Sample records for beta 2-microglobulin gene

  1. Beta-2 Microglobulin Tumor Marker


    ... limited. Home Visit Global Sites Search Help? Beta-2 Microglobulin Tumor Marker Share this page: Was this page helpful? Also known as: B2M; B 2 M; β2-Microglobulin; Thymotaxin Formal name: Beta 2 ...

  2. 21 CFR 866.5630 - Beta-2-microglobulin immunological test system.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Beta-2-microglobulin immunological test system....5630 Beta-2-microglobulin immunological test system. (a) Identification. A beta-2-microglobulin... beta-2-microglobulin (a protein molecule) in serum, urine, and other body fluids. Measurement of...

  3. The effect of surgery on the renal excretion of beta 2-microglobulin.


    Walenkamp, G H; Vree, T B; Guelen, P J; Jongman-Nix, B


    Surgical trauma causes an increase in the renal excretion rate of beta 2-microglobulin whilst creatinine excretion is not influenced. The increase in the renal excretion rate of beta 2-microglobulin is probably the result of an increased release of beta 2-microglobulin by the cells which exceeds a maximum in the active tubular reabsorption of the compound by the proximal tubule cell. The renal excretion of beta 2-microglobulin is proportional to the relative clinical trauma score. PMID:6189646

  4. 21 CFR 866.5630 - Beta-2-microglobulin immunological test system.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Beta-2-microglobulin immunological test system. 866.5630 Section 866.5630 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... beta-2-microglobulin (a protein molecule) in serum, urine, and other body fluids. Measurement of...

  5. 21 CFR 866.5630 - Beta-2-microglobulin immunological test system.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Beta-2-microglobulin immunological test system. 866.5630 Section 866.5630 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... beta-2-microglobulin (a protein molecule) in serum, urine, and other body fluids. Measurement of...

  6. 21 CFR 866.5630 - Beta-2-microglobulin immunological test system.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Beta-2-microglobulin immunological test system. 866.5630 Section 866.5630 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... beta-2-microglobulin (a protein molecule) in serum, urine, and other body fluids. Measurement of...

  7. 21 CFR 866.5630 - Beta-2-microglobulin immunological test system.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Beta-2-microglobulin immunological test system. 866.5630 Section 866.5630 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... beta-2-microglobulin (a protein molecule) in serum, urine, and other body fluids. Measurement of...

  8. Clearance and synthesis rates of beta 2-microglobulin in patients undergoing hemodialysis and in normal subjects

    SciTech Connect

    Floege, J.; Bartsch, A.; Schulze, M.; Shaldon, S.; Koch, K.M.; Smeby, L.C. )


    Retention of {beta} 2-microglobulin in patients undergoing hemodialysis is associated with a {beta} 2-microglobulin-derived amyloidosis. Removal of {beta} 2-microglobulin by renal replacement therapy has been proposed for the prevention of this amyloidosis. Currently, however, data on the {beta} 2-microglobulin synthesis rate in patients undergoing hemodialysis are scarce, and consequently it remains speculative how much removal would be necessary to counterbalance synthesis. The plasma kinetics of iodine 131-labeled {beta} 2-microglobulin were therefore examined in 11 patients with anuria who were undergoing long-term hemodialysis. Five healthy persons served as controls. Kinetic modeling of the plasma curves showed that the data fitted a two-pool model (r2 greater than 0.96) consisting of a rapid 2 to 4 hour distribution phase followed by a less steep curve, described by the plasma (metabolic) clearance (Clp). Synthetic rates were calculated from Clp and the {beta} 2-microglobulin steady state plasma concentration (plus {beta} 2-microglobulin removal during hemodialysis in the case of high flux hemodialysis). The results showed a significantly higher Clp in normal controls as compared with patients undergoing hemodialysis (65.5 {plus minus} 12.8 ml/min (mean {plus minus} SD) versus 3.4 {plus minus} 0.7 ml/min). In contrast, the {beta} 2-microglobulin synthesis rate in the patient group (3.10 {plus minus} 0.79 mg/kg/day) was not significantly different from that of normal controls (2.40 {plus minus} 0.67 mg/kg/day), which was due to markedly elevated {beta} 2-microglobulin plasma concentrations in the patients (37.6 {plus minus} 14.1 mg/L vs 1.92 {plus minus} 0.27 mg/L). These findings suggest that the presence of end-stage renal disease does not have a significant impact on the beta 2-microglobulin generation rate.

  9. [Serum beta 2 microglobulin (beta 2M) following renal transplantation].


    Pacheco-Silva, A; Nishida, S K; Silva, M S; Ramos, O L; Azjen, H; Pereira, A B


    Although there was an important improvement in graft and patient survival the last 10 years, graft rejection continues to be a major barrier to the success of renal transplantation. Identification of a laboratory test that could help to diagnose graft rejection would facilitate the management of renal transplanted patients. PURPOSE--To evaluate the utility of monitoring serum beta 2M in recently transplanted patients. METHODS--We daily determined serum beta 2M levels in 20 receptors of renal grafts (10 from living related and 10 from cadaveric donors) and compared them to their clinical and laboratory evolution. RESULTS--Eight patients who presented immediate good renal function following grafting and did not have rejection had a mean serum beta 2M of 3.7 mg/L on the 4th day post transplant. The sensitivity of the test for the diagnosis of acute rejection was 87.5%, but the specificity was only 46%. Patients who presented acute tubular necrosis (ATN) without rejection had a progressive decrease in their serum levels of beta 2M, while their serum creatinine changed as they were dialyzed. In contrast, patients with ATN and concomitance of acute rejection or CSA nephrotoxicity presented elevated beta 2M and creatinine serum levels. CONCLUSION--Daily monitoring of serum beta 2M does not improve the ability to diagnose acute rejection in patients with good renal function. However, serum beta 2M levels seemed to be useful in diagnosing acute rejection or CSA nephrotoxicity in patients with ATN. PMID:7787867

  10. Interaction between the renal excretion rates of beta 2-microglobulin and tobramycin in man.


    Vree, T B; Zweens, K; Huige, P J; Guelen, P J; Jongman-Nix, B


    The renal excretion rate of beta 2-microglobulin in man is 127 +/- 98 ng/min at alkaline urine pH (pH 7). Tobramycin, up to intravenous doses of 160 mg (2 mg/kg) does not increase the renal excretion rate of beta 2-microglobulin. Tobramycin must have less affinity than gentamicin for the tubular system for active reabsorption of amino groups containing organic compounds. Due to this reduced affinity tobramycin will be absorbed less by the proximal tubular cells, which may be one of the reasons for tobramycin being less toxic than gentamicin. beta 2-Microglobulin excretion can be used as a parameter for the relative binding affinity of aminoglycosides. PMID:6370509

  11. Beta2-microglobuline plasma level and painful shoulder in haemodialysed patients.


    Barisić, Igor; Ljutić, Dragan; Vlak, Tonko; Bekavac, Josip; Perić, Irena; Mise, Kornelija; Klancnik, Marisa; Janković, Stipan


    Painful shoulder in patients on chronic haemodialyis is most often associated with dialysis arthropathy or accumulation of deposits containing modified fibrils of beta2- microglobuline especially in bones and joints due to insufficient elimination during the therapy. The aim of this study is to investigate whether there is connection between painful shoulder and plasma level of beta2-microglobuline and to corroborate that with morphologic parameters found in proved amyloidosis. It has to be emphasized that even other causes may contribute the development of painful shoulder. Real time sonography and conventional plain radiographs of the 108 shoulders were performed in 54 patients receiving chronic haemodialysis as a treatment of terminal renal failure (without previous history of rheumatoid arthritis), 27 symptomatic with persistent pain and stiffness in both shoulders and lasting for more than 6 weeks and restriction of movements in various degree and 27 asymptomatic. Plasma level of beta2-microglobuline, CRP and uric acid were taken periodically as routine procedure during a one year prospective trial, as well as plasma level of calcium, phosphor and alkaline phosphatase. Plasmatic level of beta2-microglobuline is strongly connected with painful shoulder in dialyzed patients, as well as CRP as sign of acute inflammation. That is proved by morphologic parameters associated with histological proved amyloidosis in patients on long term dialysis, more then 10 years. PMID:20402341

  12. Receptors for fibrinogen and aggregated beta 2-microglobulin detected in strains of group B streptococci.

    PubMed Central

    Schönbeck, C; Björck, L; Kronvall, G


    Binding of radiolabeled human fibrinogen and aggregated beta-microglobulin was measured in 60 strains of beta-hemolytic group B streptococci. Positive fibrinogen binding was detected in seven of the strains. Six of the group B strains showed an uptake of aggregated beta 2-microglobulin. Four individual strains carried both receptors, indicating a positive correlation between their occurrence. Inhibition studies showed that fibrinogen competed sterically with beta 2-microglobulin binding. Receptors for both proteins were trypsin sensitive. The presence of receptors did not correlate with the serological type of the 49 group B strains tested. However, all seven type II strains were negative. No uptake of fibrinogen was noted in any of 40 group D strains tested. Binding structures for fibrinogen and aggregated beta 2-microglobulin detected in group B streptococci were similar to receptors for the same proteins in group A, C, and G streptococci in terms of mutual correlation and steric interference of binding. The occasional occurrence of these receptors also in group B strains might reflect a common origin of some types of surface proteins in gram-positive cocci. PMID:6164650

  13. Beta 2-microglobulin amyloidosis presenting as esophageal perforation in a hemodialysis patient.


    Khan, G A; Lewis, F I; Dasgupta, M


    A 45-year-old male with hypertensive end-stage renal disease and on maintenance hemodialysis for 13 years is reported. He presented with life-threatening hematemesis, secondary to esophageal rupture. Immunohistological staining and electron microscopy examination of the esophageal perforation showed depositions of beta 2-microglobulin (beta 2-M) amyoloid. The unique aspect presented here is the localized esophageal involvement with beta 2-M amyloidosis. This is the first reported patient with esophageal perforation, due to the deposition and infiltration of the lower esophagus with beta 2-M which predisposed to its rupture. PMID:9426849

  14. Soluble histocompatibility class I antigens and beta 2-microglobulin in pregnant females and cord blood samples.


    Inostroza, J; Ferrada, J; Navarrete, C; Sorensen, R U


    Pregnancy can be considered a successful transplantation of allogeneic paternal tissue to the mother. Soluble HLA class I serum levels have been found to increase during solid organ rejection episodes and during graft-versus-host disease after bone marrow transplantation. We wished to determine whether significant changes in sHLA class I and beta 2-microglobulin light chain levels occurred during pregnancy, because these may reflect adaptive changes permitting the acceptance of the fetal graft. Serum samples were obtained from women at different stages of pregnancy and in the postpartum period. Cord blood samples and serum samples from nonpregnant female and male controls living in the same geographic area in Southern Chile were also studied. The levels of sHLA class I heterodimers were determined by an ELISA sandwich technique; beta 2-microglobulin levels were measured by MEIA IMX-Abbott. There was a significant elevation of sHLA class I levels in the first 2 trimesters of pregnancy, followed by a significant drop below normal levels at the end of pregnancy, with normalization in the post-partum period. beta 2-microglobulin levels did not change significantly during pregnancy and did not correlate with sHLA class I levels. In cord blood samples, sHLA class I levels were lower and beta 2-microglobulin levels higher than those of adult controls and of mothers at the time of delivery. The variations in sHLA class I levels during pregnancy may reflect or contribute to immunoregulatory events related to the acceptance of the fetal graft. PMID:9154459

  15. Selective elution of HLA antigens and beta 2-microglobulin from human platelets by chloroquine diphosphate

    SciTech Connect

    Kao, K.J.


    To determine whether chloroquine can specifically elute HLA antigens and beta 2-microglobulin (beta 2-M) from the platelet surface, quantitative immunofluorescence flow cytometry and monoclonal antibodies were used to show that HLA antigens and beta 2-M were proportionally eluted from the platelet surface without affecting the membrane glycoproteins IIb and IIIa. Second, an autoradiogram of electrophoresed I-125-labeled platelets showed that only beta 2-M but not other I-125-labeled membrane proteins could be eluted. Although HLA antigens were poorly labeled by I-125 and could not be detected on the autoradiogram, the eluted HLA antigens could be detected by anti-HLA monoclonal antibody and immunoblotting techniques. No loss of plasma membrane integrity was observed by transmission electron microscopy after chloroquine treatment of platelets. The results indicate that chloroquine selectively elutes HLA antigens and their noncovalently associated beta 2-M without affecting other integral platelet membrane proteins.

  16. Interactions between human serum proteins and oral streptococci reveal occurrence of receptors for aggregated beta 2-microglobulin.

    PubMed Central

    Ericson, D; Bratthall, D; Björck, L; Myhre, E; Kronvall, G


    A total of 31 strains of oral streptococci representing Streptococcus mutans, Streptococcus sanguis, Streptococcus mitior, Streptococcus salivarius, and Streptococcus milleri were tested for possible binding of human immunoglobulins G, G1, G2, G3, G4, A1, A2, M1, and M2 and haptoglobin, hemoglobin, fibrinogen, and aggregated beta 2-microglobulin. Radiolabeled beta 2-microglobulin in aggregated form showed affinity for 20 of the 31 strains tested. Binding activity for the protein was found in strains belonging to all five species. The bacterial receptor was resistant to trypsin. Monomeric, unlabeled beta 2-microglobulin did not interfere with the binding of the aggregated form. Of the other proteins tested, only the immunoglobulin A1 protein showed positive binding, and that was only with a single strain of S. milleri. beta 2-Microglobulin is present on all nucleated cell membranes in vivo. The reaction between aggregated beta 2-microglobulin and oral streptococci is a new type of human-bacterium interaction which should be considered in studies of bacterial adherence. PMID:90015

  17. The relationship between the renal clearance of creatinine and the apparent renal clearance of beta-2-microglobulin in patients with normal and impaired kidney function.


    Vree, T B; Guelen, P J; Jongman-Nix, B; Walenkamp, G H


    The renal clearances of creatinine and beta 2-microglobulin of patients with either normal or impaired kidney function were measured. The renal clearance of beta 2-microglobulin depends on the urinary pH and must be considered as an apparent renal clearance because after tubular reabsorption the compound is metabolized in the kidney. Impaired kidney function reduces the percentage of tubular reabsorption of beta 2-microglobulin. PMID:6166414

  18. Beta 2-microglobulin associated amyloidosis: a vanishing complication of long-term hemodialysis?


    Schwalbe, S; Holzhauer, M; Schaeffer, J; Galanski, M; Koch, K M; Floege, J


    Beta 2-microglobulin associated amyloidosis (A beta 2m amyloidosis) is considered an inevitable complication of chronic hemodialysis, particularly in hemodialysis with cellulose based membranes. We performed a single center study to assess the prevalence of A beta 2m amyloidosis in 1988 versus 1996. Randomly selected patients, studied in 1988, were matched for time on hemodialysis (mean 71 months, range 3 to 207) and age (mean 51 years, range 22 to 80) with patients of the 1996 population. Compared to 1988 patients, the 1996 patients exhibited a lower prevalence of carpal tunnel syndrome (7 of 43 in 1988 vs. 1 of 43 in 1996; P < 0.001) and radiological evidence of A beta 2m amyloidosis (13 of 34 patients vs. 3 of 34 patients positive; P < 0.001; and 33 of 272 possible sites affected in 1988 vs. 7 of 272 sites in 1996 patients; P < 0.05). Compared to the 1988 population, the 1996 population exhibited significantly lower serum aluminum levels, lower average serum creatinine (but not urea) levels, more frequent therapy with erythropoietin, less home hemodialysis, longer hemodialysis time using high-flux synthetic dialysis membranes (mean of 13% vs. 6% of the total hemodialysis time in the 1988 group), and more frequent usage of reverse osmosis water plus bicarbonate buffer for dialysate preparation. We conclude that the prevalence and severity of A beta 2m amyloidosis unexpectedly decreased by about 80% in our center between 1988 and 1996. Given the relatively short times spent on high flux hemodialysis in both groups, increased beta 2-microglobulin removal is unlikely to account for this phenomenon. Rather, other factors, for example, dialysate composition and purity, may be involved. PMID:9328948

  19. A single disulfide bond differentiates aggregation pathways of beta2-microglobulin.


    Chen, Yiwen; Dokholyan, Nikolay V


    Deposition of wild-type beta2-microglobulin (beta2m) into amyloid fibrils is a complication in patients undergoing long-term hemodialysis. The native beta-sandwich fold of beta2m has a highly conserved disulfide bond linking Cys25 and Cys80. Oxidized beta2m forms needle-like amyloid fibrils at pH 2.5 in vitro, whereas reduced beta2m, at acid pH, in which the intra-chain disulfide bond is disrupted, cannot form typical fibrils. Instead, reduced beta2m forms thinner and more flexible filaments. To uncover the difference in molecular mechanisms underlying the aggregation of the oxidized and reduced beta2m, we performed molecular dynamics simulations of beta2m oligomerization under oxidized and reduced conditions. We show that, consistent with experimental observations, the oxidized beta2m forms domain-swapped dimer, in which the two proteins exchange their N-terminal segments complementing each other. In contrast, both dimers and trimers, formed by reduced beta2m, are comprised of parallel beta-sheets between monomers and stabilized by the hydrogen bond network along the backbone. The oligomerized monomers are in extended conformations, capable of further aggregation. We find that both reduced and oxidized dimers are thermodynamically less stable than their corresponding monomers, indicating that beta2m oligomerization is not accompanied by the formation of a thermodynamically stable dimer. Our studies suggest that the different aggregation pathways of oxidized and reduced beta2m are dictated by the formation of distinct precursor oligomeric species that are modulated by Cys25-Cys80 disulfide-bonds. We propose that the propagation of domain swapping is the aggregation mechanism for the oxidized beta2m, while "parallel stacking" of partially unfolded beta2m is the aggregation mechanism for the reduced beta2m. PMID:16242719

  20. A {beta}{sub 2}-microglobulin cleavage variant fibrillates at near-physiological pH

    SciTech Connect

    Corlin, Dorthe B. Johnsen, Christina K.; Nissen, Mogens H.; Heegaard, Niels H.H.


    {beta}{sub 2}-microglobulin ({beta}{sub 2}m) deposits as amyloid in dialysis-related amyloidosis (DRA), predominantly in joints. The molecular mechanisms underlying the amyloidogenicity of {beta}{sub 2}m are still largely unknown. In vitro, acidic conditions, pH < 4.5, induce amyloid fibrillation of native {beta}{sub 2}m within several days. Here, we show that amyloid fibrils are generated in less than an hour when a cleavage variant of {beta}{sub 2}m-found in the circulation of many dialysis patients-is exposed to pH levels (pH 6.6) occurring in joints during inflammation. Aggregation and fibrillation, including seeding effects with intact, native {beta}{sub 2}m were studied by Thioflavin T fluorescence spectroscopy, turbidimetry, capillary electrophoresis, and electron microscopy. We conclude that a biologically relevant variant of {beta}{sub 2}m is amyloidogenic at slightly acidic pH. Also, only a very small amount of preformed fibrils of this variant is required to induce fibrillation of native {beta}{sub 2}m. This may explain the apparent lack of detectable amounts of the variant {beta}{sub 2}m in extracts of amyloid from DRA patients.

  1. Polymerization of intact beta 2-microglobulin in tissue causes amyloidosis in patients on chronic hemodialysis.

    PubMed Central

    Gorevic, P D; Munoz, P C; Casey, T T; DiRaimondo, C R; Stone, W J; Prelli, F C; Rodrigues, M M; Poulik, M D; Frangione, B


    Systemic amyloidosis with a predilection for bone and synovium may complicate the course of patients on long-term hemodialysis. This form of amyloidosis can be typed as distinct from other amyloid diseases by using small tissue samples obtained by bone biopsy and at postmortem. Immunoblot analysis of two-dimensional gels of partially solubilized amyloid fibrils established that tissue deposits are composed of monomers, dimers, and higher polymers of beta 2-microglobulin (beta 2m) and that amyloid P component was also present. Anti-beta 2m antiserum recognized fibrils, as shown by immunoelectron microscopy. Purified monomer isolated from dissociated fibrils yielded peptides corresponding to the entire known sequence of beta 2m. Virtually all serum beta 2m, as well as that present in tissue fluid bathing amyloid fibrils, was monomeric. Hemodialysis-related amyloidosis is an example of a deposition disease occurring in hemodialysis patients. We have shown conclusively that, in this amyloid disease, polymerization of an intact normal serum protein to a fibrillar configuration may occur without proteolysis. We propose the designation A beta 2m for this form of amyloid fibril subunit protein. Images PMID:3532124

  2. [beta subsccript 2]-microglobulin forms three-dimensional domain-swapped amyloid fibrils with disulfide linkages

    SciTech Connect

    Liu, Cong; Sawaya, Michael R.; Eisenberg, David


    {beta}{sub 2}-microglobulin ({beta}{sub 2}-m) is the light chain of the type I major histocompatibility complex. It deposits as amyloid fibrils within joints during long-term hemodialysis treatment. Despite the devastating effects of dialysis-related amyloidosis, full understanding of how fibrils form from soluble {beta}{sub 2}-m remains elusive. Here we show that {beta}{sub 2}-m can oligomerize and fibrillize via three-dimensional domain swapping. Isolating a covalently bound, domain-swapped dimer from {beta}{sub 2}-m oligomers on the pathway to fibrils, we were able to determine its crystal structure. The hinge loop that connects the swapped domain to the core domain includes the fibrillizing segment LSFSKD, whose atomic structure we also determined. The LSFSKD structure reveals a class 5 steric zipper, akin to other amyloid spines. The structures of the dimer and the zipper spine fit well into an atomic model for this fibrillar form of {beta}{sub 2}-m, which assembles slowly under physiological conditions.

  3. Urinary cadmium and beta2-microglobulin: correlation with nutrition and smoking history (journal version)

    SciTech Connect

    Kowal, N.E.


    Urinary cadmium and beta2-microglobulin concentrations from approximately 1000 samples from the general adult U.S. population, collected as part of the National Health and Nutritional Examination Survey II (NHANES II), were related to nutritional and smoking history of the individuals. Urinary cadmium concentration was negatively correlated with dietary iron (significance level of 0.0065), negatively correlated with dietary calcium (significance level of less than 0.0001), and significantly (level of less than 0.001) higher in past or present smokers than in those who had never smoked. The results suggest increased cadmium absorption in the presence of low dietary intake of iron, low dietary intake of calcium, and cigarette smoking in the general population of the United States.

  4. Mass spectrometric characterization of conformational preludes to [beta]2-microglobulin aggregation

    NASA Astrophysics Data System (ADS)

    Jørgensen, Thomas J. D.; Cheng, Lei; Heegaard, Niels H. H.


    Characterization of protein folding and unfolding is an important issue for basic biological science, for understanding the devastating amyloid diseases, and for the manufacture and use of biological therapeutics. Unlike nuclear magnetic resonance spectroscopy, the use of mass spectrometry to monitor amide hydrogen (1H/2H) exchange kinetics (HX-MS) allows characterization of structural dynamics even when only limited amounts of protein is available. As an adjunct technique, requiring even less material and very well suited for serial monitoring of folding phenomena in a single solution under native conditions capillary electrophoresis may also be very informative. These approaches are here used to examine the small (99 amino acid residues) protein [beta]2-microglobulin ([beta]2m) which is prone to amyloidogenic unfolding especially after cleavage at its lysine-58 residue. The propensity for unfolding of native, non-cleaved [beta]2m and lysine-58 cleaved [beta]2m variants as well as the effect of acetonitrile on the conformational equilibria could be addressed by these approaches. At physiological conditions, intact [beta]2m and the lysine-58 cleaved variants undergo a transient unfolding that exhibit an EX1 type hydrogen exchange behaviour. We have measured the unfolding rate constants for the cleaved variant where Lys-58 is removed ([Delta]K58-[beta]2m) and the cleaved variant where this residue is preserved (cK58-[beta]2m) at various temperatures. Below 37 °C, the variant devoid of Lys-58 ([Delta]K58-[beta]2m) has a higher unfolding rate than cK58-[beta]2m and this correlates with the observation that [Delta]K58-[beta]2m has a higher propensity to aggregate. The results of our studies provide valuable insight into the early conformational perturbations involved in rendering this protein insoluble and amyloidogenic. The approaches used in this study should be useful also for the characterization of other conformationally unstable proteins.

  5. Structural modifications of human beta 2 microglobulin treated with oxygen-derived radicals.

    PubMed Central

    Capeillere-Blandin, C; Delaveau, T; Descamps-Latscha, B


    Treatment of human beta 2 microglobulin (beta 2m) with defined oxygen-derived species generated by treatment with gamma-radiation was studied. As assessed by SDS/PAGE, the hydroxyl radicals (.OH) caused the disappearance of the protein band at 12 kDa that represents beta 2m, and cross-linked the protein into protein bands stable to both SDS and reducing conditions. However, when .OH was generated under oxygen in equimolar combination with the superoxide anion radical (O2.-), the high-molecular-mass protein products were less represented, and fragmented derivatives were not obviously detectable. Exposure to .OH alone, or to .OH + O2.- in the presence of O2, induced the formation of beta 2m protein derivatives with a more acidic net electrical charge than the parent molecule. In contrast, O2.- alone had virtually no effect on molecular mass or pI. Changes in u.v. fluorescence during .OH attack indicated changes in conformation, as confirmed by c.d. spectrometry. A high concentration of radicals caused the disappearance of the beta-pleated sheet structure and the formation of a random coil structure. Loss of tryptophan and significant production of dityrosine (2,2'-biphenol type) were noted, exhibiting a clear dose-dependence with .OH alone or with .OH + O2.-. The combination of .OH + O2.- induced a pattern of changes similar to that with .OH alone, but more extensive for c.d. and tryptophan oxidation (2 Trp/beta 2m molecule), and more limited for dityrosine formation. Lower levels of these oxidative agents caused the reproducible formation of species at 18 and 25 kDa which were recognized by antibodies against native beta 2m. These findings provide a model for the protein pattern observed in beta 2m amyloidosis described in the literature. Images Fig. 4. Fig. 5. PMID:1649598

  6. Targeted Disruption of the β2-Microglobulin Gene Minimizes the Immunogenicity of Human Embryonic Stem Cells

    PubMed Central

    Quan, Yuan; Yan, Qing; Morales, John E.


    Human embryonic stem cells (hESCs) are a promising source of cells for tissue regeneration, yet histoincompatibility remains a major challenge to their clinical application. Because the human leukocyte antigen class I (HLA-I) molecules are the primary mediators of immune rejection, we hypothesized that cells derived from a hESC line lacking HLA-I expression could be transplanted without evoking a robust immune response from allogeneic recipients. In the present study, we used the replacement targeting strategy to delete exons 2 and 3 of β2-microglobulin on both gene alleles in hESCs. Because β2-microglobulin serves as the HLA-I light chain, disruption of the β2-microglobulin gene led to complete HLA-I deficiency on the cell surface of hESCs and their derivatives. Therefore, these cells were resistant to CD8+ T-cell-mediated destruction. Although interferon-γ (IFN-γ) treatment significantly induced β2-microglobulin expression, promoting CD8+ T cell-mediated killing of control hESCs and their derivatives, CD8+ T-cell-mediated cytotoxicity was barely observed with β2-microglobulin-null hESCs and their derivatives treated with IFN-γ. This genetic manipulation to disrupt HLA-I expression did not affect the self-renewal capacity, genomic stability, or pluripotency of hESCs. Despite being relatively sensitive to natural killer (NK) cell-mediated killing due to the lack of HLA-I expression, when transplanted into NK cell-depleted immunocompetent mice, β2-microglobulin-null hESCs developed into tumors resembling those derived from control hESCs in severe combined immunodeficiency mice. These results demonstrate that β2-microglobulin-null hESCs significantly reduce immunogenicity to CD8+ T cells and might provide a renewable source of cells for tissue regeneration without the need for HLA matching in the future. Significance This study reports the generation of a novel β2-microglobulin (B2M)−/− human embryonic stem cell (hESC) line. Differentiated mature cells



    Antimonova, O I; Grudinina, N A; Egorov, V V; Polyakov, D S; Iljin, V V; Shavlovsky, M M


    By means of spectrophotometric assay we investigated interaction of the dye Congo red (CR) with fibrils of model proteins--hen egg white lysozyme, recombinant human beta2-microglobulin (b2M) and recombinant human transthyretin (TTR). The commercial dye sample was found to contain a significant amount of impurities. Methods for the dye purification are disclosed and CR molar extinction coefficient at 490 nm (ε490) was determined to be 3.3 x 10(4) M(-1) x cm(-1) at pH above 6.0. Formation of the CR-fibril complex results in changes in the dye visible absorption spectrum. According to the data on titration of fibril solutions with excess of the dye, CR binds to lysozyme fibrils at a ratio of about 5 molecules per protein monomer within fibril structure, to b2M fibrils--about 4 molecules per monomer, to TTR fibrils--about 4 molecules per subunit of the protein. PMID:27228663

  8. The Implication and Significance of Beta 2 Microglobulin: A Conservative Multifunctional Regulator

    PubMed Central

    Li, Ling; Dong, Mei; Wang, Xiao-Guang


    Objective: This review focuses on the current knowledge on the implication and significance of beta 2 microglobulin (β2M), a conservative immune molecule in vertebrate. Data Sources: The data used in this review were obtained from PubMed up to October 2015. Terms of β2M, immune response, and infection were used in the search. Study Selections: Articles related to β2M were retrieved and reviewed. Articles focusing on the characteristic and function of β2M were selected. The exclusion criteria of articles were that the studies on β2M-related molecules. Results: β2M is critical for the immune surveillance and modulation in vertebrate animals. The dysregulation of β2M is associated with multiple diseases, including endogenous and infectious diseases. β2M could directly participate in the development of cancer cells, and the level of β2M is deemed as a prognostic marker for several malignancies. It also involves in forming major histocompatibility complex (MHC class I or MHC I) or like heterodimers, covering from antigen presentation to immune homeostasis. Conclusions: Based on the characteristic of β2M, it or its signaling pathway has been targeted as biomedical or therapeutic tools. Moreover, β2M is highly conserved among different species, and overall structures are virtually identical, implying the versatility of β2M on applications. PMID:26879019

  9. Seeding-dependent maturation of beta2-microglobulin amyloid fibrils at neutral pH.


    Kihara, Miho; Chatani, Eri; Sakai, Miyo; Hasegawa, Kazuhiro; Naiki, Hironobu; Goto, Yuji


    Beta2-microglobulin (beta2-m) is a major component of amyloid fibrils deposited in patients with dialysis-related amyloidosis. Recent studies have focused on the mechanism by which amyloid fibrils are formed under physiological conditions, which had been difficult to reproduce quantitatively. Yamamoto et al. (Yamamoto, S., Hasegawa, K., Yamaguchi, I., Tsutsumi, S., Kardos, J., Goto, Y., Gejyo, F. & Naiki, H. (2004) Biochemistry 43, 11075-11082) showed that a combination of seed fibrils prepared under acidic conditions and a low concentration of sodium dodecyl sulfate below its critical micelle concentration enabled extensive fibril formation at pH 7.0. Here, we found that repeated self-seeding at pH 7.0 with fibrils formed at the same pH causes a marked acceleration of growth, indicating the maturation of fibrils. The observed maturation can be simulated by assuming the existence of two types of fibrils with different growth rates. Importantly, some mutations of beta2-m or the addition of a low concentration of urea, both destabilizing the native conformation, were not enough to extend the fibrils at pH 7.0, and a low concentration of sodium dodecyl sulfate (i.e. 0.5 mM) was essential. Thus, even though the first stage fibrils in patients are unstable and require stabilizing factors to remain at neutral pH, they can adapt to a neutral pH with repeated self-seeding, implying a mechanism of development of amyloid deposition after a long latent period in patients. PMID:15659393

  10. Differential inhibition of mitogenic responsiveness by monoclonal antibodies to beta 2-microglobulin.


    Tam, P E; Messner, R P


    A panel of 10 monoclonal antibodies (MoAbs) to human beta 2-microglobulin (beta 2m) was used to evaluate the modulation of lymphocyte activation induced by different mitogenic stimuli. All 10 MoAbs inhibited proliferative responses of peripheral blood mononuclear cells (PBMC) to phytohemagglutinin (PHA), concanavalin A (Con A), pokeweed mitogen (PWM), and allogeneic cells in mixed lymphocyte culture (MLC), although some MoAbs were inhibitory at much lower concentrations than others. No enhancement or direct mitogenicity was observed, but at low MoAb concentrations a delayed peak response sometimes occurred. Differentiation of B cells in PWM-stimulated PBMC cultures was also inhibited as measured by reduced accumulation of supernatant IgM and IgG. Anti-beta 2m MoAb did not interfere with the binding of PHA or PWM to PBMC, and membrane mobility as judged by subsequent capping of these lectins also appeared to be normal. Furthermore, anti-beta 2m was inhibitory when added 24 hr prior to peak responsiveness, and proliferative responses to the phorbol ester PMA in combination with ionomycin were also inhibited by MoAb, indicating that membrane-mediated events were not the target of inhibition. A comparison of the inhibitory effects of anti-beta 2m MoAb on activation by different stimuli revealed that PWM and MLC responses were much more sensitive to inhibition followed by, in order of decreasing inhibition, Con A, PHA, ionomycin alone, and PMA/ionomycin. A MoAb to a monomorphic determinant of HLA-A, B, C exhibited the same inhibitory trend, suggesting that the mechanism of inhibition was the same as for anti-beta 2m MoAbs. No inhibition was observed when PBMC were stimulated by PMA alone, suggesting that the MoAbs have little effect on activation mediated by protein kinase C but may preferentially affect the calcium-dependent pathway of activation. Thus, this differential inhibition observed with different stimuli may reflect the relative contribution of class I

  11. Imaging of dialysis-related amyloid (AB-amyloid) deposits with sup 131 I-beta 2-microglobulin

    SciTech Connect

    Floege, J.; Burchert, W.; Brandis, A.; Gielow, P.; Nonnast-Daniel, B.; Spindler, E.; Hundeshagen, H.; Shaldon, S.; Koch, K.M. )


    The diagnosis of dialysis-related amyloid (AB-amyloid) has been based usually on clinical and radiological criteria. Following the discovery that beta 2-microglobulin was the major protein of this amyloid, we isolated and radiolabelled uremic plasma beta 2-microglobulin. After intravenous injection, gamma-camera images of selected joint areas were obtained from 42 patients who were on regular hemodialysis therapy. Positive scans involving the shoulder, hip, knee and carpal regions were found in 13 of 14 patients treated for more than 10 years and 10 of 16 patients treated for 5 to 10 years. Patients treated for less time had negative scans. Specificity was indicated by negative scans in non-amyloid inflammatory lesions in control hemodialysis patients. Up to 48-fold tracer enrichment was detected in excised AB-amyloid containing tissue as compared to amyloid-free tissue. These findings suggest that circulating radiolabelled beta 2-microglobulin is taken up by the amyloid deposits. This method may non-invasively detect tissue infiltrates of amyloid. It may also permit prospective evaluation of the efficacy of prophylactic dialysis strategies which are designed to prevent or delay the onset of this complication of long-term dialysis.

  12. Electron microscopic localization of receptors for aggregated beta 2-microglobulin on the surface of beta-hemolytic streptococci.

    PubMed Central

    Wagner, M; Wagner, B; Kronvall, G; Björck, L


    The presence and location of receptors for aggregated human beta 2-microglobulin (beta 2m) on the surface of group A, C, and G streptococci were studied by electron microscopic techniques. Ferritin-conjugated aggregates of human beta 2m were used in direct binding experiments. Ferritin-conjugated antibodies against beta 2m were employed in a two-step indirect binding assay where the streptococci were incubated with unlabeled beta 2m aggregates before the addition of antibodies. Similar results were obtained with these two methods. Among tested group C and G strains, some showed binding of beta 2m, whereas others were negative. In group A streptococci, beta 2m binding was localized to filamentous structures typical of M protein. In two M protein-negative group A strains, the reactivity was heterogeneous, revealing a majority of unlabeled, but also some heavily labeled streptococci. Morphologically, these beta 2m-binding bacteria exhibited M protein-like projections in contrast to the smooth surfaces of unlabeled cells. Images PMID:6352498

  13. Measurement of glomerular filtration rate in homozygous sickle cell disease: a comparison of 51Cr-EDTA clearance, creatinine clearance, serum creatinine and beta 2 microglobulin.

    PubMed Central

    Aparicio, S A; Mojiminiyi, S; Kay, J D; Shepstone, B J; de Ceulaer, K; Serjeant, G R


    Glomerular filtration rates (GFR) were measured with 51Cr-EDTA in 38 patients (aged 40-75 years) with homozygous sickle cell disease and compared with serum beta 2 microglobulin concentrations in 38 patients and with creatinine clearance in 21 patients. GFR estimated with 51Cr-EDTA was closely correlated with single serum creatinine measurements and the inverse of serum beta 2 microglobulin. Creatinine clearance was also found to be correlated, but values were, on average, 32% below those obtained by the 51Cr-EDTA method, and this difference was significant. It is concluded that measurements of beta 2 microglobulin, single serum creatinine, and creatinine clearance are valuable indicators of GFR in homozygous sickle cell disease. Measurement of beta 2 microglobulin was a useful and reliable method of estimating GFR from single plasma measurements and is therefore a useful means of screening the population. PMID:2115049

  14. Serum beta-2 microglobulin as a prognostic biomarker in patients with mantle cell lymphoma.


    Yoo, Changhoon; Yoon, Dok Hyun; Kim, Shin; Huh, Jooryung; Park, Chan-Sik; Park, Chan-Jeong; Lee, Sang-Wook; Suh, Cheolwon


    Although serum beta-2 microglobulin (B2M) has been suggested as a prognostic factor for mantle cell lymphoma (MCL), additional data are necessary to confirm its role. Between November 2005 and July 2014, a total of 52 patients with MCL were identified from the database of Asan Medical Center, Seoul, Korea. Pretreatment serum B2M information was available in 50 patients (96%). Overall survival (OS) was compared according to the serum B2M level with a cut-off value of 2.5 mg/L. The median MCL international prognostic index (MIPI) score was 5.84 (range 4.72-7.80), and the median biologic MIPI (MIPI-b) score was 6.27 (4.93-8.47). Pretreatment serum B2M was elevated in 30 patients (60%) and was significantly related to advanced stage (p = 0.02) and high MIPI (p = 0.03) and MIPI-b (p = 0.03) scores. With median follow-up duration of 29.8 months (range 0.8-87.0 months), the median OS was 56.2 months [95% confidence interval (CI) 36.6-75.9 months] in all patients, and serum B2M was significantly associated with OS (p = 0.001). In multivariate analyses adjusted for MIPI or MIPI-b scores and rituximab, elevated serum B2M was significantly associated with poor OS (when adjusting MIPI, hazard ratio = 26.4, 95% CI 2.9-241.3, p = 0.004; when adjusting MIPI-b, hazard ratio = 20.1, 95% CI 2.4-170.1, p = 0.006). Thus, pretreatment serum B2M may be an independent and significant prognostic factor in patients with MCL. PMID:25689467

  15. Pseudotumoral amyloidosis of beta 2-microglobulin origin in the buttock of a patient receiving long term haemodialysis.

    PubMed Central

    Fernández-Alonso, J; Rios-Camacho, C; Valenzuela-Castaño, A; Rocha-Castilla, J L


    A 52 year old man who had been receiving haemodialysis for 13 years, with a history of renal tuberculosis, right ischial tuberculous osteomyelitis, and dialysis arthropathy, developed a soft tissue tumour in his left buttock. Histological analysis, immunohistological staining, and electron microscopic examination of the surgically removed tumour showed massive deposits of beta 2-microglobulin (beta 2-M) amyloid. This case shows the expanding clinical spectrum of this type of amyloidosis, and it is suggested that amyloid infiltration should be considered in the differential diagnosis of gluteal tumours in these patients. Images PMID:8408708

  16. Cystatin C and beta2-microglobulin: markers of glomerular filtration in critically ill children

    PubMed Central

    Herrero-Morín, José David; Málaga, Serafín; Fernández, Nuria; Rey, Corsino; Diéguez, María Ángeles; Solís, Gonzalo; Concha, Andrés; Medina, Alberto


    Introduction Parameters allowing regular evaluation of renal function in a paediatric intensive care unit (PICU) are not optimal. The aim of the present study was to analyse the utility of serum cystatin C and beta2-microglobulin (B2M) in detecting decreased glomerular filtration rate in critically ill children. Methods This was a prospective, observational study set in an eight-bed PICU. Twenty-five children were included. The inverses of serum creatinine, cystatin C, and B2M were correlated with creatinine clearance (CrC) using a 24-hour urine sample and CrC estimation by Schwartz formula (Schwartz). The diagnostic value of serum creatinine, cystatin C, and B2M to identify a glomerular filtration rate under 80 ml/minute per 1.73 m2 was evaluated using receiver operating characteristic (ROC) curve analysis. Results Mean age was 2.9 years (range, 0.1 to 13.9 years). CrC was less than 80 ml/minute per 1.73 m2 in 14 children, and Schwartz was less than 80 ml/minute per 1.73 m2 in 9 children. Correlations between inverse of B2M and CrC (r = 0.477) and between inverse of B2M and Schwartz (r = 0.697) were better than correlations between inverse of cystatin C and CrC (r = 0.390) or Schwartz (r = 0.586) and better than correlations between inverse of creatinine and CrC (r = 0.104) or Schwartz (r = 0.442). The ability of serum cystatin C and B2M to identify a CrC rate and a Schwartz CrC rate under 80 ml/minute per 1.73 m2 was better than that of creatinine (areas under the ROC curve: 0.851 and 0.792 for cystatin C, 0.802 and 0.799 for B2M, and 0.633 and 0.625 for creatinine). Conclusion Serum cystatin C and B2M were confirmed as easy and useful markers, better than serum creatinine, to detect acute kidney injury in critically ill children. PMID:17519026

  17. Beta-2 microglobulin and lactate dehydrogenase levels are useful prognostic markers in early stage primary gastric lymphoma.


    Avilés, A; Narváez, B R


    The optimal management of primary gastric lymphoma (PGL) remains undecided because a definitive classification for therapeutic decision is not available. The International Index Project has proved to be useful in patients with nodal disease, but in extranodal presentation it has not been tested. We reviewed 297 patients with early stage PGL. They were initially classified according to the prognostic features of the International Index Project. No influence on duration of time to treatment failure (TTF) or overall survival was observed. For this reason we developed a logistical model to identify prognostic factors in patients with early stage PGL. Levels of beta-2 microglobulin and lactic dehydrogenase were observed to have prognostic significance in both univariate and multivariate analysis. With these parameters we constructed a logistical model to identify patients at low risk (TTF = 76%; at 7 years overall survival was 96%), statistically different to patients at high risk (TTF = 34% and overall survival = 22%). The number of patients at intermediate risk were too small to compare with the other groups. Because pathological or other clinical or laboratory prognostic features cannot help in the identification of a prognostic model, we propose that the use beta-2 microglobulin and lactic dehydrogenase can define different groups at risk and develop a prognostic system to define the best therapeutic approach in this patients. PMID:9807677

  18. 'Dialysis related arthropathy': a survey of 95 patients receiving chronic haemodialysis with special reference to beta 2 microglobulin related amyloidosis.

    PubMed Central

    Hurst, N P; van den Berg, R; Disney, A; Alcock, M; Albertyn, L; Green, M; Pascoe, V


    Ninety five patients receiving chronic haemodialysis (CHD) were surveyed to determine the prevalence of rheumatic disease and, where possible, its aetiology. At least three distinct rheumatic syndromes were identified--a group of patients with a syndrome consisting of large and medium joint synovial swelling, restricted hips and shoulders, tenosynovitis, carpal tunnel syndrome, and bone cysts due to deposition of beta 2 microglobulin related amyloid (AM beta 2m); a second group with erosive azotaemic osteoarthropathy; and a third group with age related degenerative disease of small, large, and axial joints. The data presented suggest that in patients receiving CHD (a) the prevalence of AM beta 2m deposition and the associated syndrome increases with duration of dialysis, but in patients who have been dialysed for more than 10 years the risk of developing AM beta 2m is related to age; (b) AM beta 2m deposition in subchondral cysts, but not synovium, causes joint destruction; also, AM beta 2m may be more prone to deposition in synovium of joints already damaged by other processes; (c) in the absence of synovial iron deposition synovial AM beta 2m is not associated with an inflammatory infiltrate; (d) hyperparathyroidism and perhaps other factors such as synovial iron deposition are probably more important than AM beta 2m as causes of peripheral joint degeneration and destructive spondyloarthropathy in patients receiving CHD. Images PMID:2658876

  19. Beta 2-microglobulin-dependent T cells are dispensable for allergen-induced T helper 2 responses.


    Zhang, Y; Rogers, K H; Lewis, D B


    CD4+ and CD8+ alpha/beta+ T cells of the T helper cell (Th)2 phenotype produce the cytokines IL-4, IL-5, and IL-13 that promote IgE production and eosinophilic inflammation. IL-4 may play an important role in mediating the differentiation of antigenically naive alpha/beta+ T cells into Th2 cells. Murine NK1.1+ (CD4+ or CD4-CD8-) alpha/beta+ T cells comprise a beta 2-microglobulin (beta 2m)-dependent cell population that rapidly produces IL-4 after cell activation in vitro and in vivo and has been proposed as a source of IL-4 for Th2 cell differentiation. alpha/beta+ CD8+ T cells, most of which require beta 2m for their development, have also been proposed as positive regulators of allergen-induced Th2 responses. We tested whether beta 2m-dependent T cells were essential for Th2 cell-mediated allergic reactions by treating wild-type, beta 2m-deficient (beta 2m -/-), and IL-4-deficient (IL-4 -/-) mice of the C57BL/6 genetic background with ovalbumin (OVA), using a protocol that induces robust allergic pulmonary disease in wild-type mice. OVA-treated beta 2m -/- mice had circulating levels of total and OVA-specific IgE, pulmonary eosinophilia, and expression of IL-4, IL-5, and IL-13 mRNA in bronchial lymph node tissue similar to that of OVA-treated wild-type mice. In contrast, these responses in OVA-treated IL-4 -/- mice were all either undetectable or markedly reduced compared with wild-type mice, confirming that IL-4 was required in this allergic model. These results indicate that the NK1.1+ alpha/beta+ T cell population, as well as other beta 2m-dependent populations, such as most peripheral alpha/beta+ CD8+ T cells, are dispensable for the Th2 pulmonary response to protein allergens. PMID:8879221

  20. Lack of HLA class I antigen expression by melanoma cells SK-MEL-33 caused by a reading frameshift in beta 2-microglobulin messenger RNA.

    PubMed Central

    Wang, Z; Cao, Y; Albino, A P; Zeff, R A; Houghton, A; Ferrone, S


    The lack of HLA class I antigen expression by the melanoma cell line SK-MEL-33 is caused by a unique lesion in beta 2-microglobulin (beta 2-mu). Sequencing of beta 2-mu mRNA detected a guanosine deletion at position 323 in codon 76 that causes a frameshift with a subsequent introduction of a stop codon at a position 54 base upstream of the normal position of the stop codon in the message. The loss of 18 amino acids and the change of 6 amino acids, including a cysteine at position 80 in the carboxy terminus of beta 2-mu, are likely to cause marked changes in the structure of the polypeptide. The latter may account for the inability of beta 2-mu to associate with HLA class I heavy chains and for its lack of reactivity with the anti-beta 2-mu mAb tested. HLA class I antigen expression on SK-MEL-33 cells was reconstituted after transfection with a wild-type B2m gene, therefore indicating that the abnormality of endogenous B2m gene is the only mechanism underlying lack of HLA class I antigen expression by SK-MEL-33 cells. The guanosine deletion in B2m gene was detected also in the melanoma tissue from which SK-MEL-33 cells had originated. Therefore, the molecular lesion identified in the SK-MEL-33 melanoma cell line is not caused by a mutation acquired during growth in vitro but is likely to reflect a somatic mutation during tumor progression. Images PMID:8432869

  1. beta-2 Microglobulin values among human immunodeficiency virus (HIV)-negative, HIV-positive asymptomatic, and HIV-positive symptomatic Ugandans.

    PubMed Central

    Piwowar, E M; Tugume, S B; Grant, R M; Lutalo, T; Pattishall, K; Katongole-Mbidde, E


    Mean serum beta-2 microglobulin levels among healthy human immunodeficiency virus-seronegative and asymptomatic and symptomatic human immunodeficiency virus-seropositive Ugandans were found to be 2.35, 3.75, and 5.06 mg/liter, respectively (P < 0.001). The upper limit of the normal range (3.5 mg/liter) is higher in this African population than that reported elsewhere. PMID:7697536

  2. The significance of urinary beta-2 microglobulin level for differential diagnosis of familial Mediterranean fever and acute appendicitis.


    Ugan, Yunus; Korkmaz, Hakan; Dogru, Atalay; Koca, Yavuz Savas; Balkarlı, Ayse; Aylak, Firdevs; Tunc, Sevket Ercan


    The clinical and laboratory parameters widely used are not specific to discriminate the abdominal pain due to FMF attack from that of acute appendicitis. The present study aims to investigate the urinary beta-2 microglobulin (U-β2M) level as a potential parameter to identify these two diseases mimicking each other. A total of 51 patients with established FMF diagnosis due to Tel Hashomer criteria on colchicine treatment (1-1.5 mg/day), 15 patients with acute appendicitis who had appropriate clinical picture and were also supported pathologically after the surgery, and 20 healthy controls were enrolled in the study. Of the 51 patients with FMF, 25 were at an attack period, while remaining 26 were not. For the diagnosis of acute attack, as well as physical examination, laboratory tests including white blood cell count, C-reactive protein, and erythrocyte sedimentation rate were performed. From urine specimens U-β2M, microalbumin, and N-acetyl glucosaminidase (U-NAG) were measured. U-β2M levels were significantly higher in acute appendicitis group compared to FMF attack, FMF non-attack, and control groups (p < 0.001, p < 0.001, and p < 0.001, respectively). U-NAG and microalbuminuria were significantly higher in acute appendicitis, FMF attack, and FMF non-attack groups compared to controls (U-NAG p < 0.001, p = 0.016, p = 0.004, microalbuminuria p < 0.001, p < 0.001, p < 0.001, respectively). Microalbuminuria was significantly higher in acute appendicitis group compared to the FMF attack group (p = 0.004). Determination of U-β2M levels may be helpful for differential diagnosis of peritonitis attacks of FMF patients on colchicine treatment and acute appendicitis. However, this finding should be substantiated with other studies. PMID:26873102

  3. Beta 2-microglobulin-, CD8+ T-cell-deficient mice survive inoculation with high doses of vaccinia virus and exhibit altered IgG responses.

    PubMed Central

    Spriggs, M K; Koller, B H; Sato, T; Morrissey, P J; Fanslow, W C; Smithies, O; Voice, R F; Widmer, M B; Maliszewski, C R


    Transgenic mice lacking an intact beta 2-microglobulin (beta 2m) gene fail to express major histocompatibility complex (MHC) class I proteins on the cell surface and, as a result, are virtually devoid of CD4- CD8+ lymphocytes. These animals provide a unique model system for directly assessing the role of CD8+ lymphocytes in the modulation of viral infection in vivo. beta 2m- CD8- mice and their normal littermates were inoculated at the base of the tail with the WR strain of vaccinia virus and monitored for serum antibody and lesion formation. Both groups developed similar lesions in response to a broad virus dose range, and all animals had completely recovered by day 28 after inoculation. Isotype-specific immunoglobulin levels were determined for each animal on day 7 and day 14 after primary inoculation, and again 7 days after a virus challenge. The virus-specific IgG1, IgG2a, and IgG2b levels were significantly different in the beta 2m-/- group (20-, 9-, and 30-fold lower, respectively, on day 7 after challenge) compared with the beta 2m+/- group. Virus-specific serum IgM levels for both groups remained similar throughout the experiment. In a separate experiment, beta 2m-/- mice were immunized with a nonviral antigen, 2,4,6-trinitrophenyl-conjugated keyhole limpet hemocyanin, and both total and antigen-specific isotype-specific immunoglobulin titers were determined. Total IgG1, IgG2a, IgG2b, and IgG3 tended to be lower overall in the beta 2m-/- mice compared with beta 2m+/- littermates. In contrast, total and antigen-specific IgE titers were similar in the two groups. These data indicate that CD8+ lymphocytes are not required to clear high doses of vaccinia virus, and they suggest that beta 2m-/- mice are less efficient at antigen-specific IgG production than their beta 2m+/- littermates. PMID:1631092

  4. Excretion of urinary cadmium, copper, and zinc in cadmium-exposed and nonexposed subjects, with special reference to urinary excretion of beta2-microglobulin and metallothionein.


    Nakajima, Maki; Kobayashi, Etsuko; Suwazono, Yasushi; Uetani, Mirei; Oishi, Mitsuhiro; Inaba, Takeya; Kido, Teruhiko; Shaikh, Zahir A; Nogawa, Koji


    The objectives of this study were to examine the association between urinary excretion of cadmium (U-Cd), copper (U-Cu), and zinc (U-Zn) and the severity of two different indicators of renal toxicity (urinary excretion of beta2-microglobulin [U-beta2-MG] and metallothionein [U-MT]) in Cd-exposed subjects compared to controls, and to assess the physiologic mechanisms by which the exposure to environmental Cd affects U-Cd, U-Cu, and U-Zn. The target population included 3508 Cd-exposed and 294 nonexposed participants who received a health survey conducted among the population of the Kakehashi River basin. Increases of U-Cd, U-beta2-MG, and U-MT in the Cd-exposed population were observed relative to excretion of these substances in controls. Regression analysis using a general linear model revealed that the correlations between U-Cd or U-Cu, and U-beta2-MG and between U-Cd, U-Cu or U-Zn, and U-MT were statistically significant in both sexes, but the correlation between U-Zn and U-beta2-MG excretion was significant only in men. These results suggest U-Cd and U-Cu is affected by dysfunction in renal tubular absorption (indicated by U-beta2-MG), whereas not only U-Cd and U-Cu but also U-Zn appear to be a function of renal cellular desquamation (indicated by U-MT). PMID:16327056

  5. [The dynamic level of beta 2-microglobulin, the basic lipid peroxidation indices and middle molecules in the blood and urine in patients with acute calculous pyelonephritis against a background of endovascular helium-neon laser therapy].


    Safafov, R M; Ianenko, E K; Nikitinskaia, L P; Golovanov, S A; Drozhzheva, V V; Kon'kova, T A; Danilkov, A P


    The authors present the effect of intravenous He-Ne laser therapy on the changes in beta 2-microglobulin, lipid peroxidation, middle-size molecules in the blood and urine of patients with acute calculous pyelonephritis. Endovascular He-Ne laser therapy was found an effective treatment of acute calculous pyelonephritis. The authors propose to combine hemosorption with endovascular He-Ne laser radiation. PMID:9123656

  6. A Study on the Relationship between Serum Beta 2-Microglobulin Levels, Underlying Chronic Kidney Disease, and Peripheral Arterial Disease in High-Vascular-Risk Patients

    PubMed Central

    Real de Asúa, Diego; Puchades, Ramón; García-Polo, Iluminada; Suárez, Carmen


    Background Serum beta 2-microglobulin (B2M) levels have been found to be increased in patients with peripheral arterial disease (PAD), yet it is still unknown whether B2M correlates with PAD intensity. Objectives We aim to evaluate the correlation between B2M and the ankle-brachial index (ABI) values in high-vascular-risk patients. Methods This is a cross-sectional study of 63 high-vascular-risk patients admitted to the Cardiology Department or evaluated as outpatients in the Internal Medicine Department of our institution. Patients were classified into two groups according to their ABI: patients without PAD (n = 44, ABI values between 0.9 and 1.4) and patients with PAD (n = 19, ABI values lower than 0.9 or higher than 1.4). We performed univariate and multivariate analysis based on a multiple linear regression model. Results Serum B2M levels were higher in patients with pathological ABI values than in those without PAD (2.36 ± 1.13 vs. 1.80 ± 0.65 mg/L; P<0.05). We found no correlation between B2M and ABI in our total population (r = –0.12) or in patients with PAD (r = –0.09; NS for both comparisons). Age, gender, arterial hypertension, estimated glomerular filtration rate (eGFR), uric acid, total cholesterol, and LDL-cholesterol correlated with B2M in the univariate analysis. In the final linear regression model, eGFR, uric acid and total cholesterol correlated independently with B2M (P<0.01). Conclusion We found no correlation between B2M levels and ABI values in high-vascular-risk patients that could usefully help in the subsequent diagnosis of PAD. However, we observed a significant correlation between B2M and eGFR, even when renal function was only slightly impaired. PMID:24757603

  7. The ESAT-6 protein of Mycobacterium tuberculosis interacts with beta-2-microglobulin (β2M) affecting antigen presentation function of macrophage.


    Sreejit, Gopalkrishna; Ahmed, Asma; Parveen, Nazia; Jha, Vishwanath; Valluri, Vijaya Lakshmi; Ghosh, Sudip; Mukhopadhyay, Sangita


    ESAT-6, an abundantly secreted protein of Mycobacterium tuberculosis (M. tuberculosis) is an important virulence factor, inactivation of which leads to reduced virulence of M. tuberculosis. ESAT-6 alone, or in complex with its chaperone CFP-10 (ESAT-6:CFP-10), is known to modulate host immune responses; however, the detailed mechanisms are not well understood. The structure of ESAT-6 or ESAT-6:CFP-10 complex does not suggest presence of enzymatic or DNA-binding activities. Therefore, we hypothesized that the crucial role played by ESAT-6 in the virulence of mycobacteria could be due to its interaction with some host cellular factors. Using a yeast two-hybrid screening, we identified that ESAT-6 interacts with the host protein beta-2-microglobulin (β2M), which was further confirmed by other assays, like GST pull down, co-immunoprecipitation and surface plasmon resonance. The C-terminal six amino acid residues (90-95) of ESAT-6 were found to be essential for this interaction. ESAT-6, in complex with CFP-10, also interacts with β2M. We found that ESAT-6/ESAT-6:CFP-10 can enter into the endoplasmic reticulum where it sequesters β2M to inhibit cell surface expression of MHC-I-β2M complexes, resulting in downregulation of class I-mediated antigen presentation. Interestingly, the ESAT-6:β2M complex could be detected in pleural biopsies of individuals suffering from pleural tuberculosis. Our data highlight a novel mechanism by which M. tuberculosis may undermine the host adaptive immune responses to establish a successful infection. Identification of such novel interactions may help us in designing small molecule inhibitors as well as effective vaccine design against tuberculosis. PMID:25356553

  8. The ESAT-6 Protein of Mycobacterium tuberculosis Interacts with Beta-2-Microglobulin (β2M) Affecting Antigen Presentation Function of Macrophage

    PubMed Central

    Parveen, Nazia; Jha, Vishwanath; Valluri, Vijaya Lakshmi; Ghosh, Sudip; Mukhopadhyay, Sangita


    ESAT-6, an abundantly secreted protein of Mycobacterium tuberculosis (M. tuberculosis) is an important virulence factor, inactivation of which leads to reduced virulence of M. tuberculosis. ESAT-6 alone, or in complex with its chaperone CFP-10 (ESAT-6:CFP-10), is known to modulate host immune responses; however, the detailed mechanisms are not well understood. The structure of ESAT-6 or ESAT-6:CFP-10 complex does not suggest presence of enzymatic or DNA-binding activities. Therefore, we hypothesized that the crucial role played by ESAT-6 in the virulence of mycobacteria could be due to its interaction with some host cellular factors. Using a yeast two-hybrid screening, we identified that ESAT-6 interacts with the host protein beta-2-microglobulin (β2M), which was further confirmed by other assays, like GST pull down, co-immunoprecipitation and surface plasmon resonance. The C-terminal six amino acid residues (90–95) of ESAT-6 were found to be essential for this interaction. ESAT-6, in complex with CFP-10, also interacts with β2M. We found that ESAT-6/ESAT-6:CFP-10 can enter into the endoplasmic reticulum where it sequesters β2M to inhibit cell surface expression of MHC-I-β2M complexes, resulting in downregulation of class I-mediated antigen presentation. Interestingly, the ESAT-6:β2M complex could be detected in pleural biopsies of individuals suffering from pleural tuberculosis. Our data highlight a novel mechanism by which M. tuberculosis may undermine the host adaptive immune responses to establish a successful infection. Identification of such novel interactions may help us in designing small molecule inhibitors as well as effective vaccine design against tuberculosis. PMID:25356553

  9. Serum Levels of Beta2-Microglobulin and Free Light Chains of Immunoglobulins Are Associated with Systemic Disease Activity in Primary Sjögren’s Syndrome. Data at Enrollment in the Prospective ASSESS Cohort

    PubMed Central

    Gottenberg, Jacques-Eric; Seror, Raphaèle; Miceli-Richard, Corinne; Benessiano, Joelle; Devauchelle-Pensec, Valerie; Dieude, Philippe; Dubost, Jean-Jacques; Fauchais, Anne-Laure; Goeb, Vincent; Hachulla, Eric; Hatron, Pierre Yves; Larroche, Claire; Le Guern, Véronique; Morel, Jacques; Perdriger, Aleth; Puéchal, Xavier; Rist, Stephanie; Saraux, Alain; Sene, Damien; Sibilia, Jean; Vittecoq, Olivier; Nocturne, Gaétane; Ravaud, Philippe; Mariette, Xavier


    Objectives To analyze the clinical and immunological characteristics at enrollment in a large prospective cohort of patients with primary Sjögren's syndrome (pSS) and to investigate the association between serum BAFF, beta2-microglobulin and free light chains of immunoglobulins and systemic disease activity at enrollment. Methods Three hundred and ninety five patients with pSS according to American-European Consensus Criteria were included from fifteen centers of Rheumatology and Internal Medicine in the “Assessment of Systemic Signs and Evolution of Sjögren's Syndrome” (ASSESS) 5-year prospective cohort. At enrollment, serum markers were assessed as well as activity of the disease measured with the EULAR Sjögren's Syndrome Disease Activity Index (ESSDAI). Results Patient median age was 58 (25th–75th: 51–67) and median disease duration was 5 (2–9) years. Median ESSDAI at enrollment was 2 (0–7) with 30.9% of patients having features of systemic involvement. Patients with elevated BAFF, beta2-microglobulin and kappa, lambda FLCS had higher ESSDAI scores at enrollment (4 [2]–[11] vs 2 [0–7], P = 0.03; 4 [1]–[11] vs 2 [0–7], P< 0.0001); 4 [2]–[10] vs 2 [0–6.6], P< 0.0001 and 4 [2–8.2] vs 2 [0–7.0], P = 0.02, respectively). In multivariate analysis, increased beta2-microglobulin, kappa and lambda FLCs were associated with a higher ESSDAI score. Median BAFF and beta2-microglobulin were higher in the 16 patients with history of lymphoma (1173.3(873.1–3665.5) vs 898.9 (715.9–1187.2) pg/ml, P = 0.01 and 2.6 (2.2–2.9) vs 2.1 (1.8–2.6) mg/l, P = 0.04, respectively). Conclusion In pSS, higher levels of beta2-microglobulin and free light chains of immunoglobulins are associated with increased systemic disease activity. PMID:23717383

  10. Revisiting the Middle Molecule Hypothesis of Uremic Toxicity: A Systematic Review of Beta 2 Microglobulin Population Kinetics and Large Scale Modeling of Hemodialysis Trials In Silico

    PubMed Central

    Roumelioti, Maria Eleni; Nolin, Thomas; Unruh, Mark L.; Argyropoulos, Christos


    Background Beta-2 Microglobulin (β2M) is a prototypical “middle molecule” uremic toxin that has been associated with a higher risk of death in hemodialysis patients. A quantitative description of the relative importance of factors determining β2M concentrations among patients with impaired kidney function is currently lacking. Methods Herein we undertook a systematic review of existing studies reporting patient level data concerning generation, elimination and distribution of β2M in order to develop a population model of β2M kinetics. We used this model and previously determined relationships between predialysis β2M concentration and survival, to simulate the population distribution of predialysis β2M and the associated relative risk (RR) of death in patients receiving conventional thrice-weekly hemodialysis with low flux (LF) and high flux (HF) dialyzers, short (SD) and long daily (LD) HF hemodialysis sessions and on-line hemodiafiltration at different levels of residual renal function (RRF). Results We identified 9 studies of 106 individuals and 156 evaluations of or more compartmental kinetic parameters of β2M. These studies used a variety of experimental methods to determine β2M kinetics ranging from isotopic dilution to profiling of intra/inter dialytic concentration changes. Most of the patients (74/106) were on dialysis with minimal RRF, thus facilitating the estimation of non-renal elimination kinetics of β2M. In large scale (N = 10000) simulations of individuals drawn from the population of β2M kinetic parameters, we found that, higher dialytic removal materially affects β2M exposures only when RRF (renal clearance of β2M) was below 2 ml/min. In patients initiating conventional HF hemodialysis, total loss of RRF was predicted to be associated with a RR of death of more than 20%. Hemodiafiltration and daily dialysis may decrease the high risk of death of anuric patients by 10% relative to conventional, thrice weekly HF dialysis. Only daily

  11. In vitro beta 2-microglobulin (beta 2m) secretion by normal and leukaemic B-cells: effects of recombinant cytokines and evidence for a differential response to the combined stimulus of phorbol ester and calcium ionophore.

    PubMed Central

    Jones, R. A.; Drexler, H. G.; Gignac, S. M.; Child, J. A.; Scott, C. S.


    Due to the increasing therapeutic use of immunoregulatory agents and the potential effects on cellular function, we examined the modulation of in vitro beta 2-microglobulin (beta 2m) production rates by 'normal' tonsil and leukaemic B-cells in response to a number of these agents. Tonsil B-cells responded to phorbol ester (TPA) by an increased beta 2m production rate, which was further enhanced by the combined stimuli of TPA plus the calcium ionophore A23187. In marked contrast, however, lymphocytes from a majority (8/11) of B-cell malignancies showed a suppression of the TPA-induced beta 2m production rate in response to the combined TPA/A23187 stimulus. These different responses of 'normal' and malignant B-cells were not apparent when IgM production rates were examined. The recombinant cytokines IL-1, IL-2, IFN-alpha, IFN-gamma and TNF also enhanced beta 2m production rates of both normal and leukaemic B-cells, but to a considerably lesser extent than did TPA. Bryostatin-1 increased beta 2m production to a level intermediate between that obtained by TPA and the cytokines. It is suggested that beta 2m production rates may correspond to the degree of B-cell differentiation, and/or to the degree of cellular 'activation'. The results further indicate that the in vitro measurement of beta 2m production provides a different index of the cellular response than that obtained by the conventional measurement of IgM production. PMID:2110813

  12. Estimation of benchmark dose as the threshold levels of urinary cadmium, based on excretion of total protein, {beta} {sub 2}-microglobulin, and N-acetyl-{beta}-D-glucosaminidase in cadmium nonpolluted regions in Japan

    SciTech Connect

    Kobayashi, Etsuko . E-mail:; Suwazono, Yasushi; Uetani, Mirei; Inaba, Takeya; Oishi, Mitsuhiro; Kido, Teruhiko; Nishijo, Muneko; Nakagawa, Hideaki; Nogawa, Koji


    Previously, we investigated the association between urinary cadmium (Cd) concentration and indicators of renal dysfunction, including total protein, {beta} {sub 2}-microglobulin ({beta} {sub 2}-MG), and N-acetyl-{beta}-D-glucosaminidase (NAG). In 2778 inhabitants {>=}50 years of age (1114 men, 1664 women) in three different Cd nonpolluted areas in Japan, we showed that a dose-response relationship existed between renal effects and Cd exposure in the general environment without any known Cd pollution. However, we could not estimate the threshold levels of urinary Cd at that time. In the present study, we estimated the threshold levels of urinary Cd as the benchmark dose low (BMDL) using the benchmark dose (BMD) approach. Urinary Cd excretion was divided into 10 categories, and an abnormality rate was calculated for each. Cut-off values for urinary substances were defined as corresponding to the 84% and 95% upper limit values of the target population who have not smoked. Then we calculated the BMD and BMDL using a log-logistic model. The values of BMD and BMDL for all urinary substances could be calculated. The BMDL for the 84% cut-off value of {beta} {sub 2}-MG, setting an abnormal value at 5%, was 2.4 {mu}g/g creatinine (cr) in men and 3.3 {mu}g/g cr in women. In conclusion, the present study demonstrated that the threshold level of urinary Cd could be estimated in people living in the general environment without any known Cd-pollution in Japan, and the value was inferred to be almost the same as that in Belgium, Sweden, and China.

