISA. Serum bicarbonate levels were measured in the blood gas analyser gas machine. We performed logistic regression analysis models to investigate Mg as an important independent predictor of elevated ox-LDL and high beta2M serum concentrations, after adjustment to traditional and specific for dialysis patients' factors. We observed a positive correlation of Mg with ox-LDL (r = 0.383, P = 0.001), but the association of Mg with beta2M, hsCRP, and serum bicarbonate levels was significantly inverse (r = -0.252, P = 0.01, r = -0.292, P = 0.004, and r = -0.282, P = 0.04 respectively). The built logistic-regression analysis showed that Mg act as a significant independent factor for the elevated ox-LDL and beta2M serum concentrations adjusting to traditional and specific factors for these patients. We observed a positive relationship between magnesium and acidosis status- related ox-LDL concentrations, but the inverse association between magnesium and beta2M serum concentrations in hemodialysis patients.

  1. The relationship between concentrations of magnesium and oxidized low-density lipoprotein and Beta2-microglobulin in the serum of patients on the end-stage of renal disease.

    PubMed

    Raikou, Vaia D; Kyriaki, Despina

    2016-05-01

    The end-stage of renal disease is associated with increased oxidative stress and oxidative modification of low-density lipoproteins (LDLs). Beta2 microglobulin (beta2M) is accumulated in the serum of dialysis patients. Magnesium (Mg) plays a protective role in the development of oxidative stress in healthy subjects. We studied the relationship between concentrations of magnesium and oxidized LDL (ox-LDL) and beta2M in the serum of patients on the end stage of renal disease. In 96 patients on on-line- predilution hemodiafiltration, beta2M and intact parathormone were measured by radioimmunoassays. High-sensitivity C-reactive protein (hsCRP) and ox-LDL were measured using ΕLISA. Serum bicarbonate levels were measured in the blood gas analyser gas machine. We performed logistic regression analysis models to investigate Mg as an important independent predictor of elevated ox-LDL and high beta2M serum concentrations, after adjustment to traditional and specific for dialysis patients' factors. We observed a positive correlation of Mg with ox-LDL (r = 0.383, P = 0.001), but the association of Mg with beta2M, hsCRP, and serum bicarbonate levels was significantly inverse (r = -0.252, P = 0.01, r = -0.292, P = 0.004, and r = -0.282, P = 0.04 respectively). The built logistic-regression analysis showed that Mg act as a significant independent factor for the elevated ox-LDL and beta2M serum concentrations adjusting to traditional and specific factors for these patients. We observed a positive relationship between magnesium and acidosis status- related ox-LDL concentrations, but the inverse association between magnesium and beta2M serum concentrations in hemodialysis patients. PMID:27215248

  2. Urinary {alpha}{sub 1}-microglobulin, {beta}{sub 2}-microglobulin, and retinol-binding protein levels in general populations in Japan with references to cadmium in urine, blood, and 24-hour food duplicates

    SciTech Connect

    Ikeda, Masayuki; Moon, Chan-Seok; Zhang, Zuo-Wen

    1995-07-01

    Possible cadmium (Cd) exposure-associated changes in urinary levels of low-molecular-weight proteins were studied in nonsmoking and nondrinking female members of the general Japanese population (378 subjects with no known occupational heavy metal exposure) who lived at 19 study sites (all without any known environmental heavy metal pollution) in 13 prefectures throughout Japan. The external Cd dose was evaluated in terms of daily Cd intake via food (Cd-F), whereas Cd levels in blood (Cd-B) and urine (Cd-U) were taken as internal dose indicators. When the subjects were classified according to Cd-F into three groups with {open_quotes}low{close_quotes} (20.4 {mu}g/day as a geometric mean of 97 women), {open_quotes}middle{close_quotes} (35.0 {mu}g/day, 120 women) and {open_quotes}high{close_quotes} (67.0 {mu}g/day, 66 women) exposure, both Cd-B and Cd-U increased in parallel with the changes in Cd-F. However, there were no dose-dependent changes in {beta}{sub 2}-microglobulin or retinol-binding protein levels in urine. {alpha}{sub 1}-Microglobulin levels appeared to increase, but the distribution of the cases above the two cutoff levels of 9.6 and 15.8 {mu}g/mg creatinine among the three Cd-F groups did not show any bias. Overall, it was concluded that there was no apparent Cd exposure-associated elevation in urinary low-molecular-weight protein levels in the study population. 41 refs., 2 figs., 7 tabs.

  3. Beta-2 Microglobulin Kidney Disease Test

    MedlinePlus

    ... accumulate in joint spaces ( synovitis ) in long-term dialysis patients; this is called dialysis-related amyloidosis (DRA). A B2M test may be ... early kidney dysfunction. People who have been on dialysis for five years or more may develop dialysis- ...

  4. Primordial linkage of β2-microglobulin to the MHC.

    PubMed

    Ohta, Yuko; Shiina, Takashi; Lohr, Rebecca L; Hosomichi, Kazuyoshi; Pollin, Toni I; Heist, Edward J; Suzuki, Shingo; Inoko, Hidetoshi; Flajnik, Martin F

    2011-03-15

    β2-Microglobulin (β2M) is believed to have arisen in a basal jawed vertebrate (gnathostome) and is the essential L chain that associates with most MHC class I molecules. It contains a distinctive molecular structure called a constant-1 Ig superfamily domain, which is shared with other adaptive immune molecules including MHC class I and class II. Despite its structural similarity to class I and class II and its conserved function, β2M is encoded outside the MHC in all examined species from bony fish to mammals, but it is assumed to have translocated from its original location within the MHC early in gnathostome evolution. We screened a nurse shark bacterial artificial chromosome library and isolated clones containing β2M genes. A gene present in the MHC of all other vertebrates (ring3) was found in the bacterial artificial chromosome clone, and the close linkage of ring3 and β2M to MHC class I and class II genes was determined by single-strand conformational polymorphism and allele-specific PCR. This study satisfies the long-held conjecture that β2M was linked to the primordial MHC (Ur MHC); furthermore, the apparent stability of the shark genome may yield other genes predicted to have had a primordial association with the MHC specifically and with immunity in general.

  5. Elevated urinary β2 microglobulin in the first identified Japanese family afflicted by X-linked myopathy with excessive autophagy.

    PubMed

    Kurashige, Takashi; Takahashi, Tetsuya; Yamazaki, Yu; Nagano, Yoshito; Kondo, Keita; Nakamura, Takeshi; Yamawaki, Takemori; Tsuburaya, Rie; Hayashi, Yukiko K; Nonaka, Ikuya; Nishino, Ichizo; Matsumoto, Masayasu

    2013-11-01

    Here we report what is to our knowledge the first identified Japanese family afflicted by X-linked myopathy with excessive autophagy. The index case is a 52-year-old man with almost 40years of progressive proximal muscle weakness. High urinary β2 microglobulin, normal serum β2 microglobulin, autophagic vacuoles with sarcolemmal features, and a hemizygous c.164-7T>G mutation in the VMA21 gene were found. His two maternal uncles had similar clinicopathological findings. High urinary β2 microglobulin without obvious renal dysfunction might result from decreased urine acidification in the distal convoluted tubules caused by the VMA21 gene mutation. These findings might prove to be useful as a preliminary marker suggestive of X-linked myopathy with excessive autophagy.

  6. Hereditary systemic amyloidosis due to Asp76Asn variant β2-microglobulin.

    PubMed

    Valleix, Sophie; Gillmore, Julian D; Bridoux, Frank; Mangione, Palma P; Dogan, Ahmet; Nedelec, Brigitte; Boimard, Mathieu; Touchard, Guy; Goujon, Jean-Michel; Lacombe, Corinne; Lozeron, Pierre; Adams, David; Lacroix, Catherine; Maisonobe, Thierry; Planté-Bordeneuve, Violaine; Vrana, Julie A; Theis, Jason D; Giorgetti, Sofia; Porcari, Riccardo; Ricagno, Stefano; Bolognesi, Martino; Stoppini, Monica; Delpech, Marc; Pepys, Mark B; Hawkins, Philip N; Bellotti, Vittorio

    2012-06-14

    We describe a kindred with slowly progressive gastrointestinal symptoms and autonomic neuropathy caused by autosomal dominant, hereditary systemic amyloidosis. The amyloid consists of Asp76Asn variant β(2)-microglobulin. Unlike patients with dialysis-related amyloidosis caused by sustained high plasma concentrations of wild-type β(2)-microglobulin, the affected members of this kindred had normal renal function and normal circulating β(2)-microglobulin values. The Asp76Asn β(2)-microglobulin variant was thermodynamically unstable and remarkably fibrillogenic in vitro under physiological conditions. Previous studies of β(2)-microglobulin aggregation have not shown such amyloidogenicity for single-residue substitutions. Comprehensive biophysical characterization of the β(2)-microglobulin variant, including its 1.40-Å, three-dimensional structure, should allow further elucidation of fibrillogenesis and protein misfolding. PMID:22693999

  7. Can small hydrophobic gold nanoparticles inhibit β2-microglobulin fibrillation?

    NASA Astrophysics Data System (ADS)

    Brancolini, Giorgia; Toroz, Dimitrios; Corni, Stefano

    2014-06-01

    Inorganic nanoparticles stabilized by a shell of organic ligands can enhance or suppress the natural propensity of proteins to form fibrils. Functionalization facilitates targeted delivery of the nanoparticles to various cell types, bioimaging, drug delivery and other therapeutic and diagnostic applications. In this study, we provide a computational model of the effect of a prototypical thiol-protected gold nanoparticle, Au25L18- (L = S(CH2)2Ph) on the β2-microglobulin natural fibrillation propensity. To reveal the molecular basis of the protein-nanoparticle association process, we performed various simulations at multiple levels (Classical Molecular Dynamics and Brownian Dynamics) that cover multiple length- and timescales. The results provide a model of the ensemble of structures constituting the protein-gold nanoparticle complexes, and insights into the driving forces for the binding of β2-microglobulin to hydrophobic small size gold nanoparticles. We have found that the small nanoparticles can bind the protein to form persistent complexes. This binding of nanoparticles is able to block the active sites of domains from binding to another protein, thus leading to potential inhibition of the fibrillation activity. A comparison with the binding patches identified for the interaction of the protein with a known inhibitor of fibrillation, supports our conclusion.Inorganic nanoparticles stabilized by a shell of organic ligands can enhance or suppress the natural propensity of proteins to form fibrils. Functionalization facilitates targeted delivery of the nanoparticles to various cell types, bioimaging, drug delivery and other therapeutic and diagnostic applications. In this study, we provide a computational model of the effect of a prototypical thiol-protected gold nanoparticle, Au25L18- (L = S(CH2)2Ph) on the β2-microglobulin natural fibrillation propensity. To reveal the molecular basis of the protein-nanoparticle association process, we performed various

  8. Co-fibrillogenesis of Wild-type and D76N β2-Microglobulin

    PubMed Central

    Natalello, Antonino; Mangione, P. Patrizia; Giorgetti, Sofia; Porcari, Riccardo; Marchese, Loredana; Zorzoli, Irene; Relini, Annalisa; Ami, Diletta; Faravelli, Giulia; Valli, Maurizia; Stoppini, Monica; Doglia, Silvia M.; Bellotti, Vittorio; Raimondi, Sara

    2016-01-01

    The amyloidogenic variant of β2-microglobulin, D76N, can readily convert into genuine fibrils under physiological conditions and primes in vitro the fibrillogenesis of the wild-type β2-microglobulin. By Fourier transformed infrared spectroscopy, we have demonstrated that the amyloid transformation of wild-type β2-microglobulin can be induced by the variant only after its complete fibrillar conversion. Our current findings are consistent with preliminary data in which we have shown a seeding effect of fibrils formed from D76N or the natural truncated form of β2-microglobulin lacking the first six N-terminal residues. Interestingly, the hybrid wild-type/variant fibrillar material acquired a thermodynamic stability similar to that of homogenous D76N β2-microglobulin fibrils and significantly higher than the wild-type homogeneous fibrils prepared at neutral pH in the presence of 20% trifluoroethanol. These results suggest that the surface of D76N β2-microglobulin fibrils can favor the transition of the wild-type protein into an amyloid conformation leading to a rapid integration into fibrils. The chaperone crystallin, which is a mild modulator of the lag phase of the variant fibrillogenesis, potently inhibits fibril elongation of the wild-type even once it is absorbed on D76N β2-microglobulin fibrils. PMID:26921323

  9. Foetal serum but not urinary β2-microglobulin correlates with histological injury to the kidney.

    PubMed

    Luton, D; Delezoide, A L; Leguy, M C; Gobeaux, C; Vuillard, E; Grangé, G; Guibourdenche, J

    2013-10-01

    In a context of foetal obstructive uropathies, biochemical markers can be helpful to assess the renal function, but most studies to date have focused on their correlation with ultrasound findings and neonatal outcome. Our aim was to evaluate foetal β2-microglobulin as an index of histological injury to the kidney. β2-microglobulin was measured in serum and/or urine from 27 foetuses with bilateral obstructive uropathy, and compared to the findings of kidney examination following the termination of pregnancy. In serum, increased β2-microglobulin levels correlated to a decreased number of glomeruli, a reduction in the blastema and the presence of primitive ducts reflecting renal hypoplasia and dysplasia. However, elevated β2-microglobulin levels in the urine correlated only to a decreased number of glomeruli.

  10. Urinary β2-Microglobulin Is a Good Indicator of Proximal Tubule Injury: A Correlative Study with Renal Biopsies.

    PubMed

    Zeng, Xu; Hossain, Deloar; Bostwick, David G; Herrera, Guillermo A; Zhang, Ping L

    2014-01-01

    Objective. After filtration through glomeruli, β2-microglobulin is reabsorbed in proximal tubules. Increased urinary β2-microglobulin indicates proximal tubule injury and measurement of β2-microglobulin in urine is useful to determine the source of renal injury. Kidney injury molecule-1 (KIM-1) has been characterized as a selective proximal tubule injury marker. This study was designed to evaluate the correlation of urinary β2-microglobulin concentration and KIM-1 expression as evidence of proximal tubule injury. Methods. Between 2009 and 2012, 46 patients with urine β2-microglobulin (RenalVysion) had follow-up kidney biopsy. Diagnoses included glomerular and tubule-interstitial disease. Immunohistochemical staining for KIM-1 was performed and the intensity was graded from 0 to 3+. Linear regression analysis was applied to correlate the values of urinary β2-microglobulin and KIM-1 staining scores. P < 0.05 was considered statistically significant. Results. Thirty patients had elevated urinary β2-microglobulin. KIM-1 staining was positive in 35 kidney biopsies. There was a significant correlation between urinary β2-microglobulin and KIM-1 staining (P < 0.05). Sensitivity was 86.6%, specificity was 43.7%, positive predictive value was 74.2%, and negative predictive value was 63.6%. Conclusion. Increased urinary β2-microglobulin is significantly correlated with KIM-1 staining in injured proximal tubules. Measurement of urine β2-microglobulin is a sensitive assay for proximal tubule injury. PMID:26317034

  11. Urinary β2-Microglobulin Is a Good Indicator of Proximal Tubule Injury: A Correlative Study with Renal Biopsies

    PubMed Central

    Zeng, Xu; Bostwick, David G.; Herrera, Guillermo A.; Zhang, Ping L.

    2014-01-01

    Objective. After filtration through glomeruli, β2-microglobulin is reabsorbed in proximal tubules. Increased urinary β2-microglobulin indicates proximal tubule injury and measurement of β2-microglobulin in urine is useful to determine the source of renal injury. Kidney injury molecule-1 (KIM-1) has been characterized as a selective proximal tubule injury marker. This study was designed to evaluate the correlation of urinary β2-microglobulin concentration and KIM-1 expression as evidence of proximal tubule injury. Methods. Between 2009 and 2012, 46 patients with urine β2-microglobulin (RenalVysion) had follow-up kidney biopsy. Diagnoses included glomerular and tubule-interstitial disease. Immunohistochemical staining for KIM-1 was performed and the intensity was graded from 0 to 3+. Linear regression analysis was applied to correlate the values of urinary β2-microglobulin and KIM-1 staining scores. P < 0.05 was considered statistically significant. Results. Thirty patients had elevated urinary β2-microglobulin. KIM-1 staining was positive in 35 kidney biopsies. There was a significant correlation between urinary β2-microglobulin and KIM-1 staining (P < 0.05). Sensitivity was 86.6%, specificity was 43.7%, positive predictive value was 74.2%, and negative predictive value was 63.6%. Conclusion. Increased urinary β2-microglobulin is significantly correlated with KIM-1 staining in injured proximal tubules. Measurement of urine β2-microglobulin is a sensitive assay for proximal tubule injury. PMID:26317034

  12. Characterization of the Functional Domain of β2-Microglobulin from the Asian Seabass, Lates calcarifer

    PubMed Central

    Mohd-Padil, Hirzahida; Tajul-Arifin, Khairina; Mohd-Adnan, Adura

    2010-01-01

    Background β2-Microglobulin (β2M) is the light chain of major histocompatibility class I (MHC I) that binds non-covalently with the α heavy chain. Both proteins attach to the antigen peptide, presenting a complex to the T cell to be destroyed via the immune mechanism. Methodology/Principal Findings In this study, a cDNA sequence encoding β2M in the Asian seabass (Lates calcarifer) was identified and analyzed using in silico approaches to predict and characterize its functional domain. The β2M cDNA contains an open reading frame (ORF) of 351 bases with a coding capacity of 116 amino acids. A large portion of the protein consists of the IG constant domain (IGc1), similar to β2M sequences from other species studied thus far. Alignment of the IGc1 domains of β2M from L. calcarifer and other species shows a high degree of overall conservation. Seven amino acids were found to be conserved across taxa whereas conservation between L. calcarifer and other fish species was restricted to 14 amino acids at identical conserved positions. Conclusion/Significance As the L. calcarifer β2M protein analyzed in this study contains a functional domain similar to that of β2M proteins in other species, it can be postulated that the β2M proteins from L. calcarifer and other organisms are derived from a common ancestor and thus have a similar immune function. Interestingly, fish β2M genes could also be classified according to the ecological habitat of the species, i.e. whether it is from a freshwater, marine or euryhaline environment. PMID:20949082

  13. Co-fibrillogenesis of Wild-type and D76N β2-Microglobulin: THE CRUCIAL ROLE OF FIBRILLAR SEEDS.

    PubMed

    Natalello, Antonino; Mangione, P Patrizia; Giorgetti, Sofia; Porcari, Riccardo; Marchese, Loredana; Zorzoli, Irene; Relini, Annalisa; Ami, Diletta; Faravelli, Giulia; Valli, Maurizia; Stoppini, Monica; Doglia, Silvia M; Bellotti, Vittorio; Raimondi, Sara

    2016-04-29

    The amyloidogenic variant of β2-microglobulin, D76N, can readily convert into genuine fibrils under physiological conditions and primes in vitro the fibrillogenesis of the wild-type β2-microglobulin. By Fourier transformed infrared spectroscopy, we have demonstrated that the amyloid transformation of wild-type β2-microglobulin can be induced by the variant only after its complete fibrillar conversion. Our current findings are consistent with preliminary data in which we have shown a seeding effect of fibrils formed from D76N or the natural truncated form of β2-microglobulin lacking the first six N-terminal residues. Interestingly, the hybrid wild-type/variant fibrillar material acquired a thermodynamic stability similar to that of homogenous D76N β2-microglobulin fibrils and significantly higher than the wild-type homogeneous fibrils prepared at neutral pH in the presence of 20% trifluoroethanol. These results suggest that the surface of D76N β2-microglobulin fibrils can favor the transition of the wild-type protein into an amyloid conformation leading to a rapid integration into fibrils. The chaperone crystallin, which is a mild modulator of the lag phase of the variant fibrillogenesis, potently inhibits fibril elongation of the wild-type even once it is absorbed on D76N β2-microglobulin fibrils. PMID:26921323

  14. Urinary β2 microglobulin in workers exposed to arc welding fumes.

    PubMed

    Aminian, Omid; Eftekhari, Saeid; Mazaheri, Maria; Sharifian, Seyed Akbar; Sadeghniiat-Haghighi, Khosro

    2011-01-01

    Welding is a process in which two or more metals are attached by the use of heat and, in some cases, pressure. Direct exposure and inhalation of welding fumes causes acute and chronic side effects in humans. Kidney damage is one of these important side effects. β(2) microglobulin is an 11.8 kilodalton protein and levels increase in the case of some inflammatory and viral diseases, or kidney malfunction and autoimmune diseases. In this study measurements of β(2) microglobulin were used as a criterion for assessing effects on the kidneys of workers exposed to welding fumes. The study population were electric arc welders in an industrial plant in Tehran, Iran. For control we selected workers who did not have any exposure to welding fumes. Both groups were selected on the basis of a questionnaire and the consideration of criteria for inclusion and exclusion. In the end 50 cases and 50 controls were chosen. A urine sample was collected from all participants and urinary pH was set to between 6-8 using NaOH (1M). Sample transportation to the laboratory complied with the related standards. The samples were assessed using the ORG 5BM kit. For quantitative assessment of β(2) microglobulin we used the Enzyme-linked Immunosorbent Assay (ELISA) method. The ages of the welders ranged from 21 to 48 years (mean=30.5 ± 5.9 yrs) and of controls from 23 to 56 years (mean=31.8 ± 5.9 yrs). Mean employment duration was 7.86 ± 5.01 years (range 2 to 27 years) for welders. Mean β(2) microglobulin level was 0.10 ± 0.096 μg/ml in welders and 0.11 ± 0.06 in controls. This difference was not statistically significant (P=0.381). In conclusion we don't find that exposure to electric arc welding fumes cause a significant change in urinary β(2) microglobulin compared to the control group. PMID:22131246

  15. Interrelationship of βeta-2 microglobulin, blood urea nitrogen and creatinine in streptozotocin-induced diabetes mellitus in rabbits

    PubMed Central

    Javadi, Shahram; Asri-Rezaei, Siamak; Allahverdizadeh, Maryam

    2014-01-01

    Measurement of serum creatinine (Cr) and blood urea nitrogen (BUN) are used as indicators of glomerular filtration rate. The increased levels of these biomarkers are usually detectable at advanced stages of kidney complications. The aim of this study was to find the interrelationship of beta-2 microglobulin (β2M), BUN and Cr in streptozotocin (STZ)-induced diabetes mellitus in rabbits. Diabetes was induced by a single intraperitoneal (IP) injection of 65 mg kg-1 of STZ in rabbits. The levels of serum insulin, glucose and three above mentioned biomarkers were measured one day before (day -1) and on days 1-3 after injection of STZ and continued weekly to the end of the experiment (12 weeks). A statistically significant increase of serum β2M, BUN, Cr and glucose levels, and a significant decrease of insulin levels were observed in diabetic animals. However, β2M levels increased as early as one day after STZ injection compared to Cr and BUN that elevated at day two, suggesting a probable diagnostic advantage of β2M over currently used biomarkers in diabetic related kidney complications. PMID:25568686

  16. Molecular cloning and characterization of sea bass (Dicentrarchus labrax, L.) MHC class I heavy chain and β2-microglobulin.

    PubMed

    Pinto, Rute D; Randelli, Elisa; Buonocore, Francesco; Pereira, Pedro J B; dos Santos, Nuno M S

    2013-03-01

    In this work, the gene and cDNA of sea bass (Dicentrarchus labrax) β2-microglobulin (Dila-β2m) and several cDNAs of MHC class I heavy chain (Dila-UA) were characterized. While Dila-β2m is single-copy, numerous Dila-UA transcripts were identified per individual with variability at the peptide-binding domain (PBD), but also with unexpected diversity from the connective peptide (CP) through the 3' untranslated region (UTR). Phylogenetic analysis segregates Dila-β2m and Dila-UA into each subfamily cluster, placing them in the fish class and branching Dila-MHC-I with lineage U. The α1 domains resemble those of the recently proposed L1 trans-species lineage. Although no Dila-specific α1, α2 or α3 sub-lineages could be observed, two highly distinct sub-lineages were identified at the CP/TM/CYT regions. The three-dimensional homology model of sea bass MHC-I complex is consistent with other characterized vertebrate structures. Furthermore, basal tissue-specific expression profiles were determined for both molecules, and expression of β2m was evaluated after poly I:C stimulus. Results suggest these molecules are orthologues of other β2m and teleost classical MHC-I and their basic structure is evolutionarily conserved, providing relevant information for further studies on antigen presentation in this fish species.

  17. Molecular cloning and characterization of sea bass (Dicentrarchus labrax, L.) MHC class I heavy chain and β2-microglobulin.

    PubMed

    Pinto, Rute D; Randelli, Elisa; Buonocore, Francesco; Pereira, Pedro J B; dos Santos, Nuno M S

    2013-03-01

    In this work, the gene and cDNA of sea bass (Dicentrarchus labrax) β2-microglobulin (Dila-β2m) and several cDNAs of MHC class I heavy chain (Dila-UA) were characterized. While Dila-β2m is single-copy, numerous Dila-UA transcripts were identified per individual with variability at the peptide-binding domain (PBD), but also with unexpected diversity from the connective peptide (CP) through the 3' untranslated region (UTR). Phylogenetic analysis segregates Dila-β2m and Dila-UA into each subfamily cluster, placing them in the fish class and branching Dila-MHC-I with lineage U. The α1 domains resemble those of the recently proposed L1 trans-species lineage. Although no Dila-specific α1, α2 or α3 sub-lineages could be observed, two highly distinct sub-lineages were identified at the CP/TM/CYT regions. The three-dimensional homology model of sea bass MHC-I complex is consistent with other characterized vertebrate structures. Furthermore, basal tissue-specific expression profiles were determined for both molecules, and expression of β2m was evaluated after poly I:C stimulus. Results suggest these molecules are orthologues of other β2m and teleost classical MHC-I and their basic structure is evolutionarily conserved, providing relevant information for further studies on antigen presentation in this fish species. PMID:23116964

  18. Structure of an early native-like intermediate of β2-microglobulin amyloidogenesis

    PubMed Central

    Vanderhaegen, Saskia; Fislage, Marcus; Domanska, Katarzyna; Versées, Wim; Pardon, Els; Bellotti, Vittorio; Steyaert, Jan

    2013-01-01

    To investigate early intermediates of β2-microglobulin (β2m) amyloidogenesis, we solved the structure of β2m containing the amyloidogenic Pro32Gly mutation by X-ray crystallography. One nanobody (Nb24) that efficiently blocks fibril elongation was used as a chaperone to co-crystallize the Pro32Gly β2m monomer under physiological conditions. The complex of P32G β2m with Nb24 reveals a trans peptide bond at position 32 of this amyloidogenic variant, whereas Pro32 adopts the cis conformation in the wild-type monomer, indicating that the cis to trans isomerization at Pro32 plays a critical role in the early onset of β2m amyloid formation. PMID:23904325

  19. Fibrillogenesis of human β2 -microglobulin in three-dimensional silicon microstructures.

    PubMed

    Merlo, Sabina; Barillaro, Giuseppe; Carpignano, Francesca; Silva, Gloria; Surdo, Salvatore; Strambini, Lucanos M; Giorgetti, Sofia; Nichino, Daniela; Relini, Annalisa; Mazzini, Giuliano; Stoppini, Monica; Bellotti, Vittorio

    2012-10-01

    The authors describe the interaction of biological nanostructures formed by β(2) -microglobulin amyloid fibrils with three-dimensional silicon microstructures consisting in periodic arrays of vertical silicon walls (≈3 μm-thick) separated by 50 μm-deep air gaps (≈5 μm-wide). These structures are of great interest from a biological point of view since they well mimic the interstitial environment typical of amyloid deposition in vivo. Moreover, they behave as hybrid photonic crystals, potentially applicable as optical transducers for label-free detection of the kinetics of amyloid fibrils formation. Fluorescence and atomic force microscopy (AFM) show that a uniform distribution of amyloid fibrils is achieved when fibrillogenesis occurs directly on silicon. The high resolution AFM images also demonstrate that amyloid fibrils grown on silicon are characterized by the same fine structure typically ensured by fibrillogenesis in solution.

  20. Identification of the class I genes of the mouse major histocompatibility complex by DNA-mediated gene transfer.

    PubMed

    Goodenow, R S; McMillan, M; Nicolson, M; Sher, B T; Eakle, K; Davidson, N; Hood, L

    1982-11-18

    DNA-mediated gene transfer was used to identify cloned class I genes from the major histocompatibility complex of the BALB/c mouse. Three genes encoding the transplantation antigens H-2 Kd, Dd and Ld were identified as well as genes encoding the Qa-2,3 and two TL differentiation antigens. As many as 10 putative novel class I genes were detected by the association of their gene products with beta 2-microglobulin. Alloantiserum prepared to one of the novel antigens was used to demonstrate the expression of the previously undetected antigen on spleen cells of various inbred, congeneic, and recombinant congeneic strains of mice. PMID:6815535

  1. Analysis of betaS and betaA genes in a Mexican population with African roots.

    PubMed

    Magaña, María Teresa; Ongay, Zoyla; Tagle, Juan; Bentura, Gilberto; Cobián, José G; Perea, F Javier; Casas-Castañeda, Maricela; Sánchez-López, Yoaly J; Ibarra, Bertha

    2002-01-01

    To investigate the origin of the beta(A) and beta(S) genes in a Mexican population with African roots and a high frequency of hemoglobin S, we analyzed 467 individuals (288 unrelated) from different towns in the states of Guerrero and Oaxaca in the Costa Chica region. The frequency of the sickle-cell trait was 12.8%, which may represent a public health problem. The frequencies of the beta-haplotypes were determined from 350 nonrelated chromosomes (313 beta(A) and 37 beta(S)). We observed 15 different beta(A) haplotypes, the most common of which were haplotypes 1 (48.9%), 2 (13.4%), and 3 (13.4%). The calculation of pairwise distributions and Nei's genetic distance analysis using 32 worldwide populations showed that the beta(A) genes are more closely related to those of Mexican Mestizos and North Africans. Bantu and Benin haplotypes and haplotype 9 were related to the beta(S) genes, with frequencies of 78.8, 18.2, and 3.0%, respectively. Comparison of these haplotypes with 17 other populations revealed a high similitude with the population of the Central African Republic. These data suggest distinct origins for the beta(A) and beta(S) genes in Mexican individuals from the Costa Chica region.

  2. Structure, Folding Dynamics, and Amyloidogenesis of D76N β2-Microglobulin

    PubMed Central

    Mangione, P. Patrizia; Esposito, Gennaro; Relini, Annalisa; Raimondi, Sara; Porcari, Riccardo; Giorgetti, Sofia; Corazza, Alessandra; Fogolari, Federico; Penco, Amanda; Goto, Yuji; Lee, Young-Ho; Yagi, Hisashi; Cecconi, Ciro; Naqvi, Mohsin M.; Gillmore, Julian D.; Hawkins, Philip N.; Chiti, Fabrizio; Rolandi, Ranieri; Taylor, Graham W.; Pepys, Mark B.; Stoppini, Monica; Bellotti, Vittorio

    2013-01-01

    Systemic amyloidosis is a fatal disease caused by misfolding of native globular proteins, which then aggregate extracellularly as insoluble fibrils, damaging the structure and function of affected organs. The formation of amyloid fibrils in vivo is poorly understood. We recently identified the first naturally occurring structural variant, D76N, of human β2-microglobulin (β2m), the ubiquitous light chain of class I major histocompatibility antigens, as the amyloid fibril protein in a family with a new phenotype of late onset fatal hereditary systemic amyloidosis. Here we show that, uniquely, D76N β2m readily forms amyloid fibrils in vitro under physiological extracellular conditions. The globular native fold transition to the fibrillar state is primed by exposure to a hydrophobic-hydrophilic interface under physiological intensity shear flow. Wild type β2m is recruited by the variant into amyloid fibrils in vitro but is absent from amyloid deposited in vivo. This may be because, as we show here, such recruitment is inhibited by chaperone activity. Our results suggest general mechanistic principles of in vivo amyloid fibrillogenesis by globular proteins, a previously obscure process. Elucidation of this crucial causative event in clinical amyloidosis should also help to explain the hitherto mysterious timing and location of amyloid deposition. PMID:24014031

  3. Structural and Thermodynamic Characteristics of Amyloidogenic Intermediates of β-2-Microglobulin.

    PubMed

    Chong, Song-Ho; Hong, Jooyeon; Lim, Sulgi; Cho, Sunhee; Lee, Jinkeong; Ham, Sihyun

    2015-09-08

    β-2-microglobulin (β2m) self-aggregates to form amyloid fibril in renal patients taking long-term dialysis treatment. Despite the extensive structural and mutation studies carried out so far, the molecular details on the factors that dictate amyloidogenic potential of β2m remain elusive. Here we report molecular dynamics simulations followed by the solvation thermodynamic analyses on the wild-type β2m and D76N, D59P, and W60C mutants at the native (N) and so-called aggregation-prone intermediate (IT) states, which are distinguished by the native cis- and non-native trans-Pro32 backbone conformations. Three major structural and thermodynamic characteristics of the IT-state relative to the N-state in β2m protein are detected that contribute to the increased amyloidogenic potential: (i) the disruption of the edge D-strand, (ii) the increased solvent-exposed hydrophobic interface, and (iii) the increased solvation free energy (less affinity toward solvent water). Mutation effects on these three factors are shown to exhibit a good correlation with the experimentally observed distinct amyloidogenic propensity of the D76N (+), D59P (+), and W60C (-) mutants (+/- for enhanced/decreased). Our analyses thus identify the structural and thermodynamic characteristics of the amyloidogenic intermediates, which will serve to uncover molecular mechanisms and driving forces in β2m amyloid fibril formation.

  4. A novel role for β2-microglobulin: a precursor of antibacterial chemokine in respiratory epithelial cells.

    PubMed

    Chiou, Shean-Jaw; Wang, Chan-Chi; Tseng, Yan-Shen; Lee, Yen-Jung; Chen, Shih-Chieh; Chou, Chi-Hsien; Chuang, Lea-Yea; Hong, Yi-Ren; Lu, Chi-Yu; Chiu, Chien-Chih; Chignard, Michel

    2016-01-01

    We analyzed a panel of cationic molecules secreted in the culture medium of human respiratory epithelial cells (REC) upon activation by IL-1β and different pathogen-associated molecular patterns. A 9 kDa fragment derived from β2-microglobulin (B2M) was identified and named shed 9 kDa B2M (sB2M-9). The primary structure of sB2M-9 was revealed to increase its pI value that potentially could play an important role in innate defense. sB2M-9 exhibits antibacterial activity against Gram positive Staphylococcus aureus (SA) but not against Gram negative Klebsiella pneumonia (KP). Upon its binding to SA, sB2M-9 induces clumps, a phenomenon not observed with B2M. Migration of THP-1 monocytes exposed to SA clumps was significantly greater than that to SA without clumps. sB2M-9 binds to SA, more likely as a chemokine, to facilitate THP-1 migration. As a whole, we demonstrated that REC release a novel chemokine with antibacterial activity that is shed from B2M to facilitate THP-1 migration. PMID:27503241

  5. Expression, purification, crystallization and preliminary X-ray diffraction analysis of nurse shark β2-microglobulin.

    PubMed

    Lu, Shuangshuang; Yao, Shugang; Chen, Rong; Zhang, Nianzhi; Chen, Jianmin; Gao, Feng; Xia, Chun

    2012-04-01

    β(2)-Microglobulin (β(2)m) is an essential subunit of the major histocompatibility complex (MHC) class I molecule that helps to stabilize the structure of peptide-MHC I (pMHC I). It is also one of the typical immunoglobulin superfamily (IgSF) molecules in the adaptive immune system (AIS). Sharks belong to the cartilaginous fish, which are the oldest jawed vertebrate ancestors with an AIS to exist in the world. Thus, the study of cartilaginous fish β(2)m would help in understanding the evolution of IgSF molecules. In order to demonstrate this, β(2)m from a cartilaginous fish, nurse shark (Ginglymostoma cirratum), was expressed, refolded, purified and crystallized. Diffraction data were collected to a resolution of 2.3 Å. The crystal belonged to space group P3(2)21, with unit-cell parameters a = b = 88.230, c = 67.146 Å. The crystal structure contained two molecules in the asymmetric unit. The results will provide structural information for study of the evolution of β(2)m and IgSF in the AIS.

  6. A novel role for β2-microglobulin: a precursor of antibacterial chemokine in respiratory epithelial cells

    PubMed Central

    Chiou, Shean-Jaw; Wang, Chan-Chi; Tseng, Yan-Shen; Lee, Yen-Jung; Chen, Shih-Chieh; Chou, Chi-Hsien; Chuang, Lea-Yea; Hong, Yi-Ren; Lu, Chi-Yu; Chiu, Chien-Chih; Chignard, Michel

    2016-01-01

    We analyzed a panel of cationic molecules secreted in the culture medium of human respiratory epithelial cells (REC) upon activation by IL-1β and different pathogen-associated molecular patterns. A 9 kDa fragment derived from β2-microglobulin (B2M) was identified and named shed 9 kDa B2M (sB2M-9). The primary structure of sB2M-9 was revealed to increase its pI value that potentially could play an important role in innate defense. sB2M-9 exhibits antibacterial activity against Gram positive Staphylococcus aureus (SA) but not against Gram negative Klebsiella pneumonia (KP). Upon its binding to SA, sB2M-9 induces clumps, a phenomenon not observed with B2M. Migration of THP-1 monocytes exposed to SA clumps was significantly greater than that to SA without clumps. sB2M-9 binds to SA, more likely as a chemokine, to facilitate THP-1 migration. As a whole, we demonstrated that REC release a novel chemokine with antibacterial activity that is shed from B2M to facilitate THP-1 migration. PMID:27503241

  7. Increased serum β2-microglobulin is associated with clinical and immunological markers of disease activity in systemic lupus erythematosus patients.

    PubMed

    Hermansen, M-L F; Hummelshøj, L; Lundsgaard, D; Hornum, L; Keller, P; Fleckner, J; Fox, B; Poulsen, L K; Jacobsen, S

    2012-09-01

    The objective of this study was to explore the relationship between serum levels of β2-microglobulin (β2MG), which some studies suggest reflect disease activity in systemic lupus erythematosus (SLE), and various clinical and immunological markers of disease activity in SLE. Twenty-six SLE patients and 10 healthy controls were included. Disease activity was assessed by: SLEDAI, 24 hr-proteinuria, circulating levels of complement C3, anti-double-stranded DNA (anti-dsDNA), β2MG and various pro-inflammatory and anti-inflammatory cytokines (IL-6, IL-8, IL-10, IL-18) measured with a multiplex assay, IFN-α assessed with a reporter gene assay, and a combined expression score of 12 IFN-α inducible genes in peripheral blood mononuclear cells. Median serum levels of β2MG were significantly higher in SLE patients vs controls (2.8 mg/L, range: 1.1-21.6 and 1.2 mg/L, range: 0.9-1.7, respectively, p < 0.001). β2MG was correlated with SLEDAI score (R = 0.68, p < 0.001), 24 hr-proteinuria (R = 0.64, p < 0.001), and complement C3 (R = -0.52, p = 0.007). The cytokines were significantly correlated with β2MG: IL-6 (R = 0.45, p = 0.02), IL-8 (R = 0.75, p < 0.001), IL-10 (R = 0.67, p < 0.001) and IL-18 (R = 0.71, p < 0.001) as were serum IFN-α (R = 0.45, p = 0.02) and the IFN-α inducible gene-score (R = 0.51, p = 0.01). The results support that β2MG may serve as a marker of disease activity in SLE. The correlations with the measured cytokines indicate that increased β2MG in SLE reflects immunological activity.

  8. Marked elevation of urinary β2-microglobulin in patients with reversible splenial lesions: A small case series.

    PubMed

    Azuma, Junji; Nabatame, Shin; Katsura, Toshiya; Yamamoto, Kyoko; Kaneno, Hiroshi; Kijima, Eri; Mizoguchi, Yoshimi; Shimotsuji, Tunesuke; Yamamoto, Takehisa; Ozono, Keiichi

    2016-09-15

    The magnetic resonance imaging findings of reversible isolated lesions with transiently reduced diffusion in the splenium of corpus callosum of patients with a wide spectrum of pathological conditions are referred to as reversible splenial lesion syndrome (RESLES). Clinically mild encephalitis/encephalopathy with a reversible splenial lesion (MERS) is probably included within the spectrum of RESLES; however, its exact pathophysiology is not known. Here, we describe three patients with MERS and one patient with RESLES, all of whom showed elevated urinary β2-microglobulin regardless of diagnosis and presence of pathogens. Elevated urinary β2-microglobulin suggested that an excessive immune response might play a role in the pathophysiology of reversible splenial lesions. PMID:27538611

  9. Human globin gene analysis for a patient with beta-o/delta beta-thalassemia.

    PubMed Central

    Ottolenghi, S; Lanyon, W G; Williamson, R; Weatherall, D J; Clegg, J B; Pitcher, C S

    1975-01-01

    Complementary DNA (cDNA) was prepared with RNA-dependent DNA polymerase from human globin messenger RNA (mRNA). Annealing and translation experimenta with total mRNA from circulating cells from a patient with heterozygous beta/heterozygous beta-delta-o thalassemia (beta-o/delta beta-o-thalassemia) demonstrated no detectable mRNA for beta-globin. cDNA enriched in sequences homologous to beta-globin mRNA was prepared by hydroxylapatite fractionation of hybrids formed between beta-o/delta beta-o-thalassemic mRNA and cDNA made from mRNA from a patient with alpha-thalassemia (hemoglobin H disease). The rate of annealing of this beta-enriched cDNA to normal human nuclear DNA was that of a sequence present as only a single copy per haploid genome. The beta-enriched cDNA annealed to the beta-o-delta beta-o-thalassemia total DNA with approximately the same kinetics as to normal DNA, indicating that no total gene deletion of beta-globin genes from the diploid genome has occurred, although the accuracy of the technique could not exclude with certainty a partial deletion or a deletion of a beta-globin gene from only one of the haploid genomes. This demonstrates that at least one of the beta-o- or the delta beta-o-thalassemia haploid genomes in this case contains a substantially intact beta-globin gene. PMID:49057

  10. β2-Microglobulin-mediated Signaling as a Target for Cancer Therapy

    PubMed Central

    Nomura, Takeo; Huang, Wen-Chin; Zhau, Haiyen E.; Josson, Sajni; Mimata, Hiromitsu; Kaur, Mandeep

    2014-01-01

    β2-microglobulin (β2-m) has become the focus of intense scrutiny since the discovery of its undesirable roles promoting osteomimicry and cancer progression. β2-m is a well-known housekeeping protein that forms complexes with the heavy chain of major histocompatibility complex class I molecules, which are heterodimeric cell surface proteins that present antigenic peptides to cytotoxic T cells. On recognition of foreign peptide antigens on cell surfaces, T cells actively bind and lyse antigen-presenting cancer cells. In addition to its roles in tumor immunity, β2-m has two different functions in cancer cells, either tumor promoting or tumor suppressing, in cancer cell context-dependent manner. Our studies have demonstrated that β2-m is involved extensively in the functional regulation of growth, survival, apoptosis, and even metastasis of cancer cells. We found that β2-m is a soluble growth factor and a pleiotropic signaling molecule which interacts with its receptor, hemochromatosis protein, to modulate epithelial-to-mesenchymal transition (EMT) through iron-responsive pathways. Specific antibodies against β2-m have remarkable tumoricidal activity in cancer, through β2-m action on iron flux, alterations of intracellular reactive oxygen species, DNA damage and repair enzyme activities, β-catenin activation and cadherin switching, and tumor responsiveness to hypoxia. These novel functions of β2-m and β2-m signaling may be common to several solid tumors including human lung, breast, renal, and prostate cancers. Our experimental results could lead to the development of a novel class of antibody-based pharmaceutical agents for cancer growth control. In this review, we briefly summarize the recent data regarding β2-m as a promising new cancer therapeutic target and discuss antagonizing this therapeutic target with antibody therapy for the treatment of localized and disseminated cancers. PMID:23848204

  11. Characterization of Salt-Induced Oligomerization of Human β2-Microglobulin at Low pH.

    PubMed

    Narang, Dominic; Singh, Anubhuti; Swasthi, Hema M; Mukhopadhyay, Samrat

    2016-08-18

    Misfolding and amyloid aggregation of human β2-microglobulin (β2m) have been linked to dialysis-related amyloidosis. Previous studies have shown that in the presence of different salt concentrations and at pH 2.5, β2m assembles into aggregates with distinct morphologies. However, the structural and mechanistic details of the aggregation of β2m, giving rise to different morphologies, are poorly understood. In this work, we have extensively characterized the salt-induced oligomers of the acid-unfolded state of β2m using an array of biophysical tools including steady-state and time-resolved fluorescence, circular dichroism, dynamic light scattering, and atomic force microscopy imaging. Fluorescence studies using the oligomer-sensitive molecular rotor, 4-(dicyanovinyl)-julolidine, in conjunction with the light scattering and cross-linking assay indicated that at low salt (NaCl) concentrations β2m exists as a disordered monomer, capable of transforming into ordered amyloid. In the presence of higher concentrations of salt, β2m aggregates into a larger oligomeric species that does not appear to transform into amyloid fibrils. Site-specific fluorescence experiments using single Trp variants of β2m revealed that the middle region of the protein is incorporated into these oligomers, whereas the C-terminal segment is highly exposed to bulk water. Additionally, stopped-flow kinetic experiments indicated that the formation of hydrophobic core and oligomerization occur concomitantly. Our results revealed the distinct pathways by which β2m assembles into oligomers and fibrils. PMID:27467899

  12. Effect of Tetracyclines on the Dynamics of Formation and Destructuration of β2-Microglobulin Amyloid Fibrils*♦

    PubMed Central

    Giorgetti, Sofia; Raimondi, Sara; Pagano, Katiuscia; Relini, Annalisa; Bucciantini, Monica; Corazza, Alessandra; Fogolari, Federico; Codutti, Luca; Salmona, Mario; Mangione, Palma; Colombo, Lino; De Luigi, Ada; Porcari, Riccardo; Gliozzi, Alessandra; Stefani, Massimo; Esposito, Gennaro; Bellotti, Vittorio; Stoppini, Monica

    2011-01-01

    The discovery of methods suitable for the conversion in vitro of native proteins into amyloid fibrils has shed light on the molecular basis of amyloidosis and has provided fundamental tools for drug discovery. We have studied the capacity of a small library of tetracycline analogues to modulate the formation or destructuration of β2-microglobulin fibrils. The inhibition of fibrillogenesis of the wild type protein was first established in the presence of 20% trifluoroethanol and confirmed under a more physiologic environment including heparin and collagen. The latter conditions were also used to study the highly amyloidogenic variant, P32G. The NMR analysis showed that doxycycline inhibits β2-microglobulin self-association and stabilizes the native-like species through fast exchange interactions involving specific regions of the protein. Cell viability assays demonstrated that the drug abolishes the natural cytotoxic activity of soluble β2-microglobulin, further strengthening a possible in vivo therapeutic exploitation of this drug. Doxycycline can disassemble preformed fibrils, but the IC50 is 5-fold higher than that necessary for the inhibition of fibrillogenesis. Fibril destructuration is a dynamic and time-dependent process characterized by the early formation of cytotoxic protein aggregates that, in a few hours, convert into non-toxic insoluble material. The efficacy of doxycycline as a drug against dialysis-related amyloidosis would benefit from the ability of the drug to accumulate just in the skeletal system where amyloid is formed. In these tissues, the doxycycline concentration reaches values several folds higher than those resulting in inhibition of amyloidogenesis and amyloid destructuration in vitro. PMID:21068391

  13. A Simulated Intermediate State for Folding and Aggregation Provides Insights into ΔN6 β2-Microglobulin Amyloidogenic Behavior

    PubMed Central

    Estácio, Sílvia G.; Krobath, Heinrich; Vila-Viçosa, Diogo; Machuqueiro, Miguel; Shakhnovich, Eugene I.; Faísca, Patrícia F. N.

    2014-01-01

    A major component of ex vivo amyloid plaques of patients with dialysis-related amyloidosis (DRA) is a cleaved variant of β2-microglobulin (ΔN6) lacking the first six N-terminal residues. Here we perform a computational study on ΔN6, which provides clues to understand the amyloidogenicity of the full-length β2-microglobulin. Contrary to the wild-type form, ΔN6 is able to efficiently nucleate fibrillogenesis in vitro at physiological pH. This behavior is enhanced by a mild acidification of the medium such as that occurring in the synovial fluid of DRA patients. Results reported in this work, based on molecular simulations, indicate that deletion of the N-terminal hexapeptide triggers the formation of an intermediate state for folding and aggregation with an unstructured strand A and a native-like core. Strand A plays a pivotal role in aggregation by acting as a sticky hook in dimer assembly. This study further predicts that the detachment of strand A from the core is maximized at pH 6.2 resulting into higher aggregation efficiency. The structural mapping of the dimerization interface suggests that Tyr10, His13, Phe30 and His84 are hot-spot residues in ΔN6 amyloidogenesis. PMID:24809460

  14. Pancreatic beta cells express a diverse set of homeobox genes.

    PubMed Central

    Rudnick, A; Ling, T Y; Odagiri, H; Rutter, W J; German, M S

    1994-01-01

    Homeobox genes, which are found in all eukaryotic organisms, encode transcriptional regulators involved in cell-type differentiation and development. Several homeobox genes encoding homeodomain proteins that bind and activate the insulin gene promoter have been described. In an attempt to identify additional beta-cell homeodomain proteins, we designed primers based on the sequences of beta-cell homeobox genes cdx3 and lmx1 and the Drosophila homeodomain protein Antennapedia and used these primers to amplify inserts by PCR from an insulinoma cDNA library. The resulting amplification products include sequences encoding 10 distinct homeodomain proteins; 3 of these proteins have not been described previously. In addition, an insert was obtained encoding a splice variant of engrailed-2, a homeodomain protein previously identified in the central nervous system. Northern analysis revealed a distinct pattern of expression for each homeobox gene. Interestingly, the PCR-derived clones do not represent a complete sampling of the beta-cell library because no inserts encoding cdx3 or lmx1 protein were obtained. Beta cells probably express additional homeobox genes. The abundance and diversity of homeodomain proteins found in beta cells illustrate the remarkable complexity and redundancy of the machinery controlling beta-cell development and differentiation. Images PMID:7991607

  15. [Knock out of bovine beta casein gene by homologous recombination].

    PubMed

    Xue, Ke; Li, Feng; Luo, Guang-Bin; Huang, Wei-Wei; Chen, Xue-Jin

    2007-05-01

    It has been reported that homologous recombination with Red system has been successfully used for knock-out. We try to work on the construction of the expression vector of Mammary Gland with Red system. This study takes CSN2 as a vector for gene target, which contains the complete bovine beta casein gene. Different homologous arms were designed and the CDS region of the beta casein gene was successfully knocked out. The efficiency was also explored for knocking out different DNA fragment. Based on the study, it is very convenient for making a deep research of the foreign gene expression under the regulation of CSN2 flanking region.

  16. The beta-tubulin gene family of Arabidopsis thaliana: preferential accumulation of the beta 1 transcript in roots.

    PubMed

    Oppenheimer, D G; Haas, N; Silflow, C D; Snustad, D P

    1988-01-01

    The genome of Arabidopsis thaliana (L.) Heynh. was shown to contain a beta-tubulin gene family consisting of at least seven distinct genes and/or pseudogenes. Genomic clones of five different beta-tubulin genes and/or pseudogenes have been isolated and partially characterized. The complete nucleotide sequence of one A. thaliana beta-tubulin gene, designated beta 1, has been determined. A comparison of the predicted amino acid sequence of the A. thaliana beta 1-tubulin with the predicted sequences of beta-tubulins of animals and protists indicated that this plant beta-tubulin shows a high degree of homology with other beta-tubulins. However, the beta 1-tubulin contains a novel single amino acid insertion at position 41. The A. thaliana beta 1-tubulin gene is transcribed, as shown by RNA blot hybridization and S1 nuclease analyses. A 3'-noncoding gene-specific probe was used to examine the expression of the beta 1-tubulin gene in leaves, roots, and flowers by blot hybridization analyses of total RNA isolated from these tissues. The results showed that the transcript of the beta 1 gene accumulates predominantly in roots, with low levels of transcript in flowers, and barely detectable levels of transcript in leaves. A second genomic clone was shown to contain two essentially identical beta-tubulin coding sequences in direct tandem orientation and separated by 1 kb.

  17. Reassociation with beta 2-microglobulin is necessary for Kb class I major histocompatibility complex binding of exogenous peptides.

    PubMed Central

    Rock, K L; Rothstein, L E; Gamble, S R; Benacerraf, B

    1990-01-01

    T lymphocytes recognize endogenously produced antigenic peptides in association with major histocompatibility complex (MHC)-encoded molecules. Peptides from the extracellular fluid can be displayed in association with class I and class II MHC molecules. Here we report that mature Kb class I MHC molecules bind peptides upon dissociation and reassociation of their light chain. Intact Kb heterodimers, unlike class II MHC molecules, are relatively unreceptive to binding peptides. This property may maintain segregation of class I and class II MHC-restricted peptides and has implications for the use of peptides as vaccines. Images PMID:2217182

  18. Nucleotide sequence of SHV-2 beta-lactamase gene

    SciTech Connect

    Garbarg-Chenon, A.; Godard, V.; Labia, R.; Nicolas, J.C. )

    1990-07-01

    The nucleotide sequence of plasmid-mediated beta-lactamase SHV-2 from Salmonella typhimurium (SHV-2pHT1) was determined. The gene was very similar to chromosomally encoded beta-lactamase LEN-1 of Klebsiella pneumoniae. Compared with the sequence of the Escherichia coli SHV-2 enzyme (SHV-2E.coli) obtained by protein sequencing, the deduced amino acid sequence of SHV-2pHT1 differed by three amino acid substitutions.

  19. Same. beta. -globin gene mutation is present on nine different. beta. -thalassemia chromosomes in a Sardinian population

    SciTech Connect

    Pirastu, M.; Galanello, R.; Doherty, M.A.; Tuveri, T.; Cao, A.; Kan, Y.W.

    1987-05-01

    The predominant ..beta..-thalassemia in Sardinia is the ..beta../sup 0/ type in which no ..beta..-globin chains are synthesized in the homozygous state. The authors determined the ..beta..-thalassemia mutations in this population by the oligonucleotide-probe method and defined the chromosome haplotypes on which the mutation resides. The same ..beta../sup 39(CAG..-->..TAG)/ nonsense mutation was found on nine different chromosome haplotypes. Although this mutation may have arisen more than once, the multiple haplotypes could also be generated by crossing over and gene conversion events. These findings underscore the frequency of mutational events in the ..beta..-globin gene region.

  20. Cloning and sequencing of the gene for human. beta. -casein

    SciTech Connect

    Loennerdal, B.; Bergstroem, S.; Andersson, Y.; Hialmarsson, K.; Sundgyist, A.; Hernell, O. )

    1990-02-26

    Human {beta}-casein is a major protein in human milk. This protein is part of the casein micelle and has been suggested to have several physiological functions in the newborn. Since there is limited information on {beta}casein and the factors that affect its concentration in human milk, the authors have isolated and sequenced the gene for this protein. A human mammary gland cDNA library (Clontech) in gt 11 was screened by plaque hy-hybridization using a 42-mer synthetic {sup 32}p-labelled oligo-nucleotide. Positive clones were identified and isolated, DNA was prepared and the gene isolated by cleavage with EcoR1. Following subcloning (PUC18), restriction mapping and Southern blotting, DNA for sequencing was prepared. The gene was sequenced by the dideoxy method. Human {beta}-casein has 212 amino acids and the amino acid sequence deducted from the nucleotide sequence is to 91% identical to the published sequence for human {beta}-casein show a high degree of conservation at the leader peptide and the highly phosphorylated sequences, but also deletions and divergence at several positions. These results provide insight into the structure of the human {beta}-casein gene and will facilitate studies on factors affecting its expression.

  1. Fusion of the Saccharomyces cerevisiae leu2 gene to an Escherichia coli beta-galactosidase gene.

    PubMed Central

    Martinez-Arias, A E; Casadaban, M J

    1983-01-01

    The promoter and translation initiation region of the Saccharomyces cerevisiae leu2 gene was fused to the Escherichia coli beta-galactosidase gene. This fusion located the control region of the leu gene and orientated its direction of expression. When the fusion was placed into yeast cells, beta-galactosidase was expressed under the same regulatory pattern as the original leu2 gene product: its synthesis was repressed in the presence of leucine and threonine. Sensitive chromogenic substrates for beta-galactosidase were used to detect expression in isolated colonies growing on agar medium. Mutant yeast cells with increased beta-galactosidase activity were identified by the color of the colonies they formed. One class of mutants obtained appeared to affect ars1 plasmid maintenance, and another class appeared to affect beta-galactoside uptake. PMID:6406836

  2. Characterization of beta-R1, a gene that is selectively induced by interferon beta (IFN-beta) compared with IFN-alpha.

    PubMed

    Rani, M R; Foster, G R; Leung, S; Leaman, D; Stark, G R; Ransohoff, R M

    1996-09-13

    We report preliminary characterization of a gene designated beta-R1, which is selectively expressed in response to interferon beta (IFN-beta) compared with IFN-alpha. In human astrocytoma cells, beta-R1 was induced to an equivalent extent by 10 IU/mL IFN-beta or 2500 IU/mL IFN-alpha2. To address the mechanism of this differential response, we analyzed induction of the beta-R1 gene in fibrosarcoma cells and derivative mutant cells lacking components required for signaling by type I IFNs. beta-R1 was readily induced by IFN-beta in the parental 2fTGH cell line, but not by recombinant IFN-alpha2, IFN-alpha Con1, or a mixture of IFN-alpha subtypes. IFN-alpha8 induced beta-R1 weakly. beta-R1 was not induced by IFN-beta in mutant cell lines U2A, U3A, U4A, and U6A, which lack, respectively, p48, STAT1, JAK1, and STAT2. U5A cells, which lack the Ifnar 2.2 component of the IFN-alpha and -beta receptor, also failed to express beta-R1. U1A cells are partially responsive to IFN-beta and IFN-alpha8 but lacked beta-R1 expression, indicating that TYK2 protein is essential for induction of this gene. Taken together, these results suggest that the expression of beta-R1 in response to type I IFN requires IFN-stimulated gene factor 3 plus an additional component, which is more efficiently formed on induction by IFN-beta compared with IFN-alpha.

  3. Correction of human. beta. sup S -globin gene by gene targeting

    SciTech Connect

    Shesely, E.G.; Hyungsuk Kim; Shehee, W.R.; Smithies, O. ); Papayannopoulou, T. ); Popovich, B.W. )

    1991-05-15

    As a step toward using gene targeting for gene therapy, the authors have corrected a human {beta}{sup S}-globin gene to the normal {beta}{sup A} allele by homologous recombination in the mouse-human hybrid cell line BSM. BSM is derived from a mouse erythroleukemia cell line and carries a single human chromosome 11 with the {beta}{sup S}-globin allele. A {beta}{sup A}-globin targeting construct containing a unique oligomer and a neomycin-resistance gene was electroporated into the BSM cells, which were then placed under G418 selection. Then 126 resulting pools containing a total {approx}29,000 G418-resistant clones were screened by PCR for the presence of a targeted recombinant: 3 positive pools were identified. A targeted clone was isolated by replating one of the positive pools into smaller pools and rescreening by PCR, followed by dilution cloning. Southern blot analysis demonstrated that the isolated clone had been targeted as planned. The correction of the {beta}{sup S} allele to {beta}{sup A} was confirmed both by allele-specific PCR and by allele-specific antibodies. Expression studies comparing the uninduced and induced RNA levels in unmodified BSM cells and in the targeted clone showed no significant alteration in the ability of the targeted clone to undergo induction, despite the potentially disrupting presence of a transcriptionally active neomycin gene 5{prime} to the human {beta}{sup A}-globin gene. Thus gene targeting can correct a {beta}{sup S} allele to {beta}{sup A}, and the use of a selectable helper gene need not significantly interfere with the induction of the corrected gene.

  4. Dissociation of β2-microglobulin determines the surface quality control of major histocompatibility complex class I molecules.

    PubMed

    Montealegre, Sebastián; Venugopalan, Vaishnavi; Fritzsche, Susanne; Kulicke, Corinna; Hein, Zeynep; Springer, Sebastian

    2015-07-01

    Major histocompatibility complex class I proteins, which present antigenic peptides to cytotoxic T lymphocytes at the surface of all nucleated cells, are endocytosed and destroyed rapidly once their peptide ligand has dissociated. The molecular mechanism of this cellular quality control process, which prevents rebinding of exogenous peptides and thus erroneous immune responses, is unknown. To identify the nature of the decisive step in endocytic sorting of class I molecules and its location, we have followed the removal of optimally and suboptimally peptide-loaded murine H-2K(b) class I proteins from the cell surface. We find that the binding of their light chain, β2-microglobulin (β2m), protects them from endocytic destruction. Thus, the extended survival of suboptimally loaded K(b) molecules at 25°C is attributed to decreased dissociation of β2m. Because all forms of K(b) are constantly internalized but little β2m-receptive heavy chain is present at the cell surface, it is likely that β2m dissociation and recognition of the heavy chain for lysosomal degradation take place in an endocytic compartment.

  5. Comparison of the aggregation of homologous β2-microglobulin variants reveals protein solubility as a key determinant of amyloid formation.

    PubMed

    Pashley, Clare L; Hewitt, Eric W; Radford, Sheena E

    2016-02-13

    The mouse and human β2-microglobulin protein orthologs are 70% identical in sequence and share 88% sequence similarity. These proteins are predicted by various algorithms to have similar aggregation and amyloid propensities. However, whilst human β2m (hβ2m) forms amyloid-like fibrils in denaturing conditions (e.g. pH2.5) in the absence of NaCl, mouse β2m (mβ2m) requires the addition of 0.3M NaCl to cause fibrillation. Here, the factors which give rise to this difference in amyloid propensity are investigated. We utilise structural and mutational analyses, fibril growth kinetics and solubility measurements under a range of pH and salt conditions, to determine why these two proteins have different amyloid propensities. The results show that, although other factors influence the fibril growth kinetics, a striking difference in the solubility of the proteins is a key determinant of the different amyloidogenicity of hβ2m and mβ2m. The relationship between protein solubility and lag time of amyloid formation is not captured by current aggregation or amyloid prediction algorithms, indicating a need to better understand the role of solubility on the lag time of amyloid formation. The results demonstrate the key contribution of protein solubility in determining amyloid propensity and lag time of amyloid formation, highlighting how small differences in protein sequence can have dramatic effects on amyloid formation. PMID:26780548

  6. Assessing the effect of loop mutations in the folding space of β2-microglobulin with molecular dynamics simulations.

    PubMed

    Estácio, Sílvia G; Shakhnovich, Eugene I; Faísca, Patrícia F N

    2013-01-01

    We use molecular dynamics simulations of a full atomistic Gō model to explore the impact of selected DE-loop mutations (D59P and W60C) on the folding space of protein human β2-microglobulin (Hβ2m), the causing agent of dialysis-related amyloidosis, a conformational disorder characterized by the deposition of insoluble amyloid fibrils in the osteoarticular system. Our simulations replicate the effect of mutations on the thermal stability that is observed in experiments in vitro. Furthermore, they predict the population of a partially folded state, with 60% of native internal free energy, which is akin to a molten globule. In the intermediate state, the solvent accessible surface area increases up to 40 times relative to the native state in 38% of the hydrophobic core residues, indicating that the identified species has aggregation potential. The intermediate state preserves the disulfide bond established between residue Cys25 and residue Cys80, which helps maintain the integrity of the core region, and is characterized by having two unstructured termini. The movements of the termini dominate the essential modes of the intermediate state, and exhibit the largest displacements in the D59P mutant, which is the most aggregation prone variant. PROPKA predictions of pKa suggest that the population of the intermediate state may be enhanced at acidic pH explaining the larger amyloidogenic potential observed in vitro at low pH for the WT protein and mutant forms. PMID:23975166

  7. Uncovering the Early Assembly Mechanism for Amyloidogenic β2-Microglobulin Using Cross-linking and Native Mass Spectrometry*

    PubMed Central

    Hall, Zoe; Schmidt, Carla; Politis, Argyris

    2016-01-01

    β2-Microglobulin (β2m), a key component of the major histocompatibility class I complex, can aggregate into fibrils with severe clinical consequences. As such, investigating the structural aspects of the formation of oligomeric intermediates of β2m and their subsequent progression toward fibrillar aggregates is of great importance. However, β2m aggregates are challenging targets in structural biology, primarily due to their inherent transient and heterogeneous nature. Here we study the oligomeric distributions and structures of the early intermediates of amyloidogenic β2m and its truncated variant ΔN6-β2m. We established compact oligomers for both variants by integrating advanced mass spectrometric techniques with available electron microscopy maps and atomic level structures from NMR spectroscopy and x-ray crystallography. Our results revealed a stepwise assembly mechanism by monomer addition and domain swapping for the oligomeric species of ΔN6-β2m. The observed structural similarity and common oligomerization pathway between the two variants is likely to enable ΔN6-β2m to cross-seed β2m fibrillation and allow the formation of mixed fibrils. We further determined the key subunit interactions in ΔN6-β2m tetramer, revealing the importance of a domain-swapped hinge region for formation of higher order oligomers. Overall, we deliver new mechanistic insights into β2m aggregation, paving the way for future studies on the mechanisms and cause of amyloid fibrillation. PMID:26655720

  8. (The isolation and characterization of beta-glucosidase gene and beta-glucosidase of Trichoderma viride): Progress report

    SciTech Connect

    Stafford, D.W.

    1983-01-01

    Our project was to isolate and characterize the enzyme ..beta..-glucosidase and to clone and characterize the ..beta..-glucosidase gene; our goal is to clone and characterize each of the cellulase genes from Trichoderma. The induction of the Trichoderma reesei cellulase complex by cellulose and by the soluble inducer, sophorose, has been demonstrated. Although the induction of the cellulase complex has previously been well documented, the induction of ..beta..-glucosidase had been questioned. 49 refs., 6 figs., 2 tabs.

  9. beta-adrenergic receptor gene polymorphisms and beta-blocker treatment outcomes in hypertension.