  13. Structural Analysis of H2-Db Class I Molecules Containing Two Different Allelic Forms of the type 1 Diabetes Susceptibility Factor beta-2 Microglobulin: Implications for the Mechanism Underlying Viriations in Antigen Presentation

    SciTech Connect

    Roden,M.; Brims, D.; Fedorov, A.; DiLorenzo, T.; Almo, S.; Nathenson, s.; Anovitz, L.; Wesolowski, D.


    Beta-2 microglobulin ({beta}2m) is a member of the immunoglobulin-like domain superfamily that is an essential structural subunit of the MHC class I (MHC-I) molecule. {beta}2m was previously identified as a susceptibility factor for the development of type 1 diabetes (T1D) in NOD mice, whereby transgenic expression of the {beta}2m{sup a} variant, but not the {beta}2mb variant, restored diabetes susceptibility to normally resistant NOD.{beta}2m{sup null} mice. Here we report the crystal structures and thermodynamic stabilities of the NOD MHC-I molecule H2-D{sup b} containing these two variants. Our results reveal subtle differences in the structures of the {beta}2m variants, namely in minor loop shifts and in variations in the hydrogen bonding networks at the interfaces between the components of the ternary complex. We also demonstrate that the thermodynamic stabilities of the {beta}2m variants in isolation differ. However, the conformation of the peptide in the MHC cleft is unchanged in {beta}2m allelic Db complexes, as are the TCR recognition surfaces. Thus, despite modest structural differences between allelic complexes, the evidence indicates that D{sup b} peptide presentation of the representative peptide is unchanged in the context of either {beta}2m allelic variant. These data suggest that other mechanisms, such as differential association of MHC-I in multiprotein complexes, are likely responsible for the effect of {beta}2m on T1D development.

  14. The relationship between concentrations of magnesium and oxidized low-density lipoprotein and Beta2-microglobulin in the serum of patients on the end-stage of renal disease.


    Raikou, Vaia D; Kyriaki, Despina


    The end-stage of renal disease is associated with increased oxidative stress and oxidative modification of low-density lipoproteins (LDLs). Beta2 microglobulin (beta2M) is accumulated in the serum of dialysis patients. Magnesium (Mg) plays a protective role in the development of oxidative stress in healthy subjects. We studied the relationship between concentrations of magnesium and oxidized LDL (ox-LDL) and beta2M in the serum of patients on the end stage of renal disease. In 96 patients on on-line- predilution hemodiafiltration, beta2M and intact parathormone were measured by radioimmunoassays. High-sensitivity C-reactive protein (hsCRP) and ox-LDL were measured using ΕLISA. Serum bicarbonate levels were measured in the blood gas analyser gas machine. We performed logistic regression analysis models to investigate Mg as an important independent predictor of elevated ox-LDL and high beta2M serum concentrations, after adjustment to traditional and specific for dialysis patients' factors. We observed a positive correlation of Mg with ox-LDL (r = 0.383, P = 0.001), but the association of Mg with beta2M, hsCRP, and serum bicarbonate levels was significantly inverse (r = -0.252, P = 0.01, r = -0.292, P = 0.004, and r = -0.282, P = 0.04 respectively). The built logistic-regression analysis showed that Mg act as a significant independent factor for the elevated ox-LDL and beta2M serum concentrations adjusting to traditional and specific factors for these patients. We observed a positive relationship between magnesium and acidosis status- related ox-LDL concentrations, but the inverse association between magnesium and beta2M serum concentrations in hemodialysis patients. PMID:27215248

  15. Calcium Binding to Beta-2-Microglobulin at Physiological Ph Drives the Occurrence of Conformational Changes Which Cause the Protein to Precipitate into Amorphous Forms That Subsequently Transform into Amyloid Aggregates

    PubMed Central

    Kumar, Sukhdeep; Sharma, Prerna; Arora, Kanika; Raje, Manoj; Guptasarma, Purnananda


    Using spectroscopic, calorimetric and microscopic methods, we demonstrate that calcium binds to beta-2-microglobulin (β2m) under physiological conditions of pH and ionic strength, in biological buffers, causing a conformational change associated with the binding of up to four calcium atoms per β2m molecule, with a marked transformation of some random coil structure into beta sheet structure, and culminating in the aggregation of the protein at physiological (serum) concentrations of calcium and β2m. We draw attention to the fact that the sequence of β2m contains several potential calcium-binding motifs of the DXD and DXDXD (or DXEXD) varieties. We establish (a) that the microscopic aggregation seen at physiological concentrations of β2m and calcium turns into actual turbidity and visible precipitation at higher concentrations of protein and β2m, (b) that this initial aggregation/precipitation leads to the formation of amorphous aggregates, (c) that the formation of the amorphous aggregates can be partially reversed through the addition of the divalent ion chelating agent, EDTA, and (d) that upon incubation for a few weeks, the amorphous aggregates appear to support the formation of amyloid aggregates that bind to the dye, thioflavin T (ThT), resulting in increase in the dye's fluorescence. We speculate that β2m exists in the form of microscopic aggregates in vivo and that these don't progress to form larger amyloid aggregates because protein concentrations remain low under normal conditions of kidney function and β2m degradation. However, when kidney function is compromised and especially when dialysis is performed, β2m concentrations probably transiently rise to yield large aggregates that deposit in bone joints and transform into amyloids during dialysis related amyloidosis. PMID:24755626

  16. Systemic Amyloidosis: Lessons from β2-Microglobulin*

    PubMed Central

    Stoppini, Monica; Bellotti, Vittorio


    β2-Microglobulin is responsible for systemic amyloidosis affecting patients undergoing long-term hemodialysis. Its genetic variant D76N causes a very rare form of familial systemic amyloidosis. These two types of amyloidoses differ significantly in terms of the tissue localization of deposits and for major pathological features. Considering how the amyloidogenesis of the β2-microglobulin mechanism has been scrutinized in depth for the last three decades, the comparative analysis of molecular and pathological properties of wild type β2-microglobulin and of the D76N variant offers a unique opportunity to critically reconsider the current understanding of the relation between the protein's structural properties and its pathologic behavior. PMID:25750126

  17. Beta-2 Microglobulin Kidney Disease Test


    ... accumulate in joint spaces ( synovitis ) in long-term dialysis patients; this is called dialysis-related amyloidosis (DRA). A B2M test may be ... early kidney dysfunction. People who have been on dialysis for five years or more may develop dialysis- ...

  18. Selective development of T helper (Th)2 cells induced by continuous administration of low dose soluble proteins to normal and beta(2)-microglobulin-deficient BALB/c mice.


    Guery, J C; Galbiati, F; Smiroldo, S; Adorini, L


    Continuous administration of soluble proteins, delivered over a 10-d period by a mini-osmotic pump implanted subcutaneously, induces a long-lasting inhibition of antigen-specific T cell proliferation in lymph node cells from BALB/c mice subsequently primed with antigen in adjuvant. The decreased T cell proliferative response is associated with a down-regulation of the T helper cell (Th)1 cytokines interleukin (IL)-2 and interferon (IFN)-gamma and with a strong increase in the secretion of the Th2 cytokines IL-4 and IL-5 by antigen specific CD4+ T cells. This is accompanied by predominant inhibition of antigen-specific antibody production of IgG2a and IgG2b, rather than IgG1 isotype. Interestingly, inhibition of Th1 and priming of Th2 cells is also induced in beta(2) microglobulin-deficient BALB/c mice, indicating that neither CD8+ nor CD4+ NK1.1+ T cells, respectively, are required. The polarization in Th2 cells is stably maintained by T cell lines, all composed of CD4+/CD8- cells expressing T cell receptor for antigen (TCR) alpha/beta chains, derived from BALB/c mice treated with continuous antigen administration, indicating that they originate from Th2 cells fully differentiated in vivo. This polarization is induced in BALB/c mice by continuous administration of any protein antigen tested, including soluble extracts from pathogenic microorganisms. Priming of Th2 cells is dose dependent and it is optimal for low rather than high doses of protein. Blocking endogenous IL-4 in vivo inhibits expansion of antigen-specific Th2 cells, but does not restore IFN-gamma production by T cells from mice treated with soluble antigen-specific Th2 cells, but does not restore IFN-gamma production by T cells from mice treated with soluble antigen, indicating the involvement of two independent mechanisms. Consistent with this, Th2 cell development, but not inhibition of Th1 cells, depends on non-major histocompatibility complex genetic predisposition, since the Th2 response is

  19. Can small hydrophobic gold nanoparticles inhibit β2-microglobulin fibrillation?

    NASA Astrophysics Data System (ADS)

    Brancolini, Giorgia; Toroz, Dimitrios; Corni, Stefano


    Inorganic nanoparticles stabilized by a shell of organic ligands can enhance or suppress the natural propensity of proteins to form fibrils. Functionalization facilitates targeted delivery of the nanoparticles to various cell types, bioimaging, drug delivery and other therapeutic and diagnostic applications. In this study, we provide a computational model of the effect of a prototypical thiol-protected gold nanoparticle, Au25L18- (L = S(CH2)2Ph) on the β2-microglobulin natural fibrillation propensity. To reveal the molecular basis of the protein-nanoparticle association process, we performed various simulations at multiple levels (Classical Molecular Dynamics and Brownian Dynamics) that cover multiple length- and timescales. The results provide a model of the ensemble of structures constituting the protein-gold nanoparticle complexes, and insights into the driving forces for the binding of β2-microglobulin to hydrophobic small size gold nanoparticles. We have found that the small nanoparticles can bind the protein to form persistent complexes. This binding of nanoparticles is able to block the active sites of domains from binding to another protein, thus leading to potential inhibition of the fibrillation activity. A comparison with the binding patches identified for the interaction of the protein with a known inhibitor of fibrillation, supports our conclusion.Inorganic nanoparticles stabilized by a shell of organic ligands can enhance or suppress the natural propensity of proteins to form fibrils. Functionalization facilitates targeted delivery of the nanoparticles to various cell types, bioimaging, drug delivery and other therapeutic and diagnostic applications. In this study, we provide a computational model of the effect of a prototypical thiol-protected gold nanoparticle, Au25L18- (L = S(CH2)2Ph) on the β2-microglobulin natural fibrillation propensity. To reveal the molecular basis of the protein-nanoparticle association process, we performed various

  20. Co-fibrillogenesis of Wild-type and D76N β2-Microglobulin

    PubMed Central

    Natalello, Antonino; Mangione, P. Patrizia; Giorgetti, Sofia; Porcari, Riccardo; Marchese, Loredana; Zorzoli, Irene; Relini, Annalisa; Ami, Diletta; Faravelli, Giulia; Valli, Maurizia; Stoppini, Monica; Doglia, Silvia M.; Bellotti, Vittorio; Raimondi, Sara


    The amyloidogenic variant of β2-microglobulin, D76N, can readily convert into genuine fibrils under physiological conditions and primes in vitro the fibrillogenesis of the wild-type β2-microglobulin. By Fourier transformed infrared spectroscopy, we have demonstrated that the amyloid transformation of wild-type β2-microglobulin can be induced by the variant only after its complete fibrillar conversion. Our current findings are consistent with preliminary data in which we have shown a seeding effect of fibrils formed from D76N or the natural truncated form of β2-microglobulin lacking the first six N-terminal residues. Interestingly, the hybrid wild-type/variant fibrillar material acquired a thermodynamic stability similar to that of homogenous D76N β2-microglobulin fibrils and significantly higher than the wild-type homogeneous fibrils prepared at neutral pH in the presence of 20% trifluoroethanol. These results suggest that the surface of D76N β2-microglobulin fibrils can favor the transition of the wild-type protein into an amyloid conformation leading to a rapid integration into fibrils. The chaperone crystallin, which is a mild modulator of the lag phase of the variant fibrillogenesis, potently inhibits fibril elongation of the wild-type even once it is absorbed on D76N β2-microglobulin fibrils. PMID:26921323

  1. Urinary β2 microglobulin in workers exposed to arc welding fumes.


    Aminian, Omid; Eftekhari, Saeid; Mazaheri, Maria; Sharifian, Seyed Akbar; Sadeghniiat-Haghighi, Khosro


    Welding is a process in which two or more metals are attached by the use of heat and, in some cases, pressure. Direct exposure and inhalation of welding fumes causes acute and chronic side effects in humans. Kidney damage is one of these important side effects. β(2) microglobulin is an 11.8 kilodalton protein and levels increase in the case of some inflammatory and viral diseases, or kidney malfunction and autoimmune diseases. In this study measurements of β(2) microglobulin were used as a criterion for assessing effects on the kidneys of workers exposed to welding fumes. The study population were electric arc welders in an industrial plant in Tehran, Iran. For control we selected workers who did not have any exposure to welding fumes. Both groups were selected on the basis of a questionnaire and the consideration of criteria for inclusion and exclusion. In the end 50 cases and 50 controls were chosen. A urine sample was collected from all participants and urinary pH was set to between 6-8 using NaOH (1M). Sample transportation to the laboratory complied with the related standards. The samples were assessed using the ORG 5BM kit. For quantitative assessment of β(2) microglobulin we used the Enzyme-linked Immunosorbent Assay (ELISA) method. The ages of the welders ranged from 21 to 48 years (mean=30.5 ± 5.9 yrs) and of controls from 23 to 56 years (mean=31.8 ± 5.9 yrs). Mean employment duration was 7.86 ± 5.01 years (range 2 to 27 years) for welders. Mean β(2) microglobulin level was 0.10 ± 0.096 μg/ml in welders and 0.11 ± 0.06 in controls. This difference was not statistically significant (P=0.381). In conclusion we don't find that exposure to electric arc welding fumes cause a significant change in urinary β(2) microglobulin compared to the control group. PMID:22131246

  2. Adenovirus expressing β2-microglobulin recovers HLA class I expression and antitumor immunity by increasing T-cell recognition.


    Del Campo, A B; Carretero, J; Muñoz, J A; Zinchenko, S; Ruiz-Cabello, F; González-Aseguinolaza, G; Garrido, F; Aptsiauri, N


    Optimal tumor cell surface expression of human leukocyte antigen (HLA) class I molecules is essential for the presentation of tumor-associated peptides to T-lymphocytes. However, a hallmark of many types of tumor is the loss or downregulation of HLA class I expression associated with ineffective tumor antigen presentation to T cells. Frequently, HLA loss can be caused by structural alterations in genes coding for HLA class I complex, including the light chain of the complex, β2-microglobulin (β2m). Its best-characterized function is to interact with HLA heavy chain and stabilize the complex leading to a formation of antigen-binding cleft recognized by T-cell receptor on CD8+ T cells. Our previous study demonstrated that alterations in the β2m gene are frequently associated with cancer immune escape leading to metastatic progression and resistance to immunotherapy. These types of defects require genetic transfer strategies to recover normal expression of HLA genes. Here we characterize a replication-deficient adenoviral vector carrying human β2m gene, which is efficient in recovering proper tumor cell surface HLA class I expression in β2m-negative tumor cells without compromising the antigen presentation machinery. Tumor cells transduced with β2m induced strong activation of T cells in a peptide-specific HLA-restricted manner. Gene therapy using recombinant adenoviral vectors encoding HLA genes increases tumor antigen presentation and represents a powerful tool for modulation of tumor cell immunogenicity by restoration of missing or altered HLA genes. It should be considered as part of cancer treatment in combination with immunotherapy. PMID:24971583

  3. Identification of the class I genes of the mouse major histocompatibility complex by DNA-mediated gene transfer.


    Goodenow, R S; McMillan, M; Nicolson, M; Sher, B T; Eakle, K; Davidson, N; Hood, L


    DNA-mediated gene transfer was used to identify cloned class I genes from the major histocompatibility complex of the BALB/c mouse. Three genes encoding the transplantation antigens H-2 Kd, Dd and Ld were identified as well as genes encoding the Qa-2,3 and two TL differentiation antigens. As many as 10 putative novel class I genes were detected by the association of their gene products with beta 2-microglobulin. Alloantiserum prepared to one of the novel antigens was used to demonstrate the expression of the previously undetected antigen on spleen cells of various inbred, congeneic, and recombinant congeneic strains of mice. PMID:6815535

  4. A novel role for β2-microglobulin: a precursor of antibacterial chemokine in respiratory epithelial cells

    PubMed Central

    Chiou, Shean-Jaw; Wang, Chan-Chi; Tseng, Yan-Shen; Lee, Yen-Jung; Chen, Shih-Chieh; Chou, Chi-Hsien; Chuang, Lea-Yea; Hong, Yi-Ren; Lu, Chi-Yu; Chiu, Chien-Chih; Chignard, Michel


    We analyzed a panel of cationic molecules secreted in the culture medium of human respiratory epithelial cells (REC) upon activation by IL-1β and different pathogen-associated molecular patterns. A 9 kDa fragment derived from β2-microglobulin (B2M) was identified and named shed 9 kDa B2M (sB2M-9). The primary structure of sB2M-9 was revealed to increase its pI value that potentially could play an important role in innate defense. sB2M-9 exhibits antibacterial activity against Gram positive Staphylococcus aureus (SA) but not against Gram negative Klebsiella pneumonia (KP). Upon its binding to SA, sB2M-9 induces clumps, a phenomenon not observed with B2M. Migration of THP-1 monocytes exposed to SA clumps was significantly greater than that to SA without clumps. sB2M-9 binds to SA, more likely as a chemokine, to facilitate THP-1 migration. As a whole, we demonstrated that REC release a novel chemokine with antibacterial activity that is shed from B2M to facilitate THP-1 migration. PMID:27503241

  5. Molecular insights into cell toxicity of a novel familial amyloidogenic variant of β2-microglobulin.


    Leri, Manuela; Bemporad, Francesco; Oropesa-Nuñez, Reinier; Canale, Claudio; Calamai, Martino; Nosi, Daniele; Ramazzotti, Matteo; Giorgetti, Sofia; Pavone, Francesco S; Bellotti, Vittorio; Stefani, Massimo; Bucciantini, Monica


    The first genetic variant of β2 -microglobulin (b2M) associated with a familial form of systemic amyloidosis has been recently described. The mutated protein, carrying a substitution of Asp at position 76 with an Asn (D76N b2M), exhibits a strongly enhanced amyloidogenic tendency to aggregate with respect to the wild-type protein. In this study, we characterized the D76N b2M aggregation path and performed an unprecedented analysis of the biochemical mechanisms underlying aggregate cytotoxicity. We showed that, contrarily to what expected from other amyloid studies, early aggregates of the mutant are not the most toxic species, despite their higher surface hydrophobicity. By modulating ganglioside GM1 content in cell membrane or synthetic lipid bilayers, we confirmed the pivotal role of this lipid as aggregate recruiter favouring their cytotoxicity. We finally observed that the aggregates bind to the cell membrane inducing an alteration of its elasticity (with possible functional unbalance and cytotoxicity) in GM1-enriched domains only, thus establishing a link between aggregate-membrane contact and cell damage. PMID:26990223

  6. A novel role for β2-microglobulin: a precursor of antibacterial chemokine in respiratory epithelial cells.


    Chiou, Shean-Jaw; Wang, Chan-Chi; Tseng, Yan-Shen; Lee, Yen-Jung; Chen, Shih-Chieh; Chou, Chi-Hsien; Chuang, Lea-Yea; Hong, Yi-Ren; Lu, Chi-Yu; Chiu, Chien-Chih; Chignard, Michel


    We analyzed a panel of cationic molecules secreted in the culture medium of human respiratory epithelial cells (REC) upon activation by IL-1β and different pathogen-associated molecular patterns. A 9 kDa fragment derived from β2-microglobulin (B2M) was identified and named shed 9 kDa B2M (sB2M-9). The primary structure of sB2M-9 was revealed to increase its pI value that potentially could play an important role in innate defense. sB2M-9 exhibits antibacterial activity against Gram positive Staphylococcus aureus (SA) but not against Gram negative Klebsiella pneumonia (KP). Upon its binding to SA, sB2M-9 induces clumps, a phenomenon not observed with B2M. Migration of THP-1 monocytes exposed to SA clumps was significantly greater than that to SA without clumps. sB2M-9 binds to SA, more likely as a chemokine, to facilitate THP-1 migration. As a whole, we demonstrated that REC release a novel chemokine with antibacterial activity that is shed from B2M to facilitate THP-1 migration. PMID:27503241

  7. Structure, Folding Dynamics, and Amyloidogenesis of D76N β2-Microglobulin

    PubMed Central

    Mangione, P. Patrizia; Esposito, Gennaro; Relini, Annalisa; Raimondi, Sara; Porcari, Riccardo; Giorgetti, Sofia; Corazza, Alessandra; Fogolari, Federico; Penco, Amanda; Goto, Yuji; Lee, Young-Ho; Yagi, Hisashi; Cecconi, Ciro; Naqvi, Mohsin M.; Gillmore, Julian D.; Hawkins, Philip N.; Chiti, Fabrizio; Rolandi, Ranieri; Taylor, Graham W.; Pepys, Mark B.; Stoppini, Monica; Bellotti, Vittorio


    Systemic amyloidosis is a fatal disease caused by misfolding of native globular proteins, which then aggregate extracellularly as insoluble fibrils, damaging the structure and function of affected organs. The formation of amyloid fibrils in vivo is poorly understood. We recently identified the first naturally occurring structural variant, D76N, of human β2-microglobulin (β2m), the ubiquitous light chain of class I major histocompatibility antigens, as the amyloid fibril protein in a family with a new phenotype of late onset fatal hereditary systemic amyloidosis. Here we show that, uniquely, D76N β2m readily forms amyloid fibrils in vitro under physiological extracellular conditions. The globular native fold transition to the fibrillar state is primed by exposure to a hydrophobic-hydrophilic interface under physiological intensity shear flow. Wild type β2m is recruited by the variant into amyloid fibrils in vitro but is absent from amyloid deposited in vivo. This may be because, as we show here, such recruitment is inhibited by chaperone activity. Our results suggest general mechanistic principles of in vivo amyloid fibrillogenesis by globular proteins, a previously obscure process. Elucidation of this crucial causative event in clinical amyloidosis should also help to explain the hitherto mysterious timing and location of amyloid deposition. PMID:24014031

  8. Marked elevation of urinary β2-microglobulin in patients with reversible splenial lesions: A small case series.


    Azuma, Junji; Nabatame, Shin; Katsura, Toshiya; Yamamoto, Kyoko; Kaneno, Hiroshi; Kijima, Eri; Mizoguchi, Yoshimi; Shimotsuji, Tunesuke; Yamamoto, Takehisa; Ozono, Keiichi


    The magnetic resonance imaging findings of reversible isolated lesions with transiently reduced diffusion in the splenium of corpus callosum of patients with a wide spectrum of pathological conditions are referred to as reversible splenial lesion syndrome (RESLES). Clinically mild encephalitis/encephalopathy with a reversible splenial lesion (MERS) is probably included within the spectrum of RESLES; however, its exact pathophysiology is not known. Here, we describe three patients with MERS and one patient with RESLES, all of whom showed elevated urinary β2-microglobulin regardless of diagnosis and presence of pathogens. Elevated urinary β2-microglobulin suggested that an excessive immune response might play a role in the pathophysiology of reversible splenial lesions. PMID:27538611

  9. Characterization of Salt-Induced Oligomerization of Human β2-Microglobulin at Low pH.


    Narang, Dominic; Singh, Anubhuti; Swasthi, Hema M; Mukhopadhyay, Samrat


    Misfolding and amyloid aggregation of human β2-microglobulin (β2m) have been linked to dialysis-related amyloidosis. Previous studies have shown that in the presence of different salt concentrations and at pH 2.5, β2m assembles into aggregates with distinct morphologies. However, the structural and mechanistic details of the aggregation of β2m, giving rise to different morphologies, are poorly understood. In this work, we have extensively characterized the salt-induced oligomers of the acid-unfolded state of β2m using an array of biophysical tools including steady-state and time-resolved fluorescence, circular dichroism, dynamic light scattering, and atomic force microscopy imaging. Fluorescence studies using the oligomer-sensitive molecular rotor, 4-(dicyanovinyl)-julolidine, in conjunction with the light scattering and cross-linking assay indicated that at low salt (NaCl) concentrations β2m exists as a disordered monomer, capable of transforming into ordered amyloid. In the presence of higher concentrations of salt, β2m aggregates into a larger oligomeric species that does not appear to transform into amyloid fibrils. Site-specific fluorescence experiments using single Trp variants of β2m revealed that the middle region of the protein is incorporated into these oligomers, whereas the C-terminal segment is highly exposed to bulk water. Additionally, stopped-flow kinetic experiments indicated that the formation of hydrophobic core and oligomerization occur concomitantly. Our results revealed the distinct pathways by which β2m assembles into oligomers and fibrils. PMID:27467899

  10. High Serum Level of β2-Microglobulin in Late Posttransplant Period Predicts Subsequent Decline in Kidney Allograft Function: A Preliminary Study

    PubMed Central

    Trailin, Andriy V.; Pleten, Marina V.; Ostapenko, Tatiana I.; Iefimenko, Nadiia F.; Nikonenko, Olexander S.


    Background. Identification of patients at risk for kidney allograft (KAG) failure beyond the first posttransplant year is an unmet need. We aimed to determine whether serum beta-2-microglobulin (β2MG) in the late posttransplant period could predict a decline in KAG function. Methods. We assessed a value of single measurement of serum β2MG at one to seventeen years after transplantation in predicting the estimated glomerular filtration rate (eGFR) and the decline in eGFR over a period of two years in 79 recipients of KAG. Results. At baseline serum β2MG concentration was higher (P = 0.011) in patients with allograft dysfunction: 8.67 ± 2.48 µg/mL versus those with satisfactory graft function: 6.67 ± 2.13 µg/mL. Higher β2MG independently predicted the lower eGFR, the drop in eGFR by ≥25% after one and two years, and the value of negative eGFR slope. When combined with proteinuria and acute rejection, serum β2MG had excellent power in predicting certain drop in eGFR after one year (AUC = 0.910). In conjunction with posttransplant time serum β2MG had good accuracy in predicting certain eGFR drop after two years (AUC = 0.821). Conclusions. Elevated serum β2MG in the late posttransplant period is useful in identifying patients at risk for rapid loss of graft function. PMID:26633915

  11. Copper Binding to β-2-Microglobulin and its Pre-Amyloid Oligomers†

    PubMed Central

    Srikanth, Rapole; Mendoza, Vanessa Leah; Bridgewater, Juma D.; Zhang, Guanshi; Vachet, Richard W.


    β-2-microglobulin (β2m) deposits as amyloid fibrils in the musculoskeletal system of patients undergoing long-term dialysis treatment as a result of kidney failure. Previous work has shown that Cu(II) binding causes β2m to organize into native-like dimers and tetramers that precede amyloid formation. Cu(II) is then released from higher order oligomers before mature Cu(II)-free amyloid fibrils are formed. While some of the Cu(II)-induced structural changes that enable β2m self assembly are starting to be revealed, the details of how the Cu(II) binding site evolves from the monomer to the dimers and tetramers are not known. Here, we report results from three mass spectrometry (MS) based methods that provide insight into the changing Cu-β2m interactions. We find that monomeric β2m binds Cu(II) via the N-terminal amine, the amide of Gln2, His31, and Asp59. In the dimer and tetramer, Asp59 is no longer bound to Cu(II), but the other residues still comprise a well-defined albeit weaker binding site that is better able to release Cu(II). Consistent with this is the observation that a fraction of the tetrameric species no longer binds Cu(II) at this weakened binding site, which agrees with a previous report that suggested the tetramer as the first Cu(II)-free oligomer. Our results also provide some insight into structural changes caused by Cu(II) binding that facilitate oligomer formation. Specifically, binding by Asp59 in the monomer requires significant movement of this residue, and we propose that this repositioning is important for establishing a pair of dimer-stabilizing salt bridges between this residue and Lys19. We also find evidence that Cu(II) binding in the N-terminal region of the monomer repels Arg3, which likely allows this residue to form a pair of dimer-stabilizing salt bridges with Glu16. Overall, our measurements suggest that the previously proposed conformational switch caused by Cu(II) binding includes not only a cis-trans isomerization at Pro32

  12. Chronic Lymphocytic Inflammation with Pontine Perivascular Enhancement Responsive to Steroids with a Significant Elevation of β-2 Microglobulin Levels

    PubMed Central

    Fujisawa, Naoaki; Mori, Harushi; Matsui, Toru


    Chronic lymphocytic inflammation with pontine perivascular enhancement responsive to steroids (CLIPPERS) is a relapsing-remitting disorder for which steroid administration is a key to control the progression. CLIPPERS can exhibit radiological features similar to malignant lymphoma, whose diagnosis is confounded by prior steroid administration. We report a case of CLIPPERS accompanied by abnormal elevation of β-2 microglobulin in the cerebrospinal fluid (CSF). A 62-year-old man started to experience numbness in all fingers of his left hand one year ago, which gradually extended to his body trunk and legs on both sides. Magnetic resonance imaging demonstrated numerous small enhancing spots scattered in his brain and spinal cord. CSF levels of β-2 microglobulin were elevated; although this often indicates central nervous system involvement in leukemia and lymphoma, the lesions were diagnosed as CLIPPERS based on the pathological findings from a biopsy specimen. We emphasize the importance of biopsy to differentiate between CLIPPERS and malignant lymphoma because the temporary radiological response to steroid might be the same in both diseases but the treatment strategies regarding the use of steroid are quite different. PMID:26713153

  13. A Simulated Intermediate State for Folding and Aggregation Provides Insights into ΔN6 β2-Microglobulin Amyloidogenic Behavior

    PubMed Central

    Estácio, Sílvia G.; Krobath, Heinrich; Vila-Viçosa, Diogo; Machuqueiro, Miguel; Shakhnovich, Eugene I.; Faísca, Patrícia F. N.


    A major component of ex vivo amyloid plaques of patients with dialysis-related amyloidosis (DRA) is a cleaved variant of β2-microglobulin (ΔN6) lacking the first six N-terminal residues. Here we perform a computational study on ΔN6, which provides clues to understand the amyloidogenicity of the full-length β2-microglobulin. Contrary to the wild-type form, ΔN6 is able to efficiently nucleate fibrillogenesis in vitro at physiological pH. This behavior is enhanced by a mild acidification of the medium such as that occurring in the synovial fluid of DRA patients. Results reported in this work, based on molecular simulations, indicate that deletion of the N-terminal hexapeptide triggers the formation of an intermediate state for folding and aggregation with an unstructured strand A and a native-like core. Strand A plays a pivotal role in aggregation by acting as a sticky hook in dimer assembly. This study further predicts that the detachment of strand A from the core is maximized at pH 6.2 resulting into higher aggregation efficiency. The structural mapping of the dimerization interface suggests that Tyr10, His13, Phe30 and His84 are hot-spot residues in ΔN6 amyloidogenesis. PMID:24809460

  14. Pancreatic beta cells express a diverse set of homeobox genes.

    PubMed Central

    Rudnick, A; Ling, T Y; Odagiri, H; Rutter, W J; German, M S


    Homeobox genes, which are found in all eukaryotic organisms, encode transcriptional regulators involved in cell-type differentiation and development. Several homeobox genes encoding homeodomain proteins that bind and activate the insulin gene promoter have been described. In an attempt to identify additional beta-cell homeodomain proteins, we designed primers based on the sequences of beta-cell homeobox genes cdx3 and lmx1 and the Drosophila homeodomain protein Antennapedia and used these primers to amplify inserts by PCR from an insulinoma cDNA library. The resulting amplification products include sequences encoding 10 distinct homeodomain proteins; 3 of these proteins have not been described previously. In addition, an insert was obtained encoding a splice variant of engrailed-2, a homeodomain protein previously identified in the central nervous system. Northern analysis revealed a distinct pattern of expression for each homeobox gene. Interestingly, the PCR-derived clones do not represent a complete sampling of the beta-cell library because no inserts encoding cdx3 or lmx1 protein were obtained. Beta cells probably express additional homeobox genes. The abundance and diversity of homeodomain proteins found in beta cells illustrate the remarkable complexity and redundancy of the machinery controlling beta-cell development and differentiation. Images PMID:7991607

  15. Structure of the mouse calcitonin/calcitonin gene-related peptide alpha and beta genes.


    Thomas, P M; Nasonkin, I; Zhang, H; Gagel, R F; Cote, G J


    We report the cloning, genomic organization and sequence of the mouse alpha-CALC and beta-CALC genes. The two genes share extensive sequence homology. The transcription units of both genes contain 6 exons. Transcripts of the alpha-CALC gene were found to alternatively include exon 4 or exons 5 and 6. For the beta-CALC gene exon 4 was not detected in transcripts derived from this gene. The predicted mouse alpha-CGRP was found to be identical to rat alpha-CGRP, however, beta-CGRP predicted amino acid sequences revealed three amino acid differences suggesting these residues are not critical to CGRP function. PMID:11761712

  16. Nucleotide sequence of SHV-2 beta-lactamase gene

    SciTech Connect

    Garbarg-Chenon, A.; Godard, V.; Labia, R.; Nicolas, J.C. )


    The nucleotide sequence of plasmid-mediated beta-lactamase SHV-2 from Salmonella typhimurium (SHV-2pHT1) was determined. The gene was very similar to chromosomally encoded beta-lactamase LEN-1 of Klebsiella pneumoniae. Compared with the sequence of the Escherichia coli SHV-2 enzyme (SHV-2E.coli) obtained by protein sequencing, the deduced amino acid sequence of SHV-2pHT1 differed by three amino acid substitutions.

  17. Same. beta. -globin gene mutation is present on nine different. beta. -thalassemia chromosomes in a Sardinian population

    SciTech Connect

    Pirastu, M.; Galanello, R.; Doherty, M.A.; Tuveri, T.; Cao, A.; Kan, Y.W.


    The predominant ..beta..-thalassemia in Sardinia is the ..beta../sup 0/ type in which no ..beta..-globin chains are synthesized in the homozygous state. The authors determined the ..beta..-thalassemia mutations in this population by the oligonucleotide-probe method and defined the chromosome haplotypes on which the mutation resides. The same ..beta../sup 39(CAG..-->..TAG)/ nonsense mutation was found on nine different chromosome haplotypes. Although this mutation may have arisen more than once, the multiple haplotypes could also be generated by crossing over and gene conversion events. These findings underscore the frequency of mutational events in the ..beta..-globin gene region.

  18. Comparison of the aggregation of homologous β2-microglobulin variants reveals protein solubility as a key determinant of amyloid formation

    PubMed Central

    Pashley, Clare L.; Hewitt, Eric W.; Radford, Sheena E.


    The mouse and human β2-microglobulin protein orthologs are 70 % identical in sequence and share 88 % sequence similarity. These proteins are predicted by various algorithms to have similar aggregation and amyloid propensities. However, whilst human β2m (hβ2m) forms amyloid-like fibrils in denaturing conditions (e.g. pH 2.5) in the absence of NaCl, mouse β2m (mβ2m) requires the addition of 0.3 M NaCl to cause fibrillation. Here, the factors which give rise to this difference in amyloid propensity are investigated. We utilise structural and mutational analyses, fibril growth kinetics and solubility measurements under a range of pH and salt conditions, to determine why these two proteins have different amyloid propensities. The results show that, although other factors influence the fibril growth kinetics, a striking difference in the solubility of the proteins is a key determinant of the different amyloidogenicity of hβ2m and mβ2m. The relationship between protein solubility and lag time of amyloid formation is not captured by current aggregation or amyloid prediction algorithms, indicating a need to better understand the role of solubility on the lag time of amyloid formation. The results demonstrate the key contribution of protein solubility in determining amyloid propensity and lag time of amyloid formation, highlighting how small differences in protein sequence can have dramatic effects on amyloid formation. PMID:26780548

  19. Structural Insights into the Pre-amyloid Tetramer of β-2-microglobulin from Covalent Labeling and Mass Spectrometry‡

    PubMed Central

    Mendoza, Vanessa Leah; Barón-Rodríguez, Mario A.; Blanco, Cristian; Vachet, Richard W.


    The main pathogenic process underlying dialysis-related amyloidosis (DRA) is the accumulation of β-2-microglobulin (β2m) as amyloid fibrils in the musculoskeletal system, and some evidence suggests that Cu(II) may play a role in β2m amyloid formation. Cu(II)-induced β2m fibril formation is preceded by the formation of discrete, oligomeric intermediates, including dimers, tetramers, and hexamers. In this work, we use selective covalent labeling reactions combined with mass spectrometry to investigate the amino acids responsible for mediating tetramer formation in wild-type β2m. By comparing the labeling patterns of the monomer, dimer, and tetramer, we find evidence that the tetramer interface is formed by the interaction of D strands from one dimer unit and G strands from another dimer unit. This covalent labeling data along with molecular dynamics calculations enable the construction of a tetramer model that indicates how the protein might proceed to form even higher order oligomers. PMID:21718071

  20. Dissociation of β2-microglobulin determines the surface quality control of major histocompatibility complex class I molecules.


    Montealegre, Sebastián; Venugopalan, Vaishnavi; Fritzsche, Susanne; Kulicke, Corinna; Hein, Zeynep; Springer, Sebastian


    Major histocompatibility complex class I proteins, which present antigenic peptides to cytotoxic T lymphocytes at the surface of all nucleated cells, are endocytosed and destroyed rapidly once their peptide ligand has dissociated. The molecular mechanism of this cellular quality control process, which prevents rebinding of exogenous peptides and thus erroneous immune responses, is unknown. To identify the nature of the decisive step in endocytic sorting of class I molecules and its location, we have followed the removal of optimally and suboptimally peptide-loaded murine H-2K(b) class I proteins from the cell surface. We find that the binding of their light chain, β2-microglobulin (β2m), protects them from endocytic destruction. Thus, the extended survival of suboptimally loaded K(b) molecules at 25°C is attributed to decreased dissociation of β2m. Because all forms of K(b) are constantly internalized but little β2m-receptive heavy chain is present at the cell surface, it is likely that β2m dissociation and recognition of the heavy chain for lysosomal degradation take place in an endocytic compartment. PMID:25782992

  1. Assessing the effect of loop mutations in the folding space of β2-microglobulin with molecular dynamics simulations.


    Estácio, Sílvia G; Shakhnovich, Eugene I; Faísca, Patrícia F N


    We use molecular dynamics simulations of a full atomistic Gō model to explore the impact of selected DE-loop mutations (D59P and W60C) on the folding space of protein human β2-microglobulin (Hβ2m), the causing agent of dialysis-related amyloidosis, a conformational disorder characterized by the deposition of insoluble amyloid fibrils in the osteoarticular system. Our simulations replicate the effect of mutations on the thermal stability that is observed in experiments in vitro. Furthermore, they predict the population of a partially folded state, with 60% of native internal free energy, which is akin to a molten globule. In the intermediate state, the solvent accessible surface area increases up to 40 times relative to the native state in 38% of the hydrophobic core residues, indicating that the identified species has aggregation potential. The intermediate state preserves the disulfide bond established between residue Cys25 and residue Cys80, which helps maintain the integrity of the core region, and is characterized by having two unstructured termini. The movements of the termini dominate the essential modes of the intermediate state, and exhibit the largest displacements in the D59P mutant, which is the most aggregation prone variant. PROPKA predictions of pKa suggest that the population of the intermediate state may be enhanced at acidic pH explaining the larger amyloidogenic potential observed in vitro at low pH for the WT protein and mutant forms. PMID:23975166

  2. Comparison of the aggregation of homologous β2-microglobulin variants reveals protein solubility as a key determinant of amyloid formation.


    Pashley, Clare L; Hewitt, Eric W; Radford, Sheena E


    The mouse and human β2-microglobulin protein orthologs are 70% identical in sequence and share 88% sequence similarity. These proteins are predicted by various algorithms to have similar aggregation and amyloid propensities. However, whilst human β2m (hβ2m) forms amyloid-like fibrils in denaturing conditions (e.g. pH2.5) in the absence of NaCl, mouse β2m (mβ2m) requires the addition of 0.3M NaCl to cause fibrillation. Here, the factors which give rise to this difference in amyloid propensity are investigated. We utilise structural and mutational analyses, fibril growth kinetics and solubility measurements under a range of pH and salt conditions, to determine why these two proteins have different amyloid propensities. The results show that, although other factors influence the fibril growth kinetics, a striking difference in the solubility of the proteins is a key determinant of the different amyloidogenicity of hβ2m and mβ2m. The relationship between protein solubility and lag time of amyloid formation is not captured by current aggregation or amyloid prediction algorithms, indicating a need to better understand the role of solubility on the lag time of amyloid formation. The results demonstrate the key contribution of protein solubility in determining amyloid propensity and lag time of amyloid formation, highlighting how small differences in protein sequence can have dramatic effects on amyloid formation. PMID:26780548

  3. β2-Microglobulin Amyloid Fibrils Are Nanoparticles That Disrupt Lysosomal Membrane Protein Trafficking and Inhibit Protein Degradation by Lysosomes*

    PubMed Central

    Jakhria, Toral; Hellewell, Andrew L.; Porter, Morwenna Y.; Jackson, Matthew P.; Tipping, Kevin W.; Xue, Wei-Feng; Radford, Sheena E.; Hewitt, Eric W.


    Fragmentation of amyloid fibrils produces fibrils that are reduced in length but have an otherwise unchanged molecular architecture. The resultant nanoscale fibril particles inhibit the cellular reduction of the tetrazolium dye 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), a substrate commonly used to measure cell viability, to a greater extent than unfragmented fibrils. Here we show that the internalization of β2-microglobulin (β2m) amyloid fibrils is dependent on fibril length, with fragmented fibrils being more efficiently internalized by cells. Correspondingly, inhibiting the internalization of fragmented β2m fibrils rescued cellular MTT reduction. Incubation of cells with fragmented β2m fibrils did not, however, cause cell death. Instead, fragmented β2m fibrils accumulate in lysosomes, alter the trafficking of lysosomal membrane proteins, and inhibit the degradation of a model protein substrate by lysosomes. These findings suggest that nanoscale fibrils formed early during amyloid assembly reactions or by the fragmentation of longer fibrils could play a role in amyloid disease by disrupting protein degradation by lysosomes and trafficking in the endolysosomal pathway. PMID:25378395

  4. β2-Microglobulin Amyloid Fibril-Induced Membrane Disruption Is Enhanced by Endosomal Lipids and Acidic pH

    PubMed Central

    Goodchild, Sophia C.; Sheynis, Tania; Thompson, Rebecca; Tipping, Kevin W.; Xue, Wei-Feng; Ranson, Neil A.; Beales, Paul A.; Hewitt, Eric W.; Radford, Sheena E.


    Although the molecular mechanisms underlying the pathology of amyloidoses are not well understood, the interaction between amyloid proteins and cell membranes is thought to play a role in several amyloid diseases. Amyloid fibrils of β2-microglobulin (β2m), associated with dialysis-related amyloidosis (DRA), have been shown to cause disruption of anionic lipid bilayers in vitro. However, the effect of lipid composition and the chemical environment in which β2m-lipid interactions occur have not been investigated previously. Here we examine membrane damage resulting from the interaction of β2m monomers and fibrils with lipid bilayers. Using dye release, tryptophan fluorescence quenching and fluorescence confocal microscopy assays we investigate the effect of anionic lipid composition and pH on the susceptibility of liposomes to fibril-induced membrane damage. We show that β2m fibril-induced membrane disruption is modulated by anionic lipid composition and is enhanced by acidic pH. Most strikingly, the greatest degree of membrane disruption is observed for liposomes containing bis(monoacylglycero)phosphate (BMP) at acidic pH, conditions likely to reflect those encountered in the endocytic pathway. The results suggest that the interaction between β2m fibrils and membranes of endosomal origin may play a role in the molecular mechanism of β2m amyloid-associated osteoarticular tissue destruction in DRA. PMID:25100247

  5. Uncovering the Early Assembly Mechanism for Amyloidogenic β2-Microglobulin Using Cross-linking and Native Mass Spectrometry*

    PubMed Central

    Hall, Zoe; Schmidt, Carla; Politis, Argyris


    β2-Microglobulin (β2m), a key component of the major histocompatibility class I complex, can aggregate into fibrils with severe clinical consequences. As such, investigating the structural aspects of the formation of oligomeric intermediates of β2m and their subsequent progression toward fibrillar aggregates is of great importance. However, β2m aggregates are challenging targets in structural biology, primarily due to their inherent transient and heterogeneous nature. Here we study the oligomeric distributions and structures of the early intermediates of amyloidogenic β2m and its truncated variant ΔN6-β2m. We established compact oligomers for both variants by integrating advanced mass spectrometric techniques with available electron microscopy maps and atomic level structures from NMR spectroscopy and x-ray crystallography. Our results revealed a stepwise assembly mechanism by monomer addition and domain swapping for the oligomeric species of ΔN6-β2m. The observed structural similarity and common oligomerization pathway between the two variants is likely to enable ΔN6-β2m to cross-seed β2m fibrillation and allow the formation of mixed fibrils. We further determined the key subunit interactions in ΔN6-β2m tetramer, revealing the importance of a domain-swapped hinge region for formation of higher order oligomers. Overall, we deliver new mechanistic insights into β2m aggregation, paving the way for future studies on the mechanisms and cause of amyloid fibrillation. PMID:26655720

  6. Cloning and sequencing of the gene for human. beta. -casein

    SciTech Connect

    Loennerdal, B.; Bergstroem, S.; Andersson, Y.; Hialmarsson, K.; Sundgyist, A.; Hernell, O. )


    Human {beta}-casein is a major protein in human milk. This protein is part of the casein micelle and has been suggested to have several physiological functions in the newborn. Since there is limited information on {beta}casein and the factors that affect its concentration in human milk, the authors have isolated and sequenced the gene for this protein. A human mammary gland cDNA library (Clontech) in gt 11 was screened by plaque hy-hybridization using a 42-mer synthetic {sup 32}p-labelled oligo-nucleotide. Positive clones were identified and isolated, DNA was prepared and the gene isolated by cleavage with EcoR1. Following subcloning (PUC18), restriction mapping and Southern blotting, DNA for sequencing was prepared. The gene was sequenced by the dideoxy method. Human {beta}-casein has 212 amino acids and the amino acid sequence deducted from the nucleotide sequence is to 91% identical to the published sequence for human {beta}-casein show a high degree of conservation at the leader peptide and the highly phosphorylated sequences, but also deletions and divergence at several positions. These results provide insight into the structure of the human {beta}-casein gene and will facilitate studies on factors affecting its expression.

  7. Correction of human. beta. sup S -globin gene by gene targeting

    SciTech Connect

    Shesely, E.G.; Hyungsuk Kim; Shehee, W.R.; Smithies, O. ); Papayannopoulou, T. ); Popovich, B.W. )


    As a step toward using gene targeting for gene therapy, the authors have corrected a human {beta}{sup S}-globin gene to the normal {beta}{sup A} allele by homologous recombination in the mouse-human hybrid cell line BSM. BSM is derived from a mouse erythroleukemia cell line and carries a single human chromosome 11 with the {beta}{sup S}-globin allele. A {beta}{sup A}-globin targeting construct containing a unique oligomer and a neomycin-resistance gene was electroporated into the BSM cells, which were then placed under G418 selection. Then 126 resulting pools containing a total {approx}29,000 G418-resistant clones were screened by PCR for the presence of a targeted recombinant: 3 positive pools were identified. A targeted clone was isolated by replating one of the positive pools into smaller pools and rescreening by PCR, followed by dilution cloning. Southern blot analysis demonstrated that the isolated clone had been targeted as planned. The correction of the {beta}{sup S} allele to {beta}{sup A} was confirmed both by allele-specific PCR and by allele-specific antibodies. Expression studies comparing the uninduced and induced RNA levels in unmodified BSM cells and in the targeted clone showed no significant alteration in the ability of the targeted clone to undergo induction, despite the potentially disrupting presence of a transcriptionally active neomycin gene 5{prime} to the human {beta}{sup A}-globin gene. Thus gene targeting can correct a {beta}{sup S} allele to {beta}{sup A}, and the use of a selectable helper gene need not significantly interfere with the induction of the corrected gene.

  8. Decoding the Structural Bases of D76N ß2-Microglobulin High Amyloidogenicity through Crystallography and Asn-Scan Mutagenesis.


    de Rosa, Matteo; Barbiroli, Alberto; Giorgetti, Sofia; Mangione, Patrizia P; Bolognesi, Martino; Ricagno, Stefano


    D76N is the first natural variant of human β-2 microglobulin (β2m) so far identified. Contrary to the wt protein, this mutant readily forms amyloid fibres in physiological conditions, leading to a systemic and severe amyloidosis. Although the Asp76Asn mutant has been extensively characterized, the molecular bases of its instability and aggregation propensity remain elusive. In this work all Asp residues of human β2m were individually substituted to Asn; D-to-N mutants (D34N, D38N, D53N, D59N, D96N and D98N) were characterised in terms of thermodynamic stability and aggregation propensity. Moreover, crystal structures of the D38N, D53N, D59N and D98N variants were solved at high-resolution (1.24-1.70 Å). Despite showing some significant variations in their thermal stabilities, none showed the dramatic drop in melting temperature (relative to the wt protein) as observed for the pathogenic mutant. Consistently, none of the variants here described displayed any increase in aggregation propensity under the experimental conditions tested. The crystal structures confirmed that D-to-N mutations are generally well tolerated, and lead only to minor reorganization of the side chains in close proximity of the mutated residue. D38N is the only exception, where backbone readjustments and a redistribution of the surface electrostatic charges are observed. Overall, our results suggest that neither removing negative charges at sites 34, 38, 53, 59, 96 and 98, nor the difference in β2m pI, are the cause of the aggressive phenotype observed in D76N. We propose that the dramatic effects of the D76N natural mutation must be linked to effects related to the crucial location of this residue within the β2m fold. PMID:26625273

  9. Decoding the Structural Bases of D76N ß2-Microglobulin High Amyloidogenicity through Crystallography and Asn-Scan Mutagenesis

    PubMed Central

    de Rosa, Matteo; Barbiroli, Alberto; Giorgetti, Sofia; Mangione, Patrizia P.; Bolognesi, Martino; Ricagno, Stefano


    D76N is the first natural variant of human β-2 microglobulin (β2m) so far identified. Contrary to the wt protein, this mutant readily forms amyloid fibres in physiological conditions, leading to a systemic and severe amyloidosis. Although the Asp76Asn mutant has been extensively characterized, the molecular bases of its instability and aggregation propensity remain elusive. In this work all Asp residues of human β2m were individually substituted to Asn; D-to-N mutants (D34N, D38N, D53N, D59N, D96N and D98N) were characterised in terms of thermodynamic stability and aggregation propensity. Moreover, crystal structures of the D38N, D53N, D59N and D98N variants were solved at high-resolution (1.24–1.70 Å). Despite showing some significant variations in their thermal stabilities, none showed the dramatic drop in melting temperature (relative to the wt protein) as observed for the pathogenic mutant. Consistently, none of the variants here described displayed any increase in aggregation propensity under the experimental conditions tested. The crystal structures confirmed that D-to-N mutations are generally well tolerated, and lead only to minor reorganization of the side chains in close proximity of the mutated residue. D38N is the only exception, where backbone readjustments and a redistribution of the surface electrostatic charges are observed. Overall, our results suggest that neither removing negative charges at sites 34, 38, 53, 59, 96 and 98, nor the difference in β2m pI, are the cause of the aggressive phenotype observed in D76N. We propose that the dramatic effects of the D76N natural mutation must be linked to effects related to the crucial location of this residue within the β2m fold. PMID:26625273

  10. Many de novo donor-specific antibodies recognize β2 -microglobulin-free, but not intact HLA heterodimers.


    Michel, K; Santella, R; Steers, J; Sahajpal, A; Downey, F X; Thohan, V; Oaks, M


    Solid-phase single antigen bead (SAB) assays are standard of care for detection and identification of donor-specific antibody (DSA) in patients who receive solid organ transplantation (SOT). While several studies have documented the reproducibility and sensitivity of SAB testing for DSA, there are little data available concerning its specificity. This study describes the identification of antibodies to β2 -microglobulin-free human leukocyte antigen (β2 -m-fHLA) heavy chains on SAB arrays and provides a reassessment of the clinical relevance of DSA testing by this platform. Post-transplant sera from 55 patients who were positive for de novo donor-specific antibodies on a SAB solid-phase immunoassay were tested under denaturing conditions in order to identify antibodies reactive with β2 -m-fHLA or native HLA (nHLA). Antibodies to β2 -m-fHLA were present in nearly half of patients being monitored in the post-transplant period. The frequency of antibodies to β2 -m-fHLA was similar among DSA and HLA antigens that were irrelevant to the transplant (non-DSA). Among the seven patients with clinical or pathologic antibody-mediated rejection (AMR), none had antibodies to β2 -m-fHLA exclusively; thus, the clinical relevance of β2 -m-fHLA is unclear. Our data suggests that SAB testing produces false positive reactions due to the presence of β2 -m-fHLA and these can lead to inappropriate assignment of unacceptable antigens during transplant listing and possibly inaccurate identification of DSA in the post-transplant period. PMID:27060279

  11. The molten globule of β(2)-microglobulin accumulated at pH 4 and its role in protein folding.


    Mukaiyama, Atsushi; Nakamura, Takashi; Makabe, Koki; Maki, Kosuke; Goto, Yuji; Kuwajima, Kunihiro


    The acid transition of β(2)-microglobulin (β2m) was studied by tryptophan fluorescence, peptide circular dichroism, and NMR spectroscopy. The protein exhibits a three-state transition with an equilibrium intermediate accumulated at pH4 (25°C). The pH4 intermediate has typical characteristics of the molten globule (MG) state; it showed a native-like secondary structure without specific side-chain tertiary structure, and the hydrodynamic radius determined by pulse field gradient NMR was only 20% larger than that of the native state. The accumulation of the pH4 intermediate is very analogous to the behavior of apomyoglobin, for which the pH4 MG has been well characterized, although β2m, a β-protein, is structurally very different from α-helical apomyoglobin. NMR pH titration of histidine residues of β2m has also indicated that His84 has an abnormally low pK(a) value in the native state. From the pH dependence of the unfolding transition, the protonations of this histidine and 10 weakly abnormal carboxylates triggered the transition from the native to the MG state. This behavior is again analogous to that of apomyoglobin, suggesting a common mechanism of production of the pH4 MG. In contrast to the folding of apomyoglobin, in which the MG was equivalent to the burst-phase kinetic folding intermediate, the burst-phase refolding intermediate of β2m, detected by stopped-flow circular dichroism, was significantly more structured than the pH4 intermediate. It is proposed that the folding of β2m from its acid-denatured state takes place in the following order: denatured state→MG→burst-phase intermediate→native state. PMID:23154171

  12. Macromolecular crowding favors the fibrillization of β2-microglobulin by accelerating the nucleation step and inhibiting fibril disassembly.


    Luo, Xu-Dong; Kong, Fan-Lou; Dang, Hai-Bin; Chen, Jie; Liang, Yi


    Hemodialysis-associated amyloidosis (HAA) involves the fibrillization of β2-microglobulin (β2M) and occurs in crowded physiological environments. However, how macromolecular crowding affects amyloid formation of β2M remains elusive. Here we study the effects of macromolecular crowding on amyloid formation and fibril disassembly of wild-type human β2M and its pathogenic mutant ΔN6. At strongly acidic pH2.5, the presence of a strong crowding agent (Ficoll 70 or dextran 70) not only dramatically accelerates the fibrillization of both wild-type β2M and its ΔN6 variant by reducing the lag time to a large extent, indicating the acceleration of the nucleation phase, but also remarkably increases the amount of β2M fibrils. At weakly acidic pH6.2, such an enhancing effect of macromolecular crowding on fibril formation is only observed for pathogenic mutant ΔN6, but not for wild-type β2M which does not form amyloid fibrils in the absence and presence of a crowding agent. Thus, we propose that the monomers of β2M form the nuclei, which is enhanced by macromolecular crowding, followed by the step of fibril elongation. Furthermore, at physiological pH, macromolecular crowding remarkably inhibits β2M fibril disassembly by decreasing rate constants corresponding to fast and slow stages of fibril disaggregation. Our data demonstrate that macromolecular crowding favors the fibrillization of β2M by accelerating the nucleation step and inhibiting fibril disassembly. Our findings provide clear evidence for the pathology of HAA that macromolecular crowding should be taken into account. PMID:27481166

  13. Asynchronous DNA replication within the human. beta. -globin gene locus

    SciTech Connect

    Epner, E.; Forrester, W.C.; Groudine, M. )


    The timing of DNA replication of the human {beta}-globin gene locus has been studied by blot hybridization of newly synthesized BrdUrd-substituted DNA from cells in different stages of the S phase. Using probes that span >120 kilobases across the human {beta}-globin gene locus, the authors show that the majority of this domain replicates in early S phase in the human erythroleukemia cell line K562 and in middle-to-late S phase in the lymphoid cell line Manca. However, in K562 cells three small regions display a strikingly different replication pattern than adjacent sequences. These islands, located in the inter-{gamma}-globin gene region and approximately 20 kilobases 5' to the {epsilon}-globin gene and 20 kilobases 3' to the {beta}-globin gene, replicate later and throughout S phase. A similar area is also present in the {alpha}-globin gene region in K562 cells. They suggest that these regions may represent sites of termination of replication forks.

  14. Molecular Basis for the Cu2+ Binding-Induced Destabilization of β2-Microglobulin Revealed by Molecular Dynamics Simulation

    PubMed Central

    Deng, Nan-Jie; Yan, Lisa; Singh, Deepak; Cieplak, Piotr


    According to experimental data, binding of the Cu2+ ions destabilizes the native state of β2-microglobulin (β2m). The partial unfolding of the protein was generally considered an early step toward fibril formation in dialysis-related amyloidosis. Recent NMR studies have suggested that the destabilization of the protein might be achieved through increased flexibility upon Cu2+ binding. However, the molecular mechanism of destabilization due to Cu2+, its role in amyloid formation, and the relative contributions of different potential copper-binding sites remain unclear. To elucidate the effect of ion ligation at atomic detail, a series of molecular dynamics simulations were carried out on apo- and Cu2+-β2m systems in explicit aqueous solutions, with varying numbers of bound ions. Simulations at elevated temperatures (360 K) provide detailed pictures for the process of Cu2+-binding-induced destabilization of the native structure at the nanosecond timescale, which are in agreement with experiments. Conformational transitions toward partially unfolded states were observed in protein solutions containing bound copper ions at His-31 and His-51, which is marked by an increase in the protein vibrational entropy, with TΔS(vibr) ranging from 30 to 69 kcal/mol. The binding of Cu2+ perturbs the secondary structure and the hydrogen bonding pattern disrupts the native hydrophobic contacts in the neighboring segments, which include the β-strand D2 and part of the β-strand E, B, and C and results in greater exposure of the D-E loop and the B-C loop to the water environment. Analysis of the MD trajectories suggests that the changes in the hydrophobic environment near the copper-binding sites lower the barrier of conformational transition and stabilize the more disordered conformation. The results also indicate that the binding of Cu2+ at His-13 has little effect on the conformational stability, whereas the copper-binding site His-31, and to a lesser extent His-51, are

  15. Sequence and expression of a halobacterial beta-galactosidase gene.


    Holmes, M L; Dyall-Smith, M L


    Studies of gene expression in haloarchaea have been greatly hindered by the lack of a convenient reporter gene. In a previous study, a beta-galactosidase from Haloferax alicantei was purified and several peptide sequences determined. The peptide sequences have now been used to clone the entire beta-galactosidase gene (designated bgaH) along with some flanking chromosomal DNA. The deduced amino acid sequence of BgaH was 665 amino acids (74 kDa) and showed greatest amino acid similarity to members of glycosyl hydrolase family 42 [classification of Henrissat, B., and Bairoch, A. (1993) New families in the classification of glycosyl hydrolases based on amino acid sequence similarities. Biochem J 293: 781-788]. Within this family, BgaH was most similar (42-43% aa identity) to enzymes from extremely thermophilic bacteria such as Thermotoga and Thermus. Family 42 enzymes are only distantly related to the Sulfolobus LacS and Escherichia coli LacZ enzymes (families one and two respectively). Three open reading frames (ORFs) upstream of bgaH were readily identified by database searches as glucose-fructose oxidoreductase, 2-dehydro-3-deoxyphosphogluconate aldolase and 2-keto-3-deoxygluconate kinase, enzymes that are also involved in carbohydrate metabolism. Downstream of bgaH there was an ORF which contained a putative fibronectin III motif. The bgaH gene was engineered into a halobacterial plasmid vector and introduced into Haloferax volcanii, a widely used strain that lacks detectable beta-galactosidase activity. Transformants were shown to express the enzyme; colonies turned blue when sprayed with Xgal and enzyme activity could be easily quantitated using a standard ONPG assay. In an accompanying publication, Patenge et al. (2000) have demonstrated the utility of bgaH as a promoter reporter in Halobacterium salinarum. PMID:10760168

  16. Evolution of T cell receptor genes. Extensive diversity of V beta families in the Mexican axolotl.


    Fellah, J S; Kerfourn, F; Charlemagne, J


    We have cloned 36 different rearranged variable regions (V beta) genes encoding the beta-chain of the T cell receptor in an amphibian species, Ambystoma mexicanum (the Mexican axolotl). Eleven different V beta segments were identified, which can be classified into 9 families on the basis of a minimum of 75% nucleotide identity. All the cloned V beta segments have the canonical features of known mammalian and avian V beta, including conserved residues Cys23, Trp34, Arg69, Tyr90, and Cys92. There seems to be a greater genetic distance between the axolotl V beta families than between the different V beta families of any mammalian species examined to date: most of the axolotl V beta s have fewer than 35% identical nucleotides and the less related families (V beta 4 and V beta 8) have no more than 23.2% identity (13.5% at the amino acid level). Despite their great mutual divergence, several axolotl V beta are sequence-related to some mammalian V beta genes, like the human V beta 13 and V beta 20 segments and their murine V beta 8 and V beta 14 homologues. However, the axolotl V beta 8 and V beta 9 families are not significantly related to any other V beta sequence at the nucleotide level and show limited amino acid similarity to mammalian V alpha, V kappa III, or VH sequences. The detection of nine V beta families among 35 randomly cloned V beta segments suggests that the V beta gene repertoire in the axolotl is probably larger than presently estimated. PMID:7963525

  17. Sequence and evolution of HLA-DR7- and -DRw53-associated. beta. -chain genes

    SciTech Connect

    Young, J.A.T.; Wilkinson, D.; Bodmer, W.F.; Trowsdale, J.


    cDNA clones representing products of the DR7 and DRw53 ..beta..-chain genes were isolated from the human B-lymphoblastoid cell line MANN (DR7, DRw53, DQw2, DPw2). The DRw53..beta.. sequence was identical to a DRw53..beta.. sequence derived from cells with a DR4 haplotype. In contrast, the DR7..beta.. sequence was as unrelated to DR4..beta.. sequence as it was to other DR..beta..-related genes, except at the 3'-untranslated region. These results suggest that the DR7 and DR4 haplotypes may have been derived relatively recently from a common ancestral haplotype and that the DR4 and DR7 ..beta..-chain genes have undergone more rapid diversification in the ..beta..1 domains, most probably as a result of natural selection, than have the DRw53..beta..-chain genes. Short tracts of sequence within the DR7 and DRw53 ..beta..1 domains were shared with other DR..beta.. sequences, indicating that exchanges of genetic information between ..beta..1 domains of DR..beta..-related genes have played a part in their evolution. Serological analysis of mouse L-cell transfectants expressing surface HLA-DR7 molecules, confirmed by antibody binding and allelic sequence comparison, identified amino acid residues that may be critical to the binding of a monomorphic DR- and CP-specific monoclonal antibody.

  18. Alpha globin gene analysis in a Sardinian family with interacting alpha and beta thalassaemia genes.


    Melis, M A; Galanello, R; Cao, A


    This paper reports the results of alpha globin gene analysis in a Sardinian family with interacting alpha and beta thalassaemia genes. The propositus, who was identified in a newborn survey as he had 26.0% Hb Bart's and 74.0% Hb F, successively developed the clinical and haematological picture of a transfusion-dependent thalassaemia major. According to the haemoglobin pattern, restriction endonuclease analysis of the DNA from this patient showed the deletion of three of the four alpha-globin structural genes. Thus beta 0-thalassaemia homozygotes with the delection of three alpha-structural genes seem to have a severe clinical phenotype similar to that of patients with a full complement of four alpha-globin structural genes. PMID:6299325

  19. Evolutionary relationships among copies of feather beta ({beta}) keratin genes from several avian orders.


    Glenn, Travis C; French, Jeffrey O; Heincelman, Traci J; Jones, Kenneth L; Sawyer, Roger H


    The feather beta (β) keratins of the white leghorn chicken (order Galliformes, Gallus gallus domesticus) are the products of a multigene family that includes claw, feather, feather-like, and scale genes (Presland et al. 1989a). Here we characterize the feather β-keratin genes in additional bird species. We designed primers for polymerase chain reactions (PCR) using sequences available from chicken, cloned the resulting amplicons to isolate individual copies, and sequenced multiple clones from each PCR reaction for which we obtained amplicons of the expected size. Feather β-keratins of 18 species from eight avian orders demonstrate DNA sequence variation within and among taxa, even in the protein-coding regions of the genes. Phylogenies of these data suggest that Galliformes (fowl-like birds), Psittaciformes (parrots), and possibly Falconiformes (birds of prey) existed as separate lineages before duplication of the feather β-keratin gene began in Ciconiiformes (herons, storks, and allies), Gruiformes (cranes, rails, and allies), and Piciformes (woodpeckers and allies). Sequences from single species of Coraciiformes (kingfishers) and Columbiformes (pigeons) are monophyletic and strikingly divergent, suggesting feather β-keratin genes in these birds also diverged after these species last shared a common ancestor with the other taxa investigated. Overall, these data demonstrate considerable variation in this structural protein in the relatively recent history of birds, and raise questions concerning the origin and homology of claw, feather-like, and scale β-keratins of birds and the reptilian β-keratins. PMID:21669807

  20. Lactogenic hormonal induction of long distance interactions between beta-casein gene regulatory elements

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lactogenic hormone regulation of beta-casein gene expression in mammary epithelial cells provides, an excellent model in which to study the mechanisms by which steroid and peptide hormone signaling control gene expression. Prolactin- and glucocorticoid-mediated induction of beta-casein gene express...