    PubMed

    Pacanowski, M A; Gong, Y; Cooper-Dehoff, R M; Schork, N J; Shriver, M D; Langaee, T Y; Pepine, C J; Johnson, J A

    2008-12-01

    Numerous studies have demonstrated that beta(1)- and beta(2)-adrenergic receptor gene (ADRB1 and ADRB2) variants influence cardiovascular risk and beta-blocker responses in hypertension and heart failure. We evaluated the relationship between ADRB1 and ADRB2 haplotypes, cardiovascular risk (death, nonfatal myocardial infarction (MI), and nonfatal stroke), and atenolol-based vs. verapamil sustained-release (SR)-based antihypertensive therapy in 5,895 coronary artery disease (CAD) patients. After an average of 2.8 years, death rates were higher in patients carrying the ADRB1 Ser49-Arg389 haplotype (hazard ratio (HR) 3.66, 95% confidence interval (95% CI) 1.68-7.99). This mortality risk was significant in patients randomly assigned to verapamil SR (HR 8.58, 95% CI 2.06-35.8) but not atenolol (HR 2.31, 95% CI 0.82-6.55), suggesting a protective role for the beta-blocker. ADRB2 haplotype associations were divergent within the treatment groups but did not remain significant after adjustment for multiple comparisons. ADRB1 haplotype variation is associated with mortality risk, and beta-blockers may be preferred in subgroups of patients defined by ADRB1 or ADRB2 polymorphisms.

  10. Beta+-thalassemia in cis of a sickle cell gene: occurrence of a promoter mutation on a beta s chromosome.

    PubMed

    Baklouti, F; Ouazana, R; Gonnet, C; Lapillonne, A; Delaunay, J; Godet, J

    1989-10-01

    An atypical sickle cell trait with a very low level of hemoglobin S and features of heterozygous beta-thalassemia was recently described. In vitro globin chain synthesis strongly suggested the presence of the two abnormalities on the same chromosome. We report the corresponding beta S-thal gene. DNA sequence revealed a C----T base substitution in the distal promoter element CACCC, at position-88 from the cap site, in addition to the expected GAG----GTG mutation responsible for the structural variant (beta 6 Glu----Val). Reticulocyte mRNA titration and transient assay of the mutant gene in COS cells showed a defect in beta-mRNA production. Restriction haplotype and DNA sequence analyses revealed that the doubly mutated gene is associated with haplotype 19 (or Benin/Algeria haplotype). In particular, we found the (AT)9(T)4 repeated sequences specifically encountered 5' to the beta S gene of Benin Algeria type. These results support the view that the beta S-thal gene resulted from an independent thalassemic mutation having occurred on a beta S chromosome rather than (a) from a beta S mutation having altered a beta-thalassemic gene or (b) from a recombination event between two chromosomes, each carrying one of the mutations.

  11. The organization of the gamma-delta-beta gene complex in normal and thalassemia cells.

    PubMed

    Bank, A; Mears, J G; Ramirez, F; Burns, A L; Spence, S; Feldenzer, J; Baird, M

    1980-01-01

    Restriction enzyme digestion analysis and direct human globin gene cloning have permitted analysis of the physical arrangement of nucleotide sequences within and surrounding the human globin genes. With these methods it has been shown that the linear arrangement 5' to 3' of the globin genes is G gamma-A gamma-delta-beta. The G gamma and A gamma genes are separated by about 3.5 kilobases (kb), while the A gamma and delta genes are 15 kb apart, and the delta and beta 6.5 kb apart. Each of these genes contains a large intervening sequence (IVS) of approximately 1 kb in precisely the same position between condons 104 and 105. In addition, each of these genes has a small IVS between codons 30 and 31. In homozygous delta beta thalassemia DNA, there is deletion of all of the normal delta and beta gene fragments. However, a new fragment 4.2 kb in size containing the 5' end of the delta globin gene is retained. Retention of this fragment in delta beta thalassemia, but not in HPFH is consistent with a role for sequences in this region for limiting gamma globin gene expression. Studies to date suggest that the beta + and beta 0 thalassemias will be due to a heterogeneous group of DNA defects affecting either beta globin gene transcription or beta mRNA processing. In most cases of beta + and beta 0 thalassemia DNA analyzed, there is no detectable deletion of beta or delta genes. In three India beta 0 patients, deletion of the 3' end of the beta gene has been found. Analysis of cloned beta globin genes from a patient with beta + thalasseia shows differences from normal in the fragments generated by restriction enzymes which cut frequently. Whether these differences are responsible for the defect in thalassemia or are polymorphisms unrelated to thalassemia remains to be determined.

  12. Transforming growth factor-beta/Smad3 signaling regulates insulin gene transcription and pancreatic islet beta-cell function.

    PubMed

    Lin, Huei-Min; Lee, Ji-Hyeon; Yadav, Hariom; Kamaraju, Anil K; Liu, Eric; Zhigang, Duan; Vieira, Anthony; Kim, Seong-Jin; Collins, Heather; Matschinsky, Franz; Harlan, David M; Roberts, Anita B; Rane, Sushil G

    2009-05-01

    Pancreatic islet beta-cell dysfunction is a signature feature of Type 2 diabetes pathogenesis. Consequently, knowledge of signals that regulate beta-cell function is of immense clinical relevance. Transforming growth factor (TGF)-beta signaling plays a critical role in pancreatic development although the role of this pathway in the adult pancreas is obscure. Here, we define an important role of the TGF-beta pathway in regulation of insulin gene transcription and beta-cell function. We identify insulin as a TGF-beta target gene and show that the TGF-beta signaling effector Smad3 occupies the insulin gene promoter and represses insulin gene transcription. In contrast, Smad3 small interfering RNAs relieve insulin transcriptional repression and enhance insulin levels. Transduction of adenoviral Smad3 into primary human and non-human primate islets suppresses insulin content, whereas, dominant-negative Smad3 enhances insulin levels. Consistent with this, Smad3-deficient mice exhibit moderate hyperinsulinemia and mild hypoglycemia. Moreover, Smad3 deficiency results in improved glucose tolerance and enhanced glucose-stimulated insulin secretion in vivo. In ex vivo perifusion assays, Smad3-deficient islets exhibit improved glucose-stimulated insulin release. Interestingly, Smad3-deficient islets harbor an activated insulin-receptor signaling pathway and TGF-beta signaling regulates expression of genes involved in beta-cell function. Together, these studies emphasize TGF-beta/Smad3 signaling as an important regulator of insulin gene transcription and beta-cell function and suggest that components of the TGF-beta signaling pathway may be dysregulated in diabetes.

  13. The role of EKLF in human beta-globin gene competition.

    PubMed

    Wijgerde, M; Gribnau, J; Trimborn, T; Nuez, B; Philipsen, S; Grosveld, F; Fraser, P

    1996-11-15

    We have investigated the role of erythroid Kruppel-like factor (EKLF) in expression of the human beta-globin genes in compound EKLF knockout/human beta-locus transgenic mice. EKLF affects only the adult mouse beta-globin genes in homozygous knockout mice; heterozygous mice are unaffected. Here we show that EKLF knockout mice express the human epsilon and gamma-globin genes normally in embryonic red cells. However, fetal liver erythropoiesis, which is marked by a period of gamma- and beta-gene competition in which the genes are alternately transcribed, exhibits an altered ratio of gamma- to beta-gene transcription. EKLF heterozygous fetal livers display a decrease in the number of transcriptionally active beta genes with a reciprocal increase in the number of transcriptionally active gamma genes. beta-Gene transcription is absent in homozygous knockout fetuses with coincident changes in chromatin structure at the beta promoter. There is a further increase in the number of transcriptionally active gamma genes and accompanying gamma gene promoter chromatin alterations. These results indicate that EKLF plays a major role in gamma- and beta-gene competition and suggest that EKLF is important in stabilizing the interaction between the Locus Control Region and the beta-globin gene. In addition, these findings provide further evidence that developmental modulation of globin gene expression within individual cells is accomplished by altering the frequency and/or duration of transcriptional periods of a gene rather than changing the rate of transcription.

  14. Decoding the Structural Bases of D76N ß2-Microglobulin High Amyloidogenicity through Crystallography and Asn-Scan Mutagenesis

    PubMed Central

    de Rosa, Matteo; Barbiroli, Alberto; Giorgetti, Sofia; Mangione, Patrizia P.; Bolognesi, Martino; Ricagno, Stefano

    2015-01-01

    D76N is the first natural variant of human β-2 microglobulin (β2m) so far identified. Contrary to the wt protein, this mutant readily forms amyloid fibres in physiological conditions, leading to a systemic and severe amyloidosis. Although the Asp76Asn mutant has been extensively characterized, the molecular bases of its instability and aggregation propensity remain elusive. In this work all Asp residues of human β2m were individually substituted to Asn; D-to-N mutants (D34N, D38N, D53N, D59N, D96N and D98N) were characterised in terms of thermodynamic stability and aggregation propensity. Moreover, crystal structures of the D38N, D53N, D59N and D98N variants were solved at high-resolution (1.24–1.70 Å). Despite showing some significant variations in their thermal stabilities, none showed the dramatic drop in melting temperature (relative to the wt protein) as observed for the pathogenic mutant. Consistently, none of the variants here described displayed any increase in aggregation propensity under the experimental conditions tested. The crystal structures confirmed that D-to-N mutations are generally well tolerated, and lead only to minor reorganization of the side chains in close proximity of the mutated residue. D38N is the only exception, where backbone readjustments and a redistribution of the surface electrostatic charges are observed. Overall, our results suggest that neither removing negative charges at sites 34, 38, 53, 59, 96 and 98, nor the difference in β2m pI, are the cause of the aggressive phenotype observed in D76N. We propose that the dramatic effects of the D76N natural mutation must be linked to effects related to the crucial location of this residue within the β2m fold. PMID:26625273

  15. Decoding the Structural Bases of D76N ß2-Microglobulin High Amyloidogenicity through Crystallography and Asn-Scan Mutagenesis.

    PubMed

    de Rosa, Matteo; Barbiroli, Alberto; Giorgetti, Sofia; Mangione, Patrizia P; Bolognesi, Martino; Ricagno, Stefano

    2015-01-01

    D76N is the first natural variant of human β-2 microglobulin (β2m) so far identified. Contrary to the wt protein, this mutant readily forms amyloid fibres in physiological conditions, leading to a systemic and severe amyloidosis. Although the Asp76Asn mutant has been extensively characterized, the molecular bases of its instability and aggregation propensity remain elusive. In this work all Asp residues of human β2m were individually substituted to Asn; D-to-N mutants (D34N, D38N, D53N, D59N, D96N and D98N) were characterised in terms of thermodynamic stability and aggregation propensity. Moreover, crystal structures of the D38N, D53N, D59N and D98N variants were solved at high-resolution (1.24-1.70 Å). Despite showing some significant variations in their thermal stabilities, none showed the dramatic drop in melting temperature (relative to the wt protein) as observed for the pathogenic mutant. Consistently, none of the variants here described displayed any increase in aggregation propensity under the experimental conditions tested. The crystal structures confirmed that D-to-N mutations are generally well tolerated, and lead only to minor reorganization of the side chains in close proximity of the mutated residue. D38N is the only exception, where backbone readjustments and a redistribution of the surface electrostatic charges are observed. Overall, our results suggest that neither removing negative charges at sites 34, 38, 53, 59, 96 and 98, nor the difference in β2m pI, are the cause of the aggressive phenotype observed in D76N. We propose that the dramatic effects of the D76N natural mutation must be linked to effects related to the crucial location of this residue within the β2m fold.

  16. Macromolecular crowding favors the fibrillization of β2-microglobulin by accelerating the nucleation step and inhibiting fibril disassembly.

    PubMed

    Luo, Xu-Dong; Kong, Fan-Lou; Dang, Hai-Bin; Chen, Jie; Liang, Yi

    2016-11-01

    Hemodialysis-associated amyloidosis (HAA) involves the fibrillization of β2-microglobulin (β2M) and occurs in crowded physiological environments. However, how macromolecular crowding affects amyloid formation of β2M remains elusive. Here we study the effects of macromolecular crowding on amyloid formation and fibril disassembly of wild-type human β2M and its pathogenic mutant ΔN6. At strongly acidic pH2.5, the presence of a strong crowding agent (Ficoll 70 or dextran 70) not only dramatically accelerates the fibrillization of both wild-type β2M and its ΔN6 variant by reducing the lag time to a large extent, indicating the acceleration of the nucleation phase, but also remarkably increases the amount of β2M fibrils. At weakly acidic pH6.2, such an enhancing effect of macromolecular crowding on fibril formation is only observed for pathogenic mutant ΔN6, but not for wild-type β2M which does not form amyloid fibrils in the absence and presence of a crowding agent. Thus, we propose that the monomers of β2M form the nuclei, which is enhanced by macromolecular crowding, followed by the step of fibril elongation. Furthermore, at physiological pH, macromolecular crowding remarkably inhibits β2M fibril disassembly by decreasing rate constants corresponding to fast and slow stages of fibril disaggregation. Our data demonstrate that macromolecular crowding favors the fibrillization of β2M by accelerating the nucleation step and inhibiting fibril disassembly. Our findings provide clear evidence for the pathology of HAA that macromolecular crowding should be taken into account. PMID:27481166

  17. The molten globule of β(2)-microglobulin accumulated at pH 4 and its role in protein folding.

    PubMed

    Mukaiyama, Atsushi; Nakamura, Takashi; Makabe, Koki; Maki, Kosuke; Goto, Yuji; Kuwajima, Kunihiro

    2013-01-23

    The acid transition of β(2)-microglobulin (β2m) was studied by tryptophan fluorescence, peptide circular dichroism, and NMR spectroscopy. The protein exhibits a three-state transition with an equilibrium intermediate accumulated at pH4 (25°C). The pH4 intermediate has typical characteristics of the molten globule (MG) state; it showed a native-like secondary structure without specific side-chain tertiary structure, and the hydrodynamic radius determined by pulse field gradient NMR was only 20% larger than that of the native state. The accumulation of the pH4 intermediate is very analogous to the behavior of apomyoglobin, for which the pH4 MG has been well characterized, although β2m, a β-protein, is structurally very different from α-helical apomyoglobin. NMR pH titration of histidine residues of β2m has also indicated that His84 has an abnormally low pK(a) value in the native state. From the pH dependence of the unfolding transition, the protonations of this histidine and 10 weakly abnormal carboxylates triggered the transition from the native to the MG state. This behavior is again analogous to that of apomyoglobin, suggesting a common mechanism of production of the pH4 MG. In contrast to the folding of apomyoglobin, in which the MG was equivalent to the burst-phase kinetic folding intermediate, the burst-phase refolding intermediate of β2m, detected by stopped-flow circular dichroism, was significantly more structured than the pH4 intermediate. It is proposed that the folding of β2m from its acid-denatured state takes place in the following order: denatured state→MG→burst-phase intermediate→native state. PMID:23154171

  18. beta2 adrenoceptor gene polymorphisms in cystic fibrosis lung disease.

    PubMed

    Büscher, Rainer; Eilmes, Katrin Jennifer; Grasemann, Hartmut; Torres, Brian; Knauer, Nicola; Sroka, Karin; Insel, Paul A; Ratjen, Felix

    2002-07-01

    The cystic fibrosis membrane conductance regulator can be activated through beta2-adrenoceptor (beta2AR) stimulation. We tested the hypothesis that coding sequence polymorphisms in the beta2AR gene contribute to the disease state in patients with cystic fibrosis. The Arg16Gly, Gln27Glu, and Thr164Ile beta2AR polymorphisms were studied by specific polymerase chain reaction and restriction fragment length polymorphism analysis in 126 cystic fibrosis patients. Forced expiratory volume in 1 s was significantly (P < 0.05) reduced in cystic fibrosis patients carrying the Gly16 allele in either homozygous or heterozygous form (Gly16Gly + Arg16Gly) compared to patients homozygous for the Arg16 allele (60.3 +/- 3.5% versus 75.7 +/- 4.9% predicted). Similarly, forced vital capacity and flows at lower lung volumes were significantly (P < 0.05 and P < 0.01) lower in cystic fibrosis patients carrying the Gly16 allele. In addition, the Gly16 allele was associated with a greater 5 year decline in pulmonary function (P < 0.01). Bronchodilator responses to albuterol were not significantly different between the groups. The Thr164Ile variant was found in four patients; these patients had markedly reduced pulmonary function. Isoproterenol-stimulated cyclic AMP formation was significantly blunted in cystic fibrosis patients carrying either the Gly16 allele or Thr164Ile genotype compared to cystic fibrosis patients homozygous for the respective Arg16 alleles. These data provide the first evidence suggesting that polymorphisms of the beta2AR gene contribute to clinical severity and disease progression in cystic fibrosis.

  19. Evolution of T cell receptor genes. Extensive diversity of V beta families in the Mexican axolotl.

    PubMed

    Fellah, J S; Kerfourn, F; Charlemagne, J

    1994-11-15

    We have cloned 36 different rearranged variable regions (V beta) genes encoding the beta-chain of the T cell receptor in an amphibian species, Ambystoma mexicanum (the Mexican axolotl). Eleven different V beta segments were identified, which can be classified into 9 families on the basis of a minimum of 75% nucleotide identity. All the cloned V beta segments have the canonical features of known mammalian and avian V beta, including conserved residues Cys23, Trp34, Arg69, Tyr90, and Cys92. There seems to be a greater genetic distance between the axolotl V beta families than between the different V beta families of any mammalian species examined to date: most of the axolotl V beta s have fewer than 35% identical nucleotides and the less related families (V beta 4 and V beta 8) have no more than 23.2% identity (13.5% at the amino acid level). Despite their great mutual divergence, several axolotl V beta are sequence-related to some mammalian V beta genes, like the human V beta 13 and V beta 20 segments and their murine V beta 8 and V beta 14 homologues. However, the axolotl V beta 8 and V beta 9 families are not significantly related to any other V beta sequence at the nucleotide level and show limited amino acid similarity to mammalian V alpha, V kappa III, or VH sequences. The detection of nine V beta families among 35 randomly cloned V beta segments suggests that the V beta gene repertoire in the axolotl is probably larger than presently estimated. PMID:7963525

  20. Sequence and evolution of HLA-DR7- and -DRw53-associated beta-chain genes.

    PubMed

    Young, J A; Wilkinson, D; Bodmer, W F; Trowsdale, J

    1987-07-01

    cDNA clones representing products of the DR7 and DRw53 beta-chain genes were isolated from the human B-lymphoblastoid cell line MANN (DR7,DRw53,DQw2, DPw2). The DRw53 beta sequence was identical to a DRw53 beta sequence derived from cells with a DR4 haplotype. In contrast, the DR7 beta sequence was as unrelated to DR4 beta sequence as it was to other DR beta-related genes, except at the 3'-untranslated region. These results suggest that the DR7 and DR4 haplotypes may have been derived relatively recently from a common ancestral haplotype and that the DR4 and DR7 beta-chain genes have undergone more rapid diversification in their beta 1 domains, most probably as a result of natural selection, than have the DRw53 beta-chain genes. Short tracts of sequence within the DR7 and DRw53 beta 1 domains were shared with other DR beta sequences, indicating that exchanges of genetic information between beta 1 domains of DR beta-related genes have played a part in their evolution. Serological analysis of mouse L-cell transfectants expressing surface HLA-DR7 molecules, confirmed by antibody binding and allelic sequence comparisons, identified amino acid residues that may be critical to the binding of a monomorphic DR- and DP-specific monoclonal antibody.

  1. A phase I/II clinical trial of beta-globin gene therapy for beta-thalassemia.

    PubMed

    Bank, Arthur; Dorazio, Ronald; Leboulch, Philippe

    2005-01-01

    Recent success in the long-term correction of mouse models of human beta-thalassemia and sickle cell anemia by lentiviral vectors and evidence of high gene transfer and expression in transduced human hematopoietic cells have led to a first clinical trial of gene therapy for the disease. A LentiGlobin vector containing a beta-globin gene (beta(A-T87Q)) that produces a hemoglobin (Hbbeta(A-T87Q)) that can be distinguished from normal hemoglobin will be used. The LentiGlobin vector is self-inactivating and contains large elements of the beta-globin locus control region as well as chromatin insulators and other features that should prevent untoward events. The study will be done in Paris with Eliane Gluckman as the principal investigator and Philippe Leboulch as scientific director. PMID:16339679

  2. Lactogenic hormonal induction of long distance interactions between beta-casein gene regulatory elements

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lactogenic hormone regulation of beta-casein gene expression in mammary epithelial cells provides, an excellent model in which to study the mechanisms by which steroid and peptide hormone signaling control gene expression. Prolactin- and glucocorticoid-mediated induction of beta-casein gene express...

  3. Hepatocyte nuclear factor 3beta is involved in pancreatic beta-cell-specific transcription of the pdx-1 gene.

    PubMed Central

    Wu, K L; Gannon, M; Peshavaria, M; Offield, M F; Henderson, E; Ray, M; Marks, A; Gamer, L W; Wright, C V; Stein, R

    1997-01-01

    The mammalian homeobox gene pdx-1 is expressed in pluripotent precursor cells in the dorsal and ventral pancreatic bud and duodenal endoderm, which will produce the pancreas and the rostral duodenum. In the adult, pdr-1 is expressed principally within insulin-secreting pancreatic islet beta cells and cells of the duodenal epithelium. Our objective in this study was to localize sequences within the mouse pdx-1 gene mediating selective expression within the islet. Studies of transgenic mice in which a genomic fragment of the mouse pdx-1 gene from kb -4.5 to +8.2 was used to drive a beta-galactosidase reporter showed that the control sequences sufficient for appropriate developmental and adult specific expression were contained within this region. Three nuclease-hypersensitive sites, located between bp -2560 and -1880 (site 1), bp -1330 and -800 (site 2), and bp -260 and +180 (site 3), were identified within the 5'-flanking region of the endogenous pdx-1 gene. Pancreatic beta-cell-specific expression was shown to be controlled by sequences within site 1 from an analysis of the expression pattern of various pdr-1-herpes simplex virus thymidine kinase promoter expression constructs in transfected beta-cell and non-beta-cell lines. Furthermore, we also established that this region was important in vivo by demonstrating that expression from a site 1-driven beta-galactosidase reporter construct was directed to islet beta-cells in transgenic mice. The activity of the site 1-driven constructs was reduced substantially in beta-cell lines by mutating a hepatocyte nuclear factor 3 (HNF3)-like site located between nucleotides -2007 and -1996. Gel shift analysis indicated that HNF3beta present in islet beta cells binds to this element. Immunohistochemical studies revealed that HNF3beta was present within the nuclei of almost all islet beta cells and subsets of pancreatic acinar cells. Together, these results suggest that HNF3beta, a key regulator of endodermal cell lineage

  4. Genomic evidence for independent origins of beta-like globin genes in monotremes and therian mammals.

    PubMed

    Opazo, Juan C; Hoffmann, Federico G; Storz, Jay F

    2008-02-01

    Phylogenetic reconstructions of the beta-globin gene family in vertebrates have revealed that developmentally regulated systems of hemoglobin synthesis have been reinvented multiple times in independent lineages. For example, the functional differentiation of embryonic and adult beta-like globin genes occurred independently in birds and mammals. In both taxa, the embryonic beta-globin gene is exclusively expressed in primitive erythroid cells derived from the yolk sac. However, the "epsilon-globin" gene in birds is not orthologous to the epsilon-globin gene in mammals, because they are independently derived from lineage-specific duplications of a proto beta-globin gene. Here, we report evidence that the early and late expressed beta-like globin genes in monotremes and therian mammals (marsupials and placental mammals) are the products of independent duplications of a proto beta-globin gene in each of these two lineages. Results of our analysis of genomic sequence data from a large number of vertebrate taxa, including sequence from the recently completed platypus genome, reveal that the epsilon- and beta-globin genes of therian mammals arose via duplication of a proto beta-globin gene after the therian/monotreme split. Our analysis of genomic sequence from the platypus also revealed the presence of a duplicate pair of beta-like globin genes that originated via duplication of a proto beta-globin gene in the monotreme lineage. This discovery provides evidence that, in different lineages of mammals, descendent copies of the same proto beta-globin gene may have been independently neofunctionalized to perform physiological tasks associated with oxygen uptake and storage during embryonic development.

  5. Expression of a mouse metallothionein-Escherichia coli. beta. -galactosidase fusion gene (MT-. beta. gal) in early mouse embryos

    SciTech Connect

    Stevens, M.E.; Meneses, J.J.; Pedersen, R.A. )

    1989-08-01

    The authors have microinjected DNA containing the inducible mouse metallothionein-I (MT-I) promoter, coupled to the structural gene for Escherichia coli {beta}-galactosidase (lacZ), into the pronuclei of one-cell mouse embryos. A qualitative histochemical assay, with 5-bromo-4-chloro-3-indolyl {beta}-D-galactopyranoside (X-Gal) as a substrate, was used to detect expression of lacZ at several preimplantation stages. They observed staining indicative of exogenous {beta}-galactosidase activity in 5-17% of DNA-injected embryos assayed at preimplantation stages after 16-24 h treatment with ZnSO{sub 4}. Thus, lacZ can be used as an indicator gene for promoter function during early mouse embryogenesis, and the incorporation of the MT-I promoter into fusion genes can be a useful means of controlling the expression of exogenous genes in preimplantation mouse embryos.

  6. The first intron of the murine beta-casein gene contains a functional promoter.

    PubMed

    Kolb, Andreas

    2003-07-11

    Caseins are the major milk proteins in most mammals. Together with calcium and phosphate they form the casein micelle. The corresponding casein genes are clustered in mammalian genomes and their expression is coordinately regulated with regard to developmental and tissue specificity. Casein gene promoters are responsive to lactogenic hormones, cell-matrix, and cell-cell interactions. Transcriptional enhancer elements are found in the 5(') upstream regions of casein genes but have also been detected in the first intron of the bovine beta-casein gene. We show here that the first intron of the murine beta-casein gene has three discernible functions. First, transcriptional enhancer elements present in the intron increase the basal activity of the beta-casein promoter. In addition, these intronic enhancer elements augment the induction of the beta-casein promoter by lactogenic hormones. Finally, we demonstrate that the first intron of the murine beta-casein gene contains a functional promoter.

  7. Intestinal lactase as an autologous beta-galactosidase reporter gene for in vivo gene expression studies.

    PubMed

    Salehi, Siamak; Eckley, Lorna; Sawyer, Greta J; Zhang, Xiaohong; Dong, Xuebin; Freund, Jean-Noel; Fabre, John W

    2009-01-01

    Intestinal lactase has potential as an autologous beta-galactosidase reporter gene for long-term gene expression studies in vivo, using chromogenic, luminescent, and fluorogenic substrates developed for Escherichia coli beta-galactosidase. In normal rat tissues, reactivity with a chromogenic fucopyranoside (X-Fuc, the preferred substrate of lactase) was present only at the lumenal surface of small intestine epithelial cells. Full-length lactase (domains I-IV), mature lactase (domains III and IV), and a cytosolic form of mature lactase (domains III and IV, without the signal sequence or transmembrane region) were evaluated. Transfection of HuH-7 cells in vitro, and hydrodynamic gene delivery to the liver in vivo, resulted in excellent gene expression. The full-length and mature (homodimeric, membrane-bound) forms reacted strongly with X-Fuc but not with the corresponding galactopyranoside (X-Gal). However, the presumptively monomeric cytosolic lactase unexpectedly reacted equally well with both substrates. The fluorogenic substrate fluorescein-di-beta-D-galactopyranoside was cleaved by cytosolic lactase, but not by full-length or mature lactase. Full-length lactase, when expressed ectopically in hepatocytes in vivo, localized exclusively to the bile canalicular membrane. Intestinal lactase is highly homologous in mice, rats, and humans and has considerable potential for evaluating long-term gene expression in experimental animals and the clinic.

  8. Total beta-globin gene deletion has high frequency in Filipinos

    SciTech Connect

    Patrick, N.; Miyakawa, F.; Hunt, J.A.

    1994-09-01

    The distribution of {beta}-thalassemia [{beta}{sup Th}] mutations is unique to each ethnic group. Most mutations affect one or a few bases; large deletions have been rare. Among families screened in Hawaii, [{beta}{sup Th}] heterozygotes were diagnosed by microcytosis, absence of abnormal hemoglobins on isoelectric focusing, and raised Hb A{sub 2} by chromatography. Gene frequency for {beta}{sup Th} was 0.02 in Filipinos. In Filipinos, polymerase chain reaction [PCR] with denaturing gradient gel electrophoresis for {beta}{sup Th} mutations detected a mutation in only 6 of 42 {beta}{sup Th} heterozygotes; an IVS2-666 C/T polymorphism showed non-heterozygosity in 37 and heterozygosity in only 5 of these {beta}{sup Th} heterozygotes. One {beta}{sup Th}/{beta}{sup Th} major patient and his mother had no mutation detected by allele-specific oligomer hybridization; PCR failed to amplify any DNA from his {beta}-globin gene. After a total {beta}-globin gene deletion [{beta}{sup Del}] was found in a Filipino family in Ontario, specific PCR amplification for {beta}{sup Del} detected this in 43 of 53 {beta}{sup Th} Filipino samples tested; the above {beta}{sup Th}/{beta}{sup Th} patient was a ({beta}{sup Del}/{beta}{sup Del}) homozygote. The {beta}{sup Del} may account for over 60% of all {beta}{sup Th} alleles in Filipinos; this is the highest proportion of a deletion {beta}{sup Th} mutation reported from any population. Most but not all {beta}{sup Del} heterozygotes had high Hb F [5.13 {plus_minus} 3.94 mean {plus_minus} 1 s.d.] compared to the codon 41/42 four base deletion common in Chinese [2.30 {plus_minus} 0.86], or to {beta}{sup Th} heterozygotes with normal {alpha}-globin genes [2.23 {plus_minus} 0.80].

  9. Molecular cloning and characterization of human pyruvate dehydrogenase. beta. subunit gene

    SciTech Connect

    Koike, Kichiko; Urata, Yoshishige; Koike, Masahiko )

    1990-08-01

    A genomic clone encompassing the entire gene for the human pyruvate dehydrogenase {beta} subunit (PDH{beta}) has been isolated by screening a leukocyte genomic library with a nick-translated human foreskin fibroblast PDH{beta} cDNA probe. The 18-kilobase clone was characterized by restriction enzyme analysis, extensive DNA sequencing, and primer-extension analysis. The PDH{beta} structural gene is composed of 10 exons and 9 introns. All intron-exon splice junctions follow the GT/AG rule. The Alu family was found in introns 2 and 8. The 5{prime} flanking region of the PDH{beta} gene contains a CAAT consensus promoter sequence but no TATA sequence. Primer-extension analysis indicated the PDH{beta} gene transcription start site is an adenine residue located 132 bases upstream from the initiation codon in exon 1.

  10. Assignment of the {beta}-arrestin 1 gene (ARRB1) to human chromosome 11q13

    SciTech Connect

    Calabrese, G.; Morizio, E.; Palka, G.

    1994-11-01

    Two types of proteins play a major role in determining homologous desensitization of G-coupled receptors: {beta}-adrenergic receptor kinase ({beta}ARK), which phosphorylates the agonist-occupied receptor, and its functional cofactor, {beta}-arrestin. {beta}ARK is a member of a multigene family, consisting of six known subtypes, which have also been named G-protein-coupled receptor kinases (GRK 1 to 6) due to the apparently unique functional association of such kinases with this receptor family. The gene for {beta}ARK1 has been localized to human chromosome 11q13. The four members of the arrestin/{beta}-arrestin gene family identified so far are arrestin, X-arrestin, {beta}-arrestin 1, and {beta}-arrestin 2. Here the authors report the chromosome mapping of the human gene for {beta}-arrestin 1 (ARRB1) to chromosome 11q13 by fluorescence in situ hybridization (FISH). Two-color FISH confirmed that the two genes coding for the functionally related proteins {beta}ARK1 and {beta}arrestin 1 both map to 11q13. 16 refs., 1 fig., 1 tab.

  11. Sequences of CAZ-3 and CTX-2 extended-spectrum beta-lactamase genes.

    PubMed Central

    Chanal, C; Sirot, D; Malaure, H; Poupart, M C; Sirot, J

    1994-01-01

    The nucleotide sequences of blaTEM genes coding for the extended-spectrum beta-lactamases CAZ-3 and CTX-2 were determined. The gene for CAZ-3 is identical to blaTEM-12b. The gene for CTX-2 differs from characterized blaTEM genes for extended-spectrum beta-lactamases by a new combination of already known mutations. We propose for CTX-2 the designation TEM-25. PMID:7840586

  12. Chromosome mapping of the human arrestin (SAG), {beta}-arrestin 2 (ARRB2), and {beta}-adrenergic receptor kinase 2 (ADRBK2) genes

    SciTech Connect

    Calabrese, G.; Sallese, M.; Stornaiuolo, A.

    1994-09-01

    Two types of proteins play a major role in determining homologous desensitization of G-coupled receptors: {beta}-adrenergic receptor kinase ({beta}ARK), which phosphorylates the agonist-occupied receptor and its functional cofactor, {beta}-arrestin. Both {beta}ARK and {beta}-arrestin are members of multigene families. The family of G-protein-coupled receptor kinases includes rhodopsin kinase, {beta}ARK1, {beta}ARK2, IT11-A (GRK4), GRK5, and GRK6. The arrestin/{beta}-arrestin gene family includes arrestin (also known as S-antigen), {beta}-arrestin 1, and {beta}-arrestin 2. Here we report the chromosome mapping of the human genes for arrestin (SAG), {beta}arrestin 2 (ARRB2), and {beta}ARK2 (ADRBK2) by fluorescence in situ hybridization (FISH). FISH results confirmed the assignment of the gene coding for arrestin (SAG) to chromosome 2 and allowed us to refine its localization to band q37. The gene coding for {beta}-arrestin 2 (ARRB2) was mapped to chromosome 17p13 and that coding for {beta}ARK2 (ADRBK2) to chromosome 22q11. 17 refs., 1 fig.

  13. Intervening sequence of DNA identified in the structural portion of a mouse beta-globin gene.

    PubMed Central

    Tilghman, S M; Tiemeier, D C; Seidman, J G; Peterlin, B M; Sullivan, M; Maizel, J V; Leder, P

    1978-01-01

    The unusual electron microscopic appearance of a hybrid formed between 9S mouse beta-globin mRNA and its corresponding cloned gene segment is caused by at least one, and possibly two, intervening sequences of DNA that interrupt the mouse beta-globin gene. Such an interpretation is consistent with a paradoxical restriction site pattern previously noted in this gene and with the nucleotide sequence of that portion of the gene that spans both structural and intervening sequences. The large intervening sequence, approximately 550 base pairs in length, occurs in the structural globin sequence and immediately follows the beta-globin codon corresponding to amino acid 104. A smaller, putative intervening sequence is located close to the 5' end of the beta-globin-coding sequence but may reside beyond its initiation codon. The beta-globin gene thus appears to be encoded in two, and possibly three, discontinuous segments. Images PMID:273235

  14. Hemoglobin Cranston, an unstable variant having an elongated beta chain due to nonhomologous crossover between two normal beta chain genes.

    PubMed Central

    Bunn, H F; Schmidt, G J; Haney, D N; Dluhy, R G

    1975-01-01

    An asymptomatic woman was found to have a compensated hemolytic state due to an unstable hemoglobin variant, comprising 35% of the total. Peptide maps of tryptic digests of the abnormal beta chain were identical to those of beta A except that tryptic peptide 15 (Tyr-His-COOH) was absent and a new peptide was detected, containing equivalent amounts of Ser, Ile, Thr, and Lys. Its sequence was determined by manual Edman degradation. An additional hydrophobic peptide isolated by counter-current distribution contained: Asx, Ser, Ala, Tyr, 2 Phe, and 3 Leu. Its sequence was determined on an automatic solid phase sequencer. Digestion with carboxypeptidase A confirmed the C-terminal sequence. Hemoglobin Cranston has an elongated beta chain with the following structure: (see article). This variant is the first "adult" human hemoglobin known to contain isoleucine. It is likely that hemoglobin Cranston arose because of a nonhomologous crossover of two normal beta chain genes, probably during meiosis, with the insertion of two nucleotides (AG) at position 144, resulting in a frame shift. Hemoglobin Cranston provides new information on the structure of the beta chain gene as well as an explanation of both the structure and genetic basis of hemoglobin Tak, the only other elongated beta chain variant that has been described. Images PMID:1059149

  15. Structural organization and transcription of the mouse gastric H+, K(+)-ATPase beta subunit gene.

    PubMed Central

    Canfield, V A; Levenson, R

    1991-01-01

    We have cloned and characterized the mouse gene encoding the beta subunit of H+, K(+)-ATPase (EC 3.6.1.36). The entire 10.5-kilobase transcription unit of the H+,K(+)-ATPase beta subunit gene was cloned in three overlapping cosmids encompassing approximately 46 kilobases of genomic DNA. A tight cluster of transcription initiation sites has been localized 24-25 nucleotides upstream of the translation start site and 28-29 nucleotides downstream of a TATA-like sequence. The H+, K(+)-ATPase beta subunit gene is split into seven exons encoding predicted structural domains of the beta subunit protein. The intracellular amino-terminal and putative transmembrane domains are encoded by individual exons, and the extracellular carboxyl-terminal domain is encoded by five exons. The exon/intron organization of the mouse H+,K(+)-ATPase beta subunit gene is identical to that of the mouse Na+,K(+)-ATPase beta 2 subunit gene. The conservation of genomic organization, together with the high sequence homology, indicates that the mouse H+,K(+)-ATPase beta and Na+,K(+)-ATPase beta 2 subunit genes originated from a common ancestral gene. Images PMID:1654563

  16. Ultrasound-mediated interferon {beta} gene transfection inhibits growth of malignant melanoma

    SciTech Connect

    Yamaguchi, Kazuki; Feril, Loreto B.; Tachibana, Katsuro; Takahashi, Akira; Matsuo, Miki; Endo, Hitomi; Harada, Yoshimi; Nakayama, Juichiro

    2011-07-22

    Highlights: {yields} Successful ultrasound-mediated transfection of melanoma (C32) cells with IFN-{beta} genes both in vitro and in vivo. {yields} Ultrasound-mediated IFN-{beta} transfection inhibited proliferation of melanoma cells in vitro. {yields} Ultrasound-mediated IFN-{beta} transfection inhibited melanoma tumor growth in vivo. -- Abstract: We investigated the effects of ultrasound-mediated transfection (sonotransfection) of interferon {beta} (IFN-{beta}) gene on melanoma (C32) both in vitro and in vivo. C32 cells were sonotransfected with IFN-{beta} in vitro. Subcutaneous C32 tumors in mice were sonicated weekly immediately after intra-tumor injection with IFN-{beta} genes mixed with microbubbles. Successful sonotransfection with IFN-{beta} gene in vitro was confirmed by ELISA, which resulted in C32 growth inhibition. In vivo, the growth ratio of tumors transfected with IFN-{beta} gene was significantly lower than the other experimental groups. These results may lead to a new method of treatment against melanoma and other hard-to-treat cancers.

  17. Characterization of a new beta-lactamase gene from isolates of Vibrio spp. in Korea.

    PubMed

    Jun, Lyu Jin; Kim, Jae Hoon; Jin, Ji Woong; Jeong, Hyun Do

    2012-04-01

    PCR was performed to analyze the beta-lactamase genes carried by ampicillin-resistant Vibrio spp. strains isolated from marine environments in Korea between 2006 and 2009. All 36 strains tested showed negative results in PCR with the primers designed from the nucleotide sequences of various known beta-lactamase genes. This prompted us to screen new beta-lactamase genes. A novel beta-lactamase gene was cloned from Vibrio alginolyticus KV3 isolated from the aquaculture water of Geoje Island of Korea. The determined nucleotide sequence (VAK-3 beta-lactamase) revealed an open reading frame (ORF) of 852 bp, encoding a protein of 283 amino acids (aa), which displayed low homology to any other beta-lactamase genes reported in public databases. The deduced 283 aa sequence of VAK-3, consisting of a 19 aa signal peptide and a 264 aa mature protein, contained highly conserved peptide segments specific to class A beta-lactamases including the specific amino acid residues STFK (62-65), SDN (122-124), E (158), and RTG (226-228). Results from PCR performed with primers specific to the VAK-3 beta-lactamase gene identified 3 of the 36 isolated strains as V. alginolyticus, Vibrio cholerae, and Photobacterium damselae subsp. damselae, indicating the utilization of various beta-lactamase genes including unidentified ones in ampicillin-resistant Vibrio spp. strains from the marine environment. In a mating experiment, none of the isolates transfered the VAK-3 beta-lactamase gene to the Escherichia coli recipient. This lack of mobility, and the presence of a chromosomal acyl-CoA flanking sequence upstream of the VAK-3 beta- lactamase gene, led to the assumption that the location of this new beta-lactamase gene was in the chromosome, rather than the mobile plasmid. Antibiotic susceptibility of VAK-3 beta-lactamase was indicated by elevated levels of resistance to penicillins, but not to cephalosporins in the wild type and E. coli harboring recombinant plasmid pKV-3, compared with those of

  18. Urinary β-2 Microglobulin Levels Sensitively Altered in an Osteomalacia Patient Receiving Add-on Adefovir Dipivoxil Therapy for Hepatitis B Virus Infection.

    PubMed

    Takagi, Junko; Morita, Hiroyuki; Ito, Kiyoaki; Ohashi, Tomohiko; Hirase, Sho; Ito, Tatsuo; Morishima, Takkan; Otake, Kazuo; Yoneda, Masashi

    2016-01-01

    Adefovir dipivoxil (ADV) is effective for hepatitis B virus (HBV) infection; however, ADV may provoke renal injury resulting in osteomalacia, and this side effect is seldom recognized until bone fractures emerge. We herein present a 66-year-old woman with HBV infection who received ADV for 6 years. Although she exhibited no sign of bone fractures, her urinary β-2 microglobulin (β2MG) level increased to 83,837 μg/L and scintigraphy revealed minimal fractures of the third rib. ADV was subsequently reduced and her urinary β2MG rapidly fell to 3,637 μg/L. Conversely, her urinary N-acetyl-β-D-glucosaminidase, and serum phosphate, alkaline phosphatase levels did not respond. PMID:27301512

  19. Selective inhibition of growth-related gene expression in murine keratinocytes by transforming growth factor beta.

    PubMed Central

    Coffey, R J; Bascom, C C; Sipes, N J; Graves-Deal, R; Weissman, B E; Moses, H L

    1988-01-01

    Transforming growth factor beta (TGF beta) is a potent inhibitor of epithelial cell proliferation. A nontumorigenic epidermal growth factor (EGF)-dependent epithelial cell line, BALB/MK, is reversibly growth arrested by TGF beta. TGF beta will also abrogate EGF-stimulated mitogenesis of quiescent BALB/MK cells. Increased levels of calcium (greater than 1.0 mM) will induce differentiation in BALB/MK cells; in contrast, TGF beta-mediated growth inhibition does not result in induction of terminal differentiation. In the present study, the effects of TGF beta and calcium on growth factor-inducible gene expression were examined. TGF beta markedly decreased c-myc and KC gene expression in rapidly growing BALB/MK cells and reduced the EGF induction of c-myc and KC in a quiescent population of cells. TGF beta exerted its control over c-myc expression at a posttranscriptional level, and this inhibitory effect was dependent on protein synthesis. TGF beta had no effect on c-fos gene expression, whereas 1.5 mM calcium attenuated EGF-induced c-fos expression in quiescent cells. Expression of beta-actin, however, was slightly increased in both rapidly growing and EGF-restimulated quiescent BALB/MK cells treated with TGF beta. Thus, in this system, TGF beta selectively reduced expression of certain genes associated with cell proliferation (c-myc and KC), and at least part of the TGF beta effect was at a posttranscriptional level. Images PMID:2463471

  20. Murine retroviruses control class I major histocompatibility antigen gene expression via a trans effect at the transcriptional level.

    PubMed

    Wilson, L D; Flyer, D C; Faller, D V

    1987-07-01

    Moloney murine leukemia virus (M-MuLV) and Moloney murine sarcoma virus (M-MSV) exert a regulatory effect on the class I genes of the murine major histocompatibility complex (MHC). We have previously shown that M-MuLV infection of mouse fibroblasts results in a substantial increase in cell surface expression of H-2K, H-2D, and H-2L proteins, whereas M-MSV, upon coinfection of the same cells, is apparently able to override the MuLV-induced increase in H-2 expression. As a result of this modulation, immune recognition of the infected cells is profoundly altered. Our efforts have been directed toward elucidating the molecular basis for this phenomenon. We report here that stimulation of interferon production as a result of infection with MuLV does not occur and, therefore, is not the cause of MuLV-induced enhancement of MHC expression. Control of H-2 class I and beta 2-microglobulin gene expression by M-MuLV, and probably by M-MSV, takes place at the transcriptional level as indicated by nuclear runoff studies and analysis of steady-state mRNA levels. Our demonstration that M-MuLV controls expression of widely separated endogenous cellular genes (those coding for H-2D, H-2K, H-2L, and beta 2-microglobulin), transfected class I MHC genes, and unintegrated chimeric genes consisting of fragments of class I MHC genes linked to sequences encoding a procaryotic enzyme, chloramphenicol acetyltransferase, suggests that M-MuLV exerts its effect in trans and not by proviral integration in the vicinity of the H-2 gene complex. Finally, we show that the sequences of at least one MHC gene, which are responsive to trans regulation by M-MuLV, lie within 1.2 kilobases upstream of the initiation codon for that gene.

  1. Structure of the three beta-tubulin-encoding genes of the unicellular alga, Polytomella agilis.

    PubMed

    Conner, T W; Thompson, M D; Silflow, C D

    1989-12-14

    The quadriflagellate, unicellular, colorless alga, Polytomella agilis, contains several distinct microtubule arrays. To study the genetic basis of microtubule heterogeneity in P. agilis, we characterized its tubulin(Tub)-encoding genes (tub). The three beta tub genes detected in blots of P. agilis DNA were isolated from a genomic library. The structure and organization of the genes were examined by restriction mapping and nucleotide (nt) sequencing. S1 nuclease protection studies showed that all three genes are expressed. The predicted amino acid (aa) sequences are more than 98% conserved with the Chlamydomonas reinhardtii and Volvox carteri beta-Tubs, underscoring the close phylogenetic relationship of these species. Evolutionary divergence among the P. agilis genes is demonstrated by differences in intron number, nt sequences in noncoding regions, and silent nt substitutions in the coding regions. However, the proteins encoded by the beta 1 and beta 3 tub genes are identical; the beta 2 gene product differs by one conservative aa substitution. These results are in striking contrast to the C-terminal aa diversity reported within beta tub gene families in animal, higher plant and fungal systems. The data support the hypothesis that those tub genes whose products assemble into axonemal microtubules are subject PMID:2533130

  2. Inhibition of spermidine synthase gene expression by transforming growth factor-beta 1 in hepatoma cells.

    PubMed Central

    Nishikawa, Y; Kar, S; Wiest, L; Pegg, A E; Carr, B I

    1997-01-01

    We screened genes responsive to transforming growth factor-beta (TGF-beta 1) protein in a human hepatoma cell line (Hep3B) using a PCR-mediated differential display technique, in order to investigate the mechanisms involved in TGF-beta-induced growth suppression. We found a gene that was down-regulated by TGF-beta 1 to be completely identical in an approx. 620 bp segment to the gene for the enzyme spermidine synthase, which mediates the conversion of putrescine into spermidine. Both spermidine synthase mRNA expression and its enzyme activity were decreased after TGF-beta 1 treatment of Hep3B cells. The inhibition of spermidine synthase gene expression by TGF-beta 1 protein was also observed in other hepatoma cell lines. The expression of genes for other biosynthetic enzymes in polyamine metabolism (ornithine decarboxylase and S-adenosylmethionine decarboxylase) was also inhibited to the same extent as for spermidine synthase, while the gene expression of spermidine/spermine N1-acetyltransferase, a catabolic enzyme, was relatively resistant to TGF-beta 1. Spermine levels in Hep3B cells were decreased by TGF-beta 1 treatment, although the levels of spermidine and putrescine were unchanged, probably due to compensation by remaining spermidine/spermine N1-acetyltransferase activity. Exogenously added spermidine or spermine, but not putrescine, partially antagonized the growth-inhibitor effects of TGF-beta 1 on Hep3B cells. Our data suggest that down-regulation of gene expression of the enzymes involved in polyamine metabolism, including spermidine synthase, may be associated with the mechanism of TGF-beta-induced growth suppression. PMID:9020892

  3. Tumor-produced, active Interleukin-1 {beta} regulates gene expression in carcinoma-associated fibroblasts

    SciTech Connect

    Dudas, Jozsef; Fullar, Alexandra; Bitsche, Mario; Schartinger, Volker; Kovalszky, Ilona; Sprinzl, Georg Mathias; Riechelmann, Herbert

    2011-09-10

    Recently we described a co-culture model of periodontal ligament (PDL) fibroblasts and SCC-25 lingual squamous carcinoma cells, which resulted in conversion of normal fibroblasts into carcinoma-associated fibroblasts (CAFs), and in epithelial-mesenchymal transition (EMT) of SCC-25 cells. We have found a constitutive high interleukin-1{beta} (IL1-{beta}) expression in SCC-25 cells in normal and in co-cultured conditions. In our hypothesis a constitutive IL1-{beta} expression in SCC-25 regulates gene expression in fibroblasts during co-culture. Co-cultures were performed between PDL fibroblasts and SCC-25 cells with and without dexamethasone (DEX) treatment; IL1-{beta} processing was investigated in SCC-25 cells, tumor cells and PDL fibroblasts were treated with IL1-{beta}. IL1-{beta} signaling was investigated by western blot and immunocytochemistry. IL1-{beta}-regulated genes were analyzed by real-time qPCR. SCC-25 cells produced 16 kD active IL1-{beta}, its receptor was upregulated in PDL fibroblasts during co-culture, which induced phosphorylation of interleukin-1 receptor-associated kinase-1 (IRAK-1), and nuclear translocalization of NF{kappa}B{alpha}. Several genes, including interferon regulatory factor 1 (IRF1) interleukin-6 (IL-6) and prostaglandin-endoperoxide synthase 2 (COX-2) were induced in CAFs during co-culture. The most enhanced induction was found for IL-6 and COX-2. Treatment of PDL fibroblasts with IL1-{beta} reproduced a time- and dose-dependent upregulation of IL1-receptor, IL-6 and COX-2. A further proof was achieved by DEX inhibition for IL1-{beta}-stimulated IL-6 and COX-2 gene expression. Constitutive expression of IL1-{beta} in the tumor cells leads to IL1-{beta}-stimulated gene expression changes in tumor-associated fibroblasts, which are involved in tumor progression. -- Graphical abstract: SCC-25 cells produce active, processed IL1-{beta}. PDL fibroblasts possess receptor for IL1-{beta}, and its expression is increased 4.56-times in the

  4. A beta-galactosidase gene is expressed during mature fruit abscission of 'Valencia' orange (Citrus sinensis).

    PubMed

    Wu, Zhencai; Burns, Jacqueline K

    2004-07-01

    beta-galactosidases have been detected in a wide range of plants and are characterized by their ability to hydrolyse terminal non-reducing beta-D-galactosyl residues from beta-D-galactosides. These enzymes have been detected in a wide range of plant organs and tissues. In a search for differentially expressed genes during the abscission process in citrus, sequences encoding beta-galactosidase were identified. Three cDNA fragments of a beta-galactosidase gene were isolated from a cDNA subtraction library constructed from mature fruit abscission zones 48 h after the application of a mature fruit-specific abscission agent, 5-chloro-3-methyl-4-nitro-1H-pyrazole (CMN-pyrazole). Based on sequence information derived from these fragments, a full-length cDNA of 2847 nucleotides (GenBank accession number AY029198) encoding beta-galactosidase was isolated from mature fruit abscission zones by 5'- and 3'-RACE approaches. The beta-galactosidase cDNA encoded a protein of 737 amino acid residues with a calculated molecular weight of 82 kDa. The deduced protein was highly homologous to plant beta-galactosidases expressed in fruit ripening. Southern blot analysis demonstrated that at least two closely related beta-galactosidase genes were present in 'Valencia' orange. Temporal expression patterns in mature fruit abscission zones indicated beta-galactosidase mRNA was detected 48 h after treatment of CMN-pyrazole and ethephon in mature fruit abscission zones. beta-galactosidase transcripts were detected in leaf abscission zones only after ethephon application. The citrus beta-galactosidase was expressed in stamens and petals of fully opened flowers and young fruitlets. The results suggest that this beta-galactosidase may play a role during abscission as well as early growth and development processes in flowers and fruitlets.

  5. Beta-lactamase genes of the penicillin-susceptible Bacillus anthracis Sterne strain.

    PubMed

    Chen, Yahua; Succi, Janice; Tenover, Fred C; Koehler, Theresa M

    2003-02-01

    Susceptibility to penicillin and other beta-lactam-containing compounds is a common trait of Bacillus anthracis. Beta-lactam agents, particularly penicillin, have been used worldwide to treat anthrax in humans. Nonetheless, surveys of clinical and soil-derived strains reveal penicillin G resistance in 2 to 16% of isolates tested. Bacterial resistance to beta-lactam agents is often mediated by production of one or more types of beta-lactamases that hydrolyze the beta-lactam ring, inactivating the antimicrobial agent. Here, we report the presence of two beta-lactamase (bla) genes in the penicillin-susceptible Sterne strain of B. anthracis. We identified bla1 by functional cloning with Escherichia coli. bla1 is a 927-nucleotide (nt) gene predicted to encode a protein with 93.8% identity to the type I beta-lactamase gene of Bacillus cereus. A second gene, bla2, was identified by searching the unfinished B. anthracis chromosome sequence database of The Institute for Genome Research for open reading frames (ORFs) predicted to encode beta-lactamases. We found a partial ORF predicted to encode a protein with significant similarity to the carboxy-terminal end of the type II beta-lactamase of B. cereus. DNA adjacent to the 5' end of the partial ORF was cloned using inverse PCR. bla2 is a 768-nt gene predicted to encode a protein with 92% identity to the B. cereus type II enzyme. The bla1 and bla2 genes confer ampicillin resistance to E. coli and Bacillus subtilis when cloned individually in these species. The MICs of various antimicrobial agents for the E. coli clones indicate that the two beta-lactamase genes confer different susceptibility profiles to E. coli; bla1 is a penicillinase, while bla2 appears to be a cephalosporinase. The beta-galactosidase activities of B. cereus group species harboring bla promoter-lacZ transcriptional fusions indicate that bla1 is poorly transcribed in B. anthracis, B. cereus, and B. thuringiensis. The bla2 gene is strongly expressed in B

  6. The isolation and characterization of beta-glucosidase gene and beta-glucosidase of Trichoderma viride: Progress report

    SciTech Connect

    Stafford, D.W.; Lunblad, R.L.

    1981-05-01

    We have demonstrated the induction by sophorose of ..beta..-glucosidase and other cellulases in Trichoderma cultures, isolated large quantities of intact RNA from induced and noninduced cultures, isolated large quantities of high molecular weight DNA free from contaminating polysaccarides and obtained about 3000 recombinant clones containing inserts, presumably of restriction enzyme cleaved Trichoderma DNA. Additionally we have examined the effect of sophorose on the ..beta..-glucosidase of Sporotrichum pulverentum, established an in vitro translation system, and prepared enzymes from the bacterium Oerskovia which will aid in attempts to insert ethanol producing genes into Trichoderma. 28 refs., 2 figs.

  7. Expression of a preproinsulin-beta-galactosidase gene fusion in mammalian cells.

    PubMed Central

    Nielsen, D A; Chou, J; MacKrell, A J; Casadaban, M J; Steiner, D F

    1983-01-01

    As an approach to the study of mammalian gene expression, the promoters and translation initiation regions of the rat preproinsulin II and the simian virus 40 early genes were fused to the structural gene of Escherichia coli beta-galactosidase, a sensitive probe for gene expression. These fusions were introduced into COS-7 cells, a simian virus 40 large tumor-antigen-producing monkey kidney cell line, where they directed the synthesis of enzymatically active hybrid beta-galactosidase proteins. Conditions for transfection were varied to optimize the expression of beta-galactosidase activity in the transfected cells. The pH optimum of this activity was found to be 7.0, the same as that of native E. coli beta-galactosidase and distinct from the major lysosomal "acid" beta-galactosidase. The fused preproinsulin-beta-galactosidase was further characterized by gel electrophoresis of nondenatured cell extracts stained by a fluorogenic substrate and by immunoprecipitation and gel electrophoresis of 3H-labeled cell proteins. These results all indicate that fully active tetrameric beta-galactosidase hybrids can be produced in mammalian cells. The expression of preproinsulin-beta-galactosidase activity was measured in the presence of high glucose, insulin, dexamethasone, or epidermal growth factor but no regulatory changes were observed. Images PMID:6310564

  8. Effect of +Gz on plasma levels of calcitonin gene related peptide, endothelin and renal function in pilots.

    PubMed

    Dai, Y; Ji, G; Dai, D; Wang, X; Xiao, L

    1998-02-01

    The effect of positive acceleration on plasma levels of calcitonin gene related peptide (CGRP), and endothelin as well as renal function in pilots were observed in this study. 20 pilots were exposed to +2.5 Gz 10 s and +3.0 Gz 10 s with an interval of 5 min without anti-G suits. Samples of plasma and serum were taken 2Omin before and after exposure. Plasma levels of CGRP and endothelin after the exposure were significantly increased (P<0.01), but alkaline phosphatase(AKP), blood levels of beta 2-microglobulin(beta 2-MG), Ca2+ in serum showed no significant change (P>0.05) as compared with those before exposure. There was a correlation between CGRP and endothlin (r=0.772, P<0.01). It is concluded that positive acceleration(+2.5, +3.0Gz) could increase plasma levels of CGRP and endothlin but did not affect renal function.

  9. Functional study of the equine beta-casein and kappa-casein gene promoters.

    PubMed

    Lenasi, Tina; Kokalj-Vokac, Nadja; Narat, Mojca; Baldi, Antonella; Dovc, Peter

    2005-01-01

    Casein genes are expressed in a tissue-specific and highly coordinated manner. The main goals of casein gene promoter studies are to unravel cis- and trans-acting factors involved in the complex signalling pathway controlling milk production, and to explore the possibility of using these promoters for tissue-specific production of heterologous proteins in the mammary gland. Here we present a comparative study of the equine beta-casein and kappa-casein gene proximal promoters. In order to confirm the assumption that in the horse, as in other mammalian species, casein genes are organized in a cluster located on a single chromosome, we performed in situ hybridization of pro-metaphase chromosomes with two BAC clones containing different equine casein genes. Sequence analysis of the beta-casein and kappa-casein gene proximal promoters revealed binding sites for activators (STAT5, GRE, NF1, MAF) and repressors (YY1, PMF), characteristic for casein genes. The alignments of casein gene promoters revealed the highest sequence identity in the proximal promoter region between the equine and human beta-casein gene promoters. We directly compared the activity of equine beta-casein and kappa-casein gene promoters in vitro using bovine mammary gland cell line BME-UV1. In this system, the kappa-casein gene proximal promoter activated the reporter gene expression more efficiently than the beta-casein gene promoter of approximately the same length. The 810 bp of beta-casein promoter activated the reporter gene expression more efficiently than the long fragment (1920 bp) and the 1206 bp fragment of the same promoter, which included also 396 bp of 5' UTR.

  10. Molecular cloning and characterization of mutant and wild-type human. beta. -actin genes

    SciTech Connect

    Leavitt, J.; Gunning, P.; Porreca, P.; Ng, S.Y.; Lin, C.H.; Kedes, L.

    1984-10-01

    There are more than 20 ..beta..-actin-specific sequences in the human genome, many of which are pseudogenes. To facilitate the isolation of potentially functional ..beta..-actin genes, they used the new method of B. Seed for selecting genomic clones by homologous recombination. A derivative of the ..pi..VX miniplasmid, ..pi..AN7..beta..1, was constructed by insertion of the 600-base-pair 3' untranslated region of the ..beta..-actin mRNA expressed in human fibroblasts. Five clones containing ..beta..-actin sequences were selected from an amplified human fetal gene library by homologous recombination between library phage and the miniplasmid. One of these clones contained a complete ..beta..-actin gene with a coding sequence identical to that determined for the mRNA of human fibroblasts. A DNA fragment consisting of mostly intervening sequences from this gene was then use to identify 13 independent recombinant copies of the analogous gene from two specially constructed gene libraries, each containing one of the two types of mutant ..beta..-actin genes found in a line of neoplastic human fibroblasts. The amino acid and nucleotide sequences encoded by the unmutated gene predict that a guanine-to-adenine transition is responsible for the glycine-to-aspartic acid mutation at codon 244 and would also result in the loss of a HaeIII site. Detection of this HaeIII polymorphism among the fibroblast-derived closed verified the identity of the ..beta..-actin gene expressed in human fibroblasts.

  11. Suitability of Commonly Used Housekeeping Genes in Gene Expression Studies for Space Radiation Research

    NASA Astrophysics Data System (ADS)

    Arenz, A.; Hellweg, C. E.; Bogner, S.; Lau, P.; Baumstark-Khan, C.

    Research on the effects of ionizing radiation exposure involves the use of real-time reverse transcription polymerase chain reaction qRT-PCR for measuring changes in gene expression Several variables needs to be controlled for gene expression analysis -- different amounts of starting material between the samples variations in enzymatic efficiencies of the reverse transcription step and differences in RNA integrity Normalization of the obtained data to an invariant endogenous control gene reference gene is the elementary step in relative quantification strategy There is a strong correlation between the quality of the normalized data and the stability of the reference gene itself This is especially relevant when the samples have been obtained after exposure to radiation qualities inducing different amounts and kinds of damage leading to a cell cycle delay or even to a cell cycle block In order to determine suitable reference genes as internal controls in qRT-PCR assays after exposure to ionizing radiation we studied the gene expression levels of commonly used reference genes in A549 lung cancer cells Expression levels obtained for human beta actin ACTB human beta-2-microglobulin B2M human glyceraldehyde-3-phosphate dehydrogenase GAPDH human porphobilinogen deaminase PBGD human 18S ribosomal RNA 18S rRNA human glucose-6-phosphate dehydrogenase G6PDH human hypoxanthine phosphoribosyl transferase HPRT human ubiquitin C UBC human transferrin TFRC

  12. Identification of a recent recombination event within the human beta-globin gene cluster.

    PubMed Central

    Gerhard, D S; Kidd, K K; Kidd, J R; Egeland, J A; Housman, D E

    1984-01-01

    In a detailed study of inheritance of DNA sequence polymorphism in a large reference pedigree, an individual was identified with an apparent genetic recombination event within the human beta-globin gene cluster. Analysis of the haplotypes of relevant individuals within this pedigree suggested that the meiotic crossing-over event is likely to have occurred within a 19.8-kilobase-pair region of the beta-globin gene cluster. Analysis of other DNA markers closely linked to the beta-globin gene cluster--segment 12 of chromosome 11 (D11S12) and loci for insulin, the cellular oncogene c-Ha-ras, and preproparathyroid hormone--confirmed that a crossover event must have occurred within the region of chromosome 11 between D11S12 and the beta-globin gene cluster. It is suggested that the event observed has occurred within a DNA region compatible with recombinational "hot spots" suggested by population studies. PMID:6096866

  13. No evidence of the human chorionic gonadotropin-beta gene 5 betaV79M polymorphism in Mexican women.

    PubMed

    Dominguez-Lopez, Pablo; Diaz-Cueto, Laura; Ulloa-Aguirre, Alfredo; Lopez-Valle, Miguel Angel; Arechavaleta-Velasco, Fabian

    2008-01-01

    Human chorionic gonadotropin (hCG) is a placental hormone essential for the maintenance of pregnancy. Previous studies have shown a G to A transition in exon 3 of the hCGbeta gene 5, which changes the naturally occurring valine to methionine in codon 79. The frequency of this transition varies among different ethnic groups, being high in USA women, and less common, or absent, in various European populations. The purpose of the present study was to determine the frequency of the betaV79M allelic variant of the beta-subunit of hCG in a Mexican population, and to compare this frequency with those found in other ethnic groups. Placental DNA from 161 pregnant Mexican women was genotyped for the betaV79M by polymerase chain reaction (PCR)-restriction fragments length polymorphism analysis. No polymorphic betaV79M alleles were identified in the population studied. The allele and genotypic frequencies of betaV79M polymorphism in Mexican Mestizo women were significantly different from those reported for the US population, but not from five different European populations. In contrast to what has been found in women from the USA, it seems that the hCGbeta V79M polymorphism is absent or extremely rare in Mexican Mestizo women.

  14. HFE gene: Structure, function, mutations, and associated iron abnormalities.

    PubMed

    Barton, James C; Edwards, Corwin Q; Acton, Ronald T

    2015-12-15

    The hemochromatosis gene HFE was discovered in 1996, more than a century after clinical and pathologic manifestations of hemochromatosis were reported. Linked to the major histocompatibility complex (MHC) on chromosome 6p, HFE encodes the MHC class I-like protein HFE that binds beta-2 microglobulin. HFE influences iron absorption by modulating the expression of hepcidin, the main controller of iron metabolism. Common HFE mutations account for ~90% of hemochromatosis phenotypes in whites of western European descent. We review HFE mapping and cloning, structure, promoters and controllers, and coding region mutations, HFE protein structure, cell and tissue expression and function, mouse Hfe knockouts and knockins, and HFE mutations in other mammals with iron overload. We describe the pertinence of HFE and HFE to mechanisms of iron homeostasis, the origin and fixation of HFE polymorphisms in European and other populations, and the genetic and biochemical basis of HFE hemochromatosis and iron overload.

  15. Sugar-inducible expression of a gene for beta-amylase in Arabidopsis thaliana.

    PubMed Central

    Mita, S; Suzuki-Fujii, K; Nakamura, K

    1995-01-01

    The levels of beta-amylase activity and of the mRNA for beta-amylase in rosette leaves of Arabidopsis thaliana (L.) Heynh. increased significantly, with the concomitant accumulation of starch, when whole plants or excised mature leaves were supplied with sucrose. A supply of glucose or fructose, but not of mannitol or sorbitol, to plants also induced the expression of the gene for beta-amylase, and the induction occurred not only in rosette leaves but also in roots, stems, and bracts. These results suggest that the gene for beta-amylase of Arabidopsis is subject to regulation by a carbohydrate metabolic signal, and expression of the gene in various tissues may be regulated by the carbon partitioning and sink-source interactions in the whole plant. The sugar-inducible expression of the gene in Arabidopsis was severely repressed in the absence of light. The sugar-inducible expression in the light was not inhibited by 3(3,4-dichlorophenyl)-1,1-dimethylurea or by chloramphenicol, but it was inhibited by cycloheximide. These results suggest that a light-induced signal and de novo synthesis of proteins in the cytoplasm are involved in the regulation. A fusion gene composed of the 5' upstream region of the gene for beta-amylase from Arabidopsis and the coding sequence of beta-glucuronidase showed the sugar-inducible expression in a light-dependent manner in rosette leaves of transgenic Arabidopsis. PMID:7716246

  16. Localization of two potassium channel {beta} subunit genes, KCNA1B and KCNA2B

    SciTech Connect

    Schultz, D.; Smith, L.; Thayer, M.

    1996-02-01

    The gating properties and current amplitudes of mammalian voltage-activated Shaker potassium channels are modulated by at least two associated {beta} subunits (Kv{beta}1.1 and Kv{beta}1.2). The human Kv{beta}1.1 gene (KCNA1B) resides on chromosome 3, as indicated by somatic cell hybrid mapping. More precise localization of KCNA1B to 3q26.1 was obtained with fluorescence in situ hybridization (FISH) and was corroborated by PCR screening of the CEPH YAC library. The human Kv{beta}1.2 gene (KCNA2B) resides on chromosome 1, as indicated by somatic cell hybrid mapping, and has been localized by FISH to 1p36.3. 20 refs., 2 figs.

  17. Tyrosine dephosphorylation of nuclear proteins mimics transforming growth factor {beta}1 stimulation of {alpha}2(I) collagen gene expression

    SciTech Connect

    Greenwel, P.; Hu, Wei; Ramirez, F.; Kohanski, R.A.

    1995-12-01

    This report describes how the transforming growth factor {beta}1 (TGF-{beta}1) stimulates the transcription of the gene coding for collagen I (COL1A2). The report goes on to correlate tyrosine dephosphorylation, increased binding of a transcriptional complex and TGF-{beta}1 stimulation of gene expression. 33 refs., 8 figs., 1 tab.

  18. Differential expression of alpha- and beta-expansin genes in the elongating leaf of Festuca pratensis.

    PubMed

    Reidy, B; McQueen-Mason, S; Nösberger, J; Fleming, A

    2001-07-01

    Grasses contain a number of genes encoding both alpha- and beta-expansins. These cell wall proteins are predicted to play a role in cell wall modifications, particularly during tissue elongation. We report here on the characterisation of five alpha- and three vegetative beta-expansins expressed in the leaf elongation zone (LEZ) of the forage grass, Festuca pratensis Huds. The expression of the predominant alpha-expansin (FpExp2) was localised to the vascular tissue, as was the beta-expansin FpExpB3. Expression of another beta-expansin (FpExpB2) was not localised to vascular tissue but was highly expressed in roots and initiating tillers. This is the first description of vegetative beta-expansin gene expression at the organ and tissue level and also the first evidence of differential expression between members of this gene family. In addition, an analysis of both alpha- and beta-expansin expression along the LEZ revealed no correlation with growth rate distribution, whereas we were able to identify a novel xyloglucan endotransglycosylase (FpXET1) whose expression profile closely mimicked leaf growth rate. These data suggest that alpha- and beta-expansin activities in the grass leaf are associated with tissue differentiation, that expansins involved in leaf growth may represent more minor components of the spectrum of expansin genes expressed in this tissue, and that XETs may be useful markers for the analysis of grass leaf growth.

  19. A Drosophila gene encoding a protein resembling the human. beta. -amyloid protein precursor

    SciTech Connect

    Rosen, D.R.; Martin-Morris, L.; Luo, L.; White, K. )

    1989-04-01

    The authors have isolated genomic and cDNA clones for a Drosophila gene resembling the human {beta}-amyloid precursor protein (APP). This gene produces a nervous system-enriched 6.5-kilobase transcript. Sequencing of cDNAs derived from the 6.5-kilobase transcript predicts an 886-amino acid polypeptide. This polypeptide contains a putative transmembrane domain and exhibits strong sequence similarity to cytoplasmic and extracellular regions of the human {beta}-amyloid precursor protein. There is a high probability that this Drosophila gene corresponds to the essential Drosophila locus vnd, a gene required for embryonic nervous system development.

  20. The exon-intron organization of the human erythroid [beta]-spectrin gene

    SciTech Connect

    Amin, K.M.; Forget, B.G. ); Scarpa, A.L.; Curtis, P.J. ); Winkelmann, J.C. )

    1993-10-01

    The human erythrocyte [beta]-spectrin gene DNA has been cloned from overlapping human genomic phage and cosmid recombinants. The entire erythroid [beta]-spectrin mRNA is encoded by 32 exons that range in size from 49 to 871 bases. The exon/intron junctions have been identified and the exons mapped. There is no correlation between intron positions and the repeat units of 106 amino acids within domain II of the [beta]-spectrin gene. The scatter of the introns over the 17 repeats argues against the 106-amino-acid unit representing a minigene that underwent repeated duplication resulting in the present [beta]-spectrin gene. In fact, the two largest exons, exon 14 (871 bp) and 16 (757 bp), extend over 4 and 3 repeat units of 106 amino acids, respectively, while repeat [beta]10 is encoded by 4 exons. No single position of an intron in the [beta]-spectrin gene is conserved between any of the 17 [beta]-spectrin and 22 [alpha]-spectrin repeat units. The nucleotide sequences of the exon/intron boundaries conform to the consensus splice site sequences except for exon 20, whose 5[prime] donor splice-site sequence begins with GC. The [beta]-spectrin isoform present in the human brain, the skeletal muscle, and the cardiac muscle is an alternatively spliced product of the erythroid [beta]-spectrin gene. This splice site is located within the coding sequences of exon 32 and its utilization in nonerythroid tissues leads to the use of 4 additional downstream exons with a size range of 44 to 530 bp. 55 refs., 3 figs., 3 tabs.

  1. Understanding the mechanisms of ATPase beta family genes for cellular thermotolerance in crossbred bulls

    NASA Astrophysics Data System (ADS)

    Deb, Rajib; Sajjanar, Basavaraj; Singh, Umesh; Alex, Rani; Raja, T. V.; Alyethodi, Rafeeque R.; Kumar, Sushil; Sengar, Gyanendra; Sharma, Sheetal; Singh, Rani; Prakash, B.

    2015-12-01

    Na+/K+-ATPase is an integral membrane protein composed of a large catalytic subunit (alpha), a smaller glycoprotein subunit (beta), and gamma subunit. The beta subunit is essential for ion recognition as well as maintenance of the membrane integrity. Present study was aimed to analyze the expression pattern of ATPase beta subunit genes (ATPase B1, ATPase B2, and ATPase B3) among the crossbred bulls under different ambient temperatures (20-44 °C). The present study was also aimed to look into the relationship of HSP70 with the ATPase beta family genes. Our results demonstrated that among beta family genes, transcript abundance of ATPase B1 and ATPase B2 is significantly ( P < 0.05) higher during the thermal stress. Pearson correlation coefficient analysis revealed that the expression of ATPase Β1, ATPase B2, and ATPase B3 is highly correlated ( P < 0.01) with HSP70, representing that the change in the expression pattern of these genes is positive and synergistic. These may provide a foundation for understanding the mechanisms of ATPase beta family genes for cellular thermotolerance in cattle.

  2. Discovery of five conserved beta -defensin gene clusters using a computational search strategy.

    PubMed

    Schutte, Brian C; Mitros, Joseph P; Bartlett, Jennifer A; Walters, Jesse D; Jia, Hong Peng; Welsh, Michael J; Casavant, Thomas L; McCray, Paul B

    2002-02-19

    The innate immune system includes antimicrobial peptides that protect multicellular organisms from a diverse spectrum of microorganisms. beta-Defensins comprise one important family of mammalian antimicrobial peptides. The annotation of the human genome fails to reveal the expected diversity, and a recent query of the draft sequence with the blast search engine found only one new beta-defensin gene (DEFB3). To define better the beta-defensin gene family, we adopted a genomics approach that uses hmmer, a computational search tool based on hidden Markov models, in combination with blast. This strategy identified 28 new human and 43 new mouse beta-defensin genes in five syntenic chromosomal regions. Within each syntenic cluster, the gene sequences and organization were similar, suggesting each cluster pair arose from a common ancestor and was retained because of conserved functions. Preliminary analysis indicates that at least 26 of the predicted genes are transcribed. These results demonstrate the value of a genomewide search strategy to identify genes with conserved structural motifs. Discovery of these genes represents a new starting point for exploring the role of beta-defensins in innate immunity.

  3. Structure, folding dynamics, and amyloidogenesis of D76N β2-microglobulin: roles of shear flow, hydrophobic surfaces, and α-crystallin.

    PubMed

    Mangione, P Patrizia; Esposito, Gennaro; Relini, Annalisa; Raimondi, Sara; Porcari, Riccardo; Giorgetti, Sofia; Corazza, Alessandra; Fogolari, Federico; Penco, Amanda; Goto, Yuji; Lee, Young-Ho; Yagi, Hisashi; Cecconi, Ciro; Naqvi, Mohsin M; Gillmore, Julian D; Hawkins, Philip N; Chiti, Fabrizio; Rolandi, Ranieri; Taylor, Graham W; Pepys, Mark B; Stoppini, Monica; Bellotti, Vittorio

    2013-10-25

    Systemic amyloidosis is a fatal disease caused by misfolding of native globular proteins, which then aggregate extracellularly as insoluble fibrils, damaging the structure and function of affected organs. The formation of amyloid fibrils in vivo is poorly understood. We recently identified the first naturally occurring structural variant, D76N, of human β2-microglobulin (β2m), the ubiquitous light chain of class I major histocompatibility antigens, as the amyloid fibril protein in a family with a new phenotype of late onset fatal hereditary systemic amyloidosis. Here we show that, uniquely, D76N β2m readily forms amyloid fibrils in vitro under physiological extracellular conditions. The globular native fold transition to the fibrillar state is primed by exposure to a hydrophobic-hydrophilic interface under physiological intensity shear flow. Wild type β2m is recruited by the variant into amyloid fibrils in vitro but is absent from amyloid deposited in vivo. This may be because, as we show here, such recruitment is inhibited by chaperone activity. Our results suggest general mechanistic principles of in vivo amyloid fibrillogenesis by globular proteins, a previously obscure process. Elucidation of this crucial causative event in clinical amyloidosis should also help to explain the hitherto mysterious timing and location of amyloid deposition. PMID:24014031

  4. Nonsense mutations in the human. beta. -globin gene affect mRNA metabolism

    SciTech Connect

    Baserga, S.J.; Benz, E.J. Jr. )

    1988-04-01

    A number of premature translation termination mutations (nonsense mutations) have been described in the human {alpha}- and {beta}-globin genes. Studies on mRNA isolated from patients with {beta}{sup 0}-thalassemia have shown that for both the {beta}-17 and the {beta}-39 mutations less than normal levels of {beta}-globin mRNA accumulate in peripheral blood cells. (The codon at which the mutation occurs designates the name of the mutation; there are 146 codons in human {beta}-globin mRNA). In vitro studies using the cloned {beta}-39 gene have reproduced this effect in a heterologous transfection system and have suggested that the defect resides in intranuclear metabolism. The authors have asked if this phenomenon of decreased mRNA accumulation is a general property of nonsense mutations and if the effect depends on the location or the type of mutation. Toward this end, they have studied the effect of five nonsense mutations and two missense mutations on the expression of human {beta}-globin mRNA in a heterologous transfection system. In all cases studied, the presence of a translation termination codon correlates with a decrease in the steady-state level of mRNA. The data suggest that the metabolism of a mammalian mRNA is affected by the presence of a mutation that affects translation.

  5. Interactions among the alpha2-, beta2-, and beta3-adrenergic receptor genes and obesity-related phenotypes in the Quebec Family Study.

    PubMed

    Ukkola, O; Rankinen, T; Weisnagel, S J; Sun, G; Pérusse, L; Chagnon, Y C; Després, J P; Bouchard, C

    2000-08-01

    The gene-gene interactions between markers in the alpha2-, beta2-, and beta3-adrenergic receptor (ADR) genes and obesity-related phenotypes were studied in the Quebec Family Study (QFS) cohort. The prevalence of the Arg allele of the Arg16Gly polymorphism in the beta2-ADR gene was higher (49%) in males with a body mass index (BMI) of 35 kg/m2 or higher versus those with a BMI less than 35 kg/m2 (33%; P = .010). The beta2-ADR gene Arg16Gly and Gln27Glu polymorphisms were associated with plasma total and low-density lipoprotein (LDL) cholesterol concentrations. In addition, the homozygotes for the 6.3-kb allele of DraI polymorphism in the alpha2-ADR gene had the lowest mean abdominal subcutaneous fat area (P = .012) and total fat area (P = .003), as well as insulin area, under the curve during an oral glucose tolerance test ([OGTT] P = .004). Several ADR gene-gene interaction effects on abdominal fat distribution and plasma lipids were detected. First, significant interactions between alpha2- and beta3-ADR genes were observed on total (P = .015) and subcutaneous (P = .004) abdominal fat. Second, interaction effects between alpha2- and beta2-ADR gene variants influenced total, high-density lipoprotein (HDL), and LDL cholesterol concentrations. Finally, there were interactions between markers within the beta2-ADR gene affecting plasma triglyceride concentrations and subcutaneous abdominal fat. From these results, we conclude that polymorphisms in the ADR genes contribute to body fat and plasma lipid variability in men. Gene-gene interactions among the ADR genes contribute to the phenotypic variability in abdominal obesity and plasma lipid and lipoprotein, but not in visceral fat levels.

  6. Beta-cell gene expression and functional characterisation of the human insulinoma cell line CM.

    PubMed

    Baroni, M G; Cavallo, M G; Mark, M; Monetini, L; Stoehrer, B; Pozzilli, P

    1999-04-01

    Animal insulinoma cell lines are widely used to study physiological and pathophysiological mechanisms involved in glucose metabolism and to establish in vitro models for studies on beta-cells. In contrast, human insulinoma cell lines are rarely used because of difficulties in obtaining and culturing them for long periods. The aim of our study was to investigate, under different experimental conditions, the capacity of the human insulinoma cell line CM to retain beta-cell function, particularly the expression of constitutive beta-cell genes (insulin, the glucose transporters GLUT1 and GLUT2, glucokinase), intracellular and secreted insulin, beta-cell granules, and cAMP content. Results showed that CM cells from an early-passage express specific beta-cell genes in response to glucose stimulation, in particular the insulin and GLUT genes. Such capacity is lost at later passages when cells are cultured at standard glucose concentrations. However, if cultured at lower glucose concentration (0.8 mM) for a longer time, CM cells re-acquire the capacity to respond to glucose stimulation, as shown by the increased expression of beta-cell genes (insulin, GLUT2, glucokinase). Nonetheless, insulin secretion could not be restored under such experimental conditions despite the presence of intracellular insulin, although cAMP response to a potent activator of adenylate cyclase, forskolin, was present indicating a viable system. In conclusion, these data show that the human insulinoma cell line CM, at both early-passage and late-passage, posseses a functional glucose-signalling pathway and insulin mRNA expression similar to normal beta-cells, representing, therefore, a good model for studies concerning the signalling and expression of beta-cells. Furthermore, we have previously shown that it is also a good model for immunological studies. In this respect it is important to note that the CM cell line is one of the very few existing human beta-cell lines in long-term culture.

  7. Arrested rearrangement of TCR V[beta] genes in thymocytes from children with x-linked severe combined immunodeficiency disease

    SciTech Connect

    Sleasman, J.W.; Harville, T.O.; White, G.B.; Barrett, D.J. ); George, J.F. ); Goodenow, M.M. Univ. of Alabama, Birmingham, AL )

    1994-07-01

    Human X-linked severe combined immunodeficiency disease (SCID) is an immunodeficiency disorder in which T cell development is arrested in the thymic cortex. B lymphocytes in children with X-linked SCID seem to differentiate normally. X-linked SCID is associated with a mutation in the gene that encodes the IL-2R [gamma]-chain. Because TCR-[beta] gene recombination is a pivotal initial event in T lymphocyte onteogeny within the thymus, the authors hypothesized that a failure to express normal IL-2R[gamma] could lead to impaired TCR-[beta] gene recombination in early thymic development. PCR was used to determine the status of TCR-[beta] gene-segment rearrangements in thymic DNA that had been obtained from children with X-linked SCID. The initial step in TCR-[beta] gene rearrangement, that of D[beta] to J[beta] recombination, was readily detected in all thymus samples from children with X-linked SCID; in contrast, V[beta] to DJ[beta] gene rearrangements were undetectable in the same samples. Both D[beta] to J[beta] and V[beta] to DJ[beta] TCR genes were rearranged in the thymic tissues obtained from immunologically normal children. The authors conclude that TCR[beta]-chain gene rearrangement is arrested in children with X-linked SCID. The results suggest a causative relationship between the failure of TCR [beta]-chain gene arrangements to proceed beyond DJ[beta] rearrangements and the production of a nonfunctional IL-2R [gamma]-chain. 45 refs., 3 figs.

  8. Positive selection determines T cell receptor V beta 14 gene usage by CD8+ T cells

    PubMed Central

    1989-01-01

    We report here a mAb, 14-2, reactive with TCRs that include V beta 14. The frequency of V beta 14+ T cells varies with CD4 and CD8 subset and is controlled by the H-2 genes. Thus CD8+ T cells from H-2b mice include approximately 2.3% V beta 14+ T cells while CD8+ T cells from mice expressing K kappa include greater than 8% V beta 14+ T cells. In all strains examined, 7-8% of CD4+ T cells express V beta 14. The frequent usage of V beta 14 in CD8+ T cells of K kappa-expressing mice is a result of preferential positive selection of V beta 14+ CD8+ T cells as demonstrated by analysis of radiation chimeras. These studies demonstrate that H-2-dependent positive selection occurs in unmanipulated mice. Furthermore, the results imply that positive selection, and possibly H-2 restriction, can be strongly influenced by a V beta domain, with some independence from the beta-junctional sequence and alpha chain. PMID:2501444

  9. Interleukin-1 beta gene polymorphism and traditional constitution in obese women.

    PubMed

    Lee, Jeong-Hoon; Kwon, Young-Dal; Hong, Seung-Heon; Jeong, Hyun-Ja; Kim, Hyung-Min; Um, Jae-Young

    2008-06-01

    In adipose tissue metabolism, cytokines were major regulators. mRNA expression studies show that adipocytes can synthesize both tumor necrosis factor-alpha and several interleukins (ILs), notably IL-1 beta (IL-1beta) and IL-6. In particular, IL-1beta expression is under strong genetic control. We examined the relationship among obesity, polymorphism of the IL-1beta at position +3953 in exon 5, and Sasang constitution. In a group of 181 healthy females with a marked variation in body mass index (BMI), we determined the genotype of IL-1beta by polymerase chain reaction-restriction fragment length polymorphism assays. A significant decrease was found for the IL-1beta T allele in the overweight group (BMI 25 approximately 29 kg/m(2)) compared with the lean group with a BMI < 25 kg/m(2) (P = .049, odds ratio [OR] = 0.296). Carriers of T allele in the heterozygous or homozygous form did not show a significant difference in physical and clinical characteristics. In addition, in Taeumin female subjects, the frequency of IL-1beta T allele was apparently decreased in the overweight group (BMI 25 approximately 29 kg/m(2)) compared with the lean group with a BMI < 25 kg/m(2) (P = .007, OR = 0.152). In overweight women, we found an association between the +3953 C/T polymorphism in the IL-1beta gene and BMI. In addition, we found an association among IL-1beta polymorphism, obesity, and Sasang constitution.

  10. Volvox carteri alpha 2- and beta 2-tubulin-encoding genes: regulatory signals and transcription.

    PubMed

    Mages, W; Cresnar, B; Harper, J F; Brüderlein, M; Schmitt, R

    1995-07-01

    Microtubules (MT) carry out several specialized morphogenetic functions in the multicellular green alga Volvox carteri (Vc), in addition to functions also executed in its closest unicellular relative, Chlamydomonas reinhardtii (Cr). To find out if these differences in morphogenetic complexity are reflected in tubulin (Tub) differences, we have compared the Vc alpha tub and beta tub genes with their Cr counterparts. The Vc genome contains two alpha tub and two beta tub genes. We report here the sequences of the alpha 2tub and beta 2tub genes, and thus complete the set of four tub sequences. The two alpha tub and two beta tub genes code for identical 451 (alpha) and 443 (beta) amino acid (aa) polypeptides; they differ from the Cr homologs in two (alpha) and one (beta) residues, respectively. Silent nucleotide (nt) exchanges between sibling genes are much more frequent in Vc than in Cr (12 vs. 2%), probably owing to a more stringent codon bias in the latter alga. Transcription of alpha 2tub and beta 2tub starts with an A, 26 bp (alpha 2) or 25 bp (beta 2) downstream from the TATA box. A 16-bp promoter element upstream and a G + C-rich sequence downstream from the TATA box are conserved in all tub of both species. Moreover, a 28-bp element of conserved sequence, and hence of possible functional significance, was found at similar locations in the 5' untranslated region (UTR) of all four alpha tub. A conserved TGTAA downstream from the translation stop codon represents the algal poly(A)-addition signal (in both Vc and Cr).(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7628715

  11. Characterization of a psychrotrophic Arthrobacter gene and its cold-active beta-galactosidase.

    PubMed Central

    Trimbur, D E; Gutshall, K R; Prema, P; Brenchley, J E

    1994-01-01

    Enzymes with high specific activities at low temperatures have potential uses for chemical conversions when low temperatures are required, as in the food industry. Psychrotrophic microorganisms which grow at low temperatures may be a valuable source of cold-active enzymes that have higher activities at low temperatures than enzymes found for mesophilic microorganisms. To find cold-active beta-galactosidases, we isolated and characterized several psychrotrophic microorganisms. One isolate, B7, is an Arthrobacter strain which produces beta-galactosidase when grown in lactose minimal media. Extracts have a specific activity at 30 degrees C of 2 U/mg with o-nitrophenyl-beta-D-galactopyranoside as a substrate. Two isozymes were detected when extracts were subjected to electrophoresis in a nondenaturing polyacrylamide gel and stained for activity with 5-bromo-4-chloro-indolyl-beta-D-galactopyranoside (X-Gal). When chromosomal DNA was prepared and transformed into Escherichia coli, three different genes encoding beta-galactosidase activity were obtained. We have subcloned and sequenced one of these beta-galactosidase genes from the Arthrobacter isolate B7. On the basis of amino acid sequence alignment, the gene was found to have probable catalytic sites homologous to those from the E. coli lacZ gene. The gene encoded a protein of 1,016 amino acids with a predicted molecular mass of 111 kDa. The enzyme was purified and characterized. The beta-galactosidase from isolate B7 has kinetic properties similar to those of the E. coli lacZ beta-galactosidase but has a temperature optimum 20 degrees C lower than that of the E. coli enzyme. Images PMID:7811090

  12. Validation of reference genes for RT-qPCR analysis of CYP4T expression in crucian carp.

    PubMed

    Mo, Fei; Zhao, Jie; Liu, Na; Cao, Li-Hua; Jiang, Shan-Xiang

    2014-09-01

    Reference genes are commonly used for normalization of target gene expression during RT-qPCR analysis. However, no housekeeping genes or reference genes have been identified to be stable across different tissue types or under different experimental conditions. To identify the most suitable reference genes for RT-qPCR analysis of target gene expression in the hepatopancreas of crucian carp (Carassius auratus) under various conditions (sex, age, water temperature, and drug treatments), seven reference genes, including beta actin (ACTB), beta-2 microglobulin (B2M), embryonic elongation factor-1 alpha (EEF1A), glyceraldehyde phosphate dehydrogenase (GAPDH), alpha tubulin (TUBA), ribosomal protein l8 (RPL8) and glucose-6-phosphate dehydrogenase (G6PDH), were evaluated in this study. The stability and ranking of gene expression were analyzed using three different statistical programs: GeNorm, Normfinder and Bestkeeper. The expression errors associated with selection of the genes were assessed by the relative quantity of CYP4T. The results indicated that all the seven genes exhibited variability under the experimental conditions of this research, and the combination of ACTB/TUBA/EEF1A or of ACTB/EEF1A was the best candidate that raised the accuracy of quantitative analysis of gene expression. The findings highlighted the importance of validation of housekeeping genes for research on gene expression under different conditions of experiment and species.

  13. Regulation of. beta. -cell glucose transporter gene expression

    SciTech Connect

    Chen, Ling; Alam, Tausif; Johnson, J.H.; Unger, R.H. Department of Veterans Affairs Medical Center, Dallas, TX ); Hughes, S.; Newgard, C.B. )

    1990-06-01

    It has been postulated that a glucose transporter of {beta} cells (GLUT-2) may be important in glucose-stimulated insulin secretion. To determine whether this transporter is constitutively expressed or regulated, the authors subjected conscious unrestrained Wistar rats to perturbations in glucose homeostasis and quantitated {beta}-cell GLUT-2 mRNA by in situ hybridization. After 3 hr of hypoglycemia, GLUT-2 and proinsulin mRNA signal densities were reduced by 25% of the level in control rats. After 4 days, GLUT-2 and proinsulin mRNA densities were reduced by 85% and 65%, respectively. After 12 days of hypoglycemia, the K{sub m} for 3-O-methyl-D-glucose transport in isolated rat islets, normally 18-20 mM, was 2.5 mM. This provides functional evidence of a profound reduction of high K{sub m} glucose transporter in {beta} cells. In contrast, GLUT-2 was only slightly reduced by hypoglycemia in liver. To determine the effect of prolonged hyperglycemia, they also infused animals with 50% (wt/vol) glucose for 5 days. Hyperglycemic clamping increased GLUT-2 mRNA by 46% whereas proinsulin mRNA doubled. They conclude that GLUT-2 expression in {beta} cells, but not liver, is subject to regulation by certain perturbations in blood glucose homeostasis.

  14. Isolation and characterization of BetaM protein encoded by ATP1B4 - a unique member of the Na,K-ATPase {beta}-subunit gene family

    SciTech Connect

    Pestov, Nikolay B.; Zhao, Hao; Basrur, Venkatesha; Modyanov, Nikolai N.

    2011-09-09

    Highlights: {yields} Structural properties of BetaM and Na,K-ATPase {beta}-subunits are sharply different. {yields} BetaM protein is concentrated in nuclear membrane of skeletal myocytes. {yields} BetaM does not associate with a Na,K-ATPase {alpha}-subunit in skeletal muscle. {yields} Polypeptide chain of the native BetaM is highly sensitive to endogenous proteases. {yields} BetaM in neonatal muscle is a product of alternative splice mRNA variant B. -- Abstract: ATP1B4 genes represent a rare instance of the orthologous gene co-option that radically changed functions of encoded BetaM proteins during vertebrate evolution. In lower vertebrates, this protein is a {beta}-subunit of Na,K-ATPase located in the cell membrane. In placental mammals, BetaM completely lost its ancestral role and through acquisition of two extended Glu-rich clusters into the N-terminal domain gained entirely new properties as a muscle-specific protein of the inner nuclear membrane possessing the ability to regulate gene expression. Strict temporal regulation of BetaM expression, which is the highest in late fetal and early postnatal myocytes, indicates that it plays an essential role in perinatal development. Here we report the first structural characterization of the native eutherian BetaM protein. It should be noted that, in contrast to structurally related Na,K-ATPase {beta}-subunits, the polypeptide chain of BetaM is highly sensitive to endogenous proteases that greatly complicated its isolation. Nevertheless, using a complex of protease inhibitors, a sample of authentic BetaM was isolated from pig neonatal skeletal muscle by a combination of ion-exchange and lectin-affinity chromatography followed by SDS-PAGE. Results of the analysis of the BetaM tryptic digest using MALDI-TOF and ESI-MS/MS mass spectrometry have demonstrated that native BetaM in neonatal skeletal muscle is a product of alternative splice mRNA variant B and comprised of 351 amino acid residues. Isolated BetaM protein was

  15. Yeast KRE genes provide evidence for a pathway of cell wall beta-glucan assembly

    PubMed Central

    1990-01-01

    The Saccharomyces cerevisiae KRE1 gene encodes a Ser/Thr-rich protein, that is directed into the yeast secretory pathway, where it is highly modified, probably through addition of O-linked mannose residues. Gene disruption of the KRE1 locus leads to a 40% reduced level of cell wall (1----6)-beta-glucan. Structural analysis of the (1----6)-beta-glucan fraction, isolated from a strain with a krel disruption mutation, showed that it had an altered structure with a smaller average polymer size. Mutations in two other loci, KRE5 and KRE6 also lead to a defect in cell wall (1----6)-beta-glucan production and appear to be epistatic to KRE1. These findings outline a possible pathway of assembly of yeast cell wall (1----6)-beta-glucan. PMID:2186051

  16. Missense mutation of the {beta}-cardiac myosin heavy-chain gene in hypertrophic cardiomyopathy

    SciTech Connect

    Arai, Shoichi; Matsuoka, Rumiko; Hirayama, Kenji; Sakurai, Hisanao

    1995-09-11

    Hypertrophic cardiomyopathy occurs as an autosomal dominant familial disorder or as a sporadic disease without familial involvement. We describe a missense mutation of the {beta}-cardiac myosin heavy chain (MHC) gene, a G to T transversion (741 Gly{r_arrow}Trp) identified by direct sequencing of exon 20 in four individuals affected with familial hypertrophic cardiomyopathy. Three individuals with sporadic hypertrophic cardiomyopathy, whose parents are clinically and genetically unaffected, had sequence variations of exon 34 of the {alpha}-cardiac MHC gene (a C to T transversion, 1658 Asp{r_arrow}Asp, resulting in FokI site polymorphism), of intron 33 of the {alpha}-cardiac MHC gene (a G to A and an A to T transversion), and also of intron 14 of the {beta}-cardiac MHC gene (a C to T transversion in a patient with Noonan syndrome). Including our case, 30 missense mutations of the {beta}-cardiac MHC gene in 49 families have been reported thus far worldwide. Almost all are located in the region of the gene coding for the globular head of the molecule, and only one mutation was found in both Caucasian and Japanese families. Missense mutations of the {Beta}-cardiac MHC gene in hypertrophic cardiomyopathy may therefore differ according to race. 29 refs., 6 figs., 3 tabs.

  17. Altered transcription of genes coding for class I histocompatibility antigens in murine tumor cells

    PubMed Central

    1983-01-01

    Three murine tumors induced by Moloney murine leukemia virus (M-MLV) which exhibited loss of some or all H-2 class I antigens at the cell surface were analyzed at the DNA and RNA level with molecular probes specific of H-2 heavy chains and beta 2-microglobulin sequences. No observable difference could be detected at the DNA level between the tumors and the parent animals. However, a decrease in H-2 mRNA was observed, especially in phenotypically H-2 negative tumor, BM5R, where H-2 transcripts were at least 30-fold less abundant. These results show that an H-2-negative character may result from a general alteration in the transcription of H-2 genes, which could reflect some kind of regulatory process. PMID:6311935

  18. C. elegans expressing human β2-microglobulin: a novel model for studying the relationship between the molecular assembly and the toxic phenotype.

    PubMed

    Diomede, Luisa; Soria, Cristina; Romeo, Margherita; Giorgetti, Sofia; Marchese, Loredana; Mangione, Patrizia Palma; Porcari, Riccardo; Zorzoli, Irene; Salmona, Mario; Bellotti, Vittorio; Stoppini, Monica

    2012-01-01

    Availability of living organisms to mimic key step of amyloidogenesis of human protein has become an indispensable tool for our translation approach aiming at filling the deep gap existing between the biophysical and biochemical data obtained in vitro and the pathological features observed in patients. Human β(2)-microglobulin (β(2)-m) causes systemic amyloidosis in haemodialysed patients. The structure, misfolding propensity, kinetics of fibrillogenesis and cytotoxicity of this protein, in vitro, have been studied more extensively than for any other globular protein. However, no suitable animal model for β(2)-m amyloidosis has been so far reported. We have now established and characterized three new transgenic C. elegans strains expressing wild type human β(2)-m and two highly amyloidogenic isoforms: P32G variant and the truncated form ΔN6 lacking of the 6 N-terminal residues. The expression of human β(2)-m affects the larval growth of C. elegans and the severity of the damage correlates with the intrinsic propensity to self-aggregate that has been reported in previous in vitro studies. We have no evidence of the formation of amyloid deposits in the body-wall muscles of worms. However, we discovered a strict correlation between the pathological phenotype and the presence of oligomeric species recognized by the A11 antibody. The strains expressing human β(2)-m exhibit a locomotory defect quantified with the body bends assay. Here we show that tetracyclines can correct this abnormality confirming that these compounds are able to protect a living organism from the proteotoxicity of human β(2)-m. PMID:23284985

  19. C. elegans Expressing Human β2-Microglobulin: A Novel Model for Studying the Relationship between the Molecular Assembly and the Toxic Phenotype

    PubMed Central

    Diomede, Luisa; Soria, Cristina; Romeo, Margherita; Giorgetti, Sofia; Marchese, Loredana; Mangione, Patrizia Palma; Porcari, Riccardo; Zorzoli, Irene; Salmona, Mario; Bellotti, Vittorio; Stoppini, Monica

    2012-01-01

    Availability of living organisms to mimic key step of amyloidogenesis of human protein has become an indispensable tool for our translation approach aiming at filling the deep gap existing between the biophysical and biochemical data obtained in vitro and the pathological features observed in patients. Human β2-microglobulin (β2-m) causes systemic amyloidosis in haemodialysed patients. The structure, misfolding propensity, kinetics of fibrillogenesis and cytotoxicity of this protein, in vitro, have been studied more extensively than for any other globular protein. However, no suitable animal model for β2-m amyloidosis has been so far reported. We have now established and characterized three new transgenic C. elegans strains expressing wild type human β2-m and two highly amyloidogenic isoforms: P32G variant and the truncated form ΔN6 lacking of the 6 N-terminal residues. The expression of human β2-m affects the larval growth of C. elegans and the severity of the damage correlates with the intrinsic propensity to self-aggregate that has been reported in previous in vitro studies. We have no evidence of the formation of amyloid deposits in the body-wall muscles of worms. However, we discovered a strict correlation between the pathological phenotype and the presence of oligomeric species recognized by the A11 antibody. The strains expressing human β2-m exhibit a locomotory defect quantified with the body bends assay. Here we show that tetracyclines can correct this abnormality confirming that these compounds are able to protect a living organism from the proteotoxicity of human β2-m. PMID:23284985

  20. Characterization of intermolecular structure of β(2)-microglobulin core fragments in amyloid fibrils by vacuum-ultraviolet circular dichroism spectroscopy and circular dichroism theory.

    PubMed

    Matsuo, Koichi; Hiramatsu, Hirotsugu; Gekko, Kunihiko; Namatame, Hirofumi; Taniguchi, Masaki; Woody, Robert W

    2014-03-20

    Intermolecular structures are important factors for understanding the conformational properties of amyloid fibrils. In this study, vacuum-ultraviolet circular dichroism (VUVCD) spectroscopy and circular dichroism (CD) theory were used for characterizing the intermolecular structures of β2-microglobulin (β2m) core fragments in the amyloid fibrils. The VUVCD spectra of β2m20-41, β2m21-31, and β2m21-29 fragments in the amyloid fibrils exhibited characteristic features, but they were affected not only by the backbone conformations but also by the aromatic side-chain conformations. To estimate the contributions of aromatic side-chains to the spectra, the theoretical spectra were calculated from the simulated structures of β2m21-29 amyloid fibrils with various types of β-sheet stacking (parallel or antiparallel) using CD theory. We found that the experimental spectrum of β2m21-29 fibrils is largely affected by aromatic-backbone couplings, which are induced by the interaction between transitions within the aromatic and backbone chromophores, and these couplings are sensitive to the type of stacking among the β-sheets of the fibrils. Further theoretical analyses of simulated structures incorporating mutated aromatic residues suggested that the β2m21-29 fibrils are composed of amyloid accumulations in which the parallel β-sheets stack in an antiparallel manner and that the characteristic Phe-Tyr interactions among the β-sheet stacks affect the aromatic-backbone coupling. These findings indicate that the coupling components, which depend on the characteristic intermolecular structures, induce the spectral differences among three fragments in the amyloid fibrils. These advanced spectral analyses using CD theory provide a useful method for characterizing the intermolecular structures of protein and peptide fragment complexes.

  1. Identification and molecular characterization of four new large deletions in the beta-globin gene cluster.

    PubMed

    Joly, Philippe; Lacan, Philippe; Garcia, Caroline; Couprie, Nicole; Francina, Alain

    2009-01-01

    Despite the fact that mutations in the human beta-globin gene cluster are essentially point mutations, a significant number of large deletions have also been described. We present here four new large deletions in the beta-globin gene cluster that have been identified on patients displaying an atypical hemoglobin phenotype (high HbF) at routine analysis. The first deletion, which spreads over 2.0 kb, removes the entire beta-globin gene, including its promoter, and is associated with a typical beta-thal minor phenotype. The three other deletions are larger (19.7 to 23.9 kb) and remove both the delta and beta-globin genes. Phenotypically, they look like an HPFH-deletion as they are associated with normal hematological parameters. The precise localization of their 5' and 3' breakpoints gives new insights about the differences between HPFH and (deltabeta)(0)-thalassemia at the molecular level. The importance of detection of these deletions in prenatal diagnosis and newborn screening of hemoglobinopathies is also discussed.

  2. Presence and diversity of the beta-lactamase gene in cat and dog staphylococci.

    PubMed

    Malik, Seidu; Christensen, Henrik; Peng, Haihong; Barton, Mary D

    2007-07-20

    Staphylococci are part of the normal microflora of humans and animals and some are potential pathogens that have become resistant to almost all known antibiotics. Despite the widespread reports of penicillin resistance in cat and dog staphylococci, the mechanism underlying penicillin resistance has not been examined. This study was aimed at investigating the molecular basis of resistance to penicillin in cat and dog staphylococcal isolates that showed phenotypic resistance to beta-lactam antibiotics. An 861 bp fragment of the structural blaZ gene which codes for beta-lactamase production in staphylococci was amplified by polymerase chain reaction (PCR) and the products were sequenced. Sequenced fragments were analysed by protein signature typing and sequences were compared to published blaZ sequences of human and bovine staphylococcal strains held in a public database. Four known protein signature types (1, 3, 5 and 6) and one new type (12) were identified in this study. When sequences were compared with published blaZ sequences, gene phylogenetic analysis revealed three major groups. The four variants of beta-lactamases types (A, B, C and D) belonged to each major group except for types A and D which were both in group II. These findings confirm that the blaZ gene is responsible for beta-lactamase production leading to subsequent resistance to beta-lactam antibiotics in feline and canine staphylococci and that the gene shows similar diversity and relatedness as found with blaZ sequences obtained from human and bovine staphylococci.

  3. A mutation of the beta-globin gene initiation codon, ATG-->AAG, found in a French Caucasian man.

    PubMed

    Lacan, Philippe; Aubry, Martine; Couprie, Nicole; Francina, Alain

    2005-01-01

    A new mutation of the beta-globin gene initiation codon, ATG-->AAG (Met-->Tyr), is reported in a man originating from the southeast of France. Typical hematological findings of beta-thalassemia (thal) trait were found. We emphasize the importance of characterizing uncommon beta-thal mutations for genetic counseling.

  4. Neofunctionalization of Chromoplast Specific Lycopene Beta Cyclase Gene (CYC-B) in Tomato Clade

    PubMed Central

    Mohan, Vijee; Pandey, Arun; Sreelakshmi, Yellamaraju; Sharma, Rameshwar

    2016-01-01

    The ancestor of tomato underwent whole genome triplication ca. 71 Myr ago followed by widespread gene loss. However, few of the triplicated genes are retained in modern day tomato including lycopene beta cyclase that mediates conversion of lycopene to β-carotene. The fruit specific β-carotene formation is mediated by a chromoplast-specific paralog of lycopene beta cyclase (CYC-B) gene. Presently limited information is available about how the variations in CYC-B gene contributed to its neofunctionalization. CYC-B gene in tomato clade contained several SNPs and In-Dels in the coding sequence (33 haplotypes) and promoter region (44 haplotypes). The CYC-B gene coding sequence in tomato appeared to undergo purifying selection. The transit peptide sequence of CYC-B protein was predicted to have a stronger plastid targeting signal than its chloroplast specific paralog indicating a possible neofunctionalization. In promoter of two Bog (Beta old gold) mutants, a NUPT (nuclear plastid) DNA fragment of 256 bp, likely derived from a S. chilense accession, was present. In transient expression assay, this promoter was more efficient than the “Beta type” promoter. CARGATCONSENSUS box sequences are required for the binding of the MADS-box regulatory protein RIPENING INHIBITOR (RIN). The loss of CARGATCONSENSUS box sequence from CYC-B promoter in tomato may be related to attenuation of its efficiency to promote higher accumulation of β-carotene than lycopene during fruit ripening. PMID:27070417

  5. Neofunctionalization of Chromoplast Specific Lycopene Beta Cyclase Gene (CYC-B) in Tomato Clade.

    PubMed

    Mohan, Vijee; Pandey, Arun; Sreelakshmi, Yellamaraju; Sharma, Rameshwar

    2016-01-01

    The ancestor of tomato underwent whole genome triplication ca. 71 Myr ago followed by widespread gene loss. However, few of the triplicated genes are retained in modern day tomato including lycopene beta cyclase that mediates conversion of lycopene to β-carotene. The fruit specific β-carotene formation is mediated by a chromoplast-specific paralog of lycopene beta cyclase (CYC-B) gene. Presently limited information is available about how the variations in CYC-B gene contributed to its neofunctionalization. CYC-B gene in tomato clade contained several SNPs and In-Dels in the coding sequence (33 haplotypes) and promoter region (44 haplotypes). The CYC-B gene coding sequence in tomato appeared to undergo purifying selection. The transit peptide sequence of CYC-B protein was predicted to have a stronger plastid targeting signal than its chloroplast specific paralog indicating a possible neofunctionalization. In promoter of two Bog (Beta old gold) mutants, a NUPT (nuclear plastid) DNA fragment of 256 bp, likely derived from a S. chilense accession, was present. In transient expression assay, this promoter was more efficient than the "Beta type" promoter. CARGATCONSENSUS box sequences are required for the binding of the MADS-box regulatory protein RIPENING INHIBITOR (RIN). The loss of CARGATCONSENSUS box sequence from CYC-B promoter in tomato may be related to attenuation of its efficiency to promote higher accumulation of β-carotene than lycopene during fruit ripening.

  6. Neofunctionalization of Chromoplast Specific Lycopene Beta Cyclase Gene (CYC-B) in Tomato Clade.

    PubMed

    Mohan, Vijee; Pandey, Arun; Sreelakshmi, Yellamaraju; Sharma, Rameshwar

    2016-01-01

    The ancestor of tomato underwent whole genome triplication ca. 71 Myr ago followed by widespread gene loss. However, few of the triplicated genes are retained in modern day tomato including lycopene beta cyclase that mediates conversion of lycopene to β-carotene. The fruit specific β-carotene formation is mediated by a chromoplast-specific paralog of lycopene beta cyclase (CYC-B) gene. Presently limited information is available about how the variations in CYC-B gene contributed to its neofunctionalization. CYC-B gene in tomato clade contained several SNPs and In-Dels in the coding sequence (33 haplotypes) and promoter region (44 haplotypes). The CYC-B gene coding sequence in tomato appeared to undergo purifying selection. The transit peptide sequence of CYC-B protein was predicted to have a stronger plastid targeting signal than its chloroplast specific paralog indicating a possible neofunctionalization. In promoter of two Bog (Beta old gold) mutants, a NUPT (nuclear plastid) DNA fragment of 256 bp, likely derived from a S. chilense accession, was present. In transient expression assay, this promoter was more efficient than the "Beta type" promoter. CARGATCONSENSUS box sequences are required for the binding of the MADS-box regulatory protein RIPENING INHIBITOR (RIN). The loss of CARGATCONSENSUS box sequence from CYC-B promoter in tomato may be related to attenuation of its efficiency to promote higher accumulation of β-carotene than lycopene during fruit ripening. PMID:27070417

  7. Sequence heterogeneity, multiplicity, and genomic organization of. cap alpha. - and. beta. -tubulin genes in Sea Urchins

    SciTech Connect

    Alexandraki, D.; Ruderman, J.V.

    1981-12-01

    The authors analyzed the multiplicity, heterogeneity, and organization of the genes encoding the ..cap alpha.. and ..beta.. tubulins in the sea urchin Lytechinus pictus by using cloned complementary deoxyribonucleic acid (cDNA) and genomic tubulin sequences. cDNA clones were constructed by using immature spermatogenic testis polyadenylic acid-containing ribonucleic acid as a template. ..cap alpha.. and ..beta..-tubulin clones were identified by hybrid selection and in vitro translation of the corresponding messenger ribonucleic acids, followed by immunoprecipitation and two-dimensional gel electrophoresis of the translation products. The ..cap alpha.. cDNA clone contains a sequence that encodes the 48 C-terminal amino acids of ..cap alpha.. tubulin and 104 base pairs of the 3' nontranslated portion of the messenger ribonucleic acid. The ..beta.. cDNA insertion contains the coding sequence for the 100 C-terminal amino acids of ..beta.. tubulin and 83 base pairs of the 3' noncoding sequence. Hybrid selections performed at different criteria demonstrated the presence of several heterogeneous, closely related tubulin messenger ribonucleic acids, suggesting the existence of heterogeneous ..cap alpha..- and ..beta..-tubulin genes. Hybridization analyses indicated that there are at least 9 to 13 sequences for each of the two tubulin gene families per haploid genome. Hybridization of the cDNA probes to both total genomic DNA and cloned germline DNA fragments gave no evidence for close physical linkage of ..cap alpha..-tubulin genes with ..beta..-tubulin genes at the DNA level. In contrast, these experiments indicated that some genes within the same family are clustered.

  8. Retroviral transfer of a human beta-globin/delta-globin hybrid gene linked to beta locus control region hypersensitive site 2 aimed at the gene therapy of sickle cell disease.

    PubMed

    Takekoshi, K J; Oh, Y H; Westerman, K W; London, I M; Leboulch, P

    1995-03-28

    Human gamma-globin and delta-globin chains have been previously identified as strong inhibitors of the polymerization of hemoglobin S, in contrast to the beta-globin chain, which exerts only a moderate antisickling effect. However, gamma-globin and delta-globin are normally expressed at very low levels in adult erythroid cells, in contrast to beta-globin. We report the design of a beta-globin/delta-globin hybrid gene, beta/delta-sickle cell inhibitor 1 (beta/delta-SCI1) and its transduction by retrovirus-mediated gene transfer. The beta/delta-SCI1-encoding gene retains the overall structure of the human beta-globin gene, while incorporating specific amino acid residues from the delta chain previously found responsible for its enhanced antisickling properties. To achieve high expression levels of beta/delta-SCI1 in adult erythrocytes, the hybrid gene was placed under the transcriptional control of the human beta-globin promoter and the DNase I hypersensitive site 2 of the human beta locus control region. High-titer retroviruses were generated, and stable proviral transmission was achieved in infected cells. The mRNA expression levels of the beta/delta-SCI1 gene in infected, dimethyl sulfoxide-induced murine erythroleukemia cells approached 85% of the endogenous murine beta maj-globin mRNA, on a per gene basis, evidence that high gene expression levels were achieved in adult erythroid cells. Further evaluation of this strategy in transgenic animal models of sickle cell disease should assess its efficacy for the gene therapy of human patients.

  9. Evolution and molecular characterization of a beta-globin gene from the Australian Echidna Tachyglossus aculeatus (Monotremata).

    PubMed

    Lee, M H; Shroff, R; Cooper, S J; Hope, R

    1999-07-01

    Coinciding with a period in evolution when monotremes, marsupials, and eutherians diverged from a common ancestor, a proto-beta-globin gene duplicated, producing the progenitors of mammalian embryonic and adult beta-like globin genes. To determine whether monotremes contain orthologues of these genes and to further investigate the evolutionary relationships of monotremes, marsupials, and eutherians, we have determined the complete DNA sequence of an echidna (Tachyglossus aculeatus) beta-like globin gene. Conceptual translation of the gene and sequence comparisons with eutherian and marsupial beta-like globin genes and echidna adult beta-globin indicate that the gene is adult expressed. Phylogenetic analyses do not clearly resolve the branching pattern of mammalian beta-like globin gene lineages and it is therefore uncertain whether monotremes have orthologues of the embryonic beta-like globin genes of marsupials and eutherians. Four models are proposed that provide a framework for interpreting further studies on the evolution of beta-like globin genes in the context of the evolution of monotremes, marsupials, and eutherians.

  10. Identification of suitable reference genes in bone marrow stromal cells from osteoarthritic donors.

    PubMed

    Schildberg, Theresa; Rauh, Juliane; Bretschneider, Henriette; Stiehler, Maik

    2013-11-01

    Bone marrow stromal cells (BMSCs) are key cellular components for musculoskeletal tissue engineering strategies. Furthermore, recent data suggest that BMSCs are involved in the development of Osteoarthritis (OA) being a frequently occurring degenerative joint disease. Reliable reference genes for the molecular evaluation of BMSCs derived from donors exhibiting OA as a primary co-morbidity have not been reported on yet. Hence, the aim of the study was to identify reference genes suitable for comparative gene expression analyses using OA-BMSCs. Passage 1 bone marrow derived BMSCs were isolated from n=13 patients with advanced stage idiopathic hip osteoarthritis and n=15 age-matched healthy donors. The expression of 31 putative reference genes was analyzed by quantitative reverse transcription polymerase chain reaction (qRT-PCR) using a commercially available TaqMan(®) assay. Calculating the coefficient of variation (CV), mRNA expression stability was determined and afterwards validated using geNorm and NormFinder algorithms. Importin 8 (IPO8), TATA box binding protein (TBP), and cancer susceptibility candidate 3 (CASC3) were identified as the most stable reference genes. Notably, commonly used reference genes, e.g. beta-actin (ACTB) and beta-2-microglobulin (B2M) were among the most unstable genes. For normalization of gene expression data of OA-BMSCs the combined use of IPO8, TBP, and CASC3 gene is recommended.

  11. Transposition of the carbenicillin-hydrolyzing beta-lactamase gene.

    PubMed Central

    Katsu, K; Inoue, M; Mitsuhashi, S

    1982-01-01

    We isolated a new transposon Tn2101, from plasmid Rms433 in Enterobacter cloacae. Tn2101 encoded the formation of type IV (carbenicillin-hydrolyzing) beta-lactamase and multiple resistance to streptomycin, sulfanilamide, spectinomycin, and mercury in addition to ampicillin. Tn2101 was transposable between conjugative (or nonconjugative) plasmids and the host chromosome. Transposition occurred independently of the general recombination ability of the host cell. Tn2101 had a molecular size of 9.5 x 10(6) and contained short inverted repeat terminal sequences. Images PMID:6279559

  12. Alpha beta T-cell development is not affected by inversion of TCR beta gene enhancer sequences: polar enhancement of gene expression regardless of enhancer orientation.

    PubMed

    Huang, Fang; Cabaud, Olivier; Verthuy, Christophe; Hueber, Anne-Odile; Ferrier, Pierre

    2003-08-01

    V(D)J recombination and expression of the T-cell receptor beta (TCRbeta) gene are required for the development of the alphabeta T lymphocyte lineage. These processes depend on a transcriptional enhancer (Ebeta) which acts preferentially on adjacent upstream sequences, and has little impact on the 5' distal and 3' proximal regions of the TCRbeta locus. Using knock-in mice, we show that alphabeta T-cell differentiation and TCRbeta gene recombination and expression are not sensitive to the orientation of Ebeta sequences. We discuss the implication of these results regarding the mode of enhancer function at this locus during T lymphocyte development.

  13. Targeting myocardial beta-adrenergic receptor signaling and calcium cycling for heart failure gene therapy.

    PubMed

    Pleger, Sven T; Boucher, Matthieu; Most, Patrick; Koch, Walter J

    2007-06-01

    Heart failure (HF) is a leading cause of morbidity and mortality in Western countries and projections reveal that HF incidence in the coming years will rise significantly because of an aging population. Pharmacologic therapy has considerably improved HF treatment during the last 2 decades, but fails to rescue failing myocardium and to increase global cardiac function. Therefore, novel therapeutic approaches to target the underlying molecular defects of ventricular dysfunction and to increase the outcome of patients in HF are needed. Failing myocardium generally exhibits distinct changes in beta-adrenergic receptor (betaAR) signaling and intracellular Ca2+-handling providing opportunities for research. Recent advances in transgenic and gene therapy techniques have presented novel therapeutic strategies to alter myocardial function and to target both betaAR signaling and Ca2+-cycling. In this review, we will discuss functional alterations of the betaAR system and Ca2+-handling in HF as well as corresponding therapeutic strategies. We will then focus on recent in vivo gene therapy strategies using the targeted inhibition of the betaAR kinase (betaARK1 or GRK2) and the restoration of S100A1 protein expression to support the injured heart and to reverse or prevent HF.

  14. RIII S/J (H-2r). An inbred mouse strain with a massive deletion of T cell receptor V beta genes

    PubMed Central

    1989-01-01

    We have identified an inbred strain of mouse, RIII S/J (H-2r), that has the largest known deletion of the TCR V beta genes by screening with mAb and TCR V beta specific probes. Upon screening of PBL with mAb F23.1, which is specific for V beta 8 TCR, RIII S/J was found to be negative. On further screening with mAb KJ 23a, which is specific for V beta 17a TCR, RIII S/J was completely negative. We next tested RIII S/J with mAb 44-22-1, which is specific for V beta 6 TCR, and found it also to be negative. The (B10 X RIII)F1 mice showed a 50% expression of V beta 6 gene, indicating a genomic rather than a clonal deletion. mAb KJ25, detecting V beta 3, was positive in RIII S/J, denoting the downstream boundary for the deletion. Southern blot analysis of liver DNA using TCR V beta-specific probes confirmed the deletion of V beta 8 gene subfamily and V beta 5 gene subfamily, along with V beta 9, V beta 11, V beta 12, and V beta 13 genes similar to the known TCR V beta deletion mutants (SWR, SJL, C57L, and C57Br). In addition, RIII S/J is missing V beta 6, V beta 15, and V beta 17 genes. Our mapping of the deletion indicates that RIII S/J has lost approximately 130 kb of V beta chromosome and with it 13 V beta genes out of the known 21 V beta genes of the TCR. The deletion is marked by the presence of V beta 10 gene upstream and V beta 3 gene downstream. PMID:2525171

  15. Nitric oxide stimulates insulin gene transcription in pancreatic {beta}-cells

    SciTech Connect

    Campbell, S.C. . E-mail: s.c.campbell@ncl.ac.uk; Richardson, H.; Ferris, W.F.; Butler, C.S.; Macfarlane, W.M.

    2007-02-23

    Recent studies have identified a positive role for nitric oxide (NO) in the regulation of pancreatic {beta}-cell function. The aim of this study was to determine the effects of short-term exposure to NO on {beta}-cell gene expression and the activity of the transcription factor PDX-1. NO stimulated the activity of the insulin gene promoter in Min6 {beta}-cells and endogenous insulin mRNA levels in both Min6 and isolated islets of Langerhans. Addition of wortmannin prior to NO stimulation blocked the observed increases in insulin gene promoter activity. Although NO addition stimulated the phosphorylation of p38, inhibition by SB203580 did not block the effect of NO on the insulin gene promoter. NO addition also stimulated both the nuclear accumulation and the DNA binding activity of PDX-1. This study has shown that over 24 h, NO stimulates insulin gene expression, PI-3-kinase activity and the activity of the critical {beta}-cell transcription factor PDX-1.

  16. Identification of genes for the constant region of rabbit T-cell receptor beta chains.

    PubMed Central

    Angiolillo, A L; Lamoyi, E; Bernstein, K E; Mage, R G

    1985-01-01

    We describe cDNA clones from thymus mRNA of a young rabbit that have sequences highly homologous to the human and murine T-cell receptor beta-chain constant region (C beta). In rabbit, man, and mouse there is a conserved extra cysteine in the constant region that could lead to a free thiol group or alternative disulfide bond formation depending on the locations and total numbers of cysteines in assembled receptor molecules. A cDNA clone (CL ANA 11) with 571 bases 5' of the C beta coding sequence has an open reading frame starting at a methionine codon that encodes 141 amino acids in frame with the C beta sequence. The encoded sequence has no resemblance to known immunoglobulin or beta-chain variable regions or other known proteins. An oligonucleotide probe from the 5' end of the encoded protein hybridizes to an approximately equal to 2-kilobase genomic DNA fragment that contains C beta gene sequences and to an approximately equal to 8-kilobase mRNA species in the thymus mRNA preparation from which the clone was derived. Within the 5' coding sequence there is a stretch of 211 bases containing strings of alternating purines and pyrimidines that may form Z-DNA. The sequence of the last 55 base pairs adjacent to C beta resembles the corresponding segment of mouse cDNA clone 86T3 that contains sequence 5' of the mouse C beta 1 gene. Although the function of a potential protein encoded by the 5' end of CL ANA 11 is unknown, it could play a role in regulation of thymocyte growth and differentiation. Images PMID:2989826

  17. Light controls phospholipase A2alpha and beta gene expression in Citrus sinensis.

    PubMed

    Liao, Hui-Ling; Burns, Jacqueline K

    2010-05-01

    The low-molecular weight secretory phospholipase A2alpha (CssPLA2alpha) and beta (CsPLA2beta) cloned in this study exhibited diurnal rhythmicity in leaf tissue of Citrus sinensis. Only CssPLA2alpha displayed distinct diurnal patterns in fruit tissues. CssPLA2alpha and CsPLA2beta diurnal expression exhibited periods of approximately 24 h; CssPLA2alpha amplitude averaged 990-fold in the leaf blades from field-grown trees, whereas CsPLA2beta amplitude averaged 6.4-fold. Diurnal oscillation of CssPLA2alpha and CsPLA2beta gene expression in the growth chamber experiments was markedly dampened 24 h after transfer to continuous light or dark conditions. CssPLA2alpha and CsPLA2beta expressions were redundantly mediated by blue, green, red and red/far-red light, but blue light was a major factor affecting CssPLA2alpha and CsPLA2beta expression. Total and low molecular weight CsPLA2 enzyme activity closely followed diurnal changes in CssPLA2alpha transcript expression in leaf blades of seedlings treated with low intensity blue light (24 micromol m(-2) s(-1)). Compared with CssPLA2alpha basal expression, CsPLA2beta expression was at least 10-fold higher. Diurnal fluctuation and light regulation of PLA2 gene expression and enzyme activity in citrus leaf and fruit tissues suggests that accompanying diurnal changes in lipophilic second messengers participate in the regulation of physiological processes associated with phospholipase A2 action.

  18. Characteristic analysis of the ampC gene encoding beta-lactamase from Photobacterium phosphoreum.

    PubMed

    Lin, Juey-Wen; Weng, Shu-Fen; Chao, Yuh-Fen; Chung, Yi-Ting

    2005-01-21

    The ampC gene of Photobacterium phosphoreum ATCC 11040 was cloned and identified. Nucleotide sequence of the regulatory region R&R and the ampC gene (GenBank Accession No. AY787792) from P. phosphoreum has been determined, and the encoded beta-lactamase is deduced. The beta-lactamase encoded by the ampC gene has a calculated M(r) 31,198 and comprises 285 amino acid residues (pI 7.35). There is a signal peptide of 20 amino acid residues MKLRFIASTLLLSFSQLASA to lead the beta-lactamase secretion, and the cleavage site is between ASA-Q; thus, the matured protein only has M(r) 29,019 and comprises 265 amino acid residues (pI 6.21). The specific amino acid residues STFK (65th to 68th), SDN (125th to 127th), and D (158th) located 33 residues downstream from the SDN loop of the class A beta-lactamases are highly conserved, but the KTG is not found. The gene order of the ampC is <--ufo-R&R-ampC-->, the genes running in the opposite directions. Functional analysis elicits that R&R([ampC]) does function to lead to the gene expression. Primer extension assay elicits that the ampC gene's transcriptional initiation +1 is -26 C upstream of the start codon; the P([I])-promoter should be the promoter response for the gene expression. Analysis of the R&R([ampC]) elicits that the upstream activator binding sequence Sigma UAS TGTTTAAATACGCTTTGAACA is like the two-component regulator binding sequence TGT-N(8-12)-ACA. It implies that P. phosphoreum ampC gene could be under-regulated by the specific two-component regulator. PMID:15596133

  19. Cell and Gene Therapy for the Beta-Thalassemias: Advances and Prospects.

    PubMed

    Mansilla-Soto, Jorge; Riviere, Isabelle; Boulad, Farid; Sadelain, Michel

    2016-04-01

    The beta-thalassemias are inherited anemias caused by mutations that severely reduce or abolish expression of the beta-globin gene. Like sickle cell disease, a related beta-globin gene disorder, they are ideal candidates for performing a genetic correction in patient hematopoietic stem cells (HSCs). The most advanced approach utilizes complex lentiviral vectors encoding the human β-globin gene, as first reported by May et al. in 2000. Considerable progress toward the clinical implementation of this approach has been made in the past five years, based on effective CD34+ cell mobilization and improved lentiviral vector manufacturing. Four trials have been initiated in the United States and Europe. Of 16 evaluable subjects, 6 have achieved transfusion independence. One of them developed a durable clonal expansion, which regressed after several years without transformation. Although globin lentiviral vectors have so far proven to be safe, this occurrence suggests that powerful insulators with robust enhancer-blocking activity will further enhance this approach. The combined discovery of Bcl11a-mediated γ-globin gene silencing and advances in gene editing are the foundations for another gene therapy approach, which aims to reactivate fetal hemoglobin (HbF) production. Its clinical translation will hinge on the safety and efficiency of gene targeting in true HSCs and the induction of sufficient levels of HbF to achieve transfusion independence. Altogether, the progress achieved over the past 15 years bodes well for finding a genetic cure for severe globin disorders in the next decade.

  20. Organization, structure, and evolution of the nonadult rat beta-globin gene cluster.

    PubMed

    Satoh, H; Inokuchi, N; Nagae, Y; Okazaki, T

    1999-07-01

    The beta-globin gene cluster of Wistar rat was extensively cloned and the embryonic genes were mapped and sequenced. Four overlapping lambda Dash recombinant clones cover about 31 kb and contain four nonadult beta-globin genes, 5'-epsilon1-gamma1-gamma2-psigamma3-3'. The epsilon1 and gamma2 are active genes, since their protein products were detected in the fetal stage of the rat (Iwahara et al., J Biochem 119:360-366, 1996). The gamma1 locus might be a pseudogene, since the ATA box in the promoter region is mutated to GTA; however, no other defect is observed. The psigamma3 locus is a truncated pseudogene because a 19-base deletion, which causes a shift of the reading frame, is observed between the second nucleotide of the putative codon 68 and codon 76. A sequence comparison suggests that the psigamma3 might be produced by a gene conversion event of the proto-gamma-globin gene set. Possible histories of the evolution of rat nonadult beta-globin genes are discussed.

  1. A new compound heterozygous frameshift mutation in the type II 3{beta}-hydroxysteroid dehydrogenase 3{beta}-HSD gene causes salt-wasting 3{beta}-HSD deficiency congenital adrenal hyperplasia

    SciTech Connect

    Zhang, L.; Sakkal-Alkaddour, S.; Chang, Ying T.; Yang, Xiaojiang; Songya Pang

    1996-01-01

    We report a new compound heterozygous frameshift mutation in the type II 3{Beta}-hydroxysteroid dehydrogenase (3{beta}-HSD) gene in a Pakistanian female child with the salt-wasting form of 3{Beta}-HSD deficiency congenital adrenal hyperplasia. The etiology for her congenital adrenal hyperplasia was not defined. Although the family history suggested possible 3{beta}-HSd deficiency disorder, suppressed adrenal function caused by excess glucocorticoid therapy in this child at 7 yr of age did not allow hormonal diagnosis. To confirm 3{beta}-HSD deficiency, we sequenced the type II 3{beta}-HSD gene in the patient, her family, and the parents of her deceased paternal cousins. The type II 3{beta}-HSD gene region of a putative promotor, exons I, II, III, and IV, and exon-intron boundaries were amplified by PCR and sequenced in all subjects. The DNA sequence of the child revealed a single nucleotide deletion at codon 318 [ACA(Thr){r_arrow}AA] in exon IV in one allele, and two nucleotide deletions at codon 273 [AAA(Lys){r_arrow}A] in exon IV in the other allele. The remaining gene sequences were normal. The codon 318 mutation was found in one allele from the father, brother, and parents of the deceased paternal cousins. The codon 273 mutation was found in one allele of the mother and a sister. These findings confirmed inherited 3{beta}-HSD deficiency in the child caused by the compound heterozygous type II 3{beta}-HSD gene mutation. Both codons at codons 279 and 367, respectively, are predicted to result in an altered and truncated type II 3{beta}-HSD protein, thereby causing salt-wasting 3{beta}-HSD deficiency in the patient. 21 refs., 2 figs., 1 tab.

  2. The T cell receptor beta genes of Xenopus.

    PubMed

    Chretien, I; Marcuz, A; Fellah, J; Charlemagne, J; Du Pasquier, L

    1997-03-01

    cDNA of the T cell receptor beta (TCRB) have been isolated from the anuran amphibian Xenopus and they show strong structural homology to TCRB sequences of other vertebrates. Ten BV families, two D segments, ten J segments, and a single C region have been defined so far. Each V family consists of one to two members per haploid genome. A unique feature of the Xenopus TCRB constant region is the lack of N-linked carbohydrate glycosylation sites. The recombination signal sequences suggest that the mechanism of rearrangements are identical to those of mammals. The locus is inherited in a diploid manner despite the pseudotetraploidy of the Xenopus laevis and X. gilli used in this study. PMID:9079820

  3. Genetic polymorphism of beta-lactoglobulin gene in native Turkish sheep breeds.

    PubMed

    Elmaci, Cengiz; Oner, Yasemin; Balcioglu, M Soner

    2006-10-01

    The genetic polymorphism of the beta-lactoglobulin gene was investigated in three native Turkish sheep breeds. The study was carried out on 108 sheep (29 Kivircik, 38 Gökçeada, and 41 Sakiz) by means of PCR-RFLP methods. Two genetic variants (A and B) and three genotypes (AA, AB, and BB) of beta-lactoglobulin have been identified. The gene frequencies of beta-LG A and B were 0.7759 and 0.2241 in Kivircik, 0.7632 and 0.2368 in Gökçeada, and 0.9756 and 0.0244 in Sakiz breeds, respectively. The populations were in Hardy-Weinberg equilibrium in all samples from the three breeds.