  1. Hepatocyte nuclear factor 3beta is involved in pancreatic beta-cell-specific transcription of the pdx-1 gene.

    PubMed Central

    Wu, K L; Gannon, M; Peshavaria, M; Offield, M F; Henderson, E; Ray, M; Marks, A; Gamer, L W; Wright, C V; Stein, R


    The mammalian homeobox gene pdx-1 is expressed in pluripotent precursor cells in the dorsal and ventral pancreatic bud and duodenal endoderm, which will produce the pancreas and the rostral duodenum. In the adult, pdr-1 is expressed principally within insulin-secreting pancreatic islet beta cells and cells of the duodenal epithelium. Our objective in this study was to localize sequences within the mouse pdx-1 gene mediating selective expression within the islet. Studies of transgenic mice in which a genomic fragment of the mouse pdx-1 gene from kb -4.5 to +8.2 was used to drive a beta-galactosidase reporter showed that the control sequences sufficient for appropriate developmental and adult specific expression were contained within this region. Three nuclease-hypersensitive sites, located between bp -2560 and -1880 (site 1), bp -1330 and -800 (site 2), and bp -260 and +180 (site 3), were identified within the 5'-flanking region of the endogenous pdx-1 gene. Pancreatic beta-cell-specific expression was shown to be controlled by sequences within site 1 from an analysis of the expression pattern of various pdr-1-herpes simplex virus thymidine kinase promoter expression constructs in transfected beta-cell and non-beta-cell lines. Furthermore, we also established that this region was important in vivo by demonstrating that expression from a site 1-driven beta-galactosidase reporter construct was directed to islet beta-cells in transgenic mice. The activity of the site 1-driven constructs was reduced substantially in beta-cell lines by mutating a hepatocyte nuclear factor 3 (HNF3)-like site located between nucleotides -2007 and -1996. Gel shift analysis indicated that HNF3beta present in islet beta cells binds to this element. Immunohistochemical studies revealed that HNF3beta was present within the nuclei of almost all islet beta cells and subsets of pancreatic acinar cells. Together, these results suggest that HNF3beta, a key regulator of endodermal cell lineage

  2. Urinary β-2 Microglobulin Levels Sensitively Altered in an Osteomalacia Patient Receiving Add-on Adefovir Dipivoxil Therapy for Hepatitis B Virus Infection.


    Takagi, Junko; Morita, Hiroyuki; Ito, Kiyoaki; Ohashi, Tomohiko; Hirase, Sho; Ito, Tatsuo; Morishima, Takkan; Otake, Kazuo; Yoneda, Masashi


    Adefovir dipivoxil (ADV) is effective for hepatitis B virus (HBV) infection; however, ADV may provoke renal injury resulting in osteomalacia, and this side effect is seldom recognized until bone fractures emerge. We herein present a 66-year-old woman with HBV infection who received ADV for 6 years. Although she exhibited no sign of bone fractures, her urinary β-2 microglobulin (β2MG) level increased to 83,837 μg/L and scintigraphy revealed minimal fractures of the third rib. ADV was subsequently reduced and her urinary β2MG rapidly fell to 3,637 μg/L. Conversely, her urinary N-acetyl-β-D-glucosaminidase, and serum phosphate, alkaline phosphatase levels did not respond. PMID:27301512

  3. Total beta-globin gene deletion has high frequency in Filipinos

    SciTech Connect

    Patrick, N.; Miyakawa, F.; Hunt, J.A.


    The distribution of {beta}-thalassemia [{beta}{sup Th}] mutations is unique to each ethnic group. Most mutations affect one or a few bases; large deletions have been rare. Among families screened in Hawaii, [{beta}{sup Th}] heterozygotes were diagnosed by microcytosis, absence of abnormal hemoglobins on isoelectric focusing, and raised Hb A{sub 2} by chromatography. Gene frequency for {beta}{sup Th} was 0.02 in Filipinos. In Filipinos, polymerase chain reaction [PCR] with denaturing gradient gel electrophoresis for {beta}{sup Th} mutations detected a mutation in only 6 of 42 {beta}{sup Th} heterozygotes; an IVS2-666 C/T polymorphism showed non-heterozygosity in 37 and heterozygosity in only 5 of these {beta}{sup Th} heterozygotes. One {beta}{sup Th}/{beta}{sup Th} major patient and his mother had no mutation detected by allele-specific oligomer hybridization; PCR failed to amplify any DNA from his {beta}-globin gene. After a total {beta}-globin gene deletion [{beta}{sup Del}] was found in a Filipino family in Ontario, specific PCR amplification for {beta}{sup Del} detected this in 43 of 53 {beta}{sup Th} Filipino samples tested; the above {beta}{sup Th}/{beta}{sup Th} patient was a ({beta}{sup Del}/{beta}{sup Del}) homozygote. The {beta}{sup Del} may account for over 60% of all {beta}{sup Th} alleles in Filipinos; this is the highest proportion of a deletion {beta}{sup Th} mutation reported from any population. Most but not all {beta}{sup Del} heterozygotes had high Hb F [5.13 {plus_minus} 3.94 mean {plus_minus} 1 s.d.] compared to the codon 41/42 four base deletion common in Chinese [2.30 {plus_minus} 0.86], or to {beta}{sup Th} heterozygotes with normal {alpha}-globin genes [2.23 {plus_minus} 0.80].

  4. Assignment of the {beta}-arrestin 1 gene (ARRB1) to human chromosome 11q13

    SciTech Connect

    Calabrese, G.; Morizio, E.; Palka, G.


    Two types of proteins play a major role in determining homologous desensitization of G-coupled receptors: {beta}-adrenergic receptor kinase ({beta}ARK), which phosphorylates the agonist-occupied receptor, and its functional cofactor, {beta}-arrestin. {beta}ARK is a member of a multigene family, consisting of six known subtypes, which have also been named G-protein-coupled receptor kinases (GRK 1 to 6) due to the apparently unique functional association of such kinases with this receptor family. The gene for {beta}ARK1 has been localized to human chromosome 11q13. The four members of the arrestin/{beta}-arrestin gene family identified so far are arrestin, X-arrestin, {beta}-arrestin 1, and {beta}-arrestin 2. Here the authors report the chromosome mapping of the human gene for {beta}-arrestin 1 (ARRB1) to chromosome 11q13 by fluorescence in situ hybridization (FISH). Two-color FISH confirmed that the two genes coding for the functionally related proteins {beta}ARK1 and {beta}arrestin 1 both map to 11q13. 16 refs., 1 fig., 1 tab.

  5. Cell stress-regulated human major histocompatibility complex class I gene expressed in gastrointestinal epithelium.

    PubMed Central

    Groh, V; Bahram, S; Bauer, S; Herman, A; Beauchamp, M; Spies, T


    Conventional major histocompatibility complex (MHC) class I genes encode molecules that present intracellular peptide antigens to T cells. They are ubiquitously expressed and regulated by interferon gamma. Two highly divergent human MHC class I genes, MICA and MICB, are regulated by promoter heat shock elements similar to those of HSP70 genes. MICA encodes a cell surface glycoprotein, which is not associated with beta 2-microglobulin, is conformationally stable independent of conventional class I peptide ligands, and almost exclusively expressed in gastrointestinal epithelium. Thus, this MHC class I molecule may function as an indicator of cell stress and may be recognized by a subset of gut mucosal T cells in an unusual interaction. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:8901601

  6. Determination of an effective housekeeping gene for the quantification of mRNA for forensic applications.


    Moreno, Lilliana I; Tate, Courtney M; Knott, Erika L; McDaniel, Jade E; Rogers, Stephanie S; Koons, Barbara W; Kavlick, Mark F; Craig, Rhonda L; Robertson, James M


    The potential application of mRNA for the identification of biological fluids using molecular techniques has been a recent development in forensic serology. Constitutively expressed housekeeping genes can assess the amount of mRNA recovered from a sample, establish its suitability for downstream applications, and provide a reference point to corroborate the identity of the fluid. qPCR was utilized to compare the expression levels of housekeeping genes from forensic-like body fluid stains to establish the most appropriate assessment of human mRNA quantity prior to profiling. Although variability was observed between fluids and individuals, results indicated that beta-2 microglobulin exhibited the highest expression for all body fluids examined and across donors. A one-way analysis of variance was performed for housekeeping gene variability between donors (at the α, 0.05, significance level), and the results indicated significant differences for semen, vaginal secretions, and menstrual blood. PMID:22309221

  7. Isolation and characterization of the complete chicken beta-globin gene region: frequent deletion of the adult beta-globin genes in lambda.

    PubMed Central

    Villeponteau, B; Martinson, H


    A library of bacteriophage lambda clones containing chicken chromosomal DNA was screened, using the adult beta-globin cDNA plasmid pHb 1001 as a probe. Sixteen overlapping clones were isolated containing 35 kilobase pairs (kbp) of chicken DNA. Characterization of these clones revealed four beta-like globin genes, some genomically repeated sequences, but no pseudo-genes. The four beta-like genes have an average intergenic distance of less than half of that found for the mammalian beta-like globin gene clusters so far characterized. The overall features of the map were confirmed by genomic Southern analysis. Frequent deletions were shown to occur between the various beta-like globin genes during phage propagation. The presumptive hatching gene in particular was always associated with abnormal lambda clones although we were able to find one such clone that did contain a normal copy of the hatching gene itself. Probably such deletions explain the failure to recover this gene in previous attempts. Images PMID:6269092

  8. Chromosome mapping of the human arrestin (SAG), {beta}-arrestin 2 (ARRB2), and {beta}-adrenergic receptor kinase 2 (ADRBK2) genes

    SciTech Connect

    Calabrese, G.; Sallese, M.; Stornaiuolo, A.


    Two types of proteins play a major role in determining homologous desensitization of G-coupled receptors: {beta}-adrenergic receptor kinase ({beta}ARK), which phosphorylates the agonist-occupied receptor and its functional cofactor, {beta}-arrestin. Both {beta}ARK and {beta}-arrestin are members of multigene families. The family of G-protein-coupled receptor kinases includes rhodopsin kinase, {beta}ARK1, {beta}ARK2, IT11-A (GRK4), GRK5, and GRK6. The arrestin/{beta}-arrestin gene family includes arrestin (also known as S-antigen), {beta}-arrestin 1, and {beta}-arrestin 2. Here we report the chromosome mapping of the human genes for arrestin (SAG), {beta}arrestin 2 (ARRB2), and {beta}ARK2 (ADRBK2) by fluorescence in situ hybridization (FISH). FISH results confirmed the assignment of the gene coding for arrestin (SAG) to chromosome 2 and allowed us to refine its localization to band q37. The gene coding for {beta}-arrestin 2 (ARRB2) was mapped to chromosome 17p13 and that coding for {beta}ARK2 (ADRBK2) to chromosome 22q11. 17 refs., 1 fig.

  9. Ultrasound-mediated interferon {beta} gene transfection inhibits growth of malignant melanoma

    SciTech Connect

    Yamaguchi, Kazuki; Feril, Loreto B.; Tachibana, Katsuro; Takahashi, Akira; Matsuo, Miki; Endo, Hitomi; Harada, Yoshimi; Nakayama, Juichiro


    Highlights: {yields} Successful ultrasound-mediated transfection of melanoma (C32) cells with IFN-{beta} genes both in vitro and in vivo. {yields} Ultrasound-mediated IFN-{beta} transfection inhibited proliferation of melanoma cells in vitro. {yields} Ultrasound-mediated IFN-{beta} transfection inhibited melanoma tumor growth in vivo. -- Abstract: We investigated the effects of ultrasound-mediated transfection (sonotransfection) of interferon {beta} (IFN-{beta}) gene on melanoma (C32) both in vitro and in vivo. C32 cells were sonotransfected with IFN-{beta} in vitro. Subcutaneous C32 tumors in mice were sonicated weekly immediately after intra-tumor injection with IFN-{beta} genes mixed with microbubbles. Successful sonotransfection with IFN-{beta} gene in vitro was confirmed by ELISA, which resulted in C32 growth inhibition. In vivo, the growth ratio of tumors transfected with IFN-{beta} gene was significantly lower than the other experimental groups. These results may lead to a new method of treatment against melanoma and other hard-to-treat cancers.

  10. Characterization of a new beta-lactamase gene from isolates of Vibrio spp. in Korea.


    Jun, Lyu Jin; Kim, Jae Hoon; Jin, Ji Woong; Jeong, Hyun Do


    PCR was performed to analyze the beta-lactamase genes carried by ampicillin-resistant Vibrio spp. strains isolated from marine environments in Korea between 2006 and 2009. All 36 strains tested showed negative results in PCR with the primers designed from the nucleotide sequences of various known beta-lactamase genes. This prompted us to screen new beta-lactamase genes. A novel beta-lactamase gene was cloned from Vibrio alginolyticus KV3 isolated from the aquaculture water of Geoje Island of Korea. The determined nucleotide sequence (VAK-3 beta-lactamase) revealed an open reading frame (ORF) of 852 bp, encoding a protein of 283 amino acids (aa), which displayed low homology to any other beta-lactamase genes reported in public databases. The deduced 283 aa sequence of VAK-3, consisting of a 19 aa signal peptide and a 264 aa mature protein, contained highly conserved peptide segments specific to class A beta-lactamases including the specific amino acid residues STFK (62-65), SDN (122-124), E (158), and RTG (226-228). Results from PCR performed with primers specific to the VAK-3 beta-lactamase gene identified 3 of the 36 isolated strains as V. alginolyticus, Vibrio cholerae, and Photobacterium damselae subsp. damselae, indicating the utilization of various beta-lactamase genes including unidentified ones in ampicillin-resistant Vibrio spp. strains from the marine environment. In a mating experiment, none of the isolates transfered the VAK-3 beta-lactamase gene to the Escherichia coli recipient. This lack of mobility, and the presence of a chromosomal acyl-CoA flanking sequence upstream of the VAK-3 beta- lactamase gene, led to the assumption that the location of this new beta-lactamase gene was in the chromosome, rather than the mobile plasmid. Antibiotic susceptibility of VAK-3 beta-lactamase was indicated by elevated levels of resistance to penicillins, but not to cephalosporins in the wild type and E. coli harboring recombinant plasmid pKV-3, compared with those of

  11. Suitability of Commonly Used Housekeeping Genes in Gene Expression Studies for Space Radiation Research

    NASA Astrophysics Data System (ADS)

    Arenz, A.; Hellweg, C. E.; Bogner, S.; Lau, P.; Baumstark-Khan, C.

    Research on the effects of ionizing radiation exposure involves the use of real-time reverse transcription polymerase chain reaction qRT-PCR for measuring changes in gene expression Several variables needs to be controlled for gene expression analysis -- different amounts of starting material between the samples variations in enzymatic efficiencies of the reverse transcription step and differences in RNA integrity Normalization of the obtained data to an invariant endogenous control gene reference gene is the elementary step in relative quantification strategy There is a strong correlation between the quality of the normalized data and the stability of the reference gene itself This is especially relevant when the samples have been obtained after exposure to radiation qualities inducing different amounts and kinds of damage leading to a cell cycle delay or even to a cell cycle block In order to determine suitable reference genes as internal controls in qRT-PCR assays after exposure to ionizing radiation we studied the gene expression levels of commonly used reference genes in A549 lung cancer cells Expression levels obtained for human beta actin ACTB human beta-2-microglobulin B2M human glyceraldehyde-3-phosphate dehydrogenase GAPDH human porphobilinogen deaminase PBGD human 18S ribosomal RNA 18S rRNA human glucose-6-phosphate dehydrogenase G6PDH human hypoxanthine phosphoribosyl transferase HPRT human ubiquitin C UBC human transferrin TFRC

  12. Enhanced jun gene expression is an early genomic response to transforming growth factor beta stimulation.

    PubMed Central

    Pertovaara, L; Sistonen, L; Bos, T J; Vogt, P K; Keski-Oja, J; Alitalo, K


    Transforming growth factor beta (TGF beta) is a multifunctional polypeptide that regulates proliferation, differentiation, and other functions of many cell types. The pathway of TGF beta signal transduction in cells is unknown. We report here that an early effect of TGF beta is an enhancement of the expression of two genes encoding serum- and phorbol ester tumor promoter-regulated transcription factors: the junB gene and the c-jun proto-oncogene, respectively. This stimulation was observed in human lung adenocarcinoma A549 cells which were growth inhibited by TGF beta, AKR-2B mouse embryo fibroblasts which were growth stimulated by TGF beta, and K562 human erythroleukemia cells, which were not appreciably affected in their growth by TGF beta. The increase in jun mRNA occurred with picomolar TGF beta concentrations within 1 h of TGF beta stimulation, reached a peak between 1 and 5 h in different cells, and declined gradually to base-line levels. This mRNA response was followed by a large increase in the biosynthesis of the c-jun protein (AP-1), as shown by metabolic labeling and immunoprecipitation analysis. However, differential and cell type-specific regulation appeared to determine the timing and magnitude of the response of each jun gene in a given cell. In AKR-2B and NIH 3T3 cells, only junB was induced by TGF beta, evidently in a protein synthesis-independent fashion. The junB response to TGF beta was maintained in c-Ha-ras and neu oncogene-transformed cells. Thus, one of the earliest genomic responses to TGF beta may involve nuclear signal transduction and amplification by the junB and c-jun transcription factors in concert with c-fos, which is also induced. The differential activation of the jun genes may explain some of the pleiotropic effects of TGF beta. Images PMID:2725496

  13. HFE gene: Structure, function, mutations, and associated iron abnormalities.


    Barton, James C; Edwards, Corwin Q; Acton, Ronald T


    The hemochromatosis gene HFE was discovered in 1996, more than a century after clinical and pathologic manifestations of hemochromatosis were reported. Linked to the major histocompatibility complex (MHC) on chromosome 6p, HFE encodes the MHC class I-like protein HFE that binds beta-2 microglobulin. HFE influences iron absorption by modulating the expression of hepcidin, the main controller of iron metabolism. Common HFE mutations account for ~90% of hemochromatosis phenotypes in whites of western European descent. We review HFE mapping and cloning, structure, promoters and controllers, and coding region mutations, HFE protein structure, cell and tissue expression and function, mouse Hfe knockouts and knockins, and HFE mutations in other mammals with iron overload. We describe the pertinence of HFE and HFE to mechanisms of iron homeostasis, the origin and fixation of HFE polymorphisms in European and other populations, and the genetic and biochemical basis of HFE hemochromatosis and iron overload. PMID:26456104

  14. Direct transfer of transforming growth factor beta 1 gene into arteries stimulates fibrocellular hyperplasia.

    PubMed Central

    Nabel, E G; Shum, L; Pompili, V J; Yang, Z Y; San, H; Shu, H B; Liptay, S; Gold, L; Gordon, D; Derynck, R


    The arterial wall responds to thrombosis or mechanical injury through the induction of specific gene products that increase cellular proliferation and connective tissue formation. These changes result in intimal hyperplasia that is observed in restenosis and the early phases of atherosclerosis. Transforming growth factor beta 1 (TGF-beta 1) is a secreted multi-functional protein that plays an important role in embryonal development and in repair following tissue injury. However, the function of TGF-beta 1 in vascular cell growth in vivo has not been defined. In this report, we have evaluated the role of TGF-beta 1 in the pathophysiology of intimal and medial hyperplasia by gene transfer of an expression plasmid encoding active TGF-beta 1 into porcine arteries. Expression of TGF-beta 1 in normal arteries resulted in substantial extracellular matrix production accompanied by intimal and medial hyperplasia. Increased procollagen, collagen, and proteoglycan synthesis in the neointima was demonstrated by immunohistochemistry relative to control transfected arteries. Expression of TGF-beta 1 induced a distinctly different program of gene expression and biologic response from the platelet-derived growth factor B (PDGF B) gene: procollagen synthesis induced by TGF-beta 1 was greater, and cellular proliferation was less prominent. These findings show that TGF-beta 1 differentially modulates extracellular matrix production and cellular proliferation in the arterial wall in vivo and could play a reparative role in the response to arterial injury. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:8248168

  15. Structure of the three beta-tubulin-encoding genes of the unicellular alga, Polytomella agilis.


    Conner, T W; Thompson, M D; Silflow, C D


    The quadriflagellate, unicellular, colorless alga, Polytomella agilis, contains several distinct microtubule arrays. To study the genetic basis of microtubule heterogeneity in P. agilis, we characterized its tubulin(Tub)-encoding genes (tub). The three beta tub genes detected in blots of P. agilis DNA were isolated from a genomic library. The structure and organization of the genes were examined by restriction mapping and nucleotide (nt) sequencing. S1 nuclease protection studies showed that all three genes are expressed. The predicted amino acid (aa) sequences are more than 98% conserved with the Chlamydomonas reinhardtii and Volvox carteri beta-Tubs, underscoring the close phylogenetic relationship of these species. Evolutionary divergence among the P. agilis genes is demonstrated by differences in intron number, nt sequences in noncoding regions, and silent nt substitutions in the coding regions. However, the proteins encoded by the beta 1 and beta 3 tub genes are identical; the beta 2 gene product differs by one conservative aa substitution. These results are in striking contrast to the C-terminal aa diversity reported within beta tub gene families in animal, higher plant and fungal systems. The data support the hypothesis that those tub genes whose products assemble into axonemal microtubules are subject PMID:2533130

  16. Gene-based intramuscular interferon-beta therapy for experimental autoimmune encephalomyelitis.


    Jaini, Ritika; Hannaman, Drew; Johnson, Justin M; Bernard, Robert M; Altuntas, Cengiz Z; Delasalas, Maida M; Kesaraju, Pavani; Luxembourg, Alain; Evans, Claire F; Tuohy, Vincent K


    In contrast to serial injections of recombinant interferon-beta (IFN-beta) for long-term therapy of multiple sclerosis (MS), prolonged systemic delivery of proteins derived through in vivo gene transfer may provide a more clinically relevant alternative. Here we compare the therapeutic efficacies of electroporation (EP)-mediated intramuscular IFN-beta gene transfer with repeated alternate-day injections of recombinant IFN-beta after the onset of relapsing-remitting experimental autoimmune encephalomyelitis (EAE), an animal model widely used in MS research. We show for the first time that a single EP-mediated intramuscular administration of 20 microg of an IFN-beta-expressing plasmid provides long-term expression of interferon-inducible genes and is therapeutic in ongoing established EAE. The achieved therapeutic effects of IFN-beta gene delivery were comparable to an 8-week regimen of 10,000 IU rIFN-beta injected every other day and involved a significant inhibition of disease progression and a significant reduction of EAE relapses compared to untreated or null-vector-treated mice. Our results indicate the viability of a convenient and effective gene-based alternative for long-term IFN-beta protein therapy in MS. PMID:16782409

  17. Targeted disruption of the mouse beta1-adrenergic receptor gene: developmental and cardiovascular effects.

    PubMed Central

    Rohrer, D K; Desai, K H; Jasper, J R; Stevens, M E; Regula, D P; Barsh, G S; Bernstein, D; Kobilka, B K


    At least three distinct beta-adrenergic receptor (beta-AR) subtypes exist in mammals. These receptors modulate a wide variety of processes, from development and behavior, to cardiac function, metabolism, and smooth muscle tone. To understand the roles that individual beta-AR subtypes play in these processes, we have used the technique of gene targeting to create homozygous beta 1-AR null mutants (beta 1-AR -/-) in mice. The majority of beta 1-AR -/- mice die prenatally, and the penetrance of lethality shows strain dependence. Beta l-AR -/- mice that do survive to adulthood appear normal, but lack the chronotropic and inotropic responses seen in wild-type mice when beta-AR agonists such as isoproterenol are administered. Moreover, this lack of responsiveness is accompanied by markedly reduced stimulation of adenylate cyclase in cardiac membranes from beta 1-AR -/- mice. These findings occur despite persistent cardiac beta 2-AR expression, demonstrating the importance of beta 1-ARs for proper mouse development and cardiac function, while highlighting functional differences between beta-AR subtypes. Images Fig. 1 Fig. 3 PMID:8693001

  18. Tumor-produced, active Interleukin-1 {beta} regulates gene expression in carcinoma-associated fibroblasts

    SciTech Connect

    Dudas, Jozsef; Fullar, Alexandra; Bitsche, Mario; Schartinger, Volker; Kovalszky, Ilona; Sprinzl, Georg Mathias; Riechelmann, Herbert


    Recently we described a co-culture model of periodontal ligament (PDL) fibroblasts and SCC-25 lingual squamous carcinoma cells, which resulted in conversion of normal fibroblasts into carcinoma-associated fibroblasts (CAFs), and in epithelial-mesenchymal transition (EMT) of SCC-25 cells. We have found a constitutive high interleukin-1{beta} (IL1-{beta}) expression in SCC-25 cells in normal and in co-cultured conditions. In our hypothesis a constitutive IL1-{beta} expression in SCC-25 regulates gene expression in fibroblasts during co-culture. Co-cultures were performed between PDL fibroblasts and SCC-25 cells with and without dexamethasone (DEX) treatment; IL1-{beta} processing was investigated in SCC-25 cells, tumor cells and PDL fibroblasts were treated with IL1-{beta}. IL1-{beta} signaling was investigated by western blot and immunocytochemistry. IL1-{beta}-regulated genes were analyzed by real-time qPCR. SCC-25 cells produced 16 kD active IL1-{beta}, its receptor was upregulated in PDL fibroblasts during co-culture, which induced phosphorylation of interleukin-1 receptor-associated kinase-1 (IRAK-1), and nuclear translocalization of NF{kappa}B{alpha}. Several genes, including interferon regulatory factor 1 (IRF1) interleukin-6 (IL-6) and prostaglandin-endoperoxide synthase 2 (COX-2) were induced in CAFs during co-culture. The most enhanced induction was found for IL-6 and COX-2. Treatment of PDL fibroblasts with IL1-{beta} reproduced a time- and dose-dependent upregulation of IL1-receptor, IL-6 and COX-2. A further proof was achieved by DEX inhibition for IL1-{beta}-stimulated IL-6 and COX-2 gene expression. Constitutive expression of IL1-{beta} in the tumor cells leads to IL1-{beta}-stimulated gene expression changes in tumor-associated fibroblasts, which are involved in tumor progression. -- Graphical abstract: SCC-25 cells produce active, processed IL1-{beta}. PDL fibroblasts possess receptor for IL1-{beta}, and its expression is increased 4.56-times in the

  19. Beta-lactamase genes of the penicillin-susceptible Bacillus anthracis Sterne strain.


    Chen, Yahua; Succi, Janice; Tenover, Fred C; Koehler, Theresa M


    Susceptibility to penicillin and other beta-lactam-containing compounds is a common trait of Bacillus anthracis. Beta-lactam agents, particularly penicillin, have been used worldwide to treat anthrax in humans. Nonetheless, surveys of clinical and soil-derived strains reveal penicillin G resistance in 2 to 16% of isolates tested. Bacterial resistance to beta-lactam agents is often mediated by production of one or more types of beta-lactamases that hydrolyze the beta-lactam ring, inactivating the antimicrobial agent. Here, we report the presence of two beta-lactamase (bla) genes in the penicillin-susceptible Sterne strain of B. anthracis. We identified bla1 by functional cloning with Escherichia coli. bla1 is a 927-nucleotide (nt) gene predicted to encode a protein with 93.8% identity to the type I beta-lactamase gene of Bacillus cereus. A second gene, bla2, was identified by searching the unfinished B. anthracis chromosome sequence database of The Institute for Genome Research for open reading frames (ORFs) predicted to encode beta-lactamases. We found a partial ORF predicted to encode a protein with significant similarity to the carboxy-terminal end of the type II beta-lactamase of B. cereus. DNA adjacent to the 5' end of the partial ORF was cloned using inverse PCR. bla2 is a 768-nt gene predicted to encode a protein with 92% identity to the B. cereus type II enzyme. The bla1 and bla2 genes confer ampicillin resistance to E. coli and Bacillus subtilis when cloned individually in these species. The MICs of various antimicrobial agents for the E. coli clones indicate that the two beta-lactamase genes confer different susceptibility profiles to E. coli; bla1 is a penicillinase, while bla2 appears to be a cephalosporinase. The beta-galactosidase activities of B. cereus group species harboring bla promoter-lacZ transcriptional fusions indicate that bla1 is poorly transcribed in B. anthracis, B. cereus, and B. thuringiensis. The bla2 gene is strongly expressed in B

  20. The effects of beta2 adrenoceptor gene polymorphisms on pressor response during laryngoscopy and tracheal intubation.


    Kim, N-S; Lee, I-O; Lee, M-K; Lim, S-H; Choi, Y-S; Kong, M-H


    We investigated whether human beta2 adrenoceptor (beta2AR) gene polymorphisms are associated with the pressor response to laryngoscopy and tracheal intubation. Ninety-two patients undergoing elective surgery under general anaesthesia were enrolled into this study. Arterial systolic pressure, heart rate and rate pressure product were measured before induction of anaesthesia and 1 min following laryngoscopy and tracheal intubation. Genomic DNA was then used to identify the beta2AR-16 and beta2AR-27 genes using an allele-specific polymerase chain reaction method. Using multiple linear regression models, controlling for age, sex, weight, baseline blood pressure, heart rate and rate pressure product, we found that patients who possessed the glutamic acid homozygote of beta2AR-27 produced significantly greater changes in mean arterial pressure and rate pressure products than patients with the glutamine homozygote of beta2AR-27 (beta coefficient for mean blood pressure = 11.81, beta coefficient for pulse-pressure product = 8.76, both p-values = 0.023). These findings suggest that genetic variability in the human beta2AR gene polymorphisms may be associated with the pressor response to laryngoscopy and tracheal intubation. PMID:11879211

  1. Complete nucleotide sequence of the human corticotropin-beta-lipotropin precursor gene.

    PubMed Central

    Takahashi, H; Hakamata, Y; Watanabe, Y; Kikuno, R; Miyata, T; Numa, S


    The nucleotide sequence of an 8658-base-pair human genomic DNA segment containing the entire corticotropin-beta-lipotropin precursor gene has been determined, and some sequence features of the gene and its flanking regions have been analysed. The gene is composed of 7665 base pairs including two introns of 3708 and 2886 base pairs. Comparison of the 5'-flanking sequences of the human, bovine and mouse corticotropin-beta-lipotropin precursor genes reveals the presence of a highly conserved region, which contains sequences of 14-15 base pairs homologous with sequences located upstream of the mRNA start site of other glucocorticoid-regulated genes. PMID:6314261

  2. Pretransplant β2-Microglobulin Is Associated with the Risk of Acute Graft-versus-Host-Disease after Allogeneic Hematopoietic Cell Transplant.


    Costa-Lima, Carolina; Miranda, Eliana Cristina Martins; Colella, Marcos Paulo; Aranha, Francisco Jose Penteado; de Souza, Carmino Antonio; Vigorito, Afonso Celso; De Paula, Erich Vinicius


    The risk of acute graft-versus-host disease (aGVHD) can be reliably estimated by the hematopoietic cell transplantation-specific comorbidity index (HCT-CI), which can be further refined by the incorporation of pre-hematopoietic cell transplantation (HCT) serum levels of inflammatory biomarkers such as ferritin and albumin. β2-Microglobulin (β2-m) is a key component of the MHC class I complex, which is independently associated with mortality and frailty in the general population. We took advantage of our institutional protocol that includes measurement of pre-HCT β2-m serum levels in the most patients to investigate whether pre-transplant β2-m levels were associated with the risk of aGVHD. One hundred three consecutive patients submitted to allogeneic HCT, of which 26 developed grades II to IV aGVHD, were included in the analysis. β2-m was significantly associated with age and HCT-CI. Higher levels of β2-m were observed in patients who developed aGVHD (P = .008). In the multivariate Cox regression model, β2-m and HCT-CI remained independently associated with the risk of developing aGVHD. In conclusion, the association between β2-m and the occurrence of aGVHD suggests that the measurement of this protein before HCT might represent an additional element for risk stratification of aGVHD. PMID:27044906

  3. Host Susceptibility to Brucella abortus Infection Is More Pronounced in IFN-γ knockout than IL-12/β2-Microglobulin Double-Deficient Mice

    PubMed Central

    Brandão, Ana Paula M. S.; Oliveira, Fernanda S.; Carvalho, Natalia B.; Vieira, Leda Q.; Azevedo, Vasco; Macedo, Gilson C.; Oliveira, Sergio C.


    Brucella abortus is a facultative intracellular bacterial pathogen that causes abortion in domestic animals and undulant fever in humans. IFN-γ, IL-12, and CD8+ T lymphocytes are important components of host immune responses against B. abortus. Herein, IFN-γ and IL-12/β2-microglobulin (β2-m) knockout mice were used to determine whether CD8+ T cells and IL-12-dependent IFN-γ deficiency would be more critical to control B. abortus infection compared to the lack of endogenous IFN-γ. At 1 week after infection, IFN-γ KO and IL-12/β2-m KO mice showed increased numbers of bacterial load in spleens; however, at 3 weeks postinfection (p.i.), only IFN-γ KO succumbed to Brucella. All IFN-γ KO had died at 16 days p.i. whereas death within the IL-12/β2-m KO group was delayed and occurred at 32 days until 47 days postinfection. Susceptibility of IL-12/β2-m KO animals to Brucella was associated to undetectable levels of IFN-γ in mouse splenocytes and inability of these cells to lyse Brucella-infected macrophages. However, the lack of endogenous IFN-γ was found to be more important to control brucellosis than CD8+ T cells and IL-12-dependent IFN-γ deficiencies. PMID:22194770

  4. Activation of Nonclassical CD1d-Restricted NK T Cells Induces Airway Hyperreactivity in β2-Microglobulin-Deficient Mice1

    PubMed Central

    Meyer, Everett H.; Pichavant, Muriel; Akbari, Omid; Yasumi, Takahiro; Savage, Paul B.; DeKruyff, Rosemarie H.; Umetsu, Dale T.


    Allergic asthma is characterized by Th2-driven eosinophilic airway inflammation and by a central feature called airway hyperreactivity (AHR), development of which requires the presence of classical type I invariant NK T (iNKT) cells. Allergen-induced AHR, however, develops in β2-microglobulin (β2m)−/− mice, which lack classical iNKT cells, suggesting that in some situations iNKT cells may be dispensable for the development of AHR. In contrast, our studies now suggest that a CD1d-restricted, NK1.1+ noninvariant TCR NKT cell population is present in β2m−/− mice and is responsible for the development of AHR but not for Th2 responses. Furthermore, treatment of β2m−/− mice with anti-CD1d mAb or anti-NK1.1 mAb unexpectedly abolished allergen-induced AHR. The CD1-restricted NKT cells in these mice, which failed to respond to α-galactosylceramide and which therefore were not classical type I iNKT cells, appear to represent an NKT cell subset restricted by a β2m-independent form of CD1d. These results indicate that, although classical type I iNKT cells are normally required for the development of AHR, under different circumstances other NKT cell subsets, including nonclassical NKT cells, may substitute for classical iNKT cells and induce AHR. PMID:18802058

  5. Urinary beta-2 microglobulin and alpha-1 microglobulin are useful screening markers for tenofovir-induced kidney tubulopathy in patients with HIV-1 infection: a diagnostic accuracy study.


    Nishijima, Takeshi; Shimbo, Takuro; Komatsu, Hirokazu; Takano, Misao; Tanuma, Junko; Tsukada, Kunihisa; Teruya, Katsuji; Gatanaga, Hiroyuki; Kikuchi, Yoshimi; Oka, Shinichi


    Kidney tubulopathy is a well-known adverse event of antiretroviral agent tenofovir. A cross-sectional study was conducted to compare the diagnostic accuracy of five tubular markers, with a collection of abnormalities in these markers as the reference standard. The study subjects were patients with HIV-1 infection on ritonavir-boosted darunavir plus tenofovir/emtricitabine with suppressed viral load. Kidney tubular dysfunction (KTD) was predefined as the presence of at least three abnormalities in the following five parameters: β2-microglobulinuria (β2M), α1-microglobulinuria (α1M), high urinary N-acetyl-β-D-glucosaminidase (NAG), fractional excretion of phosphate (FEIP), and fractional excretion of uric acid (FEUA). Receiver operating characteristic curves and areas under the curves (AUC) were estimated, and the differences between the largest AUC and each of the other AUCs were tested using a nonparametric method. The cutoff value of each tubular marker was determined using raw data of 100% sensitivity with maximal specificity. KTD was diagnosed in 19 of the 190 (10%) patients. The AUCs (95% CIs) of each tubular marker were β2M, 0.970 (0.947-0.992); α1M, 0.968 (0.944-0.992); NAG, 0.901 (0.828-0.974); FEIP, 0.757 (0.607-0.907), and FEUA, 0.762 (0.653-0.872). The AUCs of β2M and α1M were not significantly different, whereas those of the other three markers were smaller. The optimal cutoff values with 100% sensitivity were 1,123 μg/gCr (β2M, specificity 89%), 15.4 mg/gCr (α1M, specificity 87%), 3.58 U/gCr (NAG, specificity 46%), 1.02% (FEIP, specificity 0%), and 3.92% (FEUA, specificity 12%). Urinary β2M and α1M are potentially suitable screening tools for tenofovir-induced KTD. Monitoring either urinary β2M or α1M should be useful in early detection of tenofovir nephrotoxicity. PMID:23467792

  6. Molecular cloning and characterization of mutant and wild-type human. beta. -actin genes

    SciTech Connect

    Leavitt, J.; Gunning, P.; Porreca, P.; Ng, S.Y.; Lin, C.H.; Kedes, L.


    There are more than 20 ..beta..-actin-specific sequences in the human genome, many of which are pseudogenes. To facilitate the isolation of potentially functional ..beta..-actin genes, they used the new method of B. Seed for selecting genomic clones by homologous recombination. A derivative of the ..pi..VX miniplasmid, ..pi..AN7..beta..1, was constructed by insertion of the 600-base-pair 3' untranslated region of the ..beta..-actin mRNA expressed in human fibroblasts. Five clones containing ..beta..-actin sequences were selected from an amplified human fetal gene library by homologous recombination between library phage and the miniplasmid. One of these clones contained a complete ..beta..-actin gene with a coding sequence identical to that determined for the mRNA of human fibroblasts. A DNA fragment consisting of mostly intervening sequences from this gene was then use to identify 13 independent recombinant copies of the analogous gene from two specially constructed gene libraries, each containing one of the two types of mutant ..beta..-actin genes found in a line of neoplastic human fibroblasts. The amino acid and nucleotide sequences encoded by the unmutated gene predict that a guanine-to-adenine transition is responsible for the glycine-to-aspartic acid mutation at codon 244 and would also result in the loss of a HaeIII site. Detection of this HaeIII polymorphism among the fibroblast-derived closed verified the identity of the ..beta..-actin gene expressed in human fibroblasts.

  7. Sp3 proteins negatively regulate beta myosin heavy chain gene expression during skeletal muscle inactivity.


    Tsika, Gretchen; Ji, Juan; Tsika, Richard


    In adult skeletal muscle, beta myosin heavy chain (betaMyHC) gene expression is primarily restricted to slow type I fibers; however, its expression is down-regulated in response to muscle inactivity. Little is known about the signaling pathways and transcription factors that mediate this important functional response. This study demonstrates that increased binding of Sp3 to GC-rich elements in the betaMyHC promoter is a critical event in down-regulation of betaMyHC gene expression under non-weight-bearing conditions. Conversely, binding of Sp3 to these elements decreased while Sp1 binding increased with nuclear extracts from plantaris muscle exposed to mechanical overload, a stimulus that increases betaMyHC gene expression. In addition, these experiments revealed the existence of an Sp4-DNA binding complex when using adult skeletal muscle nuclear extract was used but not when nuclear extracts from cultured myotubes were used. Sp3 proteins are competitive inhibitors of Sp1-mediated betaMyHC reporter gene transactivation in both Drosophila SL-2 and mouse C2C12 myotubes. Sp4 is a weak activator of betaMyHC gene expression in SL-2 cells, which lack endogenous Sp1 activity, but does not activate betaMyHC gene expression in C2C12 myotubes, which have high levels of Sp1. These results suggest that competitive binding of Sp family proteins regulate betaMyHC gene transcription in response to altered neuromuscular activity. PMID:15572681

  8. Structural gene for beta-nerve growth factor not defective in familial dysautonomia.

    PubMed Central

    Breakefield, X O; Orloff, G; Castiglione, C; Coussens, L; Axelrod, F B; Ullrich, A


    The developmental loss of neurons in sympathetic, sensory, and some parasympathetic ganglia in familial dysautonomia suggests an inherited defect in the action of beta-nerve growth factor (beta-NGF). The role of this growth factor in dysautonomia has been difficult to resolve as there is no known source of authentic human beta-NGF. The availability of a cloned DNA probe for the human beta-NGF gene has allowed identification of some copies of the gene (alleles) in six affected families. Alleles differ in the length of restriction endonuclease fragments that hybridize to DNA probes for the gene. In two families, affected children did not inherit the same two alleles at the beta-NGF locus. Since this disease is transmitted in an autosomal recessive manner, affected children must share the same alleles at the locus causing the disease. This analysis excludes the beta-NGF gene region as the cause of this neurologic disease but does not eliminate other genes involved in beta-NGF action, such as those coding for processing enzymes, receptors, or other subunits of the NGF complex. Images PMID:6330750

  9. Selection of reference genes for studies of porcine endometrial gene expression on gestational day 12.


    Wang, Shouqi; Li, Jiaqi; Zhang, Ailing; Liu, Manqing; Zhang, Hao


    Comparing gene expression patterns in the endometrium on gestational day 12 (GD12) between Erhualian (ER) and Landrace×Large White (LL) pigs is helpful to understand the biological mechanisms of fecundity. Selecting genes that have stable expression levels as the internal standards in a comparative study is essential for identifying real gene-specific variation by quantitative RT-PCR (qRT-PCR). Five genes expressed in sow endometria on GD12 were evaluated for their suitability as internal control for relative quantification by qRT-PCR. These genes were beta-actin (ACTB), beta-2-microglobulin (B2M), phosphoglycerate kinase 1 (PGK1), RNA polymerase II polypeptide G (RPG), and ribosomal protein S20 (RPS20), which represent different functional classes. Our results indicated that ACTB, B2M, and PGK1 were not suitable as internal standards for normalization because of their huge variability between the two breeds. RPS20 and RPG were most stable, and the former is recommended to serve as the internal standard when the use of multiple housekeeping genes is unpractical. PMID:21501585

  10. Validation of reference genes for RT-qPCR analysis of CYP4T expression in crucian carp

    PubMed Central

    Mo, Fei; Zhao, Jie; Liu, Na; Cao, Li-hua; Jiang, Shan-xiang


    Reference genes are commonly used for normalization of target gene expression during RT-qPCR analysis. However, no housekeeping genes or reference genes have been identified to be stable across different tissue types or under different experimental conditions. To identify the most suitable reference genes for RT-qPCR analysis of target gene expression in the hepatopancreas of crucian carp (Carassius auratus) under various conditions (sex, age, water temperature, and drug treatments), seven reference genes, including beta actin (ACTB), beta-2 microglobulin (B2M), embryonic elongation factor-1 alpha (EEF1A), glyceraldehyde phosphate dehydrogenase (GAPDH), alpha tubulin (TUBA), ribosomal protein l8 (RPL8) and glucose-6-phosphate dehydrogenase (G6PDH), were evaluated in this study. The stability and ranking of gene expression were analyzed using three different statistical programs: GeNorm, Normfinder and Bestkeeper. The expression errors associated with selection of the genes were assessed by the relative quantity of CYP4T. The results indicated that all the seven genes exhibited variability under the experimental conditions of this research, and the combination of ACTB/TUBA/EEF1A or of ACTB/EEF1A was the best candidate that raised the accuracy of quantitative analysis of gene expression. The findings highlighted the importance of validation of housekeeping genes for research on gene expression under different conditions of experiment and species. PMID:25249772

  11. Sugar-inducible expression of a gene for beta-amylase in Arabidopsis thaliana.

    PubMed Central

    Mita, S; Suzuki-Fujii, K; Nakamura, K


    The levels of beta-amylase activity and of the mRNA for beta-amylase in rosette leaves of Arabidopsis thaliana (L.) Heynh. increased significantly, with the concomitant accumulation of starch, when whole plants or excised mature leaves were supplied with sucrose. A supply of glucose or fructose, but not of mannitol or sorbitol, to plants also induced the expression of the gene for beta-amylase, and the induction occurred not only in rosette leaves but also in roots, stems, and bracts. These results suggest that the gene for beta-amylase of Arabidopsis is subject to regulation by a carbohydrate metabolic signal, and expression of the gene in various tissues may be regulated by the carbon partitioning and sink-source interactions in the whole plant. The sugar-inducible expression of the gene in Arabidopsis was severely repressed in the absence of light. The sugar-inducible expression in the light was not inhibited by 3(3,4-dichlorophenyl)-1,1-dimethylurea or by chloramphenicol, but it was inhibited by cycloheximide. These results suggest that a light-induced signal and de novo synthesis of proteins in the cytoplasm are involved in the regulation. A fusion gene composed of the 5' upstream region of the gene for beta-amylase from Arabidopsis and the coding sequence of beta-glucuronidase showed the sugar-inducible expression in a light-dependent manner in rosette leaves of transgenic Arabidopsis. PMID:7716246

  12. Localization of two potassium channel {beta} subunit genes, KCNA1B and KCNA2B

    SciTech Connect

    Schultz, D.; Smith, L.; Thayer, M.


    The gating properties and current amplitudes of mammalian voltage-activated Shaker potassium channels are modulated by at least two associated {beta} subunits (Kv{beta}1.1 and Kv{beta}1.2). The human Kv{beta}1.1 gene (KCNA1B) resides on chromosome 3, as indicated by somatic cell hybrid mapping. More precise localization of KCNA1B to 3q26.1 was obtained with fluorescence in situ hybridization (FISH) and was corroborated by PCR screening of the CEPH YAC library. The human Kv{beta}1.2 gene (KCNA2B) resides on chromosome 1, as indicated by somatic cell hybrid mapping, and has been localized by FISH to 1p36.3. 20 refs., 2 figs.

  13. Linkage disequilibrium between the beta frequency of the human EEG and a GABAA receptor gene locus

    PubMed Central

    Porjesz, Bernice; Almasy, Laura; Edenberg, Howard J.; Wang, Kongming; Chorlian, David B.; Foroud, Tatiana; Goate, Alison; Rice, John P.; O'Connor, Sean J.; Rohrbaugh, John; Kuperman, Samuel; Bauer, Lance O.; Crowe, Raymond R.; Schuckit, Marc A.; Hesselbrock, Victor; Conneally, P. Michael; Tischfield, Jay A.; Li, Ting-Kai; Reich, Theodore; Begleiter, Henri


    Human brain oscillations represent important features of information processing and are highly heritable. A common feature of beta oscillations (13–28 Hz) is the critical involvement of networks of inhibitory interneurons as pacemakers, gated by γ-aminobutyric acid type A (GABAA) action. Advances in molecular and statistical genetics permit examination of quantitative traits such as the beta frequency of the human electroencephalogram in conjunction with DNA markers. We report a significant linkage and linkage disequilibrium between beta frequency and a set of GABAA receptor genes. Uncovering the genes influencing brain oscillations provides a better understanding of the neural function involved in information processing. PMID:11891318

  14. A Drosophila gene encoding a protein resembling the human. beta. -amyloid protein precursor

    SciTech Connect

    Rosen, D.R.; Martin-Morris, L.; Luo, L.; White, K. )


    The authors have isolated genomic and cDNA clones for a Drosophila gene resembling the human {beta}-amyloid precursor protein (APP). This gene produces a nervous system-enriched 6.5-kilobase transcript. Sequencing of cDNAs derived from the 6.5-kilobase transcript predicts an 886-amino acid polypeptide. This polypeptide contains a putative transmembrane domain and exhibits strong sequence similarity to cytoplasmic and extracellular regions of the human {beta}-amyloid precursor protein. There is a high probability that this Drosophila gene corresponds to the essential Drosophila locus vnd, a gene required for embryonic nervous system development.

  15. The exon-intron organization of the human erythroid [beta]-spectrin gene

    SciTech Connect

    Amin, K.M.; Forget, B.G. ); Scarpa, A.L.; Curtis, P.J. ); Winkelmann, J.C. )


    The human erythrocyte [beta]-spectrin gene DNA has been cloned from overlapping human genomic phage and cosmid recombinants. The entire erythroid [beta]-spectrin mRNA is encoded by 32 exons that range in size from 49 to 871 bases. The exon/intron junctions have been identified and the exons mapped. There is no correlation between intron positions and the repeat units of 106 amino acids within domain II of the [beta]-spectrin gene. The scatter of the introns over the 17 repeats argues against the 106-amino-acid unit representing a minigene that underwent repeated duplication resulting in the present [beta]-spectrin gene. In fact, the two largest exons, exon 14 (871 bp) and 16 (757 bp), extend over 4 and 3 repeat units of 106 amino acids, respectively, while repeat [beta]10 is encoded by 4 exons. No single position of an intron in the [beta]-spectrin gene is conserved between any of the 17 [beta]-spectrin and 22 [alpha]-spectrin repeat units. The nucleotide sequences of the exon/intron boundaries conform to the consensus splice site sequences except for exon 20, whose 5[prime] donor splice-site sequence begins with GC. The [beta]-spectrin isoform present in the human brain, the skeletal muscle, and the cardiac muscle is an alternatively spliced product of the erythroid [beta]-spectrin gene. This splice site is located within the coding sequences of exon 32 and its utilization in nonerythroid tissues leads to the use of 4 additional downstream exons with a size range of 44 to 530 bp. 55 refs., 3 figs., 3 tabs.

  16. Physical mapping of the human T-cell antigen receptor (TCR) {beta}-chain gene complex

    SciTech Connect

    Yashim, Y.; So, A.K.


    The genetic variation of the TCR loci and their contribution to autoimmune diseases is poorly defined, in direct contrast to the clear examples of disease association with the Class I and II alleles of the major histocompatibility complex. We have therefore started to determine the gene organization and polymorphism of the TCR {beta} locus. Yeast artificial chromosomes (YACs) were used to construct a physical map of the germline human TCR {beta}-chain gene complex. Variable gene (V{beta}) sequences for the 25 known V{beta} subfamilies were amplified by PCR and were used as probes to screen a YAC library. Five positive YACs were identified. YACs designated B3, E11 and H11 of sizes 820, 400 and 600 kbp, respectively, were analyzed for their V{beta} content by pulse-field gel electrophoresis (PFGE). YAC B3 was found to contain all 25 V{beta} subfamilies, E11 for 14 and H11 for 7. B3 was also positive for the constant region genes. Restriction enzyme mapping of B3 located V{beta} and C{beta} gene regions to four Sfi I fragments of 280, 110, 90 and 125 kbp, and was in accordance with published data. The data thus showed that YAC B3 encoded a complete and unrearranged TCR {beta}-gene locus. The map was further resolved by locating restriction sites for Sal I and Bssll II on B3. Fluorescent in situ hybridization to human metaphase chromosomes localized B3 to chromosome 7q35. However, two additional signals were obtained: one attributable to V{beta} orphon cluster on chromosome 9q21; the second to the long arm of chromosome 2. PCR amplification of a chromosome 2 somatic cell hybrid using primers for all 25 V{beta} gene families revealed the signal was not attributable to a second orphon cluster. It is suggested that B3 is a chimeric YAC with an intact TCR {beta} locus flanked by chromosome 2 sequences. The determination of the TCR genomic organization will help extend studies of the role T-cells play in autoimmune diseases.

  17. Understanding the mechanisms of ATPase beta family genes for cellular thermotolerance in crossbred bulls

    NASA Astrophysics Data System (ADS)

    Deb, Rajib; Sajjanar, Basavaraj; Singh, Umesh; Alex, Rani; Raja, T. V.; Alyethodi, Rafeeque R.; Kumar, Sushil; Sengar, Gyanendra; Sharma, Sheetal; Singh, Rani; Prakash, B.


    Na+/K+-ATPase is an integral membrane protein composed of a large catalytic subunit (alpha), a smaller glycoprotein subunit (beta), and gamma subunit. The beta subunit is essential for ion recognition as well as maintenance of the membrane integrity. Present study was aimed to analyze the expression pattern of ATPase beta subunit genes (ATPase B1, ATPase B2, and ATPase B3) among the crossbred bulls under different ambient temperatures (20-44 °C). The present study was also aimed to look into the relationship of HSP70 with the ATPase beta family genes. Our results demonstrated that among beta family genes, transcript abundance of ATPase B1 and ATPase B2 is significantly ( P < 0.05) higher during the thermal stress. Pearson correlation coefficient analysis revealed that the expression of ATPase Β1, ATPase B2, and ATPase B3 is highly correlated ( P < 0.01) with HSP70, representing that the change in the expression pattern of these genes is positive and synergistic. These may provide a foundation for understanding the mechanisms of ATPase beta family genes for cellular thermotolerance in cattle.

  18. Expression, refolding and crystallization of murine MHC class I H-2D{sup b} in complex with human β{sub 2}-microglobulin

    SciTech Connect

    Sandalova, Tatyana; Michaëlsson, Jakob; Harris, Robert A.; Ljunggren, Hans-Gustaf; Kärre, Klas; Schneider, Gunter; Achour, Adnane


    Mouse MHC class I H-2Db in complex with human β2m and the LCMV-derived peptide gp33 has been produced and crystallized. Resolution of the structure of this complex combined with the structural comparison with the previously solved crystal structure of H-2Db/mβ2m/gp33 should lead to a better understanding of how the β2m subunit affects the overall conformation of MHC complexes as well as the stability of the presented peptides. β{sub 2}-Microglobulin (β{sub 2}m) is non-covalently linked to the major histocompatibility (MHC) class I heavy chain and interacts with CD8 and Ly49 receptors. Murine MHC class I can bind human β{sub 2}m (hβ{sub 2}m) and such hybrid molecules are often used in structural and functional studies. The replacement of mouse β{sub 2}m (mβ{sub 2}m) by hβ{sub 2}m has important functional consequences for MHC class I complex stability and specificity, but the structural basis for this is unknown. To investigate the impact of species-specific β{sub 2}m subunits on MHC class I conformation, murine MHC class I H-2D{sup b} in complex with hβ{sub 2}m and the peptide gp33 derived from lymphocytic choriomeningitis virus (LCMV) has been expressed, refolded in vitro and crystallized. Crystals containing two complexes per asymmetric unit and belonging to the space group P2{sub 1}, with unit-cell parameters a = 68.1, b = 65.2, c = 101.9 Å, β = 102.4°, were obtained.

  19. Characterization of intermolecular structure of β(2)-microglobulin core fragments in amyloid fibrils by vacuum-ultraviolet circular dichroism spectroscopy and circular dichroism theory.


    Matsuo, Koichi; Hiramatsu, Hirotsugu; Gekko, Kunihiko; Namatame, Hirofumi; Taniguchi, Masaki; Woody, Robert W


    Intermolecular structures are important factors for understanding the conformational properties of amyloid fibrils. In this study, vacuum-ultraviolet circular dichroism (VUVCD) spectroscopy and circular dichroism (CD) theory were used for characterizing the intermolecular structures of β2-microglobulin (β2m) core fragments in the amyloid fibrils. The VUVCD spectra of β2m20-41, β2m21-31, and β2m21-29 fragments in the amyloid fibrils exhibited characteristic features, but they were affected not only by the backbone conformations but also by the aromatic side-chain conformations. To estimate the contributions of aromatic side-chains to the spectra, the theoretical spectra were calculated from the simulated structures of β2m21-29 amyloid fibrils with various types of β-sheet stacking (parallel or antiparallel) using CD theory. We found that the experimental spectrum of β2m21-29 fibrils is largely affected by aromatic-backbone couplings, which are induced by the interaction between transitions within the aromatic and backbone chromophores, and these couplings are sensitive to the type of stacking among the β-sheets of the fibrils. Further theoretical analyses of simulated structures incorporating mutated aromatic residues suggested that the β2m21-29 fibrils are composed of amyloid accumulations in which the parallel β-sheets stack in an antiparallel manner and that the characteristic Phe-Tyr interactions among the β-sheet stacks affect the aromatic-backbone coupling. These findings indicate that the coupling components, which depend on the characteristic intermolecular structures, induce the spectral differences among three fragments in the amyloid fibrils. These advanced spectral analyses using CD theory provide a useful method for characterizing the intermolecular structures of protein and peptide fragment complexes. PMID:24512563

  20. Preliminary study on the role of virtual touch tissue quantification combined with a urinary β2-microglobulin test on the early diagnosis of gouty kidney damage.


    Tian, Fei; Wang, Zheng-Bin; Meng, Dong-Mei; Liu, Rong-Gui; Zhang, Hai-Yan; Li, Hui-Ying; Lv, Fei-Fei


    The goal of the work described here was to evaluate the role of virtual touch tissue quantification (VTQ) combined with urinary β2-microglobulin (β2-MG) measurement in the early diagnosis of gouty kidney damage. Two hundred fifty-nine patients with gouty kidney damage and 200 healthy control subjects were tested. The shear wave velocity (SWV) of the renal parenchyma and sinus as determined with VTQ and the urinary β2-MG level of the two groups were analyzed. Although there were no significant differences in age, body mass index, creatinine level and blood urea nitrogen between the two groups (all p's > 0.05), the aforementioned parameters were higher in the group with gouty kidney damage than in the control group. Urinary β2-MG levels of the patients with kidney damage were significantly higher than those of the control subjects (t = 6.38, p < 0.01). The SWV of the renal parenchyma was higher than that of the sinus in both groups. Compared with controls, patients with kidney damage had significantly increased renal parenchyma and sinus SWVs (all p-values < 0.05). Urinary β2-MG level was positively linearly correlated with the SWV of renal parenchyma in patients with kidney damage (r = 0.442, p < 0.0001). However, there was no correlation between urinary β2-MG level and the SWV of the sinus in patients with kidney damage (r = 0). In the control group, there was no correlation between urinary β2-MG level and the SWV of the renal parenchyma or sinus. The elasticity of the kidney as determined with VTQ, combined with the urinary β2-MG level, may be helpful in the early diagnosis of gouty kidney damage. PMID:24642221

  1. Nonsense mutations in the human. beta. -globin gene affect mRNA metabolism

    SciTech Connect

    Baserga, S.J.; Benz, E.J. Jr. )


    A number of premature translation termination mutations (nonsense mutations) have been described in the human {alpha}- and {beta}-globin genes. Studies on mRNA isolated from patients with {beta}{sup 0}-thalassemia have shown that for both the {beta}-17 and the {beta}-39 mutations less than normal levels of {beta}-globin mRNA accumulate in peripheral blood cells. (The codon at which the mutation occurs designates the name of the mutation; there are 146 codons in human {beta}-globin mRNA). In vitro studies using the cloned {beta}-39 gene have reproduced this effect in a heterologous transfection system and have suggested that the defect resides in intranuclear metabolism. The authors have asked if this phenomenon of decreased mRNA accumulation is a general property of nonsense mutations and if the effect depends on the location or the type of mutation. Toward this end, they have studied the effect of five nonsense mutations and two missense mutations on the expression of human {beta}-globin mRNA in a heterologous transfection system. In all cases studied, the presence of a translation termination codon correlates with a decrease in the steady-state level of mRNA. The data suggest that the metabolism of a mammalian mRNA is affected by the presence of a mutation that affects translation.

  2. Arrested rearrangement of TCR V[beta] genes in thymocytes from children with x-linked severe combined immunodeficiency disease

    SciTech Connect

    Sleasman, J.W.; Harville, T.O.; White, G.B.; Barrett, D.J. ); George, J.F. ); Goodenow, M.M. Univ. of Alabama, Birmingham, AL )


    Human X-linked severe combined immunodeficiency disease (SCID) is an immunodeficiency disorder in which T cell development is arrested in the thymic cortex. B lymphocytes in children with X-linked SCID seem to differentiate normally. X-linked SCID is associated with a mutation in the gene that encodes the IL-2R [gamma]-chain. Because TCR-[beta] gene recombination is a pivotal initial event in T lymphocyte onteogeny within the thymus, the authors hypothesized that a failure to express normal IL-2R[gamma] could lead to impaired TCR-[beta] gene recombination in early thymic development. PCR was used to determine the status of TCR-[beta] gene-segment rearrangements in thymic DNA that had been obtained from children with X-linked SCID. The initial step in TCR-[beta] gene rearrangement, that of D[beta] to J[beta] recombination, was readily detected in all thymus samples from children with X-linked SCID; in contrast, V[beta] to DJ[beta] gene rearrangements were undetectable in the same samples. Both D[beta] to J[beta] and V[beta] to DJ[beta] TCR genes were rearranged in the thymic tissues obtained from immunologically normal children. The authors conclude that TCR[beta]-chain gene rearrangement is arrested in children with X-linked SCID. The results suggest a causative relationship between the failure of TCR [beta]-chain gene arrangements to proceed beyond DJ[beta] rearrangements and the production of a nonfunctional IL-2R [gamma]-chain. 45 refs., 3 figs.

  3. Characterization of the 5'-flanking region for the human fibrinogen beta gene.

    PubMed Central

    Huber, P; Dalmon, J; Courtois, G; Laurent, M; Assouline, Z; Marguerie, G


    To identify the possible regulatory sequences in the genetic expression of fibrinogen, a human genomic DNA library raised in lambda EMBL 4 phage was screened using cDNA probes coding for the A alpha, B beta and gamma chains of human fibrinogen. The entire fibrinogen locus was characterized and its organization analysed by means of hybridization and restriction mapping. Among the clones identified, a single recombinant lambda phage contained the beta gene and its 5'- and 3'-flanking regions. A 1.5 kb fragment of the immediate 5'-flanking region was sequenced and S1 mapping experiments revealed three transcription start points. Comparison of this sequence with that previously reported for the same region upstream from the human gamma gene revealed no significant homology which suggests that the potential promoting sequences of these genes are different. In contrast, comparison of the 5'-flanking regions of human and rat beta genes revealed a 142 bp sequence of 80% homology situated 16 bp upstream from the human beta gene. This highly conserved region may well represents a potential candidate for a regulatory sequence of the human beta gene. Images PMID:3029722

  4. Genomically imposed and somatically modified human thymocyte V sub. beta. gene repertoires

    SciTech Connect

    Baccala, R.; Kono, D.H.; Balderas, R.S.; Theofilopoulos, A.N. ); Walker, S. )


    The effect of thymic selection on the expressed human T-cell antigen receptor {beta}-chain variable region (V{sub {beta}}) gene repertoire was examined by using a multiprobe RNase protection assay. The relative abundance of transcripts for 22 V{sub {beta}} genes (encompassing 17 of the 20 human V{sub {beta}} gene subfamilies) within a thymus, and among 17 thymuses, was variable. On the basis of the presence of corresponding mRNAs, no genomic deletions were detected, but several coding region polymorphisms were identified. Analysis of mature T-cell subsets revealed the absence of complete superantigen-mediated V{sub {beta}} deletions, suggesting that this phenomenon, in contrast to mouse, is uncommon or absent in humans. However, several V{sub {beta}} genes were over- or underexpressed in one or both mature single-positive (CD4{sup +}8{sup {minus}} or CD8{sup +}4{sup {minus}}) thymocyte subsets compared to syngeneic total, mostly immature thymocytes. Whether these changes are induced by relatively weak superantigens or conventional antigens and whether the downshifts are caused by negative selection or lack of positive selection remains to be determined.

  5. Identification of suitable reference genes in bone marrow stromal cells from osteoarthritic donors.


    Schildberg, Theresa; Rauh, Juliane; Bretschneider, Henriette; Stiehler, Maik


    Bone marrow stromal cells (BMSCs) are key cellular components for musculoskeletal tissue engineering strategies. Furthermore, recent data suggest that BMSCs are involved in the development of Osteoarthritis (OA) being a frequently occurring degenerative joint disease. Reliable reference genes for the molecular evaluation of BMSCs derived from donors exhibiting OA as a primary co-morbidity have not been reported on yet. Hence, the aim of the study was to identify reference genes suitable for comparative gene expression analyses using OA-BMSCs. Passage 1 bone marrow derived BMSCs were isolated from n=13 patients with advanced stage idiopathic hip osteoarthritis and n=15 age-matched healthy donors. The expression of 31 putative reference genes was analyzed by quantitative reverse transcription polymerase chain reaction (qRT-PCR) using a commercially available TaqMan(®) assay. Calculating the coefficient of variation (CV), mRNA expression stability was determined and afterwards validated using geNorm and NormFinder algorithms. Importin 8 (IPO8), TATA box binding protein (TBP), and cancer susceptibility candidate 3 (CASC3) were identified as the most stable reference genes. Notably, commonly used reference genes, e.g. beta-actin (ACTB) and beta-2-microglobulin (B2M) were among the most unstable genes. For normalization of gene expression data of OA-BMSCs the combined use of IPO8, TBP, and CASC3 gene is recommended. PMID:24080205

  6. Enhanced jun gene expression is an early genomic response to transforming growth factor. beta. stimulation

    SciTech Connect

    Pertovaara, L.; Sistonen, L.; Keski-Oja, J.; Alitalo, K. ); Bos, T.J.; Vogt, P.K. . Dept. of Microbiology)


    Transforming growth factor {beta} (TGF{beta}) is a multifunctional polypeptide4 that regulates proliferation, differentiation, and other functions of many cell types. The pathway of TGF{beta} signal transduction in cells is unknown. The authors report here that an early effect of TGF{beta} is an enhancement of the expression of two genes encoding serum- and phorbol ester tumor promoter-regulated transcription factors: the junB gene and the c-jun proto-oncogene, respectively. This stimulation was observed in human lung adenocarcinoma A549 cells which were growth inhibited by TGF{beta}, AKR-2B mouse embryo fibroblasts which were growth stimulated by TGF{beta}, and K562 human erythroleukemia cells, which were not appreciably affected in their growth by TFG{beta}. The increase in jun mRNA occurred with picomolar TGF{beta} concentrations within 1 h of TGF{beta} stimulation, reached a peak between 1 and 5 h in different cells, and declined gradually to base-fine levels. This mRNA response was followed by a large increase in the biosynthesis of the c-jun protein (AP-1), as shown by metabolic labeling and immunoprecipitation analysis. However, differential and cell type-specific regulation appeared to determine the timing and magnitude of the response of each jun gene in a given cell. In AKR-2B and NIH 3T3 cells, only junB was induced by TGF{beta}, evidently in a protein synthesis-independent fashion. The junB response to TGF{beta} was maintained in c-Ha-ras and neu oncogene-transformed cells. Thus, one of the earliest genomic responses to TGF{beta} may involve nuclear signal transduction and amplification by the junB and c-jun transcription factors in concert with c-fos, which is also induced. The differential activation of the jun genes may explain some of the pleiotropic effects of TGF{beta}.

  7. Transcription factor assembly on the nicotinic receptor beta4 subunit gene promoter.


    Scofield, Michael D; Brüschweiler-Li, Lei; Mou, Zhongming; Gardner, Paul D


    Nicotinic acetylcholine receptors are involved in a plethora of fundamental biological processes ranging from muscle contraction to formation of memories. The receptors are pentameric proteins whose subunits are encoded by distinct genes. Subunit composition of a mature nicotinic receptor is governed in part by the transcriptional regulation of each subunit gene. Here, using chromatin immunoprecipitation assays, we report the interaction of the transcription factors Sp1, Sp3, c-Jun and Sox10 with the beta4 subunit gene promoter in neuronal-like cell lines and rodent brain tissue. Our results corroborate previous in-vitro data demonstrating that these transcription factors interact with the beta4 promoter. Taken together, these data suggest that Sp1, Sp3, c-Jun and Sox10 regulate expression of the beta4 subunit gene in the mammalian brain. PMID:18382288

  8. Regulation of. beta. -cell glucose transporter gene expression

    SciTech Connect

    Chen, Ling; Alam, Tausif; Johnson, J.H.; Unger, R.H. Department of Veterans Affairs Medical Center, Dallas, TX ); Hughes, S.; Newgard, C.B. )


    It has been postulated that a glucose transporter of {beta} cells (GLUT-2) may be important in glucose-stimulated insulin secretion. To determine whether this transporter is constitutively expressed or regulated, the authors subjected conscious unrestrained Wistar rats to perturbations in glucose homeostasis and quantitated {beta}-cell GLUT-2 mRNA by in situ hybridization. After 3 hr of hypoglycemia, GLUT-2 and proinsulin mRNA signal densities were reduced by 25% of the level in control rats. After 4 days, GLUT-2 and proinsulin mRNA densities were reduced by 85% and 65%, respectively. After 12 days of hypoglycemia, the K{sub m} for 3-O-methyl-D-glucose transport in isolated rat islets, normally 18-20 mM, was 2.5 mM. This provides functional evidence of a profound reduction of high K{sub m} glucose transporter in {beta} cells. In contrast, GLUT-2 was only slightly reduced by hypoglycemia in liver. To determine the effect of prolonged hyperglycemia, they also infused animals with 50% (wt/vol) glucose for 5 days. Hyperglycemic clamping increased GLUT-2 mRNA by 46% whereas proinsulin mRNA doubled. They conclude that GLUT-2 expression in {beta} cells, but not liver, is subject to regulation by certain perturbations in blood glucose homeostasis.