  4. Transposition of the gene encoding a TEM-12 extended-spectrum beta-lactamase.

    PubMed Central

    Heritage, J; Hawkey, P M; Todd, N; Lewis, I J

    1992-01-01

    An isolate of Klebsiella oxytoca from the blood culture of a child with leukemia was found to produce two beta-lactamases, at least one of which conferred resistance to ceftazidime. Genes encoding both enzymes were located on a single self-transmissible 100-kb plasmid, pOZ201. This plasmid was introduced into Escherichia coli UB5201 (pACYC184), and the gene encoding one beta-lactamase was transposed onto plasmid pACYC184 by exploiting a gene dosage effect. The transposable gene was found to encode a TEM-12 enzyme as determined by nucleotide sequencing. This gene was subsequently transposed onto plasmid pUB307. The transposable element encoding the TEM-12 enzyme has been designated Tn841. Both plasmids pACYC184::Tn841 and pUB307::Tn841 were shown to encode a beta-lactamase with the same isoelectric point and substrate profile as the TEM-12 beta-lactamase. Transposon Tn841, at approximately 7 kb, is larger than TnA (4.8 kb) and transposes at a lower frequency. Although it produced a resolvase which can complement the resolvase of Tn3, its transposase function was not able to complement the transposition of a TnA element which lacked transposase. The occurrence of a gene encoding an extended-spectrum beta-lactamase on a transposable element in a clinically significant bacterium is potentially a cause for concern for the spread of resistance to the extended-spectrum cephalosporins. PMID:1329636

  5. Polymorphism of DNA sequence adjacent to human beta-globin structural gene: relationship to sickle mutation.

    PubMed

    Kan, Y W; Dozy, A M

    1978-11-01

    Restriction endonuclease mapping of the human globin genes revealed a genetic variation in a Hpa I recognition site about 5000 nucleotides from the 3' end of the beta-globin structural gene. Instead of a normal 7.6-kilobase (kb) fragment which contains the beta-globin structural gene, 7.0-kb and 13.0-kb variants were detected. Both variants were found in people of African origin and were not detected in Asians or Caucasians. The 13.0-kb variant is frequently associated with the sickle hemoglobin mutation and may be useful for the prediction of the sickle cell gene in prenatal diagnosis. Polymorphism in a restriction enzyme site could be considered as a new class of genetic marker and may offer a new approach to linkage analysis and anthropological studies.

  6. Genetic regulation of carotene biosynthesis in selected tomato strains: aspects of beta-carotene biosynthesis and B gene specificity.

    PubMed

    Premachandra, B R

    1986-01-01

    A comparative qualitative and quantitative study of the carotene compositions of a high beta-carotene type mutant Priya Darshini-1 (PD-1), high lycopene type, Pusa Ruby (PR) and the F1 hybrid of these two strains was carried out. Increased amounts of beta-zeacarotene and gamma-carotene were realized in the PD-1 parent and in the F1 hybrid. This correlates the increased beta-zeacarotene and gamma-carotene synthesis with increased beta-carotene synthesis. Introduction of gene B (the gene that regulates beta-carotene biosynthesis) to a system lacking it induces considerable amount of beta-carotene synthesis at the expense of lycopene in the hybrid. Based on these observations a 'three point control' for the beta-carotene biosynthesis in tomato fruits is suggested with the gene B capable of promoting two different pathways in the high beta-carotene types. The probable sites of action of the modifier mOB (the gene that regulates expression of B gene) are indicated. Beta-carotene and xanthophyll contents of different parts of tomato plants of a PD-1 type and the PR type F2 segregates of the F1 hybrid (PR X PD-1)F1 have been studied. Results indicate that the action of gene B is highly specific and exclusively oriented towards the fruit and not expressed in any other parts of the tomato plant.

  7. Characterization and expression of the beta-N-acetylglucosaminidase gene family of Tribolium castaneum

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Enzymes belonging to the Beta-N-acetylglucosaminidase (NAG) family cleave chitin oligosaccharides produced by the action of chitinases on chitin into the constituent N-acetylglucosamine monomer. Four genes encoding putative NAGs in the red flour beetle, Tribolium castaneum, namely TcNAG1, TcFDL, Tc...

  8. Using the NCBI Genome Databases to Compare the Genes for Human & Chimpanzee Beta Hemoglobin

    ERIC Educational Resources Information Center

    Offner, Susan

    2010-01-01

    The beta hemoglobin protein is identical in humans and chimpanzees. In this tutorial, students see that even though the proteins are identical, the genes that code for them are not. There are many more differences in the introns than in the exons, which indicates that coding regions of DNA are more highly conserved than non-coding regions.

  9. Nonblack patients with sickle cell disease have African. beta. sup s gene cluster haplotypes

    SciTech Connect

    Rogers, Z.R.; Powars, D.R.; Williams, W.D. ); Kinney, T.R. ); Schroeder, W.A. )

    1989-05-26

    Of 18 nonblack patients with sickle cell disease, 14 had sickle cell anemia, 2 had hemoglobin SC disease, and 2 had hemoglobin S-{beta}{sup o}-thalassemia. The {beta}{sup s} gene cluster haplotypes that were determined in 7 patients were of African origin and were identified as Central African Republic, Central African Republic minor II, Benin, and Senegal. The haplotype Central African Republic minor II was present on the {beta}{sup o}-thalassemia chromosome in 2 patients. None of 10 patients whose {alpha}-gene status was determined had {alpha}-thalassemia-2. These data strongly support the concept that the {beta}{sup s} gene on chromosome 11 of these individuals is of African origin and that the {alpha}-gene locus on chromosome 16 is of white or native American origin. The clinical severity of the disease in these nonblack patients is appropriate to their haplotype without {alpha}-thalassemia-2 and is comparable with that of black patients. All persons with congenital hemolytic anemia should be examined for the presence of sickle cell disease regardless of physical appearance or ethnic background.

  10. Direct cellobiose production from cellulose using sextuple beta-glucosidase gene deletion Neurospora crassa mutants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Direct cellobiose production from cellulose by a genetically modified fungus—Neurospora crassa, was explored in this study. A library of N. crassa sextuple beta-glucosidase (bgl) gene deletion strains was constructed. Various concentrations of cellobiose were detected in the culture broth of the N. ...

  11. Origin and spread of beta-globin gene mutations in India, Africa, and Mediterranea: analysis of the 5' flanking and intragenic sequences of beta S and beta C genes.

    PubMed

    Trabuchet, G; Elion, J; Baudot, G; Pagnier, J; Bouhass, R; Nigon, V M; Labie, D; Krishnamoorthy, R

    1991-06-01

    Nucleotide polymorphisms of both the 5' flanking and intragenic regions of the human beta-globin gene were investigated by directly sequencing genomic DNA after amplification by the polymerase chain reaction in 47 subjects homozygous for the beta S or the beta C mutation. The sickle-cell mutation was found in the context of five different haplotypes defined by eight nucleotide substitutions and various structures of a region of the simple repeated sequence (AT) chi Ty. All subjects from the same geographic origin bear an identical chromosomal structure, defining the Senegal-, Bantu-, Benin-, Cameroon-, and Indian-type chromosomes. These results strengthen our previous conclusions about the multiple occurrence of the sickle-cell mutation. The Benin-type chromosome was also found among Algerian and Sicilian sickle-cell patients, whereas the Indian-type chromosome was observed in two geographically distant tribes, illustrating the spread of these sickle-cell genes. We also found that the intragenic sequence polymorphisms (frameworks) are not always in linkage disequilibrium with the BamH I polymorphism downstream from the beta-globin gene, as had been previously observed. Finally, we present a tentative phylogenetic tree of the different alleles at this locus. Some polymorphisms of this sequence might be contemporary with our last common ancestor, the great apes, that is, about 4-6 millions years old.

  12. Isolation and functional characterization of a lycopene beta-cyclase gene that controls fruit colour of papaya (Carica papaya L.).

    PubMed

    Devitt, Luke C; Fanning, Kent; Dietzgen, Ralf G; Holton, Timothy A

    2010-01-01

    The colour of papaya fruit flesh is determined largely by the presence of carotenoid pigments. Red-fleshed papaya fruit contain lycopene, whilst this pigment is absent from yellow-fleshed fruit. The conversion of lycopene (red) to beta-carotene (yellow) is catalysed by lycopene beta-cyclase. This present study describes the cloning and functional characterization of two different genes encoding lycopene beta-cyclases (lcy-beta1 and lcy-beta2) from red (Tainung) and yellow (Hybrid 1B) papaya cultivars. A mutation in the lcy-beta2 gene, which inactivates enzyme activity, controls lycopene production in fruit and is responsible for the difference in carotenoid production between red and yellow-fleshed papaya fruit. The expression level of both lcy-beta1 and lcy-beta2 genes is similar and low in leaves, but lcy-beta2 expression increases markedly in ripe fruit. Isolation of the lcy-beta2 gene from papaya, that is preferentially expressed in fruit and is correlated with fruit colour, will facilitate marker-assisted breeding for fruit colour in papaya and should create possibilities for metabolic engineering of carotenoid production in papaya fruit to alter both colour and nutritional properties.

  13. Transcriptional modulation of transin gene expression by epidermal growth factor and transforming growth factor beta

    SciTech Connect

    Machida, C.M.; Muldoon, L.L.; Rodland, K.D.; Magun, B.E.

    1988-06-01

    Transin is a transformation-associated gene which is expressed constitutively in rat fibroblasts transformed by a variety of oncogenes and in malignant mouse skin carcinomas but not benign papillomas or normal skin. It has been demonstrated that, in nontransformed Rat-1 cells, transin RNA expression is modulated positively by epidermal growth factor (EGF) and negatively by transforming growth factor beta (TGF-BETA); other peptide growth factors were found to have no effect on transin expression. Results presented here indicate that both protein synthesis and continuous occupancy of the EGF receptor by EGF were required for sustained induction of transin RNA. Treatment with TGF-BETA inhibited the ability of EGF to induce transin, whether assayed at the transcriptional level by nuclear run-on analysis or at the level of transin RNA accumulation by Northern (RNA) blot analysis of cellular RNA. TGF-BETA both blocked initial production of transin transcription by EGF and halted established production of transin transcripts during prolonged treatment. These results suggest that TGF-BETA acts at the transcriptional level to antagonize EGF-mediated induction of transin gene expression.

  14. Generation of a high-titer retroviral vector capable of expressing high levels of the human beta-globin gene.

    PubMed

    Sadelain, M; Wang, C H; Antoniou, M; Grosveld, F; Mulligan, R C

    1995-07-18

    Retrovirus-mediated gene transfer into hematopoietic cells may provide a means of treating both inherited and acquired diseases involving hematopoietic cells. Implementation of this approach for disorders resulting from mutations affecting the beta-globin gene (e.g., beta-thalassemia and sickle cell anemia), however, has been hampered by the inability to generate recombinant viruses able to efficiently and faithfully transmit the necessary sequences for appropriate gene expression. We have addressed this problem by carefully examining the interactions between retroviral and beta-globin gene sequences which affect vector transmission, stability, and expression. First, we examined the transmission properties of a large number of different recombinant proviral genomes which vary both in the precise nature of vector, beta-globin structural gene, and locus control region (LCR) core sequences incorporated and in the placement and orientation of those sequences. Through this analysis, we identified one specific vector, termed M beta 6L, which carries both the human beta-globin gene and core elements HS2, HS3, and HS4 from the LCR and faithfully transmits recombinant proviral sequences to cells with titers greater than 10(6) per ml. Populations of murine erythroleukemia (MEL) cells transduced by this virus expressed levels of human beta-globin transcript which, on a per gene copy basis, were 78% of the levels detected in an MEL-derived cell line, Hu11, which carries human chromosome 11, the site of the beta-globin locus. Analysis of individual transduced MEL cell clones, however, indicated that, while expression was detected in every clone tested (n = 17), the levels of human beta-globin treatment varied between 4% and 146% of the levels in Hu11. This clonal variation in expression levels suggests that small beta-globin LCR sequences may not provide for as strict chromosomal position-independent expression of beta-globin as previously suspected, at least in the context of

  15. A novel mutation of the beta-glucocerebrosidase gene associated with neurologic manifestations in three sibs.

    PubMed

    Parenti, G; Filocamo, M; Titomanlio, L; Rizzolo, G; Silvestro, E; Perretti, A; Gatti, R; Andria, G

    1998-04-01

    We report on a sibship in which three members were affected by Gaucher disease. Molecular analysis of the patients showed homozygosity for a novel mutation (C5390G) of the beta-glucocerebrosidase gene, resulting in the substitution of the arginine 353 with a glycine. Western blot analysis showed a reduced amount of beta-glucocerebrosidase-related polypeptides in fibroblasts. The phenotype resulting from this mutation is characterized by visceral and skeletal manifestations. In addition, the presence of seizures and electrophysiological abnormalities only in the 3 patients and in none of the other unaffected sibs suggests that the mutation is responsible for neurologic involvement. PMID:9650766

  16. Characterization of the genes encoding beta-ketoadipate: succinyl-coenzyme A transferase in Pseudomonas putida.

    PubMed Central

    Parales, R E; Harwood, C S

    1992-01-01

    beta-Ketoadipate:succinyl-coenzyme A transferase (beta-ketoadipate:succinyl-CoA transferase) (EC 2.8.3.6) carries out the penultimate step in the conversion of benzoate and 4-hydroxybenzoate to tricarboxylic acid cycle intermediates in bacteria utilizing the beta-ketoadipate pathway. This report describes the characterization of a DNA fragment from Pseudomonas putida that encodes this enzyme. The fragment complemented mutants defective in the synthesis of the CoA transferase, and two proteins of sizes appropriate to encode the two nonidentical subunits of the enzyme were produced in Escherichia coli when the fragment was placed under the control of a phage T7 promoter. DNA sequence analysis revealed two open reading frames, designated pcaI and pcaJ, that were separated by 8 bp, suggesting that they may comprise an operon. A comparison of the deduced amino acid sequence of the P. putida CoA transferase genes with the sequences of two other bacterial CoA transferases and that of succinyl-CoA:3-ketoacid CoA transferase from pig heart suggests that the homodimeric structure of the mammalian enzyme may have resulted from a gene fusion of the bacterial alpha and beta subunit genes during evolution. Conserved functional groups important to the catalytic activity of CoA transferases were also identified. Images PMID:1624453

  17. Regulated expression of a complete human beta-globin gene encoded by a transmissible retrovirus vector.

    PubMed Central

    Cone, R D; Weber-Benarous, A; Baorto, D; Mulligan, R C

    1987-01-01

    We introduced a human beta-globin gene into murine erythroleukemia (MEL) cells by infection with recombinant retroviruses containing the complete genomic globin sequence. The beta-globin gene was correctly regulated during differentiation, steady-state mRNA levels being induced 5- to 30-fold after treatment of the cells with the chemical inducer dimethyl sulfoxide. Studies using vectors which yield integrated proviruses lacking transcriptional enhancer sequences indicated that neither retroviral transcription nor the retroviral enhancer sequences themselves had any obvious effect on expression of the globin gene. Viral RNA expression also appeared inducible, being considerably depressed in uninduced MEL cells but approaching normal wild-type levels after dimethyl sulfoxide treatment. We provide data which suggest that the control point for both repression and subsequent activation of virus expression in MEL cells lies in the viral enhancer element. Images PMID:3029570

  18. Assignment of the {beta}B1 crystallin gene (CRYBB1) to human chromosome 22 and mouse chromosome 5

    SciTech Connect

    Hulsebos, T.J.M.; Westerveld, A.; Gilbert, D.J.; Jenkins, N.A.; Copeland, N.G.

    1995-10-10

    By using primers complementary to the rat {beta}B1 crystallin gene sequence, we amplified exons 5 and 6 of the orthologous human gene (CRYBB1). The amplified human segments displayed greater than 88% sequence homology to the corresponding rat and bovine sequences. CRYBB1 was assigned to the group 5 region in 22q11.2-q12.1 by hybridizing the exon 6 PCR product to somatic cell hybrids containing defined portions of human chromosome 22. The exon 5 and exon 6 PCR products of CRYBB1 were used to localize, by interspecific backcross mapping, the mouse gene (Crybb1) to the central portion of chromosome 5. Three other {beta} crystallin genes ({beta}B2(-l), {beta}B3, and {beta}A4) have previously been mapped to the same regions in human and mouse. We demonstrate that the {beta}B1 and {beta}A4 crystallin genes are very closely linked in the two species. These assignments complete the mapping and identification of the human and mouse homologues of the major {beta} crystallins genes that are expressed in the bovine lens. 39 refs., 5 figs., 1 tab.

  19. Anti-beta s-ribozyme reduces beta s mRNA levels in transgenic mice: potential application to the gene therapy of sickle cell anemia.

    PubMed

    Alami, R; Gilman, J G; Feng, Y Q; Marmorato, A; Rochlin, I; Suzuka, S M; Fabry, M E; Nagel, R L; Bouhassira, E E

    1999-04-01

    Our current strategy for gene therapy of sickle cell anemia involves retroviral vectors capable of transducing "designer" globin genes that code for novel anti-sickling globins (while resisting digestion by a ribozyme), coupled with the expression of a hammerhead ribozyme that can selectively cleave the human beta s mRNA. In this report, we have tested in vivo an anti-beta s hammerhead ribozyme embedded within a cDNA coding for the luciferase reporter gene driven by the human beta-globin promoter and hyper-sensitive sites 3 and 4 of the locus control region. We have created mice transgenic for this luciferase-ribozyme construct and bred the ribozyme transgene into mice that were already transgenic for the human beta s gene. We then measured expression of the beta s transgene at the protein and RNA levels by HPLC and primer extension. The presence of the ribozyme was associated with a statistically significant reduction in the level of beta s mRNA in spleen stress reticulocytes (from 60.5 +/- 4.1% to 52.9 +/- 4.2%) and in the percentage of beta s globin chains in very young mice (from 44.5 +/- 0.6% to 40.8 +/- 0.7%). These results demonstrate that it is possible to decrease the concentration of beta s chains and mRNA with the help of a hammerhead ribozyme. While the enormous amount of globin mRNA in reticulocytes is a challenge for ribozyme technology, the exquisite dependence of the delay time for formation of Hb S nuclei on the concentration of Hb S in red blood cells suggests that even a modest reduction in Hb S concentration would have therapeutic value.

  20. High-resolution structure of HLA-A*0201 in complex with a tumour-specific antigenic peptide encoded by the MAGE-A4 gene.

    PubMed

    Hillig, R C; Coulie, P G; Stroobant, V; Saenger, W; Ziegler, A; Hülsmeyer, M

    2001-07-27

    The heterotrimeric complex of the human major histocompatibity complex (MHC) molecule HLA-A*0201, beta2-microglobulin and the decameric peptide GVYDGREHTV derived from the melanoma antigen (MAGE-A4 protein has been determined by X-ray crystallography at 1.4 A resolution. MAGE-A4 belongs to a family of genes that are specifically expressed in a variety of tumours. MAGE-A4-derived peptides are presented by MHC molecules at the cell surface to cytotoxic T-lymphocytes. As the HLA-A*0201:MAGE-A4 complex occurs only on tumour cells, it is considered to be an appropriate target for immunotherapy. The structure presented here reveals potential epitopes specific to the complex and indicates which peptide residues could be recognised by T-cell receptors. In addition, as the structure could be refined anisotropically, it was possible to describe the movements of the bound peptide in more detail.

  1. Cloning and expression in Saccharomyces cerevisiae of a Trichoderma reesei beta-mannanase gene containing a cellulose binding domain.

    PubMed Central

    Stålbrand, H; Saloheimo, A; Vehmaanperä, J; Henrissat, B; Penttilä, M

    1995-01-01

    beta-Mannanase (endo-1,4-beta-mannanase; mannan endo-1,4-beta-mannosidase; EC 3.2.1.78) catalyzes endo-wise hydrolysis of the backbone of mannan and heteromannans, including hemicellulose polysaccharides, which are among the major components of plant cell walls. The gene man1, which encodes beta-mannanase, of the filamentous fungus Trichoderma reesei was isolated from an expression library by using antiserum raised towards the earlier-purified beta-mannanase protein. The deduced beta-mannanase consists of 410 amino acids. On the basis of hydrophobic cluster analysis, the beta-mannanase was assigned to family 5 of glycosyl hydrolases (cellulase family A). The C terminus of the beta-mannanase has strong amino acid sequence similarity to the cellulose binding domains of fungal cellulases and is preceded by a serine-, threonine-, and proline-rich region. Consequently, the beta-mannanase is probably organized similarly to the T. reesei cellulases, having a catalytic core domain separated from the substrate-binding domain by an O-glycosylated linker. Active beta-mannanase was expressed and secreted by using the yeast Saccharomyces cerevisiae as the host. The results indicate that the man1 gene encodes the two beta-mannanases with different isoelectric points (pIs 4.6 and 5.4) purified earlier from T. reesei. PMID:7793911

  2. Sequence analysis of the promoter regions of the classical class I gene RT1.A and two other class I genes of the rat MHC

    SciTech Connect

    Lambracht, D.; Wonigeit, K.

    1995-04-01

    Major histocompatibility complex (MHC) class I molecules present peptides to CD8+ T cells and thus play key role in immunosurveillance by T-cell-mediated mechanisms. Their expression depends on complex control mechanisms at two major levels: (1) regulation of transcription mediated through the promoter region and additional regulatory elements of the individual class I gene, and (2) availability of appropriate peptides in the endoplasmic reticulum required to stabilize the ternary complex consisting of class I {alpha} chain, {beta}{sub 2}-microglobulin ({beta}{sub 2}m), and peptide. In addition, differences in the ability of different {alpha} chains to bind {beta}{sub 2}m can influence the transport to and turnover within the cell membrane. We have now analyzed the promoter regions of class I genes of the LEW rat strain carrying the RT1{sup 1} haplotype. The analysis of three class I genes in this region has led to the identification of characteristic regulatory sequences. 20 refs., 2 figs.

  3. Recurrent fatal hydrops fetalis associated with a nucleotide substitution in the erythrocyte beta-spectrin gene.

    PubMed Central

    Gallagher, P G; Weed, S A; Tse, W T; Benoit, L; Morrow, J S; Marchesi, S L; Mohandas, N; Forget, B G

    1995-01-01

    We studied a kindred in which four third-trimester fetal losses occurred, associated with severe Coombs-negative hemolytic anemia and hydrops fetalis. Postmortem examination of two infants revealed extensive extramedullary erythropoiesis. Studies of erythrocytes and erythrocyte membranes from the parents revealed abnormal erythrocyte membrane mechanical stability as well as structural and functional abnormalities in spectrin, the principal structural protein of the erythrocyte membrane. Genetic studies identified a point mutation of the beta-spectrin gene, S2019P, in a region of beta spectrin that is critical for normal spectrin function. Both parents and two living children were heterozygous for this mutation; three infants dying of hydrops fetalis were homozygous for this mutation. In an in vitro assay using recombinant peptides, the mutant beta-spectrin peptide demonstrated a significant abnormality in its ability to interact with alpha spectrin. This is the first description of a molecular defect of the erythrocyte membrane associated with hydrops fetalis. Images PMID:7883966

  4. Comparison of the canine and human acid {beta}-galactosidase gene

    SciTech Connect

    Ahern-Rindell, A.J.; Kretz, K.A.; O`Brien, J.S.

    1996-05-17

    Several canine cDNA libraries were screened with human {beta}-galactosidase cDNA as probe. Seven positive clones were isolated and sequenced yielding a partial (2060 bp) canine {beta}-galactosidase cDNA with 86% identity to the human {beta}-galactosidase cDNA. Preliminary analysis of a canine genomic library indicated conservation of exon number and size. Analysis by Northern blotting disclosed a single mRNA of 2.4 kb in fibroblasts and liver from normal dogs and dogs affected with GM1 gangliosidosis. Although incomplete, these results indicate canine GM1 gangliosidosis is a suitable animal model of the human disease and should further efforts to devise a gene therapy strategy for its treatment. 20 refs., 2 figs., 1 tab.

  5. MHC evolution in three salmonid species: a comparison between class II alpha and beta genes.

    PubMed

    Gómez, Daniela; Conejeros, Pablo; Marshall, Sergio H; Consuegra, Sofia

    2010-08-01

    The genes of the major histocompatibility complex (MHC) are amongst the most variable in vertebrates and represent some of the best candidates to study processes of adaptive evolution. However, despite the number of studies available, most of the information on the structure and function of these genes come from studies in mammals and birds in which the MHC class I and II genes are tightly linked and class II alpha exhibits low variability in many cases. Teleost fishes are among the most primitive vertebrates with MHC and represent good organisms for the study of MHC evolution because their class I and class II loci are not physically linked, allowing for independent evolution of both classes of genes. We have compared the diversity and molecular mechanisms of evolution of classical MH class II alpha and class II beta loci in farm populations of three salmonid species: Oncorhynchus kisutch, Oncorhynchus mykiss and Salmo salar. We found single classical class II loci and high polymorphism at both class II alpha and beta genes in the three species. Mechanisms of evolution were common for both class II genes, with recombination and point mutation involved in generating diversity and positive selection acting on the peptide-binding residues. These results suggest that the maintenance of variability at the class IIalpha gene could be a mechanism to increase diversity in the MHC class II in salmonids in order to compensate for the expression of one single classical locus and to respond to a wider array of parasites. PMID:20521040

  6. MHC evolution in three salmonid species: a comparison between class II alpha and beta genes.

    PubMed

    Gómez, Daniela; Conejeros, Pablo; Marshall, Sergio H; Consuegra, Sofia

    2010-08-01

    The genes of the major histocompatibility complex (MHC) are amongst the most variable in vertebrates and represent some of the best candidates to study processes of adaptive evolution. However, despite the number of studies available, most of the information on the structure and function of these genes come from studies in mammals and birds in which the MHC class I and II genes are tightly linked and class II alpha exhibits low variability in many cases. Teleost fishes are among the most primitive vertebrates with MHC and represent good organisms for the study of MHC evolution because their class I and class II loci are not physically linked, allowing for independent evolution of both classes of genes. We have compared the diversity and molecular mechanisms of evolution of classical MH class II alpha and class II beta loci in farm populations of three salmonid species: Oncorhynchus kisutch, Oncorhynchus mykiss and Salmo salar. We found single classical class II loci and high polymorphism at both class II alpha and beta genes in the three species. Mechanisms of evolution were common for both class II genes, with recombination and point mutation involved in generating diversity and positive selection acting on the peptide-binding residues. These results suggest that the maintenance of variability at the class IIalpha gene could be a mechanism to increase diversity in the MHC class II in salmonids in order to compensate for the expression of one single classical locus and to respond to a wider array of parasites.

  7. In Vitro and in Vivo nucleosome positioning on the ovine beta-lactoglobulin gene are related.

    PubMed

    Gencheva, Marieta; Boa, Simon; Fraser, Ross; Simmen, Martin W; A Whitelaw, C Bruce; Allan, James

    2006-08-11

    Although positioned nucleosomes are known to play a direct, localised role in regulating access to DNA sequence, they also have the potential, through their long-range distribution, to affect the detailed structure of the higher-order chromatin fibre. To investigate this possibility, we firstly mapped, in vitro, the sequence-dependent positions that the core histone octamer adopts when reconstituted onto DNA containing the ovine beta-lactoglobulin gene. These positioning sites are discussed in terms of their relative affinity for the histone octamer, their locations with respect to the gene sequence and their periodic distribution throughout the gene region. Secondly, we mapped, in vivo, the sites that nucleosomes occupy on the same sequence in liver nuclei, where the gene is transcriptionally inactive. Although the sequence is largely packaged into regularly spaced nucleosomes, reflecting a fibre of uniform higher-order structure, this organisation is disrupted by a number of unusual chromatin structures in a region stretching from the second to the third introns of the gene. A comparison of the in vitro and in vivo nucleosome positioning data shows that they are qualitatively and quantitatively related, suggesting that the structure of the higher-order chromatin fibre containing the beta-lactoglobulin gene is determined, in part, by the long-range organisation of the non-coding sequences within which the gene is embedded.

  8. Analysis and expression of the alpha-expansin and beta-expansin gene families in maize

    NASA Technical Reports Server (NTRS)

    Wu, Y.; Meeley, R. B.; Cosgrove, D. J.

    2001-01-01

    Expansins comprise a multigene family of proteins in maize (Zea mays). We isolated and characterized 13 different maize expansin cDNAs, five of which are alpha-expansins and eight of which are beta-expansins. This paper presents an analysis of these 13 expansins, as well as an expression analysis by northern blotting with materials from young and mature maize plants. Some expansins were expressed in restricted regions, such as the beta-expansins ExpB1 (specifically expressed in maize pollen) and ExpB4 (expressed principally in young husks). Other expansins such as alpha-expansin Exp1 and beta-expansin ExpB2 were expressed in several organs. The expression of yet a third group was not detected in the selected organs and tissues. An analysis of expansin sequences from the maize expressed sequence tag collection is also presented. Our results indicate that expansin genes may have general, overlapping expression in some instances, whereas in other cases the expression may be highly specific and limited to a single organ or cell type. In contrast to the situation in Arabidopsis, beta-expansins in maize seem to be more numerous and more highly expressed than are alpha-expansins. The results support the concept that beta-expansins multiplied and evolved special functions in the grasses.

  9. Cell and Gene Therapy for the Beta-Thalassemias: Advances and Prospects.

    PubMed

    Mansilla-Soto, Jorge; Riviere, Isabelle; Boulad, Farid; Sadelain, Michel

    2016-04-01

    The beta-thalassemias are inherited anemias caused by mutations that severely reduce or abolish expression of the beta-globin gene. Like sickle cell disease, a related beta-globin gene disorder, they are ideal candidates for performing a genetic correction in patient hematopoietic stem cells (HSCs). The most advanced approach utilizes complex lentiviral vectors encoding the human β-globin gene, as first reported by May et al. in 2000. Considerable progress toward the clinical implementation of this approach has been made in the past five years, based on effective CD34+ cell mobilization and improved lentiviral vector manufacturing. Four trials have been initiated in the United States and Europe. Of 16 evaluable subjects, 6 have achieved transfusion independence. One of them developed a durable clonal expansion, which regressed after several years without transformation. Although globin lentiviral vectors have so far proven to be safe, this occurrence suggests that powerful insulators with robust enhancer-blocking activity will further enhance this approach. The combined discovery of Bcl11a-mediated γ-globin gene silencing and advances in gene editing are the foundations for another gene therapy approach, which aims to reactivate fetal hemoglobin (HbF) production. Its clinical translation will hinge on the safety and efficiency of gene targeting in true HSCs and the induction of sufficient levels of HbF to achieve transfusion independence. Altogether, the progress achieved over the past 15 years bodes well for finding a genetic cure for severe globin disorders in the next decade. PMID:27021486

  10. Enantioselective Degradation Mechanism of Beta-Cypermethrin in Soil From the Perspective of Functional Genes.

    PubMed

    Yang, Zhong-Hua; Ji, Guo-Dong

    2015-12-01

    The behavior and mechanisms of the enantioselective degradation of beta-cypermethrin were studied in soil. The four isomers were degraded at different rates, and the enantiomer fractions of alpha-cypermethrin and theta-cypermethrin exceeded 0.5. Moreover, 3-phenoxybenzoic acid, phenol, and protocatechuic acid were detected; based on the presence of these metabolites, we predicted the degradation pathway and identified the functional genes that are related to this degradation process. We established quantitative relationships between the data on degradation kinetics and functional genes; we found that the quantitative relationships between different enantiomers differed even under the same conditions, and the genes pobA and pytH played key roles in limiting the degradation rate. Data obtained using path analysis revealed that the same gene had different direct and indirect effects on the degradation of different isomers. A mechanism was successfully proposed to explain the selective degradation of chiral compounds based on the perspective of functional genes.

  11. Transcriptional regulation of the human iNOS gene by IL-1beta in endothelial cells.

    PubMed Central

    Kolyada, A. Y.; Madias, N. E.

    2001-01-01

    BACKGROUND: Vascular endothelium participates in the control of vascular tone and function via the release of nitric oxide (NO) by the endothelial-type NO synthase (eNOS). Inducible NO synthase (iNOS) expression in endothelial cells occurs in many clinical conditions following induction by lipopolysaccharide or cytokines and generates large quantities of NO that result in endothelial cell activation and dysfunction. No information exists on the transcriptional regulation of the human iNOS gene (or that of other species) in endothelial cells. MATERIALS AND METHODS: We examined the transcriptional regulation of the human iNOS gene by interleukin-1beta (IL-1beta) in rat pulmonary microvascular endothelial cells (PVEC) by transient cotransfections of different iNOS-promoter constructs and cDNA of different transcription factors and regulatory proteins. RESULTS: The -1034/+88 bp iNOS promoter was strongly induced by IL-1beta, the regulatory elements for such induction being localized downstream of -205 bp. Cotransfection experiments with NF-kappaB isoforms, IkappaB isoforms, and IKK mutants suggested that the NF-kappaB site at -115/-106 bp is important, but not sufficient, for induction of iNOS promoter and that the role of NF-kappaB is partially independent of its binding site. C/EBP sites within the -205/+88 bp region were shown to be responsible, along with NF-kappaB site, for induction of iNOS promoter by IL-1beta. Overexpression of C/EBPalpha, C/EBPdelta, and liver-enriched activator protein (LAP) activated the promoter, whereas overexpression of liver-enriched inhibitory protein (LIP) strongly suppressed it. C/EBPbeta (LAP and LIP isoforms) was constitutively present in PVEC and was induced (approximately 2-fold) by IL-1beta, whereas C/EBPdelta was not constitutively expressed but was strongly induced by IL-1beta. Both C/EBPbeta and C/EBPdelta participated in DNA-protein complex formation. CONCLUSION: Both NF-kappaB and C/EBP pathways are important for the

  12. A self-excising beta-recombinase/six cassette for repetitive gene deletion and homokaryon purification in Neurospora crassa

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In a previous study we developed a cassette employing a bacterial beta-recombinase acting on six recognition sequences (beta-rec/six), which allowed repetitive site-specific gene deletion and marker recycling in Neurospora crassa. However, only one positive selection marker was used in the cassette...

  13. The functional importance of a cap site-proximal region of the human prointerleukin 1[beta] gene is defined

    SciTech Connect

    Hunninghake, G.W.; Geist, L.J.; Monick, M.M.; Stinski, M.F. ); Monks, B.G.; Monroy, M.A.; Fenton, M.J. ); Webb, A.C. ); Dayer, J.M. ); Auron, P.E. )

    1992-08-01

    Prointerleukin 1[beta] (IL-1[beta]) is a cytokine that mediates a broad range of biological activities. Genomic sequences that regulate IL-1[beta] transcription include both inducible regulatory elements located more than 2,700 bp upstream of the transcriptional start site (cap site) and proximal elements located near the TATA box of this gene. In this study, we focused on the identification and characterization of trans-acting nuclear regulatory proteins that bind to the cap site-proximal region of the human IL-1[beta] gene. We identified a protein, termed NFIL-1[beta]A (NF[beta]A), that binds to a highly conserved 12-bp DNA sequence (-49 to -38) located upstream of the TATA box motif in both the human and murine IL-1[beta] genes. The IL-1[alpha] gene, which lacks a TATA motif, does not possess an NF[beta]A-binding sequence within the promoter region, suggesting that NF[beta]A may selectively regulate IL-1[beta] expression. Using electrophoretic mobility shift assays, we identified several distinct DNA-protein complexes that are expressed in a cell-type-specific manner. In monocytic cell lines, the relative abundance of these complexes varied rapidly following stimulation of the cells with phorbol esters or lipopolysaccharide. UV cross-linking analysis identified two distinct DNA-binding polypeptides that comprise distinct complexes. The functional role of NF[beta]A was assessed in transient transfection assays. These data indicate the NF[beta]A is required for both basal and inducible promoter activity in monocytic cells. Furthermore, the human cytomegalovirus immediate-early 1 gene product requires the presence of NF[beta]A in order to trans-activate the proximal IL-1[beta] promoter in a monocytic cell line. We propose that NF[beta]A is a factor that mediates either direct or indirect activation by the immediate-early 1 gene product. The proximity of this essential factor to the TATA motif suggests a possible role in transcriptional initiation.

  14. Targets for dioxin: Genes for plasminogen activator inhibitor-2 and interleukin-1. beta

    SciTech Connect

    Sutter, T.R.; Guzman, K.; Dold, K.M. ); Greenlee, W.F. )

    1991-10-18

    Dioxin (2,3,7,8-tetrachlorodibenzo-p-dioxin, TCDD), a widespread environmental contaminant, may elicit its effects by altering gene expression in susceptible cells. Five TCDD-responsive complementary DNA clones were isolated from a human keratinocyte cell line. One of these clones encodes plasminogen activator inhibitor-2, a factor that influences growth and differentiation by regulating proteolysis of the extracellular matrix. Another encodes the cytokine interleukin-1{beta}. Thus, TCDD alters the expression of growth regulator genes and has effects similar to those of other tumor-promoting agents that affect both inflammation and differentiation.

  15. beta. amyloid gene duplication in Alzheimer's disease and karyotypically normal Down syndrome

    SciTech Connect

    Delabar, J.; Goldgaber, D.; Lamour, Y.; Nicole, A.; Huret, J.; De Groucy, J.; Brown, P.; Gajdusek, D.C.; Sinet, P.

    1987-03-13

    With the recently cloned complementary DNA probe, lambdaAm4 for the chromosome 21 gene encoding brain amyloid polypeptide (..beta.. amyloid protein) of Alzheimer's disease, leukocyte DNA from three patients with sporadic Alzheimer's disease and two patients with karyotypically normal Down syndrome was found to contain three copies of this bene. Because a small region of chromosome 21 containing the ets-2 gene is duplicated in patients with Alzheimer's disease, as well as in karyotypically normal Down syndrome, duplication of a subsection of the critical segment of chromosome 21 that is duplicated in Down syndrome may be the genetic defect in Alzeimer's disease.

  16. Molecular analysis of the bare lymphocyte syndrome.

    PubMed

    Sullivan, K E; Stobo, J D; Peterlin, B M

    1985-07-01

    The bare lymphocyte syndrome is a disorder in which class I histocompatibility antigens fail to be expressed normally on the surface of lymphocytes. Utilizing complementary DNA probes for both beta 2-microglobulin and class I genes, the molecular basis for this syndrome was investigated in a family with two siblings exhibiting the bare lymphocyte syndrome. Southern blot analysis demonstrated no gross internal defect in either class I or beta 2-microglobulin genes. Northern blot analysis of class I and beta 2-microglobulin messenger RNAs also revealed no qualitative difference between affected and unaffected family members. In contrast, quantitation of both class I and beta 2-microglobulin transcripts demonstrated each to be decreased in patients when compared to controls. Moreover, the decrease in both transcripts was coordinate. These results suggest that the bare lymphocyte syndrome may represent a pretranslational regulatory defect of both class I and beta 2-microglobulin gene expression.

  17. Beta-Arrestin2 regulates RANKL and ephrins gene expression in response to bone remodeling in mice.

    PubMed

    Pierroz, Dominique D; Rufo, Anna; Bianchi, Estelle N; Glatt, Vaida; Capulli, Mattia; Rucci, Nadia; Cavat, Fanny; Rizzoli, René; Teti, Anna; Bouxsein, Mary L; Ferrari, Serge L

    2009-05-01

    PTH-stimulated intracellular signaling is regulated by the cytoplasmic adaptor molecule beta-arrestin. We reported that the response of cancellous bone to intermittent PTH is reduced in beta-arrestin2(-/-) mice and suggested that beta-arrestins could influence the bone mineral balance by controlling RANKL and osteoprotegerin (OPG) gene expression. Here, we study the role of beta-arrestin2 on the in vitro development and activity of bone marrow (BM) osteoclasts (OCs) and Ephrins ligand (Efn), and receptor (Eph) mRNA levels in bone in response to PTH and the changes of bone microarchitecture in wildtype (WT) and beta-arrestin2(-/-) mice in models of bone remodeling: a low calcium diet (LoCa) and ovariectomy (OVX). The number of PTH-stimulated OCs was higher in BM cultures from beta-arrestin2(-/-) compared with WT, because of a higher RANKL/OPG mRNA and protein ratio, without directly influencing osteoclast activity. In vivo, high PTH levels induced by LoCa led to greater changes in TRACP5b levels in beta-arrestin2(-/-) compared with WT. LoCa caused a loss of BMD and bone microarchitecture, which was most prominent in beta-arrestin2(-/-). PTH downregulated Efn and Eph genes in beta-arrestin2(-/-), but not WT. After OVX, vertebral trabecular bone volume fraction and trabecular number were lower in beta-arrestin2(-/-) compared with WT. Histomorphometry showed that OC number was higher in OVX-beta-arrestin2(-/-) compared with WT. These results indicate that beta-arrestin2 inhibits osteoclastogenesis in vitro, which resulted in decreased bone resorption in vivo by regulating RANKL/OPG production and ephrins mRNAs. As such, beta-arrestins should be considered an important mechanism for the control of bone remodeling in response to PTH and estrogen deprivation. PMID:19113915

  18. Validation of housekeeping genes in the brains of rats submitted to chronic intermittent hypoxia, a sleep apnea model.

    PubMed

    Julian, Guilherme Silva; de Oliveira, Renato Watanabe; Perry, Juliana Cini; Tufik, Sergio; Chagas, Jair Ribeiro

    2014-01-01

    Obstructive sleep apnea (OSA) is a syndrome characterized by intermittent nocturnal hypoxia, sleep fragmentation, hypercapnia and respiratory effort, and it has been associated with several complications, such as diabetes, hypertension and obesity. Quantitative real-time PCR has been performed in previous OSA-related studies; however, these studies were not validated using proper reference genes. We have examined the effects of chronic intermittent hypoxia (CIH), which is an experimental model mainly of cardiovascular consequences of OSA, on reference genes, including beta-actin, beta-2-microglobulin, glyceraldehyde-3-phosphate dehydrogenase, hypoxanthine guanine phosphoribosyl transferase and eukaryotic 18S rRNA, in different areas of the brain. All stability analyses were performed using the geNorm, Normfinder and BestKeeper software programs. With exception of the 18S rRNA, all of the evaluated genes were shown to be stable following CIH exposure. However, gene stability rankings were dependent on the area of the brain that was analyzed and varied according to the software that was used. This study demonstrated that CIH affects various brain structures differently. With the exception of the 18S rRNA, all of the tested genes are suitable for use as housekeeping genes in expression analyses.

  19. Validation of Housekeeping Genes in the Brains of Rats Submitted to Chronic Intermittent Hypoxia, a Sleep Apnea Model

    PubMed Central

    Julian, Guilherme Silva; de Oliveira, Renato Watanabe; Perry, Juliana Cini; Tufik, Sergio; Chagas, Jair Ribeiro

    2014-01-01

    Obstructive sleep apnea (OSA) is a syndrome characterized by intermittent nocturnal hypoxia, sleep fragmentation, hypercapnia and respiratory effort, and it has been associated with several complications, such as diabetes, hypertension and obesity. Quantitative real-time PCR has been performed in previous OSA-related studies; however, these studies were not validated using proper reference genes. We have examined the effects of chronic intermittent hypoxia (CIH), which is an experimental model mainly of cardiovascular consequences of OSA, on reference genes, including beta-actin, beta-2-microglobulin, glyceraldehyde-3-phosphate dehydrogenase, hypoxanthine guanine phosphoribosyl transferase and eukaryotic 18S rRNA, in different areas of the brain. All stability analyses were performed using the geNorm, Normfinder and BestKeeper software programs. With exception of the 18S rRNA, all of the evaluated genes were shown to be stable following CIH exposure. However, gene stability rankings were dependent on the area of the brain that was analyzed and varied according to the software that was used. This study demonstrated that CIH affects various brain structures differently. With the exception of the 18S rRNA, all of the tested genes are suitable for use as housekeeping genes in expression analyses. PMID:25289636

  20. Impact of beta2-adrenoreceptor gene variants on cardiac cavity size and systolic function in idiopathic dilated cardiomyopathy.

    PubMed

    Badenhorst, D; Norton, G R; Sliwa, K; Brooksbank, R; Essop, R; Sareli, P; Woodiwiss, A J

    2007-10-01

    In heart failure, the Arg16Gly and Gln27Glu polymorphisms of the beta2-adrenoreceptor (beta2-AR) gene are associated with exercise-capacity, clinical outcomes and response to beta-AR blocker therapy. Whether beta2-AR gene variants mediate these effects in-part through an impact on cardiac structural remodeling and pump function independent of the effects of beta-blockers is uncertain. We evaluated whether the Arg16Gly and Gln27Glu variants of the beta2-AR gene predict left ventricular ejection fraction (LVEF) and LV end diastolic diameter (LVEDD) in patients with idiopathic dilated cardiomyopathy (IDC) before and 6 months after receiving standard medical therapy other than beta-AR blockers. In all, 394 patients with IDC and 393 age and gender-matched controls were genotyped for the beta2-AR gene variants using restriction-fragment length polymorphism-based techniques. LVEF and dimensions were determined in 132 patients (of whom 71 were newly diagnosed) both at baseline and after 6 months. Genotype of neither variant was associated with the presence of IDC. Moreover, beta2-AR genotype did not determine LVEF or LV dimensions prior to initiating therapy. After 6 months of therapy, LVEF increased by 7.1+/-1.0 absolute units (P<0.0001) and LVEDD decreased by 0.27+/-0.06 cm (P<0.02). Adjusting for baseline values as well as gender, age, and type of angiotensin-converting enzyme inhibitor therapy received, genotype was associated with neither final LVEF and LVEDD, nor change in LVEF and LVEDD. In conclusion, these data suggest that in heart failure, the functional Arg16Gly and Gln27Glu variants of the beta2-AR gene have no independent effect on adverse structural remodeling and pump function.

  1. Cloning of the beta 3 chain gene (LAMB3) of human laminin 5, a candidate gene in junctional epidermolysis bullosa.

    PubMed

    Pulkkinen, L; Gerecke, D R; Christiano, A M; Wagman, D W; Burgeson, R E; Uitto, J

    1995-01-01

    Laminin 5 consists of three polypeptides, alpha 3, beta 3, and gamma 2, encoded by the genes LAMA3, LAMB3, and LAMC2, respectively. In this study, we have elucidated the exon-intron organization of the human LAMB3 gene. Characterization of five overlapping lambda phage DNA clones revealed that the gene was approximately 29 kb in size. Subsequent sequence data revealed that the gene consisted of 23 exons that varied from 64 to 379 bp in size, accounting for the full-length cDNA with an open reading frame of 3516 bp encoding 1172 amino acids. Comparison of the LAMB3 gene structure with the previously characterized LAMB1 gene revealed that LAMB3 was considerably more compact. Knowledge of the exon-intron organization of the LAMB3 gene will facilitate elucidation of mutations in patients with the junctional forms of epidermolysis bullosa, some of which have been associated with mutations in the laminin 5 genes. PMID:7774918

  2. Cloning of the {beta}3 chain gene (LAMB3) of human laminin 5, a candidate gene in junctional epidermolysis bullosa

    SciTech Connect

    Pulkkinen, L.; Christiano, A.M.; Uitto, J.

    1995-01-01

    Laminin 5 consists of three polypeptides, {alpha}3, {beta}3, and {gamma}2, encoded by the genes LAMA3, LAMB3, and LAMC2, respectively. In this study, we have elucidated the exon-intron organization of the human LAMB3 gene. Characterization of five overlapping {lambda} phage DNA clones revealed that the gene was approximately 29 kb in size. Subsequent sequence data revealed that the gene consisted of 23 exons that varied from 64 to 379 bp in size, accounting for the full-length cDNA with an open reading frame of 3516 hp encoding 1172 amino acids. Comparison of the LAMB3 gene structure with the previously characterized LAMB1 gene revealed that LAMB3 was considerably more compact. Knowledge of the exon-intron organization of the LAMB3 gene will facilitate elucidation of mutations in patients with the junctional forms of epidermolysis bullosa, some of which have been associated with mutations in the laminin 5 genes. 33 refs., 3 figs., 2 tabs.

  3. Comparative characterization of the cephamycinase blaCMY-1 gene and its relationship with other beta-lactamase genes.

    PubMed Central

    Bauernfeind, A; Stemplinger, I; Jungwirth, R; Wilhelm, R; Chong, Y

    1996-01-01

    A plasmidic beta-lactamase which hydrolyzed cephamycins was first detected and reported in 1989. At that time its description was restricted to phenotypic characteristics. We analyzed nucleotide sequence of its gene and explored it genetic relationship with other bla genes. The deduced amino acid sequence of the blaCMY-1 product was compared with those of other known plasmidic cephamycinases and of chromosomal AmpC beta-lactamases. The results indicate that the relationship of CMY-1 is closest to MOX-1 among the plasmidic cephamycinases and to AmpC of Pseudomonas aeruginosa among the chromosomal cephalosporinases. We conclude that the plasmidic cephamycinases described up to now may be classified into three families, as follows: CMY-1, MOX-1, and FOX-1 with AmpC of P. aeruginosa; CMY-2, BIL-1 and LAT-1 with AmpC of Citrobacter freundii; and MIR-1 with AmpC of Enterobacter cloacae. Plasmidic cephamycinases are now recognized as clinically relevant class C beta-lactamases. PMID:8843306

  4. Lactogenic hormonal induction of long distance interactions between beta-casein gene regulatory elements.

    PubMed

    Kabotyanski, Elena B; Rijnkels, Monique; Freeman-Zadrowski, Courtneay; Buser, Adam C; Edwards, Dean P; Rosen, Jeffrey M

    2009-08-21

    Lactogenic hormone regulation of beta-casein gene expression in mammary epithelial cells provides an excellent model in which to study the mechanisms by which steroid and peptide hormone signaling control gene expression. Prolactin- and glucocorticoid-mediated induction of beta-casein gene expression involves two principal regulatory regions, a proximal promoter and a distal enhancer located in the mouse approximately -6 kb upstream of the transcription start site. Using a chromosome conformation capture assay and quantitative real time PCR, we demonstrate that a chromatin loop is created in conjunction with the recruitment of specific transcription factors and p300 in HC11 mammary epithelial cells. Stimulation with both prolactin and hydrocortisone is required for the induction of these long range interactions between the promoter and enhancer, and no DNA looping was observed in nontreated cells or cells treated with each of the hormones separately. The lactogenic hormone-induced interaction between the proximal promoter and distal enhancer was confirmed in hormone-treated primary three-dimensional mammary acini cultures. In addition, the developmental regulation of DNA looping between the beta-casein regulatory regions was observed in lactating but not in virgin mouse mammary glands. Furthermore, beta-casein mRNA induction and long range interactions between these regulatory regions were inhibited in a progestin-dependent manner following stimulation with prolactin and hydrocortisone in HC11 cells expressing human PR-B. Collectively, these data suggest that the communication between these regulatory regions with intervening DNA looping is a crucial step required to both create and maintain active chromatin domains and regulate transcription.

  5. Beta S-gene-cluster haplotypes in sickle cell anemia: clinical implications.

    PubMed

    Powars, D R; Chan, L; Schroeder, W A

    1990-01-01

    Restriction endonuclease analysis was used to detect alpha-gene deletions and to determine the haplotypes in the DNA of the beta S-gene-cluster [Benin, Central African Republic (CAR), and Senegal] in 221 patients with sickle cell anemia (SS). The clinical expression of SS was modified by the beta S-gene-cluster polymorphisms and the alpha-gene status (alpha-thalassemia-2). The overall risk of soft tissue organ failure caused by the obliterative sickle vasculopathy (including stroke, renal failure, chronic lung disease with cor pulmonale, leg ulcers, and young adult death) was increased threefold in those with a CAR haplotype and was decreased in those with a Senegalese chromosome (p = 0.003). In the presence of a Senegalese haplotype, the patient's health is better, and with the CAR haplotype it is always worse. With the Benin, it is intermediate. Acute recurrent clinical events including hospitalized sickle cell crisis, bone infarction, and infection are decreased in frequency in those with a Senegalese haplotype. The risk of most acute events including acute chest syndrome is equivalent in those with Benin or CAR haplotypes. In the United States, alpha-thalassemia-2 is co-inherited randomly among the beta S-gene-cluster haplotypes. Acute events occurring during childhood are minimally effected by this co-inheritance. The risk of soft tissue organ failure is decreased. After the age of 20 years, painful episodes of the lumbar dorsal area are increased in patients who had alpha-thalassemia-2 in association with degenerative bone disease.(ABSTRACT TRUNCATED AT 250 WORDS)

  6. Calcium channel beta 4 (CACNB4): human ortholog of the mouse epilepsy gene lethargic.

    PubMed

    Escayg, A; Jones, J M; Kearney, J A; Hitchcock, P F; Meisler, M H

    1998-05-15

    The mouse neurological mutant lethargic (lh) is characterized by ataxia, focal myoclonus, and absence epilepsy due to a loss-of-function mutation in the beta4 subunit of the voltage-gated calcium channel. To evaluate the role of this channel subunit in human neurological disease, we determined the chromosomal location and intron/exon structure of the human CACNB4 gene. The 1560-bp open reading frame of the CACNB4 cDNA predicts a 58-kDa protein with an amino acid sequence that is 99% identical to the rat protein. The 13 coding exons of CACNB4 span >55 kb of genomic DNA. Human cerebellar RNA contains one major CACNB4 transcript that is 9 kb in length. Expression of CACNB4 was detected in cerebellum, kidney, testis, retina, lymphoblasts, and circulating lymphocytes. Retinal transcripts were localized by in situ hybridization to ganglion cells and the inner nuclear layer. Analysis of the GeneBridge 4 radiation hybrid mapping panel localized CACNB4 to position 791 cR on human chromosome 2, in a conserved linkage group on human 2q22-q31 and mouse chromosome 2. We localized CACNB4 to the 1.3-Mb YAC clone 952F10 in Whitehead contig WC861, along with the polymorphic markers D2S2236 and D2S2299. The chromosomal linkage of three of the four beta subunit genes to homeobox gene clusters associates the evolutionary origin of the beta gene family with the events that generated the four HOX clusters early in vertebrate evolution.

  7. Rejection of cardiac allografts by T cells expressing a restricted repertoire of T-cell receptor V beta genes.

    PubMed Central

    Shirwan, H; Barwari, L; Cramer, D V

    1997-01-01

    We have recently shown that T cells infiltrating cardiac allografts early in graft rejection use a limited T-cell receptor (TCR) V beta repertoire. In this study we tested whether this limited repertoire of V beta genes is important for graft rejection. A cell line, AL2-L3, was established from LEW lymphocytes infiltrating ACI heart allografts 2 days after transplantation. This cell line is composed of CD4+ T cells that primarily recognize the class II RTI.B major histocompatibility complex (MHC) molecule expressed by the donor graft. This cell line precipitated acute rejection of donor hearts with a median survival time (MST) of 10.5 days following adoptive transfer to sublethally irradiated LEW recipients. This rate of graft rejection was significantly (P < 0.0007) accelerated when compared with a MST of 60 days for allografts in irradiated control recipients. The AL2-L3-mediated acceleration of graft rejection was donor specific as WF third-party heart allografts were rejected with a delayed tempo (MST = 28.5 days). The V beta repertoire of this cell line was primarily restricted to the expression of V beta 4, 15 and 19 genes. The nucleotide sequence analysis of the beta-chain cDNAs from this cell line demonstrated that the restricted use of the V gene repertoire was not shared with the N, D and J regions. A wide variety of CDR3 loops and J beta genes were used in association with selected V beta genes. These data provide evidence for the role a restricted repertoire of V beta genes plays in cardiac allograft rejection in this model. The restricted usage of the V beta repertoire in an early T-cell response to allografts may provide the opportunity to therapeutically disrupt the rejection reaction by targeting selected T-cell populations for elimination at the time of organ transplantation. Images Figure 2 PMID:9176111

  8. Activity of proximal promoter of the human beta(1)-integrin gene was increased in Sézary syndrome.

    PubMed

    Paulin, Y; Boukhelifa, M; Derappe, C; Giner, M; Font, J; Aubery, M

    2001-06-01

    Changes in beta1-integrin expression have been involved in abnormal cellular interactions between malignant lymphocytes from Sézary (Sz) patients and keratinocytes. In this paper, we compare the activity of both distal and proximal promoters of the beta1-integrin gene in malignant lymphocytes from Sz patients with human normal lymphocytes. Activity of both beta1-integrin promoters was also analysed in human normal keratinocytes. Northern blot analysis shows that beta1-integrin mRNA expression is higher in malignant Sz lymphocytes than in normal lymphocytes. CAT assays show that the activity of proximal beta1-integrin promoter is markedly increased (up to 6-fold) in malignant lymphocytes from Sz patients, in comparison to normal lymphocytes. These results suggest that changes in activity of the proximal promoter of beta1-integrin subunit could be, in part, responsible for the abnormal cellular interactions between malignant lymphocytes and keratinocytes observed in Sz syndrome.

  9. Reference gene for primary culture of prostate cancer cells.

    PubMed

    Souza, Aline Francielle Damo; Brum, Ilma Simoni; Neto, Brasil Silva; Berger, Milton; Branchini, Gisele

    2013-04-01

    Selection of reference genes to normalize mRNA levels between samples is critical for gene expression studies because their expression can vary depending on the tissues or cells used and the experimental conditions. We performed ten cell cultures from samples of prostate cancer. Cells were divided into three groups: control (with no transfection protocol), cells transfected with siRNA specific to knockdown the androgen receptor and cells transfected with inespecific siRNAs. After 24 h, mRNA was extracted and gene expression was analyzed by Real-time qPCR. Nine candidates to reference genes for gene expression studies in this model were analyzed (aminolevulinate, delta-, synthase 1 (ALAS1); beta-actin (ACTB); beta-2-microglobulin (B2M); glyceraldehyde-3-phosphate dehydrogenase (GAPDH); hypoxanthine phosphoribosyltransferase 1 (HPRT1); succinate dehydrogenase complex, subunit A, flavoprotein (Fp) (SDHA); TATA box binding protein (TBP); ubiquitin C (UBC); tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide (YWHAZ)). Expression stability was calculated NormFinder algorithm to find the most stable genes. NormFinder calculated SDHA as the most stable gene and the gene with the lowest intergroup and intragroup variation, and indicated GAPDH and SDHA as the best combination of two genes for the purpose of normalization. Androgen receptor mRNA expression was evaluated after normalization by each candidate gene and showed statistical difference in the transfected group compared to control group only when normalized by combination of GAPDH and SDHA. Based on the algorithm analysis, the combination of SDHA and GAPDH should be used to normalize target genes mRNA levels in primary culture of prostate cancer cells submitted to transfection with siRNAs.

  10. High divergence in primate-specific duplicated regions: Human and chimpanzee Chorionic Gonadotropin Beta genes

    PubMed Central

    2008-01-01

    Background Low nucleotide divergence between human and chimpanzee does not sufficiently explain the species-specific morphological, physiological and behavioral traits. As gene duplication is a major prerequisite for the emergence of new genes and novel biological processes, comparative studies of human and chimpanzee duplicated genes may assist in understanding the mechanisms behind primate evolution. We addressed the divergence between human and chimpanzee duplicated genomic regions by using Luteinizing Hormone Beta (LHB)/Chorionic Gonadotropin Beta (CGB) gene cluster as a model. The placental CGB genes that are essential for implantation have evolved from an ancestral pituitary LHB gene by duplications in the primate lineage. Results We shotgun sequenced and compared the human (45,165 bp) and chimpanzee (39,876 bp) LHB/CGB regions and hereby present evidence for structural variation resulting in discordant number of CGB genes (6 in human, 5 in chimpanzee). The scenario of species-specific parallel duplications was supported (i) as the most parsimonious solution requiring the least rearrangement events to explain the interspecies structural differences; (ii) by the phylogenetic trees constructed with fragments of intergenic regions; (iii) by the sequence similarity calculations. Across the orthologous regions of LHB/CGB cluster, substitutions and indels contributed approximately equally to the interspecies divergence and the distribution of nucleotide identity was correlated with the regional repeat content. Intraspecies gene conversion may have shaped the LHB/CGB gene cluster. The substitution divergence (1.8–2.59%) exceeded two-three fold the estimates for single-copy loci and the fraction of transversional mutations was increased compared to the unique sequences (43% versus ~30%). Despite the high sequence identity among LHB/CGB genes, there are signs of functional differentiation among the gene copies. Estimates for dn/ds rate ratio suggested a purifying

  11. INS-gene mutations: From genetics and beta cell biology to clinical disease

    PubMed Central

    Liu, Ming; Sun, Jinhong; Cui, Jinqiu; Chen, Wei; Guo, Huan; Barbetti, Fabrizio; Arvan, Peter

    2015-01-01

    A growing list of insulin gene mutations causing a new form of monogenic diabetes has drawn increasing attention over the past seven years. The mutations have been identified in the untranslated regions of the insulin gene as well as the coding sequence of preproinsulin including within the signal peptide, insulin B-chain, C-peptide, insulin A-chain, and the proteolytic cleavage sites both for signal peptidase and the prohormone convertases. These mutations affect a variety of different steps of insulin biosynthesis in pancreatic beta cells. Importantly, although many of these mutations cause proinsulin misfolding with early onset autosomal dominant diabetes, some of the mutant alleles appear to engage different cellular and molecular mechanisms that underlie beta cell failure and diabetes. In this article, we review the most recent advances in the field and discuss challenges as well as potential strategies to prevent/delay the development and progression of autosomal dominant diabetes caused by INS-gene mutations. It is worth noting that although diabetes caused by INS gene mutations is rare, increasing evidence suggests that defects in the pathway of insulin biosynthesis may also be involved in the progression of more common types of diabetes. Collectively, the (pre)proinsulin mutants provide insightful molecular models to better understand the pathogenesis of all forms of diabetes in which preproinsulin processing defects, proinsulin misfolding, and ER stress are involved. PMID:25542748

  12. Nuclear orphan receptor TLX affects gene expression, proliferation and cell apoptosis in beta cells.

    PubMed

    Shi, Xiaoli; Xiong, Xiaokan; Dai, Zhe; Deng, Haohua; Sun, Li; Hu, Xuemei; Zhou, Feng; Xu, Yancheng

    Nuclear orphan receptor TLX is an essential regulator of the growth of neural stem cells. However, its exact function in pancreatic islet cells is still unknown. In the present study, gene expression profiling analysis revealed that overexpression of TLX in beta cell line MIN6 causes suppression of 176 genes and upregulation of 49 genes, including a cadre of cell cycle, cell proliferation and cell death control genes, such as Btg2, Ddit3 and Gadd45a. We next examined the effects of TLX overexpression on proliferation, apoptosis and insulin secretion in MIN6 cells. Proliferation analysis using EdU assay showed that overexpression of TLX increased percentage of EdU-positive cells. Cell cycle and apoptosis analysis revealed that overexpression of TLX in MIN6 cells resulted in higher percentage of cells exiting G1 into S-phase, and a 58.8% decrease of cell apoptosis induced by 0.5 mM palmitate. Moreover, TLX overexpression did not cause impairment of insulin secretion. Together, we conclude that TLX is among factors capable of controlling beta cell proliferation and survival, which may serve as a target for the development of novel therapies for diabetes.

  13. A Putatively Functional Haplotype in the Gene Encoding Transforming Growth Factor Beta-1 as a Potential Biomarker for Radiosensitivity

    SciTech Connect

    Schirmer, Markus A.; Brockmoeller, Juergen; Rave-Fraenk, Margret; Virsik, Patricia; Wilken, Barbara; Kuehnle, Elna; Campean, Radu; Hoffmann, Arne O.; Mueller, Katarina; Goetze, Robert G.; Neumann, Michael; Janke, Joerg H.; Nasser, Fatima; Wolff, Hendrik A.; Ghadimi, B. Michael; Schmidberger, Heinz; Hess, Clemens F.; Christiansen, Hans; Hille, Andrea

    2011-03-01

    Purpose: To determine whether genetic variability in TGFB1 is related to circulating transforming growth factor-{beta}1 (TGF-{beta}1) plasma concentrations after radiotherapy and to radiosensitivity of lymphoid cells. Patients and Methods: Transforming growth factor-{beta}1 plasma concentrations (n = 79) were measured in patients 1 year after radiotherapy and chromosomal aberrations (n = 71) ex vivo before therapy start. Furthermore, TGF-{beta}1 secretion and apoptosis were measured in isolated peripheral blood mononuclear cells of 55 healthy volunteers. These phenotypes were analyzed in relation to five germline polymorphisms in the 5' region of the TGFB1 gene. Because of high linkage disequilibrium, these five polymorphisms reflect frequent genetic variation in this region. A presumed impact of TGF-{beta}1 on DNA damage or repair was measured as micronucleus formation in 30 lymphoblastoid cell lines. Results: We identified a hypofunctional genetic haplotype termed H3 tagging the 5' region of the TGFB1 gene encoding TGF-{beta}1. H3 was associated with lower TGF-{beta}1 plasma concentrations in patients (p = 0.01) and reduced TGF-{beta}1 secretion in irradiated peripheral blood mononuclear cells (p = 0.003). Furthermore, cells with H3 were less prone to induction of chromosomal aberrations (p = 0.001) and apoptosis (p = 0.003) by irradiation. The hypothesis that high TGF-{beta}1 could sensitize cells to DNA damage was further supported by increased micronuclei formation in 30 lymphoblastoid cell lines when preincubated with TGF-{beta}1 before irradiation (p = 0.04). Conclusions: On the basis of TGF-{beta}1 plasma levels and radiation sensitivity of lymphoid cells, this study revealed a putatively hypofunctional TGFB1 haplotype. The significance of this haplotype and the suggested link between TGF-{beta}1 function and DNA integrity should be further explored in other cell types, as well as other experimental and clinical conditions.

  14. T cell receptor V beta gene usage in a human alloreactive response. Shared structural features among HLA-B27-specific T cell clones

    PubMed Central

    1990-01-01

    A strategy, based on using V beta family-specific oligonucleotides, was developed for specific amplification and direct sequencing of human TCR V beta genes. With this strategy, it was possible to undertake a structural analysis of TCRs from human T cell clones in specific responses. 12 HLA-B27-specific cytotoxic clones were examined. The results reveal a nonrandom use of V beta gene diversity in this alloreactive response in that: (a) the clones express a restricted number of V beta segments, including a subset of V beta families that are significantly more related to one another than to most other V beta families; (b) five of seven clones having a particular reaction pattern with HLA-B27 subtypes possess Alanine at the D-J junction; and (c) identical J beta segments are found associated in several instances with identical or highly homologous V beta gene segments. In addition, two new V beta 13 members are reported. PMID:1691261

  15. An extracytoplasmic function sigma factor controls beta-lactamase gene expression in Bacillus anthracis and other Bacillus cereus group species.

    PubMed

    Ross, Cana L; Thomason, Kerrie S; Koehler, Theresa M

    2009-11-01

    The susceptibility of most Bacillus anthracis strains to beta-lactam antibiotics is intriguing considering that the closely related species Bacillus cereus and Bacillus thuringiensis typically produce beta-lactamases and the B. anthracis genome harbors two beta-lactamase genes, bla1 and bla2. We show that beta-lactamase activity associated with B. anthracis is affected by two genes, sigP (BA2502) and rsiP (BA2503), predicted to encode an extracytoplasmic function sigma factor and an anti-sigma factor, respectively. Deletion of the sigP-rsiP locus abolished beta-lactamase activity in a naturally occurring penicillin-resistant strain and had no effect on beta-lactamase activity in a prototypical penicillin-susceptible strain. Complementation with sigP and rsiP from the penicillin-resistant strain, but not with sigP and rsiP from the penicillin-susceptible strain, conferred constitutive beta-lactamase activity in both mutants. These results are attributed to a nucleotide deletion near the 5' end of rsiP in the penicillin-resistant strain that is predicted to result in a nonfunctional protein. B. cereus and B. thuringiensis sigP and rsiP homologues are required for inducible penicillin resistance in these species. Expression of the B. cereus or B. thuringiensis sigP and rsiP genes in a B. anthracis sigP-rsiP-null mutant confers inducible production of beta-lactamase activity, suggesting that while B. anthracis contains the genes necessary for sensing beta-lactam antibiotics, the B. anthracis sigP and rsiP gene products are not sufficient for bla induction. PMID:19717606

  16. A pseudodeficiency allele (D152N) of the human {beta}-glucuronidase gene

    SciTech Connect

    Vervoort, R.; Liebaers, I.; Lissens, W.

    1995-10-01

    We present evidence that a 480G{r_arrow}A transition in the coding region of the {Beta}glucuronidase gene, which results in an aspartic-acid-to-asparagine substitution at amino acid position 152 (D152N), produces a pseudodeficiency allele (GUSBp) that leads to greatly reduced levels of {Beta}-glucuronidase activity without apparent deleterious consequences. The 48OG{r_arrow}A mutation was found initially in the pseudodeficient mother of a child with mucopolysaccharidosis VII (MPSVII), but it was not on her disease-causing allele, which carried the L176F mutation. The 480G{r_arrow}A change was also present in an unrelated individual with another MPSVII allele who had unusually low {Beta}-glucuronidase activity, but whose clinical symptoms were probably unrelated to {Beta}-glucuronidase deficiency. This individual also had an R357X mutation, probably on his second allele. We screened 100 unrelated normal individuals for the 480G{r_arrow}A mutation with a PCR method and detected one carrier. Reduced {Beta}-glucuronidase activity following transfection of COS cells with the D152N cDNA supported the causal relationship between the D152N allele and pseudodeficiency. The mutation reduced the fraction of expressed enzyme that was secreted. Pulse-chase experiments indicated that the reduced activity in COS cells was due to accelerated intracellular turnover of the D152N enzyme. They also suggested that a potential glycosylation site created by the mutation is utilized in {approximately}50% of the enzyme expressed. 25 refs., 3 figs., 3 tabs.

  17. Insect and wound induced GUS gene expression from a Beta vulgaris proteinase inhibitor gene promoter

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Inducible gene promoters that are specifically activated by pathogen invasion or insect pest attack are needed for effective expression of resistance genes to control plant diseases. In the present study, a promoter from a serine proteinase inhibitor gene (BvSTI) shown to be up-regulated in resist...

  18. Haplotyping the human T-cell receptor. beta. -chain gene complex by use of restriction fragment length polymorphisms

    SciTech Connect

    Charmley, P.; Chao, A.; Gatti, R.A. ); Concannon, P. ); Hood, L. )

    1990-06-01

    The authors have studied the genetic segregation of human T-cell receptor {beta}-chain (TCR{beta}) genes on chromosome 7q in 40 CEPH (Centre d'Etude du Polymorphisme Humain) families by using restriction fragment length polymorphisms (RFLPs). They constructed haplotypes from eight RFLPs by using variable- and constant-region cDNA probes, which detect polymorphisms that span more than 600 kilobases of the TCR{beta} gene complex. Analysis of allele distributions between TCR{beta} genes revealed significant linkage disequilibrium between only 6 of the 28 different pairs of RFLPs. This linkage disequilibrium strongly influences the most efficient order to proceed for typing of these RFLPs in order to achieve maximum genetic informativeness, which in this study revealed a 97.3% level of heterozygosity within the TCR{beta} gene complex. The results should provide new insight into recent reports of disease associations with the TCR{beta} gene complex and should assist in designing future experiments to detect or confirm the existence of disease-susceptibility loci in this region of the human genome.

  19. Effect of polymorphic variants of GH, Pit-1, and beta-LG genes on milk production of Holstein cows.

    PubMed

    Heidari, M; Azari, M A; Hasani, S; Khanahmadi, A; Zerehdaran, S

    2012-04-01

    Effect of polymorphic variants of growth hormone (GH), beta-lactoglobulin (beta-LG), and Pit-1 genes on milk yield was analyzed in a Holstein herd. Genotypes of the cows for these genes were determined by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. Allele frequencies were 0.884 and 0.116 for L and V variants of GH, 0.170 and 0.830 for A and B variants of Pit-1, and 0.529 and 0.471 for A and B variants of beta-LG, respectively. GLM procedure of SAS software was used to test the effects of these genes on milk yield. Results indicated significant effects of these genes on milk yield (P < 0.05). Cows with LL genotype of GH produced more milk than cows with LVgenotype (P < 0.05). Also, for Pit-1 gene, animals with AB genotype produced more milk than BB genotype (P < 0.05). In the case of beta-LG gene, milk yield of animals with AA genotype was more than BB genotype (P < 0.01). Therefore, it might be concluded that homozygote genotypes of GH (LL) and beta-LG (AA) were superior compared to heterozygote genotypes, whereas, the heterozygote genotype of Pit-1 gene (AB) was desirable.

  20. A second gene for cerulean cataracts maps to the {beta} crystallin region on chromosome 22

    SciTech Connect

    Kramer, P.; Yount, J.; Lovrien, E.

    1996-08-01

    Cogenital cataracts are one of the most common major eye abnormalities and often lead to blindness in infants. At least a third of all cases are familial. Within this group, highly penetrant, autosomal dominant forms of congenital cataracts (ADCC) are most common. ADCC is a genetically heterogeneous group of disorders, in which at least eight different loci have been identified for nine clinically distinct forms. Among these, Armitage et al. mapped a gene for cerulean blue cataracts to chromosome 17q24. Bodker et al. described a large family with cerulean blue cataracts, in which the affected daughter of affected first cousins was presumed to be homozygous for the purported gene. We report linkage in this family to the region on chromosome 22q that includes two {beta} crystallin genes (CRYBB2, CRYBB3) and one pseudogene (CRYBB2P1). The affected female in question is homozygous at all markers. 25 refs., 1 fig., 1 tab.

  1. Gene expression responses of European flounder (Platichthys flesus) to 17-beta estradiol.

    PubMed

    Williams, Tim D; Diab, Amer M; George, Stephen G; Sabine, Victoria; Chipman, James K

    2007-02-01

    Male European flounder (Platichthys flesus) were intraperitoneally injected with 10mg/kg 17-beta estradiol and tissues taken from individuals over a timecourse of 16 days. The GENIPOL P. flesus cDNA microarray was employed to detect hepatic gene expression differences between fish treated with estradiol and saline controls. Known biomarkers of estrogen exposure, choriogenin L and vitellogenins, showed sustained induction over the time-course. Among 175 identified clones showing sustained statistically significant induction or repression, those associated with the Gene Ontology terms mitochondria, amino acid synthesis, ubiquitination and apoptosis were included amongst those induced while those associated with immune function, electron transport, cell signalling and protein phosphorylation were repressed. Thus, we show the gene expression response of an environmentally relevant fish species to a high dose of an estrogenic endocrine disruptor and also report the sequencing of a further 2121 flounder ESTs.

  2. Generation of a high-titer retroviral vector capable of expressing high levels of the human beta-globin gene.

    PubMed Central

    Sadelain, M; Wang, C H; Antoniou, M; Grosveld, F; Mulligan, R C

    1995-01-01

    Retrovirus-mediated gene transfer into hematopoietic cells may provide a means of treating both inherited and acquired diseases involving hematopoietic cells. Implementation of this approach for disorders resulting from mutations affecting the beta-globin gene (e.g., beta-thalassemia and sickle cell anemia), however, has been hampered by the inability to generate recombinant viruses able to efficiently and faithfully transmit the necessary sequences for appropriate gene expression. We have addressed this problem by carefully examining the interactions between retroviral and beta-globin gene sequences which affect vector transmission, stability, and expression. First, we examined the transmission properties of a large number of different recombinant proviral genomes which vary both in the precise nature of vector, beta-globin structural gene, and locus control region (LCR) core sequences incorporated and in the placement and orientation of those sequences. Through this analysis, we identified one specific vector, termed M beta 6L, which carries both the human beta-globin gene and core elements HS2, HS3, and HS4 from the LCR and faithfully transmits recombinant proviral sequences to cells with titers greater than 10(6) per ml. Populations of murine erythroleukemia (MEL) cells transduced by this virus expressed levels of human beta-globin transcript which, on a per gene copy basis, were 78% of the levels detected in an MEL-derived cell line, Hu11, which carries human chromosome 11, the site of the beta-globin locus. Analysis of individual transduced MEL cell clones, however, indicated that, while expression was detected in every clone tested (n = 17), the levels of human beta-globin treatment varied between 4% and 146% of the levels in Hu11. This clonal variation in expression levels suggests that small beta-globin LCR sequences may not provide for as strict chromosomal position-independent expression of beta-globin as previously suspected, at least in the context of

  3. Cloning and sequence of the gene encoding a cefotaxime-hydrolyzing class A beta-lactamase isolated from Escherichia coli.

    PubMed Central

    Ishii, Y; Ohno, A; Taguchi, H; Imajo, S; Ishiguro, M; Matsuzawa, H

    1995-01-01

    Escherichia coli TUH12191, which is resistant to piperacillin, cefazolin, cefotiam, ceftizoxime, cefuzonam, and aztreonam but is susceptible to cefoxitin, latamoxef, flomoxef, and imipenem, was isolated from the urine of a patient treated with beta-lactam antibiotics. The beta-lactamase (Toho-1) purified from the bacteria had a pI of 7.8, had a molecular weight of about 29,000, and hydrolyzed beta-lactam antibiotics such as penicillin G, ampicillin, oxacillin, carbenicillin, piperacillin, cephalothin, cefoxitin, cefotaxime, ceftazidime, and aztreonam. Toho-1 was markedly inhibited by beta-lactamase inhibitors such as clavulanic acid and tazobactam. Resistance to beta-lactams, streptomycin, spectinomycin, sulfamethoxazole, and trimethoprim was transferred by conjugational transfer from E. coli TUH12191 to E. coli ML4903, and the transferred plasmid was about 58 kbp, belonging to incompatibility group M. The cefotaxime resistance gene for Toho-1 was subcloned from the 58-kbp plasmid by transformation of E. coli MV1184. The sequence of the gene for Toho-1 was determined, and the open reading frame of the gene consisted of 873 or 876 bases (initial sequence, ATGATG). The nucleotide sequence of the gene (DDBJ accession number D37830) was found to be about 73% homologous to the sequence of the gene encoding a class A beta-lactamase produced by Klebsiella oxytoca E23004. According to the amino acid sequence deduced from the DNA sequence, the precursor consisted of 290 or 291 amino acid residues, which contained amino acid motifs common to class A beta-lactamases (70SXXK, 130SDN, and 234KTG). Toho-1 was about 83% homologous to the beta-lactamase mediated by the chromosome of K. oxytoca D488 and the beta-lactamase mediated by the plasmid of E. coli MEN-1. Therefore, the newly isolated beta-lactamase Toho-1 produced by E. coli TUH12191 is similar to beta-lactamases produced by K. oxytoca D488, K. oxytoca E23004, and E. coli MEN-1 rather than to mutants of TEM or SHV enzymes

  4. Alternative splicing of the beta A4 amyloid gene of Alzheimer's disease in cortex of control and Alzheimer's disease patients.

    PubMed

    König, G; Salbaum, J M; Wiestler, O; Lang, W; Schmitt, H P; Masters, C L; Beyreuther, K

    1991-02-01

    An S1 nuclease protection assay was designed to study the splicing pattern of the alternatively spliced beta A4 amyloid gene (APP gene) of Alzheimer's disease (AD). We determined the splicing pattern of the APP gene in fetal, adult, aged adult and AD human cortex. The results suggest that alternative splicing of the APP gene in AD is not significantly different from age-matched controls, but distinct from the developing fetal brain.

  5. Effect of casein genes - beta-LGB, DGAT1, GH, and LHR - on milk production and milk composition traits in crossbred Holsteins.

    PubMed

    Molee, A; Poompramun, C; Mernkrathoke, P

    2015-03-30

    The objectives of this study were to determine the effects of a single gene and composite genotype of the casein gene family, including the beta-lactoglobulin gene (beta-LGB), acyl-CoA: diacylglycerol acyltransferase 1 gene (DGAT1), growth hormone gene (GH), and luteinizing hormone receptor gene (LHR) on milk yield, milk composition, the percentage of fat, protein, solids-not-fat, and total solid in crossbred Holsteins. A total of 231 crossbred Holstein cows were examined for the study. The genotype of the beta-casein gene was analyzed by allele-specific polymerase chain reaction, while the alpha-S1, alpha-S2, kappa-casein, DGAT1, beta-LGB, and GH genes were analyzed using a polymerase chain reaction-restriction fragment length polymorphism assay. The association between genes and milk yield and milk composition was analyzed. Three pairs of genes, for which significant associations were detected, were beta + kappa-casein, DGAT1 + beta-casein, and GH + beta-LGB. In the single-gene model, most loci are significantly associated with traits. A significant association between the composite genotype and the traits was detected in all composite genotypes. GH + beta-LGB appears to be the most suitable variants for improving milk production and percentage of milk protein. Overall, the effects of the composite genotype and single gene were different. A physical or functional relationship between genes is necessary for investigating gene markers.

  6. Identification and characteristic analysis of the ampC gene encoding beta-lactamase from Vibrio fischeri.

    PubMed

    Weng, Shu-Fen; Chao, Yuh-Fen; Lin, Juey-Wen

    2004-02-13

    Vibrio fischeri ATCC 7744 is an ampicillin resistant (Amp(r)) marine luminous bacterium. The MIC test indicates that V. fischeri is highly resistant to penicillins, and susceptible to cephalosporins. V. fischeri ampC gene was cloned and identified. Nucleotide sequence of an unidentified ufo gene and the ampC, ppiB genes (GenBank Accession No. AY438037) has been determined; whereas the ampC gene encodes the beta-lactamase (AmpC) and the ppiB gene encodes the peptidyl-prolyl cis-trans isomerase B. Alignment and comparison show that V. fischeri beta-lactamase is homologous to the related species'. The specific amino acid residues STFK (62nd to 65th), SDN (122nd to 124th), and D (155th) located 34 residues downstream from the SDN loop of the class A beta-lactamases are highly conserved, but the KTG is not found. V. fischeri ampC gene encoding beta-lactamase has a calculated M(r) 31,181 and comprises 283 amino acid residues (pI 5.35). There is a signal peptide of 18 amino acid residues MKIKPFLFGLIVLANNAI in the pro-beta-lactamase, which functioned for secretion; thus, the matured protein only has M(r) 29,197 and comprises 265 amino acid residues (pI 4.95). SDS-PAGE and the beta-lactamase functional assays elicit that the M(r) of the beta-lactamases are close to 29kDa. IEF and the beta-lactamase functional assays show that the beta-lactamases' pI are close to 4.8 as predicted. The results elucidate that V. fischeri ampC gene and the cloned ampC gene in Escherichia coli are the same one. The gene order of the ampC and the related genes is -ufo-(P*-intern)-ampC-ppiB--> (P*-intern: intern promoter for sub-regulation), whereas the P*-intern promoter displays the function to lead the ampC gene's expression for stress response. PMID:14741712

  7. Sickle cell anemia: beta s-gene-cluster haplotypes as prognostic indicators of vital organ failure.

    PubMed

    Powars, D R

    1991-07-01

    Identification of the beta s-gene-cluster haplotype and alpha-gene status provide a useful tool to improve the possibility for early detection in high-risk SS patients. The DNA polymorphisms of the beta s-gene-cluster modify the clinical course in sickle cell anemia especially as it involves the risk of end-stage organ failure of the kidney, lung, and brain. In both Africa and America, the CAR beta s haplotype increases the risk of developing irreversible complications at an early age. The degree of anemia, the Hb F concentration, and the preservation (or lack thereof) of G gamma Hb F is haplotype dependent and correlates with the overall clinical course of the patient. Further modulation of the clinical course by the coinheritance of alpha-thalassemia-2 tends to decrease the risk of soft tissue organ failure but increases the risk of osteonecrosis. A single individual can be expected to fit into the overall pattern. Some sickle related illness will eventually occur in all patients. In the presence of a Senegal haplotype, the patient's health is better, with the CAR haplotype it is always worse; severity is intermediate in the Benin. These genetic markers can be used to identify the endangered patient before the onset of irreversible major organ failure. The high risk SS patient with a CAR chromosome or one who is homozygous Ben without alpha-thalassemia-2 should be monitored closely for evidence of vasculopathy-induced microinfarction of the brain, kidneys, or lungs. Such a patient needs preventive therapy before suffering a major hemisphere stroke, losing kidney function, or developing cor pulmonale secondary to restrictive lung disease.(ABSTRACT TRUNCATED AT 250 WORDS)

  8. Double gene deletion reveals the lack of cooperation between PPAR{alpha} and PPAR{beta} in skeletal muscle

    SciTech Connect

    Bedu, E.; Desplanches, D.; Pequignot, J.; Bordier, B.; Desvergne, B. . E-mail: beatrice.desvergne@unil.ch

    2007-06-15

    The peroxisome proliferator-activated receptors (PPARs) are involved in the regulation of most of the pathways linked to lipid metabolism. PPAR{alpha} and PPAR{beta} isotypes are known to regulate muscle fatty acid oxidation and a reciprocal compensation of their function has been proposed. Herein, we investigated muscle contractile and metabolic phenotypes in PPAR{alpha}-/-, PPAR{beta}-/-, and double PPAR{alpha}-/- {beta}-/- mice. Heart and soleus muscle analyses show that the deletion of PPAR{alpha} induces a decrease of the HAD activity ({beta}-oxidation) while soleus contractile phenotype remains unchanged. A PPAR{beta} deletion alone has no effect. However, these mild phenotypes are not due to a reciprocal compensation of PPAR{beta} and PPAR{alpha} functions since double gene deletion PPAR{alpha}-PPAR{beta} mostly reproduces the null PPAR{alpha}-mediated reduced {beta}-oxidation, in addition to a shift from fast to slow fibers. In conclusion, PPAR{beta} is not required for maintaining skeletal muscle metabolic activity and does not compensate the lack of PPAR{alpha} in PPAR{alpha} null mice.

  9. Developmental regulation of {beta}-hexosaminidase {alpha}- and {beta}-subunit gene expression in the rat reproductive system

    SciTech Connect

    Trasler, J.M.; Wakamatsu, N.; Gravel, R.A.; Benoit, G.

    1994-09-01

    {beta}-Hexosaminidase is an essential lysosomal enzyme whose absence in man results in a group of disorders, the G{sub M2} gangliosidoses. Enzyme activity for {beta}-hexosaminidase is many fold higher in the epididymis than in other tissues, is present in sperm and is postulated to be required for mammalian fertilization. To better understand how {beta}-hexosaminidase is regulated in the reproductive system, we quantitated the mRNA expression of the {alpha}- and {beta}-subunits (Hex {alpha} and Hex {beta}) of the enzyme in the developing rat testis and epididymis. Hex {alpha} mRNA was differentially expressed and abundant in adult rat testis and epididymis, 13- and 2-fold brain levels, respectively. In contrast, Hex {beta} mRNA levels in the testis and epididymis were .3- and 5-fold brain levels. Within the epididymis both Hex {alpha} and Hex {beta} mRNA concentrations were highest in the corpus, 1.5-fold and 9-fold initial segment values, respectively. During testis development from 7-91 days of age, testis levels of Hex {alpha} mRNA increased 10-fold and coincided with the appearance of spermatocytes and spermatids in the epithelium. In isolated male germ cells, Hex {alpha} expression was most abundant in haploid round spermatids. Hex {alpha} mRNA was undetectable after hypophysectomy and returned to normal after testosterone administration and the return of advanced germ cells to the testis. Hex {beta} mRNA was expressed at constant low levels throughout testis development. In the caput-corpus and cauda regions of the epididymis Hex {alpha} mRNA levels increased 2-fold between 14 and 91 days; during the same developmental period epididymal Hex {beta} mRNA levels increased dramatically, by 10-20 fold. In summary, Hex {alpha} and Hex {beta} mRNAs are differentially and developmentally expressed at high levels in the rat testis and epididymis and augur for an important role for {beta}-hexosaminidase in normal male reproductive function.

  10. Characterization of horse (Equus caballus) T-cell receptor beta chain genes

    SciTech Connect

    Schrenzel, M.D.; Watson, J.L.; Ferrick, D.A.

    1994-12-31

    Genes encoding the horse (Equus caballus) T-cell receptor beta chain (TCRB) were cloned and characterized. Of 33 cDNA clones isolated from the mesenteric lymph node, 30 had functionally rearranged gene segments, and three contained germline sequences. Sixteen unique variable segments (TCRBV), 14 joining genes (TCRBJ), and two constant region genes (TCRBC) were identified. Horse TCRBV were grouped into nine families based on similarity to human sequences. TCRBV2 and TCRBV12 were the most commonly represented horse families. Analysis of predicted protein structure revealed the presence of conserved regions similar to those seen in TCRB of other species. A decanucleotide promoter sequence homologous to those found in humans and mice was located in the 5{prime} untranslated region of one horse gene. Germline sequences included the 5{prime} region of the TCRBD2 gene with flanking heptamer/nonamer recombination signals and portions of the TCRBJ2-C2 intro. Southern blot hybridizations demonstrated restriction fragment length polymorphisms at the TCRBC locus among different horse breeds.

  11. Positive and negative selection in the beta-esterase gene cluster of the Drosophila melanogaster subgroup.

    PubMed

    Balakirev, Evgeniy S; Anisimova, Maria; Ayala, Francisco J

    2006-04-01

    We examine the pattern of molecular evolution of the beta-esterase gene cluster, including the Est-6 and psiEst-6 genes, in eight species of the Drosophila melanogaster subgroup. Using maximum likelihood estimates of nonsynonymous/synonymous rate ratios, we show that the majority of Est-6 sites evolves under strong (48% of sites) or moderate (50% of sites) negative selection and a minority of sites (1.5%) is under significant positive selection. Est-6 sites likely to be under positive selection are associated with increased intraspecific variability. One positively selected site is responsible for the EST-6 F/S allozyme polymorphism; the same site is responsible for the EST-6 functional divergence between species of the melanogaster subgroup. For psiEst-6 83.7% sites evolve under negative selection, 16% sites evolve neutrally, and 0.3% sites are under positive selection. The positively selected sites of psiEst-6 are located at the beginning and at the end of the gene, where there is reduced divergence between D. melanogaster and D. simulans; these regions of psiEst-6 could be involved in regulation or some other function. Branch-site-specific analysis shows that the evolution of the melanogaster subgroup underwent episodic positive selection. Collating the present data with previous results for the beta-esterase genes, we propose that positive and negative selection are involved in a complex relationship that may be typical of the divergence of duplicate genes as one or both duplicates evolve a new function.

  12. Interaction of CCAAT/enhancer-binding protein alpha and beta with the rat caeruloplasmin gene promoter.

    PubMed Central

    Bingle, C D; Fleming, R E; Gitlin, J D

    1993-01-01

    To determine the mechanisms of expression of the rat caeruloplasmin gene, the promoter region was analysed by DNAase I footprinting. Using nuclear extract from rat liver, a prominent site of protein-DNA interaction was detected from -93 to -48 upstream of the caeruloplasmin gene transcription start and sequence analysis of this region revealed three potential CCAAT/enhancer-binding protein (C/EBP) consensus elements. Mobility-shift analysis using an oligonucleotide encoding this region identified specific binding of proteins from rat liver nuclear extract, and some of these complexes were supershifted using antisera to the C/EBP alpha and beta family members. Mobility-shift studies using a polypeptide encoding the DNA-binding domain of C/EBP alpha also revealed a specific interaction with this region of the caeruloplasmin promoter, and DNAase I footprinting using this polypeptide protected the identical region from -93 to -48. Co-transfection of expression plasmids encoding C/EBP alpha or a related leucine-zipper factor D-binding protein (DBP) revealed a C/EBP-specific increase in reporter gene activity in HepG2 cells transfected with caeruloplasmin-chloramphenicol acetyltransferase containing the -93 to -48 region. A similar result was obtained when these constructs were co-transfected into mouse L cells which were shown not to express the endogenous caeruloplasmin gene. Taken together, these data indicate a role for C/EBP alpha and beta in mediating transcription from the caeruloplasmin gene promoter and suggest that this region of the promoter is not responsible for tissue-specific expression. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 PMID:8373362

  13. Human T-cell receptor v{beta} gene polymorphism and multiple sclerosis

    SciTech Connect

    Wei, S.; Charmley, P.; Birchfield, R.I.; Concannon, P.

    1995-04-01

    Population-based genetic associations have been reported between RFLPs detected with probes corresponding to the genes encoding the {beta} chain of the T-cell receptor for antigen (RCRB) and a variety of autoimmune disorders. In the case of multiple sclerosis (MS), these studies have localized a putative disease-associated gene to a region of {approximately}110 kb in length, located within the TCRB locus. In the current study, all 14 known TCRBV (variable region) genes within the region of localization were mapped and identified. The nucleotide sequences of these genes were determined in a panel of six MS patients and six healthy controls, who were human-leukocyte antigen and TCRB-RFLP haplotype matched. Nine of the 14 TCRBV genes studied showed evidence of polymorphism. PCR-based assays for each of these polymorphic genes were developed, and allele and genotype frequencies were determined in a panel of DNA samples from 48 MS patients and 60 control individuals. No significant differences in allele, genotype, or phenotype frequencies were observed between the MS patients and controls for any of the 14 TCRBV-gene polymorphisms studied. In light of the extensive linkage disequilibrium across the region studied, the saturating numbers of polymorphisms examined, and the direct sequence analysis of all BV genes in the region, these results suggest that it is unlikely that germ-line polymorphism in the TCRBV locus makes a major contribution to MS susceptibility. The TCRBV coding region-specific markers generated in these studies, as well as the approach of testing for associations with specific functionally relevant polymorphic sites within individual BV genes, should be useful in the evaluation of the many reported disease associations involving the human TCRB region. 22 refs., 1 fig., 3 tabs.

  14. Identification of appropriate reference genes for human mesenchymal stem cell analysis by quantitative real-time PCR.

    PubMed

    Li, Xiuying; Yang, Qiwei; Bai, Jinping; Xuan, Yali; Wang, Yimin

    2015-01-01

    Normalization to a reference gene is the method of choice for quantitative reverse transcription-PCR (RT-qPCR) analysis. The stability of reference genes is critical for accurate experimental results and conclusions. We have evaluated the expression stability of eight commonly used reference genes found in four different human mesenchymal stem cells (MSC). Using geNorm, NormFinder and BestKeeper algorithms, we show that beta-2-microglobulin and peptidyl-prolylisomerase A were the optimal reference genes for normalizing RT-qPCR data obtained from MSC, whereas the TATA box binding protein was not suitable due to its extensive variability in expression. Our findings emphasize the significance of validating reference genes for qPCR analyses. We offer a short list of reference genes to use for normalization and recommend some commercially-available software programs as a rapid approach to validate reference genes. We also demonstrate that the two reference genes, β-actin and glyceraldehyde-3-phosphate dehydrogenase, are frequently used are not always successful in many cases.

  15. Detection of genes mediating beta-lactamase production in isolates of enterobacteria recovered from wild pets in Saudi Arabia

    PubMed Central

    Hassan, Sabry A.; Shobrak, Mohammed Y.

    2015-01-01

    Aim: To determine the genetic basis and types of beta-lactamase encountered among enterobacterial isolates of wild pets from the animal exhibit. Materials and Methods: A total of 17 beta-lactamase-producing enterobacteria recovered from fecal samples of wild pet animals were analyzed for a selected beta-lactamase gene by polymerase chain reaction. Results: Molecular analysis identified one or more β-lactamase-encoding genes in 14 enterobacterial isolates as a single or gene combination. The most frequent extended-spectrum β-lactamases types were TEM and CTX-M, and the most common AmpC enzymes were CMY-2 and DHA types. Conclusions: The study is the first in Saudi Arabia, have established the presence of β-lactamase-encoding genes in the fecal isolates of wild pets. PMID:27047051

  16. Group G Beta-Hemolytic Streptococcal Bacteremia Characterized by 16S Ribosomal RNA Gene Sequencing

    PubMed Central

    Woo, Patrick C. Y.; Fung, Ami M. Y.; Lau, Susanna K. P.; Wong, Samson S. Y.; Yuen, Kwok-Yung

    2001-01-01

    Little is known about the relative importance of the four species of Lancefield group G beta-hemolytic streptococci in causing bacteremia and the factors that determine the outcome for patients with group G beta-hemolytic streptococcal bacteremia. From 1997 to 2000, 75 group G beta-hemolytic streptococcal strains were isolated from the blood cultures of 66 patients. Sequencing of the 16S rRNA genes of the group G beta-hemolytic streptococci showed that all 75 isolates were Streptococcus dysgalactiae subspecies equisimilis. The API system (20 STREP) and Vitek system (GPI) successfully identified 65 (98.5%) and 62 (93.9%) isolates, respectively, as S. dysgalactiae subspecies equisimilis with >95% confidence, whereas the ATB Expression system (ID32 STREP) only successfully identified 49 isolates (74.2%) as S. dysgalactiae subspecies equisimilis with >95% confidence. The median age of the patients was 76 years (range, 33 to 99 years). Fifty-six patients (85%) were over 60 years old. All patients had underlying diseases. No source of the bacteremia was identified (primary bacteremia) in 34 patients (52%), whereas 17 (26%) had cellulitis and 8 (12%) had bed sore or wound infections. Fifty-eight patients (88%) had community-acquired group G streptococcal bacteremia. Sixty-two patients (94%) had group G Streptococcus recovered in one blood culture, whereas 4 patients (6%) had it recovered in multiple blood cultures. Fifty-nine patients (89%) had group G Streptococcus as the only bacterium recovered in their blood cultures, whereas in 7 patients other bacteria were recovered concomitantly with the group G Streptococcus in the blood cultures (Staphylococcus aureus in 3, Clostridium perfringens in 2, Citrobacter freundii in 1, and Bacteroides fragilis in 1). Overall, 10 patients (15%) died. Male sex, diagnosis other than cellulitis, hospital-acquired bacteremia, and multiple positive blood cultures were associated with mortality {P < 0.005 (relative risk [RR] = 7.6), P < 0

  17. Cloning of genes related to exo-beta-glucanase production in Saccharomyces cerevisiae: characterization of an exo-beta-glucanase structural gene.

    PubMed

    Nebreda, A R; Villa, T G; Villanueva, J R; del Rey, F

    1986-01-01

    The EXG1 gene of Saccharomyces cerevisiae was cloned and identified by complementation of a mutant strain (exg1-2) with highly reduced extracellular exo-beta-1,3-glucanase (EXG) activity. Two recombinant plasmids containing an overlapping region of 5.2 kb were isolated from a genomic DNA library and characterized by restriction mapping. The coding region was located by subcloning the original DNA inserts in a 2.7-kb HindIII-XhoI fragment. Exg+ strains and Exg- mutants transformed with yeast multicopy plasmids containing this DNA fragment showed an EXG activity 5- to 20-fold higher than for the untransformed Exg+ wild-type (wt) strains. The overproduced EXG had the same enzymic activity on different substrates, and showed the same electrophoretic behaviour on polyacrylamide gels and identical properties upon filtration through Sephacryl S-200 as those of the main EXG from Exg+ wt strains. The EXG1 gene transformed Schizosaccharomyces pombe, yielding extracellular EXG activity which showed cross-reactivity with anti-S. cervisiae EXG antibodies. A fragment including only a part of the EXG1 region was subcloned into the integrating vector YIp5, and the resulting plasmid was used to transform an Exg+ strain. Genetic and Southern analysis of several stable Exg- transformants showed that the fragment integrated by homology with the EXG1 locus. The chromosomal DNA fragment into which the plasmid integrated has a restriction pattern identical to that of the fragment on which we had previously identified the putative EXG1 gene. Only one copy of the EXG1 gene per genome was found in several strains tested by Southern analysis. Furthermore, two additional recombinant plasmids sharing a yeast DNA fragment of about 4.1 kb, which partially complements the exg1-2 mutation but which shows no homology with the 2.7-kb fragment containing the EXG1 gene, were also identified in this study. This 4.1-kb DNA fragment does not appear to contain an extragenic suppressor and could be related

  18. Identification of positive and negative regulatory regions controlling expression of the Xenopus laevis betaTrCP gene.

    PubMed

    Ballarino, Monica; Fruscalzo, Alberto; Marchioni, Marcella; Carnevali, Francesca

    2004-07-21

    betaTrCP mediates the ubiquitination and subsequent degradation of several key molecules thereby playing a relevant role in different cellular processes during development and in the adult. In Xenopus embryo, betaTrCP acts as a negative regulator of Wnt signaling by interacting with beta-catenin. In this paper, we report results of the study on expression and regulation of the Xenopus betaTrCP gene. We found that xbetaTrCP is expressed in Xenopus oocytes as three transcripts, which very likely correspond to the previously identified localized mRNAs, and four isoforms. The xbetaTrCP promoter functional and structural analysis showed the presence of elements target of positive transcriptional control. Among them, we have identified a beta-catenin/Tcf signaling responsive region and a 45-bp element containing a sequence motif conforming to the SRF binding site, closer to the transcription initiation sites. There are also elements of transcriptional negative control.

  19. Selective decreases in T cell receptor V beta expression. Decreased expression of specific V beta families is associated with expression of multiple MHC and non-MHC gene products

    PubMed Central

    1989-01-01

    Previous reports of TCR V beta usage, studying either expression of a single V beta in a wide panel of strains (6, 7, 10, 12, 13), or expression of multiple V beta s in a very limited strain distribution (14, 15), have identified instances of clonal deletion of potentially autoreactive T cells specific for either self E alpha E beta or minor lymphocyte stimulatory (Mls) antigens. The present study has investigated the range of self antigens that can influence V beta usage by evaluating expression of 16 V beta families in 30 strains of mice. It was found that significant decreases in expression occur in at least 8 of the 16 V beta families and that dominant influences on the T cell V beta repertoire are exerted by expression of Mlsa, Mlsc, and MHC gene products. Decreased expressions of V beta 5, -11, -12, and -16 were influenced by MHC gene products. The patterns of decreased expression seen in intra-MHC recombinant strains and strains of different non-MHC background were distinct for V beta 11, -12, and -16, suggesting that different ligands are involved in the deletion of T cells expressing each of these V beta genes. Mice expressing Mlsa show decreased expression of V beta 9 as well as V beta 6. Mlsc mice lacked V beta 3 expression in those strains where the expressed MHC type was compatible with a strongly stimulatory Mlsc phenotype. V beta 7 was strongly influenced by both MHC and non-MHC products that are not yet identified. These results demonstrate that strain-specific decreases of mRNA expression occur in a major portion of the TCR repertoire. Self antigens including Mlsa, Mlsc, and E alpha E beta, as well as additional MHC and non-MHC products, appear to induce these decreases in expression in the process of eliminating self-reactive T cells from the mature T cell pool. PMID:2529341

  20. Influence of beta(2)-adrenoceptor gene polymorphisms on diet-induced thermogenesis.

    PubMed

    Oomen, J M; Waijers, P M C M; van Rossum, C; Hoebee, B; Saris, W H M; van Baak, M A

    2005-11-01

    The sympathetic nervous system is involved in the control of energy metabolism and expenditure. Diet-induced thermogenesis is mediated partly by the ss-adrenergic component of this system. The aim of the present study was to investigate the role of genetic variation in the beta(2)-adrenoceptor in diet-induced thermogenesis. Data from twenty-four subjects (fourteen men and ten women; BMI 26.7(sem 0.8) kg/m(2); age 45.2(sem1.4) years) with different polymorphisms of the beta(2)-adrenoceptor at codon 16 (Gly16Gly, Gly16Arg or Arg16Arg) were recruited for this study. Subjects were given a high-carbohydrate liquid meal, and the energy expenditure, respiratory exchange ratio, and plasma concentrations of NEFA, glycerol, glucose, insulin and catecholamines were measured before and over 4 h after the meal. The AUC of energy expenditure (diet-induced thermogenesis) was not significantly different between polymorphism groups, nor was the response of any of the other measured variables to the meal. In a multiple regression model, the only variable that explained a significant proportion (32 %) of the variation in diet-induced thermogenesis was the increase in plasma adrenaline in response to the meal (P<0.05). The beta(2)-adrenoceptor codon16 polymorphisms did not contribute significantly. In conclusion, an independent contribution of the codon 16 polymorphism of the beta(2)-adrenoceptor gene to the variation in thermogenic response to a high-carbohydrate meal could not be demonstrated. The interindividual variation in thermogenic response to the meal was correlated with variations in the plasma adrenaline response to the meal.

  1. Regulation of UCP gene expression in brown adipocytes differentiated in primary culture. Effects of a new beta-adrenoceptor agonist.

    PubMed

    Champigny, O; Holloway, B R; Ricquier, D

    1992-07-01

    Primary cultures of precursor cells from mouse and rat brown adipose tissue (BAT) were used to study the effect of a new beta-agonist (ICI D7114) on the uncoupling protein (UCP) gene expression. ICI 215001 (the active metabolite of D7114) increased the expression of UCP and its mRNA in brown adipocytes differentiating in vitro in a dose-dependent manner. This stimulating effect was not inhibited by propranolol, a non-specific beta-antagonist, but was partially reduced by bupranolol, a beta 3-antagonist. No expression of UCP mRNA was ever induced by ICI 215001 in white adipocytes differentiated in vitro. It was concluded that the drug could affect the brown adipose cells through a beta 3-pathway. It could clearly modulate the expression of UCP in brown adipocytes differentiated in vitro, but was not able by itself to turn on the gene. PMID:1355051

  2. Genomic organization of the human {beta}-catenin gene (CTNNB1)

    SciTech Connect

    Nollet, F.; Berx, G.; Molemans, F.; Roy, F. van

    1996-03-05

    The cytoplasmic {beta}-catenin protein is implicated in signal transduction and associates with both the cell-cell adhesion protein E-cadherin and the tumor suppressor gene product APC. We determined the primary structure of the human {beta}-catenin gene (CTNNB1) by analysis cDNA and genomic clones. The size of the complete gene was determined to be 23.2 kb. Restriction mapping and partial sequence analysis revealed 16 exons. All splice donor and acceptor sites were conformable to the GT/AG rule. The exon size ranged from 61 to 790 bp. Half of the introns were smaller than 550 bp, with the smallest being 84 pb and the longest being 6700 bp. The intron-exon boundaries did not coincide either with conserved sites in the 12 armadillo repeat sequences of {beta}-catenin or with intron-exon boundaries in the armadillo gene of Drosophila. A major site for transcription initiation was identified as an A residue 214 nucleotides upstream of the ATG initiation codon. The resulting transcript is 3362 nucleotides long. Compared to the previously published mRNA sequence, additional residues were identified, 16 at the 5{prime} end and 766 at the 3{prime} end of the mRNA. An alternative splice acceptor site within exon 16 reduced the 3{prime} UTR sequence by 159 bp. Polymerase chain reaction on cDNA from 14 human cell lines demonstrated the general occurrence of both splice variants. The 5{prime}-flanking region is highly GC-rich and lacks a CCAAT box, but contains a TATA box and potential binding sites for several transcription factors, such as NFkB, SP1, AP2, and EGR1. Both a 437-bp fragment and a 6-kb fragment, containing about 4.7 kb of the 5{prime}-flanking region in addition to the noncoding exon 1 and 1 kb of intron 1, showed clear promoter activity when these fragments were linked to a secreted alkaline phosphatase reporter gene and transfected into a mouse epithelial cell line. 53 refs., 5 figs., 2 tabs.

  3. Cloning and characterization of a glycosyltransferase gene involved in the biosynthesis of anthracycline antibiotic beta-rhodomycin from Streptomyces violaceus.

    PubMed

    Miyamoto, Yuji; Johdo, Osamu; Nagamatsu, Yasunori; Yoshimoto, Akihiro

    2002-01-10

    A glycosyltransferase gene, rhoG, involved in the biosynthesis of the anthracycline antibiotic beta-rhodomycin was isolated as a 4.1-kb DNA fragment containing rhoG and its flanking region from Streptomyces violaceus by degenerate and inverse PCR. Sequencing analysis showed that rhoG was located in a gene cluster involved in the biosynthesis of the constitutive deoxysugar of beta-rhodomycin. The function of rhoG was verified by gene disruption, which was generated by replacing the internal 0.9-kb region of S. violaceus chromosome with a fragment including the SacI-blunted region. The rhoG disruption resulted in complete loss of beta-rhodomycin productivity, along with the accumulation of a non-glycosyl intermediate epsilon-rhodomycinone. In addition, the complementation test demonstrated that rhoG restored beta-rhodomycin production in this gene disruptant. These results indicated that rhoG is the glycosyltransferase gene responsible for the glycosylation of epsilon-rhodomycinone in beta-rhodomycin biosynthesis. PMID:11814657

  4. Neuroimmune regulation of alcohol consumption: Behavioral validation of genes obtained from genomic studies

    PubMed Central

    Blednov, Yuri A.; Ponomarev, Igor; Geil, Chelsea; Bergeson, Susan; Koob, George F.; Harris, R. Adron

    2010-01-01

    Analysis of mouse brain gene expression, using strains that differ in alcohol consumption, provided a number of novel candidate genes that potentially regulate alcohol consumption. We selected six genes [beta-2-microglobulin (B2m), cathepsin S (Ctss), cathepsin F (Ctsf), interleukin 1 receptor antagonist (Il1rn), CD14 molecule (Cd14) and interleukin 6 (Il6)] for behavioral validation using null mutant mice. These genes are known to be important for immune responses but were not specifically linked to alcohol consumption by previous research. Null mutant mice were tested for ethanol intake in three tests: 24 hr two-bottle choice, limited access two-bottle choice and limited access to one bottle of ethanol. Ethanol consumption and preference were reduced in all the null mutant mice in the 24 hr two-bottle choice test, the test that was the basis for selection of these genes. No major differences were observed in consumption of saccharin in the null mutant mice. Deletion of B2m, Ctss, Il1rn, Cd14 and Il6 also reduced ethanol consumption in the limited access two bottle choice test for ethanol intake; with the Il1rn and Ctss null mutants showing reduced intake in all three tests (with some variation between males and females). These results provide the most compelling evidence to date that global gene expression analysis can identify novel genetic determinants of complex behavioral traits. Specifically, they suggest a novel role for neuroimmune signaling in regulation of alcohol consumption. PMID:21309947

  5. Functional expression of a mouse H-2Kb gene isolated from non-expressing teratocarcinoma cells.

    PubMed Central

    Daniel-Vedele, F; Morello, D; Benicourt, C; Transy, C; Le Bail, O; Plata, F; Kourilsky, P

    1984-01-01

    Embryonal carcinoma cells do not express H-2 antigens or beta 2-microglobulin. Recent studies have suggested that the expression of these antigens is likely to be controlled at the level of transcription. To study the precise organization of the corresponding genes and their possible expression in adult mouse cells, we have isolated H-2-related genes from a genomic cosmid library constructed with PCC4-aza-RI from DNA of EC cells. Clones isolated from the library after stringent hybridization with an H-2 cDNA probe were tested for their ability to direct H-2 antigen synthesis after DNA-mediated gene transfer in a fibroblastic L cell. Four clones have been found to code for the major transplantation antigen H-2Kb. Structural analysis showed that these clones contained the same entire H-2Kb gene, identical to the corresponding gene isolated from differentiated C57Bl/10 cells. Furthermore, the present studies showed that this embryonal carcinoma gene was expressed and was functional when transfected into a differentiated cell. PMID:6714227

  6. Expression of herpes simplex virus beta and gamma genes integrated in mammalian cells and their induction by an alpha gene product.

    PubMed Central

    Sandri-Goldin, R M; Goldin, A L; Holland, L E; Glorioso, J C; Levine, M

    1983-01-01

    The proteins of herpes simplex virus type 1 (HSV-1) form three kinetic groups termed alpha, beta, and gamma, whose synthesis is regulated in a cascade fashion. alpha products are synthesized first during infection, and they are required for synthesis of beta and gamma proteins. To examine the expression of several HSV-1 beta and gamma genes in the absence of alpha functions, we transferred into mammalian cells a plasmid containing a region of the HSV-1 genome that codes for only beta and gamma genes (0.315 to 0.421 map units). We found stable integration of at least one copy of the intact plasmid in each cell line. Four HSV-1 transcripts of the beta and gamma classes were transcribed constitutively in the cells, including the genes for glycoprotein B and DNA-binding protein. No constitutive synthesis of these two proteins could be demonstrated, however. The integrated HSV-1 genes responded to viral regulatory signals in that they could be induced by infection with HSV-1 mutants resulting in a high level of synthesis of both glycoprotein B and DNA-binding protein. The HSV-1 alpha gene product ICP4 was necessary for this induction, and it was found to be most efficient at a low multiplicity of infection. Functional expression of four genes was demonstrated in that the cell lines complemented infecting HSV-1 temperature-sensitive mutants. The same genes were not available for homologous recombination with infecting virus, however, since no recombinant wild-type virus could be detected. These data demonstrate that HSV-1 beta and gamma genes can be transcribed in the absence of alpha functions in mammalian cells, but that they still respond to HSV-1 regulatory signals such as the alpha gene product ICP4. Images PMID:6318078

  7. A beta-glucuronidase reporter gene construct for monitoring aflatoxin biosynthesis in Aspergillus flavus.

    PubMed Central

    Flaherty, J E; Weaver, M A; Payne, G A; Woloshuk, C P

    1995-01-01

    Aflatoxins are toxic and carcinogenic secondary metabolites produced by the fungi Aspergillus flavus and A. parasiticus. Current research is directed at the elimination of these compounds in important food sources. The objective of this research was to develop a method to study the induction and regulation of aflatoxin biosynthesis by examining the expression of one aflatoxin pathway gene, ver1. The promoter region of ver1 was fused to the beta-glucuronidase (GUS) gene (uidA) from Escherichia coli to form the reporter construct, GAP13. A. flavus 656-2 was transformed with this construct. Aflatoxin production, GUS activity, and transcript accumulation were determined in transformants after shifting the cultures from a nonconducive medium to a medium conducive to aflatoxin biosynthesis. Transformants harboring GAP13 displayed GUS expression only when aflatoxin was detected in culture. Further, the transcription of the uidA gene driven by the ver1 promoter followed the same profile as for the ver1 genes. The results show that the GAP13 construct may be useful as a genetic tool to study the induction of aflatoxin in situ and to identify substances that affect the expression of genes involved in aflatoxin biosynthesis. The utility of this construct to detect inducers of aflatoxin biosynthesis in maize kernels was tested in a bioassay. A heat-stable inducer of aflatoxin with a molecular size of less than 10 kDa was detected in extracts from maize kernels colonized by A. flavus. PMID:7618859

  8. Obesity-related phenotypes and the beta3-adrenoceptor gene variant in postmenopausal women.

    PubMed

    Tchernof, A; Starling, R D; Walston, J D; Shuldiner, A R; Dvorak, R V; Silver, K; Matthews, D E; Poehlman, E T

    1999-07-01

    We examined the hypothesis that postmenopausal women with the beta3-adrenoceptor gene variant (Trp64Arg) have reduced total daily energy expenditure (TEE), altered free fatty acid kinetics, and increased intra-abdominal fat. A secondary objective was to examine whether the obese state masks the effect of the variant on resting metabolic rate (RMR). There were 23 obese heterozygous women with the genetic variant (age 58 +/- 6 years; BMI 36 +/- 7 kg/m2) who were compared with 19 homozygous obese women with the normal allele (age 56 +/- 4 years; BMI 36 +/- 3 kg/m2). Daily energy expenditure was determined from doubly labeled water and indirect calorimetry, lipolysis from infusion of [1-13C]palmitate, and body fat distribution from computed tomography. No significant differences were found in TEE, RMR, energy expenditure of physical activity, the thermic effect of a meal, fat oxidation as estimated by fasting and postprandial respiratory quotients (RQs), or rate of lipolysis. Similarly, no difference was found in visceral adipose tissue and abdominal subcutaneous fat areas. When RMR was compared between obese (n = 23) and never-obese women with the Trp64Arg variant (n = 16), we found a 317 kcal/day lower RMR in never-obese women after controlling for fat mass, fat-free mass, and age (P < 0.0017). These results do not support the hypothesis that already obese women with the Trp64Arg polymorphism of the beta3-adrenergic receptor gene have lower daily energy expenditure, altered lipolysis, and increased abdominal obesity. On the other hand, the lower RMR in never-obese women suggests that the obese state may mask a moderate effect of the Trp64Arg variant on energy expenditure. Although these results need to be confirmed in other populations, the obese state may have been a confounding factor in previous studies of the beta3-adrenoceptor Trp64Arg variant and energy expenditure. PMID:10389848

  9. Estrogen Receptor beta binds Sp1 and recruits a Corepressor Complex to the Estrogen Receptor alpha Gene Promoter

    PubMed Central

    Bartella, V; Rizza, P; Barone, I; Zito, D; Giordano, F; Giordano, C; Catalano, S; Mauro, L; Sisci, D; Panno, ML; Fuqua, SA; Andò, Sebastiano

    2015-01-01

    Human estrogen receptors (ERs) alpha and beta are crucially involved in the regulation of mammary growth and development. Normal breast tissues display a prevalently expression of ER beta than ER alpha, which drastically increases during breast tumorogenesis. So, it is reasonable to assume how a dysregulation of the two estrogen receptor subtypes may induce breast cancer development. However, the molecular mechanism underlying the opposite role played by the two estrogen receptors on tumor cell growth remains to be elucidated. In the present study, we have demonstrated that ER beta overexpression in breast cancer cells decreases cell proliferation and down-regulates ER alpha mRNA and protein content along with a concomitant repression of estrogen-regulated genes. Transient transfection experiments, using a vector containing the human ER alpha promoter region, showed that elevated levels of the ER beta down-regulated basal ER alpha promoter activity. Furthermore, side-directed mutagenesis and deletion analysis have revealed that the proximal GC-rich motifs at −223 and −214 is crucial for the ER beta-induced ER alpha down-regulation in breast cancer cells. This occurred through ER beta-Sp1 protein-protein interaction within the ER alpha promoter region and the recruitment of a corepressor complex containing NCoR/SMRT (nuclear receptor corepressor/silencing mediator of retinoic acid and thyroid hormone receptor), accompanied by hypoacetylation of histone H4 and displacement of RNA polymerase II. Silencing of NCoR gene expression by RNA interference reversed the down-regulatory effect of ER beta on ER alpha gene expression and cell proliferation. Our results provide evidence for a novel mechanism by which overexpression of ER beta through NCoR is able to down regulate ER alpha gene expression, thus inhibiting ER alpha’s driving role on breast cancer cell growth. PMID:22622808

  10. Inactivation of the ampD gene causes semiconstitutive overproduction of the inducible Citrobacter freundii beta-lactamase.

    PubMed Central

    Lindberg, F; Lindquist, S; Normark, S

    1987-01-01

    In Citrobacter freundii and Enterobacter cloacae, synthesis of AmpC beta-lactamase is inducible by the addition of beta-lactams to the growth medium. Spontaneous mutants that constitutively overproduce the enzyme occur at a high frequency. When the C. freundii ampC beta-lactamase gene is cloned into Escherichia coli together with the regulatory gene ampR, beta-lactamase expression from the clone is inducible. Spontaneous cefotaxime-resistant mutants were selected from an E. coli strain carrying the cloned C. freundii ampC and ampR genes on a plasmid. Virtually all isolates had chromosomal mutations leading to semiconstitutive overproduction of beta-lactamase. The mutation ampD2 in one such mutant was caused by an IS1 insertion into the hitherto unknown ampD gene, located between nadC and aroP at minute 2.4 on the E. coli chromosome. The wild-type ampD allele cloned on a plasmid could fully trans-complement beta-lactamase-overproducing mutants of both E. coli and C. freundii, restoring the wild-type phenotype of highly inducible enzyme synthesis. This indicates that these E. coli and C. freundii mutants have their lesions in ampD. We hypothesize that induction of beta-lactamase synthesis is caused by blocking of the AmpD function by the beta-lactam inducer and that this leads directly or indirectly to an AmpR-mediated stimulation of ampC expression. PMID:3032901

  11. Prominent expression of transforming growth factor beta2 gene in the chicken embryonic gonad as revealed by suppressive subtraction cloning.

    PubMed

    Hattori Ma, Masa-aki; Furuta, Hiroki; Hiyama, Yoshio; Kato, Yukio; Fujihara, Noboru

    2002-02-01

    cDNA cloning from chicken embryonic gonad subtracted from tissues of the brain, heart, liver, gizzard, mesonephros, and muscle was performed to identify growth factor genes with expression unique to embryonic ovary and testis. We obtained several cDNA clones encoding known and many unknown genes. We found for the first time that the transforming growth factor beta2 (TGF-beta2) is preferentially expressed in the chicken embryonic ovary and testis. cDNA subtraction cloning with respect to the selective expression of TGF-beta2 in the ovary and testis was further analyzed by reverse transcription-polymerase chain reaction analyses of other embryonic tissues. The ontogeny of TGF-beta2 was evaluated in chicken embryonic ovary and testis. In both testis and ovary, the levels of TGF-beta2 transcripts were high during the early period of embryonic development (E7), gradually decreased until the late embryonic days (E14--E17), and then slightly increased at the last embryonic day (E21). There was no difference in the TGF-beta2 transcripts per RNA between the left and the right ovaries. TGF-beta2 may have a critical role in the regulation of the development of chicken ovarian and testicular germ cells during the embryonic period.

  12. A member of the TGF-beta receptor gene family in the parasitic nematode Brugia pahangi.

    PubMed

    Gomez-Escobar, N; van den Biggelaar, A; Maizels, R

    1997-10-15

    The full length cDNA sequence of a Type I transforming growth factor-beta (TGF-beta) receptor has been isolated from the filarial parasitic nematode Brugia pahangi. This new gene, designated Bp-trk-1, encodes a predicted 645 amino acid sequence with an N-terminal hydrophobic stretch which may act as a signal peptide. The extracellular portion (residues 15-187) is cysteine-rich and has three potential N-glycosylation sites. At positions 250-255 the protein contains the glycine-serine rich motif characteristic of Type I receptors. The closest homologue is a Caenorhabditis elegans gene (Q09488) in cosmid C32D5.2 which shares 67% amino acid identity with Bp-trk-1 in the most conserved kinase domain (aa 259-482). Other type I receptors such as C. elegans daf-1 and Drosophila tkv show 38-53% identity in the same region. Some residues conserved in Drosophila and vertebrates are not present in the B. pahangi sequence. RT-PCR amplification has been used to show that the transcript is expressed in the three main stages of the B. pahangi life cycle: microfilariae, infective larvae and adults. The ligand remains unknown at this time but is likely to be most similar to that for C. elegans Q09488. PMID:9358045

  13. Gamma interferon and 5-azacytidine cause transcriptional elevation of class I major histocompatibility complex gene expression in K562 leukemia cells in the absence of differentiation.

    PubMed

    Chen, E; Karr, R W; Frost, J P; Gonwa, T A; Ginder, G D

    1986-05-01

    We studied the effects of gamma interferon (IFN-gamma) on HLA class I gene expression, differentiation, and proliferative capacity of K562 human leukemia cells. In the uninduced state, K562 cells show little or no class I gene expression but actively express the erythroid-specific gamma-globin gene as well as genes associated with cell proliferation, including the transferrin receptor, c-myc, and alpha-actin genes At both the surface protein and mRNA levels, IFN-gamma induces class I and beta 2-microglobulin gene expression, but does not alter the expression of the gamma-globin, transferrin receptor, c-myc, or alpha-actin genes. A 10-fold maximal induction of both class I surface protein and mRNA occurs at 48 h and is reversible upon withdrawal of IFN-gamma from the culture medium. In vitro nuclear run-on transcription assays were performed to directly establish that IFN-gamma exerts an early effect at the level of transcription, with maximal transcription rates occurring within 4 h. The difference between the time course of transcription induction and that of mRNA accumulation suggests that the regulation of class I gene expression in this human leukemic cell line also involves posttranscriptional mechanisms. Measurements of cell proliferation rates and cell cycle distribution, as well as the reversibility of the effects of IFN-gamma, demonstrate that the selective induction of class I genes in these cells occurs in the absence of differentiation.

  14. Aspects on evolution of fungal beta-lactam biosynthesis gene clusters and recruitment of trans-acting factors.

    PubMed

    Brakhage, Axel A; Thön, Marcel; Spröte, Petra; Scharf, Daniel H; Al-Abdallah, Qusai; Wolke, Sandra M; Hortschansky, Peter

    2009-01-01

    Penicillins and cephalosporins are beta-lactam antibiotics. The formation of hydrophobic penicillins has been reported in fungi only, notably Penicillium chrysogenum and Aspergillus (Emericella) nidulans, whereas the hydrophilic cephalosporins are produced by both fungi, e.g., Acremonium chrysogenum (cephalosporin C), and bacteria. The producing bacteria include Gram-negatives and Gram-positives, e.g., Streptomyces clavuligerus (cephamycin C) and Lysobacter lactamgenus (cephabacins), respectively. The evolutionary origin of beta-lactam biosynthesis genes has been the subject of discussion for many years, and two main hypotheses have been proposed: (i) horizontal gene transfer (HGT) from bacteria to fungi or (ii) vertical decent. There are strong arguments in favour of HGT, e.g., unlike most other fungal genes, beta-lactam biosynthesis genes are clustered and some of these genes lack introns. In contrast to S. clavuligerus, all regulators of fungal beta-lactam biosynthesis genes represent wide-domain regulators that are not part of the gene cluster. If bacterial regulators were co-transferred with the gene cluster from bacteria to fungi, most likely they would have been non-functional in eukaryotes and lost during evolution. Recently, the penicillin biosynthesis gene aatB was discovered, which is not part of the penicillin biosynthesis gene cluster and is even located on a different chromosome. The aatB gene is regulated by the same regulators AnCF and AnBH1 as the penicillin biosynthesis gene aatA (penDE). Data suggest that aatA and aatB are paralogues derived by duplication of a common ancestor gene. This data supports a model in which part of the beta-lactam biosynthesis gene cluster was transferred to some fungi, i.e., the acvA and ipnA gene without a regulatory gene. We propose that during the assembly of aatA and acvA-ipnA into a single gene cluster, recruitment of transcriptional regulators occurred along with acquisition of the duplicated aatA ancestor gene

  15. Physical mapping of the human t-cell receptor beta gene complex, using yeast artificial chromosomes

    SciTech Connect

    Hashim, Y.; So, A.K.; Kearney, L.

    1995-04-01

    Yeast artificial chromosomes (YACs) were used to construct a physical map of the germline human T-cell {beta} chain gene complex (TCRB). Variable region genes (BV) for the 25 known subfamilies were used as probes to screen the ICRF AM4x YAC library. Of the five positive YACs identified, one YAC designated B3, 820 kilobase pairs (kbp) in size, scored positive for all 25 TCRBV subfamilies plus the constant region genes (BC) when analyzed by pulse field gel electrophoresis. Restriction enzyme mapping of B3 located TCRBV and TCRBC gene regions to 4 Sfi I fragments of 280, 110, 90, and 125 kbp and was in accordance with published data. In addition, comparison of hybridization results of Sfi I-restricted B3 and genomic DNA from the parental cell line GM1416B revealed identical banding patterns. The data thus showed YAC B3 encoded a complete and unrearranged TCRB gene locus of some 600-620 kbp. The map was further resolved by locating restriction sites for Sal I and Bss HII on B3, giving more precise localization of the individual TCRBV gene families. Fluorescent in situ hybridization of B3 to spreads of human metaphase chromosomes localized B3 to 7q35. However, two additional signals were obtained; one attributable to the TCRBV orphon cluster on 9p21, the second to the long arm of chromosome 2. Polymerase chain reaction amplification of a chromosome 2 somatic cell hybrid, using primers for all 25 TCRBV gene families, revealed that the signal was not attributable to a second orphon cluster. It is suggested that B3 is a chimeric YAC with an intact TCRB locus flanked by chromosome 2 sequences. 32 refs., 5 figs., 1 tab.

  16. Conservation and divergence of autonomous pathway genes in the flowering regulatory network of Beta vulgaris.

    PubMed

    Abou-Elwafa, Salah F; Büttner, Bianca; Chia, Tansy; Schulze-Buxloh, Gretel; Hohmann, Uwe; Mutasa-Göttgens, Effie; Jung, Christian; Müller, Andreas E

    2011-06-01

    The transition from vegetative growth to reproductive development is a complex process that requires an integrated response to multiple environmental cues and endogenous signals. In Arabidopsis thaliana, which has a facultative requirement for vernalization and long days, the genes of the autonomous pathway function as floral promoters by repressing the central repressor and vernalization-regulatory gene FLC. Environmental regulation by seasonal changes in daylength is under control of the photoperiod pathway and its key gene CO. The root and leaf crop species Beta vulgaris in the caryophyllid clade of core eudicots, which is only very distantly related to Arabidopsis, is an obligate long-day plant and includes forms with or without vernalization requirement. FLC and CO homologues with related functions in beet have been identified, but the presence of autonomous pathway genes which function in parallel to the vernalization and photoperiod pathways has not yet been reported. Here, this begins to be addressed by the identification and genetic mapping of full-length homologues of the RNA-regulatory gene FLK and the chromatin-regulatory genes FVE, LD, and LDL1. When overexpressed in A. thaliana, BvFLK accelerates bolting in the Col-0 background and fully complements the late-bolting phenotype of an flk mutant through repression of FLC. In contrast, complementation analysis of BvFVE1 and the presence of a putative paralogue in beet suggest evolutionary divergence of FVE homologues. It is further shown that BvFVE1, unlike FVE in Arabidopsis, is under circadian clock control. Together, the data provide first evidence for evolutionary conservation of components of the autonomous pathway in B. vulgaris, while also suggesting divergence or subfunctionalization of one gene. The results are likely to be of broader relevance because B. vulgaris expands the spectrum of evolutionarily diverse species which are subject to differential developmental and/or environmental regulation

  17. Characterization of a large deletion in the {beta}-globin gene cluster in a newborn with hemoglobin FE

    SciTech Connect

    Louie, E.; Dietz, L.; Shafer, F.

    1994-09-01

    A sample on a newborn with hemoglobin FE screen results was obtained to investigate whether E/E or B/{beta}{degrees} thalassemia was present using polymerase chain reaction (PCR) methodology. The newborn appeared homozygous for the hemoglobin E mutation in our initial study, but the parents` genotypes did not support this diagnosis. The father is homozygous for the absence of the hemoglobin E mutation (non E/non E) and the mother is heterozygous (E/non E) for this mutation. The limitation of PCR analysis is an assumption that the amplification of the two {beta}-globin alleles is equivalent. A large deletion on one {beta}-globin gene, which would produce E/{beta}{degrees} thalassemia, would be missed if it included part or the entire region subjected to amplification. The family results were consistent with either non-paternity, sample mix-up or such a deletion of the {beta}-globin gene in the father and child. To rule out the possibility of non-paternity, two polymorphic loci (HLA on chromosome 6 and a VNTR system of chromosome 17) that are outside of the {beta}-globin gene were analyzed and show that inheritance is consistent and the likelihood of a sample mix-up is then reduced. We therefore believe there is a gene deletion in this family. At the present time, analyses of the RFLPs that are 5{prime} of the {beta}-globin gene cluster show that the polymorphisms most distal from the 5{prime} {beta}-globin gene are not being inherited as expected. These results support our interpretation that a deletion exists in the father and was inherited by the child. The father`s clinical picture of possible HPFH (the father has 12% hemoglobin F) also supports the interpretation of a deletion in this family. Deletions of the {beta}-globin gene within this ethnic group are rare. Currently, Southern blots on the family are being probed to determine the extent of the putative deletion.

  18. Prodigiosin induces the proapoptotic gene NAG-1 via glycogen synthase kinase-3beta activity in human breast cancer cells.

    PubMed

    Soto-Cerrato, Vanessa; Viñals, Francesc; Lambert, James R; Kelly, Julie A; Pérez-Tomás, Ricardo

    2007-01-01

    Prodigiosin (2-methyl-3-pentyl-6-methoxyprodigiosene) is a bacterial metabolite that has anticancer and antimetastatic properties. However, the molecular mechanisms responsible for these abilities are not fully understood. Gene expression profiling of the human breast cancer cell line MCF-7 treated with prodigiosin was analyzed by cDNA array technology. The majority of the significantly modified genes were related to apoptosis, cell cycle, cellular adhesion, or transcription regulation. The dramatic increase of the nonsteroidal anti-inflammatory drug-activated gene 1 (NAG-1) made this gene an interesting candidate regarding the possible mechanism by which prodigiosin induces cytotoxicity in MCF-7 cells. Our results show that prodigiosin triggers accumulation of the DNA-damage response tumor-suppressor protein p53 but that NAG-1 induction was independent of p53 accumulation. Moreover, prodigiosin caused AKT dephosphorylation and glycogen synthase kinase-3beta (GSK-3beta) activation, which correlated with NAG-1 expression. Prodigiosin-induced apoptosis was recovered by inhibiting GSK-3beta, which might be due, at least in part, to the blockade of the GSK-3beta-dependent up-regulation of death receptors 4 and 5 expression. These findings suggest that prodigiosin-mediated GSK-3beta activation is a key event in regulating the molecular pathways that trigger the apoptosis induced by this anticancer agent.