  9. Isolation and characterization of BetaM protein encoded by ATP1B4 - a unique member of the Na,K-ATPase {beta}-subunit gene family

    SciTech Connect

    Pestov, Nikolay B.; Zhao, Hao; Basrur, Venkatesha; Modyanov, Nikolai N.


    Highlights: {yields} Structural properties of BetaM and Na,K-ATPase {beta}-subunits are sharply different. {yields} BetaM protein is concentrated in nuclear membrane of skeletal myocytes. {yields} BetaM does not associate with a Na,K-ATPase {alpha}-subunit in skeletal muscle. {yields} Polypeptide chain of the native BetaM is highly sensitive to endogenous proteases. {yields} BetaM in neonatal muscle is a product of alternative splice mRNA variant B. -- Abstract: ATP1B4 genes represent a rare instance of the orthologous gene co-option that radically changed functions of encoded BetaM proteins during vertebrate evolution. In lower vertebrates, this protein is a {beta}-subunit of Na,K-ATPase located in the cell membrane. In placental mammals, BetaM completely lost its ancestral role and through acquisition of two extended Glu-rich clusters into the N-terminal domain gained entirely new properties as a muscle-specific protein of the inner nuclear membrane possessing the ability to regulate gene expression. Strict temporal regulation of BetaM expression, which is the highest in late fetal and early postnatal myocytes, indicates that it plays an essential role in perinatal development. Here we report the first structural characterization of the native eutherian BetaM protein. It should be noted that, in contrast to structurally related Na,K-ATPase {beta}-subunits, the polypeptide chain of BetaM is highly sensitive to endogenous proteases that greatly complicated its isolation. Nevertheless, using a complex of protease inhibitors, a sample of authentic BetaM was isolated from pig neonatal skeletal muscle by a combination of ion-exchange and lectin-affinity chromatography followed by SDS-PAGE. Results of the analysis of the BetaM tryptic digest using MALDI-TOF and ESI-MS/MS mass spectrometry have demonstrated that native BetaM in neonatal skeletal muscle is a product of alternative splice mRNA variant B and comprised of 351 amino acid residues. Isolated BetaM protein was

  10. Complete sequence of an HLA-dR beta chain deduced from a cDNA clone and identification of multiple non-allelic DR beta chain genes.

    PubMed Central

    Long, E O; Wake, C T; Gorski, J; Mach, B


    At least three polymorphic class II antigens are encoded in the human major histocompatibility complex (HLA): DR, DC and SB. cDNA clones encoding beta chains of HLA-DR antigen, derived from mRNA of a heterozygous B-cell line, were isolated and could be divided into four subsets, clearly distinct from cDNA clones encoding DC beta chains. Therefore, at least two non-allelic DR beta chain genes exist. The complete sequence of one of the DR beta chain cDNA clones is presented. It defines a putative signal sequence, two extracellular domains, a trans-membrane region and a cytoplasmic tail. Comparison with a DC beta chain cDNA clone revealed a homology of 70% between the two beta chains and that the two genes diverged under relatively little selective pressure. A set of amino acids conserved in immunoglobulin molecules was found to be identical in both DR and DC beta chains. Comparison of the DR beta chain sequence with the amino acid sequence of another DR beta chain revealed a homology of 87% and that most differences are single amino acid substitutions. Allelic polymorphism in DR beta chains has probably not arisen by changes in long blocks of sequence. PMID:11894954

  11. The phylogenetic history of New World monkey beta globin reveals a platyrrhine beta to delta gene conversion in the atelid ancestry.


    Prychitko, Tom; Johnson, Robert M; Wildman, Derek E; Gumucio, Deborah; Goodman, Morris


    Orthologues of the beta globin gene locus from 10 New World monkey species were sequenced and aligned against available beta and delta globin sequences from rabbit and other primates. Where needed, additional primate sequencing was performed. Phylogenetic analysis identified a beta to delta conversion in the stem of the Anthropoidea, stretching from the 3' part of the proximal promotor to the 5' start of intron 2, consistent with earlier findings. No further conversion appeared to have occurred in the descent of the catarrhines. Within the New World monkey lineage that led to spider monkey and other atelids, another shorter gene conversion was found, spanning adjacent parts of exon 1 and intron 1. The analysis also confirmed that galago beta had replaced galago delta, that an earlier loriform-specific gene conversion extended over intron 2, and that gene conversion throughout the main gene conversion region occurred in the tarsiiform lineage. Platyrrhine phylogenetic relationships were investigated with beta sequences restricted to those that were not involved in gene conversions. This phylogeny generally agreed with results from other nuclear genes. The one exception was that the beta sequences did not place the callitrichine clade within the Cebidae but weakly joined the callitrichine and atelid clades. PMID:15737593

  12. Neofunctionalization of Chromoplast Specific Lycopene Beta Cyclase Gene (CYC-B) in Tomato Clade.


    Mohan, Vijee; Pandey, Arun; Sreelakshmi, Yellamaraju; Sharma, Rameshwar


    The ancestor of tomato underwent whole genome triplication ca. 71 Myr ago followed by widespread gene loss. However, few of the triplicated genes are retained in modern day tomato including lycopene beta cyclase that mediates conversion of lycopene to β-carotene. The fruit specific β-carotene formation is mediated by a chromoplast-specific paralog of lycopene beta cyclase (CYC-B) gene. Presently limited information is available about how the variations in CYC-B gene contributed to its neofunctionalization. CYC-B gene in tomato clade contained several SNPs and In-Dels in the coding sequence (33 haplotypes) and promoter region (44 haplotypes). The CYC-B gene coding sequence in tomato appeared to undergo purifying selection. The transit peptide sequence of CYC-B protein was predicted to have a stronger plastid targeting signal than its chloroplast specific paralog indicating a possible neofunctionalization. In promoter of two Bog (Beta old gold) mutants, a NUPT (nuclear plastid) DNA fragment of 256 bp, likely derived from a S. chilense accession, was present. In transient expression assay, this promoter was more efficient than the "Beta type" promoter. CARGATCONSENSUS box sequences are required for the binding of the MADS-box regulatory protein RIPENING INHIBITOR (RIN). The loss of CARGATCONSENSUS box sequence from CYC-B promoter in tomato may be related to attenuation of its efficiency to promote higher accumulation of β-carotene than lycopene during fruit ripening. PMID:27070417

  13. Neofunctionalization of Chromoplast Specific Lycopene Beta Cyclase Gene (CYC-B) in Tomato Clade

    PubMed Central

    Mohan, Vijee; Pandey, Arun; Sreelakshmi, Yellamaraju; Sharma, Rameshwar


    The ancestor of tomato underwent whole genome triplication ca. 71 Myr ago followed by widespread gene loss. However, few of the triplicated genes are retained in modern day tomato including lycopene beta cyclase that mediates conversion of lycopene to β-carotene. The fruit specific β-carotene formation is mediated by a chromoplast-specific paralog of lycopene beta cyclase (CYC-B) gene. Presently limited information is available about how the variations in CYC-B gene contributed to its neofunctionalization. CYC-B gene in tomato clade contained several SNPs and In-Dels in the coding sequence (33 haplotypes) and promoter region (44 haplotypes). The CYC-B gene coding sequence in tomato appeared to undergo purifying selection. The transit peptide sequence of CYC-B protein was predicted to have a stronger plastid targeting signal than its chloroplast specific paralog indicating a possible neofunctionalization. In promoter of two Bog (Beta old gold) mutants, a NUPT (nuclear plastid) DNA fragment of 256 bp, likely derived from a S. chilense accession, was present. In transient expression assay, this promoter was more efficient than the “Beta type” promoter. CARGATCONSENSUS box sequences are required for the binding of the MADS-box regulatory protein RIPENING INHIBITOR (RIN). The loss of CARGATCONSENSUS box sequence from CYC-B promoter in tomato may be related to attenuation of its efficiency to promote higher accumulation of β-carotene than lycopene during fruit ripening. PMID:27070417

  14. Sequence heterogeneity, multiplicity, and genomic organization of. cap alpha. - and. beta. -tubulin genes in Sea Urchins

    SciTech Connect

    Alexandraki, D.; Ruderman, J.V.


    The authors analyzed the multiplicity, heterogeneity, and organization of the genes encoding the ..cap alpha.. and ..beta.. tubulins in the sea urchin Lytechinus pictus by using cloned complementary deoxyribonucleic acid (cDNA) and genomic tubulin sequences. cDNA clones were constructed by using immature spermatogenic testis polyadenylic acid-containing ribonucleic acid as a template. ..cap alpha.. and ..beta..-tubulin clones were identified by hybrid selection and in vitro translation of the corresponding messenger ribonucleic acids, followed by immunoprecipitation and two-dimensional gel electrophoresis of the translation products. The ..cap alpha.. cDNA clone contains a sequence that encodes the 48 C-terminal amino acids of ..cap alpha.. tubulin and 104 base pairs of the 3' nontranslated portion of the messenger ribonucleic acid. The ..beta.. cDNA insertion contains the coding sequence for the 100 C-terminal amino acids of ..beta.. tubulin and 83 base pairs of the 3' noncoding sequence. Hybrid selections performed at different criteria demonstrated the presence of several heterogeneous, closely related tubulin messenger ribonucleic acids, suggesting the existence of heterogeneous ..cap alpha..- and ..beta..-tubulin genes. Hybridization analyses indicated that there are at least 9 to 13 sequences for each of the two tubulin gene families per haploid genome. Hybridization of the cDNA probes to both total genomic DNA and cloned germline DNA fragments gave no evidence for close physical linkage of ..cap alpha..-tubulin genes with ..beta..-tubulin genes at the DNA level. In contrast, these experiments indicated that some genes within the same family are clustered.

  15. Cloning and expression of the phospho-beta-galactosidase gene of Staphylococcus aureus in Escherichia coli.

    PubMed Central

    Breidt, F; Stewart, G C


    The phospho-beta-galactosidase gene of Staphylococcus aureus was cloned in Escherichia coli. This was done by first isolating a staphylococcal transposon Tn551-induced mutant which rendered phospho-beta-galactosidase synthesis partially constitutive because of an insertion nearby this lac structural gene. This allowed selection in E. coli of chimeric plasmids which expressed the erythromycin resistance determinant of Tn551. A 26-kilobase (kb) BamHI insert in plasmid pBR322 was isolated which encoded phospho-beta-galactosidase, as determined by phospho-beta-galactosidase activity measurements. Maxicell experiments showed the presence of 56-, 13.5-, and 31-kilodalton proteins encoded by the staphylococcal DNA. The presence of the 56-kilodalton protein correlated with phospho-beta-galactosidase activity and corresponded in molecular weight to the reported value for the purified enzyme. The nature of the other proteins is unknown. Phospho-beta-galactosidase was apparently expressed in E. coli by a promoter contained within a 2.1-kb EcoRI chromosomal DNA fragment. This fragment, when inserted into a chloramphenicol acetyl transferase promoter detection plasmid, was transcriptionally active in both E. coli and Bacillus subtilis but was much more active in the latter host. Images PMID:3011732

  16. Nitric oxide stimulates insulin gene transcription in pancreatic {beta}-cells

    SciTech Connect

    Campbell, S.C. . E-mail:; Richardson, H.; Ferris, W.F.; Butler, C.S.; Macfarlane, W.M.


    Recent studies have identified a positive role for nitric oxide (NO) in the regulation of pancreatic {beta}-cell function. The aim of this study was to determine the effects of short-term exposure to NO on {beta}-cell gene expression and the activity of the transcription factor PDX-1. NO stimulated the activity of the insulin gene promoter in Min6 {beta}-cells and endogenous insulin mRNA levels in both Min6 and isolated islets of Langerhans. Addition of wortmannin prior to NO stimulation blocked the observed increases in insulin gene promoter activity. Although NO addition stimulated the phosphorylation of p38, inhibition by SB203580 did not block the effect of NO on the insulin gene promoter. NO addition also stimulated both the nuclear accumulation and the DNA binding activity of PDX-1. This study has shown that over 24 h, NO stimulates insulin gene expression, PI-3-kinase activity and the activity of the critical {beta}-cell transcription factor PDX-1.

  17. Expression of transfected mutant beta-actin genes: transitions toward the stable tumorigenic state.

    PubMed Central

    Leavitt, J; Ng, S Y; Varma, M; Latter, G; Burbeck, S; Gunning, P; Kedes, L


    Mutant human beta-actin genes were introduced into normal human (KD) fibroblasts and the derivative cell line HuT-12, which is immortalized but nontumorigenic, to test their ability to promote conversion to the tumorigenic state. Transfected substrains of HuT-12 fibroblasts that expressed abundant levels of mutant beta-actin (Gly-244----Asp-244) produced subcutaneous tumors in athymic mice after long latent periods (1.5 to 3 months). However, transfected substrains of KD fibroblasts retained their normal finite life span in culture and consequently were incapable of producing tumors. Substrains of HuT-12 cells transfected with the wild-type beta-actin gene and some transfected strains that expressed low or undetectable levels of mutant beta-actin did not produce tumors. Cell lines derived from transfectant cell tumors always exhibited elevated synthesis of the mutant beta-actin, ranging from 145 to 476% of the level expressed by the transfected cells that were inoculated to form the tumor. In general, primary transfectant cells that expressed the highest levels of mutant beta-actin were more tumorigenic than strains that expressed lower levels. The tumor-derived strains were stable in tumorigenicity and produced tumors with shortened latent periods of only 2 to 4 weeks. These findings imply that the primary transfectant strains develop subpopulations of cells that are selected to form tumors because of their elevated rate of exogenous mutant beta-actin synthesis. Actin synthesis and accumulation of gamma-actin mRNA from the endogenous beta- and gamma-actin genes were diminished in tumor-derived strains, apparently to compensate for elevated mutant beta-actin synthesis and maintain the normal cellular concentration of actin. Synthesis of the transformation-sensitive tropomyosin isoforms was decreased along with mutant beta-actin expression. Such modulations in tropomyosin synthesis are characteristically seen in transformation of avian, rodent, and human fibroblasts

  18. Pituitary tumor transforming gene-null male mice exhibit impaired pancreatic beta cell proliferation and diabetes

    PubMed Central

    Wang, Zhiyong; Moro, Enrico; Kovacs, Kalman; Yu, Run; Melmed, Shlomo


    The mammalian securin, pituitary tumor transforming gene (PTTG), regulates sister chromatid separation during mitosis. Mice or cell lines deficient in PTTG expression, however, are surprisingly viable. Here we show that PTTG disruption in mice (PTTG−/−) severely impairs glucose homeostasis leading to diabetes during late adulthood, especially in males associated with nonautoimmune insulinopenia and reversed alpha/beta cell ratio. Islet beta cell mass in PTTG−/− mice was already diminished before development of frank diabetes and only increased minimally during growth. BrdUrd incorporation of islet cells in PTTG-null mice was ≈65% lower (P < 0.005) than in the WT pancreas, whereas apoptosis rates were similar. PTTG−/− beta cells had pleiotropic nuclei, suggesting defects in cell division. The results indicated that securin is indispensable for normal pancreatic beta cell proliferation. PMID:12626748

  19. High-resolution structure of HLA-A*0201 in complex with a tumour-specific antigenic peptide encoded by the MAGE-A4 gene.


    Hillig, R C; Coulie, P G; Stroobant, V; Saenger, W; Ziegler, A; Hülsmeyer, M


    The heterotrimeric complex of the human major histocompatibity complex (MHC) molecule HLA-A*0201, beta2-microglobulin and the decameric peptide GVYDGREHTV derived from the melanoma antigen (MAGE-A4 protein has been determined by X-ray crystallography at 1.4 A resolution. MAGE-A4 belongs to a family of genes that are specifically expressed in a variety of tumours. MAGE-A4-derived peptides are presented by MHC molecules at the cell surface to cytotoxic T-lymphocytes. As the HLA-A*0201:MAGE-A4 complex occurs only on tumour cells, it is considered to be an appropriate target for immunotherapy. The structure presented here reveals potential epitopes specific to the complex and indicates which peptide residues could be recognised by T-cell receptors. In addition, as the structure could be refined anisotropically, it was possible to describe the movements of the bound peptide in more detail. PMID:11502003

  20. Characteristic analysis of the ampC gene encoding beta-lactamase from Photobacterium phosphoreum.


    Lin, Juey-Wen; Weng, Shu-Fen; Chao, Yuh-Fen; Chung, Yi-Ting


    The ampC gene of Photobacterium phosphoreum ATCC 11040 was cloned and identified. Nucleotide sequence of the regulatory region R&R and the ampC gene (GenBank Accession No. AY787792) from P. phosphoreum has been determined, and the encoded beta-lactamase is deduced. The beta-lactamase encoded by the ampC gene has a calculated M(r) 31,198 and comprises 285 amino acid residues (pI 7.35). There is a signal peptide of 20 amino acid residues MKLRFIASTLLLSFSQLASA to lead the beta-lactamase secretion, and the cleavage site is between ASA-Q; thus, the matured protein only has M(r) 29,019 and comprises 265 amino acid residues (pI 6.21). The specific amino acid residues STFK (65th to 68th), SDN (125th to 127th), and D (158th) located 33 residues downstream from the SDN loop of the class A beta-lactamases are highly conserved, but the KTG is not found. The gene order of the ampC is <--ufo-R&R-ampC-->, the genes running in the opposite directions. Functional analysis elicits that R&R([ampC]) does function to lead to the gene expression. Primer extension assay elicits that the ampC gene's transcriptional initiation +1 is -26 C upstream of the start codon; the P([I])-promoter should be the promoter response for the gene expression. Analysis of the R&R([ampC]) elicits that the upstream activator binding sequence Sigma UAS TGTTTAAATACGCTTTGAACA is like the two-component regulator binding sequence TGT-N(8-12)-ACA. It implies that P. phosphoreum ampC gene could be under-regulated by the specific two-component regulator. PMID:15596133

  1. Recombination within and between the human insulin and beta-globin gene loci.

    PubMed Central

    Lebo, R V; Chakravarti, A; Buetow, K H; Cheung, M C; Cann, H; Cordell, B; Goodman, H


    We detected a large number of polymorphic insulin restriction fragments in black Americans. These different size fragments were probably generated by unequal recombination on both sides of the human insulin gene. Population genetic analysis indicates that recombination occurred 33 times more frequently than expected to generate this large number of polymorphic fragments. Specific properties of the unique repeated 14- to 16-base-pair sequences 5' to the insulin gene suggest that this sequence would promote increased unequal recombination. Additional pedigree analysis showed that the recombination rate between the structural insulin and beta-globin gene loci was 14% with strong evidence for linkage. Since both insulin and beta-globin have been mapped to the short arm of human chromosome 11, this study establishes that the genetic map distance between these genes is 14.2 centimorgans. PMID:6348773

  2. The T cell receptor beta genes of Xenopus.


    Chretien, I; Marcuz, A; Fellah, J; Charlemagne, J; Du Pasquier, L


    cDNA of the T cell receptor beta (TCRB) have been isolated from the anuran amphibian Xenopus and they show strong structural homology to TCRB sequences of other vertebrates. Ten BV families, two D segments, ten J segments, and a single C region have been defined so far. Each V family consists of one to two members per haploid genome. A unique feature of the Xenopus TCRB constant region is the lack of N-linked carbohydrate glycosylation sites. The recombination signal sequences suggest that the mechanism of rearrangements are identical to those of mammals. The locus is inherited in a diploid manner despite the pseudotetraploidy of the Xenopus laevis and X. gilli used in this study. PMID:9079820

  3. Sequence analysis of the promoter regions of the classical class I gene RT1.A and two other class I genes of the rat MHC

    SciTech Connect

    Lambracht, D.; Wonigeit, K.


    Major histocompatibility complex (MHC) class I molecules present peptides to CD8+ T cells and thus play key role in immunosurveillance by T-cell-mediated mechanisms. Their expression depends on complex control mechanisms at two major levels: (1) regulation of transcription mediated through the promoter region and additional regulatory elements of the individual class I gene, and (2) availability of appropriate peptides in the endoplasmic reticulum required to stabilize the ternary complex consisting of class I {alpha} chain, {beta}{sub 2}-microglobulin ({beta}{sub 2}m), and peptide. In addition, differences in the ability of different {alpha} chains to bind {beta}{sub 2}m can influence the transport to and turnover within the cell membrane. We have now analyzed the promoter regions of class I genes of the LEW rat strain carrying the RT1{sup 1} haplotype. The analysis of three class I genes in this region has led to the identification of characteristic regulatory sequences. 20 refs., 2 figs.

  4. A new compound heterozygous frameshift mutation in the type II 3{beta}-hydroxysteroid dehydrogenase 3{beta}-HSD gene causes salt-wasting 3{beta}-HSD deficiency congenital adrenal hyperplasia

    SciTech Connect

    Zhang, L.; Sakkal-Alkaddour, S.; Chang, Ying T.; Yang, Xiaojiang; Songya Pang


    We report a new compound heterozygous frameshift mutation in the type II 3{Beta}-hydroxysteroid dehydrogenase (3{beta}-HSD) gene in a Pakistanian female child with the salt-wasting form of 3{Beta}-HSD deficiency congenital adrenal hyperplasia. The etiology for her congenital adrenal hyperplasia was not defined. Although the family history suggested possible 3{beta}-HSd deficiency disorder, suppressed adrenal function caused by excess glucocorticoid therapy in this child at 7 yr of age did not allow hormonal diagnosis. To confirm 3{beta}-HSD deficiency, we sequenced the type II 3{beta}-HSD gene in the patient, her family, and the parents of her deceased paternal cousins. The type II 3{beta}-HSD gene region of a putative promotor, exons I, II, III, and IV, and exon-intron boundaries were amplified by PCR and sequenced in all subjects. The DNA sequence of the child revealed a single nucleotide deletion at codon 318 [ACA(Thr){r_arrow}AA] in exon IV in one allele, and two nucleotide deletions at codon 273 [AAA(Lys){r_arrow}A] in exon IV in the other allele. The remaining gene sequences were normal. The codon 318 mutation was found in one allele from the father, brother, and parents of the deceased paternal cousins. The codon 273 mutation was found in one allele of the mother and a sister. These findings confirmed inherited 3{beta}-HSD deficiency in the child caused by the compound heterozygous type II 3{beta}-HSD gene mutation. Both codons at codons 279 and 367, respectively, are predicted to result in an altered and truncated type II 3{beta}-HSD protein, thereby causing salt-wasting 3{beta}-HSD deficiency in the patient. 21 refs., 2 figs., 1 tab.

  5. Characterization and expression of the beta-N-acetylglucosaminidase gene family of Tribolium castaneum

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Enzymes belonging to the Beta-N-acetylglucosaminidase (NAG) family cleave chitin oligosaccharides produced by the action of chitinases on chitin into the constituent N-acetylglucosamine monomer. Four genes encoding putative NAGs in the red flour beetle, Tribolium castaneum, namely TcNAG1, TcFDL, Tc...

  6. Nonblack patients with sickle cell disease have African. beta. sup s gene cluster haplotypes

    SciTech Connect

    Rogers, Z.R.; Powars, D.R.; Williams, W.D. ); Kinney, T.R. ); Schroeder, W.A. )


    Of 18 nonblack patients with sickle cell disease, 14 had sickle cell anemia, 2 had hemoglobin SC disease, and 2 had hemoglobin S-{beta}{sup o}-thalassemia. The {beta}{sup s} gene cluster haplotypes that were determined in 7 patients were of African origin and were identified as Central African Republic, Central African Republic minor II, Benin, and Senegal. The haplotype Central African Republic minor II was present on the {beta}{sup o}-thalassemia chromosome in 2 patients. None of 10 patients whose {alpha}-gene status was determined had {alpha}-thalassemia-2. These data strongly support the concept that the {beta}{sup s} gene on chromosome 11 of these individuals is of African origin and that the {alpha}-gene locus on chromosome 16 is of white or native American origin. The clinical severity of the disease in these nonblack patients is appropriate to their haplotype without {alpha}-thalassemia-2 and is comparable with that of black patients. All persons with congenital hemolytic anemia should be examined for the presence of sickle cell disease regardless of physical appearance or ethnic background.

  7. Direct cellobiose production from cellulose using sextuple beta-glucosidase gene deletion Neurospora crassa mutants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Direct cellobiose production from cellulose by a genetically modified fungus—Neurospora crassa, was explored in this study. A library of N. crassa sextuple beta-glucosidase (bgl) gene deletion strains was constructed. Various concentrations of cellobiose were detected in the culture broth of the N. ...

  8. Beta-globin gene cluster haplotype frequencies in Khalkhs and Buryats of Mongolia.


    Shimizu, Koji; Tokimasa, Kozue; Takeuchi, Yukiko; Gereksaikhan, Tudevdagva; Tanabe, Yuichi; Omoto, Keiichi; Imanishi, Tadashi; Harihara, Shinji; Hao, Luping; Jing, Feng


    Beta-globin gene cluster haplotype frequencies of 169 Khalkhs and 145 Buryats were estimated, and their characteristics were compared with those of Evenkis, Oroqens, Koreans, Japanese, and three Colombian Amerindian groups. The present study suggests that Colombian Amerindians diverged first from Asian populations and then Buryats diverged from other Asian populations. PMID:17564253

  9. Differential Expression of Salt Stress-related Genes in Wild Beta vulgaris

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Differential display reverse transcription (DDRT) technique was used to detect differentially expressed genes for wild Beta vulgaris in response to salt stress. Two month-old seedlings were treated with 250 mM Na for 1H, 10H and untreated seedlings were used as controls. A group of differentially di...

  10. Using the NCBI Genome Databases to Compare the Genes for Human & Chimpanzee Beta Hemoglobin

    ERIC Educational Resources Information Center

    Offner, Susan


    The beta hemoglobin protein is identical in humans and chimpanzees. In this tutorial, students see that even though the proteins are identical, the genes that code for them are not. There are many more differences in the introns than in the exons, which indicates that coding regions of DNA are more highly conserved than non-coding regions.

  11. CCAAT/enhancer-binding protein beta isoforms and the regulation of alpha-smooth muscle actin gene expression by IL-1 beta.


    Hu, Biao; Wu, Zhe; Jin, Hong; Hashimoto, Naozumi; Liu, Tianju; Phan, Sem H


    The role of IL-1beta in inflammation is amply documented, but its ability to inhibit myofibroblast differentiation and, in particular, the suppression of alpha-smooth muscle actin (alpha-SMA) gene expression is less well understood. Because IL-1beta can induce C/EBPbeta expression, the role of C/EBPbeta isoforms in IL-1beta regulation of alpha-SMA gene expression was investigated in rat lung myofibroblasts. The results showed that IL-1beta inhibited alpha-SMA expression in a dose-dependent manner, which was associated with stimulation of the expression of both C/EBPbeta isoforms, liver-enriched activating protein (LAP) and liver-enriched inhibitory protein (LIP). However, a greater increase in LIP relative to LAP expression resulted in a reduced LAP/LIP ratio after IL-1beta treatment. Transfection with an LAP-expressing plasmid stimulated, whereas an LIP-expressing plasmid inhibited, alpha-SMA expression. Cells from C/EBPbeta-deficient mice had reduced levels of alpha-SMA expression and promoter activity, which failed to respond to IL-1beta treatment. Sequence analysis identified the presence of a C/EBPbeta consensus binding sequence in the alpha-SMA promoter, which, when mutated, resulted in diminished promoter activity and abolished its responsiveness to IL-1beta treatment. EMSA revealed binding of C/EBPbeta to this C/EBPbeta consensus binding sequence from the alpha-SMA promoter. Finally, IL-1beta enhanced the expression of eukaryotic initiation factor 4E, a stimulator of LIP expression, which may account for a mechanism by which IL-1beta could alter the LAP/LIP ratio. These data taken together suggest that C/EBPbeta isoforms regulate alpha-SMA gene expression, and that its inhibition by IL-1beta was due to preferential stimulation of LIP expression. PMID:15383601

  12. Characterization of the human, mouse and rat PGC1 beta (peroxisome-proliferator-activated receptor-gamma co-activator 1 beta) gene in vitro and in vivo.

    PubMed Central

    Meirhaeghe, Aline; Crowley, Vivion; Lenaghan, Carol; Lelliott, Christopher; Green, Kath; Stewart, Abigail; Hart, Kevin; Schinner, Sven; Sethi, Jaswinder K; Yeo, Giles; Brand, Martin D; Cortright, Ron N; O'Rahilly, Stephen; Montague, Carl; Vidal-Puig, Antonio J


    PGC1 alpha is a co-activator involved in adaptive thermogenesis, fatty-acid oxidation and gluconeogenesis. We describe the identification of several isoforms of a new human PGC1 alpha homologue, cloned independently and named PGC1 beta. The human PGC1 beta gene is localized to chromosome 5, has 13 exons and spans more than 78 kb. Two different 5' and 3' ends due to differential splicing were identified by rapid amplification of cDNA ends PCR and screening of human cDNA libraries. We show that PGC1 beta variants in humans, mice and rats are expressed predominantly in heart, brown adipose tissue, brain and skeletal muscle. PGC1 beta expression, unlike PGC1 alpha, is not up-regulated in brown adipose tissue in response to cold or obesity. Fasting experiments showed that PGC1 alpha, but not PGC1 beta, is induced in liver and this suggests that only PGC1 alpha is involved in the hepatic gluconeogenesis. No changes in PGC1 beta gene expression were observed associated with exercise. Human PGC1 beta-1a and -2a isoforms localized to the cell nucleus and, specifically, the isoform PGC1 beta-1a co-activated peroxisome-proliferator-activated receptor-gamma, -alpha and the thyroid hormone receptor beta1. Finally, we show that ectopic expression PGC1 beta leads to increased mitochondrial number and basal oxygen consumption. These results suggest that PGC1 beta may play a role in constitutive adrenergic-independent mitochondrial biogenesis. PMID:12678921

  13. Molecular characterization of the gene for human interleukin-1[beta] converting enzyme (IL1BC)

    SciTech Connect

    Cerretti, D.P.; Hollingsworth, L.T.; Kozlosky, C.J.; Nelson, N. ); Valentine, M.B. ); Shapiro, D.N.; Morris, S.W. Univ. of Tennessee College of Medicine, Memphis, TN )


    Interleukin-1[beta] (IL-1[beta]) mediates a wide range of immune and inflammatory responses. The active cytokine is generated by proteolytic cleavage of an inactive precursor by a protease called the IL-1[beta] converting enzyme (ICE). A cDNA encoding this protease was recently isolated. A human genomic clone containing the ICE gene (IL1BC) was isolated using the cDNA as a probe. The gene consists of 10 exons spanning at least 10.6 kb. 5[prime]-anchored polymerase chain reaction indicated a single transcription start site [approximately]33 bp upstream of the initiator Met codon. The 5[prime]-flanking region does not have an apparent TATA box but may contain an initiator (Inr) promotor element. However, transcriptional activity could not be detected with a fusion gene containing the 5[prime]-flanking region linked to the bacterial chloramphenicol acetyltransferase gene (CAT) when transfected into the human acute monocytic leukemia cell line THP-1. Using the genomic IL1BC clone, the authors have confirmed the localization of the gene to chromosome 11 band q22.2-q22.3 by fluorescence in situ hybridization. 34 refs., 2 figs., 1 tab.

  14. Analyses of alpha/beta-type gliadin genes from diploid and hexaploid wheats.


    Reeves, C D; Okita, T W


    The alpha/beta-gliadin genes isolated from both hexaploid wheat (cv. Yamhill) and the diploid A genome progenitor Triticum urartu had remarkably similar sequences and differ by only a few point mutations. Primer extension analysis indicated that the transcriptional start points for individual genes in the family cluster within a few nucleotides. Comparison of the promoter region of several alpha/beta-gliadin and B-hordein genes reveals two conserved regions at about -130 and -250 bp. DNA from the hexaploid cultivars, Cheyenne and Chinese Spring, and the diploid progenitors T. urartu and Aegilops squarrosa was analysed by Southern blotting. Restriction fragment lengths of the alpha/beta-gliadin genes varied only slightly between the various wheats, although the overall copy number varied significantly. A region between approx. -1700 and -700 bp upstream from the TATA box was highly repeated in all three wheat genomes. For the hexaploid-derived gene, over 1700 bp of sequence upstream from the TATA box was determined, revealing an additional open reading frame between approx. -1550 and -1250 bp relative to the gliadin TATA box. Northern blot analysis indicated that RNA homologous to this repeated sequence family was present only in developing seed and accumulated to a maximum at late stages of maturation. PMID:3038689

  15. Thalassaemia mutations within the 5'UTR of the human beta-globin gene disrupt transcription.


    Sgourou, Argyro; Routledge, Samantha; Antoniou, Michael; Papachatzopoulou, Adamantia; Psiouri, Lambrini; Athanassiadou, Aglaia


    The mechanisms by which mutations within the 5' untranslated region (UTR) of the human beta-globin gene (HBB) cause thalassaemia are currently not well understood. We present here the first comprehensive comparative functional analysis of four 'silent' mutations in the human beta-globin 5'UTR, namely: +10(-T), +22(G --> A), +33(C --> G) and +(40-43)(-AAAC), which are present in patients with beta-thalassaemia intermedia. Expression of these genes under the control of the beta-globin locus control region in stable transfected murine erythroleukaemia cells showed that all four mutations decreased steady state levels of mRNA to 61.6%, 68%, 85.2% and 70.6%, respectively, compared with the wildtype gene. These mutations did not interfere with either mRNA transport from the nucleus to the cytoplasm, 3' end processing or mRNA stability. Nuclear run-on experiments demonstrated that mutations +10(-T) and +33(C --> G) reduced the rate of transcription to a degree that fully accounted for the observed lower level of mRNA accumulation, suggesting a disruption of downstream promoter sequences. Interestingly, mutation +22(G --> A) decreased the rate of transcription to a low degree, indicating the existence of a mechanism that acts post-transcriptionally. Generally, our data demonstrated the significance of functionally analysing mutants of this type in the presence of a full complement of transcriptional regulatory elements within a stably integrated chromatin context in an erythroid cell environment. PMID:15009072

  16. Human and rodent MaxiK channel beta-subunit genes: cloning and characterization.


    Jiang, Z; Wallner, M; Meera, P; Toro, L


    Voltage- and Ca2+-sensitive K+ (MaxiK) channels play key roles in controlling neuronal excitability and vascular tone. We cloned and analyzed human and rodent genes for the modulatory beta subunit, KCNMB1. The human and mouse beta-subunit genes are approximately 11 and approximately 9 kb in length, respectively, and have a four exon-three intron structure. Primer extension assay localized the transcription initiation site at 442 (human) or 440 (mouse) bp upstream of the translation initiation codon, agreeing with the transcript size in Northern blots. Both genes have a TATA-less putative promoter region, with a transcription initiator-like region, and motifs characteristic of regulated promoters, including muscle-specific enhancing factors-1 and -2. Consistent with a tissue-specific expression of KCNMB1, regulated at the transcriptional level, beta-subunit transcripts are abundant in smooth muscle and heart, but scarce in lymphatic tissues, brain, and liver. Expressed rat and mouse beta subunits increase the apparent Ca2+ sensitivity of the human MaxiK channel alpha subunit. PMID:9888999

  17. Rapid Evolution of Beta-Keratin Genes Contribute to Phenotypic Differences That Distinguish Turtles and Birds from Other Reptiles

    PubMed Central

    Li, Yang I.; Kong, Lesheng; Ponting, Chris P.; Haerty, Wilfried


    Sequencing of vertebrate genomes permits changes in distinct protein families, including gene gains and losses, to be ascribed to lineage-specific phenotypes. A prominent example of this is the large-scale duplication of beta-keratin genes in the ancestors of birds, which was crucial to the subsequent evolution of their beaks, claws, and feathers. Evidence suggests that the shell of Pseudomys nelsoni contains at least 16 beta-keratins proteins, but it is unknown whether this is a complete set and whether their corresponding genes are orthologous to avian beak, claw, or feather beta-keratin genes. To address these issues and to better understand the evolution of the turtle shell at a molecular level, we surveyed the diversity of beta-keratin genes from the genome assemblies of three turtles, Chrysemys picta, Pelodiscus sinensis, and Chelonia mydas, which together represent over 160 Myr of chelonian evolution. For these three turtles, we found 200 beta-keratins, which indicate that, as for birds, a large expansion of beta-keratin genes in turtles occurred concomitantly with the evolution of a unique phenotype, namely, their plastron and carapace. Phylogenetic reconstruction of beta-keratin gene evolution suggests that separate waves of gene duplication within a single genomic location gave rise to scales, claws, and feathers in birds, and independently the scutes of the shell in turtles. PMID:23576313

  18. Assignment of the {beta}B1 crystallin gene (CRYBB1) to human chromosome 22 and mouse chromosome 5

    SciTech Connect

    Hulsebos, T.J.M.; Westerveld, A.; Gilbert, D.J.; Jenkins, N.A.; Copeland, N.G.


    By using primers complementary to the rat {beta}B1 crystallin gene sequence, we amplified exons 5 and 6 of the orthologous human gene (CRYBB1). The amplified human segments displayed greater than 88% sequence homology to the corresponding rat and bovine sequences. CRYBB1 was assigned to the group 5 region in 22q11.2-q12.1 by hybridizing the exon 6 PCR product to somatic cell hybrids containing defined portions of human chromosome 22. The exon 5 and exon 6 PCR products of CRYBB1 were used to localize, by interspecific backcross mapping, the mouse gene (Crybb1) to the central portion of chromosome 5. Three other {beta} crystallin genes ({beta}B2(-l), {beta}B3, and {beta}A4) have previously been mapped to the same regions in human and mouse. We demonstrate that the {beta}B1 and {beta}A4 crystallin genes are very closely linked in the two species. These assignments complete the mapping and identification of the human and mouse homologues of the major {beta} crystallins genes that are expressed in the bovine lens. 39 refs., 5 figs., 1 tab.

  19. Common mechanism of ampC beta-lactamase induction in enterobacteria: regulation of the cloned Enterobacter cloacae P99 beta-lactamase gene.

    PubMed Central

    Lindberg, F; Normark, S


    Expression of the chromosomal beta-lactamase from the ampC gene in inducible in both Enterobacter cloacae and Citrobacter freundii. Cloning of ampC as well as its regulatory gene, ampR, from E. cloacae P99 revealed a gene organization indentical to that of C. freundii in the corresponding region. Although almost no similarities could be found between the restriction maps of ampC and ampR in the two species, the genes cross-hybridize. Also, both ampR gene products have a size of about 31,000. The regulatory features of E. cloacae beta-lactamase induction are very similar to those in C. freundii, i.e., beta-lactamase synthesis is repressed by AmpR in the absence, and stimulated in the presence, of inducer. The AmpR function can be transcomplemented between the two species, but there are quantitative regulatory aberrations in such hybrids, in contrast to the total complementation obtained within each system. These results suggest that the mechanism of beta-lactamase induction is the same in E. cloacae, C. freundii, and other gram-negative bacteria with inducible chromosomal beta-lactamase expression. Images PMID:3027046

  20. Interindividual concordance of methylation profiles in human genes for tumor necrosis factors alpha and beta.

    PubMed Central

    Kochanek, S; Toth, M; Dehmel, A; Renz, D; Doerfler, W


    The DNA in mammalian genomes is characterized by complex patterns of DNA methylation that reflect the states of all genetic activities of that genome. The modified nucleotide 5-methyldeoxycytidine (5mdC) can affect the interactions of specific proteins with DNA sequence motifs. The most extensively studied effect of sequence-specific methylations is that of the long-term silencing of eukaryotic (mammalian) promoters. We have initiated studies on the methylation status of parts of the human genome to view patterns of DNA methylation as indicators for genetic activities. In this report, analyses using both restriction enzyme--Southern blotting and the very precise genomic sequencing technique have been done. The genes for tumor necrosis factors (TNF) alpha and beta--in particular, their 5'-upstream and promoter regions--have been investigated in DNA isolated from human lymphocytes, granulocytes, and sperm. The results are characterized by a remarkable interindividual concordance of DNA methylation in specific human cell types. The patterns are identical in the DNA from one cell type for different individuals even of different genetic origins but different in the DNA from different cell types. As an example, in the DNA from human granulocytes of 15 different individuals (ages 20-48 yr, both sexes), 5mdC residues have been localized by the genomic sequencing technique in three identical sequence positions in the 5'-upstream region and in one downstream position of the gene encoding TNF-alpha. The promoter of this gene is free of 5mdC, and TNF-alpha is expressed in human granulocytes. The TNF-beta promoter is methylated in granulocytes from 9 different individuals, and TNF-beta is not expressed. In human lymphocytes, the main source of TNF-beta, the TNF-beta promoter is free of 5mdC residues. All 5'-CG-3' sites studied in the TNF-alpha and -beta genes are methylated in DNA from human sperm. In human cell lines HL-60, Jurkat, and RPMI 1788, the extent of DNA methylation

  1. Validation of housekeeping genes in the brains of rats submitted to chronic intermittent hypoxia, a sleep apnea model.


    Julian, Guilherme Silva; de Oliveira, Renato Watanabe; Perry, Juliana Cini; Tufik, Sergio; Chagas, Jair Ribeiro


    Obstructive sleep apnea (OSA) is a syndrome characterized by intermittent nocturnal hypoxia, sleep fragmentation, hypercapnia and respiratory effort, and it has been associated with several complications, such as diabetes, hypertension and obesity. Quantitative real-time PCR has been performed in previous OSA-related studies; however, these studies were not validated using proper reference genes. We have examined the effects of chronic intermittent hypoxia (CIH), which is an experimental model mainly of cardiovascular consequences of OSA, on reference genes, including beta-actin, beta-2-microglobulin, glyceraldehyde-3-phosphate dehydrogenase, hypoxanthine guanine phosphoribosyl transferase and eukaryotic 18S rRNA, in different areas of the brain. All stability analyses were performed using the geNorm, Normfinder and BestKeeper software programs. With exception of the 18S rRNA, all of the evaluated genes were shown to be stable following CIH exposure. However, gene stability rankings were dependent on the area of the brain that was analyzed and varied according to the software that was used. This study demonstrated that CIH affects various brain structures differently. With the exception of the 18S rRNA, all of the tested genes are suitable for use as housekeeping genes in expression analyses. PMID:25289636

  2. Cloning and expression in Saccharomyces cerevisiae of a Trichoderma reesei beta-mannanase gene containing a cellulose binding domain.

    PubMed Central

    Stålbrand, H; Saloheimo, A; Vehmaanperä, J; Henrissat, B; Penttilä, M


    beta-Mannanase (endo-1,4-beta-mannanase; mannan endo-1,4-beta-mannosidase; EC catalyzes endo-wise hydrolysis of the backbone of mannan and heteromannans, including hemicellulose polysaccharides, which are among the major components of plant cell walls. The gene man1, which encodes beta-mannanase, of the filamentous fungus Trichoderma reesei was isolated from an expression library by using antiserum raised towards the earlier-purified beta-mannanase protein. The deduced beta-mannanase consists of 410 amino acids. On the basis of hydrophobic cluster analysis, the beta-mannanase was assigned to family 5 of glycosyl hydrolases (cellulase family A). The C terminus of the beta-mannanase has strong amino acid sequence similarity to the cellulose binding domains of fungal cellulases and is preceded by a serine-, threonine-, and proline-rich region. Consequently, the beta-mannanase is probably organized similarly to the T. reesei cellulases, having a catalytic core domain separated from the substrate-binding domain by an O-glycosylated linker. Active beta-mannanase was expressed and secreted by using the yeast Saccharomyces cerevisiae as the host. The results indicate that the man1 gene encodes the two beta-mannanases with different isoelectric points (pIs 4.6 and 5.4) purified earlier from T. reesei. PMID:7793911

  3. Promoter activity of the 5'-flanking regions of medaka fish soluble guanylate cyclase alpha1 and beta1 subunit genes.

    PubMed Central

    Yamamoto, Takehiro; Suzuki, Norio


    We examined the spatial expression pattern of medaka fish (Oryzias latipes) soluble guanylate cyclase alpha(1) and beta(1) subunit genes, OlGCS-alpha(1) and OlGCS-beta(1), and characterized the 5'-flanking region required for expression of both genes by introducing various promoter-luciferase fusion-gene constructs into COS-1 cells and medaka fish embryos. The OlGCS-alpha(1) and OlGCS-beta(1) gene transcripts were detected in whole brain and kidney in 7-day and 9-day embryos. Primer-extension analysis demonstrated that there were no differences among various adult organs (brain, eye, kidney, ovary and testis) in the transcription start site of the OlGCS-alpha(1) and OlGCS-beta(1) genes. Neither gene contained the functional TATA box within its 5'-flanking region, and the basal promoter activity was found between nucleotides +33 and +42 in the OlGCS-alpha(1) gene and between nucleotides +146 and +155 in the OlGCS-beta(1) gene. In the assay of medaka fish embryos, the 5'-flanking region of the OlGCS-beta(1) gene exhibited lower promoter activity than that of the OlGCS-alpha(1) gene. In the experiments on dual-luciferase fusion-gene constructs, the 5'-flanking region of the OlGCS-alpha(1) gene connected to the 5'-flanking region of the OlGCS-beta(1) gene was introduced into medaka fish embryos, and the 5'-flanking regions of both subunit genes were shown to mutually influence each other's promoter activity. PMID:11772405

  4. MHC evolution in three salmonid species: a comparison between class II alpha and beta genes.


    Gómez, Daniela; Conejeros, Pablo; Marshall, Sergio H; Consuegra, Sofia


    The genes of the major histocompatibility complex (MHC) are amongst the most variable in vertebrates and represent some of the best candidates to study processes of adaptive evolution. However, despite the number of studies available, most of the information on the structure and function of these genes come from studies in mammals and birds in which the MHC class I and II genes are tightly linked and class II alpha exhibits low variability in many cases. Teleost fishes are among the most primitive vertebrates with MHC and represent good organisms for the study of MHC evolution because their class I and class II loci are not physically linked, allowing for independent evolution of both classes of genes. We have compared the diversity and molecular mechanisms of evolution of classical MH class II alpha and class II beta loci in farm populations of three salmonid species: Oncorhynchus kisutch, Oncorhynchus mykiss and Salmo salar. We found single classical class II loci and high polymorphism at both class II alpha and beta genes in the three species. Mechanisms of evolution were common for both class II genes, with recombination and point mutation involved in generating diversity and positive selection acting on the peptide-binding residues. These results suggest that the maintenance of variability at the class IIalpha gene could be a mechanism to increase diversity in the MHC class II in salmonids in order to compensate for the expression of one single classical locus and to respond to a wider array of parasites. PMID:20521040

  5. Tissue-Specific Methylation of Human Insulin Gene and PCR Assay for Monitoring Beta Cell Death

    PubMed Central

    Husseiny, Mohamed I.; Kaye, Alexander; Zebadua, Emily; Kandeel, Fouad; Ferreri, Kevin


    The onset of metabolic dysregulation in type 1 diabetes (T1D) occurs after autoimmune destruction of the majority of pancreatic insulin-producing beta cells. We previously demonstrated that the DNA encoding the insulin gene is uniquely unmethylated in these cells and then developed a methylation-specific PCR (MSP) assay to identify circulating beta cell DNA in streptozotocin-treated mice prior to the rise in blood glucose. The current study extends to autoimmune non-obese diabetic (NOD) mice and humans, showing in NOD mice that beta cell death occurs six weeks before the rise in blood sugar and coincides with the onset of islet infiltration by immune cells, demonstrating the utility of MSP for monitoring T1D. We previously reported unique patterns of methylation of the human insulin gene, and now extend this to other human tissues. The methylation patterns of the human insulin promoter, intron 1, exon 2, and intron 2 were determined in several normal human tissues. Similar to our previous report, the human insulin promoter was unmethylated in beta cells, but methylated in all other tissues tested. In contrast, intron 1, exon 2 and intron 2 did not exhibit any tissue-specific DNA methylation pattern. Subsequently, a human MSP assay was developed based on the methylation pattern of the insulin promoter and human islet DNA was successfully detected in circulation of T1D patients after islet transplantation therapy. Signal levels of normal controls and pre-transplant samples were shown to be similar, but increased dramatically after islet transplantation. In plasma the signal declines with time but in whole blood remains elevated for at least two weeks, indicating that association of beta cell DNA with blood cells prolongs the signal. This assay provides an effective method to monitor beta cell destruction in early T1D and in islet transplantation therapy. PMID:24722187

  6. Effects of endocrine disruptors on genes associated with 17beta-estradiol metabolism and excretion.


    Hanet, Nathalie; Lancon, Allan; Delmas, Dominique; Jannin, Brigitte; Chagnon, Marie-Christine; Cherkaoui-Malki, Moustapha; Latruffe, Norbert; Artur, Yves; Heydel, Jean-Marie


    In order to provide a global analysis of the effects of endocrine disruptors on the hormone cellular bioavailability, we combined 17beta-estradiol (E2) cellular flow studies with real-time PCR and Western blot expression measurements of genes involved in the hormone metabolism and excretion. Three endocrine disruptors commonly found in food were chosen for this study, which was conducted in the estrogen receptor (ER) negative hepatoblastoma HepG2 cell line: bisphenol A (BPA), genistein (GEN) and resveratrol (RES). We showed that 24 h after a single dose treatment with genistein, resveratrol or bisphenol A, the expression of ATP-binding cassette transporters (the multidrug resistance or MDR, and the multidrug resistance associated proteins or MRP) uridine diphosphate-glucuronosyltransferases (UGT) and/or sulfotransferases (ST) involved in 17beta-estradiol elimination process were significantly modulated and that 17beta-estradiol cellular flow was modified. Resveratrol induced MDR1 and MRP3 expressions, bisphenol A induced MRP2 and MRP3 expressions, and both enhanced 17beta-estradiol efflux. Genistein, on the other hand, inhibited ST1E1 and UGT1A1 expressions, and led to 17beta-estradiol cellular retention. Thus, we demonstrate that bisphenol A, genistein and resveratrol modulate 17beta-estradiol cellular bioavailability in HepG2 and that these modulations most probably involve regulations of 17beta-estradiol phase II and III metabolism proteins. Up to now, the estrogenicity of environmental estrogenic pollutants has been based on the property of these compounds to bind to ERs. Our results obtained with ER negative cells provide strong evidence for the existence of ER-independent pathways leading to endocrine disruption. PMID:18634814

  7. Expression of Caveolin-1 reduces cellular responses to TGF-{beta}1 through down-regulating the expression of TGF-{beta} type II receptor gene in NIH3T3 fibroblast cells

    SciTech Connect

    Lee, Eun Kyung; Lee, Youn Sook; Han, In-Oc; Park, Seok Hee . E-mail:


    Transcriptional repression of Transforming Growth Factor-{beta} type II receptor (T{beta}RII) gene has been proposed to be one of the major mechanisms leading to TGF-{beta} resistance. In this study, we demonstrate that expression of Caveolin-1 (Cav-1) gene in NIH3T3 fibroblast cells down-regulates the expression of T{beta}RII gene in the transcriptional level, eventually resulting in the decreased responses to TGF-{beta}. The reduced expression of T{beta}RII gene by Cav-1 appeared to be due to the changes of the sequence-specific DNA binding proteins to either Positive Regulatory Element 1 (PRE1) or PRE2 of the T{beta}RII promoter. In addition, Cav-1 expression inhibited TGF-{beta}-mediated cellular proliferation and Plasminogen Activator Inhibitor (PAI)-1 gene expression as well as TGF-{beta}-induced luciferase activity. Furthermore, the inhibition of endogeneous Cav-1 by small interfering RNA increased the expression of T{beta}RII gene. These findings strongly suggest that expression of Cav-1 leads to the decreased cellular responsiveness to TGF-{beta} through down-regulating T{beta}RII gene expression.

  8. Increased interleukin-1beta mRNA expression in skin biopsies of horses with Culicoides hypersensitivity following challenge with Culicoides nubeculosus extract.


    Kolm, Gabriela; Knapp, Elzbieta; Wagner, Regina; Klein, Dieter


    Interleukin-1beta (IL-1beta) is a primary cytokine of the skin that has a pivotal role in keratinocyte differentiation, epidermal wound healing and host defense. Pathological increase of cutaneous IL-1beta is associated with edema formation, epidermal hyperproliferation and atopic dermatitis in humans. However, in horses the role of cutaneous IL-1beta in edema formation and allergic skin disease has not been characterised so far. Particularly in Culicoides hypersensitivity (CHS), intradermal injection of Culicoides extract may be associated with enhanced transcription of local IL-1beta. To examine the mRNA expression of IL-1beta and its receptor antagonist IL-1RA in the skin of horses, biopsy specimens of horses affected and non-affected by CHS prior and following intradermal challenge with a commercial C. nubeculosus extract were examined. Our hypothesis was that cutaneous IL-1beta mRNA was significantly upregulated in horses with CHS in response to Culicoides allergen. Biopsies were taken from sites prior to and 4 h following intradermal challenge with C. nubeculosus extract. In order to obtain reliable data, real time PCR was performed and genes of interest were normalized using three different housekeeping genes, beta-actin, GAPDH, beta-2-microglobulin. No significant difference was detected in non-challenged cutaneous IL-1beta mRNA and IL-1RA mRNA levels between CHS affected and non-affected horses. Intradermal injection of C. nubeculosus extract resulted in local upregulation of IL-1beta mRNA both in horses with typical history, characteristic clinical signs for CHS and a positive intradermal skin test (IDT), and non-affected horses with a negative IDT. However, the difference in prior and post challenged site IL-1beta mRNA levels only reached statistical significance in the affected horses (p=0.01 versus 0.7). In contrast, IL-1RA mRNA levels did not demonstrate any modification following intradermal injection with C. nubeculosus in either group. In contrast

  9. Analysis and expression of the alpha-expansin and beta-expansin gene families in maize

    NASA Technical Reports Server (NTRS)

    Wu, Y.; Meeley, R. B.; Cosgrove, D. J.


    Expansins comprise a multigene family of proteins in maize (Zea mays). We isolated and characterized 13 different maize expansin cDNAs, five of which are alpha-expansins and eight of which are beta-expansins. This paper presents an analysis of these 13 expansins, as well as an expression analysis by northern blotting with materials from young and mature maize plants. Some expansins were expressed in restricted regions, such as the beta-expansins ExpB1 (specifically expressed in maize pollen) and ExpB4 (expressed principally in young husks). Other expansins such as alpha-expansin Exp1 and beta-expansin ExpB2 were expressed in several organs. The expression of yet a third group was not detected in the selected organs and tissues. An analysis of expansin sequences from the maize expressed sequence tag collection is also presented. Our results indicate that expansin genes may have general, overlapping expression in some instances, whereas in other cases the expression may be highly specific and limited to a single organ or cell type. In contrast to the situation in Arabidopsis, beta-expansins in maize seem to be more numerous and more highly expressed than are alpha-expansins. The results support the concept that beta-expansins multiplied and evolved special functions in the grasses.

  10. Localisation of Neuregulin 1-{beta}3 to different sub-nuclear structures alters gene expression

    SciTech Connect

    Wang, Ming; Trim, Carol M.; Gullick, William J.


    Neuregulins are growth factors that signal via the ErbB3 and ErbB4 receptors. Here we show using immunohistochemistry that they are often expressed in the nucleus of a range of tumour types including soft tissue and breast. The Neuregulin 1 type I-{beta}3 (NRG1-{beta}3) isoform localises to two sub-nuclear compartments in animal cells, nucleoli and spliceosomes. We used NRG1-{beta}3 tagged with photoactivatable GFP and demonstrated that this re-localised from nucleoli to spliceosomes over 90 min. Tyrosine kinase activity was not required for retaining the NRG1-{beta}3 within the nucleus. Mutation of the lysines 14 and 16 or 15 and 16 together prevented nucleolar uptake while four positively charged residues were identified which were required for spliceosome uptake. Molecular modelling suggests that three of these may form a binding site. We showed using a kinome array that NRG1-{beta}3 and a mutant exclusively localising to spliceosomes increased phosphorylation and/or expression of the HER4 and HER2 receptors. Using a transcriptomic analysis the same two constructs induced expression of several messenger RNAs and we confirmed the increased expression at the protein level of the most highly induced, Heat Shock Protein 70B'. These results suggest that Neuregulin activates receptor signalling in spliceosomes leading to altered gene expression.

  11. Selection of suitable reference genes for expression analysis in human glioma using RT-qPCR.


    Grube, Susanne; Göttig, Tatjana; Freitag, Diana; Ewald, Christian; Kalff, Rolf; Walter, Jan


    In human glioma research, quantitative real-time reverse-transcription PCR is a frequently used tool. Considering the broad variation in the expression of candidate reference genes among tumor stages and normal brain, studies using quantitative RT-PCR require strict definition of adequate endogenous controls. This study aimed at testing a panel of nine reference genes [beta-2-microglobulin, cytochrome c-1 (CYC1), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), hydroxymethylbilane synthase, hypoxanthine guanine phosphoribosyl transferase 1, ribosomal protein L13a (RPL13A), succinate dehydrogenase, TATA-box binding protein and 14-3-3 protein zeta] to identify and validate the most suitable reference genes for expression studies in human glioma of different grades (World Health Organization grades II-IV). After analysis of the stability values calculated using geNorm, NormFinder, and BestKeeper algorithms, GAPDH, RPL13A, and CYC1 can be indicated as reference genes applicable for accurate normalization of gene expression in glioma compared with normal brain and anaplastic astrocytoma or glioblastoma alone within this experimental setting. Generally, there are no differences in expression levels and variability of candidate genes in glioma tissue compared to normal brain. But stability analyses revealed just a small number of genes suitable for normalization in each of the tumor subgroups and across these groups. Nevertheless, our data show the importance of validation of adequate reference genes prior to every study. PMID:25862007

  12. Cell and Gene Therapy for the Beta-Thalassemias: Advances and Prospects.


    Mansilla-Soto, Jorge; Riviere, Isabelle; Boulad, Farid; Sadelain, Michel


    The beta-thalassemias are inherited anemias caused by mutations that severely reduce or abolish expression of the beta-globin gene. Like sickle cell disease, a related beta-globin gene disorder, they are ideal candidates for performing a genetic correction in patient hematopoietic stem cells (HSCs). The most advanced approach utilizes complex lentiviral vectors encoding the human β-globin gene, as first reported by May et al. in 2000. Considerable progress toward the clinical implementation of this approach has been made in the past five years, based on effective CD34+ cell mobilization and improved lentiviral vector manufacturing. Four trials have been initiated in the United States and Europe. Of 16 evaluable subjects, 6 have achieved transfusion independence. One of them developed a durable clonal expansion, which regressed after several years without transformation. Although globin lentiviral vectors have so far proven to be safe, this occurrence suggests that powerful insulators with robust enhancer-blocking activity will further enhance this approach. The combined discovery of Bcl11a-mediated γ-globin gene silencing and advances in gene editing are the foundations for another gene therapy approach, which aims to reactivate fetal hemoglobin (HbF) production. Its clinical translation will hinge on the safety and efficiency of gene targeting in true HSCs and the induction of sufficient levels of HbF to achieve transfusion independence. Altogether, the progress achieved over the past 15 years bodes well for finding a genetic cure for severe globin disorders in the next decade. PMID:27021486

  13. beta 3-Adrenergic-mediated suppression of leptin gene expression in rats.


    Li, H; Matheny, M; Scarpace, P J


    To investigate the role of beta 3-adrenergic receptors in the suppression of leptin gene expression, we fasted F-344 rats to decrease leptin mRNA levels, refed the rats to stimulate leptin mRNA production, and examined the ability of the beta 3-adrenergic agonist CGP-12177 to prevent the rise in leptin mRNA levels. In the initial 2 h after CGP-12177 (0.75 mg/kg), there were significant reductions in both food consumption and leptin mRNA levels in epididymal, perirenal, and interscapular white adipose tissue. We were unable to detect leptin mRNA in interscapular brown adipose tissue (IBAT), whereas there was a significant increase in uncoupling protein mRNA levels in IBAT after CGP-12177. The suppression of leptin mRNA and food intake by CGP-12177 was confirmed in a second experiment using another rat strain, the F-344 x BN. Furthermore, refeeding after a period of fasting increased leptin mRNA, which was prevented by CGP-12177. These data indicate a role for beta 3-adrenergic-mediated regulation of leptin gene expression in nonmutant rodents and are consistent with other reports suggesting that beta 3-adrenergic agonists suppress food intake. PMID:9227448

  14. Precise nucleosome positioning in the promoter of the chicken beta A globin gene.


    Kefalas, P; Gray, F C; Allan, J


    Histone octamers were reconstituted onto 5' end-labelled DNA fragments derived from the promoter region of the chicken beta A globin gene. The location of the reconstituted histone octamer with respect to the DNA sequence of each fragment was assessed by Exonuclease III digestion of purified nucleosome monomers. By this approach we have found a strong preference for histone octamers to be positioned over nucleotides -206 to -62 relative to the gene cap site. This stretch of DNA contains all those 5' beta globin sequences which, by DNase footprinting, bind specific protein factors and incorporates three promoter consensus sequence motifs. The upstream terminal 32 base pairs of this DNA segment contains the binding sites for the erythrocyte specific G-string binding protein and transcription factor Spl and appears to be relatively weakly bound to the histone octamer. PMID:3340546

  15. Precise nucleosome positioning in the promoter of the chicken beta A globin gene.

    PubMed Central

    Kefalas, P; Gray, F C; Allan, J


    Histone octamers were reconstituted onto 5' end-labelled DNA fragments derived from the promoter region of the chicken beta A globin gene. The location of the reconstituted histone octamer with respect to the DNA sequence of each fragment was assessed by Exonuclease III digestion of purified nucleosome monomers. By this approach we have found a strong preference for histone octamers to be positioned over nucleotides -206 to -62 relative to the gene cap site. This stretch of DNA contains all those 5' beta globin sequences which, by DNase footprinting, bind specific protein factors and incorporates three promoter consensus sequence motifs. The upstream terminal 32 base pairs of this DNA segment contains the binding sites for the erythrocyte specific G-string binding protein and transcription factor Spl and appears to be relatively weakly bound to the histone octamer. Images PMID:3340546

  16. Identification of Suitable Reference Genes for Real Time Quantitative Polymerase Chain Reaction Assays on Pectoralis major Muscle in Chicken (Gallus gallus )

    PubMed Central

    Nascimento, Carlos S.; Barbosa, Leandro T.; Brito, Claudson; Fernandes, Roberta P. M.; Mann, Renata S.; Pinto, Ana Paula G.; Oliveira, Haniel C.; Dodson, Mike V.; Guimarães, Simone E. F.; Duarte, Marcio S.


    Thirteen reference genes were investigated to determine their stability to be used as a housekeeping in gene expression studies in skeletal muscle of chickens. Five different algorithms were used for ranking of reference genes and results suggested that individual rankings of the genes differed among them. The stability of the expression of reference genes were validated using samples obtained from the Pectoralis major muscle in chicken. Samples were obtained from chickens in different development periods post hatch and under different nutritional diets. For gene expression calculation the ΔΔCt approach was applied to compare relative expression of pairs of genes within each of 52 samples when normalized to mitochondrially encoded cytochrome c oxidase II (MT-CO2) target gene. Our findings showed that hydroxymethylbilane synthase (HMBS) and hypoxanthine phosphoribosyl transferase 1 (HPRT1) are the most stable reference genes while transferrin receptor (TFRC) and beta-2-microglobulin (B2M) ranked as the least stable genes in the Pectoralis major muscle of chickens. Moreover, our results revealed that HMBS and HPRT1 gene expression did not change due to dietary variations and thus it is recommended for accurate normalization of RT-qPCR data in chicken Pectoralis major muscle. PMID:26020643

  17. Identification of Suitable Reference Genes for Real Time Quantitative Polymerase Chain Reaction Assays on Pectoralis major Muscle in Chicken (Gallus gallus ).


    Nascimento, Carlos S; Barbosa, Leandro T; Brito, Claudson; Fernandes, Roberta P M; Mann, Renata S; Pinto, Ana Paula G; Oliveira, Haniel C; Dodson, Mike V; Guimarães, Simone E F; Duarte, Marcio S


    Thirteen reference genes were investigated to determine their stability to be used as a housekeeping in gene expression studies in skeletal muscle of chickens. Five different algorithms were used for ranking of reference genes and results suggested that individual rankings of the genes differed among them. The stability of the expression of reference genes were validated using samples obtained from the Pectoralis major muscle in chicken. Samples were obtained from chickens in different development periods post hatch and under different nutritional diets. For gene expression calculation the ΔΔCt approach was applied to compare relative expression of pairs of genes within each of 52 samples when normalized to mitochondrially encoded cytochrome c oxidase II (MT-CO2) target gene. Our findings showed that hydroxymethylbilane synthase (HMBS) and hypoxanthine phosphoribosyl transferase 1 (HPRT1) are the most stable reference genes while transferrin receptor (TFRC) and beta-2-microglobulin (B2M) ranked as the least stable genes in the Pectoralis major muscle of chickens. Moreover, our results revealed that HMBS and HPRT1 gene expression did not change due to dietary variations and thus it is recommended for accurate normalization of RT-qPCR data in chicken Pectoralis major muscle. PMID:26020643

  18. Involvement of the RAR{beta}1 and dlk genes in small cell lung carcinogenesis and in human development

    SciTech Connect

    Toulouse, A.; Pelletier, M.; Morin, J.


    Lung cancer is the most lethal malignant disease in western societies. It encompasses four major histological types: squamous carcinoma, adenocarcinoma, and large cell carcinoma (known together as non-small-cell lung cancers) and a fourth type which is small cell carcinoma. This last histological class is a particularly aggressive malignant disease; it is characterized by an early development of metastasis so that upon time of diagnosis these are already widespread throughout the body. Our group is interested in defining and understanding the role of the retinoic acid receptor {beta}(RAR{beta}) gene in human lung cancer. This gene encodes nuclear transcription factors which are part of the thyroid and steroid hormone receptor superfamily. Four isoforms are known in mouse, which are generated by alternative splicing from two promoters, P{sub 1} (isoforms {beta}1 and {beta}3) and P{sub 2} (isoforms {beta}2 and {beta}4). In human only the isoforms {beta}2 (a tumor suppressor gene) and {beta}4 were known until recently when our group cloned the sequences encoding the 5{prime} end of the mRNA for RAR{beta}1. Expression studies have shown that this isoform is expressed during development in almost all tissues tested and that it is also expressed in a particular subset of human small cell carcinoma lines. It is not expressed in any adult tissue examined so far. Recently, Laborda et al. have cloned a human gene (dlk for delta-like) similar to the drosophila neurogenic gene Delta. We have found striking similarities in the expression pattern of dlk and RAR{beta}1 since the two genes are coexpressed in all fetal tissues examined and are also coexpressed in virtually identical subsets of SCLC lines. These results have implications for human embryogenesis and tumorigenesis.

  19. A self-excising beta-recombinase/six cassette for repetitive gene deletion and homokaryon purification in Neurospora crassa

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In a previous study we developed a cassette employing a bacterial beta-recombinase acting on six recognition sequences (beta-rec/six), which allowed repetitive site-specific gene deletion and marker recycling in Neurospora crassa. However, only one positive selection marker was used in the cassette...

  20. Characterization of the human beta4 nAChR gene and polymorphisms in CHRNA3 and CHRNB4.


    Lev-Lehman, E; Bercovich, D; Xu, W; Stockton, D W; Beaudet, A L


    Most neuronal nicotinic acetylcholine receptors are heteropentamers, composed of alpha and beta subunits. Mice lacking the alpha3 subunit and mice lacking both the beta2 and beta4 subunits, but not mice lacking the beta2 or beta4 subunits alone, have a severe phenotype characterized by megacystis, failure of bladder strips to contract in response to nicotine, widely dilated ocular pupils, growth failure, and perinatal mortality. The deficit in bladder contraction was also found in mice lacking only the beta4 subunit, although they did not develop megacystis. The major bladder phenotype resembles the human autosomal recessive disorder of megacystis-microcolon-hypoperistalsis syndrome (MMIHS). Based on the similarity of the mouse and human phenotypes, we initiated mutation analyses in the alpha3 and beta4 genes in MMIHS families. The human gene encoding the beta4 subunit was fully characterized, including refinement of its mapping. Analysis of disease families and controls identified numerous genetic variants, including high-frequency polymorphisms in both CHRNA3 and CHRNB4. Although no loss-of-function mutations have been identified to date, these genes remain strong candidates for involvement in MMIHS, because various mutations might be obscured within the complex cluster of genes. Some of the markers presented here are valuable tools for analysis of the role of genetic variation in responses to nicotine and for characterization of various dysautonomic abnormalities. PMID:11450844

  1. beta. amyloid gene duplication in Alzheimer's disease and karyotypically normal Down syndrome

    SciTech Connect

    Delabar, J.; Goldgaber, D.; Lamour, Y.; Nicole, A.; Huret, J.; De Groucy, J.; Brown, P.; Gajdusek, D.C.; Sinet, P.


    With the recently cloned complementary DNA probe, lambdaAm4 for the chromosome 21 gene encoding brain amyloid polypeptide (..beta.. amyloid protein) of Alzheimer's disease, leukocyte DNA from three patients with sporadic Alzheimer's disease and two patients with karyotypically normal Down syndrome was found to contain three copies of this bene. Because a small region of chromosome 21 containing the ets-2 gene is duplicated in patients with Alzheimer's disease, as well as in karyotypically normal Down syndrome, duplication of a subsection of the critical segment of chromosome 21 that is duplicated in Down syndrome may be the genetic defect in Alzeimer's disease.

  2. Targets for dioxin: Genes for plasminogen activator inhibitor-2 and interleukin-1. beta

    SciTech Connect

    Sutter, T.R.; Guzman, K.; Dold, K.M. ); Greenlee, W.F. )


    Dioxin (2,3,7,8-tetrachlorodibenzo-p-dioxin, TCDD), a widespread environmental contaminant, may elicit its effects by altering gene expression in susceptible cells. Five TCDD-responsive complementary DNA clones were isolated from a human keratinocyte cell line. One of these clones encodes plasminogen activator inhibitor-2, a factor that influences growth and differentiation by regulating proteolysis of the extracellular matrix. Another encodes the cytokine interleukin-1{beta}. Thus, TCDD alters the expression of growth regulator genes and has effects similar to those of other tumor-promoting agents that affect both inflammation and differentiation.

  3. Cloning of the {beta}3 chain gene (LAMB3) of human laminin 5, a candidate gene in junctional epidermolysis bullosa

    SciTech Connect

    Pulkkinen, L.; Christiano, A.M.; Uitto, J.


    Laminin 5 consists of three polypeptides, {alpha}3, {beta}3, and {gamma}2, encoded by the genes LAMA3, LAMB3, and LAMC2, respectively. In this study, we have elucidated the exon-intron organization of the human LAMB3 gene. Characterization of five overlapping {lambda} phage DNA clones revealed that the gene was approximately 29 kb in size. Subsequent sequence data revealed that the gene consisted of 23 exons that varied from 64 to 379 bp in size, accounting for the full-length cDNA with an open reading frame of 3516 hp encoding 1172 amino acids. Comparison of the LAMB3 gene structure with the previously characterized LAMB1 gene revealed that LAMB3 was considerably more compact. Knowledge of the exon-intron organization of the LAMB3 gene will facilitate elucidation of mutations in patients with the junctional forms of epidermolysis bullosa, some of which have been associated with mutations in the laminin 5 genes. 33 refs., 3 figs., 2 tabs.

  4. Cloning of the beta 3 chain gene (LAMB3) of human laminin 5, a candidate gene in junctional epidermolysis bullosa.


    Pulkkinen, L; Gerecke, D R; Christiano, A M; Wagman, D W; Burgeson, R E; Uitto, J


    Laminin 5 consists of three polypeptides, alpha 3, beta 3, and gamma 2, encoded by the genes LAMA3, LAMB3, and LAMC2, respectively. In this study, we have elucidated the exon-intron organization of the human LAMB3 gene. Characterization of five overlapping lambda phage DNA clones revealed that the gene was approximately 29 kb in size. Subsequent sequence data revealed that the gene consisted of 23 exons that varied from 64 to 379 bp in size, accounting for the full-length cDNA with an open reading frame of 3516 bp encoding 1172 amino acids. Comparison of the LAMB3 gene structure with the previously characterized LAMB1 gene revealed that LAMB3 was considerably more compact. Knowledge of the exon-intron organization of the LAMB3 gene will facilitate elucidation of mutations in patients with the junctional forms of epidermolysis bullosa, some of which have been associated with mutations in the laminin 5 genes. PMID:7774918

  5. Thyrotropin releasing hormone (TRH) affects gene expression in pancreatic beta-cells.


    Luo, LuGuang; Yano, Naohiro


    Thyrotropin-releasing hormone (TRH), originally identified as a hypothalamic hormone, is expressed in the pancreas. The peptide has been shown to control glycemia, although the role of TRH in the pancreas has not yet been clarified. In quiescent INS-1 cells (rat immortalized beta-cell line), 200 nM of TRH for 24 hours significantly increased insulin levels in the culture medium and in cell extracts. In studies with gene array technology where about 60% to 75% of the 1081 genes were detected, TRH significantly stimulated multiple groups of gene expressions, including G-protein-coupled receptor and related signaling, such as insulin secretion, endoplasmic reticulum traffic mechanisms, cell-cycle regulators, protein turnover factors, DNA recombination, and growth factors. Noticeably, TRH suppressed the genes of proapoptotic Bcl-2-associated protein X, Bcl-xL/ Bcl-2-associated death promoter, and Fas. The multiple gene expressions in response to TRH in pancreatic cells suggest that the changed microenvironment brought about by TRH may influence beta-cellfunction. PMID:16392621

  6. Sickle cell disorder, beta-globin gene cluster haplotypes and alpha-thalassemia in neonates and adults from Guadeloupe.


    Kéclard, L; Romana, M; Lavocat, E; Saint-Martin, C; Berchel, C; Mérault, G


    We have studied haplotype of beta(S) chromosome and alpha-globin gene status in 534 patients (255 adults and 279 children of whom 159 neonates) from Guadeloupe with various sickle cell-related conditions, namely SS (n = 298), SC (n = 170), S-beta-thal (n = 56), and other rare forms (n = 10). Haplotype data on beta(S) chromosomes confirm our previous observation that Benin type is the most prevalent (75%) beta(S) chromosome in Guadeloupe, in disagreement with the historical records. Comparison of the frequency of distribution of various beta(S) haplotypes between neonates and adults on the one hand and between SS and SC cases on the other shows that the current beta(S) haplotype distribution in this island is not distorted by haplotype-related differential survival. We also show that the frequency of alpha-thalassemia (-3.7 kb) in Guadeloupe is one of the highest recorded in this region involved in Atlantic slave trade and also failed to reveal any age-dependent increase in frequency. We conclude that the African component of Guadeloupe is distinct from that of Brazil and Cuba but is close to that of Jamaica. PMID:9136913

  7. Identification of cellular target genes of the Epstein-Barr virus transactivator Zta: activation of transforming growth factor beta igh3 (TGF-beta igh3) and TGF-beta 1.

    PubMed Central

    Cayrol, C; Flemington, E K


    The lytic switch transactivator Zta initiates the ordered cascade of Epstein-Barr virus gene expression that culminates in virus production. Zta is a sequence-specific DNA-binding protein that transactivates early viral promotes via cis-acting sequences. Activation of some of these genes is mediated through binding to consensus AP-1 promoter elements. This observation suggests that Zta may also regulate the expression of cellular genes. While many targets of Zta have been identified in the Epstein-Barr virus genome, putative host cell targets remain largely unknown. To address this issue, a tetracycline-regulated Zta expression system was generated, and differential hybridization screening was used to isolate Zta-responsive cellular genes. The major target identified by this analysis is a gene encoding a fasciclin-like secreted factor, transforming growth factor beta igh3 (TGF-beta igh3), that was originally identified as a gene that is responsive to the potent immunosuppressor TGF-beta 1. Northern (RNA) blot analysis demonstrated that induction of Zta expression results in a 10-fold increase in TGF-beta igh3 mRNA levels. Zta was also found to increase TGF-beta 1 mRNA levels as well as the amount of active TGF-beta 1 secreted into the medium. Interestingly, alpha 1-collagen IV, which has been shown to potentiate the effects of TGF-beta 1, is also a cellular target of Zta. These results suggest that Zta could play a role in modulating the host cell environment through activating the expression of secreted factors. PMID:7769680

  8. Comparative characterization of the cephamycinase blaCMY-1 gene and its relationship with other beta-lactamase genes.

    PubMed Central

    Bauernfeind, A; Stemplinger, I; Jungwirth, R; Wilhelm, R; Chong, Y


    A plasmidic beta-lactamase which hydrolyzed cephamycins was first detected and reported in 1989. At that time its description was restricted to phenotypic characteristics. We analyzed nucleotide sequence of its gene and explored it genetic relationship with other bla genes. The deduced amino acid sequence of the blaCMY-1 product was compared with those of other known plasmidic cephamycinases and of chromosomal AmpC beta-lactamases. The results indicate that the relationship of CMY-1 is closest to MOX-1 among the plasmidic cephamycinases and to AmpC of Pseudomonas aeruginosa among the chromosomal cephalosporinases. We conclude that the plasmidic cephamycinases described up to now may be classified into three families, as follows: CMY-1, MOX-1, and FOX-1 with AmpC of P. aeruginosa; CMY-2, BIL-1 and LAT-1 with AmpC of Citrobacter freundii; and MIR-1 with AmpC of Enterobacter cloacae. Plasmidic cephamycinases are now recognized as clinically relevant class C beta-lactamases. PMID:8843306

  9. Polymorphic variation in the 11beta-hydroxylase gene associates with reduced 11-hydroxylase efficiency.


    Barr, Marianne; MacKenzie, Scott M; Friel, Elaine C; Holloway, Christine D; Wilkinson, Donna M; Brain, Nick J R; Ingram, Mary C; Fraser, Robert; Brown, Morris; Samani, Nilesh J; Caulfield, Mark; Munroe, Patricia B; Farrall, Martin; Webster, John; Clayton, David; Dominiczak, Anna F; Connell, John M C; Davies, Eleanor


    The -344 C/T and intron 2 conversion variants in the CYP11B2 gene, encoding aldosterone synthase, have been associated with markers of impaired 11beta-hydroxylase activity. We hypothesize that this association is because of variations in the adjacent 11beta-hydroxylase gene (CYP11B1) and arises through linkage disequilibrium between CYP11B1 and CYP11B2. The pattern of variation across the entire CYP11B locus was determined by sequencing 26 normotensive subjects stratified by and homozygous for the -344 and intron conversion variants. Eighty-three variants associated with -344 and intron conversion were identified. Haplotype analysis revealed 4 common haplotypes, accounting for 68% of chromosomes, confirming strong linkage disequilibrium across the region. Two novel CYP11B1 polymorphisms upstream of the coding region (-1889 G/T and -1859 A/G) were identified as contributing to the common haplotypes. Given the potential for such mutations to affect transcriptional regulation of CYP11B1, these were analyzed further. A total of 512 hypertensive subjects from the British Genetics of Hypertension Study population were genotyped for these polymorphisms. A significant association was identified between the -1889 polymorphism and urinary tetrahydrodeoxycortisol/total cortisol metabolite ratio, indicating reduced 11beta-hydroxylase efficiency. A similar pattern was observed for the -1859 polymorphism, but this did not achieve statistical significance. Functional studies in vitro using luciferase reporter gene constructs show that these polymorphisms significantly alter the transcriptional response of CYP11B1 to stimulation by adrenocorticotropic hormone or forskolin. This study strongly suggests that the impaired 11beta-hydroxylase efficiency associated previously with the CYP11B2 -344 and intron conversion variants is because of linkage with these newly identified polymorphisms in CYP11B1. PMID:17075029

  10. Rejection of cardiac allografts by T cells expressing a restricted repertoire of T-cell receptor V beta genes.

    PubMed Central

    Shirwan, H; Barwari, L; Cramer, D V


    We have recently shown that T cells infiltrating cardiac allografts early in graft rejection use a limited T-cell receptor (TCR) V beta repertoire. In this study we tested whether this limited repertoire of V beta genes is important for graft rejection. A cell line, AL2-L3, was established from LEW lymphocytes infiltrating ACI heart allografts 2 days after transplantation. This cell line is composed of CD4+ T cells that primarily recognize the class II RTI.B major histocompatibility complex (MHC) molecule expressed by the donor graft. This cell line precipitated acute rejection of donor hearts with a median survival time (MST) of 10.5 days following adoptive transfer to sublethally irradiated LEW recipients. This rate of graft rejection was significantly (P < 0.0007) accelerated when compared with a MST of 60 days for allografts in irradiated control recipients. The AL2-L3-mediated acceleration of graft rejection was donor specific as WF third-party heart allografts were rejected with a delayed tempo (MST = 28.5 days). The V beta repertoire of this cell line was primarily restricted to the expression of V beta 4, 15 and 19 genes. The nucleotide sequence analysis of the beta-chain cDNAs from this cell line demonstrated that the restricted use of the V gene repertoire was not shared with the N, D and J regions. A wide variety of CDR3 loops and J beta genes were used in association with selected V beta genes. These data provide evidence for the role a restricted repertoire of V beta genes plays in cardiac allograft rejection in this model. The restricted usage of the V beta repertoire in an early T-cell response to allografts may provide the opportunity to therapeutically disrupt the rejection reaction by targeting selected T-cell populations for elimination at the time of organ transplantation. Images Figure 2 PMID:9176111

  11. Selection of reference genes for gene expression studies in pig tissues using SYBR green qPCR

    PubMed Central

    Nygard, Ann-Britt; Jørgensen, Claus B; Cirera, Susanna; Fredholm, Merete


    Background Real-time quantitative PCR (qPCR) is a method for rapid and reliable quantification of mRNA transcription. Internal standards such as reference genes are used to normalise mRNA levels between different samples for an exact comparison of mRNA transcription level. Selection of high quality reference genes is of crucial importance for the interpretation of data generated by real-time qPCR. Results In this study nine commonly used reference genes were investigated in 17 different pig tissues using real-time qPCR with SYBR green. The genes included beta-actin (ACTB), beta-2-microglobulin (B2M), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), hydroxymethylbilane synthase (HMBS), hypoxanthine phosphoribosyltransferase 1 (HPRT1), ribosomal protein L4 (RPL4), succinate dehydrogenase complex subunit A (SDHA), TATA box binding protein (TPB)and tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta polypeptide (YWHAZ). The stability of these reference genes in different pig tissues was investigated using the geNorm application. The range of expression stability in the genes analysed was (from the most stable to the least stable): ACTB/RPL4, TBP, HPRT, HMBS, YWHAZ, SDHA, B2M and GAPDH. Conclusion Expression stability varies greatly between genes. ACTB, RPL4, TPB and HPRT1 were found to have the highest stability across tissues. Based on both expression stability and expression level, our data suggest that ACTB and RPL4 are good reference genes for high abundant transcripts while TPB and HPRT1 are good reference genes for low abundant transcripts in expression studies across different pig tissues. PMID:17697375

  12. [The association between beta-adrenergic receptor gene polymorphisms and personality traits].


    Numajiri, Maki; Aoki, Jun; Nishizawa, Daisuke; Kasai, Shinya; Ogai, Yasukazu; Ikeda, Kazutaka; Iwahashi, Kazuhiko


    The relationship between the polymorphisms (SNPs) of the beta-adrenergic receptor (beta-AR) gene and personality assessed by TCI (Temperament and Character Inventory), was studied among 192 healthy Japanese subjects (121 male subjects and 71 female subjects). In this study, the statistical analyses were performed overall and separately for each sex. As a result, it was shown that there were significant relationships between SD (self-directedness) and 49Ser/Gly (rs1801252) in ADRB1, P (persistence) and 389Arg/Gly (rs1801253) in ADRB1, and ST (self-transcendence) and 27Gln/Glu (rs1042714) in ADRB2 overall. Among the male subjects, there were further significant relationships between ST and 49Ser/Gly in ADRB1, NS (novelty-seeking), HA (harm avoidance) and P and 389Arg/Gly in ADRB1, and P and 64Arg/Trp(rsrs4994) in ADRB3. Among the female subjects, there were also significant relationships between SD and 49Ser/Gly in ADRB1, and C (cooperativeness) and 389Arg/Gly in ADRB1. Thus it was shown that there were correlations between beta-AR gene polymorphisms and several subscales of TCI. PMID:23012891

  13. Ocular gene transfer of active TGF-beta induces changes in anterior segment morphology and elevated IOP in rats.


    Robertson, Jennifer V; Golesic, Elizabeth; Gauldie, Jack; West-Mays, Judith A


    Purpose. Transforming growth factor beta (TGF-beta) is known to play a crucial role in wound healing and fibrotic tissue remodeling. A large body of evidence suggests a role for this cytokine in the pathogenesis of glaucoma; however, the mechanisms by which it affects anterior segment morphology are not well understood. Therefore, the purpose of this study was to examine the effects of TGF-beta overexpression on anterior segment morphology and subsequent effects on intraocular pressure. Methods. Adenoviral gene transfer was used to deliver active TGF-beta1 to the rat eye. Measurements of intraocular pressure were taken with a tonometer on days 0, 14, 21, and 29. Histologic analysis was undertaken to examine anterior segment morphology, and markers of matrix deposition and fibrosis were used. Results. Gene transfer of TGF-beta in the anterior segment resulted in the formation of peripheral anterior synechiae (PAS), which consisted of a fibroproliferative region of corneal endothelial cells, matrix accumulation, and decrease in trabecular meshwork expression of alpha-smooth muscle actin. These features were accompanied by ocular hypertension. Conclusions. Gene transfer of TGF-beta into the anterior segment induces aberrant PAS associated with the transition of corneal endothelial cells and subsequent matrix deposition. These features are highly reminiscent of human iridocorneal endothelial (ICE) syndrome. Gene transfer of TGF-beta can, therefore, be used to induce anatomic changes in the anterior segment in a rodent model that result in ocular hypertension. PMID:19696167

  14. Insect and wound induced GUS gene expression from a Beta vulgaris proteinase inhibitor gene promoter

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Inducible gene promoters that are specifically activated by pathogen invasion or insect pest attack are needed for effective expression of resistance genes to control plant diseases. In the present study, a promoter from a serine proteinase inhibitor gene (BvSTI) shown to be up-regulated in resist...

  15. A Putatively Functional Haplotype in the Gene Encoding Transforming Growth Factor Beta-1 as a Potential Biomarker for Radiosensitivity

    SciTech Connect

    Schirmer, Markus A.; Brockmoeller, Juergen; Rave-Fraenk, Margret; Virsik, Patricia; Wilken, Barbara; Kuehnle, Elna; Campean, Radu; Hoffmann, Arne O.; Mueller, Katarina; Goetze, Robert G.; Neumann, Michael; Janke, Joerg H.; Nasser, Fatima; Wolff, Hendrik A.; Ghadimi, B. Michael; Schmidberger, Heinz; Hess, Clemens F.; Christiansen, Hans; Hille, Andrea


    Purpose: To determine whether genetic variability in TGFB1 is related to circulating transforming growth factor-{beta}1 (TGF-{beta}1) plasma concentrations after radiotherapy and to radiosensitivity of lymphoid cells. Patients and Methods: Transforming growth factor-{beta}1 plasma concentrations (n = 79) were measured in patients 1 year after radiotherapy and chromosomal aberrations (n = 71) ex vivo before therapy start. Furthermore, TGF-{beta}1 secretion and apoptosis were measured in isolated peripheral blood mononuclear cells of 55 healthy volunteers. These phenotypes were analyzed in relation to five germline polymorphisms in the 5' region of the TGFB1 gene. Because of high linkage disequilibrium, these five polymorphisms reflect frequent genetic variation in this region. A presumed impact of TGF-{beta}1 on DNA damage or repair was measured as micronucleus formation in 30 lymphoblastoid cell lines. Results: We identified a hypofunctional genetic haplotype termed H3 tagging the 5' region of the TGFB1 gene encoding TGF-{beta}1. H3 was associated with lower TGF-{beta}1 plasma concentrations in patients (p = 0.01) and reduced TGF-{beta}1 secretion in irradiated peripheral blood mononuclear cells (p = 0.003). Furthermore, cells with H3 were less prone to induction of chromosomal aberrations (p = 0.001) and apoptosis (p = 0.003) by irradiation. The hypothesis that high TGF-{beta}1 could sensitize cells to DNA damage was further supported by increased micronuclei formation in 30 lymphoblastoid cell lines when preincubated with TGF-{beta}1 before irradiation (p = 0.04). Conclusions: On the basis of TGF-{beta}1 plasma levels and radiation sensitivity of lymphoid cells, this study revealed a putatively hypofunctional TGFB1 haplotype. The significance of this haplotype and the suggested link between TGF-{beta}1 function and DNA integrity should be further explored in other cell types, as well as other experimental and clinical conditions.

  16. Cap disease due to mutation of the beta-tropomyosin gene (TPM2).


    Clarke, Nigel F; Domazetovska, Ana; Waddell, Leigh; Kornberg, Andrew; McLean, Catriona; North, Kathryn N


    Cap disease or cap myopathy is a form of congenital myopathy in which peripheral, well-demarcated 'caps' of disorganised thin filaments are seen in muscle fibres. Mutation of the TPM2 gene, that encodes beta-tropomyosin, is the first reported genetic cause. In this paper, we describe a further case of cap disease due to a mutation in TPM2, confirming the importance of this genetic association. This is the first report of cardiac dysfunction due to a mutation in TPM2. Our patient has an identical TPM2 mutation to the first genetically diagnosed cap disease patient, a denovo heterozygous three base pair deletion that removes glutamic acid 139 from the centre of beta-tropomyosin (p.E139del). 2D-gel electrophoresis studies show that the shortened mutant protein incorporates into sarcomeric structures, where it likely imposes a dominant-negative effect to cause muscle weakness. PMID:19345583

  17. A pseudodeficiency allele (D152N) of the human {beta}-glucuronidase gene

    SciTech Connect

    Vervoort, R.; Liebaers, I.; Lissens, W.


    We present evidence that a 480G{r_arrow}A transition in the coding region of the {Beta}glucuronidase gene, which results in an aspartic-acid-to-asparagine substitution at amino acid position 152 (D152N), produces a pseudodeficiency allele (GUSBp) that leads to greatly reduced levels of {Beta}-glucuronidase activity without apparent deleterious consequences. The 48OG{r_arrow}A mutation was found initially in the pseudodeficient mother of a child with mucopolysaccharidosis VII (MPSVII), but it was not on her disease-causing allele, which carried the L176F mutation. The 480G{r_arrow}A change was also present in an unrelated individual with another MPSVII allele who had unusually low {Beta}-glucuronidase activity, but whose clinical symptoms were probably unrelated to {Beta}-glucuronidase deficiency. This individual also had an R357X mutation, probably on his second allele. We screened 100 unrelated normal individuals for the 480G{r_arrow}A mutation with a PCR method and detected one carrier. Reduced {Beta}-glucuronidase activity following transfection of COS cells with the D152N cDNA supported the causal relationship between the D152N allele and pseudodeficiency. The mutation reduced the fraction of expressed enzyme that was secreted. Pulse-chase experiments indicated that the reduced activity in COS cells was due to accelerated intracellular turnover of the D152N enzyme. They also suggested that a potential glycosylation site created by the mutation is utilized in {approximately}50% of the enzyme expressed. 25 refs., 3 figs., 3 tabs.

  18. A second gene for cerulean cataracts maps to the {beta} crystallin region on chromosome 22

    SciTech Connect

    Kramer, P.; Yount, J.; Lovrien, E.


    Cogenital cataracts are one of the most common major eye abnormalities and often lead to blindness in infants. At least a third of all cases are familial. Within this group, highly penetrant, autosomal dominant forms of congenital cataracts (ADCC) are most common. ADCC is a genetically heterogeneous group of disorders, in which at least eight different loci have been identified for nine clinically distinct forms. Among these, Armitage et al. mapped a gene for cerulean blue cataracts to chromosome 17q24. Bodker et al. described a large family with cerulean blue cataracts, in which the affected daughter of affected first cousins was presumed to be homozygous for the purported gene. We report linkage in this family to the region on chromosome 22q that includes two {beta} crystallin genes (CRYBB2, CRYBB3) and one pseudogene (CRYBB2P1). The affected female in question is homozygous at all markers. 25 refs., 1 fig., 1 tab.

  19. Thyroid hormone resistance: a novel mutation in thyroid hormone receptor beta (THRB) gene - case report.


    Işık, Emregül; Beck Peccoz, Paolo; Campi, Irene; Özön, Alev; Alikaşifoğlu, Ayfer; Gönç, Nazlı; Kandemir, Nurgün


    Thyroid hormone resistance (THR) is a dominantly inherited syndrome characterized by reduced sensitivity to thyroid hormones. It is usually caused by mutations in the thyroid hormone receptor beta (THRB) gene. In the present report, we describe the clinical and laboratory characteristics and genetic analysis of patients with a novel THRB gene mutation. The index patient had been misdiagnosed as hyperthyroidism and treated with antithyroid drugs since eight days of age. Thyroid hormone results showed that thyrotropin (thyroid-stimulating hormone, TSH) was never suppressed despite elevated thyroid hormone levels, and there was no symptom suggesting hyperthyroidism. A heterozygous mutation at codon 350 located in exon 9 of the THRB gene was detected in all the affected members of the family. It is important to consider thyroid hormone levels in association with TSH levels to prevent inappropriate treatment and the potential complications, such as clinical hypothyroidism or an increase in goiter size. PMID:24217081

  20. Two common single nucleotide polymorphisms in the gene encoding beta-carotene 15,15'-monoxygenase alter beta-carotene metabolism in female volunteers.


    Leung, W C; Hessel, S; Méplan, C; Flint, J; Oberhauser, V; Tourniaire, F; Hesketh, J E; von Lintig, J; Lietz, G


    The key enzyme responsible for beta-carotene conversion into retinal is beta-carotene 15,15'-monoxygenase (BCMO1). Since it has been reported that the conversion of beta-carotene into vitamin A is highly variable in up to 45% of healthy individuals, we hypothesized that genetic polymorphisms in the BCMO1 gene could contribute to the occurrence of the poor converter phenotype. Here we describe the screening of the total open reading frame of the BCMO1 coding region that led to the identification of two common nonsynonymous single nucleotide polymorphisms (R267S: rs12934922; A379V: rs7501331) with variant allele frequencies of 42 and 24%, respectively. In vitro biochemical characterization of the recombinant 267S + 379V double mutant revealed a reduced catalytic activity of BCMO1 by 57% (P<0.001). Assessment of the responsiveness to a pharmacological dose of beta-carotene in female volunteers confirmed that carriers of both the 379V and 267S + 379V variant alleles had a reduced ability to convert beta-carotene, as indicated through reduced retinyl palmitate:beta-carotene ratios in the triglyceride-rich lipoprotein fraction [-32% (P=0.005) and -69% (P=0.001), respectively] and increased fasting beta-carotene concentrations [+160% (P=0.025) and +240% (P=0.041), respectively]. Our data show that there is genetic variability in beta-carotene metabolism and may provide an explanation for the molecular basis of the poor converter phenotype within the population. PMID:19103647

  1. Generation of a high-titer retroviral vector capable of expressing high levels of the human beta-globin gene.

    PubMed Central

    Sadelain, M; Wang, C H; Antoniou, M; Grosveld, F; Mulligan, R C


    Retrovirus-mediated gene transfer into hematopoietic cells may provide a means of treating both inherited and acquired diseases involving hematopoietic cells. Implementation of this approach for disorders resulting from mutations affecting the beta-globin gene (e.g., beta-thalassemia and sickle cell anemia), however, has been hampered by the inability to generate recombinant viruses able to efficiently and faithfully transmit the necessary sequences for appropriate gene expression. We have addressed this problem by carefully examining the interactions between retroviral and beta-globin gene sequences which affect vector transmission, stability, and expression. First, we examined the transmission properties of a large number of different recombinant proviral genomes which vary both in the precise nature of vector, beta-globin structural gene, and locus control region (LCR) core sequences incorporated and in the placement and orientation of those sequences. Through this analysis, we identified one specific vector, termed M beta 6L, which carries both the human beta-globin gene and core elements HS2, HS3, and HS4 from the LCR and faithfully transmits recombinant proviral sequences to cells with titers greater than 10(6) per ml. Populations of murine erythroleukemia (MEL) cells transduced by this virus expressed levels of human beta-globin transcript which, on a per gene copy basis, were 78% of the levels detected in an MEL-derived cell line, Hu11, which carries human chromosome 11, the site of the beta-globin locus. Analysis of individual transduced MEL cell clones, however, indicated that, while expression was detected in every clone tested (n = 17), the levels of human beta-globin treatment varied between 4% and 146% of the levels in Hu11. This clonal variation in expression levels suggests that small beta-globin LCR sequences may not provide for as strict chromosomal position-independent expression of beta-globin as previously suspected, at least in the context of

  2. Specific Silencing of the REST Target Genes in Insulin-Secreting Cells Uncovers Their Participation in Beta Cell Survival

    PubMed Central

    Gesina, Emilie; Caille, Dorothee; Gjinovci, Asllan; Waeber, Gerard; Meda, Paolo; Haefliger, Jacques-Antoine


    The absence of the transcriptional repressor RE-1 Silencing Transcription Factor (REST) in insulin-secreting beta cells is a major cue for the specific expression of a large number of genes. These REST target genes were largely ascribed to a function of neurotransmission in a neuronal context, whereas their role in pancreatic beta cells has been poorly explored. To identify their functional significance, we have generated transgenic mice expressing REST in beta cells (RIP-REST mice), and previously discovered that REST target genes are essential to insulin exocytosis. Herein we characterized a novel line of RIP-REST mice featuring diabetes. In diabetic RIP-REST mice, high levels of REST were associated with postnatal beta cell apoptosis, which resulted in gradual beta cell loss and sustained hyperglycemia in adults. Moreover, adenoviral REST transduction in INS-1E cells led to increased cell death under control conditions, and sensitized cells to death induced by cytokines. Screening for REST target genes identified several anti-apoptotic genes bearing the binding motif RE-1 that were downregulated upon REST expression in INS-1E cells, including Gjd2, Mapk8ip1, Irs2, Ptprn, and Cdk5r2. Decreased levels of Cdk5r2 in beta cells of RIP-REST mice further confirmed that it is controlled by REST, in vivo. Using siRNA-mediated knock-down in INS-1E cells, we showed that Cdk5r2 protects beta cells against cytokines and palmitate-induced apoptosis. Together, these data document that a set of REST target genes, including Cdk5r2, is important for beta cell survival. PMID:23029270

  3. Specific silencing of the REST target genes in insulin-secreting cells uncovers their participation in beta cell survival.


    Martin, David; Allagnat, Florent; Gesina, Emilie; Caille, Dorothee; Gjinovci, Asllan; Waeber, Gerard; Meda, Paolo; Haefliger, Jacques-Antoine


    The absence of the transcriptional repressor RE-1 Silencing Transcription Factor (REST) in insulin-secreting beta cells is a major cue for the specific expression of a large number of genes. These REST target genes were largely ascribed to a function of neurotransmission in a neuronal context, whereas their role in pancreatic beta cells has been poorly explored. To identify their functional significance, we have generated transgenic mice expressing REST in beta cells (RIP-REST mice), and previously discovered that REST target genes are essential to insulin exocytosis. Herein we characterized a novel line of RIP-REST mice featuring diabetes. In diabetic RIP-REST mice, high levels of REST were associated with postnatal beta cell apoptosis, which resulted in gradual beta cell loss and sustained hyperglycemia in adults. Moreover, adenoviral REST transduction in INS-1E cells led to increased cell death under control conditions, and sensitized cells to death induced by cytokines. Screening for REST target genes identified several anti-apoptotic genes bearing the binding motif RE-1 that were downregulated upon REST expression in INS-1E cells, including Gjd2, Mapk8ip1, Irs2, Ptprn, and Cdk5r2. Decreased levels of Cdk5r2 in beta cells of RIP-REST mice further confirmed that it is controlled by REST, in vivo. Using siRNA-mediated knock-down in INS-1E cells, we showed that Cdk5r2 protects beta cells against cytokines and palmitate-induced apoptosis. Together, these data document that a set of REST target genes, including Cdk5r2, is important for beta cell survival. PMID:23029270

  4. Glucocorticoids down-regulate beta 1-adrenergic-receptor expression by suppressing transcription of the receptor gene.

    PubMed Central

    Kiely, J; Hadcock, J R; Bahouth, S W; Malbon, C C


    The expression of beta 2-adrenergic receptors is up-regulated by glucocorticoids. In contrast, beta 1-adrenergic receptors display glucocorticoid-induced down-regulation. In rat C6 glioma cells, which express both of these subtypes of beta-adrenergic receptors, the synthetic glucocorticoid dexamethasone stimulates no change in the total beta-adrenergic receptor content, but rather shifts the beta 1:beta 2 ratio from 80:20 to 50:50. Radioligand binding and immunoblotting demonstrate a sharp decline in beta 1-adrenergic receptor expression. Metabolic labelling of cells with [35S]-methionine in tandem with immunoprecipitation by beta 1-adrenergic-receptor-specific antibodies reveals a sharp decline in the synthesis of the receptor within 48 h for cells challenged with glucocorticoid. Steady-state levels of beta 1-adrenergic-receptor mRNA declined from 0.47 to 0.26 amol/microgram of total cellular RNA within 2 h of dexamethasone challenge, as measured by DNA-excess solution hybridization. The stability of receptor mRNA was not influenced by glucocorticoid; the half-lives of the beta 1- and beta 2-subtype mRNAs were 1.7 and 1.5 h respectively. Nuclear run-on assays revealed the basis for the down-regulation of receptor expression, i.e. a sharp decline in the relative rate of transcription for the beta 1-adrenergic-receptor gene in nuclei from dexamethasone-treated as compared with vehicle-treated cells. These data demonstrate transcriptional suppression as a molecular explanation for glucocorticoid-induced down-regulation of beta 1-adrenergic receptors. Images Figure 1 Figure 2 Figure 6 PMID:8092990

  5. Quantitation of beta-thalassemia genes in Quebec immigrants of Mediterranean, southeast Asian, and Asian Indian origins.


    Kaplan, F; Kokotsis, G; Capua, A; Scriver, C R


    Beta-thalassemia minor occurs at 5% frequency (on average) in populations migrant (since 1945) from Mediterranean countries to the province of Quebec. Individuals of Southeast Asian/Chinese and Asian Indian origin now living in the province also carry beta-thalassemia genes at similar frequencies. We characterized beta-thalassemia genes on 68 chromosomes (19 patients and 30 carriers identified by screening) to describe heterogeneity of beta-thalassemia alleles and to evaluate desirability of DNA tests in carrier screening. Thirteen different mutations account for 74% of the 68 beta-thalassemia chromosomes: seven occur on Mediterranean chromosomes (IVS I,nt110, Non 39, IVS I,nt6, IVS I,nt1G----A, IVS II,nt1, Fr8, IVS II,nt745) another three on SE Asian chromosomes (Fr 41-42, IVS II,nt654, HbE) and yet another three on Asian Indian chromosomes (IVS I,nt5, 619 bp del, IVS I,nt1G----T). Twenty-six percent (18/68) of the chromosomes carried none of 17 alleles accounting for 92-96% of beta-thalassemia molecular pathology in reference populations. The Italian beta-thalassemia chromosomes in the Quebec sample least resembled those in the corresponding source population. Until the spectrum of mutations in Quebec populations is fully defined, phenotype assay remains the most reliable and efficient method for beta-thalassemia carrier screening. PMID:1782730

  6. Transfer of beta-amyloid precursor protein gene using adenovirus vector causes mitochondrial abnormalities in cultured normal human muscle.

    PubMed Central

    Askanas, V; McFerrin, J; Baqué, S; Alvarez, R B; Sarkozi, E; Engel, W K


    As in Alzheimer-disease (AD) brain, vacuolated muscle fibers of inclusion-body myositis (IBM) contain abnormally accumulated beta-amyloid precursor protein (beta APP), including its beta-amyloid protein epitope, and increased beta APP-751 mRNA. Other similarities between IBM muscle and AD brain phenotypes include paired helical filaments, hyperphosphorylated tau protein, apolipoprotein E, and mitochondrial abnormalities, including decreased cytochrome-c oxidase (COX) activity. The pathogenesis of these abnormalities in IBM muscle and AD brain is not known. We now report that direct transfer of the beta APP gene, using adenovirus vector, into cultured normal human muscle fibers causes structural abnormalities of mitochondria and decreased COX activity. In this adenovirus-mediated beta APP gene transfer, we demonstrated that beta APP overproduction can induce mitochondrial abnormalities. The data suggest that excessive beta APP may be responsible for mitochondrial and COX abnormalities in IBM muscle and perhaps AD brain. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 Fig. 7 PMID:8577761

  7. Identification and characteristic analysis of the ampC gene encoding beta-lactamase from Vibrio fischeri.


    Weng, Shu-Fen; Chao, Yuh-Fen; Lin, Juey-Wen


    Vibrio fischeri ATCC 7744 is an ampicillin resistant (Amp(r)) marine luminous bacterium. The MIC test indicates that V. fischeri is highly resistant to penicillins, and susceptible to cephalosporins. V. fischeri ampC gene was cloned and identified. Nucleotide sequence of an unidentified ufo gene and the ampC, ppiB genes (GenBank Accession No. AY438037) has been determined; whereas the ampC gene encodes the beta-lactamase (AmpC) and the ppiB gene encodes the peptidyl-prolyl cis-trans isomerase B. Alignment and comparison show that V. fischeri beta-lactamase is homologous to the related species'. The specific amino acid residues STFK (62nd to 65th), SDN (122nd to 124th), and D (155th) located 34 residues downstream from the SDN loop of the class A beta-lactamases are highly conserved, but the KTG is not found. V. fischeri ampC gene encoding beta-lactamase has a calculated M(r) 31,181 and comprises 283 amino acid residues (pI 5.35). There is a signal peptide of 18 amino acid residues MKIKPFLFGLIVLANNAI in the pro-beta-lactamase, which functioned for secretion; thus, the matured protein only has M(r) 29,197 and comprises 265 amino acid residues (pI 4.95). SDS-PAGE and the beta-lactamase functional assays elicit that the M(r) of the beta-lactamases are close to 29kDa. IEF and the beta-lactamase functional assays show that the beta-lactamases' pI are close to 4.8 as predicted. The results elucidate that V. fischeri ampC gene and the cloned ampC gene in Escherichia coli are the same one. The gene order of the ampC and the related genes is -ufo-(P*-intern)-ampC-ppiB--> (P*-intern: intern promoter for sub-regulation), whereas the P*-intern promoter displays the function to lead the ampC gene's expression for stress response. PMID:14741712

  8. Specific expression of a beta-tubulin gene (GhTub1) in developing cotton fibers.


    Li, Yuanli; Sun, Jie; Li, Chunhong; Zhu, Yongqing; Xia, Guixian


    A cDNA library was constructed using poly (A)(+) RNA isolated from -1-15 DPA fibers of upland cotton (Gossypium hirsutum). The cDNA encoding a beta-tubulin isoform (designated as GhTub1) was identified through EST search. Northern blot analysis using 3'-UTR of the cDNA as a gene-specific probe was performed to investigate the expression levels of GhTub1 in various organs and in the developing fibers. The results showed that GhTub1 gene was specifically expressed in cotton fiber cells. During fiber development, GhTub1 transcripts accumulated highly at the stage of cell rapid elongation with the highest expression appearing at the time when fiber expansion reaches the peak rate. To probe the in vivo function of GhTub1, its cDNA was cloned in the yeast expression vector pREP1 and transformed into the fission yeast Schizosaccharomyces pombe. Overexpression of GhTub1 in yeast cells caused severe changes in the cell morphology. These results suggest that GhTub1 may play a role in the polar elongation of cotton fibers. To our knowledge, this is the first report on the fiber-specific transcript accumulation of a cotton beta-tubulin gene. PMID:18763138

  9. Molecular cloning and analysis of zebrafish voltage-gated sodium channel beta subunit genes: implications for the evolution of electrical signaling in vertebrates

    PubMed Central

    Chopra, Sameer S; Watanabe, Hiroshi; Zhong, Tao P; Roden, Dan M


    Background Action potential generation in excitable cells such as myocytes and neurons critically depends on voltage-gated sodium channels. In mammals, sodium channels exist as macromolecular complexes that include a pore-forming alpha subunit and 1 or more modulatory beta subunits. Although alpha subunit genes have been cloned from diverse metazoans including flies, jellyfish, and humans, beta subunits have not previously been identified in any non-mammalian species. To gain further insight into the evolution of electrical signaling in vertebrates, we investigated beta subunit genes in the teleost Danio rerio (zebrafish). Results We identified and cloned single zebrafish gene homologs for beta1-beta3 (zbeta1-zbeta3) and duplicate genes for beta4 (zbeta4.1, zbeta4.2). Sodium channel beta subunit loci are similarly organized in fish and mammalian genomes. Unlike their mammalian counterparts, zbeta1 and zbeta2 subunit genes display extensive alternative splicing. Zebrafish beta subunit genes and their splice variants are differentially-expressed in excitable tissues, indicating tissue-specific regulation of zbeta1-4 expression and splicing. Co-expression of the genes encoding zbeta1 and the zebrafish sodium channel alpha subunit Nav1.5 in Chinese Hamster Ovary cells increased sodium current and altered channel gating, demonstrating functional interactions between zebrafish alpha and beta subunits. Analysis of the synteny and phylogeny of mammalian, teleost, amphibian, and avian beta subunit and related genes indicated that all extant vertebrate beta subunits are orthologous, that beta2/beta4 and beta1/beta3 share common ancestry, and that beta subunits are closely related to other proteins sharing the V-type immunoglobulin domain structure. Vertebrate sodium channel beta subunit genes were not identified in the genomes of invertebrate chordates and are unrelated to known subunits of the para sodium channel in Drosophila. Conclusion The identification of conserved

  10. Nkx6.1 controls a gene regulatory network required for establishing and maintaining pancreatic Beta cell identity.


    Schaffer, Ashleigh E; Taylor, Brandon L; Benthuysen, Jacqueline R; Liu, Jingxuan; Thorel, Fabrizio; Yuan, Weiping; Jiao, Yang; Kaestner, Klaus H; Herrera, Pedro L; Magnuson, Mark A; May, Catherine Lee; Sander, Maike


    All pancreatic endocrine cell types arise from a common endocrine precursor cell population, yet the molecular mechanisms that establish and maintain the unique gene expression programs of each endocrine cell lineage have remained largely elusive. Such knowledge would improve our ability to correctly program or reprogram cells to adopt specific endocrine fates. Here, we show that the transcription factor Nkx6.1 is both necessary and sufficient to specify insulin-producing beta cells. Heritable expression of Nkx6.1 in endocrine precursors of mice is sufficient to respecify non-beta endocrine precursors towards the beta cell lineage, while endocrine precursor- or beta cell-specific inactivation of Nkx6.1 converts beta cells to alternative endocrine lineages. Remaining insulin(+) cells in conditional Nkx6.1 mutants fail to express the beta cell transcription factors Pdx1 and MafA and ectopically express genes found in non-beta endocrine cells. By showing that Nkx6.1 binds to and represses the alpha cell determinant Arx, we identify Arx as a direct target of Nkx6.1. Moreover, we demonstrate that Nkx6.1 and the Arx activator Isl1 regulate Arx transcription antagonistically, thus establishing competition between Isl1 and Nkx6.1 as a critical mechanism for determining alpha versus beta cell identity. Our findings establish Nkx6.1 as a beta cell programming factor and demonstrate that repression of alternative lineage programs is a fundamental principle by which beta cells are specified and maintained. Given the lack of Nkx6.1 expression and aberrant activation of non-beta endocrine hormones in human embryonic stem cell (hESC)-derived insulin(+) cells, our study has significant implications for developing cell replacement therapies. PMID:23382704

  11. Characterization of horse (Equus caballus) T-cell receptor beta chain genes

    SciTech Connect

    Schrenzel, M.D.; Watson, J.L.; Ferrick, D.A.


    Genes encoding the horse (Equus caballus) T-cell receptor beta chain (TCRB) were cloned and characterized. Of 33 cDNA clones isolated from the mesenteric lymph node, 30 had functionally rearranged gene segments, and three contained germline sequences. Sixteen unique variable segments (TCRBV), 14 joining genes (TCRBJ), and two constant region genes (TCRBC) were identified. Horse TCRBV were grouped into nine families based on similarity to human sequences. TCRBV2 and TCRBV12 were the most commonly represented horse families. Analysis of predicted protein structure revealed the presence of conserved regions similar to those seen in TCRB of other species. A decanucleotide promoter sequence homologous to those found in humans and mice was located in the 5{prime} untranslated region of one horse gene. Germline sequences included the 5{prime} region of the TCRBD2 gene with flanking heptamer/nonamer recombination signals and portions of the TCRBJ2-C2 intro. Southern blot hybridizations demonstrated restriction fragment length polymorphisms at the TCRBC locus among different horse breeds.

  12. Double gene deletion reveals the lack of cooperation between PPAR{alpha} and PPAR{beta} in skeletal muscle

    SciTech Connect

    Bedu, E.; Desplanches, D.; Pequignot, J.; Bordier, B.; Desvergne, B. . E-mail:


    The peroxisome proliferator-activated receptors (PPARs) are involved in the regulation of most of the pathways linked to lipid metabolism. PPAR{alpha} and PPAR{beta} isotypes are known to regulate muscle fatty acid oxidation and a reciprocal compensation of their function has been proposed. Herein, we investigated muscle contractile and metabolic phenotypes in PPAR{alpha}-/-, PPAR{beta}-/-, and double PPAR{alpha}-/- {beta}-/- mice. Heart and soleus muscle analyses show that the deletion of PPAR{alpha} induces a decrease of the HAD activity ({beta}-oxidation) while soleus contractile phenotype remains unchanged. A PPAR{beta} deletion alone has no effect. However, these mild phenotypes are not due to a reciprocal compensation of PPAR{beta} and PPAR{alpha} functions since double gene deletion PPAR{alpha}-PPAR{beta} mostly reproduces the null PPAR{alpha}-mediated reduced {beta}-oxidation, in addition to a shift from fast to slow fibers. In conclusion, PPAR{beta} is not required for maintaining skeletal muscle metabolic activity and does not compensate the lack of PPAR{alpha} in PPAR{alpha} null mice.

  13. Human T-cell receptor v{beta} gene polymorphism and multiple sclerosis

    SciTech Connect

    Wei, S.; Charmley, P.; Birchfield, R.I.; Concannon, P.


    Population-based genetic associations have been reported between RFLPs detected with probes corresponding to the genes encoding the {beta} chain of the T-cell receptor for antigen (RCRB) and a variety of autoimmune disorders. In the case of multiple sclerosis (MS), these studies have localized a putative disease-associated gene to a region of {approximately}110 kb in length, located within the TCRB locus. In the current study, all 14 known TCRBV (variable region) genes within the region of localization were mapped and identified. The nucleotide sequences of these genes were determined in a panel of six MS patients and six healthy controls, who were human-leukocyte antigen and TCRB-RFLP haplotype matched. Nine of the 14 TCRBV genes studied showed evidence of polymorphism. PCR-based assays for each of these polymorphic genes were developed, and allele and genotype frequencies were determined in a panel of DNA samples from 48 MS patients and 60 control individuals. No significant differences in allele, genotype, or phenotype frequencies were observed between the MS patients and controls for any of the 14 TCRBV-gene polymorphisms studied. In light of the extensive linkage disequilibrium across the region studied, the saturating numbers of polymorphisms examined, and the direct sequence analysis of all BV genes in the region, these results suggest that it is unlikely that germ-line polymorphism in the TCRBV locus makes a major contribution to MS susceptibility. The TCRBV coding region-specific markers generated in these studies, as well as the approach of testing for associations with specific functionally relevant polymorphic sites within individual BV genes, should be useful in the evaluation of the many reported disease associations involving the human TCRB region. 22 refs., 1 fig., 3 tabs.

  14. Stress Induced Expression of a Beta vulgaris L. Gene for a Chloroplast-Targeted Signal Calmodulin-Binding Protein

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In sugarbeet, Beta vulgaris L., Medicago truncatula Gaertn and Populus trichocarpa Torr & Gray, a cluster of orthologous genes includes NPR1, a disease resistance-controlling gene, CaMP, encoding a calmodulin-binding protein and CK1PK, determining a dual-specificity casein kinase 1-class protein kin...

  15. Coel is a LTR retrotransopson-like element, in Beta vulgaris L., and contains a Tnp2-domain transposase gene

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We describe herein the discovery of Coe1, a LTR retrotransposon-like element in Beta vulgaris, that carries a Tnp2-type transposase gene, Tbv1, and is flanked by the 8-mer sequence motif CACTATAA in or near inverted repeats. The Tbv1 transposase gene within Coe1 consists of eight exons, and the pre...

  16. Detection of genes mediating beta-lactamase production in isolates of enterobacteria recovered from wild pets in Saudi Arabia

    PubMed Central

    Hassan, Sabry A.; Shobrak, Mohammed Y.


    Aim: To determine the genetic basis and types of beta-lactamase encountered among enterobacterial isolates of wild pets from the animal exhibit. Materials and Methods: A total of 17 beta-lactamase-producing enterobacteria recovered from fecal samples of wild pet animals were analyzed for a selected beta-lactamase gene by polymerase chain reaction. Results: Molecular analysis identified one or more β-lactamase-encoding genes in 14 enterobacterial isolates as a single or gene combination. The most frequent extended-spectrum β-lactamases types were TEM and CTX-M, and the most common AmpC enzymes were CMY-2 and DHA types. Conclusions: The study is the first in Saudi Arabia, have established the presence of β-lactamase-encoding genes in the fecal isolates of wild pets. PMID:27047051

  17. Developmental regulation of {beta}-hexosaminidase {alpha}- and {beta}-subunit gene expression in the rat reproductive system

    SciTech Connect

    Trasler, J.M.; Wakamatsu, N.; Gravel, R.A.; Benoit, G.


    {beta}-Hexosaminidase is an essential lysosomal enzyme whose absence in man results in a group of disorders, the G{sub M2} gangliosidoses. Enzyme activity for {beta}-hexosaminidase is many fold higher in the epididymis than in other tissues, is present in sperm and is postulated to be required for mammalian fertilization. To better understand how {beta}-hexosaminidase is regulated in the reproductive system, we quantitated the mRNA expression of the {alpha}- and {beta}-subunits (Hex {alpha} and Hex {beta}) of the enzyme in the developing rat testis and epididymis. Hex {alpha} mRNA was differentially expressed and abundant in adult rat testis and epididymis, 13- and 2-fold brain levels, respectively. In contrast, Hex {beta} mRNA levels in the testis and epididymis were .3- and 5-fold brain levels. Within the epididymis both Hex {alpha} and Hex {beta} mRNA concentrations were highest in the corpus, 1.5-fold and 9-fold initial segment values, respectively. During testis development from 7-91 days of age, testis levels of Hex {alpha} mRNA increased 10-fold and coincided with the appearance of spermatocytes and spermatids in the epithelium. In isolated male germ cells, Hex {alpha} expression was most abundant in haploid round spermatids. Hex {alpha} mRNA was undetectable after hypophysectomy and returned to normal after testosterone administration and the return of advanced germ cells to the testis. Hex {beta} mRNA was expressed at constant low levels throughout testis development. In the caput-corpus and cauda regions of the epididymis Hex {alpha} mRNA levels increased 2-fold between 14 and 91 days; during the same developmental period epididymal Hex {beta} mRNA levels increased dramatically, by 10-20 fold. In summary, Hex {alpha} and Hex {beta} mRNAs are differentially and developmentally expressed at high levels in the rat testis and epididymis and augur for an important role for {beta}-hexosaminidase in normal male reproductive function.

  18. Cloning of genes related to exo-beta-glucanase production in Saccharomyces cerevisiae: characterization of an exo-beta-glucanase structural gene.


    Nebreda, A R; Villa, T G; Villanueva, J R; del Rey, F


    The EXG1 gene of Saccharomyces cerevisiae was cloned and identified by complementation of a mutant strain (exg1-2) with highly reduced extracellular exo-beta-1,3-glucanase (EXG) activity. Two recombinant plasmids containing an overlapping region of 5.2 kb were isolated from a genomic DNA library and characterized by restriction mapping. The coding region was located by subcloning the original DNA inserts in a 2.7-kb HindIII-XhoI fragment. Exg+ strains and Exg- mutants transformed with yeast multicopy plasmids containing this DNA fragment showed an EXG activity 5- to 20-fold higher than for the untransformed Exg+ wild-type (wt) strains. The overproduced EXG had the same enzymic activity on different substrates, and showed the same electrophoretic behaviour on polyacrylamide gels and identical properties upon filtration through Sephacryl S-200 as those of the main EXG from Exg+ wt strains. The EXG1 gene transformed Schizosaccharomyces pombe, yielding extracellular EXG activity which showed cross-reactivity with anti-S. cervisiae EXG antibodies. A fragment including only a part of the EXG1 region was subcloned into the integrating vector YIp5, and the resulting plasmid was used to transform an Exg+ strain. Genetic and Southern analysis of several stable Exg- transformants showed that the fragment integrated by homology with the EXG1 locus. The chromosomal DNA fragment into which the plasmid integrated has a restriction pattern identical to that of the fragment on which we had previously identified the putative EXG1 gene. Only one copy of the EXG1 gene per genome was found in several strains tested by Southern analysis. Furthermore, two additional recombinant plasmids sharing a yeast DNA fragment of about 4.1 kb, which partially complements the exg1-2 mutation but which shows no homology with the 2.7-kb fragment containing the EXG1 gene, were also identified in this study. This 4.1-kb DNA fragment does not appear to contain an extragenic suppressor and could be related

  19. CTNNB1 mutations and overexpression of Wnt/beta-catenin target genes in WT1-mutant Wilms' tumors.


    Li, Chi-Ming; Kim, Connie E; Margolin, Adam A; Guo, Meirong; Zhu, Jimmy; Mason, Jacqueline M; Hensle, Terrence W; Murty, Vundavalli V V S; Grundy, Paul E; Fearon, Eric R; D'Agati, Vivette; Licht, Jonathan D; Tycko, Benjamin


    Gain-of-function mutations in exon 3 of beta-catenin (CTNNB1) are specific for Wilms' tumors that have lost WT1, but 50% of WT1-mutant cases lack such "hot spot" mutations. To ask whether stabilization of beta-catenin might be essential after WT1 loss, and to identify downstream target genes, we compared expression profiles in WT1-mutant versus WT1 wild-type Wilms' tumors. Supervised and nonsupervised hierarchical clustering of the expression data separated these two classes of Wilms' tumor. The WT1-mutant tumors overexpressed genes encoding myogenic and other transcription factors (MOX2, LBX1, SIM2), signaling molecules (TGFB2, FST, BMP2A), extracellular Wnt inhibitors (WIF1, SFRP4), and known beta-catenin/TCF targets (FST, CSPG2, CMYC). Beta-Catenin/TCF target genes were overexpressed in the WT1-mutant tumors even in the absence of CTNNB1 exon 3 mutations, and complete sequencing revealed gain-of-function mutations elsewhere in the CTNNB1 gene in some of these tumors, increasing the overall mutation frequency to 75%. Lastly, we identified and validated a novel direct beta-catenin target gene, GAD1, among the WT1-mutant signature genes. These data highlight two molecular classes of Wilms' tumor, and indicate strong selection for stabilization of beta-catenin in the WT1-mutant class. Beta-Catenin stabilization can initiate tumorigenesis in other systems, and this mechanism is likely critical in tumor formation after loss of WT1. PMID:15579438

  20. Isolation, characterization, and expression of the gene encoding the beta subunit of the mitochondrial processing peptidase from Blastocladiella emersonii.


    Costa Rocha, C R; Lopes Gomes, S


    A 2.3-kb BamHI-KpnI fragment was isolated from a partial genomic library and shown by nucleotide sequence analysis to contain the entire coding region of the gene encoding the beta subunit of the Blastocladiella mitochondrial processing peptidase (beta-MPP). The predicted beta-MPP protein has 465 amino acids and a calculated molecular mass of 50.8 kDa. S1 nuclease protection assays revealed an intron, 209 bp in size, interrupting the coding region between the putative signal sequence and the mature protein. Northern blot analysis showed that beta-MPP mRNA levels decrease significantly during B. emersonii sporulation, reaching basal levels in the zoospore stage. The amount of beta-MPP protein, determined in Western blots, unlike its mRNA, does not vary significantly throughout the fungal life cycle. PMID:9683495

  1. Enantioselective Degradation Mechanism of Beta-Cypermethrin in Soil From the Perspective of Functional Genes.


    Yang, Zhong-Hua; Ji, Guo-Dong


    The behavior and mechanisms of the enantioselective degradation of beta-cypermethrin were studied in soil. The four isomers were degraded at different rates, and the enantiomer fractions of alpha-cypermethrin and theta-cypermethrin exceeded 0.5. Moreover, 3-phenoxybenzoic acid, phenol, and protocatechuic acid were detected; based on the presence of these metabolites, we predicted the degradation pathway and identified the functional genes that are related to this degradation process. We established quantitative relationships between the data on degradation kinetics and functional genes; we found that the quantitative relationships between different enantiomers differed even under the same conditions, and the genes pobA and pytH played key roles in limiting the degradation rate. Data obtained using path analysis revealed that the same gene had different direct and indirect effects on the degradation of different isomers. A mechanism was successfully proposed to explain the selective degradation of chiral compounds based on the perspective of functional genes. PMID:26403376

  2. Genomic organization of the human {beta}-catenin gene (CTNNB1)

    SciTech Connect

    Nollet, F.; Berx, G.; Molemans, F.; Roy, F. van


    The cytoplasmic {beta}-catenin protein is implicated in signal transduction and associates with both the cell-cell adhesion protein E-cadherin and the tumor suppressor gene product APC. We determined the primary structure of the human {beta}-catenin gene (CTNNB1) by analysis cDNA and genomic clones. The size of the complete gene was determined to be 23.2 kb. Restriction mapping and partial sequence analysis revealed 16 exons. All splice donor and acceptor sites were conformable to the GT/AG rule. The exon size ranged from 61 to 790 bp. Half of the introns were smaller than 550 bp, with the smallest being 84 pb and the longest being 6700 bp. The intron-exon boundaries did not coincide either with conserved sites in the 12 armadillo repeat sequences of {beta}-catenin or with intron-exon boundaries in the armadillo gene of Drosophila. A major site for transcription initiation was identified as an A residue 214 nucleotides upstream of the ATG initiation codon. The resulting transcript is 3362 nucleotides long. Compared to the previously published mRNA sequence, additional residues were identified, 16 at the 5{prime} end and 766 at the 3{prime} end of the mRNA. An alternative splice acceptor site within exon 16 reduced the 3{prime} UTR sequence by 159 bp. Polymerase chain reaction on cDNA from 14 human cell lines demonstrated the general occurrence of both splice variants. The 5{prime}-flanking region is highly GC-rich and lacks a CCAAT box, but contains a TATA box and potential binding sites for several transcription factors, such as NFkB, SP1, AP2, and EGR1. Both a 437-bp fragment and a 6-kb fragment, containing about 4.7 kb of the 5{prime}-flanking region in addition to the noncoding exon 1 and 1 kb of intron 1, showed clear promoter activity when these fragments were linked to a secreted alkaline phosphatase reporter gene and transfected into a mouse epithelial cell line. 53 refs., 5 figs., 2 tabs.

  3. Haplotype analysis of beta-actin gene for its association with sperm quality and boar fertility.


    Lin, C-L; Jennen, D G J; Ponsuksili, S; Tholen, E; Tesfaye, D; Schellander, K; Wimmers, K


    beta-actin (ACTB) was examined as a direct functional candidate gene for the possible association with sperm concentration, motility (MOT), semen volume per ejaculate, plasma droplet rate, abnormal sperm rate (ASR) and the fertility traits, non-return rate and number of piglets born alive (NBA). Three polymorphisms in intron 3 (T>C) and one polymorphism in exon 4 (T>C) of porcine ACTB gene were identified by comparative sequencing of animals of the breeds Pietrain and Hampshire. Association analysis revealed that haplotypes affected the variation of the traits MOT, ASR and NBA. The beneficial haplotypes may provide considerable improvement of sperm quality and fertility in the tested commercial boar population. PMID:17177693

  4. Characteristic beta-globin gene cluster haplotypes of Evenkis and Oroqens in north China.


    Shimizu, Koji; Marubayashi, Azusa; Tokimasa, Kozue; Harihara, Shinji; Omoto, Keiichi; Imanishi, Tadashi; Hao, Luping; Jin, Feng


    Haplotype frequencies of the beta-globin gene cluster were estimated for 114 Evenkis and 81 Oroqens from northeast China, and their characteristics were compared with those in Japanese, Koreans, and three Colombian Amerindian groups of South America (Wayuu, Kamsa, and Inga tribes). A major 5' subhaplotype (5' to the delta-globin gene) was + - - - - in Evenkis, whereas + - - - -, - + + - +, and - + - + + were the major subhaplotypes in Oroqens. One possible candidate for an ancestral 5' subhaplotype, - - - - -, was found in one Evenki (0.5%) and three Oroqen chromosomes (2.0%). They were observed as heterozygous forms for + ---- and -----. Major haplotypes were +-----+, + -----+-, and + - - - - + + in Evenkis, whereas they were +-----+,-++-+-+, +----+-, and -+-++-+ in Oroqens. The lowest Nei's genetic distance values of Evenkis or Oroqens based on the 5' subhaplotype frequency distributions were observed in relation to the Wayuu or Koreans, respectively, but those of Evenkis and Oroqens based on the haplotype frequency distributions were found in relation to Koreans. PMID:15757246

  5. Obesity-related phenotypes and the beta3-adrenoceptor gene variant in postmenopausal women.


    Tchernof, A; Starling, R D; Walston, J D; Shuldiner, A R; Dvorak, R V; Silver, K; Matthews, D E; Poehlman, E T


    We examined the hypothesis that postmenopausal women with the beta3-adrenoceptor gene variant (Trp64Arg) have reduced total daily energy expenditure (TEE), altered free fatty acid kinetics, and increased intra-abdominal fat. A secondary objective was to examine whether the obese state masks the effect of the variant on resting metabolic rate (RMR). There were 23 obese heterozygous women with the genetic variant (age 58 +/- 6 years; BMI 36 +/- 7 kg/m2) who were compared with 19 homozygous obese women with the normal allele (age 56 +/- 4 years; BMI 36 +/- 3 kg/m2). Daily energy expenditure was determined from doubly labeled water and indirect calorimetry, lipolysis from infusion of [1-13C]palmitate, and body fat distribution from computed tomography. No significant differences were found in TEE, RMR, energy expenditure of physical activity, the thermic effect of a meal, fat oxidation as estimated by fasting and postprandial respiratory quotients (RQs), or rate of lipolysis. Similarly, no difference was found in visceral adipose tissue and abdominal subcutaneous fat areas. When RMR was compared between obese (n = 23) and never-obese women with the Trp64Arg variant (n = 16), we found a 317 kcal/day lower RMR in never-obese women after controlling for fat mass, fat-free mass, and age (P < 0.0017). These results do not support the hypothesis that already obese women with the Trp64Arg polymorphism of the beta3-adrenergic receptor gene have lower daily energy expenditure, altered lipolysis, and increased abdominal obesity. On the other hand, the lower RMR in never-obese women suggests that the obese state may mask a moderate effect of the Trp64Arg variant on energy expenditure. Although these results need to be confirmed in other populations, the obese state may have been a confounding factor in previous studies of the beta3-adrenoceptor Trp64Arg variant and energy expenditure. PMID:10389848

  6. Estrogen Receptor beta binds Sp1 and recruits a Corepressor Complex to the Estrogen Receptor alpha Gene Promoter

    PubMed Central

    Bartella, V; Rizza, P; Barone, I; Zito, D; Giordano, F; Giordano, C; Catalano, S; Mauro, L; Sisci, D; Panno, ML; Fuqua, SA; Andò, Sebastiano


    Human estrogen receptors (ERs) alpha and beta are crucially involved in the regulation of mammary growth and development. Normal breast tissues display a prevalently expression of ER beta than ER alpha, which drastically increases during breast tumorogenesis. So, it is reasonable to assume how a dysregulation of the two estrogen receptor subtypes may induce breast cancer development. However, the molecular mechanism underlying the opposite role played by the two estrogen receptors on tumor cell growth remains to be elucidated. In the present study, we have demonstrated that ER beta overexpression in breast cancer cells decreases cell proliferation and down-regulates ER alpha mRNA and protein content along with a concomitant repression of estrogen-regulated genes. Transient transfection experiments, using a vector containing the human ER alpha promoter region, showed that elevated levels of the ER beta down-regulated basal ER alpha promoter activity. Furthermore, side-directed mutagenesis and deletion analysis have revealed that the proximal GC-rich motifs at −223 and −214 is crucial for the ER beta-induced ER alpha down-regulation in breast cancer cells. This occurred through ER beta-Sp1 protein-protein interaction within the ER alpha promoter region and the recruitment of a corepressor complex containing NCoR/SMRT (nuclear receptor corepressor/silencing mediator of retinoic acid and thyroid hormone receptor), accompanied by hypoacetylation of histone H4 and displacement of RNA polymerase II. Silencing of NCoR gene expression by RNA interference reversed the down-regulatory effect of ER beta on ER alpha gene expression and cell proliferation. Our results provide evidence for a novel mechanism by which overexpression of ER beta through NCoR is able to down regulate ER alpha gene expression, thus inhibiting ER alpha’s driving role on breast cancer cell growth. PMID:22622808

  7. Nucleotide sequence analysis of beta tubulin gene in a wide range of dermatophytes.


    Rezaei-Matehkolaei, Ali; Mirhendi, Hossein; Makimura, Koichi; de Hoog, G Sybren; Satoh, Kazuo; Najafzadeh, Mohammad Javad; Shidfar, Mohammad Reza


    We investigated the resolving power of the beta tubulin protein-coding gene (BT2) for systematic study of dermatophyte fungi. Initially, 144 standard and clinical strains belonging to 26 species in the genera Trichophyton, Microsporum, and Epidermophyton were identified by internal transcribe spacer (ITS) sequencing. Subsequently, BT2 was partially amplified in all strains, and sequence analysis performed after construction of a BT2 database that showed length ranged from approximately 723 (T. ajelloi) to 808 nucleotides (M. persicolor) in different species. Intraspecific sequence variation was found in some species, but T. tonsurans, T. equinum, T. concentricum, T. verrucosum, T. rubrum, T. violaceum, T. eriotrephon, E. floccosum, M. canis, M. ferrugineum, and M. audouinii were invariant. The sequences were found to be relatively conserved among different strains of the same species. The species with the closest resemblance were Arthroderma benhamiae and T. concentricum and T. tonsurans and T. equinum with 100% and 99.8% identity, respectively; the most distant species were M. persicolor and M. amazonicum. The dendrogram obtained from BT2 topology was almost compatible with the species concept based on ITS sequencing, and similar clades and species were distinguished in the BT2 tree. Here, beta tubulin was characterized in a wide range of dermatophytes in order to assess intra- and interspecies variation and resolution and was found to be a taxonomically valuable gene. PMID:25079222

  8. Cloning and sequencing of the metallothioprotein beta-lactamase II gene of Bacillus cereus 569/H in Escherichia coli.

    PubMed Central

    Hussain, M; Carlino, A; Madonna, M J; Lampen, J O


    The structural gene for beta-lactamase II (EC, a metallothioenzyme, from Bacillus cereus 569/H (constitutive for high production of the enzyme) was cloned in Escherichia coli, and the nucleotide sequence was determined. This is the first class B beta-lactamase whose primary structure has been reported. The amino acid sequence of the exoenzyme form, deduced from the DNA, indicates that beta-lactamase II, like other secreted proteins, is synthesized as a precursor with a 30-amino acid N-terminal signal peptide. The pre-beta-lactamase II (Mr, 28,060) is processed in E. coli and in B. cereus to a single mature protein (Mr, 24,932) which is totally secreted by B. cereus but in E. coli remains intracellular, probably in the periplasm. The expression of the gene in E. coli RR1 on the multicopy plasmid pRWHO12 was comparable to that in B. cereus, where it is presumably present as a single copy. The three histidine residues that are involved (along with the sole cysteine of the mature protein) in Zn(II) binding and hence in enzymatic activity against beta-lactams were identified. These findings will help to define the secondary structure, mechanism of action, and evolutionary lineage of B. cereus beta-lactamase II and other class B beta-lactamases. Images PMID:3930467

  9. Adenoviral delivery of the beta2-adrenoceptor gene in sepsis: a subcutaneous approach in rat for kidney protection.


    Nakamura, Akio; Imaizumi, Akira; Niimi, Ryo; Yanagawa, Yukishige; Kohsaka, Takao; Johns, Edward J


    Successful gene therapy requires gene delivery that is efficient, has an optimal route of administration and has biosafety. The aims of the present study were to evaluate the safety and applicability of the subcutaneous delivery route for adenoviral transgenes containing the human beta(2)-adrenoceptor (adeno-beta(2)-AR) and to investigate whether this approach prevented renal dysfunction in a rat model of endotoxaemic shock induced by LPS (lipopolysaccharide). Subcutaneous administration of adeno-beta(2)-AR (a total of 10(10) viral particles) significantly increased beta-AR density in the kidney, lung and liver, but was without effect on physiological and plasma biochemical parameters. Moreover, this dose of virus did not cause any of the potential toxic responses of viral administration, such as inflammation and tissue TNF (tumour necrosis factor)-alpha expression. Although the LPS challenge caused a decrease in glomerular filtration rate, fractional excretion of sodium and renal beta-AR density in all groups, the reduction in renal function was significantly less in the rats given adeno-beta(2)-AR compared with non-treated rats. Thus, although further evaluation will be required, this initial study demonstrated that the subcutaneous injection of adeno-beta(2)-AR was efficient, comparatively non-pathogenic and potentially therapeutic to deal with acute renal failure associated with sepsis. PMID:16076286

  10. Conservation and divergence of autonomous pathway genes in the flowering regulatory network of Beta vulgaris

    PubMed Central

    Abou-Elwafa, Salah F.; Büttner, Bianca; Chia, Tansy; Schulze-Buxloh, Gretel; Hohmann, Uwe; Mutasa-Göttgens, Effie; Jung, Christian; Müller, Andreas E.