  19. Cloning and characterization of 5'-untranslated region of porcine beta casein gene (CSN2).

    PubMed

    Lee, Poongyeon; Chung, Hee Kyoung; Lee, Hyun-Gi; Lee, Hwi-Cheul; Woo, Jae-Seok; Lee, Seunghoon; Jo, Su-Jin; Chang, Won-Kyong; Lee, Hoon-Taek; Kwon, Moosik; Park, Jin-Ki

    2008-10-01

    beta-Casein (CSN2) is a major milk protein in most mammals. The CSN2 gene is generally induced by lactogenic hormones bound to its promoter. The expression of this gene can be enhanced by signal transducers and activators of transcription (STAT) and glucocorticoid receptor (GR). Here, we analyzed the promoter and intron 1 regions of the porcine CSN2 gene. The porcine CSN2 promoter and intron 1 regions (-3098bp to +2446bp) were cloned into the pGL3-Basic vector containing the luciferase reporter gene (pCSN2-PEI). Lactogenic signals induced the transcription of porcine CSN2. By using AG490, a Janus kinase (JAK) inhibitor, we demonstrated that STAT5 positively regulates the transcription of porcine CSN2. Further, seven STAT mutants were generated by site-directed mutagenesis. By performing electrophoretic mobility shift assays (EMSAs), we located a critical element for pCSN2-PEI transcription bound to STAT5 in the -102bp to -84bp region. The construct containing only the promoter region (pCSN2-P), however, did not exert any promotive effects on transcription in two cell types-a mouse mammary epithelial cell line (HC11) and porcine mammary gland epithelial cells (PMECs). Thus, the construct containing intron 1 of porcine CSN2 exerts an elevating effect on transcription. We suggest that the transcription of porcine CSN2 is regulated by lactogenic signals via the STAT5 site (-102bp to -84bp) and intron 1.

  20. A molecular map of the chicken major histocompatibility complex: the class II beta genes are closely linked to the class I genes and the nucleolar organizer.

    PubMed Central

    Guillemot, F; Billault, A; Pourquié, O; Béhar, G; Chaussé, A M; Zoorob, R; Kreibich, G; Auffray, C

    1988-01-01

    We have cloned in a cosmid vector four DNA clusters covering 320 kb of the chicken MHC (B complex), including five class II (B-L) beta genes defining two related isotypic families. Additional B complex genes have been revealed using tissue-specific cDNA probes. A cosmid fragment has been used to isolate a cDNA for a class I (B-F) transcript. This transcript, that is by far the most divergent known member of the class I gene family, hybridized to six B-F genes present in the cosmids. One of the clusters was shown to contain two rRNA transcriptional units from the nucleolar organizer region (NOR), marking the telomeric boundary of the B complex. None of the other B complex genes hybridizes to, or has the transcriptional characteristics of mammalian MHC class II alpha or class III genes. The map we have obtained shows that the B complex does not contain well defined class I and class II regions since B-F and B-L beta genes are closely associated with unrelated genes. Moreover, class II beta genes are very closely linked to class I genes in two clusters, and to the NOR in a third one. Images PMID:3141149

  1. Evaluation of reference genes for quantitative real-time RT-PCR analysis of gene expression in Nile tilapia (Oreochromis niloticus).

    PubMed

    Yang, Chang Geng; Wang, Xian Li; Tian, Juan; Liu, Wei; Wu, Fan; Jiang, Ming; Wen, Hua

    2013-09-15

    Quantitative real-time reverse-transcriptase polymerase chain reaction (RT-qPCR) has been used frequently to study gene expression related to fish immunology. In such studies, a stable reference gene should be selected to correct the expression of the target gene. In this study, seven candidate reference genes (glyceraldehyde-3-phosphate dehydrogenase (GADPH), ubiquitin-conjugating enzyme (UBCE), 18S ribosomal RNA (18S rRNA), beta-2-microglobulin (B2M), elongation factor 1 alpha (EF1A), tubulin alpha chain-like (TUBA) and beta actin (ACTB)), were selected to analyze their stability and normalization in seven tissues (liver, spleen, kidney, brain, heart, muscle and intestine) of Nile tilapia (Oreochromis niloticus) challenged with Streptococcus agalactiae or Streptococcus iniae, respectively. The results showed that all the candidate reference genes exhibited tissue-dependent transcriptional variations. With PBS injection as a control, UBCE was the most stable and suitable single reference gene in the intestine, liver, brain, kidney, and spleen after S. iniae infection, and in the liver, kidney, and spleen after S. agalactiae infection. EF1A was the most suitable in heart and muscle after S. iniae or S. agalactiae infection. GADPH was the most suitable gene in intestine and brain after S. agalactiae infection. In normal conditions, UBCE and 18S rRNA were the most stably expressed genes across the various tissues. These results showed that for RT-qPCR analysis of tilapia, selecting two or more reference genes may be more suitable for cross-tissue analysis of gene expression.

  2. Candidate Gene Study of TRAIL and TRAIL Receptors: Association with Response to Interferon Beta Therapy in Multiple Sclerosis Patients

    PubMed Central

    Órpez-Zafra, Teresa; Pinto-Medel, María Jesús; Oliver-Martos, Begoña; Ortega-Pinazo, Jesús; Arnáiz, Carlos; Guijarro-Castro, Cristina; Varadé, Jezabel; Álvarez-Lafuente, Roberto; Urcelay, Elena; Sánchez-Jiménez, Francisca

    2013-01-01

    TRAIL and TRAIL Receptor genes have been implicated in Multiple Sclerosis pathology as well as in the response to IFN beta therapy. The objective of our study was to evaluate the association of these genes in relation to the age at disease onset (AAO) and to the clinical response upon IFN beta treatment in Spanish MS patients. We carried out a candidate gene study of TRAIL, TRAILR-1, TRAILR-2, TRAILR-3 and TRAILR-4 genes. A total of 54 SNPs were analysed in 509 MS patients under IFN beta treatment, and an additional cohort of 226 MS patients was used to validate the results. Associations of rs1047275 in TRAILR-2 and rs7011559 in TRAILR-4 genes with AAO under an additive model did not withstand Bonferroni correction. In contrast, patients with the TRAILR-1 rs20576-CC genotype showed a better clinical response to IFN beta therapy compared with patients carrying the A-allele (recessive model: p = 8.88×10−4, pc = 0.048, OR = 0.30). This SNP resulted in a non synonymous substitution of Glutamic acid to Alanine in position 228 (E228A), a change previously associated with susceptibility to different cancer types and risk of metastases, suggesting a lack of functionality of TRAILR-1. In order to unravel how this amino acid change in TRAILR-1 would affect to death signal, we performed a molecular modelling with both alleles. Neither TRAIL binding sites in the receptor nor the expression levels of TRAILR-1 in peripheral blood mononuclear cell subsets (monocytes, CD4+ and CD8+ T cells) were modified, suggesting that this SNP may be altering the death signal by some other mechanism. These findings show a role for TRAILR-1 gene variations in the clinical outcome of IFN beta therapy that might have relevance as a biomarker to predict the response to IFN beta in MS. PMID:23658636

  3. Genomic organization of the murine G protein beta subunit genes and related processed pseudogenes.

    PubMed

    Kitanaka, J; Wang, X B; Kitanaka, N; Hembree, C M; Uhl, G R

    2001-12-01

    The functional significance of heterotrimeric guanine nucleotide binding protein (G protein) for the many physiological processes including the molecular mechanisms of drug addiction have been described. In investigating the changes of mRNA expression after acute psychostimulant administration, we previously identified a cDNA encoding a G protein beta1 subunit (Gbeta1) that was increased up to four-fold in certain brain regions after administration of psychostimulants. The mouse Gbeta1 gene (the mouse genetic symbol, GNB1) was mapped to chromosome 4, but little was known of its genetic features. To characterize the GNB1 gene further, we have cloned and analyzed the genomic structures of the mouse GNBI gene and its homologous sequences. The GNBI gene spans at least 50 kb, and consists of 12 exons and 11 introns. The exon/intron boundaries were determined and found to follow the GT/AG rule. Exons 3-11 encode the Gbeta1 protein, and the exon 2 is an alternative, resulting in putative two splicing variants. Although intron 11 is additional for GNBI compared with GNB2 and GNB3, the intron positions within the protein coding region of GNB1, GNB2 and GNB3 are identical, suggesting that GNB1 should have diverged from the ancestral gene family earlier than the genes for GNB2 and GNB3. We also found the 5'-truncated processed pseudogenes with 71-89% similarities to GNBI mRNA sequence, suggesting that the truncated cDNA copies, which have been reverse-transcribed from a processed mRNA for GNB1, might have been integrated into several new locations in the mouse genome. PMID:11913780

  4. A review on the origin and spread of deleterious mutants of the beta-globin gene in Indian populations.

    PubMed

    Das, S K; Talukder, G

    2001-01-01

    Deleterious mutations of the human beta-globin gene are responsible for beta-thalassaemia and other haemoglobinopathies, which are the most common genetic diseases in Indian populations. A highly heterogeneous distribution of those mutations is observed in India and certain mutations are restricted to some extent to particular groups only. The reasons behind the geographical clustering and origin of the mutations in India is a highly debated issue and the evidence is conflicting. Our present article aims at tracing the origin of the deleterious beta-globin mutation and evaluates the role of different evolutionary forces responsible for the spread and present distribution of those mutations in Indian populations, using data from molecular biology and statistical methods. Mutations are generated essentially randomly, but "hot-spot" sites for mutation are reported for the beta-globin gene cluster, indicating sequence dependency of mutation. A single origin of a deleterious beta-globin mutation, followed by recombination (in a hot spot region) and/or interallelic gene conversion (within beta-globin gene) through time is the most plausible hypothesis to explain the association of those mutations with multiple haplotype backgrounds and frameworks. It is suggested that India is the place of origin of HbE and HbD mutations and that they dispersed to other parts of the would by migration. HbS mutants present in Indian populations are not of Middle East origin but rather a fresh mutation is the probable explanation for the prevalence among tribal groups. beta-thalassaemia represents a heterogeneous group of mutant alleles in India. Five common and twelve rare mutations have been reported in variable frequencies among different Indian populations. Gene flow of those mutant alleles from different populations of the world by political, military and commercial interactions possibly accounts for the heterogenous nature of beta-thalassaemia among Indians. A multiple allelic

  5. GeneSpeed Beta Cell: An Online Genomics Data Repository and Analysis Resource Tailored for the Islet Cell Biologist

    PubMed Central

    Quayum, Nayeem; Kutchma, Alecksandr; Sarkar, Suparna A.; Juhl, Kirstine; Gradwohl, Gerard; Mellitzer, Georg; Hutton, John C.; Jensen, Jan

    2008-01-01

    Objective. We here describe the development of a freely available online database resource, GeneSpeed Beta Cell, which has been created for the pancreatic islet and pancreatic developmental biology investigator community. Research Design and Methods. We have developed GeneSpeed Beta Cell as a separate component of the GeneSpeed database, providing a genomics-type data repository of pancreas and islet-relevant datasets interlinked with the domain-oriented GeneSpeed database. Results. GeneSpeed Beta Cell allows the query of multiple published and unpublished select genomics datasets in a simultaneous fashion (multiexperiment viewing) and is capable of defining intersection results from precomputed analysis of such datasets (multidimensional querying). Combined with the protein-domain categorization/assembly toolbox provided by the GeneSpeed database, the user is able to define spatial expression constraints of select gene lists in a relatively rigid fashion within the pancreatic expression space. We provide several demonstration case studies of relevance to islet cell biology and development of the pancreas that provide novel insight into islet biology. Conclusions. The combination of an exhaustive domain-based compilation of the transcriptome with gene array data of interest to the islet biologist affords novel methods for multidimensional querying between individual datasets in a rapid fashion, presently not available elsewhere. PMID:18795106

  6. A gene encoding the major beta tubulin of the mitotic spindle in Physarum polycephalum plasmodia

    SciTech Connect

    Burland, T.G.; Paul, E.C.A.; Oetliker, M.; Dove, W.F.

    1988-03-01

    The multinucleate plasmodium of Physarum polycephalum is unusual among eucaryotic cells in that it uses tubulins only in mitotic-spindle microtubules; cytoskeletal, flagellar, and centriolar microtubules are absent in this cell type. The authors identified a ..beta..-tubulin cDNA clone, ..beta..105, which is shown to correspond to the transcript of the betC ..beta..-tubulin locus and to encode ..beta..2 tubulin, the ..beta.. tubulin expressed specifically in the plasmodium and used exclusively in the mitotic spindle. Physarum amoebae utilize tubulins in the cytoskeleton, centrioles, and flagella, in addition to the mitotic spindle. Sequence analysis shows that ..beta..2 tubulin is only 83% identical to the two ..beta.. tubulins expressed in amoebae. This compares with 70 to 83% identity between Physarum ..beta..2 tubulin and the ..beta.. tubulins of yeasts, fungi, alga, trypanosome, fruit fly, chicken, and mouse. On the other hand, Physarum ..beta..2 tubulin is no more similar to, for example, Aspergillus ..beta.. tubulins than it is to those of Drosophila melanogaster or mammals. Several eucaryotes express at least one widely diverged ..beta.. tubulin as well as one or more ..beta.. tubulins that conform more closely to a consensus ..beta..-tubulin sequence. The authors suggest that ..beta..-tubulins diverge more when their expression pattern is restricted, especially when this restriction results in their use in fewer functions. This divergence among ..beta.. tubulins could have resulted through neutral drift. For example, exclusive use of Physarum ..beta..2 tubulin in the spindle may have allowed more amino acid substitutions than would be functionally tolerable in the ..beta.. tubulins that are utilized in multiple microtubular organelles. Alternatively, restricted use of ..beta.. tubulins may allow positive selection to operate more freely to refine ..beta..-tubulin function.

  7. A common system controls the induction of very different genes. The class-A beta-lactamase of Proteus vulgaris and the enterobacterial class-C beta-lactamase.

    PubMed

    Datz, M; Joris, B; Azab, E A; Galleni, M; Van Beeumen, J; Frère, J M; Martin, H H

    1994-11-15

    Among the Enterobacteriaceae, Proteus vulgaris is exceptional in the inducible production of a 29-kDa beta-lactamase (cefuroximase) with an unusually high activity towards the beta-lactamase-stable oximino-cephalosporins (e.g. cefuroxime and cefotaxime). Sequencing of the corresponding gene, cumA, showed that the derived CumA beta-lactamase belonged to the molecular class A. The structural gene was under the direct control of gene cumR, which was transcribed backwards and whose initiation codon was 165 bp away from that of the beta-lactamase gene. This resembled the arrangement of structural and regulator genes ampC and ampR of the 39-kDa molecular-class-C beta-lactamase AmpC present in many enterobacteria. Moreover, cloned genes ampD and ampG for negative modulation and signal transduction of AmpC beta-lactamase induction, respectively, were also able to restore constitutively CumA overproducing and non-inducible P. vulgaris mutants to the inducible, wild-type phenotype. The results indicate that controls of the induction phenomena are equivalent for the CumA and AmpC beta-lactamase. Very different structural genes can thus be under the control of identical systems.

  8. Oct-1 functions as a transactivator in the hormonal induction of beta-casein gene expression.

    PubMed

    Dong, Bing; Huang, Chengfei; Li, Defa; Zhao, Feng-Qi

    2009-08-01

    The ubiquitous transcription factor Oct-1 is involved in the hormonal regulation of the transcription of the major milk protein beta-casein through an interaction with the prolactin receptor, the STAT-5, and the glucocorticoid receptor (GR). In this study, this interaction was further demonstrated using Oct-1-deficient cells. In addition, Oct-1 mRNA expression is shown to increase during pregnancy and reach the highest levels during early lactation in mouse mammary gland. In reconstituted COS-7 cells, the endogenous Oct-1 binding activity rapidly increased within 5 min upon the lactogenic hormone treatment, indicating potential post-transcriptional/translational modification of Oct-1 by prolactin and glucocorticoids. Furthermore, STAT-5B was as effective as STAT-5A in the interaction with Oct-1 during hormonal induction, and a GR mutant, which carries mutations at multiple potential phosphorylation sites, functioned similarly to the wild-type GR, indicating that these phosphorylation sites may not be involved in the interaction of GR with Oct-1 on the beta-casein gene promoter.

  9. A missense mutation in the beta-2 integrin gene (ITGB2) causes canine leukocyte adhesion deficiency.

    PubMed

    Kijas, J M; Bauer, T R; Gäfvert, S; Marklund, S; Trowald-Wigh, G; Johannisson, A; Hedhammar, A; Binns, M; Juneja, R K; Hickstein, D D; Andersson, L

    1999-10-01

    Canine leukocyte adhesion deficiency (CLAD) is a fatal immunodeficiency disease found in Irish setters. The clinical manifestations of CLAD are very similar to LAD in humans and BLAD in cattle, which are both caused by mutations in ITGB2 encoding the leukocyte integrin beta-2 subunit (CD18). Sequence analysis of the ITGB2 coding sequence from a CLAD dog and a healthy control revealed a single missense mutation, Cys36Ser. This cysteine residue is conserved among all beta integrins, and the mutation most likely disrupts a disulfide bond. The mutation showed a complete association with CLAD in Irish setters and was not found in a sample of dogs from other breeds. The causative nature of this mutation was confirmed by transduction experiments using retroviral vectors and human LAD EBV B-cells. The normal canine CD18 formed heterodimers with the human CD11 subunit, whereas gene transfer of the mutant CD18 resulted in very low levels of CD11/CD18 expression. The identification of the causative mutation for CLAD now makes it possible to identify carrier animals with a simple diagnostic DNA test, and it forms the basis for using CLAD as a large animal model for the development and evaluation of clinical treatments for human LAD. PMID:10512685

  10. Molecular analysis of T-cell receptor beta genes in cutaneous T-cell lymphoma reveals Jbeta1 bias.

    PubMed

    Morgan, Suzanne M; Hodges, Elizabeth; Mitchell, Tracey J; Harris, Susan; Whittaker, Sean J; Smith, John L

    2006-08-01

    Molecular characterization of T-cell receptor junctional region sequences in cutaneous T-cell lymphoma had not been previously reported. We have examined in detail the features of the T-cell receptor beta (TCRB) gene rearrangements in 20 individuals with well-defined stages of cutaneous T-cell lymphoma (CTCL) comprising 10 cases with early-stage mycosis fungoides (MF) and 10 cases with late-stage MF or Sezary syndrome. Using BIOMED-2 PCR primers, we detected a high frequency of clonally rearranged TCR gamma and TCRB genes (17/20 and 15/20 cases, respectively). We carried out sequencing analysis of each complete clonal variable (V)beta-diversity (D)beta-joining(J)beta fingerprint generated by PCR amplification, and determined the primary structure of the Vbeta-Dbeta-Jbeta junctional regions. We observed considerable diversity in the T-cell receptor Vbeta gene usage and complementarity-determining region 3 loops. Although we found that TCRB gene usage in CTCL and normal individuals share common features, our analysis also revealed preferential usage of Jbeta1 genes in all cases with advanced stages of disease.

  11. Deletion and replacement of the mouse adult beta-globin genes by a "plug and socket" repeated targeting strategy.

    PubMed

    Detloff, P J; Lewis, J; John, S W; Shehee, W R; Langenbach, R; Maeda, N; Smithies, O

    1994-10-01

    We describe a two-step strategy to alter any mouse locus repeatedly and efficiently by direct positive selection. Using conventional targeting for the first step, a functional neo gene and a nonfunctional HPRT minigene (the "socket") are introduced into the genome of HPRT- embryonic stem (ES) cells close to the chosen locus, in this case the beta-globin locus. For the second step, a targeting construct (the "plug") that recombines homologously with the integrated socket and supplies the remaining portion of the HPRT minigene is used; this homologous recombination generates a functional HPRT gene and makes the ES cells hypoxanthine-aminopterin-thymidine resistant. At the same time, the plug provides DNA sequences that recombine homologously with sequences in the target locus and modifies them in the desired manner; the plug is designed so that correctly targeted cells also lose the neo gene and become G418 sensitive. We have used two different plugs to make alterations in the mouse beta-globin locus starting with the same socket-containing ES cell line. One plug deleted 20 kb of DNA containing the two adult beta-globin genes. The other replaced the same region with the human beta-globin gene containing the mutation responsible for sickle cell anemia.

  12. Cloning, expression, and catabolite repression of a gene encoding beta-galactosidase of Bacillus megaterium ATCC 14581.

    PubMed

    Shaw, G C; Kao, H S; Chiou, C Y

    1998-09-01

    A gene encoding beta-galactosidase, designated mbgA, was isolated from Bacillus megaterium ATCC 14581. Chromosomal beta-galactosidase production could be dramatically induced by lactose but not by isopropyl-beta-D-thiogalactopyranoside (IPTG) and was subject to catabolite repression by glucose. Disruption of mbgA in the B. megaterium chromosome resulted in loss of lactose-inducible beta-galactosidase production. A 27-bp inverted repeat was found to overlap the mbgA promoter sequence. Two partially overlapping catabolite-responsive elements (CREs) were identified within the inverted repeat. Base substitutions within CRE-I and/or CRE-II caused partial relief from catabolite repression. The results suggest that the 27-bp inverted repeat may serve as a target for a catabolite repressor(s). PMID:9721318

  13. Gene structure and chromosomal localization of the human HSD11K gene encoding the kidney (type 2) isozyme of 11{beta}-hydroxysteroid dehydrogenase

    SciTech Connect

    Agarwal, A.K.; Rogerson, F.M.; Mune, T.; White, P.C.

    1995-09-01

    11{beta}-hydroxysteroid dehydrogenase (11{beta}HSD) converts glucocorticoids to inactive products and is thus thought to confer specificity for aldosterone on the type I mineralocorticoid receptor in the kidney. Recent studies indicate the presence of at least two isozymes of 11{beta}HSD. In vitro, the NAD{sup +}-dependent kidney (type 2) isozyme catalyzes 11{beta}-dehydrogenase but not reductase reactions, whereas the NADP{sup +}-dependent liver (type 1) isozyme catalyzes both reactions. We have now characterized the human gene encoding kidney 11{beta}HSD (HSD11K). A bacteriophage P1 clone was isolated after screening a human genomic library by hybridization with sheep HSD11K cDNA. The gene consists of 5 exons spread over 6 kb. The nucleotide binding domain lies in the first exon are GC-rich (80%), suggesting that the gene may be transcriptionally regulated by factors that recognize GC-rich sequences. Fluorescence in situ hybridization of metaphase chromosomes with a positive P1 clone localized the gene to chromosome 16q22. In contrast, the HSD11L (liver isozyme) gene is located on chromosome 1 and contains 6 exons; the coding sequences of these genes are only 21% identical. HSD11K is expressed at high levels in the placenta and kidney of midgestation human fetuses and at lower levels in lung and testes. Different transcriptional start sites are utilized in kidney and placenta. These data should be applicable to genetic analysis of the syndrome of apparent mineralocorticoid excess, which may represent a deficiency of 11{beta}HSD. 25 refs., 5 figs.

  14. Evidence for beta1-adrenergic receptor involvement in amygdalar corticotropin-releasing factor gene expression: implications for cocaine withdrawal.

    PubMed

    Rudoy, Carla A; Reyes, Arith-Ruth S; Van Bockstaele, Elisabeth J

    2009-04-01

    We previously showed that betaxolol, a selective beta(1)-adrenergic receptor antagonist, administered during early phases of cocaine abstinence, ameliorated withdrawal-induced anxiety and blocked increases in amygdalar beta(1)-adrenergic receptor expression in rats. Here, we report the efficacy of betaxolol in reducing increases in gene expression of amygdalar corticotropin-releasing factor (CRF), a peptide known to be involved in mediating 'anxiety-like' behaviors during initial phases of cocaine abstinence. We also demonstrate attenuation of an amygdalar beta(1)-adrenergic receptor-mediated cell-signaling pathway following this treatment. Male rats were administered betaxolol at 24 and 44 h following chronic cocaine administration. Animals were euthanized at the 48-h time point and the amygdala was microdissected and processed for quantitative reverse transcriptase-polymerase chain reaction and/or western blot analysis. Results showed that betaxolol treatment during early cocaine withdrawal attenuated increases in amygdalar CRF gene expression and cyclic adenosine monophosphate-dependent protein kinase regulatory and catalytic subunit (nuclear fraction) protein expression. Our data also reveal that beta(1)-adrenergic receptors are on amygdalar neurons, which are immunoreactive for CRF. The present findings suggest that the efficacy of betaxolol treatment on cocaine withdrawal-induced anxiety may be related, in part, to its effect on amygdalar beta(1)-adrenergic receptor, modulation of its downstream cell-signaling elements and CRF gene expression.

  15. Transcriptional induction of the agp/ebp (c/ebp beta) gene by hepatocyte growth factor.

    PubMed

    Shen, B J; Chang, C J; Lee, H S; Tsai, W H; Miau, L H; Lee, S C

    1997-06-01

    Hepatocyte growth factor (HGF) is a pleiotropic factor with mitogenic, morphogenic, motogenic, cytotoxic, or growth inhibitory activity. Although the signaling of HGF is mediated through the cell membrane receptor c-Met, the molecular mechanism of downstream signal transduction remains obscure. In this report, we present evidence that shows HGF can stimulate the expression of AGP/EBP (C/EBP beta) and NF-kappaB, which are both key transcription factors responsible for the regulation of many genes under stress conditions or during the acute-phase response. Biochemical and functional analysis indicates that the HGF-responsive element is located in the region -376 to -352 (URE1) of the 5'-upstream regulatory sequence of agp/ebp. Activation of NF-kappaB by HGF was observed to precede the induction of agp/ebp. Further studies indicate that NF-kappaB can cooperate with AGP/EBP or other members of the C/EBP family to activate the agp/ebp gene in both URE1 and URE2-dependent manner. These results suggest that the induction of the agp/ebp gene by HGF is mediated at least in part by its activation of NF-kappaB. The activated NF-kappaB then interacts with AGP/EBP, resulting in the induction of agp/ebp.

  16. Identification of Leptospira serovars by RFLP of the RNA polymerase beta subunit gene (rpoB)

    PubMed Central

    Jung, Lenice Roteia Cardoso; Bomfim, Maria Rosa Quaresma; Kroon, Erna Geessien; Nunes, Álvaro Cantini

    2015-01-01

    Leptospires are usually classified by methods based on DNA-DNA hybridization and the conventional cross-agglutination absorption test, which uses polyclonal antibodies against lipopolysaccharides. In this study, the amplification of the rpoB gene, which encodes the beta-subunit of RNA polymerase, was used as an alternative tool to identify Leptospira. DNA extracts from sixty-eight serovars were obtained, and the hypervariable region located between 1990 and 2500-bp in the rpoB gene was amplified by polymerase chain reaction (PCR). The 600-bp amplicons of the rpoB gene were digested with the restriction endonucleases TaqI, Tru1I, Sau3AI and MslI, and the restriction fragments were separated by 6% polyacrylamide gel electrophoresis. Thirty-five fragment patters were obtained from the combined data of restriction fragment length polymorphism (PCR-RFLP) analysis and used to infer the phylogenetic relationships among the Leptospira species and serovars. The species assignments obtained were in full agreement with the established taxonomic classifications. Twenty-two serovars were effectively identified based on differences in their molecular profiles. However, the other 46 serovars remained clustered in groups that included more than one serovar of different species. This study demonstrates the value of RFLP analysis of PCR-amplified rpoB as an initial method for identifying Leptospira species and serovars. PMID:26273261

  17. Suppressors of trp1 fluorescence identify a new arabidopsis gene, TRP4, encoding the anthranilate synthase beta subunit.

    PubMed Central

    Niyogi, K K; Last, R L; Fink, G R; Keith, B

    1993-01-01

    Suppressors of the blue fluorescence phenotype of the Arabidopsis trp1-100 mutant can be used to identify mutations in genes involved in plant tryptophan biosynthesis. Two recessive suppressor mutations define a new gene, TRP4. The trp4 mutant and the trp1-100 mutant are morphologically normal and grow without tryptophan, whereas the trp4; trp1-100 double mutant requires tryptophan for growth. The trp4; trp1-100 double mutant does not segregate at expected frequencies in genetic crosses because of a female-specific defect in transmission of the double mutant genotype, suggesting a role for the tryptophan pathway in female gametophyte development. Genetic and biochemical evidence shows that trp4 mutants are defective in a gene encoding the beta subunit of anthranilate synthase (AS). Arabidopsis AS beta subunit genes were isolated by complementation of an Escherichia coli anthranilate synthase mutation. The trp4 mutation cosegregates with one of the genes, ASB1, located on chromosome 1. Sequence analysis of the ASB1 gene from trp4-1 and trp4-2 plants revealed different single base pair substitutions relative to the wild type. Anthranilate synthase alpha and beta subunit genes are regulated coordinately in response to bacterial pathogen infiltration. PMID:8400875

  18. Inhibition of bacterial cell wall-induced leukocyte recruitment and hepatic granuloma formation by TGF-beta gene transfer.

    PubMed

    Song, X; Zeng, L; Pilo, C M; Zagorski, J; Wahl, S M

    1999-10-01

    Intraperitoneal injection of streptococcal cell walls (SCW) into Lewis rats results in dissemination of SCW to the liver, spleen, bone marrow, and peripheral joints. The uptake of SCW by Kupffer cells in the liver initiates a chain of events largely mediated by T lymphocytes and macrophages. Local synthesis and secretion of cytokines and growth factors in response to the persistent SCW lead to the evolution and maintenance of a chronic T cell-dependent granulomatous response and result in granuloma formation and irreversible hepatic fibrosis. In an attempt to impede the development of the chronic granulomatous lesions in the liver, we injected a plasmid DNA encoding TGF-beta 1 i.m. to the SCW animals to determine the effect of TGF-beta 1 gene transfer on the course of liver inflammation and fibrosis. A single injection of plasmid DNA encoding TGF-beta 1 resulted in virtual abolition of the development of the SCW-induced hepatic granuloma formation and matrix expansion. TGF-beta 1 DNA not only reduced key proinflammatory cytokines including TNF-alpha, IL-1 beta, IFN-gamma, and IL-18, but also inhibited both CXC and CC chemokine production, thereby blocking inflammatory cell recruitment and accumulation in the liver. Moreover, TGF-beta 1 gene delivery inhibited its own expression in the liver tissue, which is otherwise up-regulated in SCW-injected animals. Our study suggests that TGF-beta 1 gene transfer suppresses hepatic granuloma formation by blocking the recruitment of inflammatory cells to the liver, and thus may provide a new approach to the control of hepatic granulomatous and fibrotic diseases. PMID:10491005

  19. Live Borrelia burgdorferi preferentially activate interleukin-1 beta gene expression and protein synthesis over the interleukin-1 receptor antagonist.

    PubMed Central

    Miller, L C; Isa, S; Vannier, E; Georgilis, K; Steere, A C; Dinarello, C A

    1992-01-01

    Lyme arthritis is one of the few forms of chronic arthritis in which the cause is known with certainty. Because cytokines are thought to contribute to the pathogenesis of chronic arthritis, we investigated the effect of the Lyme disease spirochete, Borrelia burgdorferi, on the gene expression and synthesis of IL-1 beta and the IL-1 receptor antagonist (IL-1ra) in human peripheral blood mononuclear cells. Live B. burgdorferi induced fivefold more IL-1 beta than IL-1 alpha and sevenfold more IL-1 beta than IL-1ra; LPS or sonicated B. burgdorferi induced similar amounts of all three cytokines. This preferential induction of IL-1 beta was most dramatic in response to a low passage, virulent preparation of B. burgdorferi vs. three high passage avirulent strains. No difference in induction of IL-1ra was seen between these strains. The marked induction of IL-1 beta was partially diminished by heat-treatment and abrogated by sonication; IL-1ra was not affected. This suggested that a membrane component(s) accounted for the preferential induction of IL-1 beta. However, recombinant outer surface protein beta induced little IL-1 beta. By 4 h after stimulation, B. burgdorferi induced sixfold more IL-1 beta protein than LPS. In contrast to LPS-induced IL-1 beta mRNA which reached maximal accumulation after 3 h, B. burgdorferi-induced IL-1 beta mRNA showed biphasic elevations at 3 and 18 h. B. burgdorferi-induced IL-1ra mRNA peaked at 12 h, whereas LPS-induced IL-1ra mRNA peaked at 9 h. IL-1 beta synthesis increased in response to increasing numbers of spirochetes, whereas IL-1ra synthesis did not. The preferential induction by B. burgdorferi of IL-1 beta over IL-1ra is an example of excess agonist over antagonist synthesis induced by a microbial pathogen, and may contribute to the destructive lesion of Lyme arthritis. Images PMID:1387885

  20. Human beta-globin gene polymorphisms characterized in DNA extracted from ancient bones 12,000 years old.

    PubMed Central

    Béraud-Colomb, E; Roubin, R; Martin, J; Maroc, N; Gardeisen, A; Trabuchet, G; Goosséns, M

    1995-01-01

    Analyzing the nuclear DNA from ancient human bones is an essential step to the understanding of genetic diversity in current populations, provided that such systematic studies are experimentally feasible. This article reports the successful extraction and amplification of nuclear DNA from the beta-globin region from 5 of 10 bone specimens up to 12,000 years old. These have been typed for beta-globin frameworks by sequencing through two variable positions and for a polymorphic (AT) chi (T) gamma microsatellite 500 bp upstream of the beta-globin gene. These specimens of human remains are somewhat older than those analyzed in previous nuclear gene sequencing reports and considerably older than those used to study high-copy-number human mtDNA. These results show that the systematic study of nuclear DNA polymorphisms of ancient populations is feasible. Images Figure 2 Figure 3 PMID:8533755

  1. Early peroxisome proliferator-activated receptor gamma regulated genes involved in expansion of pancreatic beta cell mass

    PubMed Central

    2011-01-01

    Background The progression towards type 2 diabetes depends on the allostatic response of pancreatic beta cells to synthesise and secrete enough insulin to compensate for insulin resistance. The endocrine pancreas is a plastic tissue able to expand or regress in response to the requirements imposed by physiological and pathophysiological states associated to insulin resistance such as pregnancy, obesity or ageing, but the mechanisms mediating beta cell mass expansion in these scenarios are not well defined. We have recently shown that ob/ob mice with genetic ablation of PPARγ2, a mouse model known as the POKO mouse failed to expand its beta cell mass. This phenotype contrasted with the appropriate expansion of the beta cell mass observed in their obese littermate ob/ob mice. Thus, comparison of these models islets particularly at early ages could provide some new insights on early PPARγ dependent transcriptional responses involved in the process of beta cell mass expansion Results Here we have investigated PPARγ dependent transcriptional responses occurring during the early stages of beta cell adaptation to insulin resistance in wild type, ob/ob, PPARγ2 KO and POKO mice. We have identified genes known to regulate both the rate of proliferation and the survival signals of beta cells. Moreover we have also identified new pathways induced in ob/ob islets that remained unchanged in POKO islets, suggesting an important role for PPARγ in maintenance/activation of mechanisms essential for the continued function of the beta cell. Conclusions Our data suggest that the expansion of beta cell mass observed in ob/ob islets is associated with the activation of an immune response that fails to occur in POKO islets. We have also indentified other PPARγ dependent differentially regulated pathways including cholesterol biosynthesis, apoptosis through TGF-β signaling and decreased oxidative phosphorylation. PMID:22208362

  2. [The ht-PAm cDNA knock-in the goat beta-casein gene locus].

    PubMed

    Shen, Wei; Yang, Zheng-Tian; Tian, Li-Yuan; Wu, Xiao-Jie; Chen, Hong; Huang, Pei-Tang; Deng, Ji-Xian

    2004-05-01

    The production of recombinant protein is one of the major successes of biotechnology, animal cells are required to synthesize proteins with the appropriate post-translational modifications. Transgenic animal mammary gland bioreactor are being used for this purpose. Gene targeting is a more powerful method to produce mammary gland bioreactor, and nuclear transfer from cultured somatic cells provides an wonderful means of cell-mediated transgensis. Here we describe efficient and reproducible gene targeting in goat fetal fibroblasts to place the human tissue plasminogen activator mutant (ht-PAm) cDNA at the beta-casein locus, and would produce the transgenic goat by nuclear transfer. To construct the gene targeting vector pGBC4tPA, the milk goat beta-casein genomic DNA sequence for homologous arms had been cloned firstly. The left arm was 6.3 kb fragment including goat beta-casein gene 5' flanking sequence, and the right arm was 2.4 kb fragement including beta-casein gene from exon 8 to exon 9. The ht-PAm cDNA was subcloned in the goat beta-casein gene exon 2, and the endogenous start condon was replaced by that of ht-PAm. The bacterial neomycin (neo) gene as positive selection marker gene, was placed in the beta-casein gene intron 7, the thymidine kinase (tk) as the negative selection marker gene, was just outside the right arm. The validity of the positive-negative selection vector (PNS), was tested, and targeting homologous recombination (HR) were elevated to 5-fold with the negative selection marker using the drug GANC. The DNA fragment in which two LoxP sequence was delected effectively using Cre recombinase in vitro. Goat fetal fibroblasts were thawed and cultured to subconfluence before transfection, about 10(7) fibroblasts were electoporated at 240V, 600 microF in 0.8 mL PBS buffer containing linear pGBC4tPA. transfected cells were cultured in collagen-coated 96-wellplate for 24h without selection, then added the drug G418 (600 microg/mL) and GANC (2 micromol

  3. Expression of two CYP1A genes in {beta}NF and TCDD-treated rainbow trout primary hepatocyte culture

    SciTech Connect

    Rabergh, C.M.; Lipsky, M.M.; Vroliijk, N.H.; Chen, T.T.

    1995-12-31

    In mammalian systems, it is well known that two CYP1A genes are expressed in response to environmental toxicants such as polycyclic aromatic hydrocarbons (PAHs) and TCDD (2,3,7,3-tetrachlorodibenzo-p-dioxin). The presence of two CYP1A genes in fish has been previously reported, though expression of these two genes has not been characterized. In this study, the authors examined the expression of these two genes in primary culture of rainbow trout hepatocytes treated with {beta}NF and TCDD. Hepatocytes were isolated by a modified two-step collagenase perfusion of the liver and cultured on polylysine coated dishes. The optimum time and concentration of induction was determined for both chemicals. The expression of the genes was also studied in long-term cultures up to 20 days. RNA was isolated by the method of Chomzynski and Sacchi and the RNase protection assay was used to detect the expression of the CYP1A genes by using antisense riboprobes specific for the MRNA of each gene. A differential concentration- and time-dependent expression of the two genes was observed in cells treated with {beta}NF and TCDD. Whether these two genes are paralogous, i.e., produced by gene duplication within the species, or whether one of them may in fact be an orthologue to a mammalian counterpart within the CYP1A family, remains to be determined.

  4. Chicken beta B1-crystallin gene expression: presence of conserved functional polyomavirus enhancer-like and octamer binding-like promoter elements found in non-lens genes.

    PubMed Central

    Roth, H J; Das, G C; Piatigorsky, J

    1991-01-01

    Expression of the chicken beta B1-crystallin gene was examined. Northern (RNA) blot and primer extension analyses showed that while abundant in the lens, the beta B1 mRNA is absent from the liver, brain, heart, skeletal muscle, and fibroblasts of the chicken embryo, suggesting lens specificity. Promoter fragments ranging from 434 to 126 bp of 5'-flanking sequence (plus 30 bp of exon 1) of the beta B1 gene fused to the bacterial chloramphenicol acetyltransferase gene functioned much more efficiently in transfected embryonic chicken lens epithelial cells than in transfected primary muscle fibroblasts or HeLa cells. Transient expression of recombinant plasmids in cultured lens cells, DNase I footprinting, in vitro transcription in a HeLa cell extract, and gel mobility shift assays were used to identify putative functional promoter elements of the beta B1-crystallin gene. Sequence analysis revealed a number of potential regulatory elements between positions -126 and -53 of the beta B1 promoter, including two Sp1 sites, two octamer binding sequence-like sites (OL-1 and OL-2), and two polyomavirus enhancer-like sites (PL-1 and PL-2). Deletion and site-specific mutation experiments established the functional importance of PL-1 (-116 to -102), PL-2 (-90 to -76), and OL-2 (-75 to -68). DNase I footprinting using a lens or a HeLa cell nuclear extract and gel mobility shifts using a lens nuclear extract indicated the presence of putative lens transcription factors binding to these DNA sequences. Competition experiments provided evidence that PL-1 and PL-2 recognize the same or very similar factors, while OL-2 recognizes a different factor. Our data suggest that the same or closely related transcription factors found in many tissues are used for expression of the chicken beta B1-crystallin gene in the lens. Images PMID:1996106

  5. Regulatory elements and structural features of Beta vulgaris polygalacturonase-inhibiting protein gene for fungal and pest control

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polygalacturonase-inhibiting proteins (PGIPs) are involved in plant defense. PGIPs are cell wall leucine-rich repeat (LRR) proteins that are known to inhibit pathogen and pest polygalacturonases (PGs) during the infection process. Several sugar beet (Beta vulgaris L.) PGIP genes (BvPGIP) were clon...

  6. An ancient repeat sequence in the ATP synthase beta-subunit gene of forcipulate sea stars.

    PubMed

    Foltz, David W

    2007-11-01

    A novel repeat sequence with a conserved secondary structure is described from two nonadjacent introns of the ATP synthase beta-subunit gene in sea stars of the order Forcipulatida (Echinodermata: Asteroidea). The repeat is present in both introns of all forcipulate sea stars examined, which suggests that it is an ancient feature of this gene (with an approximate age of 200 Mya). Both stem and loop regions show high levels of sequence constraint when compared to flanking nonrepetitive intronic regions. The repeat was also detected in (1) the family Pterasteridae, order Velatida and (2) the family Korethrasteridae, order Velatida. The repeat was not detected in (1) the family Echinasteridae, order Spinulosida, (2) the family Astropectinidae, order Paxillosida, (3) the family Solasteridae, order Velatida, or (4) the family Goniasteridae, order Valvatida. The repeat lacks similarity to published sequences in unrestricted GenBank searches, and there are no significant open reading frames in the repeat or in the flanking intron sequences. Comparison via parametric bootstrapping to a published phylogeny based on 4.2 kb of nuclear and mitochondrial sequence for a subset of these species allowed the null hypothesis of a congruent phylogeny to be rejected for each repeat, when compared separately to the published phylogeny. In contrast, the flanking nonrepetitive sequences in each intron yielded separate phylogenies that were each congruent with the published phylogeny. In four species, the repeat in one or both introns has apparently experienced gene conversion. The two introns also show a correlated pattern of nucleotide substitutions, even after excluding the putative cases of gene conversion.

  7. Transcriptional control of expression of fungal beta-lactam biosynthesis genes.

    PubMed

    Litzka, O; Then Bergh, K; Van den Brulle, J; Steidl, S; Brakhage, A A

    1999-01-01

    The most commonly used beta-lactam antibiotics for the therapy of infectious diseases are penicillin and cephalosporin. Penicillin is produced as end product by some fungi most notably by Aspergillus (Emericella) nidulans and Penicillium chrysogenum. Cephalosporins are synthesised by several bacteria and fungi, e.g. by the fungus Acremonium chrysogenum (syn. Cephalosporium acremonium). The biosynthetic pathways leading to both secondary metabolites start from the same three amino acid precursors and have the first two enzymatic reactions in common. The penicillin biosynthesis is catalysed by three enzymes encoded by acvA (pcbAB), ipnA (pcbC) and aatA (penDE). The genes are organised into a cluster. In A. chrysogenum, in addition to acvA and ipnA, which are also clustered, a second cluster contains the genes for enzymes catalysing the reactions of the later steps of the cephalosporin pathway (cefEF, cefG). Transcription of biosynthesis genes is subject to sophisticated control by nutritional factors (e.g. glucose, nitrogen), amino acids such as lysine and methionine, and ambient pH. Some regulators have been identified such as the A. nidulans pH regulatory protein PACC and the transcriptional complex PENR1. PENR1 is a HAP-like transcriptional complex similar or identical to AnCF. Additional positive regulatory factors seem to be represented by recessive trans-acting mutations of A. nidulans (prgA1, prgB1, npeE1) and P. chrysogenum (carried by mutants Npe2 and Npe3). The GATA-binding factor NRE appears to be involved in the regulation of the penicillin biosynthesis genes by the nitrogen source in P. chrysogenum. Formal genetic evidence suggests the existence of transcriptional repressors as well.

  8. Identification of a Novel Single Nucleotide Polymorphism in Porcine Beta-Defensin-1 Gene.

    PubMed

    Pruthviraj, D R; Usha, A P; Venkatachalapathy, R T

    2016-03-01

    Porcine beta-defensin-1 (PBD-1) gene plays an important role in the innate immunity of pigs. The peptide encoded by this gene is an antimicrobial peptide that has direct activity against a wide range of microbes. This peptide is involved in the co-creation of an antimicrobial barrier in the oral cavity of pigs. The objective of the present study was to detect polymorphisms, if any, in exon-1 and exon-2 regions of PBD-1 gene in Large White Yorkshire (LWY) and native Ankamali pigs of Kerala, India. Blood samples were collected from 100 pigs and genomic DNA was isolated using phenol chloroform method. The quantity of DNA was assessed in a spectrophotometer and quality by gel electrophoresis. Exon-1 and exon-2 regions of PBD-1 gene were amplified by polymerase chain reaction (PCR) and the products were subjected to single strand conformation polymorphism (SSCP) analysis. Subsequent silver staining of the polyacrylamide gels revealed three unique SSCP banding patterns in each of the two exons. The presence of single nucleotide polymorphisms (SNPs) was confirmed by nucleotide sequencing of the PCR products. A novel SNP was found in the 5'-UTR region of exon-1 and a SNP was detected in the mature peptide coding region of exon-2. In exon-1, the pooled population frequencies of GG, GT, and TT genotypes were 0.67, 0.30, and 0.03, respectively. GG genotype was predominant in both the breeds whereas TT genotype was not detected in LWY breed. Similarly, in exon-2, the pooled population frequencies of AA, AG, and GG genotypes were 0.50, 0.27, and 0.23, respectively. AA genotype was predominant in LWY pigs whereas GG genotype was predominant in native pigs. These results suggest that there exists a considerable genetic variation at PBD-1 locus and further association studies may help in development of a PCR based genotyping test to select pigs with better immunity. PMID:26950860

  9. The expression of pregnancy-specific {beta}1-glycoprotein genes in Meckel-Gruber syndrome fibroblasts

    SciTech Connect

    Wu, Shao-Ming; Cham, Wai-Yee

    1994-09-01

    Meckel-Gruber syndrome (MS) is an autosomal recessive disorder with multiple congenital malformations. The only available prenatal diagnostic marker for this disorder is the amniotic fluid level of pregnancy-specific {beta}1-glycoprotein (PSG). PSG is a family of proteins which are expressed at high levels during pregnancy. Increasing maternal serum PSG levels correlate with the progression of pregnancy and can be used as indicators for pregnancy outcome and fetal well-being. The amniotic fluid PSG level is about one-tenth of that of the maternal serum level in normal pregnancy, but are elevated in all cases of MS examined so far. On the other hand, the maternal serum PSG level and third trimester placental PSG content are normal in most cases of MS. This study aims at comparing the expression of PSG in fibroblasts derived from a fetus afflicted with MS. Total cellular RNA was extracted from two MS cultured fibroblast lines (M3206 and GM7817) and four age- and sex-matched control fibroblast lines obtained from the Human Genetic Mutant Cell Repository, Camden, NJ. The expression of eight PSG genes namely, PSG1, PSG2, PSG3, PSG4, PSG5, PSG6, PSG9 and PSG11, were examined with reverse transcription-polymerase chain reaction (RT-PCR). All PSG transcripts present in the cell were first amplified using universal primers in a 28-cycle PCR. Specific PSG gene products were then amplified with PSG gene-specific primers. Results showed that there is no significant difference in PSG expression between control and disease fibroblasts. In both cases, the most abundant transcript was the type II transcript of PSG5 followed by the type I transcripts of PSG1 and PG4. PSG9, PSG11 and PSG 3 were expressed at very low levels or not expressed at all in MS as well as in normal control fibroblasts. These results showed that PSG gene expression was not altered in MS fibroblasts.

  10. Identification of a Novel Single Nucleotide Polymorphism in Porcine Beta-Defensin-1 Gene.

    PubMed

    Pruthviraj, D R; Usha, A P; Venkatachalapathy, R T

    2016-03-01

    Porcine beta-defensin-1 (PBD-1) gene plays an important role in the innate immunity of pigs. The peptide encoded by this gene is an antimicrobial peptide that has direct activity against a wide range of microbes. This peptide is involved in the co-creation of an antimicrobial barrier in the oral cavity of pigs. The objective of the present study was to detect polymorphisms, if any, in exon-1 and exon-2 regions of PBD-1 gene in Large White Yorkshire (LWY) and native Ankamali pigs of Kerala, India. Blood samples were collected from 100 pigs and genomic DNA was isolated using phenol chloroform method. The quantity of DNA was assessed in a spectrophotometer and quality by gel electrophoresis. Exon-1 and exon-2 regions of PBD-1 gene were amplified by polymerase chain reaction (PCR) and the products were subjected to single strand conformation polymorphism (SSCP) analysis. Subsequent silver staining of the polyacrylamide gels revealed three unique SSCP banding patterns in each of the two exons. The presence of single nucleotide polymorphisms (SNPs) was confirmed by nucleotide sequencing of the PCR products. A novel SNP was found in the 5'-UTR region of exon-1 and a SNP was detected in the mature peptide coding region of exon-2. In exon-1, the pooled population frequencies of GG, GT, and TT genotypes were 0.67, 0.30, and 0.03, respectively. GG genotype was predominant in both the breeds whereas TT genotype was not detected in LWY breed. Similarly, in exon-2, the pooled population frequencies of AA, AG, and GG genotypes were 0.50, 0.27, and 0.23, respectively. AA genotype was predominant in LWY pigs whereas GG genotype was predominant in native pigs. These results suggest that there exists a considerable genetic variation at PBD-1 locus and further association studies may help in development of a PCR based genotyping test to select pigs with better immunity.

  11. Identification of a Novel Single Nucleotide Polymorphism in Porcine Beta-Defensin-1 Gene

    PubMed Central

    Pruthviraj, D. R.; Usha, A. P.; Venkatachalapathy, R. T.

    2016-01-01

    Porcine beta-defensin-1 (PBD-1) gene plays an important role in the innate immunity of pigs. The peptide encoded by this gene is an antimicrobial peptide that has direct activity against a wide range of microbes. This peptide is involved in the co-creation of an antimicrobial barrier in the oral cavity of pigs. The objective of the present study was to detect polymorphisms, if any, in exon-1 and exon-2 regions of PBD-1 gene in Large White Yorkshire (LWY) and native Ankamali pigs of Kerala, India. Blood samples were collected from 100 pigs and genomic DNA was isolated using phenol chloroform method. The quantity of DNA was assessed in a spectrophotometer and quality by gel electrophoresis. Exon-1 and exon-2 regions of PBD-1 gene were amplified by polymerase chain reaction (PCR) and the products were subjected to single strand conformation polymorphism (SSCP) analysis. Subsequent silver staining of the polyacrylamide gels revealed three unique SSCP banding patterns in each of the two exons. The presence of single nucleotide polymorphisms (SNPs) was confirmed by nucleotide sequencing of the PCR products. A novel SNP was found in the 5′-UTR region of exon-1 and a SNP was detected in the mature peptide coding region of exon-2. In exon-1, the pooled population frequencies of GG, GT, and TT genotypes were 0.67, 0.30, and 0.03, respectively. GG genotype was predominant in both the breeds whereas TT genotype was not detected in LWY breed. Similarly, in exon-2, the pooled population frequencies of AA, AG, and GG genotypes were 0.50, 0.27, and 0.23, respectively. AA genotype was predominant in LWY pigs whereas GG genotype was predominant in native pigs. These results suggest that there exists a considerable genetic variation at PBD-1 locus and further association studies may help in development of a PCR based genotyping test to select pigs with better immunity. PMID:26950860

  12. Targeting the exogenous htPAm gene on goat somatic cell beta-casein locus for transgenic goat production.

    PubMed

    Shen, Wei; Lan, Guocheng; Yang, Xueyi; Li, Lan; Min, Lingjiang; Yang, Zhengtian; Tian, Liyuan; Wu, Xiaojie; Sun, Yujiang; Chen, Hong; Tan, Jinghe; Deng, Jixian; Pan, Qingjie

    2007-04-01

    Combining gene targeting of animal somatic cells with nuclear transfer technique has provided a powerful method to produce transgenic animal mammary gland bioreactor. The objective of this study is to make an efficient and reproducible gene targeting in goat fetal fibroblasts by inserting the exogenous htPAm cDNA into the beta-casein locus with liposomes or electroporation so that htPAm protein might be produced in gene-targeted goat mammary gland. By gene-targeting technique, the exogenous htPAm gene was inserted to milk goat beta-casein gene sequences. Fetal fibroblasts were isolated from Day 35 fetuses of Guanzhong milk goats, and transfected with linear gene-targeting vector pGBC4htPAm using Lipefectamin-2000 and electoporation, respectively. Forty-eight gene-targeted cell colonies with homologous recombination were obtained, and three cell colonies were verified by DNA sequence analysis within the homologous recombination region. Using gene-targeted cell lines as donor cells for nuclear transfer, a total of 600 reconstructed embryos had been obtained, and 146 developed cloned embryos were transferred to 16 recipient goats, and finally three goats showed pregnancy at Day 90.

  13. Gene Expression Profiles of Beta-Cell Enriched Tissue Obtained by Laser Capture Microdissection from Subjects with Type 2 Diabetes

    PubMed Central

    Marselli, Lorella; Thorne, Jeffrey; Dahiya, Sonika; Sgroi, Dennis C.; Sharma, Arun; Bonner-Weir, Susan; Marchetti, Piero; Weir, Gordon C.

    2010-01-01

    Background Changes in gene expression in pancreatic beta-cells from type 2 diabetes (T2D) should provide insights into their abnormal insulin secretion and turnover. Methodology/Principal Findings Frozen sections were obtained from cadaver pancreases of 10 control and 10 T2D human subjects. Beta-cell enriched samples were obtained by laser capture microdissection (LCM). RNA was extracted, amplified and subjected to microarray analysis. Further analysis was performed with DNA-Chip Analyzer (dChip) and Gene Set Enrichment Analysis (GSEA) software. There were changes in expression of genes linked to glucotoxicity. Evidence of oxidative stress was provided by upregulation of several metallothionein genes. There were few changes in the major genes associated with cell cycle, apoptosis or endoplasmic reticulum stress. There was differential expression of genes associated with pancreatic regeneration, most notably upregulation of members of the regenerating islet gene (REG) family and metalloproteinase 7 (MMP7). Some of the genes found in GWAS studies to be related to T2D were also found to be differentially expressed. IGF2BP2, TSPAN8, and HNF1B (TCF2) were upregulated while JAZF1 and SLC30A8 were downregulated. Conclusions/Significance This study made possible by LCM has identified many novel changes in gene expression that enhance understanding of the pathogenesis of T2D. PMID:20644627

  14. Beta2-Adrenergic Receptor Gene Polymorphisms as Systemic Determinants of Healthy Aging in an Evolutionary Context

    PubMed Central

    Kulminski, Alexander M.; Culminskaya, Irina V.; Ukraintseva, Svetlana V.; Arbeev, Konstantin G.; Land, Kenneth C.; Yashin, Anatoli I.

    2010-01-01

    The Gln27Glu polymorphism but not the Arg16Gly polymorphism of the beta2-adrenergic receptor (ADRB2) gene appears to be associated with a broad range of aging-associated phenotypes, including cancers at different sites, myocardial infarction (MI), intermittent claudication (IC), and overall/healthy longevity in the Framingham Heart Study Offspring cohort. The Gln27Gln genotype increases risks of cancer, MI and IC, whereas the Glu27 allele or, equivalently, the Gly16Glu27 haplotype tends to be protective against these diseases. Genetic associations with longevity are of opposite nature at young-old and oldest-old ages highlighting the phenomenon of antagonistic pleiotropy. The mechanism of antagonistic pleiotropy is associated with an evolutionary-driven advantage of carriers of a derived Gln27 allele at younger ages and their survival disadvantage at older ages as a result of increased risks of cancer, MI and IC. The ADRB2 gene can play an important systemic role in healthy aging in evolutionary context that warrants exploration in other populations. PMID:20399803

  15. Association of beta 2 adrenoceptor gene polymorphisms in Malaysian hypertensive subjects.

    PubMed

    Komara, M; Vasudevan, R; Ismail, P; Bakar, S A; Pishva, S R; Heidari, F

    2014-04-16

    The sympathetic nervous system plays a major role in blood pressure regulation. Beta 2 (β2) adrenoceptor gene polymorphisms have been associated with hypertension in different populations with conflicting results. We examined the association of three common polymorphisms, Arg16Gly, Gln27Glu, and Thr164Ile, of the β2 adrenoceptor gene in Malaysian hypertensive subjects. A total of 160 hypertensive and control subjects were recruited. Systolic blood pressure (SBP), diastolic blood pressure (DBP), and anthropometric measurements were obtained from each subject. Biochemical analyses of lipid profiles were conducted with an autoanalyzer. DNA samples were extracted from blood and buccal cells. Genotyping was accomplished with polymerase chain reaction-restriction fragment length polymorphism. SBP, DBP, body mass index, and biochemical factors all differed significantly between case and control subjects (P < 0.05). The genotype frequencies of Arg16Arg, Arg16Gly, and Gly16Gly were 22.5, 70, and 7.5% among cases and 33.1, 63.1, and 3.8% among controls, respectively. The genotype frequencies of Gln27Gln, Gln27Glu, and Glu27Glu among cases were 41.1, 50, and 1.9% compared to 77.5, 20.6, and 1.9% among controls, respectively. In this study, the Gln27Glu polymorphism was significantly associated with Malaysian hypertensive subjects (P < 0.05). Therefore, the Gln27Glu polymorphism of the β2 adrenoceptor could be a risk factor associated with hypertension among Malaysians.

  16. Glomerular expression of interleukin-1 receptor antagonist and interleukin-1 beta genes in antibody-mediated glomerulonephritis.

    PubMed Central

    Tam, F. W.; Smith, J.; Cashman, S. J.; Wang, Y.; Thompson, E. M.; Rees, A. J.

    1994-01-01

    Interleukin-1 (IL-1) is a powerful proinflammatory cytokine whose function is modulated by a natural IL-1 receptor antagonist (IL-1ra). There are few data about kinetics of in vivo synthesis of IL-1ra at tissue level, except in response to bacterial endotoxin. The purpose of this study was to examine the kinetics of local expression of IL-1ra gene in relation to IL-1 beta gene in a model of anti-glomerular basement membrane antibody-mediated glomerulonephritis. Rats were killed in groups of 5 or 6 at 0, 4, 6, 24, 48, and 96 hours after induction of glomerulonephritis. Messenger RNA for IL-1ra and IL-1 beta was undetectable by Northern blot in normal glomeruli but increased markedly 4 to 6 hours after induction of nephritis. The increase in IL-1ra mRNA was more sustained than that of IL-1 beta mRNA. In situ hybridization showed that IL-1 beta mRNA increased diffusely within glomeruli, while IL-1ra mRNA was expressed more discretely. Expression of these mRNA in noninflamed tissues, spleens and lungs, was different, particularly increase in IL-1ra mRNA was more substantial than that of IL-1 beta. These observations suggest that differential expression of IL-1ra and IL-1 beta might focus inflammation in glomeruli while protecting more distant sites. They also raise the possibility of reducing glomerular injury by therapeutic measures that upregulate glomerular synthesis of IL-1ra while reducing that of IL-1 beta. Images Figure 1 Figure 2 Figure 4 Figure 5 PMID:8030744

  17. A genetic linkage map of mouse chromosome 2 extending from thrombospondin to paired box gene 1, including the H3 minor histocompatibility complex

    SciTech Connect

    Zuberi, A.R.; Nguyen, H.Q.; Auman, H.J.

    1996-04-01

    The classical minor histocompatibility 3(H3) locus was originally defined by the phenotype of skin graft rejection, which is complex genetic trait. H3 is now known to be a gene complex comprised of a minimum of two functionally interdependent alloantigen-encoding loci, H3a and H3b. H3a encodes a peptide recognized by cytotoxic T cells, and H3b encodes a peptide that stimulates helper T cells. The H3 complex also contains the {beta}{sub 2}-microglobulin gene (B2m), and polymorphisms in B2m contribute to the tissue rejection phenotype. We describe a high-density genetic linkage map of a 16-cM region of mouse Chromosome 2 from thromospondin (Thbs1) to paired box gene 1 (Pax1). This genetic map includes H3a, H3b, and B2m. Other genes and anonymous loci have also been placed on the map. H3a maps between D2Mit444 and B2m in close vicinity to several known genes. H3b maps 12 cM distal to H3a, and the proprotein convertase subtilisin/kexin type 2 gene (Pcsk2; formerly Nec2) cosegregates with H3b in a high-resolution backcross panel. The H3 complex spans a region that shows conserved synteny to human chromosomes 15q, 2q, and 20p. 59 refs., 4 figs., 1 tab.

  18. Involvement of the ubiquitous Oct-1 transcription factor in hormonal induction of beta-casein gene expression.

    PubMed

    Dong, Bing; Zhao, Feng-Qi

    2007-01-01

    Transcription of the milk protein beta-casein gene is induced by the lactogenic hormones Prl (prolactin) and glucocorticoids. Multiple transcription factors involved in this induction have been identified, including the STAT5 (signal transducer and activator of transcription 5) and the GR (glucocorticoid receptor). Our previous studies have identified a binding site for the ubiquitous Oct-1 (octamer-binding transcription factor 1) protein in the lactogenic hormonal regulatory region of the mouse beta-casein promoter. In the present study, we report that Oct-1 is indeed expressed and binds to the beta-casein promoter in mammary epithelial cells. Oct-1 activates hormonally induced beta-casein promoter activity in a dose-dependent manner. Hormonal induction of promoter activity was decreased not only by mutating the Oct-1-binding site from ATTAGCAT to GCTAGCAT, which abolishes Oct-1 binding (50% decrease, P<0.01), but also by changing the site to the consensus Oct-1-binding motif ATTTGCAT (40% decrease, P<0.01). Reversing the Oct-1-binding site reduced hormonal induction by 70% (P<0.01), showing that orientation of Oct-1 binding is also critical in hormonal action. In transient transfection experiments, Oct-1 collaboratively transactivated the beta-casein gene promoter with STAT5 and/or GR in the presence of Prl receptor in cells treated with the lactogenic hormones. The C-terminus of Oct-1 was not essential to its function. The results of the present study provide biochemical evidence that the ubiquitous Oct-1 transcription factor may be involved in hormonally regulated, tissue-specific beta-casein gene expression.

  19. cDNA sequence and mapping of the mouse Copb gene encoding the beta subunit of the COPI coatomer complex.

    PubMed

    LI, W; Elliott, R W; Novak, E K; Swank, R T

    1999-05-01

    COPI-coated vesicles are involved in retrograde-directed selective transport of proteins from the Golgi complex to the endoplasmic reticulum (ER) as well as mediate anterograde transport of cargo proteins within the Golgi or in endosomal trafficking. The COPI protein complex contains an ADP-ribosylation factor (ARF1) and seven coatamer subunits (alpha, beta, beta', gamma, delta, epsilon, zeta-COP). The localization and function of human beta subunit of coatamer (COPB) suggests it is likely a candidate gene of ruby-eye-2 (ru2), which is a mouse model of human Hermansky-Pudlak syndrome characterized by the dysfunction of several subcellular organelles. In this study, we determined the entire coding sequence of mouse (Copb) cDNA by combining an overlapping mouse EST contig with EST walking. beta-COP was found highly conserved in mouse, rat, and human, and it is ubiquitously expressed in mouse. The Copb gene was mapped to mouse Chr 7 at a position of 53.3 cM by radiation hybrid mapping. Our RH mapping data, sequencing of RT-PCR products, and Western blotting exclude the Copb gene as a candidate for ru2.

  20. Quantitative response relationships between degradation rates and functional genes during the degradation of beta-cypermethrin in soil.

    PubMed

    Yang, Zhong-Hua; Ji, Guo-Dong

    2015-12-15

    In the present study, the degradation mechanisms of beta-cypermethrin and its metabolites in soil were explored through the quantitative response relationships between the degradation rates and related functional genes. We found that the degradation rate of beta-cypermethrin was rapid in unsterilized soil but not in sterilized soil, which indicated that the degradation process is microbially based. Moreover, three metabolites (3-phenoxybenzoic acid, phenol and protocatechuic acid) were detected during the degradation process and used to identify the degradation pathway and functional genes related to the degradation process. The key rate-limiting functional genes were pytH and pobA, and the relative contributions of these genes to the degradation process were examined with a path analysis. The path analysis revealed that the genes pobA and pytH had the greatest direct effects on the degradation of beta-cypermethrin (pobA), alpha-cypermethrin (pobA), theta-cypermethrin (pytH) and 3-phenoxybenzoic acid (pytH).

  1. Pest protection conferred by a Beta vulgaris serine proteinase inhibitor gene.

    PubMed

    Smigocki, Ann C; Ivic-Haymes, Snezana; Li, Haiyan; Savić, Jelena

    2013-01-01

    Proteinase inhibitors provide a means of engineering plant resistance to insect pests. A Beta vulgaris serine proteinase inhibitor gene (BvSTI) was fused to the constitutive CaMV35S promoter for over-expression in Nicotiana benthamiana plants to study its effect on lepidopteran insect pests. Independently derived BvSTI transgenic tobacco T2 homozygous progeny were shown to have relatively high BvSTI gene transcript levels. BvSTI-specific polyclonal antibodies cross-reacted with the expected 30 kDA recombinant BvSTI protein on Western blots. In gel trypsin inhibitor activity assays revealed a major clear zone that corresponded to the BvSTI proteinase inhibitor that was not detected in the untransformed control plants. BvSTI-transgenic plants were bioassayed for resistance to five lepidopteran insect pests. Spodoptera frugiperda, S. exigua and Manduca sexta larvae fed BvSTI leaves had significant reductions in larval weights as compared to larvae fed on untransformed leaves. In contrast, larval weights increased relative to the controls when Heliothis virescens and Agrotis ipsilon larvae were fed on BvSTI leaves. As the larvae entered the pupal stage, pupal sizes reflected the overall larval weights. Some developmental abnormalities of the pupae and emerging moths were noted. These findings suggest that the sugar beet BvSTI gene may prove useful for effective control of several different lepidopteran insect pests in genetically modified tobacco and other plants. The sugar beet serine proteinase inhibitor may be more effective for insect control because sugar beet is cropped in restricted geographical areas thus limiting the exposure of the insects to sugar beet proteinase inhibitors and build up of non-sensitive midgut proteases.

  2. Baseline Gene Expression Signatures in Monocytes from Multiple Sclerosis Patients Treated with Interferon-beta

    PubMed Central

    Bustamante, Marta F.; Nurtdinov, Ramil N.; Río, Jordi; Montalban, Xavier; Comabella, Manuel

    2013-01-01

    Background A relatively large proportion of relapsing-remitting multiple sclerosis (RRMS) patients do not respond to interferon-beta (IFNb) treatment. In previous studies with peripheral blood mononuclear cells (PBMC), we identified a subgroup of IFNb non-responders that was characterized by a baseline over-expression of type I IFN inducible genes. Additional mechanistic experiments carried out in IFNb non-responders suggested a selective alteration of the type I IFN signaling pathway in the population of blood monocytes. Here, we aimed (i) to investigate whether the type I IFN signaling pathway is up-regulated in isolated monocytes from IFNb non-responders at baseline; and (ii) to search for additional biological pathways in this cell population that may be implicated in the response to IFNb treatment. Methods Twenty RRMS patients classified according to their clinical response to IFNb treatment and 10 healthy controls were included in the study. Monocytes were purified from PBMC obtained before treatment by cell sorting and the gene expression profiling was determined with oligonucleotide microarrays. Results and discussion Purified monocytes from IFNb non-responders were characterized by an over-expression of type I IFN responsive genes, which confirms the type I IFN signature in monocytes suggested from previous studies. Other relevant signaling pathways that were up-regulated in IFNb non-responders were related with the mitochondrial function and processes such as protein synthesis and antigen presentation, and together with the type I IFN signaling pathway, may also be playing roles in the response to IFNb. PMID:23637780

  3. A second glutamine synthetase gene with expression in the gills of the gulf toadfish (opsanus beta)

    SciTech Connect

    Walsh, Patrick J.; Mayer, Gregory D.; Medina, Monica; Bernstein, Matthew L.; Barimo, John F.; Mommsen, Thomas P.

    2003-05-08

    Enzyme and molecular biology approaches were used to more completely characterize the expression of the nitrogen metabolism enzyme glutamine synthetase [GSase; L-glutamate: ammonia ligase (ADP-forming), E.C. 6.3.1.2] in a variety of tissues of the gulf toadfish (Opsanus beta) subjected to unconfined (ammonotelic) and confined (ureotelic) conditions. Enzymological results demonstrate that while weight-specific GSase activities rank in the order of brain > liver > stomach {approx} kidney > intestine > gill> heart/spleen > muscle, when tissue mass is used to calculate a glutamine synthetic potential, the liver has the greatest, followed by muscle > stomach and intestine with minor contributions from the remaining tissues. Additionally, during confinement stress, GSase activity only increases significantly in liver (5-fold) and muscle (2-fold), tissues which previously showed significant expression of the other enzymes of urea synthesis. RT PCR and RACE PCR revealed the presence of a second GSas e cDNA from gill tissue that appears to share relatively low nucleotide and amino acid sequence similarity ({approx}73 percent) with the original GSase cloned from liver, and furthermore lacks a mitochondrial leader targeting sequence. RT PCR and restriction digestion experiments demonstrated that mRNA from the original ''liver'' GSase is expressed in all tissues examined (liver, gill, stomach, intestine, kidney, brain and muscle), whereas the new ''gill'' form shows expression primarily in the gill. Enzyme activities of gill GSase also exhibit a different subcellular compartmentation with apparent exclusive expression in the soluble compartment, whereas other tissues expressing the ''liver'' form show both cytoplasmic and mitochondrial activities. Finally, phylogenetic analysis of a number of GSases demonstrates that the toadfish gill GSase has a greater affinity for a clade that includes the Xenopus GSase genes and one of two Fugu GSase genes, than it has for a clade

  4. Influence of beta(2)-integrin adhesion molecule expression and pulmonary infection with Pasteurella haemolytica on cytokine gene expression in cattle.

    PubMed

    Lee, H Y; Kehrli, M E; Brogden, K A; Gallup, J M; Ackermann, M R

    2000-07-01

    beta(2)-Integrins are leukocyte adhesion molecules composed of alpha (CD11a, -b, -c, or -d) and beta (CD18) subunit heterodimers. Genetic CD18 deficiency results in impaired neutrophil egress into tissues that varies between conducting airways and alveoli of the lung. In this study, we investigated whether CD18 deficiency in cattle affects proinflammatory cytokine (PIC) expression in pulmonary tissue after respiratory infection with Pasteurella haemolytica. Cattle were infected with P. haemolytica via fiberoptic deposition of organisms into the posterior part of the right cranial lung lobe. Animals were euthanized at 2 or 4 h postinoculation (p.i.), and tissues were collected to assess PIC gene expression using antisense RNA probes specific for bovine interleukin-1alpha (IL-1alpha), IL-1beta, IL-6, gamma interferon (IFN-gamma), and tumor necrosis factor alpha (TNF-alpha) along with the beta-actin (beta-Act) housekeeping gene. Expression of PIC was induced at 2 h p.i. in P. haemolytica-infected cattle and continued to 4 h p.i. At 2 h p.i., induction of gene expression and increase of cells that expressed PIC were observed both in CD18(+) and CD18(-) cattle after inoculation of P. haemolytica. The induction of gene expression with P. haemolytica inoculation was more prominent in CD18(-) cattle than in CD18(+) cattle by comparison to pyrogen-free saline (PFS)-inoculated control animals. At 4 h p.i., however, the induction of PIC, especially IL-1alpha, IL-6, and IFN-gamma, in the lungs of CD18(+) cattle inoculated with P. haemolytica was greater than that in lungs of the CD18(-) cattle. IFN-gamma and TNF-alpha genes were not increased in P. haemolytica-inoculated CD18(-) cattle lungs compared to the PFS-inoculated control lungs at 4 h p.i. In PFS-inoculated lungs, we generally observed a higher percentage of cells and higher level of gene expression in the lungs of CD18(-) cattle than in the lungs of CD18(+) cattle, especially at 4 h p.i. The rate of neutrophil

  5. [Mechanism of genuineness of liquorice Glycyrrhiza uralensis based on CNVs of HMGR, SQS1 and beta-AS gene].

    PubMed

    Liu, Ying; Liu, Dong-Ji; Liu, Chun-Sheng; Liao, Cai-Li; Cheng, Xiao-Li

    2012-02-01

    This study is to reveal the correlation between CNVs of HMGR, SQS1, beta-AS gene and genuineness of liquorice. Real-time PCR was used to detect the copy number of HMGR, SQS1, beta-AS gene of liquorice. According to the results, the range of the copy number variation of HMGR gene was between 1 and 3, the copy number of SQS1 gene was 1 or 2, and the copy number of beta-AS gene was only 1. On the basis of the copy number of HMGR, SQS1 and beta-AS gene, there were five groups, type A (2 + 1 + 1), type B (1 + 1 + 1), type C (3 + 2 + 1), type D (2 + 2 + 1) and type E (3 + 1 + 1). There were two types, type A and type B, in Hangjinqi of Inner Mongolia, and the ratio of A to B was 1:1.3. There were also two types, type A and type B, in Chifeng of Inner Mongolia, and the ratio of A to B was 3:1. There were four types, type A, type B, type C and type D, in Yanchi of Ningxia province, and the ratio of A to B was 1:5.1. There were three types, type A, type B and type E, in Minqin of Gansu province, and the ratio of A to B was 2:1. So CNVs mainly existed in the liquorice from Ningxia and Gansu provinces. While the genetic background of liquorice from Hangjinqi of Inner Mongolia was stabilized. The results of the experiment proved that the correlation between CNVs and origins was one of the reasons of genuineness of liquorice.

  6. Amyloid beta-protein gene duplication is not common in Alzheimer's disease: analysis by polymorphic restriction fragments.

    PubMed

    Furuya, H; Sasaki, H; Goto, I; Wong, C W; Glenner, G G; Sakaki, Y

    1988-01-15

    The amyloid beta-protein(BP) is an important component of amyloid fibrils of both Alzheimer's disease(AD) and adult Down syndrome(DS). It has been hypothesized that sporadic AD may involve the duplication of a subregion of chromosome 21 containing the BP locus. However, an improved method for detection of the BP gene duplication using polymorphic Hind III fragments led us to a conclusion that BP gene duplication is rare, if any, in (Japanese) sporadic AD patients, indicating that the duplication of the BP gene itself is not the common underlying genetic defect in AD.

  7. Cystatin B-deficient mice have increased expression of apoptosis and glial activation genes

    SciTech Connect

    Lieuallen, Kimberly; Pennacchio, Len A.; Park, Morgan; Myers, Richard M.; Lennon, Gregory G.

    2001-07-05

    Loss-of-function mutations in the cystatin B (Cstb) gene cause a neurological disorder known as Unverricht Lundborg disease (EPM1) in human patients. Mice that lack Cstb provide a mammalian model for EPM1 by displaying progressive ataxia and myoclonic seizures. We analyzed RNAs from brains of Cstb-deficient mice by using modified differential display, oligonucleotide microarray hybridization and quantitative reverse transcriptase polymerase chain reaction to examine the molecular consequences of the lack of Cstb. We identified seven genes that have consistently increased transcript levels in neurological tissues from the knockout mice. These genes are cathepsin S, C1q B-chain of complement (C1qB), beta-2-microglobulin, glial fibrillary acidic protein (Gfap), apolipoprotein D, fibronectin 1 and metallothionein II, which are expected to be involved in increased proteolysis, apoptosis and glial activation. The molecular changes in Cstb-deficient mice are consistent with the pathology found in the mouse model and may provide clues towards the identification of therapeutic points of intervention for EPM1 patients.

  8. Evolutionary diversification of the BetaM interactome acquired through co-option of the ATP1B4 gene in placental mammals

    PubMed Central

    Korneenko, Tatyana V.; Pestov, Nikolay B.; Ahmad, Nisar; Okkelman, Irina A.; Dmitriev, Ruslan I.; Shakhparonov, Mikhail I.; Modyanov, Nikolai N.

    2016-01-01

    ATP1B4 genes represent a rare instance of orthologous vertebrate gene co-option that radically changed properties of the encoded BetaM proteins, which function as Na,K-ATPase subunits in lower vertebrates and birds. Eutherian BetaM has lost its ancestral function and became a muscle-specific resident of the inner nuclear membrane. Our earlier work implicated BetaM in regulation of gene expression through direct interaction with the transcriptional co-regulator SKIP. To gain insight into evolution of BetaM interactome we performed expanded screening of eutherian and avian cDNA libraries using yeast-two-hybrid and split-ubiquitin systems. The inventory of identified BetaM interactors includes lamina-associated protein LAP-1, myocyte nuclear envelope protein Syne1, BetaM itself, heme oxidases HMOX1 and HMOX2; transcription factor LZIP/CREB3, ERGIC3, PHF3, reticulocalbin-3, and β-sarcoglycan. No new interactions were found for chicken BetaM and human Na,K-ATPase β1, β2 and β3 isoforms, indicating the uniqueness of eutherian BetaM interactome. Analysis of truncated forms of BetaM indicates that residues 72-98 adjacent to the membrane in nucleoplasmic domain are important for the interaction with SKIP. These findings demonstrate that evolutionary alterations in structural and functional properties of eutherian BetaM proteins are associated with the increase in its interactome complexity. PMID:26939788

  9. Analysis of structure and expression of the Xenopus thyroid hormone receptor-beta gene to explain its autoinduction.

    PubMed

    Machuca, I; Esslemont, G; Fairclough, L; Tata, J R

    1995-01-01

    Transcription of both Xenopus thyroid hormone receptor (TR) genes, xTR alpha and -beta, is strongly up-regulated by their own ligand T3 during natural or T3-induced metamorphosis of tadpoles and in some Xenopus cell lines. To explain this autoinduction, we analyzed the sequence of 1.6 kilobases of xTR beta promoter for putative T3-responsive elements. Two direct repeat +4 AGGTCA hexamer motifs (DR+4), an imperfect distal (-793/-778) and a perfect proximal (-5/11) site, a DR+1 site, and some possible half-sites were located in the 1.6-kilobase promoter. Transfection of Xenopus XTC-2 cells (which express xTR alpha and -beta) and XL-2 cells (which predominantly express TR alpha) with chloramphenicol acetyltransferase reporter constructs of deletion mutants and promoter fragments showed that the distal and proximal DR+4 sites responded to T3, although other flanking sequences may also play a role. The thyroid hormone-responsive element half-site present as DR+1 in the up-stream sequence at -1260/-950, when cloned in front of a heterologous promoter, functions independently. T3 enhanced transcription from the two DR+4-containing fragments when present together by only 2- to 3-fold due to a high basal activity. Overexpression of unliganded xTR alpha and xTR beta in XTC-2 cells repressed basal activity, which was then enhanced 7- to 4-fold by T3, respectively; with XL-2 cells cotransfected with xTR beta, T3 inducibility increased to 16-fold. Electrophoretic mobility shift assays with recombinant Xenopus TR alpha, TR beta, retinoid-X receptor-alpha (RXR alpha) and RXR gamma proteins showed that TR-RXR heterodimers, but not TR or RXR monomers or homodimers, strongly bound the natural and synthetic distal and proximal DR+4 elements in a ligand-independent manner. TR/RXR heterodimers exhibited the highest binding affinity for a 28-mer oligonucleotide probe for the -5/11 proximal DR+4 site, with only slight binding to DR+1 (retinoid-X-responsive element-like) site. The x

  10. Influence of polymorphism in the genes for the interleukin (IL)-1 receptor antagonist and IL-1beta on tuberculosis.

    PubMed

    Wilkinson, R J; Patel, P; Llewelyn, M; Hirsch, C S; Pasvol, G; Snounou, G; Davidson, R N; Toossi, Z

    1999-06-21

    Several lines of evidence suggest that host genetic factors controlling the immune response influence infection by Mycobacterium tuberculosis. The proinflammatory cytokine interleukin (IL)-1beta and its antagonist, IL-1Ra (IL-1 receptor agonist), are strongly induced by M. tuberculosis and are encoded by polymorphic genes. The induction of both IL-1Ra mRNA and secreted protein by M. tuberculosis in IL-1Ra allele A2-positive (IL-1Ra A2(+)) healthy subjects was 1.9-fold higher than in IL-1Ra A2(-) subjects. The M. tuberculosis-induced expression of mRNA for IL-1beta was higher in subjects of the IL-1beta (+3953) A1(+) haplotype (P = 0.04). The molar ratio of IL-1Ra/IL-1beta induced by M. tuberculosis was markedly higher in IL-1Ra A2(+) individuals (P < 0.05), with minor overlap between the groups, reflecting linkage between the IL-1Ra A2 and IL-1beta (+3953) A2 alleles. In M. tuberculosis-stimulated peripheral blood mononuclear cells, the addition of IL-4 increased IL-1Ra secretion, whereas interferon gamma increased and IL-10 decreased IL-1beta production, indicative of a differential influence on the IL-1Ra/IL-1beta ratio by cytokines. In a study of 114 healthy purified protein derivative-reactive subjects and 89 patients with tuberculosis, the frequency of allelic variants at two positions (-511 and +3953) in the IL-1beta and IL-1Ra genes did not differ between the groups. However, the proinflammatory IL-1Ra A2(-)/IL-1beta (+3953) A1(+) haplotype was unevenly distributed, being more common in patients with tuberculous pleurisy (92%) in comparison with healthy M. tuberculosis-sensitized control subjects or patients with other disease forms (57%, P = 0.028 and 56%, P = 0. 024, respectively). Furthermore, the IL-1Ra A2(+) haplotype was associated with a reduced Mantoux response to purified protein derivative of M. tuberculosis: 60% of tuberculin-nonreactive patients were of this type. Thus, the polymorphism at the IL-1 locus influences the cytokine response and may

  11. Analysis of structure and expression of the Xenopus thyroid hormone receptor-beta gene to explain its autoinduction.

    PubMed

    Machuca, I; Esslemont, G; Fairclough, L; Tata, J R

    1995-01-01

    Transcription of both Xenopus thyroid hormone receptor (TR) genes, xTR alpha and -beta, is strongly up-regulated by their own ligand T3 during natural or T3-induced metamorphosis of tadpoles and in some Xenopus cell lines. To explain this autoinduction, we analyzed the sequence of 1.6 kilobases of xTR beta promoter for putative T3-responsive elements. Two direct repeat +4 AGGTCA hexamer motifs (DR+4), an imperfect distal (-793/-778) and a perfect proximal (-5/11) site, a DR+1 site, and some possible half-sites were located in the 1.6-kilobase promoter. Transfection of Xenopus XTC-2 cells (which express xTR alpha and -beta) and XL-2 cells (which predominantly express TR alpha) with chloramphenicol acetyltransferase reporter constructs of deletion mutants and promoter fragments showed that the distal and proximal DR+4 sites responded to T3, although other flanking sequences may also play a role. The thyroid hormone-responsive element half-site present as DR+1 in the up-stream sequence at -1260/-950, when cloned in front of a heterologous promoter, functions independently. T3 enhanced transcription from the two DR+4-containing fragments when present together by only 2- to 3-fold due to a high basal activity. Overexpression of unliganded xTR alpha and xTR beta in XTC-2 cells repressed basal activity, which was then enhanced 7- to 4-fold by T3, respectively; with XL-2 cells cotransfected with xTR beta, T3 inducibility increased to 16-fold. Electrophoretic mobility shift assays with recombinant Xenopus TR alpha, TR beta, retinoid-X receptor-alpha (RXR alpha) and RXR gamma proteins showed that TR-RXR heterodimers, but not TR or RXR monomers or homodimers, strongly bound the natural and synthetic distal and proximal DR+4 elements in a ligand-independent manner. TR/RXR heterodimers exhibited the highest binding affinity for a 28-mer oligonucleotide probe for the -5/11 proximal DR+4 site, with only slight binding to DR+1 (retinoid-X-responsive element-like) site. The x

  12. Glial fibrillary acidic protein gene promoter is differently modulated by transforming growth factor-beta 1 in astrocytes from distinct brain regions.

    PubMed

    Sousa, Vivian de Oliveira; Romão, Luciana; Neto, Vivaldo Moura; Gomes, Flávia Carvalho Alcantara

    2004-04-01

    The expression of glial fibrillary acidic protein (GFAP), the major intermediate filament protein of mature astrocytes, is regulated under developmental and pathological conditions. Recently, we have investigated GFAP gene modulation by using a transgenic mouse bearing part of the GFAP gene promoter linked to the beta-galactosidase reporter gene. We demonstrated that cerebral cortex neurons activate the GFAP gene promoter, inducing transforming growth factor-beta 1 (TGF-beta 1) secretion by astrocytes. Here, we report that cortical neurons or conditioned medium derived from them do not activate the GFAP gene promoter of transgenic astrocytes derived from midbrain and cerebellum suggesting a neuroanatomical regional specificity of this phenomenon. Surprisingly, they do induce synthesis of TGF-beta 1 by these cells. Western blot and immunocytochemistry assays revealed wild distribution of TGF receptor in all subpopulations of astrocytes and expression of TGF-beta 1 in neurons derived from all regions, thus indicating that the unresponsiveness of the cerebellar and midbrain GFAP gene to TGF-beta 1 is not due to a defect in TGF-beta 1 signalling. Together, our data highlight the great complexity of neuron-glia interactions and might suggest a distinct mechanism underlying modulation of the GFAP gene in the heterogeneous population of astrocytes throughout the central nervous system.

  13. Evaluation of serum markers in the LRF CLL4 trial: β2-microglobulin but not serum free light chains, is an independent marker of overall survival.

    PubMed

    Pratt, Guy; Thomas, Peter; Marden, Nicola; Alexander, Denis; Davis, Zadie; Hussey, David; Parry, Helen; Harding, Stephen; Catovsky, Daniel; Begley, Joe; Oscier, David

    2016-10-01

    Chronic lymphocytic leukemia (CLL) is characterized by heterogeneous clinical behavior and there is a need for improved biomarkers. The current study evaluated the prognostic significance of serum free light chains (sFLC, kappa, and lambda) and other serum markers (bar, serum thymidine kinase (sTK), soluble CD23, and LDH) together with established biomarkers in 289 patients enrolled into the LRF CLL4 trial. In a multivariable analysis of serum markers alone, higher big and kappa light chains were statistically significant in predicting disease progression and higher blg, and sTK in predicting mortality. In multivariable analysis for overall survival the following were independently significant: β2M levels, immunoglobulin gene (IGHV) mutational status (>98% homology), age, 17p13 deletions (>10%), and CD38 expression. β2M is the only serum marker that retained clear independent value as a biomarker in the LRF CLL4 trial and remains powerfully prognostic requiring evaluation in any future method of risk stratifying patients.

  14. Expression stability of reference genes for quantitative RT-PCR of healthy and diseased pituitary tissue samples varies between humans, mice, and dogs.

    PubMed

    van Rijn, Sarah J; Riemers, Frank M; van den Heuvel, Douwe; Wolfswinkel, Jeannette; Hofland, Leo; Meij, Björn P; Penning, Louis C

    2014-04-01

    Pituitary surgery generates pituitary tissue for histology, immunohistochemistry, and molecular biological research. In the last decade, the pathogenesis of pituitary adenomas has been extensively studied in humans, and to a lesser degree in dogs, and tumor oncogenesis has been studied in knock-out mice, often by means of quantitative reversed-transcriptase PCR (RT-qPCR). A precondition of such analyses is that so-called reference genes are stably expressed regardless of changes in disease status or treatment. In this study, the expression of six frequently used reference genes, namely, tata box binding protein (tbp), tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide (ywhaz), hydroxymethylbilane synthase (hmbs), beta-2-microglobulin (b2m), succinate dehydrogenase complex subunit A (sdha), and glyceraldehyde 3 phosphate dehydrogenase 1 (gapdh), was studied in pituitary tissue (normal and adenoma) from three species (humans, mice, and dogs). The stability of expression of these reference genes differed between species and between healthy and diseased tissue within one species. Quantitative analysis based on a single reference gene that is assumed to be stably expressed might lead to wrong conclusions. This cross-species analysis clearly emphasizes the need to evaluate the expression stability of reference genes as a standard and integral aspect of study design and data analysis, in order to improve the validity of the conclusions drawn on the basis of quantitative molecular analyses.

  15. Role of the von Hippel-Lindau tumor suppressor gene in the formation of beta1-integrin fibrillar adhesions.

    PubMed

    Esteban-Barragán, Miguel A; Avila, Pilar; Alvarez-Tejado, Miguel; Gutiérrez, M Dolores; García-Pardo, Angeles; Sánchez-Madrid, Francisco; Landázuri, Manuel O

    2002-05-15

    The von Hippel-Lindau tumor suppressor gene (VHL) is absent or inactivated in the VHLcancer syndrome and in most sporadic renal cancers. VHL is requiredfor the assembly of a proper extracellular fibronectin matrix, although the exact mechanism remains unknown. In this report, we demonstrate that 786-O renal cancer cells are unable to organize an adequate matrix even in the presence of an excess of exogenous fibronectin. Because the formation of integrin fibrillar adhesions plays a pivotal role in the organization of extracellular fibronectin, we next examined the expression and subcellular distribution of integrins in VHL- cells and their wild-type VHL stably transfected counterparts. The levels of beta1 and alphav integrins were increased in VHL- cells when compared with VHL+ transfectants. Early after plating, both VHL+ and VHL- cells were capable of assembling classic "patch-like" alphav focal contacts. As the culture advanced and cells became confluent, alphav integrins partly relocated to the intercellular junctions in VHL+ transfectants, which then developed large beta1 fibrillar-type adhesions and anchored firmly to the substrate. In contrast, confluent VHL- cells were unable to assemble beta1 fibrillar adhesions, and alphav focal contacts remained unchanged at all stages of the culture. Exogenous activation of beta1 integrins with either divalent cations or activating antibodies partly restored the capability of VHL- cells to assemble beta1 fibrillar adhesions and fibronectin fibers. Finally, pulse-chase studies of metabolically labeled 786-O cells revealed that the maturation of the common beta1-integrin chain was delayed in VHL- cells when compared with VHL+ cells. Our results show that VHL is an important regulator of integrins and is essential for the formation of beta1 fibrillar adhesions. These findings help to explain the abnormal extracellular matrix organization and increased motility of VHL- renal cancer cells. PMID:12019174

  16. Transforming growth factor beta differentially modulates the inducible nitric oxide synthase gene in distinct cell types.

    PubMed

    Gilbert, R S; Herschman, H R

    1993-08-31

    Nitric oxide is a mediator of paracrine cell signalling. An inducible form of nitric oxide synthase (iNOS) is expressed in macrophages and in Swiss 3T3 cells. Transforming growth factor beta (TGF-beta) is a cytokine that modulates many cellular functions. We find that TGF-beta cannot induce iNOS mRNA expression, either in macrophage cell lines or in Swiss 3T3 cells. However, TGF-beta attenuates lipopolysaccharide induction of iNOS mRNA in macrophages. In contrast, TGF-beta enhances iNOS induction by phorbol ester, serum or lipopolysaccharide in 3T3 cells. Thus TGF-beta can inhibit or augment iNOS mRNA induction in response to primary inducers, depending on the cell type in question.

  17. Transforming growth factor. beta. sub 1 is present at sites of extracellular matrix gene expression in human pulmonary fibrosis

    SciTech Connect

    Broekelmann, T.J.; Limper, A.H.; McDonald, J.A. ); Colby, T.V. )

    1991-08-01

    Idiopathic pulmonary fibrosis is an inexorably fatal disorder characterized by connective tissue deposition within the terminal air spaces resulting in loss of lung function and eventual respiratory failure. Previously, the authors demonstrated that foci of activated fibroblasts expressing high levels of fibronectin, procollagen, and smooth muscle actin and thus resembling those found in healing wounds are responsible for the connective tissue deposition and scarring in idiopathic pulmonary fibrosis. Using in situ hybridization and immunohistochemistry, they now demonstrate the presence of transforming growth factor {beta}{sub 1} (TGF-{beta}{sub 1}), a potent profibrotic cytokine, in the foci containing these activated fibroblasts. These results suggest that matrix-associated TGF-{beta}{sub 1} may serve as a stimulus for the persistent expression of connective tissue genes. One potential source of the TGF-{beta}{sub 1} is the alveolar macrophage, and they demonstrate the expression of abundant TGF-{beta}{sub 1} mRNA in alveolar macrophages in lung tissue from patients with idiopathic pulmonary fibrosis.

  18. Inactivation of the IL-6 gene prevents development of multicentric Castleman's disease in C/EBP beta-deficient mice

    PubMed Central

    1996-01-01

    Castleman's disease is a lymphoproliferative disorder thought to be related to deregulated production of IL-6. We have previously shown that mice lacking the trans-acting factor C/EBP beta, a transcriptional regulator of IL-6 and a mediator of IL-6 intracellular signaling, develop a pathology nearly identical to multicentric Castleman's disease, together with increasingly high levels of circulating IL-6. We describe here how the simultaneous inactivation of both IL-6 and C/EBP beta genes prevents the development of pathological traits of Castleman's disease observed in C/EBP beta-deficient mice. Histological and phenotypic analysis of lymph nodes and spleen of double mutant mice did not show either the lymphoadenopathy and splenomegaly or the abnormal expansion of myeloid, B and plasma cell compartments observed in C/EBP beta-/- mice, while B cell development, although delayed, was normal. Our data demonstrate that IL-6 is essential for the development of multicentric Castleman's disease in C/EBP beta-/- mice. PMID:8879230

  19. Differential activation of transcription versus recombination of transgenic T cell receptor beta variable region gene segments in B and T lineage cells

    PubMed Central

    1994-01-01

    We have tested the ability of the T cell receptor beta (TCR-beta) transcriptional enhancer (E beta) to confer transcriptional activation and tissue-specific V(D)J recombination of TCR-beta V, D, and J segments in a transgenic minilocus recombination substrate. We find that the minimal E beta element, as previously shown for a DNA segment that contained the E mu element, promotes a high level of substrate D to J beta rearrangement in both B and T cells, but only promotes V beta to DJ beta rearrangement in T cells. Thus, both the E mu and E beta elements similarly direct V(D)J recombination of this substrate in vivo, supporting a general role for transcriptional enhancers in the normal regulation of this rearrangement process. Surprisingly, however, we found that both the V beta and DJ beta portion of the constructs were transcribed in an enhancer-dependent fashion (conferred by either E mu or E beta) in both B and T lineage cells, including normal precursor B cells propagated in culture. These findings indicate that, at least in some contexts, transcriptional activation, per se, is not sufficient to confer V(D)J recombinational accessibility to a substrate V gene segment. PMID:8006587

  20. Mutations in the dopamine beta-hydroxylase gene are associated with human norepinephrine deficiency

    NASA Technical Reports Server (NTRS)

    Kim, Chun-Hyung; Zabetian, Cyrus P.; Cubells, Joseph F.; Cho, Sonhae; Biaggioni, Italo; Cohen, Bruce M.; Robertson, David; Kim, Kwang-Soo

    2002-01-01

    Norepinephrine (NE), a key neurotransmitter of the central and peripheral nervous systems, is synthesized by dopamine beta-hydroxylase (DBH) that catalyzes oxidation of dopamine (DA) to NE. NE deficiency is a congenital disorder of unknown etiology, in which affected patients suffer profound autonomic failure. Biochemical features of the syndrome include undetectable tissue and circulating levels of NE and epinephrine, elevated levels of DA, and undetectable levels of DBH. Here, we report identification of seven novel variants including four potentially pathogenic mutations in the human DBH gene (OMIM 223360) from analysis of two unrelated patients and their families. Both patients are compound heterozygotes for variants affecting expression of DBH protein. Each carries one copy of a T-->C transversion in the splice donor site of DBH intron 1, creating a premature stop codon. In patient 1, there is a missense mutation in DBH exon 2. Patient 2 carries missense mutations in exons 1 and 6 residing in cis. We propose that NE deficiency is an autosomal recessive disorder resulting from heterogeneous molecular lesions at DBH. Copyright 2002 Wiley-Liss, Inc.

  1. Nucleotide sequence of the structural gene for diphtheria toxin carried by corynebacteriophage beta.

    PubMed Central

    Greenfield, L; Bjorn, M J; Horn, G; Fong, D; Buck, G A; Collier, R J; Kaplan, D A

    1983-01-01

    A 1,942-base-pair DNA segment encoding the structural gene for diphtheria toxin was sequenced, and the primary structure of the toxin was deduced. Restriction enzyme fragments corresponding to nontoxic or hypotoxic peptides of the toxin were isolated from corynebacteriophage beta and cloned into Escherichia coli on plasmid pBR322, and the sequence was determined. The mature toxin molecule deduced from the sequence has 535 amino acid residues and a molecular weight of 58,342. The deduced sequence for the fragment A moiety was the same as that determined at the protein level, except for a single serine residue, which had been mispositioned in the earlier study. Several differences were noted with respect to the partial sequence data available on the fragment B moiety, some or all of which may reflect genetic variations among populations of corynephages carrying the toxin gene. The DNA sequence predicts a 25-residue leader peptide preceding the mature protein, which is presumably involved in secretion of the toxin from lysogenized Corynebacterium diphtheriae. We infer that initiation of translation probably occurs at a GTG codon (codon -25). Cloned restriction fragments containing sequences for the amino-terminal region of toxin, together with 5' flanking regions, were expressed in E. coli. Toxin-related peptides were synthesized and secreted into the periplasmic space. These results provide a basis for applying recombinant DNA methods to the study of diphtheria toxin and for producing novel, genetically altered forms of the toxin suited to the construction of new classes of immunotoxins. PMID:6316330

  2. Analysis of the transforming growth factor-beta 1 gene promoter polymorphisms in early osseointegrated implant failure.

    PubMed

    Dos Santos, Maria Cristina Leme Godoy; Campos, Maria Isabela Guimarães; Souza, Ana Paula; Scarel-Caminaga, Raquel Mantuaneli; Mazzonetto, Renato; Line, Sergio Roberto Peres

    2004-09-01

    Transforming growth factor-beta 1 is a multifunctional cytokine involved in extracellular matrix deposition, reduction of inflammation, and promotion of wound healing. Single nucleotide polymorphisms in the promoter region of human transforming growth factor-beta 1 gene, C-509T and G-800A, have been shown to increase the transcriptional activity of this cytokine and have been associated with a variety of diseases. The objective of this study was to investigate the possible association between these single nucleotide polymorphisms and the early implant failure. A sample of 68 nonsmoking patients was divided into two groups: a test group comprising 28 patients with one or more early failed implants and a control group consisting of 40 individuals with one or more healthy implants. Genomic DNA from oral mucosa was amplified by polymerase chain reaction and analyzed by restriction fragment length polymorphism. The significance of the differences in observed frequencies of single nucleotide polymorphisms was assessed using the chi square test and Fisher's exact test. The cited single nucleotide polymorphisms in transforming growth factor-beta 1 were analyzed in combination as haplotype using the computer program ARLEQUIN. The authors did not observe significant differences in the allele and genotypes to both single nucleotide polymorphisms of transforming growth factor-beta 1 gene (C-509T and G-800A) between control and early implant failure groups. The distribution of the haplotypes arranged as allele and genotypes were similar between control and test groups. These results indicate that C-509T and G-800A polymorphisms in the transforming growth factor-beta 1 gene are not associated separately or in haplotype combinations with early implant failure, suggesting that the presence of those single nucleotide polymorphisms alone do not constitute a genetic risk factor for early implant failure in the Brazilian population. PMID:15359164

  3. Occurrence of bacteria producing broad-spectrum beta-lactamases and qnr genes in hospital and urban wastewater samples.

    PubMed

    Röderová, Magdaléna; Sedláková, Miroslava Htoutou; Pudová, Vendula; Hricová, Kristýna; Silová, Romana; Imwensi, Peter Eghonghon Odion; Bardoň, Jan; Kolář, Milan

    2016-04-01

    The aims were to investigate the level of antibiotic-resistant bacteria in hospital and urban wastewater and to determine the similarity of isolates obtained from wastewater and hospitalized patients. Wastewater samples were collected in September 2013 and 2014. After identification using MALDI-TOF MS, beta-lactamase production was determined by relevant phenotypic tests. Genes responsible for the production of single beta-lactamase groups and Qnr proteins were established. The epidemiological relationship of the isolates from wastewater and hospitalized patients was determined by PFGE. A total of 51 isolates of enterobacteria were obtained. Overall, 45.1% of them produced broad-spectrum beta-lactamases. Genes encoding TEM, SHV, CTX-M, CIT, DHA and EBC types of enzymes and Qnr proteins were detected. No broad-spectrum beta-lactamase production was confirmed in the urban wastewater treatment plant. The most important finding was the detection of two identical isolates of K. pneumoniae in 2013, one from a patient's urinary catheter and the other from a wastewater sample. PMID:27196551

  4. Functional analysis of a proline to serine mutation in codon 453 of the thyroid hormone receptor {beta}1 gene

    SciTech Connect

    Ozata, M.; Suzuki, Satoru; Takeda, Teiji

    1995-10-01

    Mutations in the gene encoding human thyroid hormone receptor {beta}(hTR{beta}) have been associated with generalized resistance to thyroid hormone (GRTH). This disorder is associated with significant behavoral abnormalities. We examined the hTR{beta} gene in a family with members who manifest inappropriately normal TSH, elevated free T{sub 4}, and free and total T{sub 3}. Sequence analysis showed a cytosine to thymine transition at nucleotide 1642 in one allele of the index patient`s genomic DNA. This altered proline to serine at codon 453. The resulting mutant receptor when expressed in vitro bound DNA with high affinity, but the T{sub 3} affinity of the receptor was impaired. The mutant TR demonstrated a dominant negative effect when cotransfected with two isoforms of wild-type receptor and also in the presence of TR variant {alpha}2 in COS-1 cells. Mutations of codon 453 occur more frequently than at other sites, and four different amino acid substitutions have been reported. Significant differences in phenotype occur among affected individuals, varying from normality to moderately severe GRTH. There is no clear correlation between K{sub a} or in vitro function of the mutant receptor, and phenotype. This study extends the association between GRTH and illness, and indicates that early diagnosis and counseling are needed in families with TR{beta}1 abnormalities. 34 refs., 5 figs., 2 tabs.

  5. Occurrence of bacteria producing broad-spectrum beta-lactamases and qnr genes in hospital and urban wastewater samples.

    PubMed

    Röderová, Magdaléna; Sedláková, Miroslava Htoutou; Pudová, Vendula; Hricová, Kristýna; Silová, Romana; Imwensi, Peter Eghonghon Odion; Bardoň, Jan; Kolář, Milan

    2016-04-01

    The aims were to investigate the level of antibiotic-resistant bacteria in hospital and urban wastewater and to determine the similarity of isolates obtained from wastewater and hospitalized patients. Wastewater samples were collected in September 2013 and 2014. After identification using MALDI-TOF MS, beta-lactamase production was determined by relevant phenotypic tests. Genes responsible for the production of single beta-lactamase groups and Qnr proteins were established. The epidemiological relationship of the isolates from wastewater and hospitalized patients was determined by PFGE. A total of 51 isolates of enterobacteria were obtained. Overall, 45.1% of them produced broad-spectrum beta-lactamases. Genes encoding TEM, SHV, CTX-M, CIT, DHA and EBC types of enzymes and Qnr proteins were detected. No broad-spectrum beta-lactamase production was confirmed in the urban wastewater treatment plant. The most important finding was the detection of two identical isolates of K. pneumoniae in 2013, one from a patient's urinary catheter and the other from a wastewater sample.

  6. Human-Specific SNP in Obesity Genes, Adrenergic Receptor Beta2 (ADRB2), Beta3 (ADRB3), and PPAR γ2 (PPARG), during Primate Evolution

    PubMed Central

    Takenaka, Akiko; Nakamura, Shin; Mitsunaga, Fusako; Inoue-Murayama, Miho; Udono, Toshifumi; Suryobroto, Bambang

    2012-01-01

    Adrenergic-receptor beta2 (ADRB2) and beta3 (ADRB3) are obesity genes that play a key role in the regulation of energy balance by increasing lipolysis and thermogenesis. The Glu27 allele in ADRB2 and the Arg64 allele in ADRB3 are associated with abdominal obesity and early onset of non-insulin-dependent diabetes mellitus (NIDDM) in many ethnic groups. Peroxisome proliferator-activated receptor γ (PPARG) is required for adipocyte differentiation. Pro12Ala mutation decreases PPARG activity and resistance to NIDDM. In humans, energy-expense alleles, Gln27 in ADRB2 and Trp64 in ADRB3, are at higher frequencies than Glu27 and Arg64, respectively, but Ala12 in PPARG is at lower frequency than Pro12. Adaptation of humans for lipolysis, thermogenesis, and reduction of fat accumulation could be considered by examining which alleles in these genes are dominant in non-human primates (NHP). All NHP (P. troglodytes, G. gorilla, P. pygmaeus, H. agilis and macaques) had energy-thrifty alleles, Gly16 and Glu27 in ADRB2, and Arg64 in ADRB3, but did not have energy-expense alleles, Arg16, Gln27 and Trp64 alleles. In PPARG gene, all NHP had large adipocyte accumulating type, the Pro12 allele. Conclusions These results indicate that a tendency to produce much more heat through the energy-expense alleles developed only in humans, who left tropical rainforests for savanna and developed new features in their heat-regulation systems, such as reduction of body hair and increased evaporation of water, and might have helped the protection of entrails from cold at night, especially in glacial periods. PMID:22937051

  7. Laser-induced propagation and destruction of amyloid beta fibrils.

    PubMed

    Yagi, Hisashi; Ozawa, Daisaku; Sakurai, Kazumasa; Kawakami, Toru; Kuyama, Hiroki; Nishimura, Osamu; Shimanouchi, Toshinori; Kuboi, Ryoichi; Naiki, Hironobu; Goto, Yuji

    2010-06-18

    The amyloid deposition of amyloid beta (Abeta) peptides is a critical pathological event in Alzheimer disease (AD). Preventing the formation of amyloid deposits and removing preformed fibrils in tissues are important therapeutic strategies against AD. Previously, we reported the destruction of amyloid fibrils of beta(2)-microglobulin K3 fragments by laser irradiation coupled with the binding of amyloid-specific thioflavin T. Here, we studied the effects of a laser beam on Abeta fibrils. As was the case for K3 fibrils, extensive irradiation destroyed the preformed Abeta fibrils. However, irradiation during spontaneous fibril formation resulted in only the partial destruction of growing fibrils and a subsequent explosive propagation of fibrils. The explosive propagation was caused by an increase in the number of active ends due to breakage. The results not only reveal a case of fragmentation-induced propagation of fibrils but also provide insights into therapeutic strategies for AD.

  8. Mapping of the gene encoding the. beta. -amyloid precursor protein and its relationship to the Down syndrome region of chromosome 21

    SciTech Connect

    Patterson, D.; Gardiner, K.; Kao, F.T.; Tanzi, R.; Watkins, P.; Gusella, J.F. )

    1988-11-01

    The gene encoding the {beta}-amyloid precursor protein has been assigned to human chromosome 21, as has a gene responsible for at least some cases of familial Alzheimer disease. Linkage studies strongly suggest that the {beta}-amyloid precursor protein and the product corresponding to familial Alzheimer disease are from two genes, or at least that several million base pairs of DNA separate the markers. The precise location of the {beta}-amyloid precursor protein gene on chromosome 21 has not yet been determined. Here the authors show, by using a somatic-cell/hybrid-cell mapping panel, in situ hybridization, and transverse-alternating-field electrophoresis, that the {beta}-amyloid precursor protein gene is located on chromosome 21 very near the 21q21/21q/22 border and probably within the region of chromosome 21 that, when trisomic, results in Down syndrome.

  9. Structural and phylogenetic analysis of the MHC class I-like Fc receptor gene

    SciTech Connect

    Kandil, Eman; Ishibashi, Teruo; Kasahara, Masanori

    1995-06-01

    The intestinal epithelium of neonatal mice and rats expresses an Fc receptor that mediates selective uptake of IgG in mothers`milk. This receptor (FcRn), which helps newborn animals to acquire passive immunity, is an MHC class I-like heterodimer made up of a heavy chain and {beta}{sub 2}-microglobulin. In the present study, we determined the genomic structure of a mouse gene (FcRn) encoding the heavy of FcRn. The overall exon-intron organization of the Fcrn gene was similar to that of the Fcrn gene, thus providing structural evidence that Fcrn os a bona fide class I gene. The 5{prime}-flanking region of the Fcrn gene contained the binding motifs for two cytokine-inducible transcription factors, NF-IL6 and NF1. However, regulatory elements found in MHC class I genes (enhancer A, enhancer B, and the IFN response element) were absent. Phylogenetic tree analysis suggested that, like the MICA, AZGP1, and CD1 genes, the Fcrn gene diverged form MHC class I genes after the emergence of amphibians but before the split of placental and marsupial mammals. Consistent with this result, Southern blot analysis with a mouse Fcrn cDNA probe detected cross-hybridizing bands in various mammalian species and chickens. Sequence analysis of the Fcrn gene isolated from eight mouse strains showed that the membrane-distal domain of FcRn has at least three amino acid variants. The fact that Fcrn is a single copy gene indicates that it is expressed in both the neonatal intestine and the fetal yolk sac. 74 refs., 7 figs., 2 tabs.

  10. Sequential changes in chromatin structure during transcriptional activation in the beta globin LCR and its target gene.

    PubMed

    Kim, Kihoon; Kim, AeRi

    2010-09-01

    Chromatin structure is modulated during transcriptional activation. The changes include the association of transcriptional activators, formation of hypersensitive sites and covalent modifications of histones. To understand the order of the various changes accompanying transcriptional activation, we analyzed the mouse beta globin gene, which is transcriptionally inducible in erythroid MEL cells over a time course of HMBA treatment. Transcription of the globin genes requires the locus control region (LCR) consisting of several hypersensitive sites (HSs). Erythroid specific transcriptional activators such as NF-E2, GATA-1, TAL1 and EKLF were associated with the LCR in the uninduced state before transcriptional activation. The HSs of the LCR were formed in this state as revealed by high sensitivity to DNase I and MNase attack. However the binding of transcriptional activators and the depletion of histones were observed in the promoter of the beta globin gene only after transcriptional activation. In addition, various covalent histone modifications were sequentially detected in lysine residues of histone H3 during the activation. Acetylation of K9, K36 and K27 was notable in both LCR HSs and gene after induction but before transcriptional initiation. Inactive histone marks such as K9me2, K36me2 and K27me2 were removed coincident with transcriptional initiation in the gene region. Taken together, these results indicate that LCR has a substantially active structure in the uninduced state while transcriptional activation serially adds active marks, including histone modifications, and removes inactive marks in the target gene of the LCR.

  11. A summary of 7q interstitial deletions and exclusion mapping of the gene for beta-glucuronidase.

    PubMed Central

    Fagan, K; Gill, A; Henry, R; Wilkinson, I; Carey, B

    1989-01-01

    Three patients are described with different phenotypes and differing de novo interstitial deletions of the long arm of a chromosome 7. The first patient has a deletion with loss of the proximal 7q11.23 band. Only three other cases have been reported with this particular deletion. Our second case shows mild dysmorphism similar to the other four patients reported with deletion of bands 7q21.12----21.3. Our third patient has a deletion of the 7q22.1----32.2 segment and has many of the phenotypic features of the other reported cases of del 7q22----32. GUSB, the gene for beta-glucuronidase, has been localised to the 7cen----q22 region. Analysis of beta-glucuronidase levels in blood leucocytes of our patients has helped more precisely to assign this gene locus to 7q21.11 or 7q22.1. Images PMID:2486209

  12. A red beet (Beta vulgaris) UDP-glucosyltransferase gene induced by wounding, bacterial infiltration and oxidative stress.

    PubMed

    Sepúlveda-Jiménez, Gabriela; Rueda-Benítez, Patricia; Porta, Helena; Rocha-Sosa, Mario

    2005-02-01

    Mechanical wounding, infiltration with P. syringae or A. tumefaciens, and exposure to an H(2)O(2)-generating system (Glc/Glc oxidase) induce betacyanin synthesis in red beet (Beta vulgaris) leaves. These conditions also induced the expression of BvGT, a gene encoding a glucosyltransferase (GT) from Beta vulgaris. BvGT has a high similarity to Dorotheanthus bellidiformis betanidin-5 GT involved in betacyanin synthesis. Furthermore, the transient expression of a BvGT antisense construct resulted in the reduction of BvGT transcript accumulation and betanin synthesis, suggesting a role for this gene product in betacyanin glucosylation. In addition, the NADPH oxidase inhibitor, diphenylene iodonium (DPI), inhibited the accumulation of the BvGT transcript in response to infiltration with Agrobacterium tumefaciens. Hence, this result suggests that ROS produced by a plasma membrane NADPH oxidase may act as a signal to induce BvGT expression, necessary for betanin synthesis after wounding and bacterial infiltration. PMID:15582929

  13. Concordance of a point mutation 5' to the A gamma-globin gene with A gamma beta + hereditary persistence of fetal hemoglobin in Greeks.

    PubMed

    Waber, P G; Bender, M A; Gelinas, R E; Kattamis, C; Karaklis, A; Sofroniadou, K; Stamatoyannopoulos, G; Collins, F S; Forget, B G; Kazazian, H H

    1986-02-01

    In the Greek A gamma beta + type of hereditary persistence of fetal hemoglobin (HPFH), adult heterozygotes produce about 20% fetal hemoglobin (HbF), which is predominantly of the A gamma chain variety. The affected beta-globin gene cluster produces near normal amounts of beta-like globin, but in a A gamma to beta ratio of 20:80 instead of 0.5:99.5. Gelinas et al and Collins et al have shown a G to A change 117 nucleotides 5' to the A gamma gene in two Greeks with A gamma beta + HPFH. To demonstrate that this change is not a neutral polymorphism, we carried out hybridization with oligonucleotide probes (19mers) specific for the normal and the mutant sequences. While normal probe identified the A gamma fragment in genomic DNA of all subjects studied, mutant probe was positive only in Greeks with A gamma beta + HPFH. In sum, 108 beta-globin gene clusters of individuals without HPFH were negative when tested with mutant probe, but all 11 affected individuals of six families with Greek A gamma beta + HPFH (two previously sequenced and four new families) were positive with mutant probe. These data support the conclusion that the -117 mutation is causative of A gamma beta + HPFH in Greeks.

  14. Induction of cytochrome P450IA1 gene expression in rat epidermis and human keratinocytes by. beta. -napthoflavone and benzanthracene

    SciTech Connect

    Khan, I.U.; Mukhtar, H.; Bickers, D.R.; Haqqi, T.M. )

    1991-03-15

    Cytochrome P450IA1 (P450IA1) plays a major role in the bioactivation of procarcinogens in various tissues including skin. However, factors controlling the expression of P450IA1 gene message in mammalian skin are unknown. In this study, the polymerase chain reaction (PCR) using specific primers was employed to study the expression of P450IA1 mRNA transcripts in rat epidermis and human keratinocytes (HK) treated with {beta}-napthoflavone ({beta}NF) and benzanthracene (BA). Total RNA was extracted from the epidermis of control and inducer-treated 4-day-old and adult Sprague Dawley rats, and from control and inducer-treated HL. cDNAs were synthesized using random primers and reverse transcriptase. PCR products were analyzed on agarose gel and quantitated by densitometry. Inducer treatment of rats and HK resulted in several-fold increases in aryl hydrocarbon hydroxylase (AHH) activity. The level of P450IA1 gene message increased 2-5-fold in treated animals as compared to controls; higher basal level and inducibility in adult than in 4-day-old rats. This induction occurred as early as 4 h after {beta}NF application, reached a maximum at 16 h and returned to basal levels by 36 h. Exposure to {beta}NF and BA resulted in 2-3-fold increase in gene message in HK. Northern blot analysis complemented PCR data. These results indicate that in mammalian skin P450IA1 gene expression is increased by the inducers of epidermal AHH activity.

  15. Cloning of the RHO1 gene from Candida albicans and its regulation of beta-1,3-glucan synthesis.

    PubMed Central

    Kondoh, O; Tachibana, Y; Ohya, Y; Arisawa, M; Watanabe, T

    1997-01-01

    The Saccharomyces cerevisiae RHO1 gene encodes a low-molecular-weight GTPase. One of its recently identified functions is the regulation of beta-1,3-glucan synthase, which synthesizes the main component of the fungal cell wall (J. Drgonova et al., Science 272:277-279, 1996; T. Mazur and W. Baginsky, J. Biol. Chem. 271:14604-14609, 1996; and H. Qadota et al., Science 272:279-281, 1996). From the opportunistic pathogenic fungus Candida albicans, we cloned the RHO1 gene by the PCR and cross-hybridization methods. Sequence analysis revealed that the Candida RHO1 gene has a 597-nucleotide region which encodes a putative 22.0-kDa peptide. The deduced amino acid sequence predicts that Candida albicans Rho1p is 82.9% identical to Saccharomyces Rho1p and contains all the domains conserved among Rho-type GTPases from other organisms. The Candida albicans RHO1 gene could rescue a S. cerevisiae strain containing a rho1 deletion. Furthermore, recombinant Candida albicans Rho1p could reactivate the beta-1,3-glucan synthesis activities of both C. albicans and S. cerevisiae membranes in which endogenous Rho1p had been depleted by Tergitol NP-40-NaCl treatment. Candida albicans Rho1p was copurified with the beta-1,3-glucan synthase putative catalytic subunit, Candida albicans Gsc1p, by product entrapment. Candida albicans Rho1p was shown to interact directly with Candida albicans Gsc1p in a ligand overlay assay and a cross-linking study. These results indicate that Candida albicans Rho1p acts in the same manner as Saccharomyces cerevisiae Rho1p to regulate beta-1,3-glucan synthesis. PMID:9401032

  16. Endocytosed β2-Microglobulin Amyloid Fibrils Induce Necrosis and Apoptosis of Rabbit Synovial Fibroblasts by Disrupting Endosomal/Lysosomal Membranes: A Novel Mechanism on the Cytotoxicity of Amyloid Fibrils

    PubMed Central

    Okoshi, Tadakazu; Yamaguchi, Itaru; Ozawa, Daisaku; Hasegawa, Kazuhiro; Naiki, Hironobu

    2015-01-01

    Dialysis-related amyloidosis is a major complication in long-term hemodialysis patients. In dialysis-related amyloidosis, β2-microglobulin (β2-m) amyloid fibrils deposit in the osteoarticular tissue, leading to carpal tunnel syndrome and destructive arthropathy with cystic bone lesions, but the mechanism by which these amyloid fibrils destruct bone and joint tissue is not fully understood. In this study, we assessed the cytotoxic effect of β2-m amyloid fibrils on the cultured rabbit synovial fibroblasts. Under light microscopy, the cells treated with amyloid fibrils exhibited both necrotic and apoptotic changes, while the cells treated with β2-m monomers and vehicle buffer exhibited no morphological changes. As compared to β2-m monomers and vehicle buffer, β2-m amyloid fibrils significantly reduced cellular viability as measured by the lactate dehydrogenase release assay and the 3-(4,5-di-methylthiazol-2-yl)-2,5-diphenyltetrazolium bromide reduction assay and significantly increased the percentage of apoptotic cells as measured by the terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling method. β2-m amyloid fibrils added to the medium adhered to cell surfaces, but did not disrupt artificial plasma membranes as measured by the liposome dye release assay. Interestingly, when the cells were incubated with amyloid fibrils for several hours, many endosomes/lysosomes filled with amyloid fibrils were observed under confocal laser microscopy and electron microscopy, Moreover, some endosomal/lysosomal membranes were disrupted by intravesicular fibrils, leading to the leakage of the fibrils into the cytosol and adjacent to mitochondria. Inhibition of actin-dependent endocytosis by cytochalasin D attenuated the toxicity of amyloid fibrils. These results suggest that endocytosed β2-m amyloid fibrils induce necrosis and apoptosis by disrupting endosomal/lysosomal membranes, and this novel mechanism on the cytotoxicity of amyloid fibrils is described

  17. The β2-microglobulin-free heterodimerization of rhesus monkey MHC class I A with its normally spliced variant reduces the ubiquitin-dependent degradation of MHC class I A.

    PubMed

    Dai, Zheng-Xi; Zhang, Gao-Hong; Zhang, Xi-He; Xia, Hou-Jun; Li, Shao-You; Zheng, Yong-Tang

    2012-03-01

    The MHC class I (MHC I) molecules play a pivotal role in the regulation of immune responses by presenting antigenic peptides to CTLs and by regulating cytolytic activities of NK cells. In this article, we show that MHC I A in rhesus macaques can be alternatively spliced, generating a novel MHC I A isoform (termed "MHC I A-sv1") devoid of α(3) domain. Despite the absence of β2-microglobulin (β2m), the MHC I A-sv1 proteins reached the cell surface of K562-transfected cells as endoglycosidase H-sensitive glycoproteins that could form disulfide-bonded homodimers. Cycloheximide-based protein chase experiments showed that the MHC I A-sv1 proteins were more stable than the full-length MHC I A in transiently or stably transfected cell lines. Of particular interest, our studies demonstrated that MHC I A-sv1 could form β2m-free heterodimers with its full-length protein in mammalian cells. The formation of heterodimers was accompanied by a reduction in full-length MHC I A ubiquitination and consequent stabilization of the protein. Taken together, these results demonstrated that MHC I A-sv1 and MHC I A can form a novel heterodimeric complex as a result of the displacement of β2m and illustrated the relevance of regulated MHC I A protein degradation in the β2m-free heterodimerization-dependent control, which may have some implications for the MHC I A splice variant in the fine tuning of classical MHC I A/TCR and MHC I A/killer cell Ig-like receptor interactions.

  18. Characterization of cultivar differences in beta-1,3 glucanase gene expression, glucanase activity and fruit pulp softening rates during fruit ripening in three naturally occurring banana cultivars.

    PubMed

    Roy Choudhury, Swarup; Roy, Sujit; Sengupta, Dibyendu N

    2009-11-01

    beta-1,3 glucanase (E.C.3.2.1.39) is the key enzyme involved in the hydrolytic cleavage of 1,3 beta-D glucosidic linkages in beta-1,3 glucans. This work describes a comparative analysis of expression patterns of beta-1,3 glucanase gene in relation to changes in fruit pulp softening rates in three banana cultivars, Rasthali (AAB), Kanthali (AB), and Monthan (ABB). Analysis of transcript and protein levels of beta-1,3 glucanase gene during ripening revealed differential timing in expression of the gene which correlated well with the variation in enzymatic activity of glucanase and fruit pulp softening rates in the three cultivars. Exogenously applied ethylene strongly induced beta-1,3 glucanase expression during the early ripening days in Rasthali, while the expression of the gene was marginally stimulated following ethylene treatment in preclimacteric Kanthali fruit. Conversely, in Monthan, beta-1,3 glucanase expression was very low throughout the ripening stages, and ethylene treatment did not induce the expression of the gene in this cultivar. Analysis of glucanase activity using protein extracts from unripe and ripe fruit of Monthan with crude cell wall polysaccharide fractions (used as substrate) indicated that the natural substrate for glucanase remained almost unutilized in this cultivar due to low in vivo glucanase activity. Furthermore, the recombinant beta-1,3 glucanase protein, overexpressed in E. coli, showed requirement for substrates with contiguous beta-1,3 linkages for optimal activity. Overall, our results provide new information on the expression profile of beta-1,3 glucanase gene in connection with the pattern of changes in fruit firmness at the physiological and molecular levels during ripening in three banana cultivars. PMID:19697038

  19. Cloning and characterization of the endogenous cephalosporinase gene, cepA, from Bacteroides fragilis reveals a new subgroup of Ambler class A beta-lactamases.

    PubMed Central

    Rogers, M B; Parker, A C; Smith, C J

    1993-01-01

    Bacteroides fragilis CS30 is a clinical isolate resistant to high concentrations of benzylpenicillin and cephaloridine but not to cephamycin or penem antibiotics. beta-Lactam resistance is mediated by a chromosomally encoded cephalosporinase produced at a high level. The gene encoding this beta-lactamase was cloned from genomic libraries constructed in Escherichia coli and then mated with B. fragilis 638 for identification of ampicillin-resistant (Apr) strains. Apr transconjugants contained a nitrocefin-reactive protein with the physical and enzymatic properties of the original CS30 isolate. The beta-lactamase gene (cepA) was localized by deletion analysis and subcloned, and its nucleotide sequence was determined. The 903-bp cepA open reading frame encoded a 300-amino-acid precursor protein (predicted molecular mass, 34,070 Da). A beta-lactamase-deficient mutant strain of B. fragilis 638 was constructed by insertional inactivation with the cepA gene of CS30, demonstrating strict functional homology between these chromosomal beta-lactamase genes. An extensive comparison of the CepA protein sequence by alignment with other beta-lactamases revealed the strict conservation of at least four elements common to Ambler class A. A further comparison of the CepA protein sequence with protein sequences of beta-lactamases from two other Bacteroides species indicated that they constitute their own distinct subgroup of class A beta-lactamases. Images PMID:8285623

  20. A human serotonin 1D receptor variant (5HT1D beta) encoded by an intronless gene on chromosome 6.

    PubMed Central

    Demchyshyn, L; Sunahara, R K; Miller, K; Teitler, M; Hoffman, B J; Kennedy, J L; Seeman, P; Van Tol, H H; Niznik, H B

    1992-01-01

    An intronless gene encoding a serotonin receptor (5HT1D beta) has been cloned and functionally expressed in mammalian fibroblast cultures. Based on the deduced amino acid sequence, the gene encodes a 390-amino acid protein displaying considerable homology, within putative transmembrane domains (approximately 75% identity) to the canine and human 5HT1D receptors. Membranes prepared from CHO cells stably expressing the receptor bound [3H]serotonin with high affinity (Kd 4 nM) and displayed a pharmacological profile consistent, but not identical, with that of the characterized serotonin 5HT1D receptor. Most notably, metergoline and serotonergic piperazine derivatives, as a group, display 3- to 8-fold lower affinity for the 5HT1D beta receptor than for the 5HT1D receptor, whereas both receptors display similar affinities for tryptamine derivatives, including the antimigraine drug sumatriptan. Northern blot analysis revealed an mRNA of approximately 5.5 kilobases expressed in human and monkey frontal cortex, medulla, striatum, hippocampus and amygdala but not in cerebellum, olfactory tubercle, and pituitary. The 5HT1D beta gene maps to human chromosome 6. The existence of multiple neuronal 5HT1D-like receptors may help account for some of the complexities associated with [3H]serotonin binding patterns in native membranes. Images PMID:1351684

  1. Phenotypic detection and molecular characterization of beta-lactamase genes among Citrobacter species in a tertiary care hospital

    PubMed Central

    Praharaj, Ashok Kumar; Khajuria, Atul; Kumar, Mahadevan; Grover, Naveen

    2016-01-01

    Objective: To examine the distribution, emergence, and spread of genes encoding beta-lactamase resistance in Citrobacter species isolated from hospitalized patients in a tertiary care hospital. Methods: A prospective study was conducted in a 1000-bed tertiary care center in Pune, India from October 2010 to October 2013. A total of 221 Citrobacter spp. isolates were recovered from clinical specimens from different patients (one isolate per patient) admitted to the surgical ward, medical ward and medical and surgical Intensive Care Units. Polymerase chain reaction (PCR) assays and sequencing were used to determine the presence of beta-lactamase encoding genes. Conjugation experiments were performed to determine their transferability. Isolate relatedness were determined by repetitive element based-PCR, enterobacterial repetitive intergenic consensus-PCR and randomly amplified polymorphic DNA. Results: Among 221 tested isolates of Citrobacter spp. recovered from various clinical specimens, 179 (80.9%) isolates showed minimum inhibitory concentration (MIC) >4 μg/ml against meropenem and imipenem. One hundred and forty-five isolates with increased MICs value against carbapenems were further processed for molecular characterization of beta-lactamase genes. Susceptibility profiling of the isolates indicated that 100% retained susceptibility to colistin. Conjugation experiments indicated that blaNDM-1 was transferable via a plasmid. Conclusion: The ease of NDM-1 plasmid transmissibility may help their dissemination among the Citrobacter species as well as to others in Enterobacteriaceae. Early detection, antimicrobial stewardship and adequate infection control measures will help in limiting the spread of these organisms. PMID:26952135

  2. Analysis of beta, gamma, and delta T-cell receptor genes in mycosis fungoides and Sezary syndrome.

    PubMed

    Whittaker, S J; Smith, N P; Jones, R R; Luzzatto, L

    1991-10-01

    The authors have analyzed the configuration of immunoglobulin (Ig) and beta, gamma and delta T-cell receptor (TCR) genes in DNA extracted from skin, lymph nodes, and peripheral blood mononuclear cells obtained from 41 patients with mycosis fungoides (MF), 14 patients with Sezary syndrome, and 13 patients with benign inflammatory dermatoses. No discrete rearranged bands (DRB) were detected in patients with inflammatory dermatoses. In tissue DNA from 19 patients with MF DRB were detected with beta and gamma, but not delta TCR probes. Only one patient with MF had a rearrangement of gamma and delta with germ line beta TCR genes. In 13 patients multiple biopsies were analyzed and DRB, when present, were identical in different lesions from individual patients. In three patients analysis of DNA from dermatopathic lymph nodes did not reveal DRB. Analysis of peripheral blood DNA from 24 patients revealed a discrete rearrangement of the gamma TCR gene in four patients and both beta and gamma genes in four additional patients. In MF DRB were detected more frequently with advancing stage of disease in tissues (P less than 0.01) but not in peripheral blood (P equals 0.36). Of 14 patients with Sezary syndrome, eight had DRB in peripheral blood DNA with both beta and gamma probes and in three of these patients identical DRB were also detected in DNA from skin biopsy samples. In contrast, DRB were not detected in the peripheral blood of the other six patients. In both MF and Sezary syndrome there was no restricted usage of particular V gamma genes. These results indicate that in MF (1) T-cell clones can be detected in skin biopsy specimens from the majority of patients with early stage disease, (2) gamma delta T-cell clones are only rarely found, and (3) TCR gene analysis can detect T-cell clones in the peripheral blood with a greater degree of specificity than conventional light microscopic study. In Sezary syndrome these studies also suggest that a subset of patients have a

  3. PARP-1 and YY1 Are Important Novel Regulators of CXCL12 Gene Transcription in Rat Pancreatic Beta Cells

    PubMed Central

    Marković, Jelena; Grdović, Nevena; Dinić, Svetlana; Karan-Djurašević, Teodora; Uskoković, Aleksandra; Arambašić, Jelena; Mihailović, Mirjana; Pavlović, Sonja; Poznanović, Goran; Vidaković, Melita

    2013-01-01

    Despite significant progress, the molecular mechanisms responsible for pancreatic beta cell depletion and development of diabetes remain poorly defined. At present, there is no preventive measure against diabetes. The positive impact of CXCL12 expression on the pancreatic beta cell prosurvival phenotype initiated this study. Our aim was to provide novel insight into the regulation of rat CXCL12 gene (Cxcl12) transcription. The roles of poly(ADP-ribose) polymerase-1 (PARP-1) and transcription factor Yin Yang 1 (YY1) in Cxcl12 transcription were studied by examining their in vitro and in vivo binding affinities for the Cxcl12 promoter in a pancreatic beta cell line by the electrophoretic mobility shift assay and chromatin immunoprecipitation. The regulatory activities of PARP-1 and YY1 were assessed in transfection experiments using a reporter vector with a Cxcl12 promoter sequence driving luciferase gene expression. Experimental evidence for PARP-1 and YY1 revealed their trans-acting potential, wherein PARP-1 displayed an inhibitory, and YY1 a strong activating effect on Cxcl12 transcription. Streptozotocin (STZ)-induced general toxicity in pancreatic beta cells was followed by changes in Cxcl12 promoter regulation. PARP-1 binding to the Cxcl12 promoter during basal and in STZ-compromised conditions led us to conclude that PARP-1 regulates constitutive Cxcl12 expression. During the early stage of oxidative stress, YY1 exhibited less affinity toward the Cxcl12 promoter while PARP-1 displayed strong binding. These interactions were accompanied by Cxcl12 downregulation. In the later stages of oxidative stress and intensive pancreatic beta cell injury, YY1 was highly expressed and firmly bound to Cxcl12 promoter in contrast to PARP-1. These interactions resulted in higher Cxcl12 expression. The observed ability of PARP-1 to downregulate, and of YY1 to upregulate Cxcl12 promoter activity anticipates corresponding effects in the natural context where the functional

  4. Construction of bioactive chimeric MHC class I tetramer by expression and purification of human-murine chimeric MHC heavy chain and beta(2)m as a fusion protein in Escherichia coli.