    The transition from vegetative growth to reproductive development is a complex process that requires an integrated response to multiple environmental cues and endogenous signals. In Arabidopsis thaliana, which has a facultative requirement for vernalization and long days, the genes of the autonomous pathway function as floral promoters by repressing the central repressor and vernalization-regulatory gene FLC. Environmental regulation by seasonal changes in daylength is under control of the photoperiod pathway and its key gene CO. The root and leaf crop species Beta vulgaris in the caryophyllid clade of core eudicots, which is only very distantly related to Arabidopsis, is an obligate long-day plant and includes forms with or without vernalization requirement. FLC and CO homologues with related functions in beet have been identified, but the presence of autonomous pathway genes which function in parallel to the vernalization and photoperiod pathways has not yet been reported. Here, this begins to be addressed by the identification and genetic mapping of full-length homologues of the RNA-regulatory gene FLK and the chromatin-regulatory genes FVE, LD, and LDL1. When overexpressed in A. thaliana, BvFLK accelerates bolting in the Col-0 background and fully complements the late-bolting phenotype of an flk mutant through repression of FLC. In contrast, complementation analysis of BvFVE1 and the presence of a putative paralogue in beet suggest evolutionary divergence of FVE homologues. It is further shown that BvFVE1, unlike FVE in Arabidopsis, is under circadian clock control. Together, the data provide first evidence for evolutionary conservation of components of the autonomous pathway in B. vulgaris, while also suggesting divergence or subfunctionalization of one gene. The results are likely to be of broader relevance because B. vulgaris expands the spectrum of evolutionarily diverse species which are subject to differential developmental and/or environmental regulation

  11. Clinical Significance of a Point Mutation in DNA Polymerase Beta (POLB) Gene in Gastric Cancer

    PubMed Central

    Tan, Xiaohui; Wang, Hongyi; Luo, Guangbin; Ren, Shuyang; Li, Wenmei; Cui, Jiantao; Gill, Harindarpal S.; Fu, Sidney W.; Lu, Youyong


    Gastric cancer (GC) is a major cause of global cancer mortality. Genetic variations in DNA repair genes can modulate DNA repair capability and, consequently, have been associated with risk of developing cancer. We have previously identified a T to C point mutation at nucleotide 889 (T889C) in DNA polymerase beta (POLB) gene, a key enzyme involved in base excision repair in primary GCs. The purpose of this study was to evaluate the mutation and expression of POLB in a larger cohort and to identify possible prognostic roles of the POLB alterations in GC. Primary GC specimens and their matched normal adjacent tissues were collected at the time of surgery. DNA, RNA and protein samples were isolated from GC specimens and cell lines. Mutations were detected by PCR-RFLP/DHPLC and sequencing analysis. POLB gene expression was examined by RT-PCR, tissue microarray, Western blotting and immunofluorescence assays. The function of the mutation was evaluated by chemosensitivity, MTT, Transwell matrigel invasion and host cell reactivation assays. The T889C mutation was detected in 18 (10.17%) of 177 GC patients. And the T889C mutation was associated with POLB overexpression, lymph nodes metastases and poor tumor differentiation. In addition, patients with- the mutation had significantly shorter survival time than those without-, following postoperative chemotherapy. Furthermore, cell lines with T889C mutation in POLB gene were more resistant to the treatment of 5-fluorouracil, cisplatin and epirubicin than those with wild type POLB. Forced expression of POLB gene with T889C mutation resulted in enhanced cell proliferation, invasion and resistance to anticancer drugs, along with increased DNA repair capability. These results suggest that POLB gene with T889C mutation in surgically resected primary gastric tissues may be clinically useful for predicting responsiveness to chemotherapy in patients with GC. The POLB gene alteration may serve as a prognostic biomarker for GC. PMID

  12. Negative regulation in the expression of a sugar-inducible gene in Arabidopsis thaliana. A recessive mutation causing enhanced expression of a gene for beta-amylase.

    PubMed Central

    Mita, S; Hirano, H; Nakamura, K


    Expression of a beta-amylase gene of Arabidopsis thaliana (AT beta-Amy) is regulated by sugars. We identified a mutant, hba1, in which the level of expression of AT beta-Amy in leaves of plants that had been grown in a medium with 2% sucrose was significantly higher than that in wild-type plants. Higher that wild-type levels of beta-amylase in hba1 plants depended on the presence of 1 to 2% sucrose or 1% glucose in the medium, whereas leaves of mutant plants grown with higher levels of sugars had beta-amylase activities similar to those in leaves of wild-type plants. The hba1 phenotype was recessive and did not affect levels of sugars and starch in leaves. It is proposed that expression of AT beta-Amy is regulated by a combination of both positive and negative factors, dependent on the level of sugars, and that HBA1 might function to maintain low-level expression of AT beta-Amy until the level of sugars reaches some high level. Results of crosses of hba1 plants with transgenic plants that harbored an AT beta-Amy:GUS transgene with 1587 bp of the 5'-upstream region suggested that HBA1 affects expressions of AT beta-Amy in trans. The hba1 plants also had growth defects and elevated levels of anthocyanin in their petioles. However, sugar-related changes in levels of several mRNAs other than beta-amylase mRNA were unaffected in hba1 plants, suggesting that only a subset of sugar-regulated genes is under the control HBA1. PMID:9193090

  13. Characterization of a large deletion in the {beta}-globin gene cluster in a newborn with hemoglobin FE

    SciTech Connect

    Louie, E.; Dietz, L.; Shafer, F.


    A sample on a newborn with hemoglobin FE screen results was obtained to investigate whether E/E or B/{beta}{degrees} thalassemia was present using polymerase chain reaction (PCR) methodology. The newborn appeared homozygous for the hemoglobin E mutation in our initial study, but the parents` genotypes did not support this diagnosis. The father is homozygous for the absence of the hemoglobin E mutation (non E/non E) and the mother is heterozygous (E/non E) for this mutation. The limitation of PCR analysis is an assumption that the amplification of the two {beta}-globin alleles is equivalent. A large deletion on one {beta}-globin gene, which would produce E/{beta}{degrees} thalassemia, would be missed if it included part or the entire region subjected to amplification. The family results were consistent with either non-paternity, sample mix-up or such a deletion of the {beta}-globin gene in the father and child. To rule out the possibility of non-paternity, two polymorphic loci (HLA on chromosome 6 and a VNTR system of chromosome 17) that are outside of the {beta}-globin gene were analyzed and show that inheritance is consistent and the likelihood of a sample mix-up is then reduced. We therefore believe there is a gene deletion in this family. At the present time, analyses of the RFLPs that are 5{prime} of the {beta}-globin gene cluster show that the polymorphisms most distal from the 5{prime} {beta}-globin gene are not being inherited as expected. These results support our interpretation that a deletion exists in the father and was inherited by the child. The father`s clinical picture of possible HPFH (the father has 12% hemoglobin F) also supports the interpretation of a deletion in this family. Deletions of the {beta}-globin gene within this ethnic group are rare. Currently, Southern blots on the family are being probed to determine the extent of the putative deletion.

  14. Candidate Gene Study of TRAIL and TRAIL Receptors: Association with Response to Interferon Beta Therapy in Multiple Sclerosis Patients

    PubMed Central

    Órpez-Zafra, Teresa; Pinto-Medel, María Jesús; Oliver-Martos, Begoña; Ortega-Pinazo, Jesús; Arnáiz, Carlos; Guijarro-Castro, Cristina; Varadé, Jezabel; Álvarez-Lafuente, Roberto; Urcelay, Elena; Sánchez-Jiménez, Francisca


    TRAIL and TRAIL Receptor genes have been implicated in Multiple Sclerosis pathology as well as in the response to IFN beta therapy. The objective of our study was to evaluate the association of these genes in relation to the age at disease onset (AAO) and to the clinical response upon IFN beta treatment in Spanish MS patients. We carried out a candidate gene study of TRAIL, TRAILR-1, TRAILR-2, TRAILR-3 and TRAILR-4 genes. A total of 54 SNPs were analysed in 509 MS patients under IFN beta treatment, and an additional cohort of 226 MS patients was used to validate the results. Associations of rs1047275 in TRAILR-2 and rs7011559 in TRAILR-4 genes with AAO under an additive model did not withstand Bonferroni correction. In contrast, patients with the TRAILR-1 rs20576-CC genotype showed a better clinical response to IFN beta therapy compared with patients carrying the A-allele (recessive model: p = 8.88×10−4, pc = 0.048, OR = 0.30). This SNP resulted in a non synonymous substitution of Glutamic acid to Alanine in position 228 (E228A), a change previously associated with susceptibility to different cancer types and risk of metastases, suggesting a lack of functionality of TRAILR-1. In order to unravel how this amino acid change in TRAILR-1 would affect to death signal, we performed a molecular modelling with both alleles. Neither TRAIL binding sites in the receptor nor the expression levels of TRAILR-1 in peripheral blood mononuclear cell subsets (monocytes, CD4+ and CD8+ T cells) were modified, suggesting that this SNP may be altering the death signal by some other mechanism. These findings show a role for TRAILR-1 gene variations in the clinical outcome of IFN beta therapy that might have relevance as a biomarker to predict the response to IFN beta in MS. PMID:23658636

  15. Genomic organization of the murine G protein beta subunit genes and related processed pseudogenes.


    Kitanaka, J; Wang, X B; Kitanaka, N; Hembree, C M; Uhl, G R


    The functional significance of heterotrimeric guanine nucleotide binding protein (G protein) for the many physiological processes including the molecular mechanisms of drug addiction have been described. In investigating the changes of mRNA expression after acute psychostimulant administration, we previously identified a cDNA encoding a G protein beta1 subunit (Gbeta1) that was increased up to four-fold in certain brain regions after administration of psychostimulants. The mouse Gbeta1 gene (the mouse genetic symbol, GNB1) was mapped to chromosome 4, but little was known of its genetic features. To characterize the GNB1 gene further, we have cloned and analyzed the genomic structures of the mouse GNBI gene and its homologous sequences. The GNBI gene spans at least 50 kb, and consists of 12 exons and 11 introns. The exon/intron boundaries were determined and found to follow the GT/AG rule. Exons 3-11 encode the Gbeta1 protein, and the exon 2 is an alternative, resulting in putative two splicing variants. Although intron 11 is additional for GNBI compared with GNB2 and GNB3, the intron positions within the protein coding region of GNB1, GNB2 and GNB3 are identical, suggesting that GNB1 should have diverged from the ancestral gene family earlier than the genes for GNB2 and GNB3. We also found the 5'-truncated processed pseudogenes with 71-89% similarities to GNBI mRNA sequence, suggesting that the truncated cDNA copies, which have been reverse-transcribed from a processed mRNA for GNB1, might have been integrated into several new locations in the mouse genome. PMID:11913780

  16. GeneSpeed Beta Cell: An Online Genomics Data Repository and Analysis Resource Tailored for the Islet Cell Biologist

    PubMed Central

    Quayum, Nayeem; Kutchma, Alecksandr; Sarkar, Suparna A.; Juhl, Kirstine; Gradwohl, Gerard; Mellitzer, Georg; Hutton, John C.; Jensen, Jan


    Objective. We here describe the development of a freely available online database resource, GeneSpeed Beta Cell, which has been created for the pancreatic islet and pancreatic developmental biology investigator community. Research Design and Methods. We have developed GeneSpeed Beta Cell as a separate component of the GeneSpeed database, providing a genomics-type data repository of pancreas and islet-relevant datasets interlinked with the domain-oriented GeneSpeed database. Results. GeneSpeed Beta Cell allows the query of multiple published and unpublished select genomics datasets in a simultaneous fashion (multiexperiment viewing) and is capable of defining intersection results from precomputed analysis of such datasets (multidimensional querying). Combined with the protein-domain categorization/assembly toolbox provided by the GeneSpeed database, the user is able to define spatial expression constraints of select gene lists in a relatively rigid fashion within the pancreatic expression space. We provide several demonstration case studies of relevance to islet cell biology and development of the pancreas that provide novel insight into islet biology. Conclusions. The combination of an exhaustive domain-based compilation of the transcriptome with gene array data of interest to the islet biologist affords novel methods for multidimensional querying between individual datasets in a rapid fashion, presently not available elsewhere. PMID:18795106

  17. Gene structure and chromosomal localization of the human HSD11K gene encoding the kidney (type 2) isozyme of 11{beta}-hydroxysteroid dehydrogenase

    SciTech Connect

    Agarwal, A.K.; Rogerson, F.M.; Mune, T.; White, P.C.


    11{beta}-hydroxysteroid dehydrogenase (11{beta}HSD) converts glucocorticoids to inactive products and is thus thought to confer specificity for aldosterone on the type I mineralocorticoid receptor in the kidney. Recent studies indicate the presence of at least two isozymes of 11{beta}HSD. In vitro, the NAD{sup +}-dependent kidney (type 2) isozyme catalyzes 11{beta}-dehydrogenase but not reductase reactions, whereas the NADP{sup +}-dependent liver (type 1) isozyme catalyzes both reactions. We have now characterized the human gene encoding kidney 11{beta}HSD (HSD11K). A bacteriophage P1 clone was isolated after screening a human genomic library by hybridization with sheep HSD11K cDNA. The gene consists of 5 exons spread over 6 kb. The nucleotide binding domain lies in the first exon are GC-rich (80%), suggesting that the gene may be transcriptionally regulated by factors that recognize GC-rich sequences. Fluorescence in situ hybridization of metaphase chromosomes with a positive P1 clone localized the gene to chromosome 16q22. In contrast, the HSD11L (liver isozyme) gene is located on chromosome 1 and contains 6 exons; the coding sequences of these genes are only 21% identical. HSD11K is expressed at high levels in the placenta and kidney of midgestation human fetuses and at lower levels in lung and testes. Different transcriptional start sites are utilized in kidney and placenta. These data should be applicable to genetic analysis of the syndrome of apparent mineralocorticoid excess, which may represent a deficiency of 11{beta}HSD. 25 refs., 5 figs.

  18. A Chromosome 8 Gene-Cluster Polymorphism with Low Human Beta-Defensin 2 Gene Copy Number Predisposes to Crohn Disease of the Colon

    PubMed Central

    Fellermann, Klaus; Stange, Daniel E.; Schaeffeler, Elke; Schmalzl, Hartmut; Wehkamp, Jan; Bevins, Charles L.; Reinisch, Walter; Teml, Alexander; Schwab, Matthias; Lichter, Peter; Radlwimmer, Bernhard; Stange, Eduard F.


    Defensins are endogenous antimicrobial peptides that protect the intestinal mucosa against bacterial invasion. It has been suggested that deficient defensin expression may underlie the chronic inflammation of Crohn disease (CD). The DNA copy number of the beta-defensin gene cluster on chromosome 8p23.1 is highly polymorphic within the healthy population, which suggests that the defective beta-defensin induction in colonic CD could be due to low beta-defensin–gene copy number. Here, we tested this hypothesis, using genomewide DNA copy number profiling by array-based comparative genomic hybridization and quantitative polymerase-chain-reaction analysis of the human beta-defensin 2 (HBD-2) gene. We showed that healthy individuals, as well as patients with ulcerative colitis, have a median of 4 (range 2–10) HBD-2 gene copies per genome. In a surgical cohort with ileal or colonic CD and in a second large cohort with inflammatory bowel diseases, those with ileal resections/disease exhibited a normal median HBD-2 copy number of 4, whereas those with colonic CD had a median of only 3 copies per genome (P=.008 for the surgical cohort; P=.032 for the second cohort). Overall, the copy number distribution in colonic CD was shifted to lower numbers compared with controls (P=.002 for both the surgical cohort and the cohort with inflammatory bowel diseases). Individuals with ⩽3 copies have a significantly higher risk of developing colonic CD than did individuals with ⩾4 copies (odds ratio 3.06; 95% confidence interval 1.46–6.45). An HBD-2 gene copy number of <4 was associated with diminished mucosal HBD-2 mRNA expression (P=.033). In conclusion, a lower HBD-2 gene copy number in the beta-defensin locus predisposes to colonic CD, most likely through diminished beta-defensin expression. PMID:16909382

  19. A gene encoding the major beta tubulin of the mitotic spindle in Physarum polycephalum plasmodia

    SciTech Connect

    Burland, T.G.; Paul, E.C.A.; Oetliker, M.; Dove, W.F.


    The multinucleate plasmodium of Physarum polycephalum is unusual among eucaryotic cells in that it uses tubulins only in mitotic-spindle microtubules; cytoskeletal, flagellar, and centriolar microtubules are absent in this cell type. The authors identified a ..beta..-tubulin cDNA clone, ..beta..105, which is shown to correspond to the transcript of the betC ..beta..-tubulin locus and to encode ..beta..2 tubulin, the ..beta.. tubulin expressed specifically in the plasmodium and used exclusively in the mitotic spindle. Physarum amoebae utilize tubulins in the cytoskeleton, centrioles, and flagella, in addition to the mitotic spindle. Sequence analysis shows that ..beta..2 tubulin is only 83% identical to the two ..beta.. tubulins expressed in amoebae. This compares with 70 to 83% identity between Physarum ..beta..2 tubulin and the ..beta.. tubulins of yeasts, fungi, alga, trypanosome, fruit fly, chicken, and mouse. On the other hand, Physarum ..beta..2 tubulin is no more similar to, for example, Aspergillus ..beta.. tubulins than it is to those of Drosophila melanogaster or mammals. Several eucaryotes express at least one widely diverged ..beta.. tubulin as well as one or more ..beta.. tubulins that conform more closely to a consensus ..beta..-tubulin sequence. The authors suggest that ..beta..-tubulins diverge more when their expression pattern is restricted, especially when this restriction results in their use in fewer functions. This divergence among ..beta.. tubulins could have resulted through neutral drift. For example, exclusive use of Physarum ..beta..2 tubulin in the spindle may have allowed more amino acid substitutions than would be functionally tolerable in the ..beta.. tubulins that are utilized in multiple microtubular organelles. Alternatively, restricted use of ..beta.. tubulins may allow positive selection to operate more freely to refine ..beta..-tubulin function.

  20. Cap disease caused by heterozygous deletion of the beta-tropomyosin gene TPM2.


    Lehtokari, Vilma-Lotta; Ceuterick-de Groote, Chantal; de Jonghe, Peter; Marttila, Minttu; Laing, Nigel G; Pelin, Katarina; Wallgren-Pettersson, Carina


    "Cap myopathy" or "cap disease" is a congenital myopathy characterised by cap-like structures at the periphery of muscle fibres, consisting of disarranged thin filaments with enlarged Z discs. Here we report a deletion in the beta-tropomyosin (TPM2) gene causing cap disease in a 36-year-old male patient with congenital muscle weakness, myopathic facies and respiratory insufficiency. The mutation identified in this patient is an in-frame deletion (c.415_417delGAG) of one codon in exon 4 of TPM2 removing a single glutamate residue (p.Glu139del) from the beta-tropomyosin protein. This is expected to disrupt the seven-amino acid repeat essential for making a coiled coil, and thus to impair tropomyosin-actin interaction. Missense mutations in TPM2 have previously been found to cause rare cases of nemaline myopathy and distal arthrogryposis. This mutation is one not previously described and the first genetic cause identified for cap disease. PMID:17434307

  1. A missense mutation in the beta-2 integrin gene (ITGB2) causes canine leukocyte adhesion deficiency.


    Kijas, J M; Bauer, T R; Gäfvert, S; Marklund, S; Trowald-Wigh, G; Johannisson, A; Hedhammar, A; Binns, M; Juneja, R K; Hickstein, D D; Andersson, L


    Canine leukocyte adhesion deficiency (CLAD) is a fatal immunodeficiency disease found in Irish setters. The clinical manifestations of CLAD are very similar to LAD in humans and BLAD in cattle, which are both caused by mutations in ITGB2 encoding the leukocyte integrin beta-2 subunit (CD18). Sequence analysis of the ITGB2 coding sequence from a CLAD dog and a healthy control revealed a single missense mutation, Cys36Ser. This cysteine residue is conserved among all beta integrins, and the mutation most likely disrupts a disulfide bond. The mutation showed a complete association with CLAD in Irish setters and was not found in a sample of dogs from other breeds. The causative nature of this mutation was confirmed by transduction experiments using retroviral vectors and human LAD EBV B-cells. The normal canine CD18 formed heterodimers with the human CD11 subunit, whereas gene transfer of the mutant CD18 resulted in very low levels of CD11/CD18 expression. The identification of the causative mutation for CLAD now makes it possible to identify carrier animals with a simple diagnostic DNA test, and it forms the basis for using CLAD as a large animal model for the development and evaluation of clinical treatments for human LAD. PMID:10512685

  2. [Investigation of beta-lactamase genes and clonal relationship among the extended-spectrum beta-lactamase producing nosocomial Escherichia coli isolates].


    Görgeç, Sündüz; Kuzucu, Çiğdem; Otlu, Barış; Yetkin, Funda; Ersoy, Yasemin


    Extended-spectrum beta-lactamase (ESBL) producing microorganisms currently cause a major problem. Among theseCTX-M beta-lactamase producing Escherichia coli has also disseminated worldwide as an important cause of both nosocomial and community-acquired infections. The aims of this study were to determine the prevalence of the beta-lactamase genes, antibiotic susceptibilities and clonal relationships of ESBL-producing nosocomial E.coli isolates. A total of 76 ESBL-producing E.coli strains isolated from urine (n= 26), blood (n= 25) and wound (n= 25) specimens of hospitalized patients identified as nosocomial infection agents according to the CDC criteria between June 2010-June 2011 were included in the study. Antibiotic susceptibilities of the isolates were detected by Kirby-Bauer disc diffusion method according to CLSI recommendations. ESBL production was tested by double disc diffusion method, and cefotaxime/cefotaxime-clavulanic acid E-test strips (AB Biodisk, Sweden) were used for indeterminate results. Presence of TEM, SHV, CTX-M, OXA-2 group, 0XA-10 group, PER, VEB and GES beta-lactamase genes were investigated by polymerase chain reaction (PCR) using specific primers. Pulsed-field gel electrophoresis (PFGE) method was used for the detection of clonal relationships among the strains. Most of the ESBL-producing E.coli strains were isolated from samples of inpatients in intensive care (35%), internal medicine (16%) and general surgery (13%) units. All of the 76 strains were found susceptible to imipenem, meropenem and amikacin; however all were resistant to cefotaxime and ceftriaxone. The susceptibility rates of the isolates to cefoxitin, ertapenem, cefoperazone/sulbactam, piperacillin-tazobactam, gentamicin, ciprofloxacin, cefepime, amoxicillin-clavulanic acid, aztreonam and ceftazidime were 96%, 83%, 63%, 61%, 50%, 41%, 25%, 21%, 20% and 18%, respectively. Among E.coli isolates, the frequency of CTX-M, TEM, OXA-2 group, PER, SHV and OXA-10 group beta

  3. Identification of Leptospira serovars by RFLP of the RNA polymerase beta subunit gene (rpoB)

    PubMed Central

    Jung, Lenice Roteia Cardoso; Bomfim, Maria Rosa Quaresma; Kroon, Erna Geessien; Nunes, Álvaro Cantini


    Leptospires are usually classified by methods based on DNA-DNA hybridization and the conventional cross-agglutination absorption test, which uses polyclonal antibodies against lipopolysaccharides. In this study, the amplification of the rpoB gene, which encodes the beta-subunit of RNA polymerase, was used as an alternative tool to identify Leptospira. DNA extracts from sixty-eight serovars were obtained, and the hypervariable region located between 1990 and 2500-bp in the rpoB gene was amplified by polymerase chain reaction (PCR). The 600-bp amplicons of the rpoB gene were digested with the restriction endonucleases TaqI, Tru1I, Sau3AI and MslI, and the restriction fragments were separated by 6% polyacrylamide gel electrophoresis. Thirty-five fragment patters were obtained from the combined data of restriction fragment length polymorphism (PCR-RFLP) analysis and used to infer the phylogenetic relationships among the Leptospira species and serovars. The species assignments obtained were in full agreement with the established taxonomic classifications. Twenty-two serovars were effectively identified based on differences in their molecular profiles. However, the other 46 serovars remained clustered in groups that included more than one serovar of different species. This study demonstrates the value of RFLP analysis of PCR-amplified rpoB as an initial method for identifying Leptospira species and serovars. PMID:26273261

  4. Identification of the beta-glucosidase gene from Bifidobacterium animalis subsp. lactis and its expression in B. bifidum BGN4.


    Youn, So Youn; Park, Myeong Soo; Ji, Geun Eog


    beta-Glucosidase is necessary for the bioconversion of glycosidic phytochemicals in food. Two Bifidobacterium strains (Bifidobacterium animalis subsp. lactis SH5 and B. animalis subsp. lactis RD68) with relatively high beta- glucosidase activities were selected among 46 lactic acid bacteria. A beta-glucosidase gene (bbg572) from B. lactis was shotgun cloned, fully sequenced, and analyzed for its transcription start site, structural gene, and deduced transcriptional terminator. The structural gene of bbg572 was 1,383 bp. Based on amino sequence similarities, bbg572 was assigned to family 1 of the glycosyl hydrolases. To overexpress bbg572 in Bifidobacterium, several bifidobacteria expression vectors were constructed by combining several promoters and a terminator sequence from different bifidobacteria. The maximum activity of recombinant Bbg572 was achieved when it was expressed under its own promoter and terminator. Its enzyme activity increased 31-fold compared with those of its parental strains. The optimal pH for Bbg572 was pH 6.0. Bbg572 was stable at 37-40 degrees C. It hydrolyzed isoflavones, quercetins, and disaccharides with various beta-glucoside linkages. Bbg572 also converted the ginsenosides Rb1 and Rb2. These results suggest that this new beta-glucosidase-positive Bifidobacterium transformant can be utilized for the production of specific aglycone products. PMID:23221535

  5. Molecular cloning and characterization of beta-expansin gene related to root hair formation in barley.


    Kwasniewski, Miroslaw; Szarejko, Iwona


    Root hairs are specialized epidermal cells that play a role in the uptake of water and nutrients from the rhizosphere and serve as a site of interaction with soil microorganisms. The process of root hair formation is well characterized in Arabidopsis (Arabidopsis thaliana); however, there is a very little information about the genetic and molecular basis of root hair development in monocots. Here, we report on isolation and cloning of the beta-expansin (EXPB) gene HvEXPB1, tightly related to root hair initiation in barley (Hordeum vulgare). Using root transcriptome differentiation in the wild-type/root-hairless mutant system, a cDNA fragment present in roots of wild-type plants only was identified. After cloning of full-length cDNA and genomic sequences flanking the identified fragment, the subsequent bioinformatics analyses revealed homology of the protein coded by the identified gene to the EXPB family. Reverse transcription-PCR showed that expression of HvEXPB1 cosegregated with the root hair phenotype in F2 progeny of the cross between the hairless mutant rhl1.a and the wild-type Karat parent variety. Expression of the HvEXPB1 gene was root specific; it was expressed in roots of wild-type forms, but not in coleoptiles, leaves, tillers, and spikes. The identified gene was active in roots of two other analyzed root hair mutants: rhp1.a developing root hair primordia only and rhs1.a with very short root hairs. Contrary to this, a complete lack of HvEXPB1 expression was observed in roots of the spontaneous root-hairless mutant bald root barley. All these observations suggest a role of the HvEXPB1 gene in the process of root hair formation in barley. PMID:16679418

  6. The alpha/beta fold family of proteins database and the cholinesterase gene server ESTHER.

    PubMed Central

    Cousin, X; Hotelier, T; Giles, K; Lievin, P; Toutant, J P; Chatonnet, A


    ESTHER (for esterases, alpha/betahydrolase enzyme and relatives) is a database of sequences phylogenetically related to cholinesterases. These sequences define a homogeneous group of enzymes (carboxylesterases, lipases and hormone-sensitive lipases) sharing a similar structure of a central beta-sheet surrounded by alpha-helices. Among these proteins a wide range of functions can be found (hydrolases, adhesion molecules, hormone precursors). The purpose of ESTHER is to help comparison of structures and functions of members of the family. Since the last release, new features have been added to the server. A BLAST comparison tool allows sequence homology searches within the database sequences. New sections are available: kinetics and inhibitors of cholinesterases, fasciculin-acetylcholinesterase interaction and a gene structure review. The mutation analysis compilation has been improved with three-dimensional images. A mailing list has been created. PMID:9016525

  7. Influence of beta-blockers on the myocardial mRNA expressions of circadian clock- and metabolism-related genes.


    Ushijima, Kentarou; Maekawa, Tomohiro; Ishikawa-Kobayashi, Eiko; Ando, Hitoshi; Shiga, Tsuyoshi; Fujimura, Akio


    Daily rhythms are regulated by a master clock-system in the suprachiasmatic nucleus and by a peripheral clock-system in each organ. Because norepinephrine is one of the timekeepers for the myocardial circadian clock that influences cardiac metabolism, it is speculated that a beta-blocker may affect the circadian clock and metabolism in heart tissue. In this study, thirty mg/kg/day of propranolol (a lipophilic beta-blocker) or atenolol (a hydrophilic beta-blocker) was given orally to Wistar rats for 4 weeks. The mRNA expressions of Bmal1 and E4BP4 in heart tissue were suppressed by the beta-blockers. However, the mRNA expressions of these clock genes in the suprachiasmatic nucleus were unchanged. Myocardial mRNA expressions of lactate dehydrogenase a and pyruvate dehydrogenase kinase 4 were also suppressed by the beta-blockers. In addition, ATP content in heart tissue was significantly elevated by the beta-blockers throughout 24 hours. The effects of propranolol and atenolol did not differ significantly. This study showed for the first time that a beta-blocker affects myocardial clock gene expression. Propranolol and atenolol increased ATP content in heart tissue throughout 24 hours. The influences of beta-blockers may be negligible on the SCN, and may be independent of lipid solubility on heart tissue. It is well known that these drugs exert a protective effect against myocardial ischemia, which may be mediated by an increase in the preservation of myocardial ATP. PMID:23394803

  8. Inhibition of bacterial cell wall-induced leukocyte recruitment and hepatic granuloma formation by TGF-beta gene transfer.


    Song, X; Zeng, L; Pilo, C M; Zagorski, J; Wahl, S M


    Intraperitoneal injection of streptococcal cell walls (SCW) into Lewis rats results in dissemination of SCW to the liver, spleen, bone marrow, and peripheral joints. The uptake of SCW by Kupffer cells in the liver initiates a chain of events largely mediated by T lymphocytes and macrophages. Local synthesis and secretion of cytokines and growth factors in response to the persistent SCW lead to the evolution and maintenance of a chronic T cell-dependent granulomatous response and result in granuloma formation and irreversible hepatic fibrosis. In an attempt to impede the development of the chronic granulomatous lesions in the liver, we injected a plasmid DNA encoding TGF-beta 1 i.m. to the SCW animals to determine the effect of TGF-beta 1 gene transfer on the course of liver inflammation and fibrosis. A single injection of plasmid DNA encoding TGF-beta 1 resulted in virtual abolition of the development of the SCW-induced hepatic granuloma formation and matrix expansion. TGF-beta 1 DNA not only reduced key proinflammatory cytokines including TNF-alpha, IL-1 beta, IFN-gamma, and IL-18, but also inhibited both CXC and CC chemokine production, thereby blocking inflammatory cell recruitment and accumulation in the liver. Moreover, TGF-beta 1 gene delivery inhibited its own expression in the liver tissue, which is otherwise up-regulated in SCW-injected animals. Our study suggests that TGF-beta 1 gene transfer suppresses hepatic granuloma formation by blocking the recruitment of inflammatory cells to the liver, and thus may provide a new approach to the control of hepatic granulomatous and fibrotic diseases. PMID:10491005

  9. Cystatin B-deficient mice have increased expression of apoptosis and glial activation genes

    SciTech Connect

    Lieuallen, Kimberly; Pennacchio, Len A.; Park, Morgan; Myers, Richard M.; Lennon, Gregory G.


    Loss-of-function mutations in the cystatin B (Cstb) gene cause a neurological disorder known as Unverricht Lundborg disease (EPM1) in human patients. Mice that lack Cstb provide a mammalian model for EPM1 by displaying progressive ataxia and myoclonic seizures. We analyzed RNAs from brains of Cstb-deficient mice by using modified differential display, oligonucleotide microarray hybridization and quantitative reverse transcriptase polymerase chain reaction to examine the molecular consequences of the lack of Cstb. We identified seven genes that have consistently increased transcript levels in neurological tissues from the knockout mice. These genes are cathepsin S, C1q B-chain of complement (C1qB), beta-2-microglobulin, glial fibrillary acidic protein (Gfap), apolipoprotein D, fibronectin 1 and metallothionein II, which are expected to be involved in increased proteolysis, apoptosis and glial activation. The molecular changes in Cstb-deficient mice are consistent with the pathology found in the mouse model and may provide clues towards the identification of therapeutic points of intervention for EPM1 patients.

  10. Human beta-globin gene polymorphisms characterized in DNA extracted from ancient bones 12,000 years old.

    PubMed Central

    Béraud-Colomb, E; Roubin, R; Martin, J; Maroc, N; Gardeisen, A; Trabuchet, G; Goosséns, M


    Analyzing the nuclear DNA from ancient human bones is an essential step to the understanding of genetic diversity in current populations, provided that such systematic studies are experimentally feasible. This article reports the successful extraction and amplification of nuclear DNA from the beta-globin region from 5 of 10 bone specimens up to 12,000 years old. These have been typed for beta-globin frameworks by sequencing through two variable positions and for a polymorphic (AT) chi (T) gamma microsatellite 500 bp upstream of the beta-globin gene. These specimens of human remains are somewhat older than those analyzed in previous nuclear gene sequencing reports and considerably older than those used to study high-copy-number human mtDNA. These results show that the systematic study of nuclear DNA polymorphisms of ancient populations is feasible. Images Figure 2 Figure 3 PMID:8533755

  11. Expression of two CYP1A genes in {beta}NF and TCDD-treated rainbow trout primary hepatocyte culture

    SciTech Connect

    Rabergh, C.M.; Lipsky, M.M.; Vroliijk, N.H.; Chen, T.T.


    In mammalian systems, it is well known that two CYP1A genes are expressed in response to environmental toxicants such as polycyclic aromatic hydrocarbons (PAHs) and TCDD (2,3,7,3-tetrachlorodibenzo-p-dioxin). The presence of two CYP1A genes in fish has been previously reported, though expression of these two genes has not been characterized. In this study, the authors examined the expression of these two genes in primary culture of rainbow trout hepatocytes treated with {beta}NF and TCDD. Hepatocytes were isolated by a modified two-step collagenase perfusion of the liver and cultured on polylysine coated dishes. The optimum time and concentration of induction was determined for both chemicals. The expression of the genes was also studied in long-term cultures up to 20 days. RNA was isolated by the method of Chomzynski and Sacchi and the RNase protection assay was used to detect the expression of the CYP1A genes by using antisense riboprobes specific for the MRNA of each gene. A differential concentration- and time-dependent expression of the two genes was observed in cells treated with {beta}NF and TCDD. Whether these two genes are paralogous, i.e., produced by gene duplication within the species, or whether one of them may in fact be an orthologue to a mammalian counterpart within the CYP1A family, remains to be determined.

  12. Regulation of T cell receptor beta gene rearrangements and allelic exclusion by the helix-loop-helix protein, E47.


    Agata, Yasutoshi; Tamaki, Nobuyuki; Sakamoto, Shuji; Ikawa, Tomokatsu; Masuda, Kyoko; Kawamoto, Hiroshi; Murre, Cornelis


    Allelic exclusion of antigen-receptor genes is ensured primarily by monoallelic locus activation upon rearrangement and subsequently by feedback inhibition of continued rearrangement. Here, we demonstrated that the basic helix-loop-helix protein, E47, promoted T cell receptor beta (TCRbeta) gene rearrangement by directly binding to target gene segments to increase chromatin accessibility in a dosage-sensitive manner. Feedback signaling abrogated E47 binding, leading to a decline in accessibility. Conversely, enforced expression of E47 induced TCRbeta gene rearrangement by antagonizing feedback inhibition. Thus, the abundance of E47 is rate limiting in locus activation, and feedback signaling downregulates E47 activity to ensure allelic exclusion. PMID:18093539

  13. Regulatory elements and structural features of Beta vulgaris polygalacturonase-inhibiting protein gene for fungal and pest control

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polygalacturonase-inhibiting proteins (PGIPs) are involved in plant defense. PGIPs are cell wall leucine-rich repeat (LRR) proteins that are known to inhibit pathogen and pest polygalacturonases (PGs) during the infection process. Several sugar beet (Beta vulgaris L.) PGIP genes (BvPGIP) were clon...

  14. Evaluation of serum markers in the LRF CLL4 trial: β2-microglobulin but not serum free light chains, is an independent marker of overall survival.


    Pratt, Guy; Thomas, Peter; Marden, Nicola; Alexander, Denis; Davis, Zadie; Hussey, David; Parry, Helen; Harding, Stephen; Catovsky, Daniel; Begley, Joe; Oscier, David


    Chronic lymphocytic leukemia (CLL) is characterized by heterogeneous clinical behavior and there is a need for improved biomarkers. The current study evaluated the prognostic significance of serum free light chains (sFLC, kappa, and lambda) and other serum markers (bar, serum thymidine kinase (sTK), soluble CD23, and LDH) together with established biomarkers in 289 patients enrolled into the LRF CLL4 trial. In a multivariable analysis of serum markers alone, higher big and kappa light chains were statistically significant in predicting disease progression and higher blg, and sTK in predicting mortality. In multivariable analysis for overall survival the following were independently significant: β2M levels, immunoglobulin gene (IGHV) mutational status (>98% homology), age, 17p13 deletions (>10%), and CD38 expression. β2M is the only serum marker that retained clear independent value as a biomarker in the LRF CLL4 trial and remains powerfully prognostic requiring evaluation in any future method of risk stratifying patients. PMID:26732125

  15. Understanding the links among neuromedin U gene, beta2-adrenoceptor gene and bone health: an observational study in European children.


    Gianfagna, Francesco; Cugino, Daniela; Ahrens, Wolfgang; Bailey, Mark E S; Bammann, Karin; Herrmann, Diana; Koni, Anna C; Kourides, Yiannis; Marild, Staffan; Molnár, Dénes; Moreno, Luis A; Pitsiladis, Yannis P; Russo, Paola; Siani, Alfonso; Sieri, Sabina; Sioen, Isabelle; Veidebaum, Toomas; Iacoviello, Licia


    Neuromedin U, encoded by the NMU gene, is a hypothalamic neuropeptide that regulates both energy metabolism and bone mass. The beta-2 adrenergic receptor, encoded by the ADRB2 gene, mediates several effects of catecholamine hormones and neurotransmitters in bone. We investigated whether NMU single nucleotide polymorphisms (SNPs) and haplotypes, as well as functional ADRB2 SNPs, are associated with bone stiffness in children from the IDEFICS cohort, also evaluating whether NMU and ADRB2 interact to affect this trait. A sample of 2,274 subjects (52.5% boys, age 6.2 ± 1.8 years) from eight European countries, having data on calcaneus bone stiffness index (SI, mean of both feet) and genotyping (NMU gene: rs6827359, rs12500837, rs9999653; ADRB2 gene: rs1042713, rs1042714), was studied. After false discovery rate adjustment, SI was significantly associated with all NMU SNPs. rs6827359 CC homozygotes showed the strongest association (recessive model, Δ= -1.8, p=0.006). Among the five retrieved haplotypes with frequencies higher than 1% (range 2.0-43.9%), the CCT haplotype (frequency=39.7%) was associated with lower SI values (dominant model, Δ= -1.0, p=0.04) as compared to the most prevalent haplotype. A non-significant decrease in SI was observed in in ADRB2 rs1042713 GG homozygotes, while subjects carrying SI-lowering genotypes at both SNPs (frequency = 8.4%) showed much lower SI than non-carriers (Δ= -3.9, p<0.0001; p for interaction=0.025). The association was more evident in preschool girls, in whom SI showed a curvilinear trend across ages. In subgroup analyses, rs9999653 CC NMU or both GG ADRB2 genotypes were associated with either lower serum calcium or β-CrossLaps levels (p=0.01). This study in European children shows, for the first time in humans, a role for NMU gene through interaction with ADRB2 gene in bone strength regulation, more evident in preschool girls. PMID:23936460

  16. Understanding the Links among neuromedin U Gene, beta2-adrenoceptor Gene and Bone Health: An Observational Study in European Children

    PubMed Central

    Gianfagna, Francesco; Cugino, Daniela; Ahrens, Wolfgang; Bailey, Mark E. S.; Bammann, Karin; Herrmann, Diana; Koni, Anna C.; Kourides, Yiannis; Marild, Staffan; Molnár, Dénes; Moreno, Luis A.; Pitsiladis, Yannis P.; Russo, Paola; Siani, Alfonso; Sieri, Sabina; Sioen, Isabelle; Veidebaum, Toomas; Iacoviello, Licia


    Neuromedin U, encoded by the NMU gene, is a hypothalamic neuropeptide that regulates both energy metabolism and bone mass. The beta-2 adrenergic receptor, encoded by the ADRB2 gene, mediates several effects of catecholamine hormones and neurotransmitters in bone. We investigated whether NMU single nucleotide polymorphisms (SNPs) and haplotypes, as well as functional ADRB2 SNPs, are associated with bone stiffness in children from the IDEFICS cohort, also evaluating whether NMU and ADRB2 interact to affect this trait. A sample of 2,274 subjects (52.5% boys, age 6.2±1.8 years) from eight European countries, having data on calcaneus bone stiffness index (SI, mean of both feet) and genotyping (NMU gene: rs6827359, rs12500837, rs9999653; ADRB2 gene: rs1042713, rs1042714), was studied. After false discovery rate adjustment, SI was significantly associated with all NMU SNPs. rs6827359 CC homozygotes showed the strongest association (recessive model, Δ = −1.8, p = 0.006). Among the five retrieved haplotypes with frequencies higher than 1% (range 2.0–43.9%), the CCT haplotype (frequency = 39.7%) was associated with lower SI values (dominant model, Δ = −1.0, p = 0.04) as compared to the most prevalent haplotype. A non-significant decrease in SI was observed in in ADRB2 rs1042713 GG homozygotes, while subjects carrying SI-lowering genotypes at both SNPs (frequency = 8.4%) showed much lower SI than non-carriers (Δ = −3.9, p<0.0001; p for interaction = 0.025). The association was more evident in preschool girls, in whom SI showed a curvilinear trend across ages. In subgroup analyses, rs9999653 CC NMU or both GG ADRB2 genotypes were associated with either lower serum calcium or β-CrossLaps levels (p = 0.01). This study in European children shows, for the first time in humans, a role for NMU gene through interaction with ADRB2 gene in bone strength regulation, more evident in preschool girls. PMID:23936460

  17. The expression of pregnancy-specific {beta}1-glycoprotein genes in Meckel-Gruber syndrome fibroblasts

    SciTech Connect

    Wu, Shao-Ming; Cham, Wai-Yee


    Meckel-Gruber syndrome (MS) is an autosomal recessive disorder with multiple congenital malformations. The only available prenatal diagnostic marker for this disorder is the amniotic fluid level of pregnancy-specific {beta}1-glycoprotein (PSG). PSG is a family of proteins which are expressed at high levels during pregnancy. Increasing maternal serum PSG levels correlate with the progression of pregnancy and can be used as indicators for pregnancy outcome and fetal well-being. The amniotic fluid PSG level is about one-tenth of that of the maternal serum level in normal pregnancy, but are elevated in all cases of MS examined so far. On the other hand, the maternal serum PSG level and third trimester placental PSG content are normal in most cases of MS. This study aims at comparing the expression of PSG in fibroblasts derived from a fetus afflicted with MS. Total cellular RNA was extracted from two MS cultured fibroblast lines (M3206 and GM7817) and four age- and sex-matched control fibroblast lines obtained from the Human Genetic Mutant Cell Repository, Camden, NJ. The expression of eight PSG genes namely, PSG1, PSG2, PSG3, PSG4, PSG5, PSG6, PSG9 and PSG11, were examined with reverse transcription-polymerase chain reaction (RT-PCR). All PSG transcripts present in the cell were first amplified using universal primers in a 28-cycle PCR. Specific PSG gene products were then amplified with PSG gene-specific primers. Results showed that there is no significant difference in PSG expression between control and disease fibroblasts. In both cases, the most abundant transcript was the type II transcript of PSG5 followed by the type I transcripts of PSG1 and PG4. PSG9, PSG11 and PSG 3 were expressed at very low levels or not expressed at all in MS as well as in normal control fibroblasts. These results showed that PSG gene expression was not altered in MS fibroblasts.

  18. Identification of a Novel Single Nucleotide Polymorphism in Porcine Beta-Defensin-1 Gene.


    Pruthviraj, D R; Usha, A P; Venkatachalapathy, R T


    Porcine beta-defensin-1 (PBD-1) gene plays an important role in the innate immunity of pigs. The peptide encoded by this gene is an antimicrobial peptide that has direct activity against a wide range of microbes. This peptide is involved in the co-creation of an antimicrobial barrier in the oral cavity of pigs. The objective of the present study was to detect polymorphisms, if any, in exon-1 and exon-2 regions of PBD-1 gene in Large White Yorkshire (LWY) and native Ankamali pigs of Kerala, India. Blood samples were collected from 100 pigs and genomic DNA was isolated using phenol chloroform method. The quantity of DNA was assessed in a spectrophotometer and quality by gel electrophoresis. Exon-1 and exon-2 regions of PBD-1 gene were amplified by polymerase chain reaction (PCR) and the products were subjected to single strand conformation polymorphism (SSCP) analysis. Subsequent silver staining of the polyacrylamide gels revealed three unique SSCP banding patterns in each of the two exons. The presence of single nucleotide polymorphisms (SNPs) was confirmed by nucleotide sequencing of the PCR products. A novel SNP was found in the 5'-UTR region of exon-1 and a SNP was detected in the mature peptide coding region of exon-2. In exon-1, the pooled population frequencies of GG, GT, and TT genotypes were 0.67, 0.30, and 0.03, respectively. GG genotype was predominant in both the breeds whereas TT genotype was not detected in LWY breed. Similarly, in exon-2, the pooled population frequencies of AA, AG, and GG genotypes were 0.50, 0.27, and 0.23, respectively. AA genotype was predominant in LWY pigs whereas GG genotype was predominant in native pigs. These results suggest that there exists a considerable genetic variation at PBD-1 locus and further association studies may help in development of a PCR based genotyping test to select pigs with better immunity. PMID:26950860

  19. Identification of a Novel Single Nucleotide Polymorphism in Porcine Beta-Defensin-1 Gene

    PubMed Central

    Pruthviraj, D. R.; Usha, A. P.; Venkatachalapathy, R. T.


    Porcine beta-defensin-1 (PBD-1) gene plays an important role in the innate immunity of pigs. The peptide encoded by this gene is an antimicrobial peptide that has direct activity against a wide range of microbes. This peptide is involved in the co-creation of an antimicrobial barrier in the oral cavity of pigs. The objective of the present study was to detect polymorphisms, if any, in exon-1 and exon-2 regions of PBD-1 gene in Large White Yorkshire (LWY) and native Ankamali pigs of Kerala, India. Blood samples were collected from 100 pigs and genomic DNA was isolated using phenol chloroform method. The quantity of DNA was assessed in a spectrophotometer and quality by gel electrophoresis. Exon-1 and exon-2 regions of PBD-1 gene were amplified by polymerase chain reaction (PCR) and the products were subjected to single strand conformation polymorphism (SSCP) analysis. Subsequent silver staining of the polyacrylamide gels revealed three unique SSCP banding patterns in each of the two exons. The presence of single nucleotide polymorphisms (SNPs) was confirmed by nucleotide sequencing of the PCR products. A novel SNP was found in the 5′-UTR region of exon-1 and a SNP was detected in the mature peptide coding region of exon-2. In exon-1, the pooled population frequencies of GG, GT, and TT genotypes were 0.67, 0.30, and 0.03, respectively. GG genotype was predominant in both the breeds whereas TT genotype was not detected in LWY breed. Similarly, in exon-2, the pooled population frequencies of AA, AG, and GG genotypes were 0.50, 0.27, and 0.23, respectively. AA genotype was predominant in LWY pigs whereas GG genotype was predominant in native pigs. These results suggest that there exists a considerable genetic variation at PBD-1 locus and further association studies may help in development of a PCR based genotyping test to select pigs with better immunity. PMID:26950860

  20. Arsenite oxidase aox genes from a metal-resistant beta-proteobacterium.


    Muller, Daniel; Lièvremont, Didier; Simeonova, Diliana Dancheva; Hubert, Jean-Claude; Lett, Marie-Claire


    The beta-proteobacterial strain ULPAs1, isolated from an arsenic-contaminated environment, is able to efficiently oxidize arsenite [As(III)] to arsenate [As(V)]. Mutagenesis with a lacZ-based reporter transposon yielded two knockout derivatives deficient in arsenite oxidation. Sequence analysis of the DNA flanking the transposon insertions in the two mutants identified two adjacent open reading frames, named aoxA and aoxB, as well as a putative promoter upstream of the aoxA gene. Reverse transcription-PCR data indicated that these genes are organized in an operonic structure. The proteins encoded by aoxA and aoxB share 64 and 72% identity with the small Rieske subunit and the large subunit of the purified and crystallized arsenite oxidase of Alcaligenes faecalis, respectively (P. J. Ellis, T. Conrads, R. Hille, and P. Kuhn, Structure [Cambridge] 9:125-132, 2001). Importantly, almost all amino acids involved in cofactor interactions in both subunits of the A. faecalis enzyme were conserved in the corresponding sequences of strain ULPAs1. An additional Tat (twin-arginine translocation) signal peptide sequence was detected at the N terminus of the protein encoded by aoxA, strongly suggesting that the Tat pathway is involved in the translocation of the arsenite oxidase to its known periplasmic location. PMID:12486049

  1. NeuroD1/beta2 contributes to cell-specific transcription of the proopiomelanocortin gene.

    PubMed Central

    Poulin, G; Turgeon, B; Drouin, J


    NeuroD1/beta2 is a basic helix-loop-helix (bHLH) factor expressed in the endocrine cells of the pancreas and in a subset of neurons as they undergo terminal differentiation. We now show that NeuroD1 is expressed in corticotroph cells of the pituitary gland and that it is involved in cell-specific transcription of the proopiomelanocortin (POMC) gene. It was previously shown that corticotroph-specific POMC transcription depends in part on the action of cell-restricted bHLH factors that were characterized as the CUTE (corticotroph upstream transcription element) (M. Therrien and J. Drouin, Mol. Cell. Biol. 13:2342-2353, 1993) complexes. We now demonstrate that these complexes contain NeuroD1 in association with various ubiquitous bHLH dimerization partners. The NeuroD1-containing heterodimers specifically recognize and activate transcription from the POMC promoter E box that confers transcriptional specificity. Interestingly, the NeuroD1 heterodimers activate transcription in synergy with Ptx1, a Bicoid-related homeodomain protein, which also contributes to corticotroph specificity of POMC transcription. In the adult pituitary gland, NeuroD1 transcripts are detected in POMC-expressing corticotroph cells. Taken together with the restricted pattern of Ptx1 expression, these results suggest that these two factors establish the basis of a combinatorial code for the program of corticotroph-specific gene expression. PMID:9343431

  2. Prognostic implications of novel beta cardiac myosin heavy chain gene mutations that cause familial hypertrophic cardiomyopathy.

    PubMed Central

    Anan, R; Greve, G; Thierfelder, L; Watkins, H; McKenna, W J; Solomon, S; Vecchio, C; Shono, H; Nakao, S; Tanaka, H


    Three novel beta cardiac myosin heavy chain (MHC) gene missense mutations, Phe513Cys, Gly716Arg, and Arg719Trp, which cause familial hypertrophic cardiomyopathy (FHC) are described. One mutation in exon 15 (Phe513Cys) does not alter the charge of the encoded amino acid, and affected family members have a near normal life expectancy. The Gly716Arg mutation (exon 19; charge change of +1) causes FHC in three family members, one of whom underwent transplantation for heart failure. The Arg719Trp mutation (exon 19; charge change of -1) was found in four unrelated FHC families with a high incidence of premature death and an average life expectancy in affected individuals of 38 yr. A comparable high frequency of disease-related deaths in four families with the Arg719Trp mutation suggests that this specific gene defect directly accounts for the observed malignant phenotype. Further, the significantly different life expectancies associated with the Arg719Trp vs. Phe513Cys mutation (P < 0.001) support the hypothesis that mutations which alter the charge of the encoded amino acid affect survival more significantly than those that produce a conservative amino acid change. Images PMID:8282798

  3. Structural and phylogenetic analysis of the MHC class I-like Fc receptor gene

    SciTech Connect

    Kandil, Eman; Ishibashi, Teruo; Kasahara, Masanori


    The intestinal epithelium of neonatal mice and rats expresses an Fc receptor that mediates selective uptake of IgG in mothers`milk. This receptor (FcRn), which helps newborn animals to acquire passive immunity, is an MHC class I-like heterodimer made up of a heavy chain and {beta}{sub 2}-microglobulin. In the present study, we determined the genomic structure of a mouse gene (FcRn) encoding the heavy of FcRn. The overall exon-intron organization of the Fcrn gene was similar to that of the Fcrn gene, thus providing structural evidence that Fcrn os a bona fide class I gene. The 5{prime}-flanking region of the Fcrn gene contained the binding motifs for two cytokine-inducible transcription factors, NF-IL6 and NF1. However, regulatory elements found in MHC class I genes (enhancer A, enhancer B, and the IFN response element) were absent. Phylogenetic tree analysis suggested that, like the MICA, AZGP1, and CD1 genes, the Fcrn gene diverged form MHC class I genes after the emergence of amphibians but before the split of placental and marsupial mammals. Consistent with this result, Southern blot analysis with a mouse Fcrn cDNA probe detected cross-hybridizing bands in various mammalian species and chickens. Sequence analysis of the Fcrn gene isolated from eight mouse strains showed that the membrane-distal domain of FcRn has at least three amino acid variants. The fact that Fcrn is a single copy gene indicates that it is expressed in both the neonatal intestine and the fetal yolk sac. 74 refs., 7 figs., 2 tabs.

  4. beta-Glucosidase as a reporter for the gene expression studies in Thermus thermophilus and constitutive expression of DNA repair genes.


    Ohta, Toshihiro; Tokishita, Shin-Ichi; Imazuka, Reiko; Mori, Ichiro; Okamura, Jin; Yamagata, Hideo


    Thermus thermophilus is an extremely thermophilic eubacterium that grows optimally at 70-75 degrees C. Because the frequency of DNA damage, such as deamination, depurination and single-strand breaks, increases as the temperature rises, the regulation of expression as well as the specificities and activities of T.thermophilus DNA repair systems are of particular interest. To study those systems, we developed a gene expression vector using the T.thermophilus beta-glucosidase gene (bgl) with host strain JOS9 (Deltabgl) derived from the T.thermophilus wild-type strain HB27. Since HB27 has two putative beta-galactosidase genes, the use of a single bgl gene as a reporter in combination with a Deltabgl host strain permits the study of gene expression against a low background level. We assayed Bgl activity with 2-nitrophenyl-beta-d-glucopyranoside as the substrate at 80 degrees C. We measured the expression of seven genes involved in DNA repair--three nucleotide excision repair genes (uvrA, uvrB and uvrC) and four recombinational repair genes (recA, ruvA, ruvB and ruvC). Expression levels of uvrA and uvrB were about three times those of uvrC, while those of ruvA, ruvB and ruvC were almost equal. Both ruvA and ruvC formed an operon with their adjacent 5'-upstream gene paaG and ftsQAZ, respectively. recA was transcribed as an operon of four genes, amt-cinA-ligT-recA. All seven DNA repair genes were expressed constitutively, and the DNA damaging agent mitomycin C did not increase their expression. PMID:16777922

  5. Is the staple diet eaten in Medawachchiya, Sri Lanka, a predisposing factor in the development of chronic kidney disease of unknown etiology? - A comparison based on urinary β2-microglobulin measurements

    PubMed Central


    Background Exact mechanism of causation of chronic kidney disease of unknown etiology (CKDu) in Sri Lanka is not described to date, despite the identification of possible multiple risk factors. Questions have been raised as to why only some are affected while others remain intact, though they are inhabitants of the same locality. Methods Comparative studies were carried out, assessing urinary β2 microglobulin (β2m) and the dietary patterns of CKDu patients and age sex matched non-CKDu subjects. Urinary β2m levels of spot urine samples were analyzed using the Enzyme-linked Immunosorbent assay (ELISA) and dietary patterns were studied using twenty four hour dietary recalls and frequency consumption of foods of animal origin performed on three occasions at six months intervals within a period of one and half years. Results The mean urinary β2m level of CKDu patients from Medawachchiya was significantly (p < 0.05) higher when compared with that of the non-CKDu subjects. The mean urinary β2m level of the non-CKDu subjects was within the reference limits for spot urine samples (0 – 0.3 μg/mL). White raw rice was the staple diet of both CKDu patients and non-CKDu subjects and the level of consumption was almost the same. The consumption of fresh water fish products of CKDu patients under high (14, 14%), moderate (36, 36%), low (26, 26%) and less (20, 20%) categories did not show significant variations (p > 0.05) compared to non-CKDu subjects. Conclusions Staple food in diet and the consumption pattern of CKDu patients from Medawachchiya were similar to that of non-CKDu subjects from the same area despite their urinary β2m concentration being significantly higher. PMID:24988874

  6. A single gene directs synthesis of a precursor protein with beta- and alpha-amylase activities in Bacillus polymyxa.

    PubMed Central

    Uozumi, N; Sakurai, K; Sasaki, T; Takekawa, S; Yamagata, H; Tsukagoshi, N; Udaka, S


    The Bacillus polymyxa amylase gene comprises 3,588 nucleotides. The mature amylase comprises 1,161 amino acids with a molecular weight of 127,314. The gene appeared to be divided into two portions by the direct-repeat sequence located at almost the middle of the gene. The 5' region upstream of the direct-repeat sequence was shown to be responsible for the synthesis of beta-amylase. The 3' region downstream of the direct-repeat sequence contained four sequences homologous with those in other alpha-amylases, such as Taka-amylase A. The 48-kilodalton (kDa) amylase isolated from B. polymyxa was proven to have alpha-amylase activity. The amino acid sequences of the peptides generated from the 48-kDa amylase showed complete agreement with the predicted amino acid sequence of the C-terminal portion. The B. polymyxa amylase gene was therefore concluded to contain in-phase beta- and alpha-amylase-coding sequences in the 5' and 3' regions, respectively. A precursor protein, a 130-kDa amylase, directed by a plasmid, pYN520, carrying the entire amylase gene, had both beta- and alpha-amylase activities. This represents the first report of a single protein precursor in procaryotes that gives rise to two enzymes. Images PMID:2464578

  7. A second glutamine synthetase gene with expression in the gills of the gulf toadfish (opsanus beta)

    SciTech Connect

    Walsh, Patrick J.; Mayer, Gregory D.; Medina, Monica; Bernstein, Matthew L.; Barimo, John F.; Mommsen, Thomas P.


    Enzyme and molecular biology approaches were used to more completely characterize the expression of the nitrogen metabolism enzyme glutamine synthetase [GSase; L-glutamate: ammonia ligase (ADP-forming), E.C.] in a variety of tissues of the gulf toadfish (Opsanus beta) subjected to unconfined (ammonotelic) and confined (ureotelic) conditions. Enzymological results demonstrate that while weight-specific GSase activities rank in the order of brain > liver > stomach {approx} kidney > intestine > gill> heart/spleen > muscle, when tissue mass is used to calculate a glutamine synthetic potential, the liver has the greatest, followed by muscle > stomach and intestine with minor contributions from the remaining tissues. Additionally, during confinement stress, GSase activity only increases significantly in liver (5-fold) and muscle (2-fold), tissues which previously showed significant expression of the other enzymes of urea synthesis. RT PCR and RACE PCR revealed the presence of a second GSas e cDNA from gill tissue that appears to share relatively low nucleotide and amino acid sequence similarity ({approx}73 percent) with the original GSase cloned from liver, and furthermore lacks a mitochondrial leader targeting sequence. RT PCR and restriction digestion experiments demonstrated that mRNA from the original ''liver'' GSase is expressed in all tissues examined (liver, gill, stomach, intestine, kidney, brain and muscle), whereas the new ''gill'' form shows expression primarily in the gill. Enzyme activities of gill GSase also exhibit a different subcellular compartmentation with apparent exclusive expression in the soluble compartment, whereas other tissues expressing the ''liver'' form show both cytoplasmic and mitochondrial activities. Finally, phylogenetic analysis of a number of GSases demonstrates that the toadfish gill GSase has a greater affinity for a clade that includes the Xenopus GSase genes and one of two Fugu GSase genes, than it has for a clade

  8. Baseline Gene Expression Signatures in Monocytes from Multiple Sclerosis Patients Treated with Interferon-beta

    PubMed Central

    Bustamante, Marta F.; Nurtdinov, Ramil N.; Río, Jordi; Montalban, Xavier; Comabella, Manuel


    Background A relatively large proportion of relapsing-remitting multiple sclerosis (RRMS) patients do not respond to interferon-beta (IFNb) treatment. In previous studies with peripheral blood mononuclear cells (PBMC), we identified a subgroup of IFNb non-responders that was characterized by a baseline over-expression of type I IFN inducible genes. Additional mechanistic experiments carried out in IFNb non-responders suggested a selective alteration of the type I IFN signaling pathway in the population of blood monocytes. Here, we aimed (i) to investigate whether the type I IFN signaling pathway is up-regulated in isolated monocytes from IFNb non-responders at baseline; and (ii) to search for additional biological pathways in this cell population that may be implicated in the response to IFNb treatment. Methods Twenty RRMS patients classified according to their clinical response to IFNb treatment and 10 healthy controls were included in the study. Monocytes were purified from PBMC obtained before treatment by cell sorting and the gene expression profiling was determined with oligonucleotide microarrays. Results and discussion Purified monocytes from IFNb non-responders were characterized by an over-expression of type I IFN responsive genes, which confirms the type I IFN signature in monocytes suggested from previous studies. Other relevant signaling pathways that were up-regulated in IFNb non-responders were related with the mitochondrial function and processes such as protein synthesis and antigen presentation, and together with the type I IFN signaling pathway, may also be playing roles in the response to IFNb. PMID:23637780

  9. Assignment of the gene for the. beta. subunit of thyroid-stimulating hormone to the short arm of human chromosome 1

    SciTech Connect

    Dracopoli, N.C.; Rettig, W.J.; Whitfield, G.K.; Darlington, G.J.; Spengler, B.A.; Biedler, J.L.; Old, L.J.; Kourides, I.A.


    The chromosomal locations of the genes for the ..beta.. subunit of human thyroid-stimulating hormone (TSH) and the glycoprotein hormone ..cap alpha.. subunit have been determined by restriction enzyme analysis of DNA extracted from rodent-human somatic cell hybrids. Human chorionic gonadotropin (CG) ..cap alpha..-subunit cDNA and a cloned 0.9-kilobase (kb) fragment of the human TSH ..beta..-subunit gene were used as hybridization probes in the analysis of Southern blots of DNA extracted from rodent-human hybrid clones. Analysis of the segregation of 5- and 10-kb EcoRI fragments hybridizing to CG ..cap alpha..-subunit cDNA confirmed the previous assignment of this gene to chromosome 6. Analysis of the patterns of segregation of a 2.3-kb EcoRI fragment containing human TSH ..beta..-subunit sequences permitted the assignment of the TSH ..beta..-subunit gene to human chromosome 1. The subregional assignment of TSH ..beta.. subunit to chromosome 1p22 was made possible by the additional analysis of a set of hybrids containing partially overlapping segments of this chromosome. Human TSH ..beta.. subunit is not syntenic with genes encoding the ..beta.. subunits of CG, luteinizing hormone, or follicle-stimulating hormone and is assigned to a conserved linkage group that also contains the structural genes for the ..beta.. subunit of nerve growth factor (NGFB) and the proto-oncogene N-ras (NRAS).

  10. Influence of beta(2)-integrin adhesion molecule expression and pulmonary infection with Pasteurella haemolytica on cytokine gene expression in cattle.