    PubMed

    Ren, Ding; Wang, Fang; He, Xiaowen; Jiang, Lei; Li, Dean; Ying, He; Sun, Shuhan

    2006-12-01

    Major histocompatibility (MHC) class I tetramers are used in the quantitative analysis of epitope peptide-specific CD8+ T-cells. An MHC class I tetramer was composed of 4 MHC class I complexes and a fluorescently labeled streptavidin (SA) molecule. Each MHC class I complex consists of an MHC heavy chain, a beta(2)-microglobulin (beta(2)m) molecule and a synthetic epitope peptide. In most previous studies, an MHC class I complex was formed in the refolding buffer with an expressed MHC heavy chain molecule and beta(2)m, respectively. This procedure inevitably resulted in the disadvantages of forming unwanted multimers and self-refolding products, and the purification of each kind of monomer was time-consuming. In the present study, the genes of a human/murine chimeric MHC heavy chain (HLA-A2 alpha1, HLA-A2 alpha2 and MHC-H2D alpha3) and beta(2)m were tandem-cloned into plasmid pET17b and expressed as a fusion protein. The recombinant fusion protein was refolded with each of the three HLA-A2 restricted peptides (HBc18-27 FLPSDFFPSI, HBx52-60 HLSLRGLPV, and HBx92-100 VLHKRTLGL) and thus three chimeric MHC class I complexes were obtained. Biotinylation was performed, and its level of efficiency was observed via a band-shift assay in non-reducing polyacrylamide gel electrophoresis (PAGE). Such chimeric MHC class I tetramers showed a sensitive binding activity in monitoring HLA/A2 restrictive cytotoxic T lymphocytes (CTLs) in immunized HLA/A*0201 transgenic mice. PMID:17046278

  5. Mutant HNF-1{alpha} and mutant HNF-1{beta} identified in MODY3 and MODY5 downregulate DPP-IV gene expression in Caco-2 cells

    SciTech Connect

    Gu Ning; Adachi, Tetsuya; Matsunaga, Tetsuro; Takeda, Jun; Tsujimoto, Gozoh; Ishihara, Akihiko; Yasuda, Koichiro; Tsuda, Kinsuke . E-mail: jinkan@tom.life.h.kyoto-u.ac.jp

    2006-08-04

    Dipeptidylpeptidase IV (DPP-IV) is a well-documented drug target for the treatment of type 2 diabetes. Hepatocyte nuclear factors (HNF)-1{alpha} and HNF-1{beta}, known as the causal genes of MODY3 and MODY5, respectively, have been reported to be involved in regulation of DPP-IV gene expression. But, it is not completely clear (i) that they play roles in regulation of DPP-IV gene expression, and (ii) whether DPP-IV gene activity is changed by mutant HNF-1{alpha} and mutant HNF-1{beta} in MODY3 and MODY5. To explore these questions, we investigated transactivation effects of wild HNF-1{alpha} and 13 mutant HNF-1{alpha}, as well as wild HNF-1{beta} and 2 mutant HNF-1{beta}, on DPP-IV promoter luciferase gene in Caco-2 cells by means of a transient experiment. Both wild HNF-1{alpha} and wild HNF-1{beta} significantly transactivated DPP-IV promoter, but mutant HNF-1{alpha} and mutant HNF-1{beta} exhibited low transactivation activity. Moreover, to study whether mutant HNF-1{alpha} and mutant HNF-1{beta} change endogenous DPP-IV enzyme activity, we produced four stable cell lines from Caco-2 cells, in which wild HNF-1{alpha} or wild HNF-1{beta}, or else respective dominant-negative mutant HNF-1{alpha}T539fsdelC or dominant-negative mutant HNF-1{beta}R177X, was stably expressed. We found that DPP-IV gene expression and enzyme activity were significantly increased in wild HNF-1{alpha} cells and wild HNF-1{beta} cells, whereas they decreased in HNF-1{alpha}T539fsdelC cells and HNF-1{beta}R177X cells, compared with DPP-IV gene expression and enzyme activity in Caco-2 cells. These results suggest that both wild HNF-1{alpha} and wild HNF-1{beta} have a stimulatory effect on DPP-IV gene expression, but that mutant HNF-1{alpha} and mutant HNF-1{beta} attenuate the stimulatory effect.

  6. Lysyl oxidase like 4, a novel target gene of TGF-{beta}1 signaling, can negatively regulate TGF-{beta}1-induced cell motility in PLC/PRF/5 hepatoma cells

    SciTech Connect

    Kim, Dong Joon; Lee, Dong Chul; Yang, Suk-Jin; Lee, Jung Ju; Bae, Eun Mi; Kim, Dong Min; Min, Sang Hyun; Kim, Soo Jung; Kang, Dong Chul; Sang, Byung Chan; Myung, Pyung Keun; Park, Kyung Chan Yeom, Young Il

    2008-09-05

    Transforming growth factor-{beta}1 (TGF-{beta}1) is a multi-functional cytokine involved in the regulation of cell proliferation, differentiation and extracellular matrix formation. In search for novel genes mediating the TGF-{beta}1 function at downstream signaling, we performed a cDNA microarray analysis and identified 60 genes whose expression is regulated by TGF-{beta}1 in the liver cancer cell line PLC/PRF/5. Among them, we report here lysyl oxidase like 4 (LOXL4) as a novel target of TGF-{beta}1 signaling, and provide experimental evidence for its expression regulation and function. LOXL4 was found to be the only member of LOX family whose expression is induced by TGF-{beta}1 in hepatoma cells. Deletion mapping of the LOXL4 promoter indicated that the TGF-{beta}1 regulation of LOXL4 expression is mediated through the binding of AP1 transcription factor to a conserved region of the promoter. This was confirmed by the chromatin immunoprecipitation assay that captured c-Fos-bound chromatin from TGF-{beta}1-treated cells. Forced expression of LOXL4 in PLC/PRF/5 cells resulted in inhibition of cell motility through Matrigel in the presence of TGF-{beta}1 treatment. In parallel, LOXL4 suppressed the expression of laminins and {alpha}3 integrin and the activity of MMP2. These results suggest that LOXL4 may function as a negative feedback regulator of TGF-{beta}1 in cell invasion by inhibiting the metabolism of extracellular matrix (ECM) components.

  7. Cloning and characterization of the gene for beta-tubulin from a benomyl-resistant mutant of Neurospora crassa and its use as a dominant selectable marker.

    PubMed Central

    Orbach, M J; Porro, E B; Yanofsky, C

    1986-01-01

    We cloned the beta-tubulin gene of Neurospora crassa from a benomyl-resistant strain and determined its nucleotide sequence. The gene encodes a 447-residue protein which shows strong homology to other beta-tubulins. The coding region is interrupted by six introns, five of which are within the region coding for the first 54 amino acids of the protein. Intron position comparisons between the N. crassa gene and other fungal beta-tubulin genes reveal considerable positional conservation. The mutation responsible for benomyl resistance was determined; it caused a phenylalanine-to-tyrosine change at position 167. Codon usage in the beta-tubulin gene is biased, as has been observed for other abundantly expressed N. crassa genes such as am and the H3 and H4 histone genes. This bias results in pyrimidines in the third positions of 96% of the codons in codon families in which there is a choice between purines and pyrimidines in this position. Bias is also evident by the absence of 19 of the 61 sense codons. We demonstrated that benomyl resistance is due to the cloned beta-tubulin gene of strain Bml511(r)a and that this gene can be used as a dominant selectable marker in N. crassa transformation. PMID:2946938

  8. Population genetics of a functional variant of the dopamine beta-hydroxylase gene (DBH).

    PubMed

    Cubells, J F; Kobayashi, K; Nagatsu, T; Kidd, K K; Kidd, J R; Calafell, F; Kranzler, H R; Ichinose, H; Gelernter, J

    1997-07-25

    Dopamine beta-hydroxylase (E.C. 1.14.17.1; protein abbreviation: DbetaH) catalyzes conversion of dopamine to norepinephrine. Previous work identified two expressed alleles of the gene encoding DbetaH (locus symbol DBH), containing either G or T at nucleotide position 910, resulting in specification by codon 304 of alanine (DBH*304A) or serine (DBH*304S), respectively. The current study employed denaturing gradient gel electrophoresis to identify these alleles, and after developing a PCR RFLP for rapid genotyping, estimated the frequencies of the alleles in African-Americans, European-Americans, and in several geographically dispersed populations (Mbuti, Danes, Adygei, Chinese, Japanese, Surui, Maya, and Nasioi). DBH*304A was the most common allele in all populations tested, with allele frequencies greater than 0.80 in each case. There was significant heterogeneity in allele frequency across population groups. The DBH*304S allele was most common in subjects of African descent, and least common in East Asians and individuals from indigenous populations of North and South America. The frequency of DBH*304S was significantly higher in African-Americans (0.16) than in European-Americans (0.06; P < 0.004). Of the four DBH*304S homozygotes observed, all were Europeans and three of the four were Danes. Based on empirical P-values generated by computer simulation, the observed proportions of DBH*304S homozygotes did not differ significantly from Hardy-Weinberg expectations in any of the populations after Bonferroni correction for multiple comparisons. The observation of significant heterogeneity in DBH*304S allele frequency across different population samples demonstrates the importance of controlling for population stratification in future studies testing for associations between DBH*304S and clinical phenotypes. PMID:9259372

  9. Mutations in the lysosomal [beta]-galactosidase gene that cause the adult form of GMI gangliosidosis

    SciTech Connect

    Chakraborty, S.; Rafi, M.A.; Wenger, D.A. )

    1994-06-01

    Three adult patients with acid-galactosidase deficiency/GM1 gangliosidosis who were from two unrelated families of Scandinavian descent were found to share a common point mutation in the coding region of the corresponding gene. The patients share common clinical features, including early dysarthria, mild ataxia, and bone abnormalities. When cDNA from the two patients in family 1 was PCR amplified and sequenced, most (39/41) of the clones showed a C-to-T transition (C[yields]T) at nucleotide 245 (counting from the initiation codon). This mutation changes the codon for the Thr(ACG) to Met(ATG). Mutant and normal sequences were also found in that position in genomic DNA, indicating the presence of another mutant allele. Genomic DNA from the patient in family 2 revealed the same point mutation in one allele. It was determined that in each family only the father carried the C[yields]T mutation. Expression studies showed that this mutation produced 3%-4% of [beta]-galactosidase activity, confirming its deleterious effects. The cDNA clones from the patients in family 1 that did not contain the C[yields]T revealed a 20-bp insertion of intronic sequence between nucleotides 75 and 76, the location of the first intron. Further analysis showed the insertion of a T near the 5[prime] splice donor site which led to the use of a cryptic splice site. It appears that the C[yields]T mutation results in enough functional enzyme to produce a mild adult form of the disease, even in the presence of a second mutation that likely produces nonfunctional enzyme. 31 refs., 7 figs., 1 tab.

  10. CREB-dependent gene regulation by prion protein: impact on MMP-9 and beta-dystroglycan.

    PubMed

    Pradines, Elodie; Loubet, Damien; Schneider, Benoît; Launay, Jean-Marie; Kellermann, Odile; Mouillet-Richard, Sophie

    2008-11-01

    Corruption of the normal function of the cellular prion protein (PrP(C)) by the scrapie isoform (PrP(Sc)) emerges as a critical causal event in Transmissible Spongiform Encaphalopathies (TSE) pathogenesis. However, PrP(C) physiological role remains unclear. By exploiting the properties of the 1C11 neuroectodermal cell line, able to convert into 1C11(5-HT) serotonergic or 1C11(NE) noradrenergic neuronal cells, we assigned a signaling function to PrP(C). Here, we establish that antibody-mediated PrP(C) ligation promotes the recruitment of the cAMP responsive element binding protein (CREB) transcription factor downstream from the MAPK ERK1/2, in 1C11 precursor cells and their 1C11(5-HT) and 1C11(NE) neuronal progenies. Whatever the differentiation state of 1C11 cells, the PrP(C)-dependent CREB activation triggers Egr-1 and c-fos transcription, two immediate early genes that relay CREB's role in cell survival and proliferation as well as in neuronal plasticity. Furthermore, in 1C11-derived neuronal cells, we draw a link between the PrP(C)-CREB coupling and a transcriptional regulation of the metalloproteinase MMP-9 and its inhibitor TIMP-1, which play pivotal roles in neuronal pathophysiology. Finally, the PrP(C)-dependent control on MMP-9 impacts on the processing of the transmembrane protein, beta-dystroglycan. Taken together, our data define molecular mechanisms that likely mirror PrP(C) ubiquitous contribution to cytoprotection and its involvement in neuronal plasticity.

  11. Differential fate of erythromycin and beta-lactam resistance genes from swine lagoon waste under different aquatic conditions.

    PubMed

    Knapp, Charles W; Zhang, Wen; Sturm, Belinda S M; Graham, David W

    2010-05-01

    The attenuation and fate of erythromycin-resistance-methylase (erm) and extended-spectrum beta-lactamse (bla) genes were quantified over time in aquatic systems by adding 20-L swine waste to 11,300-L outdoor mesocosms that simulated receiving water conditions below intensive agricultural operations. The units were prepared with two different light-exposure scenarios and included artificial substrates to assess gene movement into biofilms. Of eleven genes tested, only erm(B), erm(F), bla(SHV) and bla(TEM) were found in sufficient quantity for monitoring. The genes disappeared rapidly from the water column and first-order water-column disappearance coefficients were calculated. However, detected gene levels became elevated in the biofilms within 2 days, but then disappeared over time. Differences were observed between sunlight and dark treatments and among individual genes, suggesting that ecological and gene-specific factors play roles in the fate of these genes after release into the environment. Ultimately, this information will aid in generating better predictive models for gene fate. PMID:20053492

  12. Genetic mapping of the beta 1 GABA receptor gene to human chromosome 4, using a tetranucleotide repeat polymorphism.

    PubMed Central

    Dean, M; Lucas-Derse, S; Bolos, A; O'Brien, S J; Kirkness, E F; Fraser, C M; Goldman, D

    1991-01-01

    As more coding loci for functional human genes are described, there is a growing need to identify DNA polymorphisms in specific genes. By examining DNA sequences within the introns of the beta 1 subunit of the gamma-aminobutyric acid receptor gene, GABARB1, we found a tetranucleotide repeat sequence (GATA). Amplification of this region by using PCR revealed seven alleles and a high degree of polymorphism (PIC = .75) in human populations. DNAs from the CEPH families were typed for the GABARB1 intron polymorphism and were analyzed with respect to 20 linked markers on chromosome 4. The results permit placement of GABARB1 on the linkage map of chromosome 4, between D4S104 and ALB. These results affirm that sequence analysis of noncoding segments included within or adjacent to functional genes has value as a strategy to detect highly informative polymorphisms. Images Figure 2 PMID:1652891

  13. SNP analyses of growth factor genes EGF, TGF{beta}-1, and HGF reveal haplotypic association of EGF with autism

    SciTech Connect

    Toyoda, Takao; Thanseem, Ismail; Kawai, Masayoshi; Sekine, Yoshimoto; Nakamura, Kazuhiko; Anitha, Ayyappan; Suda, Shiro . E-mail: nakamura@hama-med.ac.jp; Yamada, Kazuo; Tsujii, Masatsugu |; Iwayama, Yoshimi; Hattori, Eiji; Toyota, Tomoko; Yoshikawa, Takeo; Miyachi, Taishi; Tsuchiya, Kenji; Sugihara, Gen-ichi; Matsuzaki, Hideo; Iwata, Yasuhide; Suzuki, Katsuaki; Mori, Norio |; Ouchi, Yasuomi |; Sugiyama, Toshiro; Takei, Nori

    2007-09-07

    Autism is a pervasive neurodevelopmental disorder diagnosed in early childhood. Growth factors have been found to play a key role in the cellular differentiation and proliferation of the central and peripheral nervous systems. Epidermal growth factor (EGF) is detected in several regions of the developing and adult brain, where, it enhances the differentiation, maturation, and survival of a variety of neurons. Transforming growth factor-{beta} (TGF{beta}) isoforms play an important role in neuronal survival, and the hepatocyte growth factor (HGF) has been shown to exhibit neurotrophic activity. We examined the association of EGF, TGF{beta}1, and HGF genes with autism, in a trio association study, using DNA samples from families recruited to the Autism Genetic Resource Exchange; 252 trios with a male offspring scored for autism were selected for the study. Transmission disequilibrium test revealed significant haplotypic association of EGF with autism. No significant SNP or haplotypic associations were observed for TGF{beta}1 or HGF. Given the role of EGF in brain and neuronal development, we suggest a possible role of EGF in the pathogenesis of autism.

  14. Transgenic mice containing a 248-kb yeast artificial chromosome carrying the human beta-globin locus display proper developmental control of human globin genes.

    PubMed Central

    Peterson, K R; Clegg, C H; Huxley, C; Josephson, B M; Haugen, H S; Furukawa, T; Stamatoyannopoulos, G

    1993-01-01

    Transgenic mice were generated using a purified 248-kb yeast artificial chromosome (YAC) bearing an intact 82-kb human beta-globin locus and 148 kb of flanking sequence. Seventeen of 148 F0 pups were transgenic. RNase protection analysis of RNA isolated from the blood of 13 gamma- and beta-globin-positive founders showed that only the human beta-globin gene was expressed in the adult founders. Studies of F1 and F2 fetuses demonstrated that the genes of the beta-locus YAC displayed the proper developmental switches in beta-like globin gene expression. Expression of epsilon- and gamma-globin, but not beta-globin, was observed in the yolk sac, there was only minor gamma and mostly beta expression in the 14-day liver, and only beta mRNA in the blood of the adult animals. Structural data showed that the locus was intact. These results indicate that it is now possible to dissect regulatory mechanisms within the context of an entire locus in vivo by using the ability to perform mutagenesis efficiently in yeast via homologous recombination, followed by purification of the altered YAC and its introduction into mice. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:8356061

  15. Selection and validation of reference house-keeping genes in the J774A1 macrophage cell line for quantitative real-time PCR.

    PubMed

    Ferraz, F B; Fernandez, J H

    2016-01-01

    Macrophages are essential components of the innate and adaptive immune responses, playing a decisive role in atherosclerosis, asthma, obesity, and cancer. The differential gene expression resulting from adhesion of macrophages to the extra-cellular matrix (ECM) has been studied in the J774A1 murine macrophage cell line using quantitative polymerase chain reaction (qPCR). The goal of this study was to identify housekeeping genes (HKGs) that remain stable and unaltered under normal culture conditions and in the presence of laminin after a time lapse of 6 and 24 h. The expression stabilities of eight commonly used reference genes were analyzed by determining the comparative threshold cycle ((ΔΔ)Ct) values, and using the BestKeeper, NormFinder, and geNorm algorithms. BestKeeper analysis revealed that the glyceraldehyde-3-phosphate dehydrogenase (GAPDH), peptidylprolyl isomerase A (PPIA), and ribosomal protein L13a (RPL13A) genes were highly stable, confirming the results of the (ΔΔ)Ct analysis. On the other hand, NormFinder proposed RPL13A and beta-glucuronidase (GUSB) to be the most suitable combination, and geNorm adjudged RPL13A, PPIA, and GUSB to be the most stable across all culture conditions. All programs discarded the use of actin beta and beta-2-microglobulin for normalization. The collected data indicated that RPL13A, PPIA, GAPDH, and GUSB as highly suitable as reference genes for qPCR analysis of murine macrophages under normal and ECM-simulated culture conditions. This study also emphasizes the importance of evaluating HKGs used for normalization to ensure the accuracy of qPCR data. PMID:26985962

  16. Isolation and linkage analysis of expressed disease-resistance gene analogues of sugar beet (Beta vulgaris L.).

    PubMed

    Hunger, Sandra; Di Gaspero, Gabriele; Möhring, Slike; Bellin, Diana; Schäfer-Pregl, Ralf; Borchardt, Dietrich C; Durel, Charles-Eric; Werber, Martin; Weisshaar, Bernd; Salamini, Francesco; Schneider, Katharina

    2003-02-01

    Sequence conservation among resistance genes (R genes) was exploited to identify 47 R gene analogues (RGAs) from sugar beet (Beta vulgaris L.). Using degenerate primers, 11 RGAs were amplified from genomic DNA and 7 from leaf or beet cDNA. Twenty-nine were selected from an EST sequencing program. Twenty-one RGAs contained structures similar to the nucleotide binding site (NBS)--leucine rich repeat (LRR) domain, a motif commonly found in several R genes. Among the remaining RGAs, 19 revealed similarity to the serine (threonine) protein kinase domain of R genes, 4 showed features related to the LRR region of the rice disease resistance gene Xa21, 1 RGA resembled the sugar beet nematode resistance gene Hs1pro-1, and 2 had homologies to other gene products associated with disease resistance. For 20 EST-derived RGAs, transcript levels were compared in leaf and root tissue revealing organ-specific transcription in 7 cases. Thirty-three RGAs were spread over all nine sugar beet chromosomes, except for a cluster of nine closely linked RGAs on chromosome 7. The analysis of linkage between RGAs and loci for rhizomania and Cercospora resistance identified alleles associated with resistance in both cases.

  17. Cloning and characterization of KNR4, a yeast gene involved in (1,3)-beta-glucan synthesis.

    PubMed Central

    Hong, Z; Mann, P; Brown, N H; Tran, L E; Shaw, K J; Hare, R S; DiDomenico, B

    1994-01-01

    k9 killer toxin from Hansenula mrakii was used to select a number of resistant mutants from Saccharomyces cerevisiae. Preliminary biochemical and genetic studies showed that some of them acquired structural defects in the cell wall. One of these mutants, the knr4-1 mutant, displays a number of cell wall defects, including osmotic sensitivity; sensitivity to cercosporamide, a known antifungal agent; and resistance to Zymolyase, a (1,3)-beta-glucanase. We report here the isolation and analysis of the KNR4 gene. DNA sequence analysis revealed an uninterrupted open reading frame which contains five potential start codons. The longest coding template encodes a protein of 505 amino acids with a calculated molecular mass of 57,044 Da. A data base search revealed 100% identity with a nuclear protein, SMI1p. Disruption of the KNR4 locus does not result in cell death; however, it leads to reduced levels of both (1,3)-beta-glucan synthase activity and (1,3)-beta-glucan content in the cell wall. The gene was mapped to the right arm of chromosome VII. Images PMID:8289782

  18. Normal transcription of the beta-hexosaminidase alpha-chain gene in the Ashkenazi Tay-Sachs mutation.

    PubMed

    Paw, B H; Neufeld, E F

    1988-02-25

    Tay-Sachs disease is a biochemically heterogeneous lysosomal storage disorder caused by lack of the A isoenzyme of beta-hexosaminidase; the underlying defect is a mutation in the gene encoding the alpha-chain. It has been shown that fibroblasts isolated from Tay-Sachs patients of Ashkenazi Jewish origin contain no alpha-chain mRNA detectable on Northern blots. We now have compared run-on transcription in nuclei isolated from three strains of Ashkenazi Tay-Sachs fibroblasts and from a strain of normal (IMR90) cells. Using alpha-chain and beta-chain cDNAs as probes, we found no difference in the relative amount of [32P]ribonucleotide added to nascent transcripts; the average ratio of alpha/beta hybridizable radioactivity was 1.3 and 1.4 for mutant and normal cells, respectively. The identity of the Tay-Sachs alpha-chain transcript was confirmed by competition hybridization with excess alpha-chain mRNA. The results indicate that the Ashkenazi Tay-Sachs mutation permits a normal level of transcription of the alpha-chain gene and points to a posttranscriptional defect, such as RNA processing, transport, or stability.

  19. Defective pigment granule biogenesis and aberrant behavior caused by mutations in the Drosophila AP-3beta adaptin gene ruby.

    PubMed Central

    Kretzschmar, D; Poeck, B; Roth, H; Ernst, R; Keller, A; Porsch, M; Strauss, R; Pflugfelder, G O

    2000-01-01

    Lysosomal protein trafficking is a fundamental process conserved from yeast to humans. This conservation extends to lysosome-like organelles such as mammalian melanosomes and insect eye pigment granules. Recently, eye and coat color mutations in mouse (mocha and pearl) and Drosophila (garnet and carmine) were shown to affect subunits of the heterotetrameric adaptor protein complex AP-3 involved in vesicle trafficking. Here we demonstrate that the Drosophila eye color mutant ruby is defective in the AP-3beta subunit gene. ruby expression was found in retinal pigment and photoreceptor cells and in the developing central nervous system. ruby mutations lead to a decreased number and altered size of pigment granules in various cell types in and adjacent to the retina. Humans with lesions in the related AP-3betaA gene suffer from Hermansky-Pudlak syndrome, which is caused by defects in a number of lysosome-related organelles. Hermansky-Pudlak patients have a reduced skin pigmentation and suffer from internal bleeding, pulmonary fibrosis, and visual system malfunction. The Drosophila AP-3beta adaptin also appears to be involved in processes other than eye pigment granule biogenesis because all ruby allele combinations tested exhibited defective behavior in a visual fixation paradigm. PMID:10790396

  20. Cloning and characterization of a novel gene that encodes (S)-beta-bisabolene synthase from ginger, Zingiber officinale.

    PubMed

    Fujisawa, Masaki; Harada, Hisashi; Kenmoku, Hiromichi; Mizutani, Satoru; Misawa, Norihiko

    2010-06-01

    Ginger, Zingiber officinale Roscoe, contains a fragrant oil mainly composed of sesquiterpenes and monoterpenes. We isolated a cDNA that codes for a sesquiterpene synthase from young rhizomes of ginger, Z. officinale Roscoe, Japanese cultivar "Kintoki". The cDNA, designated ZoTps1, potentially encoded a protein that comprised 550 amino acid residues and exhibited 49-53% identity with those of the sesquiterpene synthases already isolated from the genus Zingiber. Recombinant Escherichia coli cells, in which ZoTps1 was coexpressed along with genes for D-mevalonate utilization, resulted in the production of a sesquiterpene (S)-beta-bisabolene exclusively with a D-mevalonolactone supplement. This result indicated that ZoTps1 was the (S)-beta-bisabolene synthase gene in ginger. ZoTPS1 was suggested to catalyze (S)-beta-bisabolene formation with the conversion of farnesyl diphosphate to nerolidyl diphosphate followed by the cyclization between position 1 and 6 carbons. The ZoTps1 transcript was detected in young rhizomes, but not in leaves, roots and mature rhizomes of the ginger "Kintoki". PMID:20229191

  1. Localization of eight additional genes in the human major histocompatibility complex, including the gene encoding the casein kinase II {beta} subunit (CSNK2B)

    SciTech Connect

    Albertella, M.R.; Jones, H.; Thomson, W.

    1996-09-01

    A wide range of autoimmune and other diseases are known to be associated with the major histocompatibility complex. Many of these diseases are linked to the genes encoding the polymorphic histocompatibility complex. Many of these diseases are linked to the genes encoding the polymorphic histocompatibility antigens in the class I and class II regions, but some appear to be more strongly associated with genes in the central 1100-kb class III region, making it important to characterize this region fully for the presence of novel genes. An {approximately}220-kb segment of DNA in the class III region separating the Hsp70 (HSPA1L) and BAT1 (D6S8IE) genes, which was previously known to contain 14 genes. Genomic DNA fragments spanning the gaps between the known genes were used as probes to isolate cDNAs corresponding to five new genes within this region. Evidence from Northern blot analysis and exon trapping experiments that suggested the presence of at least two more new genes was also obtained. Partial cDNA and complete exonic genomic sequencing of one of the new genes has identified it as the casein kinase II{beta} subunit (CSNK2B). Two of the other novel genes lie within a region syntenic to that implicated in susceptibility to experimental allergic orchitis in the mouse, an autoimmune disease of the testis, and represent additional candidates for the Orch-1 locus associated with this disease. In addition, characterization of the 13-kb intergenic gap separating the RD (D6545) and G11 (D6S60E) genes has revealed the presence of a gene encoding a 1246-amino-acid polypeptide that shows significant sequence similarity to the yeast anti-viral Ski2p gene product. 49 refs., 8 figs.

  2. Gene clusters for beta-lactam antibiotics and control of their expression: why have clusters evolved, and from where did they originate?

    PubMed

    Liras, Paloma; Martín, Juan F

    2006-03-01

    While beta-lactam compounds were discovered in filamentous fungi, actinomycetes and gram-negative bacteria are also known to produce different types of beta-lactams. All beta-lactam compounds contain a four-membered beta-lactam ring. The structure of their second ring allows these compounds to be classified into penicillins, cephalosporins, clavams, carbapenens or monobactams. Most beta-lactams inhibits bacterial cell wall biosynthesis but others behave as beta-lactamase inhibitors (e.g., clavulanic acid) and even as antifungal agents (e.g., some clavams). Due to the nature of the second ring in beta-lactam molecules, the precursors and biosynthetic pathways of clavams, carbapenems and monobactams differ from those of penicillins and cephalosporins. These last two groups, including cephamycins and cephabacins, are formed from three precursor amino acids that are linked into the alpha-aminoadipyl-L-cysteinyl-D-valine tripeptide. The first two steps of their biosynthetic pathways are common. The intermediates of these pathways, the characteristics of the enzymes involved, the lack of introns in the genes and bioinformatic analysis suggest that all of them should have evolved from an ancestral gene cluster of bacterial origin, which was surely transferred horizontally in the soil from producer to non-producer microorganisms. The receptor strains acquired fragments of the original bacterial cluster and occasionally inserted new genes into the clusters, which once modified, acquired new functions and gave rise to the final compounds that we know. When the order of genes in the Streptomyces genome is analyzed, the antibiotic gene clusters are highlighted as gene islands in the genome. Nonetheless, the assemblage of the ancestral beta-lactam gene cluster remains a matter of speculation. PMID:16636985

  3. The Role of Plastids in the Expression of Nuclear Genes for Thylakoid Proteins Studied with Chimeric [beta]-Glucuronidase Gene Fusions.

    PubMed Central

    Bolle, C.; Sopory, S.; Lubberstedt, T.; Klosgen, R. B.; Herrmann, R. G.; Oelmuller, R.

    1994-01-01

    We have analyzed plastid and nuclear gene expression in tobacco seedlings using the carotenoid biosynthesis inhibitor nor-flurazon. mRNA levels for three nuclear-encoded chlorophyll-binding proteins of photosystem I and photosystem II (CAB I and II and the CP 24 apoprotein) are no longer detectable in photobleached seedlings, whereas those for other components of the thylakoid membrane (the 33- and 23-kD polypeptides and Rieske Fe/S polypeptide) accumulate to some extent. Transgenic tobacco seedlings with promoter fusions from genes for thylakoid membrane proteins exhibit a similar expression behavior: a CAB-[beta]-glucuronidase (GUS) gene fusion is not expressed in herbicide-treated seedlings, whereas PC-, FNR-, PSAF-, and ATPC-promoter fusions are expressed, although at reduced levels. All identified segments in nuclear promoters analyzed that have been shown to respond to light also respond to photodamage to the plastids. Thus, the regulatory signal pathways either merge prior to gene regulation or interact with closely neighboring cis elements. These results indicate that plastids control nuclear gene expression via different and gene-specific cis-regulatory elements and that CAB gene expression is different from the expression of the other genes tested. Finally, a plastid-directing import sequence from the maize Waxy gene is capable of directing the GUS protein into the photodamaged organelle. Therefore, plastid import seems to be functional in photobleached organelles. PMID:12232290

  4. Binding of HMG 17 to mononucleosomes of the avian beta-globin gene cluster in erythroid and non-erythroid cells.

    PubMed Central

    Brotherton, T W; Reneker, J; Ginder, G D

    1990-01-01

    The binding of HMG 17 to stripped core mononucleosomes containing DNA from the avian beta-globin gene cluster was examined to determine whether binding in vitro in this developmentally-regulated gene domain was associated with transcriptional activity or DNaseI-sensitivity in intact nuclei. Mononucleosomes were prepared from primitive and definitive stage embryonic red blood cells of chick embryos, adult reticulocytes, adult reticulocytes in which embryonic rho-globin transcription was induced, and adult thymus cells. Preferential binding by HMG 17 to mononucleosomes containing the beta-globin gene cluster was confined to erythroid-derived mononucleosomes that contain the embryonic rho-globin gene, the adult beta-globin gene, and DNA sequences located between these two genes, but not to those that contain the embryonic epsilon-globin gene. Comparison of these results to the known patterns of transcription and DNaseI-sensitivity within the beta-globin gene cluster shows that HMG 17 binding, although tissue-specific, does not correlate directly with either DNaseI-sensitivity or active gene transcription, but is dependent on other factors present in core mononucleosomes from this active gene domain. Images PMID:1692412

  5. Associations of a polymorphic AP-2 binding site in the 5'-flanking region of the bovine beta-lactoglobulin gene with milk proteins.

    PubMed

    Kuss, A W; Gogol, J; Geidermann, H

    2003-06-01

    Studies on a polymorphic position (R10) in an Activator-Protein-2 (AP-2) binding site of the bovine beta-Lactoglobulin (beta-Lg) gene promoter region and quantitative traits of individual milk proteins were based on material from 79 German Holstein Friesian (HF) and 61 Simmental (Sm) cows. At least four milk samples per cow were analyzed with alkaline Urea-PAGE in combination with densitometry for quantification of individual milk proteins. The two alleles of the R10 single nucleotide polymorphism (SNP) carry either G or C in position -435 bp of the beta-Lg promoter region. G- and C-alleles were found in Sm with nearly equal frequencies, while in HF the C-allele frequency was higher (0.73) than that of the G-allele. In both breeds, the R10 G-homozygotes had higher (P < 0.001) amounts of beta-Lg secreted per day and proportion of beta-Lg in milk protein compared with the C-homozygotes. A similar association was found for alpha-lactalbumin, whereas the relative proportions and daily secreted amounts of caseins (alphaS1, beta, kappa) showed lower values in beta-Lg R10 G-homozygotes. A positive association (P < 0.001) of R10 CC with milk yield has also been observed and indicates a close proximity of the beta-Lg locus to a candidate gene for this trait. The association between the SNP in the AP-2 binding site of the beta-Lg gene and its gene product can be explained as the result of differences in protein binding activity, and, therefore, allele specific differences in gene expression. Thus, our study clearly links a DNA polymorphism of molecular function very closely with in vivo expression parameters of the same locus.

  6. Beta-globin gene evolution in the ruminants: evidence for an ancient origin of sheep haplotype B.

    PubMed

    Jiang, Y; Wang, X; Kijas, J W; Dalrymple, B P

    2015-10-01

    Domestic sheep (Ovis aries) can be divided into two groups with significantly different responses to hypoxic environments, determined by two allelic beta-globin haplotypes. Haplotype A is very similar to the goat beta-globin locus, whereas haplotype B has a deletion spanning four globin genes, including beta-C globin, which encodes a globin with high oxygen affinity. We surveyed the beta-globin locus using resequencing data from 70 domestic sheep from 42 worldwide breeds and three Ovis canadensis and two Ovis dalli individuals. Haplotype B has an allele frequency of 71.4% in O. aries and was homozygous (BB) in all five wild sheep. This shared ancestry indicates haplotype B is at least 2-3 million years old. Approximately 40 kb of the sequence flanking the ~37-kb haplotype B deletion had unexpectedly low identity between haplotypes A and B. Phylogenetic analysis showed that the divergent region of sheep haplotype B is remarkably distinct from the beta-globin loci in goat and cattle but still groups with the Ruminantia. We hypothesize that this divergent ~40-kb region in haplotype B may be from an unknown ancestral ruminant and was maintained in the lineage to O. aries, but not other Bovidae, evolving independently of haplotype A. Alternatively, the ~40-kb sequence in haplotype B was more recently acquired by an ancestor of sheep from an unknown non-Bovidae ruminant, replacing part of haplotype A. Haplotype B has a lower nucleotide diversity than does haplotype A, suggesting a recent bottleneck, whereas the higher frequency of haplotype B suggests a subsequent spread through the global population of O. aries.

  7. Beta-globin gene evolution in the ruminants: evidence for an ancient origin of sheep haplotype B.

    PubMed

    Jiang, Y; Wang, X; Kijas, J W; Dalrymple, B P

    2015-10-01

    Domestic sheep (Ovis aries) can be divided into two groups with significantly different responses to hypoxic environments, determined by two allelic beta-globin haplotypes. Haplotype A is very similar to the goat beta-globin locus, whereas haplotype B has a deletion spanning four globin genes, including beta-C globin, which encodes a globin with high oxygen affinity. We surveyed the beta-globin locus using resequencing data from 70 domestic sheep from 42 worldwide breeds and three Ovis canadensis and two Ovis dalli individuals. Haplotype B has an allele frequency of 71.4% in O. aries and was homozygous (BB) in all five wild sheep. This shared ancestry indicates haplotype B is at least 2-3 million years old. Approximately 40 kb of the sequence flanking the ~37-kb haplotype B deletion had unexpectedly low identity between haplotypes A and B. Phylogenetic analysis showed that the divergent region of sheep haplotype B is remarkably distinct from the beta-globin loci in goat and cattle but still groups with the Ruminantia. We hypothesize that this divergent ~40-kb region in haplotype B may be from an unknown ancestral ruminant and was maintained in the lineage to O. aries, but not other Bovidae, evolving independently of haplotype A. Alternatively, the ~40-kb sequence in haplotype B was more recently acquired by an ancestor of sheep from an unknown non-Bovidae ruminant, replacing part of haplotype A. Haplotype B has a lower nucleotide diversity than does haplotype A, suggesting a recent bottleneck, whereas the higher frequency of haplotype B suggests a subsequent spread through the global population of O. aries. PMID:26096044

  8. Identification and characterization of NADPH-dependent cytochrome P450 reductase gene and cytochrome b₅ gene from Plutella xylostella: possible involvement in resistance to beta-cypermethrin.

    PubMed

    Chen, Xi'en; Zhang, Yalin

    2015-03-10

    NADPH-cytochrome P450 reductase (CPR) and cytochrome b5 (b5) are essential for cytochrome P450 mediated biological reactions. CPR and b5 in several insects have been found to be associated with insecticide resistance. However, CPR and b5 in the diamondback moth (DBM), Plutella xylostella, are not characterized and their roles remain undefined. A full-length cDNA of CPR encoding 678 amino acids and a full-length cDNA of b5 encoding 127 amino acids were cloned from DBM. Their deduced amino acid sequences shared high identities with those of other insects and showed characteristics of classical CPRs and b5s, respectively. The mRNAs of both genes were detectable in all developmental stages with the highest expression levels occurring in the 4th instar larvae. Tissue-specific expression analysis showed that their transcripts were most abundant in gut. Transcripts of CPR and b5 in the beta-cypermethrin resistant DBM strain were 13.2- and 2.84-fold higher than those in the beta-cypermethrin susceptible strain, respectively. The expression levels of CPR and b5 were enhanced by beta-cypermethrin at the concentration of 12 mg L(-1) (~LC10). The results indicate that CPR and b5 may play essential roles in the P450 mediated resistance of DBM to beta-cypermethrin or even other insecticides.

  9. Association of interleukin 1beta gene (+3953) polymorphism and severity of endometriosis in Turkish women.

    PubMed

    Attar, Rukset; Agachan, Bedia; Kucukhuseyin, Ozlem; Toptas, Bahar; Attar, Erkut; Isbir, Turgay

    2010-01-01

    Endometriosis is regarded as a complex trait, in which genetic and environmental factors contribute to the disease phenotype. We investigated whether the interleukin (IL) 1beta (+3953) polymorphism is associated with the severity of endometriosis. Diagnosis of endometriosis was made on the basis of laparoscopic findings. Stage of endometriosis was determined according to the Revised American Fertility Society classification. 118 women were enrolled in the study. 78 women did not have endometriosis, 6 women had stage I, 3 had stage II, 13 had stage III and 18 had stage IV endometriosis. Polymerase Chain Reaction (PCR), Restriction Fragment Length Polymorphism (RFLP), and agarose gel electrophoresis techniques were used to determine the IL 1beta (+3953) genotype. Frequencies of the IL-1beta (+3953) genotypes in the control group were: CC, 0.397; TT, 0.115; CT, 0.487. Frequencies of the IL-1beta (+3953) genotypes in cases were: CC, 0.375; TT, 0.225; CT, 0.400. We found a 2.22 fold increase in TT genotype in the endometriosis group. However, the difference was not statistically significant (P > 0.05). We also observed an increase in the frequency of IL-1beta (+3953) T allele in the endometriosis group. However, the difference was not statistically significant. We also investigated the association between IL-1beta (+3953) polymorphism and the severity of endometriosis. The frequencies of CC+CT genotypes in stage I, III and IV endometriosis patients were 83.3, 84/6 and 72.2%, respectively; and TT genotypes were 16.7, 15.4 and 27.8%, respectively. We observed a statistically insignificant increase in TT genotype in stage IV endometriosis (P > 0.05). We suggest that IL-1beta (+3953) polymorphism is not associated with endometriosis in Turkish women.

  10. CFE-1, a novel plasmid-encoded AmpC beta-lactamase with an ampR gene originating from Citrobacter freundii.

    PubMed

    Nakano, Ryuichi; Okamoto, Ryoichi; Nakano, Yumiko; Kaneko, Kenichi; Okitsu, Naohiro; Hosaka, Yoshio; Inoue, Matsuhisa

    2004-04-01

    A clinical isolate of Escherichia coli from a patient in Japan, isolate KU6400, was found to produce a plasmid-encoded beta-lactamase that conferred resistance to extended-spectrum cephalosporins and cephamycins. Resistance arising from production of a beta-lactamase could be transferred by either conjugation or transformation with plasmid pKU601 into E. coli ML4947. The substrate and inhibition profiles of this enzyme resembled those of the AmpC beta-lactamase. The resistance gene of pKU601, which was cloned and expressed in E. coli, proved to contain an open reading frame showing 99.8% DNA sequence identity with the ampC gene of Citrobacter freundii GC3. DNA sequence analysis also identified a gene upstream of ampC whose sequence was 99.0% identical to the ampR gene from C. freundii GC3. In addition, a fumarate operon (frdABCD) and an outer membrane lipoprotein (blc) surrounding the ampR-ampC genes in C. freundii were identified, and insertion sequence (IS26) elements were observed on both sides of the sequences identified (forming an IS26 composite transposon); these results confirm the evidence of the translocation of a beta-lactamase-associated gene region from the chromosome to a plasmid. Finally, we describe a novel plasmid-encoded AmpC beta-lactamase, CFE-1, with an ampR gene derived from C. freundii.

  11. A homozygous nonsense mutation in the {beta}3 chain gene of laminin 5 (LAMB3) in herlitz junctional epidermolysis bullosa

    SciTech Connect

    Pulkkinen, L.; Christiano, A.M.; Uitto, J.

    1994-11-15

    Herlitz junctional epidermolysis bullosa (H-JEB) is a severe autosomal recessive disorder characterized by blister formation within the dermal-epidermal basement membrane. Based on immunofluorescence analysis recognizing laminin 5 epitopes (previously known as nicein/kalinin), the genes for this lamina lucida protein have been proposed as candidate genes in H-JEB. Amplification of mRNA by RT-PCR, followed by direct nucleotide sequencing, revealed a homozygous C-to T transition resulting in a premature termination codon (CGA{r_arrow}TGA) on both alleles. This mutation was verified at the genomic DNA level, and both parents were shown to be heterozygous carriers of the same mutation. This is the first description of a mutation in the laminin {beta}3 chain gene (LAMB3) of laminin 5 in an H-JEB patient. 15 refs., 2 figs.

  12. Mutations in the latent TGF-beta binding protein 3 (LTBP3) gene cause brachyolmia with amelogenesis imperfecta

    PubMed Central

    Huckert, Mathilde; Stoetzel, Corinne; Morkmued, Supawich; Laugel-Haushalter, Virginie; Geoffroy, Véronique; Muller, Jean; Clauss, François; Prasad, Megana K.; Obry, Frédéric; Raymond, Jean Louis; Switala, Marzena; Alembik, Yves; Soskin, Sylvie; Mathieu, Eric; Hemmerlé, Joseph; Weickert, Jean-Luc; Dabovic, Branka Brukner; Rifkin, Daniel B.; Dheedene, Annelies; Boudin, Eveline; Caluseriu, Oana; Cholette, Marie-Claude; Mcleod, Ross; Antequera, Reynaldo; Gellé, Marie-Paule; Coeuriot, Jean-Louis; Jacquelin, Louis-Frédéric; Bailleul-Forestier, Isabelle; Manière, Marie-Cécile; Van Hul, Wim; Bertola, Debora; Dollé, Pascal; Verloes, Alain; Mortier, Geert; Dollfus, Hélène; Bloch-Zupan, Agnès

    2015-01-01

    Inherited dental malformations constitute a clinically and genetically heterogeneous group of disorders. Here, we report on four families, three of them consanguineous, with an identical phenotype, characterized by significant short stature with brachyolmia and hypoplastic amelogenesis imperfecta (AI) with almost absent enamel. This phenotype was first described in 1996 by Verloes et al. as an autosomal recessive form of brachyolmia associated with AI. Whole-exome sequencing resulted in the identification of recessive hypomorphic mutations including deletion, nonsense and splice mutations, in the LTBP3 gene, which is involved in the TGF-beta signaling pathway. We further investigated gene expression during mouse development and tooth formation. Differentiated ameloblasts synthesizing enamel matrix proteins and odontoblasts expressed the gene. Study of an available knockout mouse model showed that the mutant mice displayed very thin to absent enamel in both incisors and molars, hereby recapitulating the AI phenotype in the human disorder. PMID:25669657

  13. Mutations in the latent TGF-beta binding protein 3 (LTBP3) gene cause brachyolmia with amelogenesis imperfecta.

    PubMed

    Huckert, Mathilde; Stoetzel, Corinne; Morkmued, Supawich; Laugel-Haushalter, Virginie; Geoffroy, Véronique; Muller, Jean; Clauss, François; Prasad, Megana K; Obry, Frédéric; Raymond, Jean Louis; Switala, Marzena; Alembik, Yves; Soskin, Sylvie; Mathieu, Eric; Hemmerlé, Joseph; Weickert, Jean-Luc; Dabovic, Branka Brukner; Rifkin, Daniel B; Dheedene, Annelies; Boudin, Eveline; Caluseriu, Oana; Cholette, Marie-Claude; Mcleod, Ross; Antequera, Reynaldo; Gellé, Marie-Paule; Coeuriot, Jean-Louis; Jacquelin, Louis-Frédéric; Bailleul-Forestier, Isabelle; Manière, Marie-Cécile; Van Hul, Wim; Bertola, Debora; Dollé, Pascal; Verloes, Alain; Mortier, Geert; Dollfus, Hélène; Bloch-Zupan, Agnès

    2015-06-01

    Inherited dental malformations constitute a clinically and genetically heterogeneous group of disorders. Here, we report on four families, three of them consanguineous, with an identical phenotype, characterized by significant short stature with brachyolmia and hypoplastic amelogenesis imperfecta (AI) with almost absent enamel. This phenotype was first described in 1996 by Verloes et al. as an autosomal recessive form of brachyolmia associated with AI. Whole-exome sequencing resulted in the identification of recessive hypomorphic mutations including deletion, nonsense and splice mutations, in the LTBP3 gene, which is involved in the TGF-beta signaling pathway. We further investigated gene expression during mouse development and tooth formation. Differentiated ameloblasts synthesizing enamel matrix proteins and odontoblasts expressed the gene. Study of an available knockout mouse model showed that the mutant mice displayed very thin to absent enamel in both incisors and molars, hereby recapitulating the AI phenotype in the human disorder.

  14. [The cloning and expression of the gene for beta-galactosidase from Candida pseudotropicalis yeasts in Saccharomyces cerevisiae cells].

    PubMed

    Tretiak, K A; Zakal'skiĭ, A E; Gudz', S P

    1998-01-01

    The gene of beta-galactosidase of lactose-assimilating yeast Candida pseudotropicalis was cloned in pG2 and pBG2-3 hybrid shuttle vectors and expressed in Saccharomyces cerevisiae laboratory strains under the control of own promoter. The plasmids were able to replicate autonomously with relative stability in transformants of baker's yeasts. The availability of glucose or lactose in the medium influenced the recombinant plasmid stability and the expression of the cloned gene. A number of experiments have shown that the LAC+ phenotype in pG2-transformed Saccharomyces cerevisiae was due to the expression of the Candida pseudotropicalis lactose permease gene that is probably located in SaIG1/XhoI DNA fragment about 4.3 kb long. Southern hybridization experiments showed that LAC(+)-transformants of Saccharomyces cerevisiae contained both autonomously-replicative, and integrative pG2 plasmid.

  15. Genetic localization of four genes for nematode (Heterodera schachtii Schm.) resistance in sugar beet (Beta vulgaris L.).

    PubMed

    Heller, R; Schondelmaier, J; Steinrücken, G; Jung, C

    1996-06-01

    Sugar beet (Beta vulgaris L.) is highly susceptible to the beet cyst nematode (Heterodera schachtii Schm.). Three resistance genes originating from the wild beets B. procumbens (Hs1 (pro-1)) and B. webbiana (Hs1 (web-1), Hs2 (web-7)) have been transferred to sugar beet via species hybridization. We describe the genetic localization of the nematode resistance genes in four different sugar beet lines using segregating F2 populations and RFLP markers from our current sugar beet linkage map. The mapping studies yielded a surprising result. Although the four parental lines carrying the wild beet translocations were not related to each other, the four genes mapped to the same locus in sugar beet independent of the original translocation event. Close linkage (0-4.6 cM) was found with marker loci at one end of linkage group IV. In two populations, RFLP loci showed segregation distortion due to gametic selection. For the first time, the non-randomness of the translocation process promoting gene transfer from the wild beet to the sugar beet is demonstrated. The data suggest that the resistance genes were incorporated into the sugar beet chromosomes by non-allelic homologous recombination. The finding that the different resistance genes are allelic will have major implications on future attempts to breed sugar beet combining the different resistance genes.

  16. Interactions between beta-2 adrenoceptor gene variation, cardiovascular control and dietary sodium in healthy young adults.

    PubMed

    Eisenach, John H; Schroeder, Darrell R; Pavey, Emily S; Penheiter, Alan R; Knutson, Jean N; Turner, Stephen T; Joyner, Michael J

    2014-12-01

    Dietary sodium affects function of the beta-2 adrenoceptor (ADRB2). We tested the hypothesis that haplotype variation in the ADRB2 gene would influence the cardiovascular and regional vasodilator responses to sympathoexcitatory manoeuvres following low, normal and high sodium diets, and ADRB2-mediated forearm vasodilation in the high sodium condition. Seventy-one healthy young adults were grouped by double homozygous haplotypes: Arg16+Gln27 (n = 31), the rare Gly16+Gln27 (n = 10) and Gly16+Glu27 (n = 30). Using a randomized cross-over design, subjects were studied following 5 days of controlled low, normal and high sodium with 1 month or longer between diets (and low hormone phase of the menstrual cycle). All three visits utilized ECG and finger plethysmography for haemodynamic measures, and the high sodium visit included a brachial arterial catheter for forearm vasodilator responses to isoprenaline with plethysmography. Lymphocytes were sampled for ex vivo analysis of ADRB2 density and binding conformation. We found a main effect of haplotype on ADRB2 density (P = 0.03) with the Gly16+Glu27 haplotype having the greatest density (low, normal, high sodium: 12.9 ± 0.9, 13.5 ± 0.9 and 13.6 ± 0.8 fmol mg(-1) protein, respectively) and Arg16+Gln27 having the least (9.3 ± 0.6, 10.1 ± 0.5 and 10.3 ± 0.6  fmol mg(-1) protein, respectively), but there were no sodium or haplotype effects on receptor binding conformation. In the mental stress trial, there was a main effect of haplotype on cardiac output (P = 0.04), as Arg16+Gln27 had the lowest responses. Handgrip and forearm vasodilation yielded no haplotype differences, and no correlations were present for ADRB2 density and haemodynamics. Our findings support cell-based evidence that ADRB2 haplotype influences ADRB2 protein expression independent of dietary sodium, yet the haemodynamic consequences appear modest in healthy humans.

  17. Targeting exogenous GDNF gene to the bovine somatic cell beta-casein locus for the production of transgenic bovine animals.

    PubMed

    Zhang, X M; Luo, F H; Ding, H M; Li, B; Zhang, J J; Wu, Y J

    2015-11-25

    Considerable attention is currently being directed toward methods for producing recombinant human proteins in the mammary glands of genetically modified transgenic livestock. However, the expression of inserted genes in transgenic animals is variable and often very low because of the randomness of the site of transgene integration. One possible strategy to avoid the expression problem associated with random integration is to use site-specific integration by targeting integration to a high expression locus and, thereby, to improve expression of the transferred gene. In the present study, we focused on glial cell line-derived neurotrophic factor (GDNF), a novel type of neurotrophic factor first cloned in 1993. Research has shown that GDNF may have potential applications in the treatment of Parkinson's disease and other diseases of the central nervous system since it acts as a protective factor for central dopaminergic neurons. Here, we constructed a gene targeting vector to knock-in the human GDNF gene at the bovine beta-casein gene locus as a first step to producing transgenic animals with a high level of expression of human GDNF protein in their mammary glands. Bovine fetal fibroblast cells were transfected with linearized pNRTCNbG by electroporation. Three cell clones were identified with successful targeting to the beta-casein locus; and were confirmed using both polymerase chain reaction analysis and sequencing. Gene-targeted cells were used as nuclear donors; a total of 161 embryos were reconstructed, 23 of which developed to the blastocyst stage. These blastocysts were transferred to 8 recipient cows, but no offspring were obtained.

  18. Targeting exogenous GDNF gene to the bovine somatic cell beta-casein locus for the production of transgenic bovine animals.

    PubMed

    Zhang, X M; Luo, F H; Ding, H M; Li, B; Zhang, J J; Wu, Y J

    2015-01-01

    Considerable attention is currently being directed toward methods for producing recombinant human proteins in the mammary glands of genetically modified transgenic livestock. However, the expression of inserted genes in transgenic animals is variable and often very low because of the randomness of the site of transgene integration. One possible strategy to avoid the expression problem associated with random integration is to use site-specific integration by targeting integration to a high expression locus and, thereby, to improve expression of the transferred gene. In the present study, we focused on glial cell line-derived neurotrophic factor (GDNF), a novel type of neurotrophic factor first cloned in 1993. Research has shown that GDNF may have potential applications in the treatment of Parkinson's disease and other diseases of the central nervous system since it acts as a protective factor for central dopaminergic neurons. Here, we constructed a gene targeting vector to knock-in the human GDNF gene at the bovine beta-casein gene locus as a first step to producing transgenic animals with a high level of expression of human GDNF protein in their mammary glands. Bovine fetal fibroblast cells were transfected with linearized pNRTCNbG by electroporation. Three cell clones were identified with successful targeting to the beta-casein locus; and were confirmed using both polymerase chain reaction analysis and sequencing. Gene-targeted cells were used as nuclear donors; a total of 161 embryos were reconstructed, 23 of which developed to the blastocyst stage. These blastocysts were transferred to 8 recipient cows, but no offspring were obtained. PMID:26634460

  19. Interleukin-1 alpha, interleukin-1 beta and interleukin-8 gene expression in human aural cholesteatomas.

    PubMed

    Kim, C S; Lee, C H; Chung, J W; Kim, C D

    1996-03-01

    Bone destruction is a common characteristic feature of chronic otitis media, especially aural cholesteatoma. A number of immunohistochemical studies have suggested that interleukin-1 (IL-1) may be responsible for cholesteatomatous bone destruction. We designed this study to present the mRNA expression patterns of IL-1 alpha, IL-1 beta, and IL-8, which can induce and activate the leukocyte, the major reservoir of potent proteolytic enzymes. Total RNAs were extracted from aural cholesteatomas, external auditory canal skin (EACS), postauricular skin (PAS), and granulation tissues and transcribed into cDNAs. cDNAs were amplified by using PCR technique with primers for IL-1 alpha, IL-1 beta, IL-8, and beta-actin. Amplified products were hybridized with each internal probe and the relative density was measured. In granulation tissues, the relative density of IL-1 alpha was greater than that of other tissues. The ratio of IL-1 beta and IL-8 of aural cholesteatoma was significantly higher than that of EACS and PAS. We suggest that both of IL-1 alpha and IL-1 beta may play a role in the pathological changes, and that IL-8, which is mainly produced from cholesteatomatous epithelium, may have an important role in the pathological changes of cholesteatomas.

  20. CCAAT-binding factor regulates expression of the beta1 subunit of soluble guanylyl cyclase gene in the BE2 human neuroblastoma cell line

    NASA Technical Reports Server (NTRS)

    Sharina, Iraida G.; Martin, Emil; Thomas, Anthony; Uray, Karen L.; Murad, Ferid

    2003-01-01

    Soluble guanylyl cyclase (sGC) is a cytosolic enzyme producing the intracellular messenger cyclic guanosine monophosphate (cGMP) on activation with nitric oxide (NO). sGC is an obligatory heterodimer composed of alpha and beta subunits. We investigated human beta1 sGC transcriptional regulation in BE2 human neuroblastoma cells. The 5' upstream region of the beta1 sGC gene was isolated and analyzed for promoter activity by using luciferase reporter constructs. The transcriptional start site of the beta1 sGC gene in BE2 cells was identified. The functional significance of consensus transcriptional factor binding sites proximal to the transcriptional start site was investigated by site deletions in the 800-bp promoter fragment. The elimination of CCAAT-binding factor (CBF) and growth factor independence 1 (GFI1) binding cores significantly diminished whereas deletion of the NF1 core elevated the transcription. Electrophoretic mobility-shift assay (EMSA) and Western analysis of proteins bound to biotinated EMSA probes confirmed the interaction of GFI1, CBF, and NF1 factors with the beta1 sGC promoter. Treatment of BE2 cells with genistein, known to inhibit the CBF binding to DNA, significantly reduced protein levels of beta1 sGC by inhibiting transcription. In summary, our study represents an analysis of the human beta1 sGC promoter regulation in human neuroblastoma BE2 cells and identifies CBF as a critically important factor in beta1 sGC expression.

  1. Progesterone receptor repression of prolactin/signal transducer and activator of transcription 5-mediated transcription of the beta-casein gene in mammary epithelial cells.

    PubMed

    Buser, Adam C; Gass-Handel, Elizabeth K; Wyszomierski, Shannon L; Doppler, Wolfgang; Leonhardt, Susan A; Schaack, Jerome; Rosen, Jeffrey M; Watkin, Harriet; Anderson, Steven M; Edwards, Dean P

    2007-01-01

    Prolactin (PRL) and glucocorticoids act synergistically to stimulate transcription of the beta-casein milk protein gene. Signal transducer and activator of transcription 5 (Stat5) mediates PRL-dependent trans-activation, and glucocorticoid potentiation occurs through cross talk between glucocorticoid receptor (GR) and Stat5 at the beta-casein promoter. In the mouse, progesterone withdrawal leads to terminal differentiation and secretory activation of the mammary gland at parturition, indicating progesterone's role in repressing milk protein gene expression during pregnancy. To investigate the mechanism of the inhibitory action of progesterone, experiments were performed with cell culture systems reconstituted to express progesterone receptor (PR), the PRL receptor/Stat5 signaling pathway, and GR, enabling evaluation of PR, GR, and Stat5 interactions at the beta-casein promoter. With COS-1, normal murine mammary gland, HC-11, and primary mammary epithelial cells, progestin-PR directly repressed the PRL receptor/Stat5a signaling pathway's mediation of PRL-induced beta-casein transcription. Progestin-PR also inhibited glucocorticoid-GR enhancement of PRL induced trans-activation of beta-casein. Inhibition depended on a functional PR DNA binding domain and specific PR-DNA interactions at the beta-casein promoter. Chromatin immunoprecipitation assays in HC-11 cells revealed recruitment of PR and Stat5a to the beta-casein promoter by progestin or PRL, respectively. Recruitment was disrupted by cotreatment with progestin and PRL, suggesting a mutual interference between activated PR and Stat5a. Without PRL, progestin-PR also recruited Stat5a to the beta-casein promoter, suggesting that recruitment of an unactivated form of Stat5a may contribute to inhibition of beta-casein by progesterone. These results define a negative cross talk between PR and Stat5a/GR that may contribute to the physiological role of progesterone to repress lactogenic hormone induction of the beta

  2. The maize chloroplast genes for the beta and epsilon subunits of the photosynthetic coupling factor CF1 are fused.

    PubMed Central

    Krebbers, E T; Larrinua, I M; McIntosh, L; Bogorad, L

    1982-01-01

    We have cloned and sequenced the maize chloroplast genome fragment Eco RI e which contains the 2.2 kb transcript previously reported (Link, G. and Bogorad, L. (1980) Proc. Nat. Acad. Sci. 77 6821-6825) to lie next to the maize gene for the large subunit of ribulose bisphosphate carboxylase (LS) and to be transcribed divergently. Immunochemical and sequencing data show that the gene codes for the beta subunit of the maize chloroplast coupling factor complex (CF1). The derived amino acid sequence is highly homologous to that of the corresponding E. coli protein (Saraste et al. (1981) Nucleic Acids Res. 9 5287-5296). The last base of the codon for the terminal lysine residue of the beta subunit of CF1 is the first base of the codon for the initiating methionine of an open reading frame whose derived amino acid composition and size closely match that reported for the epsilon subunit (Binder et al. (1978) J. Biol. Chem. 253 3094-3100). The close coupling of the two genes may serve to in sure their stoichiometric production. Images PMID:6290998

  3. Identification of the human {beta}A2 crystallin gene (CRYBA2): Localization of the gene on human chromosome 2 and of the homologous gene on mouse chromosome 1

    SciTech Connect

    Hulsebos, T.J.M.; Cerosaletti, K.M.; Fournier, R.E.K.

    1995-08-10

    By using primers synthesized on the basis of the bovine {beta}A2 crystalline gene sequence, we amplified exons 5 and 6 of the human gene (CRYBA2). CRYBA2 was assigned to human chromosome 2 by concordance analysis in human x rodent somatic cell hybrids using the amplified PCR products as probe. Regional localization to 2q34-q36 was established by hybridizing the CRYBA2 probe to microcell and radiation hybrids containing defined fragments of chromosome 2 as the only human contribution. The CRYBA2 probe was also used to localize, by interspecific backcross mapping, the mouse gene (Cryba2) to the central portion of chromosome 1 in a region of known human chromosome 2 homology. Finally, we demonstrate that in both species the {beta}A2 crystallin gene is linked but separable from the {gamma}A crystallin gene. The {beta}A2 crystallin gene is a candidate gene for human and mouse hereditary cataract. 32 refs., 4 figs.

  4. Isolation, characterization, and expression of a second {beta}-tubulin-encoding gene from Colletotrichum gloeosporioides f. sp. aeschynomene

    SciTech Connect

    Buhr, T.L.; Dickman, M.B.

    1994-11-01

    Colletotrichum gloeosporioides (Penz.) Sacc. F. sp. aeschynomene incites anthracnose on Aeschynomene virgininica (northern jointvetch). Northern jointvetch is a leguminous weed in rice and soybean fields. Contaminating northern jointvetch seeds greatly reduce the market value of rice. C. gloeosporioides (Penz.) Sacc. F. sp. aeschynomene has been commercially marketed as a mycoherbicide to decrease populations of northern jointvetch. Development of a transformation system would be extremely useful for investigating the molecular biology of C. gloeosporioides (Penz.) Sacc. F. sp. aeschynomen. This paper reports the nucleotide sequence of a second gene for {beta} Tub (TUB2) in C. gloeosporioides (Penz.) Sacc. F. sp. aeschynomene and identifies a molecular lesion which likely confers BEN (systemic fungicide) resistance.

  5. Isolation and sequencing of a putative promoter region of the murine G protein beta 1 subunit (GNB1) gene.

    PubMed

    Kitanaka, Junichi; Kitanaka, Nobue; Takemura, Motohiko; Wang, Xiao-Bing; Hembree, Cambria M; Goodman, Nancy L; Uhl, George R

    2002-02-01

    The expression of the heterotrimeric GTP-binding protein beta 1 subunit gene (GNB1) is regulated by psychostimulants such as cocaine and amphetamines. Since the up-regulation appears to be one of the candidate processes of sensitization, it is necessary to elucidate the cellular and molecular mechanism of the GNB1 gene regulation for a better understanding the establishment of sensitization. In the present study, we describe the isolation and nucleotide sequence analysis of the GNB1 gene promoter region. We have isolated approximately 10 kb of the 5'-flanking region of the mouse of GNB1 gene and found potential elements involved in putative transcriptional control of the GNB1, such as AP1, AP2, Sp1, cyclic AMP response element, and nuclear factor kappa B recognition sites, within the sequences 0.3 kb upstream from the putative transcription start site. This region was highly rich in G + C content, but lacked TATA or CATT boxes. Comparing the nucleotide sequence of the cDNA clone with the human genome databases using the BLAST program a region containing putative exon 1 and promoter of the human GNB1 gene in chromosome 1 was found. The cloning and sequence analysis of an extensive portion of the 5'-flanking regulatory region of the GNB1 gene provides new insights into the factors involved in the regulation by psychostimulants of GNB1 expression. PMID:12180136

  6. Global gene expression profiling of multiple myeloma, monoclonal gammopathy of undetermined significance, and normal bone marrow plasma cells.

    PubMed

    Zhan, Fenghuang; Hardin, Johanna; Kordsmeier, Bob; Bumm, Klaus; Zheng, Mingzhong; Tian, Erming; Sanderson, Ralph; Yang, Yang; Wilson, Carla; Zangari, Maurizio; Anaissie, Elias; Morris, Christopher; Muwalla, Firas; van Rhee, Frits; Fassas, Athanasios; Crowley, John; Tricot, Guido; Barlogie, Bart; Shaughnessy, John

    2002-03-01

    Bone marrow plasma cells (PCs) from 74 patients with newly diagnosed multiple myeloma (MM), 5 with monoclonal gammopathy of undetermined significance (MGUS), and 31 healthy volunteers (normal PCs) were purified by CD138(+) selection. Gene expression of purified PCs and 7 MM cell lines were profiled using high-density oligonucleotide microarrays interrogating about 6800 genes. On hierarchical clustering analysis, normal and MM PCs were differentiated and 4 distinct subgroups of MM (MM1, MM2, MM3, and MM4) were identified. The expression pattern of MM1 was similar to normal PCs and MGUS, whereas MM4 was similar to MM cell lines. Clinical parameters linked to poor prognosis, abnormal karyotype (P =.002) and high serum beta(2)-microglobulin levels (P =.0005), were most prevalent in MM4. Also, genes involved in DNA metabolism and cell cycle control were overexpressed in a comparison of MM1 and MM4. In addition, using chi(2) and Wilcoxon rank sum tests, 120 novel candidate disease genes were identified that discriminate normal and malignant PCs (P <.0001); many are involved in adhesion, apoptosis, cell cycle, drug resistance, growth arrest, oncogenesis, signaling, and transcription. A total of 156 genes, including FGFR3 and CCND1, exhibited highly elevated ("spiked") expression in at least 4 of the 74 MM cases (range, 4-25 spikes). Elevated expression of these 2 genes was caused by the translocation t(4;14)(p16;q32) or t(11;14)(q13;q32). Thus, novel candidate MM disease genes have been identi