    Lee, H Y; Kehrli, M E; Brogden, K A; Gallup, J M; Ackermann, M R


    beta(2)-Integrins are leukocyte adhesion molecules composed of alpha (CD11a, -b, -c, or -d) and beta (CD18) subunit heterodimers. Genetic CD18 deficiency results in impaired neutrophil egress into tissues that varies between conducting airways and alveoli of the lung. In this study, we investigated whether CD18 deficiency in cattle affects proinflammatory cytokine (PIC) expression in pulmonary tissue after respiratory infection with Pasteurella haemolytica. Cattle were infected with P. haemolytica via fiberoptic deposition of organisms into the posterior part of the right cranial lung lobe. Animals were euthanized at 2 or 4 h postinoculation (p.i.), and tissues were collected to assess PIC gene expression using antisense RNA probes specific for bovine interleukin-1alpha (IL-1alpha), IL-1beta, IL-6, gamma interferon (IFN-gamma), and tumor necrosis factor alpha (TNF-alpha) along with the beta-actin (beta-Act) housekeeping gene. Expression of PIC was induced at 2 h p.i. in P. haemolytica-infected cattle and continued to 4 h p.i. At 2 h p.i., induction of gene expression and increase of cells that expressed PIC were observed both in CD18(+) and CD18(-) cattle after inoculation of P. haemolytica. The induction of gene expression with P. haemolytica inoculation was more prominent in CD18(-) cattle than in CD18(+) cattle by comparison to pyrogen-free saline (PFS)-inoculated control animals. At 4 h p.i., however, the induction of PIC, especially IL-1alpha, IL-6, and IFN-gamma, in the lungs of CD18(+) cattle inoculated with P. haemolytica was greater than that in lungs of the CD18(-) cattle. IFN-gamma and TNF-alpha genes were not increased in P. haemolytica-inoculated CD18(-) cattle lungs compared to the PFS-inoculated control lungs at 4 h p.i. In PFS-inoculated lungs, we generally observed a higher percentage of cells and higher level of gene expression in the lungs of CD18(-) cattle than in the lungs of CD18(+) cattle, especially at 4 h p.i. The rate of neutrophil

  11. Linkage of two human pregnancy-specific. beta. sub 1 -glycoprotein genes: One is associated with hydatidiform mole

    SciTech Connect

    Leslie, K.K.; Watanabe, Shuichiro; Lei, Kejian; Chou, D.Y.; Plouzek, C.A.; Deng, Hweichuang; Torres, J.; Chou, J.Y. )


    A genomic clone containing two linked human pregnancy-specific {beta}{sub 1}-glycoprotein (PS{beta}G) genes has been isolated and characterized. The two genes are arranged in the same 5{prime} {yields} 3{prime} orientation; the 3{prime} region (including the A2 and B-C exons) of the upstream gene, PSGGA, is linked to the 5{prime} region (including the 5{prime}/L and L/N exons) of PSGGB, the downstream gene. Depending upon the domains compared, PSGGA and PSGGB share 92-98% nucleotide and 86-95% amino acid sequence identity with PSG93, the most abundant PS{beta}G transcript. Northern blot hybridization performed with a PSGGB-specific oligonucleotide probe to the N domain revealed that PSGGB or a PSGGB-like gene encodes a major 1.7-kilobase mRNA in hydatidiform mole tissues and a major 2.0-kilobase mRNA in term placenta tissues. Moreover, the PSGGB-specific probe hybridized most strongly with mRNA from molar trophoblastic tissue, suggesting that the PSGGB-like species may be the gene preferentially expressed in gestational trophoblastic disease. Additionally, the sequence of a 2,315-base-pair PS{beta}G cDNA (PSG95) that contains an N-A1-A2-B2-C domain arrangement is reported. The coding region of PSG95 is identical to the previously reported cDNA clones PSG1d and FL-NCA, but PSG95 contains an additional 518 and 523 base pairs in the 3{prime} end as compared with PSG1d and FL-NCA, respectively.

  12. The Internally Self-fertilizing Hermaphroditic Teleost Rivulus marmoratus (Cyprinodontiformes, Rivulidae) beta-Actin Gene: Amplification and Sequence Analysis with Conserved Primers.




    To determine the ease and feasibility of amplifying the beta-actin gene in fish by the polymerase chain reaction (PCR), genomic DNAs of several fish (Rivulus, Southern top mouth minnow, common fat minnow, oily bitterling, carp, Far Eastern catfish, medaka, and European flounder) were extracted and used as a template with conserved primers, designed on the basis of high amino acid homology (approximately 98% or more). Among them, the self-fertilizing hermaphroditic fish Rivulus marmoratus was chosen for further characterization. After amplification of the Rivulus beta-actin PCR product with Taq polymerase, PCR product was subcloned to pCRII vector. After restriction enzyme mapping of Rivulus beta-actin gene, the amplified insert was sequenced using ALF Express automatic DNA sequencer with conserved internal primers. The R. marmoratus beta-actin gene consists of 1763 bp encoding 375 amino acids including 5 exons and 4 introns. The splicing and acceptance sites of the exon and intron boundaries of the Rivulus beta-actin gene were highly conserved with consensus sequences (GT/AG). The amino acid homology of R. marmoratus beta-actin to other species was high: 98.93% to human; 98.93%, Atlantic salmon; 98.93%, common carp; 98.93%, grass carp; 98.93%, zebrafish; 98.67%, medaka; and 98.40%, sea bream. To determine the expression of the R. marmoratus beta-actin gene in liver and ovary, reverse transcriptase-polymerase chain reaction was carried out with internal primers. In conclusion, these universal primers are successful in the rapid cloning of the fish beta-actin gene by PCR, based on a high homology of the beta-actin gene conserved through evolution. This approach will be applicable to the isolation of other beta-actin homologues in the investigation of phylogenetic comparisons of fish species, along with a possible application to cloning strategy in other conserved genes. PMID:10811955

  13. Evolutionary diversification of the BetaM interactome acquired through co-option of the ATP1B4 gene in placental mammals

    PubMed Central

    Korneenko, Tatyana V.; Pestov, Nikolay B.; Ahmad, Nisar; Okkelman, Irina A.; Dmitriev, Ruslan I.; Shakhparonov, Mikhail I.; Modyanov, Nikolai N.


    ATP1B4 genes represent a rare instance of orthologous vertebrate gene co-option that radically changed properties of the encoded BetaM proteins, which function as Na,K-ATPase subunits in lower vertebrates and birds. Eutherian BetaM has lost its ancestral function and became a muscle-specific resident of the inner nuclear membrane. Our earlier work implicated BetaM in regulation of gene expression through direct interaction with the transcriptional co-regulator SKIP. To gain insight into evolution of BetaM interactome we performed expanded screening of eutherian and avian cDNA libraries using yeast-two-hybrid and split-ubiquitin systems. The inventory of identified BetaM interactors includes lamina-associated protein LAP-1, myocyte nuclear envelope protein Syne1, BetaM itself, heme oxidases HMOX1 and HMOX2; transcription factor LZIP/CREB3, ERGIC3, PHF3, reticulocalbin-3, and β-sarcoglycan. No new interactions were found for chicken BetaM and human Na,K-ATPase β1, β2 and β3 isoforms, indicating the uniqueness of eutherian BetaM interactome. Analysis of truncated forms of BetaM indicates that residues 72-98 adjacent to the membrane in nucleoplasmic domain are important for the interaction with SKIP. These findings demonstrate that evolutionary alterations in structural and functional properties of eutherian BetaM proteins are associated with the increase in its interactome complexity. PMID:26939788

  14. Evolutionary diversification of the BetaM interactome acquired through co-option of the ATP1B4 gene in placental mammals.


    Korneenko, Tatyana V; Pestov, Nikolay B; Ahmad, Nisar; Okkelman, Irina A; Dmitriev, Ruslan I; Shakhparonov, Mikhail I; Modyanov, Nikolai N


    ATP1B4 genes represent a rare instance of orthologous vertebrate gene co-option that radically changed properties of the encoded BetaM proteins, which function as Na,K-ATPase subunits in lower vertebrates and birds. Eutherian BetaM has lost its ancestral function and became a muscle-specific resident of the inner nuclear membrane. Our earlier work implicated BetaM in regulation of gene expression through direct interaction with the transcriptional co-regulator SKIP. To gain insight into evolution of BetaM interactome we performed expanded screening of eutherian and avian cDNA libraries using yeast-two-hybrid and split-ubiquitin systems. The inventory of identified BetaM interactors includes lamina-associated protein LAP-1, myocyte nuclear envelope protein Syne1, BetaM itself, heme oxidases HMOX1 and HMOX2; transcription factor LZIP/CREB3, ERGIC3, PHF3, reticulocalbin-3, and β-sarcoglycan. No new interactions were found for chicken BetaM and human Na,K-ATPase β1, β2 and β3 isoforms, indicating the uniqueness of eutherian BetaM interactome. Analysis of truncated forms of BetaM indicates that residues 72-98 adjacent to the membrane in nucleoplasmic domain are important for the interaction with SKIP. These findings demonstrate that evolutionary alterations in structural and functional properties of eutherian BetaM proteins are associated with the increase in its interactome complexity. PMID:26939788

  15. Molecular cloning and sequencing of two phospho-beta-galactosidase I and II genes of Lactobacillus gasseri JCM1031 isolated from human intestine.


    Saito, T; Suzuki, M; Konno, K; Kitazawa, H; Kawai, Y; Itoh, T; Kamio, Y


    Lactobacillus (Lb.) gasseri JCM1031, which is classified into the B1 subgroup of the Lb. acidophilus group of lactic acid bacteria, characteristically produces two different phospho-beta-galactosidases (P-beta-gal) I and II in the same cytosol as reported in our previous papers [Biosci. Biotech. Biochem., 60, 139-141, 708-710 (1996)]. To clarify the functional and genetic properties of the two enzymes, the structural genes of P-beta-gal I and II were cloned and sequenced. The structural gene of P-beta-gal I had 1,446 bp, encoding a polypeptide of 482 amino acid residues. The structural gene of P-beta-gal II had 1,473 bp, encoding a polypeptide of 491 amino acid residues. The deduced relative molecular masses of 55,188 and 56,243 agreed well with the previous value obtained from the purified P-beta-gal I and II protein, respectively. Multiple alignment of the protein sequence of P-beta-gal I and II with those of P-beta-gals from 5 microorganisms had 30-35% identity on the amino acid level, but those with phospho-beta-glucosidases from 5 microorganisms had the relatively high identity of about 50%. Considering that this strain grows on lactose medium and shows no beta-galactosidase activity, and that purified P-beta-gal I and II can obviously hydrolyze o-nitrophenyl-beta-D-galactopyranoside 6-phosphate (substrate), and also the conservation of a cysteine residue in the molecule, the P-beta-gal I and II were each confirmed as a novel P-beta-gal enzyme. PMID:9972258

  16. Localization of the human {beta}-catenin gene (CTNNB1) to 3p21: A region implicated in tumor development

    SciTech Connect

    Kraus, C.; Liehr, T.; Ballhausen, G.


    The human {beta}-catenin locus (CTNNB1) was mapped by in situ fluorescence analysis to band p21 on the short arm of chromosome 3, a region frequently affected by somatic alterations in a variety of tumors. PCR primers for the genomic amplification of {beta}-catenin sequences were selected on the basis of homology to exon 4 of the Drosophila armadillo gene. Analysis of a panel of somatic cell hybrids confirmed the localization of {beta}-catenin on human chromosome 3. Furthermore, exclusion mapping of three hybrids carrying defined fragments of the short arm of human chromosome 3 allowed us to determine the position of the CTNNB1 locus close to the marker D3S2 in 3p21. 22 refs., 3 figs.

  17. Analysis of structure and expression of the Xenopus thyroid hormone receptor-beta gene to explain its autoinduction.


    Machuca, I; Esslemont, G; Fairclough, L; Tata, J R


    Transcription of both Xenopus thyroid hormone receptor (TR) genes, xTR alpha and -beta, is strongly up-regulated by their own ligand T3 during natural or T3-induced metamorphosis of tadpoles and in some Xenopus cell lines. To explain this autoinduction, we analyzed the sequence of 1.6 kilobases of xTR beta promoter for putative T3-responsive elements. Two direct repeat +4 AGGTCA hexamer motifs (DR+4), an imperfect distal (-793/-778) and a perfect proximal (-5/11) site, a DR+1 site, and some possible half-sites were located in the 1.6-kilobase promoter. Transfection of Xenopus XTC-2 cells (which express xTR alpha and -beta) and XL-2 cells (which predominantly express TR alpha) with chloramphenicol acetyltransferase reporter constructs of deletion mutants and promoter fragments showed that the distal and proximal DR+4 sites responded to T3, although other flanking sequences may also play a role. The thyroid hormone-responsive element half-site present as DR+1 in the up-stream sequence at -1260/-950, when cloned in front of a heterologous promoter, functions independently. T3 enhanced transcription from the two DR+4-containing fragments when present together by only 2- to 3-fold due to a high basal activity. Overexpression of unliganded xTR alpha and xTR beta in XTC-2 cells repressed basal activity, which was then enhanced 7- to 4-fold by T3, respectively; with XL-2 cells cotransfected with xTR beta, T3 inducibility increased to 16-fold. Electrophoretic mobility shift assays with recombinant Xenopus TR alpha, TR beta, retinoid-X receptor-alpha (RXR alpha) and RXR gamma proteins showed that TR-RXR heterodimers, but not TR or RXR monomers or homodimers, strongly bound the natural and synthetic distal and proximal DR+4 elements in a ligand-independent manner. TR/RXR heterodimers exhibited the highest binding affinity for a 28-mer oligonucleotide probe for the -5/11 proximal DR+4 site, with only slight binding to DR+1 (retinoid-X-responsive element-like) site. The x

  18. Cloning of genes encoding alpha-L-arabinofuranosidase and beta-xylosidase from Trichoderma reesei by expression in Saccharomyces cerevisiae.

    PubMed Central

    Margolles-Clark, E; Tenkanen, M; Nakari-Setälä, T; Penttilä, M


    A cDNA expression library of Trichoderma reesei RutC-30 was constructed in the yeast Saccharomyces cerevisiae. Two genes, abf1 and bxl1, were isolated by screening the yeast library for extracellular alpha-L-arabinofuranosidase activity with the substrate p-nitrophenyl-alpha-L-arabinofuranoside. The genes abf1 and bxl1 encode 500 and 758 amino acids, respectively, including the signal sequences. The deduced amino acid sequence of ABFI displays high-level similarity to the alpha-L-arabinofuranosidase B of Aspergillus niger, and the two can form a new family of glycosyl hydrolases. The deduced amino acid sequence of BXLI shows similarities to the beta-glucosidases grouped in family 3. The yeast-produced enzymes were tested for enzymatic activities against different substrates. ABFI released L-arabinose from p-nitrophenyl-alpha-L-arabinofuranoside and arabinoxylans and showed some beta-xylosidase activity toward p-nitrophenyl-beta-D-xylopyranoside. BXLI did not release L-arabinose from arabinoxylan. It showed alpha-L-arabinofuranosidase, alpha-L-arabinopyranosidase, and beta-xylosidase activities against p-nitrophenyl-alpha-L-arabinofuranosidase, p-nitrophenyl-alpha-L-arabinopyranoside, and p-nitrophenyl-beta-D- xylopyranoside, respectively, with the last activity being the highest. It was also able to hydrolyze xylobiose and slowly release xylose from polymeric xylan. ABFI and BXLI correspond to a previously purified alpha-L-arabinofuranosidase and a beta-xylosidase from T. reesei, respectively, as confirmed by partial amino acid sequencing of the Trichoderma-produced enzymes. Both enzymes produced in yeasts displayed hydrolytic properties similar to those of the corresponding enzymes purified from T. reesei. PMID:8837440

  19. Effects of Ghrelin on Sexual Behavior and Luteinizing Hormone Beta-subunit Gene Expression in Male Rats

    PubMed Central

    Babaei-Balderlou, Farrin; Khazali, Homayoun


    Background: The hormones of hypothalamo-pituitary-gonadal (HPG) axis have facilitative effects on reproductive behavior in mammals. Ghrelin as a starvation hormone has an inhibitory effect on HPG axis’ function. Hence, it is postulated that ghrelin may reduce the sexual behavior through inhibiting of HPG axis. The aim of this study was to examine the effects of ghrelin and its antagonist, [D-Lys3 ]-GHRP-6, on sexual behavior and LH beta-subunit gene expression in male rats. Methods: In this experimental study, 128 male Wistar rats were divided into two groups. Each group was further subdivided into eight subgroups (n=8 rats/subgroup) including the animals that received saline, ghrelin (2, 4 or 8 nmol), [D-Lys3 ]-GHRP-6 (5 or 10 nmol) or co-administration of ghrelin (4 nmol) and [D-Lys3 ]-GHRP-6 (5 or 10 nmol) through the stereotaxically implanted cannula into the third cerebral ventricle. The sexual behavior of male rats encountering with females and the hypo-physeal LH beta-subunit gene expression were evaluated at two different groups. Data were analyzed by ANOVA and p<0.05 was considered statistically significant. Results: Ghrelin injection (4 and 8 nmol) significantly (p<0.01) increased the latencies to the first mount, intromission and ejaculation as well as the post-ejaculatory interval. Also, 4 and 8 nmol ghrelin significantly (p<0.05) increased the number of mount and decreased the number of ejaculation. In co-administrated groups, [D-Lys3 ]-GHRP-6 antagonized the effects of ghrelin. Ghrelin injection (4 and 8 nmol) reduced the LH beta-subunit gene expression while pretreatment with [D-Lys3 ]-GHRP-6 improved the gene expression. Conclusion: Ghrelin decreased the sexual behavior and LH beta-subunit gene expression in male rats, whereas [D-Lys3 ]-GHRP-6 antagonizes these effects. PMID:27141463

  20. Role of the von Hippel-Lindau tumor suppressor gene in the formation of beta1-integrin fibrillar adhesions.


    Esteban-Barragán, Miguel A; Avila, Pilar; Alvarez-Tejado, Miguel; Gutiérrez, M Dolores; García-Pardo, Angeles; Sánchez-Madrid, Francisco; Landázuri, Manuel O


    The von Hippel-Lindau tumor suppressor gene (VHL) is absent or inactivated in the VHLcancer syndrome and in most sporadic renal cancers. VHL is requiredfor the assembly of a proper extracellular fibronectin matrix, although the exact mechanism remains unknown. In this report, we demonstrate that 786-O renal cancer cells are unable to organize an adequate matrix even in the presence of an excess of exogenous fibronectin. Because the formation of integrin fibrillar adhesions plays a pivotal role in the organization of extracellular fibronectin, we next examined the expression and subcellular distribution of integrins in VHL- cells and their wild-type VHL stably transfected counterparts. The levels of beta1 and alphav integrins were increased in VHL- cells when compared with VHL+ transfectants. Early after plating, both VHL+ and VHL- cells were capable of assembling classic "patch-like" alphav focal contacts. As the culture advanced and cells became confluent, alphav integrins partly relocated to the intercellular junctions in VHL+ transfectants, which then developed large beta1 fibrillar-type adhesions and anchored firmly to the substrate. In contrast, confluent VHL- cells were unable to assemble beta1 fibrillar adhesions, and alphav focal contacts remained unchanged at all stages of the culture. Exogenous activation of beta1 integrins with either divalent cations or activating antibodies partly restored the capability of VHL- cells to assemble beta1 fibrillar adhesions and fibronectin fibers. Finally, pulse-chase studies of metabolically labeled 786-O cells revealed that the maturation of the common beta1-integrin chain was delayed in VHL- cells when compared with VHL+ cells. Our results show that VHL is an important regulator of integrins and is essential for the formation of beta1 fibrillar adhesions. These findings help to explain the abnormal extracellular matrix organization and increased motility of VHL- renal cancer cells. PMID:12019174

  1. Mutations in the dopamine beta-hydroxylase gene are associated with human norepinephrine deficiency

    NASA Technical Reports Server (NTRS)

    Kim, Chun-Hyung; Zabetian, Cyrus P.; Cubells, Joseph F.; Cho, Sonhae; Biaggioni, Italo; Cohen, Bruce M.; Robertson, David; Kim, Kwang-Soo


    Norepinephrine (NE), a key neurotransmitter of the central and peripheral nervous systems, is synthesized by dopamine beta-hydroxylase (DBH) that catalyzes oxidation of dopamine (DA) to NE. NE deficiency is a congenital disorder of unknown etiology, in which affected patients suffer profound autonomic failure. Biochemical features of the syndrome include undetectable tissue and circulating levels of NE and epinephrine, elevated levels of DA, and undetectable levels of DBH. Here, we report identification of seven novel variants including four potentially pathogenic mutations in the human DBH gene (OMIM 223360) from analysis of two unrelated patients and their families. Both patients are compound heterozygotes for variants affecting expression of DBH protein. Each carries one copy of a T-->C transversion in the splice donor site of DBH intron 1, creating a premature stop codon. In patient 1, there is a missense mutation in DBH exon 2. Patient 2 carries missense mutations in exons 1 and 6 residing in cis. We propose that NE deficiency is an autosomal recessive disorder resulting from heterogeneous molecular lesions at DBH. Copyright 2002 Wiley-Liss, Inc.

  2. Generation of Mice With a Conditional Allele for the Transforming Growth Factor Beta3 Gene

    PubMed Central

    Doetschman, Thomas; Georgieva, Teodora; Li, Hongqi; Reed, Thomas D.; Grisham, Christina; Friel, Jacqueline; Estabrook, Mark A.; Gard, Connie; Sanford, L.P.; Azhar, Mohamad


    Summary The transforming growth factor beta (TGFβ) pathway is involved in embryonic development and several inherited and acquired human diseases. The gene for TGFβ3 (Tgfb3) encodes one of the three ligands for TGF b receptors. It is widely expressed in the embryo and its mutation or misexpression is found in human diseases. Tgfb3−/− mice die at birth from cleft palate, precluding functional studies in adults. Here, we generated mice in which exon 6 of Tgfb3 was flanked with LoxP sites (Tgfb3flox/flox). The adult mice were normal and fertile. EIIa-Cre-mediated deletion of exon 6 in Tgfb3flox/flox mice efficiently generated Tgfb3 conditional knockout (Tgfb3cko/cko) mice which died at birth from the same cleft palate defect as Tgfb3−/− mice, indicating that the conditional and knockout alleles are functionally equivalent. This Tgfb3cko allele will now enable studies of TGFβ3 function in different cell or tissue types in embryonic development and during adulthood. genesis 50:59-66, 2012. PMID:22223248

  3. Use of an Activated Beta-Catenin to Identify Wnt Pathway Target Genes in Caenorhabditis elegans, Including a Subset of Collagen Genes Expressed in Late Larval Development

    PubMed Central

    Jackson, Belinda M.; Abete-Luzi, Patricia; Krause, Michael W.; Eisenmann, David M.


    The Wnt signaling pathway plays a fundamental role during metazoan development, where it regulates diverse processes, including cell fate specification, cell migration, and stem cell renewal. Activation of the beta-catenin−dependent/canonical Wnt pathway up-regulates expression of Wnt target genes to mediate a cellular response. In the nematode Caenorhabditis elegans, a canonical Wnt signaling pathway regulates several processes during larval development; however, few target genes of this pathway have been identified. To address this deficit, we used a novel approach of conditionally activated Wnt signaling during a defined stage of larval life by overexpressing an activated beta-catenin protein, then used microarray analysis to identify genes showing altered expression compared with control animals. We identified 166 differentially expressed genes, of which 104 were up-regulated. A subset of the up-regulated genes was shown to have altered expression in mutants with decreased or increased Wnt signaling; we consider these genes to be bona fide C. elegans Wnt pathway targets. Among these was a group of six genes, including the cuticular collagen genes, bli-1col-38, col-49, and col-71. These genes show a peak of expression in the mid L4 stage during normal development, suggesting a role in adult cuticle formation. Consistent with this finding, reduction of function for several of the genes causes phenotypes suggestive of defects in cuticle function or integrity. Therefore, this work has identified a large number of putative Wnt pathway target genes during larval life, including a small subset of Wnt-regulated collagen genes that may function in synthesis of the adult cuticle. PMID:24569038

  4. Improvement of cellulase activity in Trichoderma reesei by heterologous expression of a beta-glucosidase gene from Penicillium decumbens.


    Ma, Liang; Zhang, Jun; Zou, Gen; Wang, Chengshu; Zhou, Zhihua


    Trichoderma reesei is a well-known cellulase producer and widely applied in enzyme industry. To increase its ability to efficiently decompose cellulose, the beta-glucosidase activity of its enzyme cocktail needs to be enhanced. In this study, a beta-glucosidase I coding sequence from Penicillium decumbens was ligated with the cellobiohydrolase I (cbh1) promoter of T. reesei and introduced into the genome of T. reesei strain Rut-C30 by Agrobacterium-mediated transformation. In comparison to that from the parent strain, the beta-glucosidase activity of the enzyme complexes from two selected transformants increased 6- to 8-fold and their filter paper activity (FPAs) was enhanced by 30% on average. The transformant's saccharifying ability towards pretreated cornstalk was also significantly enhanced. To further confirm the effect of heterologous beta-glucosidase on the cellulase activity of T. reesei, the heterologously expressed pBGL1 was purified and added to the enzyme complex produced by T. reesei Rut-C30. Supplementation of the Rut-C30 enzyme complex with pBGL1 brought about 80% increase of glucose yield during the saccharification of pretreated cornstalk. Our results indicated that the heterologous expression of a beta-glucosidase gene in T. reesei might produce balanced cellulase preparation. PMID:22112562

  5. Transforming growth factor. beta. sub 1 is present at sites of extracellular matrix gene expression in human pulmonary fibrosis

    SciTech Connect

    Broekelmann, T.J.; Limper, A.H.; McDonald, J.A. ); Colby, T.V. )


    Idiopathic pulmonary fibrosis is an inexorably fatal disorder characterized by connective tissue deposition within the terminal air spaces resulting in loss of lung function and eventual respiratory failure. Previously, the authors demonstrated that foci of activated fibroblasts expressing high levels of fibronectin, procollagen, and smooth muscle actin and thus resembling those found in healing wounds are responsible for the connective tissue deposition and scarring in idiopathic pulmonary fibrosis. Using in situ hybridization and immunohistochemistry, they now demonstrate the presence of transforming growth factor {beta}{sub 1} (TGF-{beta}{sub 1}), a potent profibrotic cytokine, in the foci containing these activated fibroblasts. These results suggest that matrix-associated TGF-{beta}{sub 1} may serve as a stimulus for the persistent expression of connective tissue genes. One potential source of the TGF-{beta}{sub 1} is the alveolar macrophage, and they demonstrate the expression of abundant TGF-{beta}{sub 1} mRNA in alveolar macrophages in lung tissue from patients with idiopathic pulmonary fibrosis.

  6. Construction of bioactive chimeric MHC class I tetramer by expression and purification of human-murine chimeric MHC heavy chain and beta(2)m as a fusion protein in Escherichia coli.


    Ren, Ding; Wang, Fang; He, Xiaowen; Jiang, Lei; Li, Dean; Ying, He; Sun, Shuhan


    Major histocompatibility (MHC) class I tetramers are used in the quantitative analysis of epitope peptide-specific CD8+ T-cells. An MHC class I tetramer was composed of 4 MHC class I complexes and a fluorescently labeled streptavidin (SA) molecule. Each MHC class I complex consists of an MHC heavy chain, a beta(2)-microglobulin (beta(2)m) molecule and a synthetic epitope peptide. In most previous studies, an MHC class I complex was formed in the refolding buffer with an expressed MHC heavy chain molecule and beta(2)m, respectively. This procedure inevitably resulted in the disadvantages of forming unwanted multimers and self-refolding products, and the purification of each kind of monomer was time-consuming. In the present study, the genes of a human/murine chimeric MHC heavy chain (HLA-A2 alpha1, HLA-A2 alpha2 and MHC-H2D alpha3) and beta(2)m were tandem-cloned into plasmid pET17b and expressed as a fusion protein. The recombinant fusion protein was refolded with each of the three HLA-A2 restricted peptides (HBc18-27 FLPSDFFPSI, HBx52-60 HLSLRGLPV, and HBx92-100 VLHKRTLGL) and thus three chimeric MHC class I complexes were obtained. Biotinylation was performed, and its level of efficiency was observed via a band-shift assay in non-reducing polyacrylamide gel electrophoresis (PAGE). Such chimeric MHC class I tetramers showed a sensitive binding activity in monitoring HLA/A2 restrictive cytotoxic T lymphocytes (CTLs) in immunized HLA/A*0201 transgenic mice. PMID:17046278

  7. Mapping of the gene encoding the. beta. -amyloid precursor protein and its relationship to the Down syndrome region of chromosome 21

    SciTech Connect

    Patterson, D.; Gardiner, K.; Kao, F.T.; Tanzi, R.; Watkins, P.; Gusella, J.F. )


    The gene encoding the {beta}-amyloid precursor protein has been assigned to human chromosome 21, as has a gene responsible for at least some cases of familial Alzheimer disease. Linkage studies strongly suggest that the {beta}-amyloid precursor protein and the product corresponding to familial Alzheimer disease are from two genes, or at least that several million base pairs of DNA separate the markers. The precise location of the {beta}-amyloid precursor protein gene on chromosome 21 has not yet been determined. Here the authors show, by using a somatic-cell/hybrid-cell mapping panel, in situ hybridization, and transverse-alternating-field electrophoresis, that the {beta}-amyloid precursor protein gene is located on chromosome 21 very near the 21q21/21q/22 border and probably within the region of chromosome 21 that, when trisomic, results in Down syndrome.

  8. Functional analysis of a proline to serine mutation in codon 453 of the thyroid hormone receptor {beta}1 gene

    SciTech Connect

    Ozata, M.; Suzuki, Satoru; Takeda, Teiji


    Mutations in the gene encoding human thyroid hormone receptor {beta}(hTR{beta}) have been associated with generalized resistance to thyroid hormone (GRTH). This disorder is associated with significant behavoral abnormalities. We examined the hTR{beta} gene in a family with members who manifest inappropriately normal TSH, elevated free T{sub 4}, and free and total T{sub 3}. Sequence analysis showed a cytosine to thymine transition at nucleotide 1642 in one allele of the index patient`s genomic DNA. This altered proline to serine at codon 453. The resulting mutant receptor when expressed in vitro bound DNA with high affinity, but the T{sub 3} affinity of the receptor was impaired. The mutant TR demonstrated a dominant negative effect when cotransfected with two isoforms of wild-type receptor and also in the presence of TR variant {alpha}2 in COS-1 cells. Mutations of codon 453 occur more frequently than at other sites, and four different amino acid substitutions have been reported. Significant differences in phenotype occur among affected individuals, varying from normality to moderately severe GRTH. There is no clear correlation between K{sub a} or in vitro function of the mutant receptor, and phenotype. This study extends the association between GRTH and illness, and indicates that early diagnosis and counseling are needed in families with TR{beta}1 abnormalities. 34 refs., 5 figs., 2 tabs.

  9. Occurrence of bacteria producing broad-spectrum beta-lactamases and qnr genes in hospital and urban wastewater samples.


    Röderová, Magdaléna; Sedláková, Miroslava Htoutou; Pudová, Vendula; Hricová, Kristýna; Silová, Romana; Imwensi, Peter Eghonghon Odion; Bardoň, Jan; Kolář, Milan


    The aims were to investigate the level of antibiotic-resistant bacteria in hospital and urban wastewater and to determine the similarity of isolates obtained from wastewater and hospitalized patients. Wastewater samples were collected in September 2013 and 2014. After identification using MALDI-TOF MS, beta-lactamase production was determined by relevant phenotypic tests. Genes responsible for the production of single beta-lactamase groups and Qnr proteins were established. The epidemiological relationship of the isolates from wastewater and hospitalized patients was determined by PFGE. A total of 51 isolates of enterobacteria were obtained. Overall, 45.1% of them produced broad-spectrum beta-lactamases. Genes encoding TEM, SHV, CTX-M, CIT, DHA and EBC types of enzymes and Qnr proteins were detected. No broad-spectrum beta-lactamase production was confirmed in the urban wastewater treatment plant. The most important finding was the detection of two identical isolates of K. pneumoniae in 2013, one from a patient's urinary catheter and the other from a wastewater sample. PMID:27196551

  10. Human-Specific SNP in Obesity Genes, Adrenergic Receptor Beta2 (ADRB2), Beta3 (ADRB3), and PPAR γ2 (PPARG), during Primate Evolution

    PubMed Central

    Takenaka, Akiko; Nakamura, Shin; Mitsunaga, Fusako; Inoue-Murayama, Miho; Udono, Toshifumi; Suryobroto, Bambang


    Adrenergic-receptor beta2 (ADRB2) and beta3 (ADRB3) are obesity genes that play a key role in the regulation of energy balance by increasing lipolysis and thermogenesis. The Glu27 allele in ADRB2 and the Arg64 allele in ADRB3 are associated with abdominal obesity and early onset of non-insulin-dependent diabetes mellitus (NIDDM) in many ethnic groups. Peroxisome proliferator-activated receptor γ (PPARG) is required for adipocyte differentiation. Pro12Ala mutation decreases PPARG activity and resistance to NIDDM. In humans, energy-expense alleles, Gln27 in ADRB2 and Trp64 in ADRB3, are at higher frequencies than Glu27 and Arg64, respectively, but Ala12 in PPARG is at lower frequency than Pro12. Adaptation of humans for lipolysis, thermogenesis, and reduction of fat accumulation could be considered by examining which alleles in these genes are dominant in non-human primates (NHP). All NHP (P. troglodytes, G. gorilla, P. pygmaeus, H. agilis and macaques) had energy-thrifty alleles, Gly16 and Glu27 in ADRB2, and Arg64 in ADRB3, but did not have energy-expense alleles, Arg16, Gln27 and Trp64 alleles. In PPARG gene, all NHP had large adipocyte accumulating type, the Pro12 allele. Conclusions These results indicate that a tendency to produce much more heat through the energy-expense alleles developed only in humans, who left tropical rainforests for savanna and developed new features in their heat-regulation systems, such as reduction of body hair and increased evaporation of water, and might have helped the protection of entrails from cold at night, especially in glacial periods. PMID:22937051

  11. Selection and validation of reference house-keeping genes in the J774A1 macrophage cell line for quantitative real-time PCR.


    Ferraz, F B; Fernandez, J H


    Macrophages are essential components of the innate and adaptive immune responses, playing a decisive role in atherosclerosis, asthma, obesity, and cancer. The differential gene expression resulting from adhesion of macrophages to the extra-cellular matrix (ECM) has been studied in the J774A1 murine macrophage cell line using quantitative polymerase chain reaction (qPCR). The goal of this study was to identify housekeeping genes (HKGs) that remain stable and unaltered under normal culture conditions and in the presence of laminin after a time lapse of 6 and 24 h. The expression stabilities of eight commonly used reference genes were analyzed by determining the comparative threshold cycle ((ΔΔ)Ct) values, and using the BestKeeper, NormFinder, and geNorm algorithms. BestKeeper analysis revealed that the glyceraldehyde-3-phosphate dehydrogenase (GAPDH), peptidylprolyl isomerase A (PPIA), and ribosomal protein L13a (RPL13A) genes were highly stable, confirming the results of the (ΔΔ)Ct analysis. On the other hand, NormFinder proposed RPL13A and beta-glucuronidase (GUSB) to be the most suitable combination, and geNorm adjudged RPL13A, PPIA, and GUSB to be the most stable across all culture conditions. All programs discarded the use of actin beta and beta-2-microglobulin for normalization. The collected data indicated that RPL13A, PPIA, GAPDH, and GUSB as highly suitable as reference genes for qPCR analysis of murine macrophages under normal and ECM-simulated culture conditions. This study also emphasizes the importance of evaluating HKGs used for normalization to ensure the accuracy of qPCR data. PMID:26985962

  12. Correction of a splice-site mutation in the beta-globin gene stimulated by triplex-forming peptide nucleic acids.


    Chin, Joanna Y; Kuan, Jean Y; Lonkar, Pallavi S; Krause, Diane S; Seidman, Michael M; Peterson, Kenneth R; Nielsen, Peter E; Kole, Ryszard; Glazer, Peter M


    Splice-site mutations in the beta-globin gene can lead to aberrant transcripts and decreased functional beta-globin, causing beta-thalassemia. Triplex-forming DNA oligonucleotides (TFOs) and peptide nucleic acids (PNAs) have been shown to stimulate recombination in reporter gene loci in mammalian cells via site-specific binding and creation of altered helical structures that provoke DNA repair. We have designed a series of triplex-forming PNAs that can specifically bind to sequences in the human beta-globin gene. We demonstrate here that these PNAs, when cotransfected with recombinatory donor DNA fragments, can promote single base-pair modification at the start of the second intron of the beta-globin gene, the site of a common thalassemia-associated mutation. This single base pair change was detected by the restoration of proper splicing of transcripts produced from a green fluorescent protein-beta-globin fusion gene. The ability of these PNAs to induce recombination was dependent on dose, sequence, cell-cycle stage, and the presence of a homologous donor DNA molecule. Enhanced recombination, with frequencies up to 0.4%, was observed with use of the lysomotropic agent chloroquine. Finally, we demonstrate that these PNAs were effective in stimulating the modification of the endogenous beta-globin locus in human cells, including primary hematopoietic progenitor cells. This work suggests that PNAs can be effective tools to induce heritable, site-specific modification of disease-related genes in human cells. PMID:18757759

  13. Herpes simplex virus infection selectively stimulates accumulation of beta interferon reporter gene mRNA by a posttranscriptional mechanism.

    PubMed Central

    Mosca, J D; Pitha, P M; Hayward, G S


    To study the mechanism of a novel herpes simplex virus (HSV) activity that stimulates expression of reporter genes containing beta interferon (IFN-beta)-coding sequences, we have established permanent DNA-transfected cell lines that each contain two distinct hybrid genes encoding mRNA species with different half-lives. These reporter genes comprised either the human IFN-beta- or bacterial chloramphenicol acetyltransferase (CAT)-coding and 3' untranslated regions placed under the transcriptional control of the powerful major immediate-early promoter-enhancer region (IE94) from simian cytomegalovirus. Most of the dual-transfected cell lines yielded significant levels of steady-state IE94-CAT mRNA and abundant constitutive synthesis of CAT enzyme activity, whereas no accumulation of IE94-IFN mRNA could be detected. However, infection with HSV type 1 resulted in a 300-fold increase in IE94-IFN-specific mRNA transcripts, compared with no more than 3- to 5-fold stimulation of IE94-CAT-specific mRNA. In contrast, cycloheximide treatment increased stable mRNA levels and transcription initiation rates from both the IE94-IFN and IE94-CAT hybrid genes. Run-on transcription assays in isolated nuclei suggested that induction of IE94-IFN gene expression by HSV type 1 occurred predominantly at the posttranscriptional level. Enhancement of the unstable IFN mRNA species after HSV infection was also observed in cell lines containing a simian virus 40 enhancer-driven IFN gene (SV2-IFN). Similarly, in transient-transfection assays, both SV2-IFN and IE94-IFN gave only low basal mRNA synthesis, but superinfection with HSV again led to high-level accumulation of IFN mRNA. Finally, substitution of the SV2-IFN gene 3' region with poly(A) and splicing signals from the SV2-CAT gene cassette led to stabilization of the IFN mRNA even in the absence of HSV. Therefore, we conclude that HSV infection leads to selective accumulation of IFN-beta mRNA by a posttranscriptional mechanism that is

  14. Phylogenetic comparisons suggest that distance from the locus control region guides developmental expression of primate beta-type globin genes.


    Johnson, Robert M; Prychitko, Tom; Gumucio, Deborah; Wildman, Derek E; Uddin, Monica; Goodman, Morris


    Phylogenetic inferences drawn from comparative data on mammalian beta-globin gene clusters indicate that the ancestral primate cluster contained a locus control region (LCR) and five paralogously related beta-type globin loci (5'-LCR-epsilon-gamma-psieta-delta-beta-3'), with epsilon and gamma expressed solely during embryonic life. A gamma locus tandem duplication (5'-gamma(1)-gamma(2)-3') triggered gamma's evolution toward fetal expression but by a different trajectory in platyrrhines (New World monkeys) than in catarrhines (Old World monkeys and apes, including humans). In platyrrhine (e.g., Cebus) fetuses, gamma(1) at the ancestral distance from epsilon is down-regulated, whereas gamma(2) at increased distance is up-regulated. Catarrhine gamma(1) and gamma(2) acquired longer distances from epsilon (14 and 19 kb, respectively), and both are up-regulated throughout fetal life with gamma(1)'s expression predominating over gamma(2)'s. On enlarging the platyrrhine expression data, we find Aotus gamma is embryonic, Alouatta gamma is inactive at term, and in Callithrix, gamma(1) is down-regulated fetally, whereas gamma(2) is up-regulated. Of eight mammalian taxa now represented per taxon by embryonic, fetal, and postnatal beta-type globin gene expression data, four taxa are primates, and data for three of these primates are from this laboratory. Our results support a model in which a short distance (<10 kb) between epsilon and the adjacent gamma is a plesiomorphic character that allows the LCR to drive embryonic expression of both genes, whereas a longer distance (>10 kb) impedes embryonic activation of the downstream gene. PMID:16488971

  15. Characterization of cultivar differences in beta-1,3 glucanase gene expression, glucanase activity and fruit pulp softening rates during fruit ripening in three naturally occurring banana cultivars.


    Roy Choudhury, Swarup; Roy, Sujit; Sengupta, Dibyendu N


    beta-1,3 glucanase (E.C. is the key enzyme involved in the hydrolytic cleavage of 1,3 beta-D glucosidic linkages in beta-1,3 glucans. This work describes a comparative analysis of expression patterns of beta-1,3 glucanase gene in relation to changes in fruit pulp softening rates in three banana cultivars, Rasthali (AAB), Kanthali (AB), and Monthan (ABB). Analysis of transcript and protein levels of beta-1,3 glucanase gene during ripening revealed differential timing in expression of the gene which correlated well with the variation in enzymatic activity of glucanase and fruit pulp softening rates in the three cultivars. Exogenously applied ethylene strongly induced beta-1,3 glucanase expression during the early ripening days in Rasthali, while the expression of the gene was marginally stimulated following ethylene treatment in preclimacteric Kanthali fruit. Conversely, in Monthan, beta-1,3 glucanase expression was very low throughout the ripening stages, and ethylene treatment did not induce the expression of the gene in this cultivar. Analysis of glucanase activity using protein extracts from unripe and ripe fruit of Monthan with crude cell wall polysaccharide fractions (used as substrate) indicated that the natural substrate for glucanase remained almost unutilized in this cultivar due to low in vivo glucanase activity. Furthermore, the recombinant beta-1,3 glucanase protein, overexpressed in E. coli, showed requirement for substrates with contiguous beta-1,3 linkages for optimal activity. Overall, our results provide new information on the expression profile of beta-1,3 glucanase gene in connection with the pattern of changes in fruit firmness at the physiological and molecular levels during ripening in three banana cultivars. PMID:19697038

  16. Cloning and characterization of the endogenous cephalosporinase gene, cepA, from Bacteroides fragilis reveals a new subgroup of Ambler class A beta-lactamases.

    PubMed Central

    Rogers, M B; Parker, A C; Smith, C J


    Bacteroides fragilis CS30 is a clinical isolate resistant to high concentrations of benzylpenicillin and cephaloridine but not to cephamycin or penem antibiotics. beta-Lactam resistance is mediated by a chromosomally encoded cephalosporinase produced at a high level. The gene encoding this beta-lactamase was cloned from genomic libraries constructed in Escherichia coli and then mated with B. fragilis 638 for identification of ampicillin-resistant (Apr) strains. Apr transconjugants contained a nitrocefin-reactive protein with the physical and enzymatic properties of the original CS30 isolate. The beta-lactamase gene (cepA) was localized by deletion analysis and subcloned, and its nucleotide sequence was determined. The 903-bp cepA open reading frame encoded a 300-amino-acid precursor protein (predicted molecular mass, 34,070 Da). A beta-lactamase-deficient mutant strain of B. fragilis 638 was constructed by insertional inactivation with the cepA gene of CS30, demonstrating strict functional homology between these chromosomal beta-lactamase genes. An extensive comparison of the CepA protein sequence by alignment with other beta-lactamases revealed the strict conservation of at least four elements common to Ambler class A. A further comparison of the CepA protein sequence with protein sequences of beta-lactamases from two other Bacteroides species indicated that they constitute their own distinct subgroup of class A beta-lactamases. Images PMID:8285623

  17. Phenotypic detection and molecular characterization of beta-lactamase genes among Citrobacter species in a tertiary care hospital

    PubMed Central

    Praharaj, Ashok Kumar; Khajuria, Atul; Kumar, Mahadevan; Grover, Naveen


    Objective: To examine the distribution, emergence, and spread of genes encoding beta-lactamase resistance in Citrobacter species isolated from hospitalized patients in a tertiary care hospital. Methods: A prospective study was conducted in a 1000-bed tertiary care center in Pune, India from October 2010 to October 2013. A total of 221 Citrobacter spp. isolates were recovered from clinical specimens from different patients (one isolate per patient) admitted to the surgical ward, medical ward and medical and surgical Intensive Care Units. Polymerase chain reaction (PCR) assays and sequencing were used to determine the presence of beta-lactamase encoding genes. Conjugation experiments were performed to determine their transferability. Isolate relatedness were determined by repetitive element based-PCR, enterobacterial repetitive intergenic consensus-PCR and randomly amplified polymorphic DNA. Results: Among 221 tested isolates of Citrobacter spp. recovered from various clinical specimens, 179 (80.9%) isolates showed minimum inhibitory concentration (MIC) >4 μg/ml against meropenem and imipenem. One hundred and forty-five isolates with increased MICs value against carbapenems were further processed for molecular characterization of beta-lactamase genes. Susceptibility profiling of the isolates indicated that 100% retained susceptibility to colistin. Conjugation experiments indicated that blaNDM-1 was transferable via a plasmid. Conclusion: The ease of NDM-1 plasmid transmissibility may help their dissemination among the Citrobacter species as well as to others in Enterobacteriaceae. Early detection, antimicrobial stewardship and adequate infection control measures will help in limiting the spread of these organisms. PMID:26952135

  18. Direct Reprogramming for Pancreatic Beta-Cells Using Key Developmental Genes

    PubMed Central

    Cavelti-Weder, Claudia; Li, Weida; Zumsteg, Adrian; Stemann, Marianne; Yamada, Takatsugu; Bonner-Weir, Susan; Weir, Gordon


    Direct reprogramming is a promising approach for regenerative medicine whereby one cell type is directly converted into another without going through a multipotent or pluripotent stage. This reprogramming approach has been extensively explored for the generation of functional insulin-secreting cells from non-beta-cells with the aim of developing novel cell therapies for the treatment of people with diabetes lacking sufficient endogenous beta-cells. A common approach for such conversion studies is the introduction of key regulators that are important in controlling beta-cell development and maintenance. In this review, we will summarize the recent advances in the field of beta-cell reprogramming and discuss the challenges of creating functional and long-lasting beta-cells. PMID:26998407

  19. Mutant HNF-1{alpha} and mutant HNF-1{beta} identified in MODY3 and MODY5 downregulate DPP-IV gene expression in Caco-2 cells

    SciTech Connect

    Gu Ning; Adachi, Tetsuya; Matsunaga, Tetsuro; Takeda, Jun; Tsujimoto, Gozoh; Ishihara, Akihiko; Yasuda, Koichiro; Tsuda, Kinsuke . E-mail:


    Dipeptidylpeptidase IV (DPP-IV) is a well-documented drug target for the treatment of type 2 diabetes. Hepatocyte nuclear factors (HNF)-1{alpha} and HNF-1{beta}, known as the causal genes of MODY3 and MODY5, respectively, have been reported to be involved in regulation of DPP-IV gene expression. But, it is not completely clear (i) that they play roles in regulation of DPP-IV gene expression, and (ii) whether DPP-IV gene activity is changed by mutant HNF-1{alpha} and mutant HNF-1{beta} in MODY3 and MODY5. To explore these questions, we investigated transactivation effects of wild HNF-1{alpha} and 13 mutant HNF-1{alpha}, as well as wild HNF-1{beta} and 2 mutant HNF-1{beta}, on DPP-IV promoter luciferase gene in Caco-2 cells by means of a transient experiment. Both wild HNF-1{alpha} and wild HNF-1{beta} significantly transactivated DPP-IV promoter, but mutant HNF-1{alpha} and mutant HNF-1{beta} exhibited low transactivation activity. Moreover, to study whether mutant HNF-1{alpha} and mutant HNF-1{beta} change endogenous DPP-IV enzyme activity, we produced four stable cell lines from Caco-2 cells, in which wild HNF-1{alpha} or wild HNF-1{beta}, or else respective dominant-negative mutant HNF-1{alpha}T539fsdelC or dominant-negative mutant HNF-1{beta}R177X, was stably expressed. We found that DPP-IV gene expression and enzyme activity were significantly increased in wild HNF-1{alpha} cells and wild HNF-1{beta} cells, whereas they decreased in HNF-1{alpha}T539fsdelC cells and HNF-1{beta}R177X cells, compared with DPP-IV gene expression and enzyme activity in Caco-2 cells. These results suggest that both wild HNF-1{alpha} and wild HNF-1{beta} have a stimulatory effect on DPP-IV gene expression, but that mutant HNF-1{alpha} and mutant HNF-1{beta} attenuate the stimulatory effect.

  20. Active macrophage-associated TGF-beta co-localizes with type I procollagen gene expression in atherosclerotic human pulmonary arteries.

    PubMed Central

    Bahadori, L.; Milder, J.; Gold, L.; Botney, M.


    Vascular remodeling in adult atherosclerotic pulmonary arteries is characterized by discrete areas of neointimal smooth muscle cell extracellular matrix gene expression in close proximity to non-foamy macrophages, suggesting regulation by local macrophage-associated factors. The purpose of these studies was to begin addressing the role of putative macrophage-associated factors such as transforming growth factor-beta (TGF-beta), by determining the spatial relationship between TGF-beta and neointimal matrix gene expression in human atherosclerotic pulmonary arteries. For example, the participation of TGF-beta in vascular remodeling could be inferred by its colocalization with non-foamy macrophages in areas of active matrix synthesis. In situ hybridization and immunohistochemistry demonstrated focal neointimal procollagen gene expression in close association with non-foamy but not foamy macrophages. Immunohistochemistry with isoform-specific anti-TGF-beta antibodies demonstrated all three isoforms of TGF-beta associated with non-foamy macrophages, but foamy macrophages were not immunoreactive. Neointimal and medial smooth muscle cells stained lightly. In contrast, intense TGF-beta immunoreactivity was also associated with medial smooth muscle cells in normal nonremodeling vessels. Immunohistochemistry with antibodies specific for latent TGF-beta was similar to immunohistochemistry for mature TGF-beta in both remodeling and nonremodeling vessels. Finally, using an antibody specific for active TGF-beta 1, immunoreactivity was only seen in non-foamy neointimal macrophages but not in foamy macrophages or medial smooth muscle cells from hypertensive or normal vessels. These observations suggest non-foamy macrophages may participate in modulating matrix gene expression in atherosclerotic remodeling via a TGF-beta-dependent mechanism. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 PMID:7747808

  1. Genetic mapping of the beta 1 GABA receptor gene to human chromosome 4, using a tetranucleotide repeat polymorphism.

    PubMed Central

    Dean, M; Lucas-Derse, S; Bolos, A; O'Brien, S J; Kirkness, E F; Fraser, C M; Goldman, D


    As more coding loci for functional human genes are described, there is a growing need to identify DNA polymorphisms in specific genes. By examining DNA sequences within the introns of the beta 1 subunit of the gamma-aminobutyric acid receptor gene, GABARB1, we found a tetranucleotide repeat sequence (GATA). Amplification of this region by using PCR revealed seven alleles and a high degree of polymorphism (PIC = .75) in human populations. DNAs from the CEPH families were typed for the GABARB1 intron polymorphism and were analyzed with respect to 20 linked markers on chromosome 4. The results permit placement of GABARB1 on the linkage map of chromosome 4, between D4S104 and ALB. These results affirm that sequence analysis of noncoding segments included within or adjacent to functional genes has value as a strategy to detect highly informative polymorphisms. Images Figure 2 PMID:1652891

  2. Rat 17 beta-hydroxysteroid dehydrogenase type IV is a novel peroxisome proliferator-inducible gene.


    Corton, J C; Bocos, C; Moreno, E S; Merritt, A; Marsman, D S; Sausen, P J; Cattley, R C; Gustafsson, J A


    To better understand the molecular mechanisms of the pleiotropic responses induced by exposure to peroxisome proliferator chemicals (PPCs), we conducted a systematic search for genes whose mRNA levels are modulated by the PPC WY-14,643 (WY) in rat liver. The sequence of one up-regulated cDNA (2480 bp) was predicted to encode a protein of 735 aa with 82% identity to the porcine 17 beta-hydroxysteroid dehydrogenase type IV (HSD IV). Like the porcine enzyme, the rat HSD IV contains' a region homologous to yeast hydratase-dehydrogenase-epimerases and to sterol carrier proteins, indicating that the rat HSD IV has broad substrate specificity and contributes to cholesterol metabolism. The rat HSD IV was regulated by diverse PPCs via two distinct mechanisms. Induction of HSD IV and acyl-CoA oxidase (ACO) proteins in rat liver at different treatment times and concentrations of gemfibrozil and di-n-butyl phthalate were almost identical, indicating that HSD IV mRNA induction involves the peroxisome proliferator-activated receptor alpha, a regulator of ACO. In contrast, HSD IV protein levels were only weakly induced by WY, a strong inducer of ACO protein, even though the levels of HSD IV and ACO mRNA were strongly stimulated by WY and gemfibrozil. Thus, HSD IV protein levels were uniquely regulated pretranslationally by WY via a novel mechanism. Increased conversion of estradiol to the less-active estrone by HSD IV induction may explain how phthalate exposure leads to decreases in serum estradiol levels and suppression of ovulation. PMID:8913347

  3. Polymorphisms of cystathionine beta-synthase gene are associated with susceptibility to sepsis.


    Sponholz, Christoph; Kramer, Marcel; Schöneweck, Franziska; Menzel, Uwe; Inanloo Rahatloo, Kolsoum; Giamarellos-Bourboulis, Evangelos J; Papavassileiou, Vassileios; Lymberopoulou, Korina; Pavlaki, Maria; Koutelidakis, Ioannis; Perdios, Ioannis; Scherag, André; Bauer, Michael; Platzer, Matthias; Huse, Klaus


    Sepsis is the systemic inflammatory host response to infection. Cystathionine beta-synthase (CBS)-dependent homocysteine (Hcy) pathway was demonstrated to affect disease severity and mortality in patients with severe sepsis/septic shock. Independent studies identified a single-nucleotide polymorphism (SNP, rs6586282, hg19 chr21:g.44478497C>T) in intron 14 of the CBS-coding gene (CBS) associated with Hcy plasma levels. We aimed to describe the association of this SNP and variants of a splice donor-affecting variable-number tandem repeat (VNTR, NG_008938.1:g.22763_22793[16_22]) 243 bp downstream of rs6586282 with severe human sepsis. We analyzed the VNTR structure and genotyped variants of rs6586282 and a neighboring SNP (rs34758144, hg19 chr21:g.44478582G>A) in two case-control studies including patients with severe sepsis/septic shock from Germany (n=168) and Greece (n=237). In both studies, we consistently observed an association of CBS VNTR alleles with sepsis susceptibility. Risk linearly increased with number of tandem repeats (per allele odds ratio in the adjusted analysis 1.34; 95% confidence interval (CI)=1.17-1.55; P<0.001). Association had also been shown for rs34758144 whose risk allele is in linkage disequilibrium with one long VNTR allele (19 repeat). In contrast, we observed no evidence for an effect on 28-day survival in patients with severe sepsis/septic shock (per allele hazard ratio in the adjusted analysis for VNTR 1.10; 95% CI=0.95-1.28; P=0.20). In a minigene approach, we demonstrated alternative splicing in distinct VNTR alleles, which, however, was independent of the number of tandem units. In conclusion, there is no ordinary conjunction between human CBS and severe sepsis/septic shock, but CBS genotypes are involved in disease susceptibility. PMID:26508567

  4. Lysyl oxidase like 4, a novel target gene of TGF-{beta}1 signaling, can negatively regulate TGF-{beta}1-induced cell motility in PLC/PRF/5 hepatoma cells

    SciTech Connect

    Kim, Dong Joon; Lee, Dong Chul; Yang, Suk-Jin; Lee, Jung Ju; Bae, Eun Mi; Kim, Dong Min; Min, Sang Hyun; Kim, Soo Jung; Kang, Dong Chul; Sang, Byung Chan; Myung, Pyung Keun; Park, Kyung Chan Yeom, Young Il


    Transforming growth factor-{beta}1 (TGF-{beta}1) is a multi-functional cytokine involved in the regulation of cell proliferation, differentiation and extracellular matrix formation. In search for novel genes mediating the TGF-{beta}1 function at downstream signaling, we performed a cDNA microarray analysis and identified 60 genes whose expression is regulated by TGF-{beta}1 in the liver cancer cell line PLC/PRF/5. Among them, we report here lysyl oxidase like 4 (LOXL4) as a novel target of TGF-{beta}1 signaling, and provide experimental evidence for its expression regulation and function. LOXL4 was found to be the only member of LOX family whose expression is induced by TGF-{beta}1 in hepatoma cells. Deletion mapping of the LOXL4 promoter indicated that the TGF-{beta}1 regulation of LOXL4 expression is mediated through the binding of AP1 transcription factor to a conserved region of the promoter. This was confirmed by the chromatin immunoprecipitation assay that captured c-Fos-bound chromatin from TGF-{beta}1-treated cells. Forced expression of LOXL4 in PLC/PRF/5 cells resulted in inhibition of cell motility through Matrigel in the presence of TGF-{beta}1 treatment. In parallel, LOXL4 suppressed the expression of laminins and {alpha}3 integrin and the activity of MMP2. These results suggest that LOXL4 may function as a negative feedback regulator of TGF-{beta}1 in cell invasion by inhibiting the metabolism of extracellular matrix (ECM) components.

  5. Localization of eight additional genes in the human major histocompatibility complex, including the gene encoding the casein kinase II {beta} subunit (CSNK2B)

    SciTech Connect

    Albertella, M.R.; Jones, H.; Thomson, W.


    A wide range of autoimmune and other diseases are known to be associated with the major histocompatibility complex. Many of these diseases are linked to the genes encoding the polymorphic histocompatibility complex. Many of these diseases are linked to the genes encoding the polymorphic histocompatibility antigens in the class I and class II regions, but some appear to be more strongly associated with genes in the central 1100-kb class III region, making it important to characterize this region fully for the presence of novel genes. An {approximately}220-kb segment of DNA in the class III region separating the Hsp70 (HSPA1L) and BAT1 (D6S8IE) genes, which was previously known to contain 14 genes. Genomic DNA fragments spanning the gaps between the known genes were used as probes to isolate cDNAs corresponding to five new genes within this region. Evidence from Northern blot analysis and exon trapping experiments that suggested the presence of at least two more new genes was also obtained. Partial cDNA and complete exonic genomic sequencing of one of the new genes has identified it as the casein kinase II{beta} subunit (CSNK2B). Two of the other novel genes lie within a region syntenic to that implicated in susceptibility to experimental allergic orchitis in the mouse, an autoimmune disease of the testis, and represent additional candidates for the Orch-1 locus associated with this disease. In addition, characterization of the 13-kb intergenic gap separating the RD (D6545) and G11 (D6S60E) genes has revealed the presence of a gene encoding a 1246-amino-acid polypeptide that shows significant sequence similarity to the yeast anti-viral Ski2p gene product. 49 refs., 8 figs.

  6. SNP analyses of growth factor genes EGF, TGF{beta}-1, and HGF reveal haplotypic association of EGF with autism

    SciTech Connect

    Toyoda, Takao; Thanseem, Ismail; Kawai, Masayoshi; Sekine, Yoshimoto; Nakamura, Kazuhiko; Anitha, Ayyappan; Suda, Shiro . E-mail:; Yamada, Kazuo; Tsujii, Masatsugu |; Iwayama, Yoshimi; Hattori, Eiji; Toyota, Tomoko; Yoshikawa, Takeo; Miyachi, Taishi; Tsuchiya, Kenji; Sugihara, Gen-ichi; Matsuzaki, Hideo; Iwata, Yasuhide; Suzuki, Katsuaki; Mori, Norio |; Ouchi, Yasuomi |; Sugiyama, Toshiro; Takei, Nori


    Autism is a pervasive neurodevelopmental disorder diagnosed in early childhood. Growth factors have been found to play a key role in the cellular differentiation and proliferation of the central and peripheral nervous systems. Epidermal growth factor (EGF) is detected in several regions of the developing and adult brain, where, it enhances the differentiation, maturation, and survival of a variety of neurons. Transforming growth factor-{beta} (TGF{beta}) isoforms play an important role in neuronal survival, and the hepatocyte growth factor (HGF) has been shown to exhibit neurotrophic activity. We examined the association of EGF, TGF{beta}1, and HGF genes with autism, in a trio association study, using DNA samples from families recruited to the Autism Genetic Resource Exchange; 252 trios with a male offspring scored for autism were selected for the study. Transmission disequilibrium test revealed significant haplotypic association of EGF with autism. No significant SNP or haplotypic associations were observed for TGF{beta}1 or HGF. Given the role of EGF in brain and neuronal development, we suggest a possible role of EGF in the pathogenesis of autism.

  7. Knockdown of prolactin receptors in a pancreatic beta cell line: effects on DNA synthesis, apoptosis, and gene expression.


    Arumugam, Ramamani; Fleenor, Don; Freemark, Michael


    Prolactin (PRL) and placental lactogen stimulate beta cell replication and insulin production in vitro and in vivo. The molecular mechanisms by which lactogens promote beta cell expansion are unclear. We treated rat insulinoma cells with a PRL receptor (PRLR) siRNA to determine if PRLR signaling is required for beta cell DNA synthesis and cell survival and to identify beta cell cycle genes whose expression depends upon lactogen action. Effects of PRLR knockdown were compared with those of PRL treatment. PRLR knockdown (-80 %) reduced DNA synthesis, increased apoptosis, and inhibited expression of cyclins D2 and B2, IRS-2, Tph1, and the anti-apoptotic protein PTTG1; p21 and BCL6 mRNAs increased. Conversely, PRL treatment increased DNA synthesis, reduced apoptosis, and enhanced expression of A, B and D2 cyclins, CDK1, IRS-2, FoxM1, BCLxL, and PTTG1; BCL6 declined. PRLR signaling is required for DNA synthesis and survival of rat insulinoma cells. The effects of lactogens are mediated by down-regulation of cell cycle inhibitors (BCL6, p21) and induction of A, B, and D2 cyclins, IRS-2, Tph1, FoxM1, and the anti-apoptotic proteins BCLxL and PTTG1. PMID:24114406

  8. Roles of fetal G gamma-globin promoter elements and the adult beta-globin 3' enhancer in the stage-specific expression of globin genes.


    Perez-Stable, C; Costantini, F


    The human fetal G gamma-globin and adult beta-globin genes are expressed in a tissue- and developmental stage-specific pattern in transgenic mice: the G gamma gene in embryonic cells and the beta gene in fetal and adult erythroid cells. Several of the cis-acting DNA sequences thought to be responsible for these patterns of expression are located 5' to the G gamma-globin gene and 3' to the beta-globin gene. To further define the locations and functional roles of these elements, we examined the effects of 5' truncations on the expression of the G gamma-globin gene, as well as the ability of G gamma-globin upstream sequences to alter the developmental regulation of a beta-globin gene, as well as the ability of G gamma-globin upstream sequences to alter the developmental regulation of a beta-globin gene. We found that sequences between -201 and -136 are essential for expression of the G gamma-globin gene, whereas those upstream of -201 have little effect on the level or tissue or stage specificity of G gamma-globin expression. The G gamma-globin upstream sequences from -201 to -136 were, furthermore, capable of activating a linked beta-globin gene in embryonic blood cells; however, a G gamma-globin fragment from -383 to -206 was similarly active in this assay, and the complete fragment from -383 to -136 was considerably more active than either of the smaller fragments, suggesting the presence of multiple cis-acting elements for embryonic blood cells. Our data also suggested the possibility of a negative regulatory element between -201 and -136. These results are discussed in relation to several DNA elements in the G gamma-globin upstream region, which have been shown to bind nuclear factors in erythroid cells. Finally, we observed that removal of the beta-globin 3'-flanking sequences, including the 3' enhancer, from the G gamma-globin upstream-beta-globin hybrid gene resulted in a 25-fold reduction in expression in embryonic blood cells. This suggests that the beta

  9. Organization of the antiseptic resistance gene qacA and Tn552-related beta-lactamase genes in multidrug- resistant Staphylococcus haemolyticus strains of animal and human origins.


    Anthonisen, I-L; Sunde, M; Steinum, T M; Sidhu, M S; Sørum, H


    A part (12 kb) of a plasmid containing the beta-lactamase genes of Tn552, the disinfectant resistance gene qacA, and flanking DNA has been cloned from a Staphylococcus haemolyticus isolate and sequenced. This region was used to map the corresponding regions in six other multiresistant S. haemolyticus isolates of human and animal origin. The organizations of the genetic structures were almost identical in all isolates studied. The beta-lactamase and qacA genes from S. haemolyticus have >99.9% identities at the nucleotide level with the same genes from S. aureus, demonstrating that various staphylococcal species able to colonize animal and human hosts can exchange the genetic elements involved in resistance to antibiotics and disinfectants. The use of antibiotics and disinfectants in veterinary practice and animal husbandry may also contribute to the selection and maintenance of resistance factors among the staphylococcal species. Different parts of the 12-kb section analyzed had high degrees of nucleotide identity with regions from several other different Staphylococcus aureus plasmids. This suggests the contribution of interplasmid recombination in the evolutionary makeup of this 12-kb section involving plasmids that can intermingle between various staphylococcal species. The lateral spread of resistance genes between various staphylococcal species is probably facilitated by the generation of large multiresistance plasmids and the subsequent interspecies exchange of them. PMID:12384372

  10. Isolation and overexpression of a gene encoding an extracellular beta-(1,3-1,4)-glucanase from Streptococcus bovis JB1.

    PubMed Central

    Ekinci, M S; McCrae, S I; Flint, H J


    Streptococcus bovis JB1 was found to produce a 25-kDa extracellular enzyme active against beta-(1,3-1,4)-glucans. A gene was isolated encoding a specific beta-(1,3-1,4)-glucanase that corresponds to this size and belongs to glycoside hydrolase family 16. A 4- to 10-fold increase in supernatant beta-glucanase activity was obtained when the cloned beta-glucanase gene was reintroduced into S. bovis JB1 by use of constructs based on the plasmid vector pTRW10 or pIL253. The beta-(1,3-1,4)-glucanase gene was also expressed upon introduction of the pTRW10 construct pTRWL1R into Lactococcus lactis IL2661 and Enterococcus faecalis JH2-SS, although extracellular activity was 8- to 50-fold lower than that in S. bovis JB1. The beta-(1,3-1,4)-glucanase purified from the culture supernatant of S. bovis JB1 carrying pTRWL1R showed a K(m) of 2.8 mg per ml and a Vmax of 338 mumol of glucose equivalents per min per mg of protein with barley beta-glucan as the substrate. The S. bovis beta-(1,3-1,4)-glucanase may contribute to the ability of this bacterium to utilize starch by degrading structural polysaccharides present in endosperm cell walls. PMID:9327538

  11. Differences in Extended-Spectrum Beta-Lactamase Producing Escherichia coli Virulence Factor Genes in the Baltic Sea Region

    PubMed Central

    Balode, Arta; Makarova, Mariia; Huik, Kristi; Kõljalg, Siiri; Kaftyreva, Lidia; Miciuleviciene, Jolanta; Naaber, Paul; Rööp, Tiiu; Toompere, Karolin; Suzhaeva, Ludmila; Sepp, Epp


    The aim of this study was to compare the prevalence of different virulence factor (VF) genes in extended-spectrum beta-lactamase (ESBL) producing Escherichia coli strains isolated from the Baltic Sea region. A total of 432 strains of phenotypically ESBL positive E. coli were collected from 20 institutions located in Estonia, Latvia, Lithuania, and the region of St. Petersburg in Russia from January to May 2012 and analyzed for phylogenetic group and prevalence of 23 VF genes. The strains were collected from clinical material (urine, blood, wound, and respiratory tract). Bacterial isolates were compared according to phylogenetic group, clinical material, and geographical origin. Most of the VF genes were concentrated within phylogenetic group B2 and/or D. When comparing strains isolated from different countries, it was found that strains originating from Estonia and Latvia belonged mainly to group B2 and strains from Lithuania and Russia mainly to groups B2 and D. The P-fimbrial adhesin gene papEF was more prevalent in Russian strains, colicin gene cvaC in Lithuanian strains, and capsular gene kpsMTII in Latvian strains; serum resistant gene traT was less prevalent in Estonian strains. The regional differences of VF genes remained statistically significant after taking into account the phylogenetic distribution in the countries. PMID:25250320

  12. Differences in extended-spectrum beta-lactamase producing Escherichia coli virulence factor genes in the Baltic Sea region.


    Lillo, Jana; Pai, Kristiine; Balode, Arta; Makarova, Mariia; Huik, Kristi; Kõljalg, Siiri; Ivanova, Marina; Kaftyreva, Lidia; Miciuleviciene, Jolanta; Naaber, Paul; Parv, Kristel; Pavelkovich, Anastasia; Rööp, Tiiu; Toompere, Karolin; Suzhaeva, Ludmila; Sepp, Epp


    The aim of this study was to compare the prevalence of different virulence factor (VF) genes in extended-spectrum beta-lactamase (ESBL) producing Escherichia coli strains isolated from the Baltic Sea region. A total of 432 strains of phenotypically ESBL positive E. coli were collected from 20 institutions located in Estonia, Latvia, Lithuania, and the region of St. Petersburg in Russia from January to May 2012 and analyzed for phylogenetic group and prevalence of 23 VF genes. The strains were collected from clinical material (urine, blood, wound, and respiratory tract). Bacterial isolates were compared according to phylogenetic group, clinical material, and geographical origin. Most of the VF genes were concentrated within phylogenetic group B2 and/or D. When comparing strains isolated from different countries, it was found that strains originating from Estonia and Latvia belonged mainly to group B2 and strains from Lithuania and Russia mainly to groups B2 and D. The P-fimbrial adhesin gene papEF was more prevalent in Russian strains, colicin gene cvaC in Lithuanian strains, and capsular gene kpsMTII in Latvian strains; serum resistant gene traT was less prevalent in Estonian strains. The regional differences of VF genes remained statistically significant after taking into account the phylogenetic distribution in the countries. PMID:25250320

  13. IL-1beta, but not BMP-7 leads to a dramatic change in the gene expression pattern of human adult articular chondrocytes--portraying the gene expression pattern in two donors.


    Saas, J; Haag, J; Rueger, D; Chubinskaya, S; Sohler, F; Zimmer, R; Bartnik, E; Aigner, T


    Anabolic and catabolic cytokines and growth factors such as BMP-7 and IL-1beta play a central role in controlling the balance between degradation and repair of normal and (osteo)arthritic articular cartilage matrix. In this report, we investigated the response of articular chondrocytes to these factors IL-1beta and BMP-7 in terms of changes in gene expression levels. Large scale analysis was performed on primary human adult articular chondrocytes isolated from two human, independent donors cultured in alginate beads (non-stimulated and stimulated with IL-1beta and BMP-7 for 48 h) using Affymetrix gene chips (oligo-arrays). Biostatistical and bioinformatic evaluation of gene expression pattern was performed using the Resolver software (Rosetta). Part of the results were confirmed using real-time PCR. IL-1beta modulated significantly 909 out of 3459 genes detectable, whereas BMP-7 influenced only 36 out of 3440. BMP-7 induced mainly anabolic activation of chondrocytes including classical target genes such as collagen type II and aggrecan, while IL-1beta, both, significantly modulated the gene expression levels of numerous genes; namely, IL-1beta down-regulated the expression of anabolic genes and induced catabolic genes and mediators. Our data indicate that BMP-7 has only a limited effect on differentiated cells, whereas IL-1beta causes a dramatic change in gene expression pattern, i.e. induced or repressed much more genes. This presumably reflects the fact that BMP-7 signaling is effected via one pathway only (i.e. Smad-pathway) whereas IL-1beta is able to signal via a broad variety of intracellular signaling cascades involving the JNK, p38, NFkB and Erk pathways and even influencing BMP signaling. PMID:17161615

  14. Cloning and characterization of KNR4, a yeast gene involved in (1,3)-beta-glucan synthesis.

    PubMed Central

    Hong, Z; Mann, P; Brown, N H; Tran, L E; Shaw, K J; Hare, R S; DiDomenico, B


    k9 killer toxin from Hansenula mrakii was used to select a number of resistant mutants from Saccharomyces cerevisiae. Preliminary biochemical and genetic studies showed that some of them acquired structural defects in the cell wall. One of these mutants, the knr4-1 mutant, displays a number of cell wall defects, including osmotic sensitivity; sensitivity to cercosporamide, a known antifungal agent; and resistance to Zymolyase, a (1,3)-beta-glucanase. We report here the isolation and analysis of the KNR4 gene. DNA sequence analysis revealed an uninterrupted open reading frame which contains five potential start codons. The longest coding template encodes a protein of 505 amino acids with a calculated molecular mass of 57,044 Da. A data base search revealed 100% identity with a nuclear protein, SMI1p. Disruption of the KNR4 locus does not result in cell death; however, it leads to reduced levels of both (1,3)-beta-glucan synthase activity and (1,3)-beta-glucan content in the cell wall. The gene was mapped to the right arm of chromosome VII. Images PMID:8289782

  15. Mapping of the human nicotinic acetylcholine receptor [beta]3 gene (CHRNB3) within chromosome 8p11. 2

    SciTech Connect

    Koyama, Koyama; Sudo, Kazunori; Nakamura, Yusuke )


    The authors have used an exon amplification method to construct a transcriptional map for human chromosome 8. With this method, transcribed sequences from defined regions of genomic DNA can be efficiently isolated using cosmid clones mapped to human chromosome 8. Cosmid DNAs were digested with BglII and BamHI and ligated into a BamHI site of an exon trapping vector, pSPL1. Transfection of the subcloned DNAs into Cos7 cells, isolation of cytoplasmic RNA, synthesis of cDNA by reverse transcriptase, and amplification of spliced fragments were performed according to the method described by Buckler et al. Amplified fragments were subcloned into a plasmid, pBluescriptII, and sequenced by the dideoxy chain termination method. Sequence analysis to search for similarity or identity to known genes with the program FASTA detected complete identity of one (ET634-2) of these exon amplification fragments, 227 bp in length, to the nucleotide sequence at 1138-1364 of the cDNA for the human nicotinic acetylcholine receptor (nAChR) [beta]3 gene. This transcribed fragment, containing a part of the human nAChR [beta]3 gene, was isolated from cosmid clone cCI8-328, which was previously mapped to 8p11.2 by fluorescence in situ hybridization. Localization of this gene to chromosome agreed with the results of previous mapping experiments using somatic hybrid cell lines.

  16. Transcription of T cell receptor beta-chain genes is controlled by a downstream regulatory element.

    PubMed Central

    Krimpenfort, P; de Jong, R; Uematsu, Y; Dembic, Z; Ryser, S; von Boehmer, H; Steinmetz, M; Berns, A


    To characterize cis-acting elements controlling the expression of T cell receptor beta-chains we generated a number of transgenic mouse lines harboring a rearranged T cell receptor beta-chain with different extensions of 5' and 3' flanking sequences. Transcriptional analysis of transgenic mice carrying these clones showed that sequences located downstream of the polyadenylation signal of the C beta 2 region are indispensable for expression in transgenic mice. The sequences conferring enhancer activity in this fragment were further defined by transient CAT assays. Strong enhancer activity was found to reside in a 550 bp fragment located 5 kb downstream from C beta 2. The nucleotide sequence of this fragment revealed a number of oligonucleotide motifs characteristic for enhancer elements. Images PMID:3396541

  17. Gene clusters for beta-lactam antibiotics and control of their expression: why have clusters evolved, and from where did they originate?


    Liras, Paloma; Martín, Juan F


    While beta-lactam compounds were discovered in filamentous fungi, actinomycetes and gram-negative bacteria are also known to produce different types of beta-lactams. All beta-lactam compounds contain a four-membered beta-lactam ring. The structure of their second ring allows these compounds to be classified into penicillins, cephalosporins, clavams, carbapenens or monobactams. Most beta-lactams inhibits bacterial cell wall biosynthesis but others behave as beta-lactamase inhibitors (e.g., clavulanic acid) and even as antifungal agents (e.g., some clavams). Due to the nature of the second ring in beta-lactam molecules, the precursors and biosynthetic pathways of clavams, carbapenems and monobactams differ from those of penicillins and cephalosporins. These last two groups, including cephamycins and cephabacins, are formed from three precursor amino acids that are linked into the alpha-aminoadipyl-L-cysteinyl-D-valine tripeptide. The first two steps of their biosynthetic pathways are common. The intermediates of these pathways, the characteristics of the enzymes involved, the lack of introns in the genes and bioinformatic analysis suggest that all of them should have evolved from an ancestral gene cluster of bacterial origin, which was surely transferred horizontally in the soil from producer to non-producer microorganisms. The receptor strains acquired fragments of the original bacterial cluster and occasionally inserted new genes into the clusters, which once modified, acquired new functions and gave rise to the final compounds that we know. When the order of genes in the Streptomyces genome is analyzed, the antibiotic gene clusters are highlighted as gene islands in the genome. Nonetheless, the assemblage of the ancestral beta-lactam gene cluster remains a matter of speculation. PMID:16636985

  18. A novel type of class I gene organization in vertebrates: a large family of non-MHC-linked class I genes is expressed at the RNA level in the amphibian Xenopus.

    PubMed Central

    Flajnik, M F; Kasahara, M; Shum, B P; Salter-Cid, L; Taylor, E; Du Pasquier, L


    A Xenopus class I cDNA clone, isolated from a cDNA expression library using antisera, is a member of a large family of non-classical class I genes (class Ib) composed of at least nine subfamilies, all of which are expressed at the RNA level. The subfamilies are well conserved in their immunoglobulin-like alpha 3 domains, but their peptide-binding regions (PBRs) and cytoplasmic domains are very divergent. In contrast to the great allelic diversity found in the PBR of classical class I genes, the alleles of one of the Xenopus non-classical subfamilies are extremely well conserved in all regions. Several of the invariant amino acids essential for the anchoring of peptides in the classical class I groove are not conserved in some subfamilies, but the class Ib genes are nevertheless more closely related in the PBR to classical and non-classical genes linked to the MHC in mammals and birds than to any other described class I genes like CD1 and the neonatal rat intestinal Fc receptor. Comparison with the Xenopus MHC-linked class Ia protein indicate that amino acids presumed to interact with beta 2-microglobulin are identical or conservatively changed in the two major class I families. Genomic analyses of Xenopus species suggest that the classical and non-classical families diverged from a common ancestor before the emergence of the genus Xenopus over 100 million years ago; all of the non-classical genes appear to be linked on a chromosome distinct from the one harboring the MHC. We hypothesize that this class Ib gene family is under very different selection pressures from the classical MHC genes, and that each subfamily may have evolved for a particular function. Images PMID:8223448

  19. Gene networks modified by sulphonylureas in beta cells: a pathway-based analysis of insulin secretion and cell death.


    Magnusson, Nils E; Dyrskjøt, Lars; Grimm, Daniela; Wehland, Markus; Pietsch, Jessica; Rungby, Jørgen


    Sulphonylureas (SUs) used in the treatment for type 2 diabetes have been shown to result in different clinical outcome. This study hypothesized that three widely used SUs, glibenclamide, glimepiride and gliclazide, may affect function and survival of insulin-producing cells differently. To evaluate differences between SUs, insulin secretion and cell death were measured, and genome-wide gene expression patterns were compared using a bioinformatics approach focusing on functional relationships between molecules. Insulin-producing INS-1E cells exposed to SUs for 6 and 24 hr were assayed using GeneChip. Cluster and pathway analyses were used to identify differentially expressed genes and patterns of potential biological functions associated with SU treatment. Cell death was measured using acridine orange/Hoechst 33342 staining. Short-term treatment (6 hr) yielded up-regulation of insulin secretion and genes associated with insulin secretion for all three SUs applied. While long-term treatment (24-72 hr) with gliclazide did not change gene expression or cell survival, treatment with glibenclamide or glimepiride up-regulated genes associated with oxidative stress and hypoxia, but did not induce cell death. Short-term treatment with SUs initiates gene regulation that can be attributed to insulin secretion with few differences between individual SUs. This regulation was temporal and returned to baseline after 24 hr. Individual differences observed after 24-72 hr indicate that glibenclamide and glimepiride induce potentially harmful cell signalling insufficient for triggering beta cell death. PMID:22642398

  20. Autogenous production of interferon-beta switches on HLA genes during differentiation of histiocytic lymphoma U937 cells.

    PubMed Central

    Yarden, A; Shure-Gottlieb, H; Chebath, J; Revel, M; Kimchi, A


    The expression of class I HLA genes was measured during the in vitro differentiation of human U937 lymphoma cells towards macrophages. Following the onset of differentiation by phorbol myristate acetate the levels of cytoplasmic mRNA that hybridized with a [32P]HLA-B cDNA probe increased by a factor of nine. Elevation in HLA mRNA accumulation was followed by an increase in the rate of synthesis of HLA proteins and also by a dramatic increase in class I HLA cell surface antigen expression, as shown by cytofluorimetric analysis. The elevation in HLA mRNA and surface antigens could be prevented by adding antibodies against human interferon-beta (IFN-beta) to the culture medium at the onset of differentiation. Interferon antiviral activity was detected in the medium of differentiated U937 cells. The same anti-IFN-beta antibodies prevented the increase in (2'-5')oligo(A) synthetase activity which also takes place in differentiating U937 cells. Accumulation of the IFN-induced (2'-5')oligo(A) synthetase in U937 cells is preceded by an increase in its specific 1.6-kb mRNA as shown by hybridization to cloned (2'-5')-oligo(A) synthetase cDNA. The enzyme was preferentially found in the nuclear fraction of differentiating U937 cells. We suggest that an autogenous production of interferon-beta by the differentiating cells, switches on expression of the class I HLA genes as well as that of the (2'-5')oligo(A) synthetase. Images Fig. 2. Fig. 3. PMID:6376119

  1. A homozygous nonsense mutation in the {beta}3 chain gene of laminin 5 (LAMB3) in herlitz junctional epidermolysis bullosa

    SciTech Connect

    Pulkkinen, L.; Christiano, A.M.; Uitto, J.


    Herlitz junctional epidermolysis bullosa (H-JEB) is a severe autosomal recessive disorder characterized by blister formation within the dermal-epidermal basement membrane. Based on immunofluorescence analysis recognizing laminin 5 epitopes (previously known as nicein/kalinin), the genes for this lamina lucida protein have been proposed as candidate genes in H-JEB. Amplification of mRNA by RT-PCR, followed by direct nucleotide sequencing, revealed a homozygous C-to T transition resulting in a premature termination codon (CGA{r_arrow}TGA) on both alleles. This mutation was verified at the genomic DNA level, and both parents were shown to be heterozygous carriers of the same mutation. This is the first description of a mutation in the laminin {beta}3 chain gene (LAMB3) of laminin 5 in an H-JEB patient. 15 refs., 2 figs.

  2. Mutations in the latent TGF-beta binding protein 3 (LTBP3) gene cause brachyolmia with amelogenesis imperfecta.


    Huckert, Mathilde; Stoetzel, Corinne; Morkmued, Supawich; Laugel-Haushalter, Virginie; Geoffroy, Véronique; Muller, Jean; Clauss, François; Prasad, Megana K; Obry, Frédéric; Raymond, Jean Louis; Switala, Marzena; Alembik, Yves; Soskin, Sylvie; Mathieu, Eric; Hemmerlé, Joseph; Weickert, Jean-Luc; Dabovic, Branka Brukner; Rifkin, Daniel B; Dheedene, Annelies; Boudin, Eveline; Caluseriu, Oana; Cholette, Marie-Claude; Mcleod, Ross; Antequera, Reynaldo; Gellé, Marie-Paule; Coeuriot, Jean-Louis; Jacquelin, Louis-Frédéric; Bailleul-Forestier, Isabelle; Manière, Marie-Cécile; Van Hul, Wim; Bertola, Debora; Dollé, Pascal; Verloes, Alain; Mortier, Geert; Dollfus, Hélène; Bloch-Zupan, Agnès


    Inherited dental malformations constitute a clinically and genetically heterogeneous group of disorders. Here, we report on four families, three of them consanguineous, with an identical phenotype, characterized by significant short stature with brachyolmia and hypoplastic amelogenesis imperfecta (AI) with almost absent enamel. This phenotype was first described in 1996 by Verloes et al. as an autosomal recessive form of brachyolmia associated with AI. Whole-exome sequencing resulted in the identification of recessive hypomorphic mutations including deletion, nonsense and splice mutations, in the LTBP3 gene, which is involved in the TGF-beta signaling pathway. We further investigated gene expression during mouse development and tooth formation. Differentiated ameloblasts synthesizing enamel matrix proteins and odontoblasts expressed the gene. Study of an available knockout mouse model showed that the mutant mice displayed very thin to absent enamel in both incisors and molars, hereby recapitulating the AI phenotype in the human disorder. PMID:25669657

  3. Mutations in the latent TGF-beta binding protein 3 (LTBP3) gene cause brachyolmia with amelogenesis imperfecta

    PubMed Central

    Huckert, Mathilde; Stoetzel, Corinne; Morkmued, Supawich; Laugel-Haushalter, Virginie; Geoffroy, Véronique; Muller, Jean; Clauss, François; Prasad, Megana K.; Obry, Frédéric; Raymond, Jean Louis; Switala, Marzena; Alembik, Yves; Soskin, Sylvie; Mathieu, Eric; Hemmerlé, Joseph; Weickert, Jean-Luc; Dabovic, Branka Brukner; Rifkin, Daniel B.; Dheedene, Annelies; Boudin, Eveline; Caluseriu, Oana; Cholette, Marie-Claude; Mcleod, Ross; Antequera, Reynaldo; Gellé, Marie-Paule; Coeuriot, Jean-Louis; Jacquelin, Louis-Frédéric; Bailleul-Forestier, Isabelle; Manière, Marie-Cécile; Van Hul, Wim; Bertola, Debora; Dollé, Pascal; Verloes, Alain; Mortier, Geert; Dollfus, Hélène; Bloch-Zupan, Agnès


    Inherited dental malformations constitute a clinically and genetically heterogeneous group of disorders. Here, we report on four families, three of them consanguineous, with an identical phenotype, characterized by significant short stature with brachyolmia and hypoplastic amelogenesis imperfecta (AI) with almost absent enamel. This phenotype was first described in 1996 by Verloes et al. as an autosomal recessive form of brachyolmia associated with AI. Whole-exome sequencing resulted in the identification of recessive hypomorphic mutations including deletion, nonsense and splice mutations, in the LTBP3 gene, which is involved in the TGF-beta signaling pathway. We further investigated gene expression during mouse development and tooth formation. Differentiated ameloblasts synthesizing enamel matrix proteins and odontoblasts expressed the gene. Study of an available knockout mouse model showed that the mutant mice displayed very thin to absent enamel in both incisors and molars, hereby recapitulating the AI phenotype in the human disorder. PMID:25669657

  4. The flow cytometry-defined light chain cytoplasmic immunoglobulin index and an associated 12-gene expression signature are independent prognostic factors in multiple myeloma.


    Papanikolaou, X; Alapat, D; Rosenthal, A; Stein, C; Epstein, J; Owens, R; Yaccoby, S; Johnson, S; Bailey, C; Heuck, C; Tian, E; Joiner, A; van Rhee, F; Khan, R; Zangari, M; Jethava, Y; Waheed, S; Davies, F; Morgan, G; Barlogie, B


    As part of Total Therapy (TT) 3b, baseline marrow aspirates were subjected to two-color flow cytometry of nuclear DNA content and cytoplasmic immunoglobulin (DNA/CIG) as well as plasma cell gene expression profiling (GEP). DNA/CIG-derived parameters, GEP and standard clinical variables were examined for their effects on overall survival (OS) and progression-free survival (PFS). Among DNA/CIG parameters, the percentage of the light chain-restricted (LCR) cells and their cytoplasmic immunoglobulin index (CIg) were linked to poor outcome. In the absence of GEP data, low CIg <2.8, albumin <3.5 g/dl and age ⩾65 years were significantly associated with inferior OS and PFS. When GEP information was included, low CIg survived the model along with GEP70-defined high risk and low albumin. Low CIg was linked to beta-2-microglobulin >5.5 mg/l, a percentage of LCR cells exceeding 50%, C-reactive protein ⩾8 mg/l and GEP-derived high centrosome index. Further analysis revealed an association of low CIg with 12 gene probes implicated in cell cycle regulation, differentiation and drug transportation from which a risk score was developed in TT3b that held prognostic significance also in TT3a, TT2 and HOVON trials, thus validating its general applicability. Low CIg is a powerful new prognostic variable and has identified potentially drug-able targets. PMID:25753926

  5. The flow cytometry-defined light chain cytoplasmic immunoglobulin index and an associated 12-gene expression signature are independent prognostic factors in multiple myeloma

    PubMed Central

    Papanikolaou, X; Alapat, D; Rosenthal, A; Stein, C; Epstein, J; Owens, R; Yaccoby, S; Johnson, S; Bailey, C; Heuck, C; Tian, E; Joiner, A; van Rhee, F; Khan, R; Zangari, M; Jethava, Y; Waheed, S; Davies, F; Morgan, G; Barlogie, B


    As part of Total Therapy (TT) 3b, baseline marrow aspirates were subjected to two-color flow cytometry of nuclear DNA content and cytoplasmic immunoglobulin (DNA/CIG) as well as plasma cell gene expression profiling (GEP). DNA/CIG-derived parameters, GEP and standard clinical variables were examined for their effects on overall survival (OS) and progression-free survival (PFS). Among DNA/CIG parameters, the percentage of the light chain-restricted (LCR) cells and their cytoplasmic immunoglobulin index (CIg) were linked to poor outcome. In the absence of GEP data, low CIg <2.8, albumin <3.5 g/dl and age ⩾65 years were significantly associated with inferior OS and PFS. When GEP information was included, low CIg survived the model along with GEP70-defined high risk and low albumin. Low CIg was linked to beta-2-microglobulin >5.5 mg/l, a percentage of LCR cells exceeding 50%, C-reactive protein ⩾8 mg/l and GEP-derived high centrosome index. Further analysis revealed an association of low CIg with 12 gene probes implicated in cell cycle regulation, differentiation and drug transportation from which a risk score was developed in TT3b that held prognostic significance also in TT3a, TT2 and HOVON trials, thus validating its general applicability. Low CIg is a powerful new prognostic variable and has identified potentially drug-able targets. PMID:25753926

  6. Interactions between beta-2 adrenoceptor gene variation, cardiovascular control and dietary sodium in healthy young adults

    PubMed Central

    Eisenach, John H; Schroeder, Darrell R; Pavey, Emily S; Penheiter, Alan R; Knutson, Jean N; Turner, Stephen T; Joyner, Michael J


    Dietary sodium affects function of the beta-2 adrenoceptor (ADRB2). We tested the hypothesis that haplotype variation in the ADRB2 gene would influence the cardiovascular and regional vasodilator responses to sympathoexcitatory manoeuvres following low, normal and high sodium diets, and ADRB2-mediated forearm vasodilation in the high sodium condition. Seventy-one healthy young adults were grouped by double homozygous haplotypes: Arg16+Gln27 (n = 31), the rare Gly16+Gln27 (n = 10) and Gly16+Glu27 (n = 30). Using a randomized cross-over design, subjects were studied following 5 days of controlled low, normal and high sodium with 1 month or longer between diets (and low hormone phase of the menstrual cycle). All three visits utilized ECG and finger plethysmography for haemodynamic measures, and the high sodium visit included a brachial arterial catheter for forearm vasodilator responses to isoprenaline with plethysmography. Lymphocytes were sampled for ex vivo analysis of ADRB2 density and binding conformation. We found a main effect of haplotype on ADRB2 density (P = 0.03) with the Gly16+Glu27 haplotype having the greatest density (low, normal, high sodium: 12.9 ± 0.9, 13.5 ± 0.9 and 13.6 ± 0.8 fmol mg−1 protein, respectively) and Arg16+Gln27 having the least (9.3 ± 0.6, 10.1 ± 0.5 and 10.3 ± 0.6  fmol mg−1 protein, respectively), but there were no sodium or haplotype effects on receptor binding conformation. In the mental stress trial, there was a main effect of haplotype on cardiac output (P = 0.04), as Arg16+Gln27 had the lowest responses. Handgrip and forearm vasodilation yielded no haplotype differences, and no correlations were present for ADRB2 density and haemodynamics. Our findings support cell-based evidence that ADRB2 haplotype influences ADRB2 protein expression independent of dietary sodium, yet the haemodynamic consequences appear modest in healthy humans. PMID:25260632

  7. Targeting exogenous GDNF gene to the bovine somatic cell beta-casein locus for the production of transgenic bovine animals.


    Zhang, X M; Luo, F H; Ding, H M; Li, B; Zhang, J J; Wu, Y J


    Considerable attention is currently being directed toward methods for producing recombinant human proteins in the mammary glands of genetically modified transgenic livestock. However, the expression of inserted genes in transgenic animals is variable and often very low because of the randomness of the site of transgene integration. One possible strategy to avoid the expression problem associated with random integration is to use site-specific integration by targeting integration to a high expression locus and, thereby, to improve expression of the transferred gene. In the present study, we focused on glial cell line-derived neurotrophic factor (GDNF), a novel type of neurotrophic factor first cloned in 1993. Research has shown that GDNF may have potential applications in the treatment of Parkinson's disease and other diseases of the central nervous system since it acts as a protective factor for central dopaminergic neurons. Here, we constructed a gene targeting vector to knock-in the human GDNF gene at the bovine beta-casein gene locus as a first step to producing transgenic animals with a high level of expression of human GDNF protein in their mammary glands. Bovine fetal fibroblast cells were transfected with linearized pNRTCNbG by electroporation. Three cell clones were identified with successful targeting to the beta-casein locus; and were confirmed using both polymerase chain reaction analysis and sequencing. Gene-targeted cells were used as nuclear donors; a total of 161 embryos were reconstructed, 23 of which developed to the blastocyst stage. These blastocysts were transferred to 8 recipient cows, but no offspring were obtained. PMID:26634460

  8. Identification of the human {beta}A2 crystallin gene (CRYBA2): Localization of the gene on human chromosome 2 and of the homologous gene on mouse chromosome 1

    SciTech Connect

    Hulsebos, T.J.M.; Cerosaletti, K.M.; Fournier, R.E.K.


    By using primers synthesized on the basis of the bovine {beta}A2 crystalline gene sequence, we amplified exons 5 and 6 of the human gene (CRYBA2). CRYBA2 was assigned to human chromosome 2 by concordance analysis in human x rodent somatic cell hybrids using the amplified PCR products as probe. Regional localization to 2q34-q36 was established by hybridizing the CRYBA2 probe to microcell and radiation hybrids containing defined fragments of chromosome 2 as the only human contribution. The CRYBA2 probe was also used to localize, by interspecific backcross mapping, the mouse gene (Cryba2) to the central portion of chromosome 1 in a region of known human chromosome 2 homology. Finally, we demonstrate that in both species the {beta}A2 crystallin gene is linked but separable from the {gamma}A crystallin gene. The {beta}A2 crystallin gene is a candidate gene for human and mouse hereditary cataract. 32 refs., 4 figs.

  9. Interleukin-1 alpha, interleukin-1 beta and interleukin-8 gene expression in human aural cholesteatomas.


    Kim, C S; Lee, C H; Chung, J W; Kim, C D


    Bone destruction is a common characteristic feature of chronic otitis media, especially aural cholesteatoma. A number of immunohistochemical studies have suggested that interleukin-1 (IL-1) may be responsible for cholesteatomatous bone destruction. We designed this study to present the mRNA expression patterns of IL-1 alpha, IL-1 beta, and IL-8, which can induce and activate the leukocyte, the major reservoir of potent proteolytic enzymes. Total RNAs were extracted from aural cholesteatomas, external auditory canal skin (EACS), postauricular skin (PAS), and granulation tissues and transcribed into cDNAs. cDNAs were amplified by using PCR technique with primers for IL-1 alpha, IL-1 beta, IL-8, and beta-actin. Amplified products were hybridized with each internal probe and the relative density was measured. In granulation tissues, the relative density of IL-1 alpha was greater than that of other tissues. The ratio of IL-1 beta and IL-8 of aural cholesteatoma was significantly higher than that of EACS and PAS. We suggest that both of IL-1 alpha and IL-1 beta may play a role in the pathological changes, and that IL-8, which is mainly produced from cholesteatomatous epithelium, may have an important role in the pathological changes of cholesteatomas. PMID:8725537

  10. CCAAT-binding factor regulates expression of the beta1 subunit of soluble guanylyl cyclase gene in the BE2 human neuroblastoma cell line

    NASA Technical Reports Server (NTRS)

    Sharina, Iraida G.; Martin, Emil; Thomas, Anthony; Uray, Karen L.; Murad, Ferid


    Soluble guanylyl cyclase (sGC) is a cytosolic enzyme producing the intracellular messenger cyclic guanosine monophosphate (cGMP) on activation with nitric oxide (NO). sGC is an obligatory heterodimer composed of alpha and beta subunits. We investigated human beta1 sGC transcriptional regulation in BE2 human neuroblastoma cells. The 5' upstream region of the beta1 sGC gene was isolated and analyzed for promoter activity by using luciferase reporter constructs. The transcriptional start site of the beta1 sGC gene in BE2 cells was identified. The functional significance of consensus transcriptional factor binding sites proximal to the transcriptional start site was investigated by site deletions in the 800-bp promoter fragment. The elimination of CCAAT-binding factor (CBF) and growth factor independence 1 (GFI1) binding cores significantly diminished whereas deletion of the NF1 core elevated the transcription. Electrophoretic mobility-shift assay (EMSA) and Western analysis of proteins bound to biotinated EMSA probes confirmed the interaction of GFI1, CBF, and NF1 factors with the beta1 sGC promoter. Treatment of BE2 cells with genistein, known to inhibit the CBF binding to DNA, significantly reduced protein levels of beta1 sGC by inhibiting transcription. In summary, our study represents an analysis of the human beta1 sGC promoter regulation in human neuroblastoma BE2 cells and identifies CBF as a critically important factor in beta1 sGC expression.

  11. The investigation of oxacillinase/metallo-beta-lactamase genes and clonal analysis in carbapenem-resistant Klebsiella pneumoniae.


    Cetinkol, Yeliz; Yildirim, Arzu Altunçekiç; Telli, Murat; Calgin, Mustafa Kerem


    Infections due to carbapenem-resistant Klebsiella pneumoniae represent a growing problem nationally. In our study, we aimed to examine carbapenem-resistant K. pneumoniae with multiple resistance isolated in the intensive care unit of our hospital. Isolates were investigated for the presence of oxacillinase and metallo-beta lactamase genes with a view to determining the clonal relationship between the strains intensely over a short period. Strain identification was completed with conventional methods and automated identification kit. OXA-58, OXA-23, OXA-51, OXA-24 and OXA-48 and metallo-beta lactamase genes IPM, VIM, SPM, SIM, GIM and NDM-1 were investigated with PCR. For clonal relationships of carbapenem-resistant strains, the PFGE experiment was performed. While all of these carbapenem-resistant strains were positive for OXA-48, the resistant genes NDM-1, VIM, KPC, IPM, SPM, GIM, SIM, OXA-23, OXA-24, OXA-58 and OXA-51 were not observed. When molecular typing results were investigated, PFGE determined clonal distribution of three pulsotypes. However, it was observed that the strains intensified in a single clone and this was assessed as the outbreak isolate. The results of this study showed the primary enzyme responsible for carbapenem resistance in K. pneumoniae strains in our hospital is still OXA-48. To prevent the spread of carbapenem-resistant K. pneumoniae isolates, with epidemic potential, national-level monitoring and effective infection control precautions should be enforced. PMID:27031897

  12. Purification and characterization of beta 2-tomatinase, an enzyme involved in the degradation of alpha-tomatine and isolation of the gene encoding beta 2-tomatinase from Septoria lycopersici.


    Sandrock, R W; DellaPenna, D; VanEtten, H D


    Lycopersicon species often contain the toxic glycoalkaloid alpha-tomatine, which is proposed to protect these plants from general microbial infection. however, fungal pathogens of tomato often are tolerant to alpha-tomatine and detoxification of alpha-tomatine may be how these pathogens avoid this potential barrier. As an initial step to evaluate this possibility, we have purfied to homogeneity a beta-1,2-D glucosidase from the tomato pathogen Septoria lycopersici that hydrolyzes the beta-1,2-D glucosyl bond on the tetrasaccharide moiety of alpha-tomatine to produce beta2-tomatine. The enzyme is a 110-kDa protein with a pI of 4.5 and a Km for alpha-tomatine of 62 microM. Little or no activity was detected on a variety of other glycosides. The gene encoding this protein was isolated and contains an open reading frame of 803 amino acids that shares sequence homology with several other beta-D-glucosidases. When S. lycopersici was incubated with alpha-tomatine, beta2-tomatinase mRNA accumulated, suggesting that the enzyme is substrate inducible. Aspergillus nidulans expressed ¿beta2-tomatinase¿ activity when transformed with this gene but transformants were still sensitive to alpha-tomatine. PMID:8664504

  13. Beta vulgaris root genes and their potential role in insect resistance: functional genomics analysis of a serine proteinase inhibitor gene

    Technology Transfer Automated Retrieval System (TEKTRAN)

    To gain knowledge of root defense response mechanisms, an area of plant defense research that lacks much information, more than 150 sugar beet (Beta vulgaris L.) root ESTs responding to infestations by the sugar beet root maggot (SBRM, Tetanops myopaeformis von Röder) were identified using suppressi...

  14. The GUS gene fusion system (Escherichia coli beta-D-glucuronidase gene), a useful tool in studies of root colonization by Fusarium oxysporum.

    PubMed Central

    Couteaudier, Y; Daboussi, M J; Eparvier, A; Langin, T; Orcival, J


    The plant-pathogenic fungus Fusarium oxysporum was successfully transformed with the beta-D-glucuronidase gene from Escherichia coli (gusA) (GUS system) in combination with the gene for nitrate reductase (niaD) as the selectable marker. The frequency of cotransformation, as determined by GUS expression on plates containing medium supplemented with 5-bromo-4-chloro-3-indolyl glucuronide (GUS+), was very high (up to 75%). Southern hybridization analyses of GUS+ transformants revealed that single or multiple copies of the gusA gene were integrated into the genomes. High levels of GUS activity are expressed in some transformants, but activity in F. oxysporum does not appear to be correlated with the copy number of the gusA gene. Since the highest activity was found in a transformant with a single copy, it can be assumed that sequence elements of F. oxysporum integrated upstream of the gene can act as a promoter or enhancer. Expression of the gusA gene was also detected during growth of the fungus in plants, indicating that the GUS system can be used as a sensitive and easy reporter gene assay in F. oxysporum. Images PMID:8328800

  15. New splicing mutation in the choline kinase beta (CHKB) gene causing a muscular dystrophy detected by whole-exome sequencing.


    Oliveira, Jorge; Negrão, Luís; Fineza, Isabel; Taipa, Ricardo; Melo-Pires, Manuel; Fortuna, Ana Maria; Gonçalves, Ana Rita; Froufe, Hugo; Egas, Conceição; Santos, Rosário; Sousa, Mário


    Muscular dystrophies (MDs) are a group of hereditary muscle disorders that include two particularly heterogeneous subgroups: limb-girdle MD and congenital MD, linked to 52 different genes (seven common to both subgroups). Massive parallel sequencing technology may avoid the usual stepwise gene-by-gene analysis. We report the whole-exome sequencing (WES) analysis of a patient with childhood-onset progressive MD, also presenting mental retardation and dilated cardiomyopathy. Conventional sequencing had excluded eight candidate genes. WES of the trio (patient and parents) was performed using the ion proton sequencing system. Data analysis resorted to filtering steps using the GEMINI software revealed a novel silent variant in the choline kinase beta (CHKB) gene. Inspection of sequence alignments ultimately identified the causal variant (CHKB:c.1031+3G>C). This splice site mutation was confirmed using Sanger sequencing and its effect was further evaluated with gene expression analysis. On reassessment of the muscle biopsy, typical abnormal mitochondrial oxidative changes were observed. Mutations in CHKB have been shown to cause phosphatidylcholine deficiency in myofibers, causing a rare form of CMD (only 21 patients reported). Notwithstanding interpretative difficulties that need to be overcome before the integration of WES in the diagnostic workflow, this work corroborates its utility in solving cases from highly heterogeneous groups of diseases, in which conventional diagnostic approaches fail to provide a definitive diagnosis. PMID:25740612

  16. Isolation and sequencing of a putative promoter region of the murine G protein beta 1 subunit (GNB1) gene.


    Kitanaka, Junichi; Kitanaka, Nobue; Takemura, Motohiko; Wang, Xiao-Bing; Hembree, Cambria M; Goodman, Nancy L; Uhl, George R


    The expression of the heterotrimeric GTP-binding protein beta 1 subunit gene (GNB1) is regulated by psychostimulants such as cocaine and amphetamines. Since the up-regulation appears to be one of the candidate processes of sensitization, it is necessary to elucidate the cellular and molecular mechanism of the GNB1 gene regulation for a better understanding the establishment of sensitization. In the present study, we describe the isolation and nucleotide sequence analysis of the GNB1 gene promoter region. We have isolated approximately 10 kb of the 5'-flanking region of the mouse of GNB1 gene and found potential elements involved in putative transcriptional control of the GNB1, such as AP1, AP2, Sp1, cyclic AMP response element, and nuclear factor kappa B recognition sites, within the sequences 0.3 kb upstream from the putative transcription start site. This region was highly rich in G + C content, but lacked TATA or CATT boxes. Comparing the nucleotide sequence of the cDNA clone with the human genome databases using the BLAST program a region containing putative exon 1 and promoter of the human GNB1 gene in chromosome 1 was found. The cloning and sequence analysis of an extensive portion of the 5'-flanking regulatory region of the GNB1 gene provides new insights into the factors involved in the regulation by psychostimulants of GNB1 expression. PMID:12180136

  17. The expression of the TGF beta 1 gene in the first trimester human eye and other embryonic organs.


    Hyldahl, L; Engström, W; Schofield, P


    We have examined the expression of the transforming growth factor beta 1 gene in a variety of tissues in the developing human embryo. Northern blot analysis revealed the presence of TGF B1 mRNA in the 10-12 week old eye as well as in most first trimester organs with the notable exception of the yolk sack. In an attempt to determine the topographical distribution of TGF B1 transcripts within the eye, we found that messenger RNA levels were higher in the posterior regions of the eye globe. PMID:2279276

  18. Isolation, characterization, and expression of a second {beta}-tubulin-encoding gene from Colletotrichum gloeosporioides f. sp. aeschynomene

    SciTech Connect

    Buhr, T.L.; Dickman, M.B.


    Colletotrichum gloeosporioides (Penz.) Sacc. F. sp. aeschynomene incites anthracnose on Aeschynomene virgininica (northern jointvetch). Northern jointvetch is a leguminous weed in rice and soybean fields. Contaminating northern jointvetch seeds greatly reduce the market value of rice. C. gloeosporioides (Penz.) Sacc. F. sp. aeschynomene has been commercially marketed as a mycoherbicide to decrease populations of northern jointvetch. Development of a transformation system would be extremely useful for investigating the molecular biology of C. gloeosporioides (Penz.) Sacc. F. sp. aeschynomen. This paper reports the nucleotide sequence of a second gene for {beta} Tub (TUB2) in C. gloeosporioides (Penz.) Sacc. F. sp. aeschynomene and identifies a molecular lesion which likely confers BEN (systemic fungicide) resistance.

  19. Localization of the mouse protein serine/threonine phosphatase 2C{beta} gene to chromosome 17E 4-5

    SciTech Connect

    Ohnishi, Motoko; Kobayashi, Takayasu; Kato, Shunsuke


    This article reports on the genetic mapping of the mouse serine/threonine phosphatase 2C{Beta} gene to chromosome 17E 4-5 using fluorescence in situ hybridization. The localization is compared to predicted locations based on gene mapping in the rat. 12 refs., 1 fig.

  20. Wound induced Beta vulgaris polygalacturonase-inhibiting protein genes encode a longer leucine-rich repeat domain and inhibit fungal polygalacturonases

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polygalacturonase-inhibiting proteins (PGIPs) are leucine-rich repeat (LRR) proteins involved in plant defense. Sugar beet (Beta vulgaris L.) PGIP genes, BvPGIP1, BvPGIP2 and BvPGIP3, were isolated from two breeding lines, F1016 and F1010. Full-length cDNA sequences of the three BvPGIP genes encod...

  1. Pseudophosphorylated prolactin (S179D PRL) inhibits growth and promotes beta-casein gene expression in the rat mammary gland.


    Kuo, C Benson; Wu, Wei; Xu, Xiaolei; Yang, Lili; Chen, Cyndi; Coss, Djurdjica; Birdsall, Ben; Nasseri, Dorsa; Walker, Ameae M


    We have investigated the individual roles of unmodified prolactin (U-PRL) and a mimic of phosphorylated PRL (S179D PRL) in mammary development. Recombinant versions of the PRLs were delivered to rats throughout pregnancy at a rate of 6 microg/24 h per rat and to non-pregnant females at a rate of 24 microg/24 h per rat. Measurement of progesterone, corticosterone, and estradiol showed no effect of the administered PRLs on the levels of these other mammotropic hormones. Histological and morphometric analysis showed U-PRL to cause mammary growth, whereas S179D PRL inhibited growth. Molecular analysis demonstrated decreased beta-casein expression in the mammary glands of the U-PRL-treated animals at term and increased beta-casein expression in the mammary glands of the S179D PRL-treated animals. Superior beta-casein gene expression in response to S179D PRL versus U-PRL was confirmed in HC11 cells. We conclude that U-PRL is important for growth, whereas S179D PRL promotes at least one measure of differentiated function in the mammary gland. PMID:12195299

  2. HLA-DR, DQ and T cell antigen receptor constant beta genes in Japanese patients with ulcerative colitis.

    PubMed Central

    Kobayashi, K; Atoh, M; Konoeda, Y; Yagita, A; Inoko, H; Sekiguchi, S


    We studied the T cell antigen receptor (TcR) constant beta chain genes on HLA typed Japanese patients with ulcerative colitis (UC). A TcR constant beta EcoRI 6.0-kb fragment was present in all Japanese UC patients (n = 17) but completely absent in the controls (n = 35) (chi2 = 47.6, P less than 0.001). The frequency of HLA-DR2 antigen was significantly higher in UC patients (85% versus 28% in controls, P less than 0.001). Furthermore, HLA-DQw1 antigen was also increased in UC patients (96% versus 60% in controls, P less than 0.001). However, HLA-DR4 antigen was significantly decreased in UC patients (12% versus 37%, P = 0.02). HLA-DR1 antigen was not found in UC patients and was present in only 15% of the controls. These results suggest that TcR beta chain and HLA-DQw1 antigen may be important in the pathogenesis of Japanese UC. Images Fig. 1 PMID:1973647

  3. Mapping of the {beta}{sub 2} subunit gene (GABRB2) to microdissected human chromosome 5q34-q35 defines a gene cluster for the most abundant GABA{sub A} receptor isoform

    SciTech Connect

    Russek, S.J.; Farb, D.H. |


    The {gamma}-aminobutyric acid receptor (GABA{sub A}R) is a multisubunit Cl{sup -} channel that mediates most fast inhibitory synaptic transmission in the central nervous system. Molecular evolution has given rise to many genetic variants of GABA{sub A}R subunits, including {alpha}{sub 1-6}, {beta}{sub 1-4}, {gamma}{sub 1-4}, {sigma}, and {rho}{sub 1-2}, suggesting that an enormous number of combinations of subunits are possible. Here we report that the {beta}{sub 2} gene is located on chromosome 5q34-q35, defining a cluster comprising {alpha}{sub 1}, {beta}{sub 2}, and {gamma}{sub 2} genes that together code for the most abundant GABA{sub A}R isoform. The fact that intron position is conserved in the {beta}{sub 1-3} genes, taken together with the observation that chromosomes 4 and 15 also contain distinct {alpha}-{beta}-{gamma} gene clusters, strongly suggests that an ancestral {alpha}-{beta}-{gamma} cluster was duplicated and translocated to at least two different chromosomes. This organization of GABA{sub A}R gene clusters may have been preserved as linkage provides a mechanism for facilitating coordinate gene expression. 34 refs., 5 figs., 1 tab.

  4. Epidermolysis bullosa with pyloric atresia: novel mutations in the beta4 integrin gene (ITGB4).

    PubMed Central

    Pulkkinen, L.; Kim, D. U.; Uitto, J.


    Epidermolysis bullosa with pyloric atresia (EB-PA; OMIM 226730) is a clinically and genetically heterogeneous autosomal recessive blistering disorder, including lethal and nonlethal variants. Recently, expression of alpha6beta4 integrin, a transmembrane protein of the epithelial basement membranes, has been shown to be altered in these patients. In this work, we have explored the molecular pathology of the lethal form of EB-PA, and we describe novel ITGB4 mutations in five alleles of three patients. The mutation detection strategy included polymerase chain reaction amplification of each exon of ITGB4, followed by heteroduplex analysis and direct nucleotide sequencing. The novel mutations included a homozygous 2-bp deletion in exon 34 (4501delTC), compound heterozygosity for a 2-bp deletion within the paternal allele (120delTG) within exon 3 and a cysteine substitution in the maternal allele (C245G) within exon 7, and the paternal nonsense mutation within exon 4 (Q73X). Thus, three of four distinct mutations predicted truncated polypeptide chains, whereas the missense mutation in the extracellular domain of beta4 integrin may affect ligand binding or dimerization of alpha6 and beta4 integrin subunits. These mutations emphasize the critical importance of the alpha6beta4 integrin in providing stability to the association of epidermis to the underlying dermis at the cutaneous basement membrane zone. Images Figure 1 Figure2 Figure 3 Figure 4 Figure 5 PMID:9422533

  5. Use of the Escherichia coli beta-glucuronidase (gusA) gene as a reporter gene for analyzing promoters in lactic acid bacteria.

    PubMed Central

    Platteeuw, C; Simons, G; de Vos, W M


    A transcriptional fusion vector, designated pNZ272, based on the promoterless beta-glucuronidase gene (gusA) of Escherichia coli as a reporter gene, has been constructed for lactic acid bacteria. The replicon of pNZ272 was derived from the Lactococcus lactis plasmid pSH71, allowing replication in a wide range of gram-positive bacteria and E. coli. The applicability of pNZ272 and the expression of the gusA gene in L. lactis was demonstrated in shotgun cloning experiments with lactococcal chromosomal and bacteriophage DNA. In addition, three defined lactococcal promoters were inserted in pNZ272: the plasmid-derived lacA promoter, the chromosomal usp45 promoter, and a promoter from bacteriophage phi SK11G. The three resulting plasmids showed beta-glucuronidase activity in a gusA-deficient E. coli strain and in four species of lactic acid bacteria belonging to the genera Lactobacillus, Lactococcus, and Leuconostoc. The copy numbers of the gusA-expressing plasmids were similar within a single species of lactic acid bacteria. However, the specific beta-glucuronidase activity and the gusA mRNA levels varied considerably both within a single species and among different species of lactic acid bacteria. The transcriptional start site of all three promoters was determined and found to be identical in the different species. The results of this comparative promoter analysis indicate that the requirements for efficient transcription initiation differ among the lactic acid bacteria studied. Images PMID:8135517

  6. Assignment of human transforming growth factor-{beta} type I and type III receptor genes (TGFBR1 and TGFBR3) to 9q33-q34 and 1p32-p33, respectively

    SciTech Connect

    Johnson, D.W.; Qumsiyeh, M.; Marchuk, D.A.; Benkhalifa, M.


    Transforming growth factor-{Beta} (TGF-{beta}) is a multifunctional cytokine, known to modulate several tissue development and repair processes, including cell differentiation, cell cycle progression, cellular migration, adhesion, and extracellular matrix production. The TGF-{beta} receptors and cell surface binding proteins mediate the diverse effects of TGF-{beta}. An endothelial cell-specific TGF-{beta} binding protein, endoglin, is mutated in hereditary hemorrhagic telangiectasia type 1, an autosomal dominant disorder of vascular dysplasia. Mutations in other TGF-{beta} binding protein genes may also lead to disease. We have used PCR with a cell hybrid DNA panel, and fluorescence in situ chromosomal hybridization (FISH), to localize two other TGF-{beta} receptor genes. These are the TGF-{beta} type I and type II receptors (also known as ALK-5 and betaglycan, respectively). The corresponding gene loci are designated TGFBR1 and TGFBR3. 10 refs., 1 fig., 1 tab.

  7. Gene expression and molecular phylogenetic analyses of beta-glucosidase in the termite Reticulitermes speratus (Isoptera: Rhinotermitidae).


    Shimada, Keisuke; Maekawa, Kiyoto


    Beta-glucosidase (BG) is known as a multifunctional enzyme for social maintenance in terms of both cellulose digestion and social communication in termites. However, the expression profiles of each BG gene and their evolutionary history are not well understood. First, we cloned two types of BG homologs (RsBGI and RsBGII) from the termite Reticulitermes speratus (Kolbe). Gene expression analyses showed that RsBGI expression levels of primary queens and kings from 30 to 100 days after colony foundation were high, but those of reproductives dropped after day 400. Extremely low gene expression levels of RsBGI were observed in eggs, whereas workers had significantly higher expression levels than those of soldiers and other colony members. Consequently, RsBGI gene expression levels changed among each developmental stage, and RsBGI was shown to be involved in cellulose digestion. On the other hand, the RsBGII gene was consistently expressed in all castes and developmental stages examined, and notable expression changes were not observed among them, including in eggs. It was indicated that RsBGII is a main component involved in social communication, for example, the egg-recognition pheromone shown in this species previously. Finally, we obtained partial gene homologs from other termite and cockroach species, including the woodroach (genus Cryptocercus), which is the sister group to termites, and performed molecular phylogenetic analyses. The results showed that the origin of the BG gene homologs preceded the divergence of termites and cockroaches, suggesting that the acquisition of multifunctionality of the BG gene also occurred in cockroach lineages. PMID:24831179

  8. The cotton-top tamarin (Saguinus oedipus) has five beta-microseminoprotein genes, two of which are pseudogenes.


    Valtonen-André, Camilla; Lundwall, Ake


    beta-Microseminoprotein (MSP) is one of the most abundant proteins in human seminal plasma and is secreted from the prostate gland. Its evolution can be traced from primates down to nonvertebrate species such as amphioxus, despite substantial differences in the primary structure. Most mammals are known to have one single MSP gene, but we have previously shown that the cotton-top tamarin and the common marmoset-two New World monkeys-carry several MSP genes. In this study we continue our characterization of MSP genes in the cotton-top tamarin by presenting the full nucleotide sequence of the three previously identified genes, mspA, mspE, and mspJ. A promoter analysis using the luciferase reporter showed that mspE is as transcriptionally active as the single human MSP gene, whereas mspA and mspJ display no activity with this assay. Two novel MSP genes were also identified, mspB and mspH, both of which are pseudogenes. MspB has a frameshift mutation in the third exon resulting in a new C-terminus and premature stop of translation. MspH has the features of a processed pseudogene, originating from a transcript of mspE. It is integrated into the genome together with another processed pseudogene originating from a transcript of the nucleoporin gene NUP88. The MSP genes described in this study probably arose by phylogenetically rather late duplication or retrotransposition, suggesting that they are confined to a limited number of New World monkeys. PMID:18020964

  9. Detection of sequence variants in the gene encoding the beta 3 chain of laminin 5 (LAMB3).


    Pulkkinen, L; McGrath, J A; Christiano, A M; Uitto, J


    Laminin 5, a candidate gene/protein system for mutations in the junctional forms of epidermolysis bullosa (JEB), consists of three polypeptides encoded by the LAMA3, LAMB3, and LAMC2 genes. In this study, primer pairs for the amplification of the complete cDNA as well as 22 exons of the LAMB3 gene encoding the entire beta 3 chain of laminin 5, were established. The primers for amplification of individual exons from genomic DNA were placed at least 50 bp away from the exon-intron borders in the flanking intronic sequences. For amplification of cDNA generated by RT-PCR, eight primer pairs covering overlapping segments of mRNA were used. The amplified sequences were used to study sequence variations of the LAMB3 gene in patients with JEB and unrelated individuals using heteroduplex analysis. Nine out of 13 JEB patients examined showed heteroduplexes in at least one of the PCR products, indicating the existence of two variable alleles in their DNA. Sequence analyses revealed putative pathogenetic mutations in seven of the JEB patients, while four of the heteroduplexes resulted from polymorphisms, reflecting a single basepair substitution. The results demonstrate that this method is useful in the detection of JEB mutations, as well as polymorphisms in the LAMB3 gene. PMID:7550237

  10. Extended spectrum beta-lactamase and fluoroquinolone resistance genes and plasmids among Escherichia coli isolates from zoo animals, Czech Republic.


    Dobiasova, Hana; Dolejska, Monika; Jamborova, Ivana; Brhelova, Eva; Blazkova, Lucie; Papousek, Ivo; Kozlova, Marketa; Klimes, Jiri; Cizek, Alois; Literak, Ivan


    Commensal Escherichia coli isolates from healthy zoo animals kept in Ostrava Zoological Garden, Czech Republic, were investigated to evaluate the dissemination of extended-spectrum beta-lactamase (ESBL) and plasmid-mediated quinolone resistance (PMQR) genes. A total of 160 faecal samples of various animal species were inoculated onto MacConkey agar with cefotaxime (2 mg L(-1)) or ciprofloxacin (0.05 mg L(-1)) to obtain ESBL- or PMQR-positive E. coli isolates. Clonality of E. coli isolates was investigated by multilocus sequence typing and pulsed-field gel electrophoresis. Plasmids carrying ESBL or PMQR genes were typed by PCR-based replicon typing, plasmid multilocus sequence typing and restriction fragment length polymorphism. Forty-nine (71%, n = 69) cefotaxime-resistant and 15 (16%, n = 94) ciprofloxacin-resistant E. coli isolates harboured ESBL or PMQR genes. Isolates were assigned to 18 sequence types (ST) and 20 clusters according to their macrorestriction patterns by pulsed-field gel electrophoresis. The genes blaCTX -M-1 and qnrS1 were detected on highly related IncI1 plasmids assigned to clonal complex 3 (ST3, ST38) and on non-related IncN plasmids of ST1 and ST3, respectively. The gene qnrS1 was located on related IncX1 plasmids. Dissemination of antibiotic resistance is associated with spreading of particular E. coli clones and plasmids of specific incompatibility groups among various animal species. PMID:23679004

  11. The Effect of Estradiol-17(beta), Goitrogen (T3), and Flutamide on Gene Expression in Medaka, Oryzias latipes

    SciTech Connect

    E.Haut, J


    Concern has been generated over the discovery of endocrine disrupting chemicals in rivers near sewage outflows. The presence of endocrine disrupting chemicals such as estradiol-17{beta} has been associated with a reduction of reproductive success in fish and an increase in the female phenotype and gonadal intersex in fish downstream of sewage treatment facilities. Such effects are believed to result from a disruption in the normal estrogenic pathways since estrogen plays a vital role in reproduction, sexual differentiation, the developments of secondary sex characteristics, and ovulation. Most studies have focused on the effect of a single endocrine disruptor on a single gene which does not provide for the interaction between genes. Microarray technology has made it possible to put an entire genome on a single chip so that researchers can get a clearer picture of the interaction of genes expressed in a cell and changes of said interactions when those cells are exposed to various conditions. Medaka males were exposed to known endocrine disruptors, estradial-17{beta} and goitrogen, and medaka females were exposed to flutamide. All treatments were then compared to controls. Total RNA was extracted from the livers of both treated and untreated males and hybridized to a microarray chip designed to have EST sequences specific to medaka. ESTs were identified through two-channel microarray analysis and compared to GenBank using blastn searches to identify up regulated genes. Choriogenins H and L, zona radiata, and vitellogenin, previously shown to be estrogen-induced in male fish were identified. Heat shock proteins (hsp70, hsp90, and hsp8) were also induced by estradiol-17{beta}, as was choriogenin Hminor. Exposure to goitrogen (T3) resulted in the induced expression of glutathione S-transferase and a GABA receptor protein in male medaka. Treatment with flutamide, an antiandrogen, caused the up regulation of choriogenin L, choriogenin Hminor, and zona radiata-2 in female

  12. Polymorphism of follicle stimulating hormone beta (FSHβ) subunit gene and its association with litter traits in giant panda.


    Huang, Xiaoyu; Li, Desheng; Wang, Jiwen; Huang, Yan; Han, Chunchun; Zhang, Guiquan; Huang, Zhi; Wu, Honglin; Wei, Ming; Wang, Guosong; Hu, Haiping; Deng, Tao; He, Tao; Zhou, Yingming; Song, Shixian; Luo, Bo; Zhang, Heming


    The different SSCP patterns of the follicle stimulating hormone beta (FSHβ) gene amplified by three pairs of primers were sequenced. Comparisons among the three nucleotide sequences of three genotypes indicated that three base substitutions (A213T, A91G, and A89C) were detected in FSHβ gene, which A213T substitution led to one amino acids mutation (Lys > Met), and the other two substitutions were synonymous mutations. The AA, AB and BB genotypes patterns obtained by FSHβ primer1 had evident relation with the litter traits, but the SSCP genotypes patterns obtained by FSHβ primer2 and primer3 had no evident relation with the litter traits in giant panda. The giant panda with AA and AB genotype had the largest litter size and multiparity rate compared with the BB genotypes (P < 0.05). We speculated that the giant pandas with the A allele have better litter traits than those with the B allele. PMID:24057246

  13. An Atropa belladonna hyoscyamine 6beta-hydroxylase gene is differentially expressed in the root pericycle and anthers.


    Suzuki, K; Yun, D J; Chen, X Y; Yamada, Y; Hashimoto, T


    The AbH6H gene for hyoscyamine 6beta-hydroxylase (H6H), which converts hyoscyamine to scopolamine, was isolated from Atropa belladonna. This plant also possesses a related sequence, Ab psiH6H, which appears to be a non-functional pseudo-gene. AbH6H RNA was detected in cultured root, native root and anther, but not in stem, leaf, pistil, petal, and sepal tissues. In situ hybridization, immunohistochemistry and promoter::GUS transgene analysis showed that AbH6H is expressed specifically in root pericycle cells, and in tapetum and pollen mother cells. A 671 bp 5'-upstream region from AbH6H was sufficient for pericycle-specific expression in hairy roots of A. belladonna and Hyoscyamus niger, which both produce scopolamine, but cell-specific regulation was severely compromised in tobacco hairy roots, which do not produce scopolamine. PMID:10394953

  14. Cyclic stretch induces cyclooxygenase-2 gene expression in vascular endothelial cells via activation of nuclear factor kappa-{beta}

    SciTech Connect

    Zhao, Haige; Hiroi, Toyoko; Hansen, Baranda S.; Rade, Jeffrey J.


    Vascular endothelial cells respond to biomechanical forces, such as cyclic stretch and shear stress, by altering gene expression. Since endothelial-derived prostanoids, such as prostacyclin and thromboxane A{sub 2}, are key mediators of endothelial function, we investigated the effects of cyclic stretch on the expression of genes in human umbilical vein endothelial cells controlling prostanoid synthesis: cyclooxygenase-1 (COX-1), cyclooxygenase-2 (COX-2), prostacyclin synthase (PGIS) and thromboxane A{sub 2} synthase (TXAS). COX-2 and TXAS mRNAs were upregulated by cyclic stretch for 24 h. In contrast, PGIS mRNA was decreased and stretch had no effect on COX-1 mRNA expression. We further show that stretch-induced upregulation of COX-2 is mediated by activation of the NF-{kappa}{beta} signaling pathway.

  15. Positive regulation of phenolic catabolism in Agrobacterium tumefaciens by the pcaQ gene in response to beta-carboxy-cis,cis-muconate.

    PubMed Central

    Parke, D


    An Escherichia coli system for generating a commercially unavailable catabolite in vivo was developed and was used to facilitate molecular genetic studies of phenolic catabolism. Introduction of the plasmid-borne Acinetobacter pcaHG genes, encoding the 3,4-dioxygenase which acts on protocatechuate, into E. coli resulted in bioconversion of exogenously supplied protocatechuate into beta-carboxy-cis,cis-muconate. This compound has been shown to be an inducer of the protocatechuate (pca) genes required for catabolism of protocatechuate to tricarboxylic acid cycle intermediates in Rhizobium leguminosarum biovar trifolii. The E. coli bioconversion system was used to explore regulation of the pca genes in a related bacterium, Agrobacterium tumefaciens. The pcaD gene, which encodes beta-ketoadipate enol-lactone hydrolase, from A. tumefaciens A348 was cloned and was shown to be adjacent to a regulatory region which responds strongly to beta-carboxy-cis,cis-muconate in E. coli. Site-specific insertional mutagenesis of the regulatory region eliminated expression of the pcaD gene in E. coli. When the mutation was incorporated into the A. tumefaciens chromosome, it eliminated expression of the pcaD gene and at least three other pca genes as well. The regulatory region was shown to activate gene expression in trans. The novel regulatory gene was termed pcaQ to differentiate it from pca regulatory genes identified in other microbes, which bind different metabolites. PMID:8501056

  16. Chromosomal beta-lactamase genes of Klebsiella oxytoca are divided into two main groups, blaOXY-1 and blaOXY-2.

    PubMed Central

    Fournier, B; Roy, P H; Lagrange, P H; Philippon, A


    The chromosomally encoded beta-lactamase gene (blaOXY-2) of the wild-type Klebsiella oxytoca SL911 was cloned and sequenced. Its nucleotide sequence similarity with the previously sequenced K. oxytoca beta-lactamase gene (blaOXY-1) (Y. Arakawa, M. Ohta, N. Kido, M. Mori, H. Ito, T. Komatsu, Y. Fujii, and N. Kato, Antimicrob. Agents Chemother. 33:63-70, 1989) is 87.3%, and its amino acid similarity is 89.7%. This group of K. oxytoca beta-lactamases is related to chromosomal beta-lactamases of Citrobacter diversus, Proteus vulgaris, and Yersinia enterocolitica and to the plasmid-mediated extended-spectrum beta-lactamases MEN-1 and Toho-1. By colony hybridization with 86 strains susceptible and resistant to aztreonam, isolated in six countries, K. oxytoca beta-lactamase genes hybridized with either a specific blaOXY-1 DNA probe (668 bp) or a blaOXY-2 DNA probe (723 bp). Thus, beta-lactamase genes could be divided into two groups: blaOXY-1 (47% of the strains) and blaOXY-2 (53% of the strains). A study of isoelectric points confirmed the great variability reported in the literature. However, the two beta-lactamase groups were each represented by four different pIs: for OXY-2, 5.2, 5.7, 6.4, and 6.8, with the 5.2 form representing 59% of all OXY-2 enzymes, and for OXY-1, 7.1, 7.5, 8.2, and 8.8, with the 7.5 form representing 88% of all OXY-1 enzymes. PMID:8834897

  17. Candidate gene association studies of the alpha 4 (CHRNA4) and beta 2 (CHRNB2) neuronal nicotinic acetylcholine receptor subunit genes in Alzheimer's disease.


    Cook, Lynnette J; Ho, Luk W; Taylor, Alison E; Brayne, Carol; Evans, John Grimley; Xuereb, John; Cairns, Nigel J; Pritchard, Antonia; Lemmon, Helen; Mann, David; St Clair, David; Turic, Dragana; Hollingworth, Paul; Moore, Pamela J; Jehu, Luke; Archer, Nicola; Walter, Sarah; Foy, Catherine; Edmondson, Amanda; Powell, John; Lovestone, Simon; Owen, Michael J; Williams, Julie; Lendon, Corinne; Rubinsztein, David C


    Consistent deficits in the cholinergic system are evident in Alzheimer's disease (AD) patients, including selective loss of alpha4beta2 nicotinic acetylcholine receptors in the brains of AD patients. Knockout mice for the beta2 subunit have impaired neuronal survival in ageing. Accordingly, we have analysed polymorphisms in the genes that encode the alpha4 and beta2 subunits, CHRNA4 and CHRNB2 respectively, for genetic associations with late-onset AD. A significant association for disease was observed for a non-coding polymorphism in CHRNB2 (odds ratio=0.57, 95% confidence interval=0.35-0.95, P=0.024). Replication analysis was performed in two further sample sets. While these did not individually yield significant results, a significant association remained when all samples were pooled (odds ratio=0.70, 95% confidence interval=0.52-0.95, P=0.019). These data suggest that this variant warrants further examination in large case-control series. PMID:15026168

  18. Genomic organization and sequence of the Gus-s/sup a/ allele of the murine. beta. -glucuronidase gene

    SciTech Connect

    Funkenstein, B.; Leary, S.L.; Stein, J.C.; Catterall, J.F.


    The Gus-s/sup ..cap alpha../ allele of the mouse ..beta..-glucuronidase gene exhibits a high degree of inducibility by androgens due to its linkage with the Gus-r/sup ..cap alpha../ regulatory locus. The authors isolated Gus-s/sup ..cap alpha../ on a 28-kilobase pair fragment of mouse chromosome 5 and found that it contains 12 exons and 11 intervening sequences spanning 14 kilobase pairs of this genomic segment. The mRNA cap site was identified by ribonuclease protection and primer extension analyses which revealed an unusually short 5' noncoding sequence of 12 nucleotides. Proximal regulatory sequences in the 5'-flanking DNA and the complete sequence of the Gus-s/sup ..cap alpha../ mRNA transcript were also determined. Comparison of the amino acid sequence determined from the Gus-s/sup ..cap alpha../ nucleotide sequence with that of human ..beta..-glucuronidase indicated that the two human mRNA species differ due to alternate splicing of an exon homologous to exon 6 of the mouse gene.

  19. Development a diagnostic pan-dermatophyte TaqMan probe real-time PCR assay based on beta tubulin gene.


    Mirhendi, Hossein; Motamedi, Marjan; Makimura, Koichi; Satoh, Kazuo


    Early differentiation of dermatophytosis from other cutaneous mycoses is essential to avoid inaccurate therapy. DNA-based techniques including real-time PCR have increasingly been considered for detection of fungal elements in clinical specimens. In this study, after partial sequence analysis of beta tubulin (BT2) gene in 13 common and rare pathogenic dermatophyte species, a pan-dermatophyte primer and probe set was designed in a TaqMan probe-based PCR format. The sensitivity and specificity of the system was tested with 22 reference strains of dermatophytes, 234 positive clinical specimens, 32 DNA samples extracted from normal nails, several fungi other than dermatophytes and human DNAs. Analytical detection limit of the designed PCR on serially diluted DNAs of prepared recombinant plasmid indicated that only five molecules per sample are the minimum number for reliable detection by the assay. A total of 226 out of 234 (96.5%) DNAs extracted from clinical samples, but none of the 32 nail samples, from healthy volunteers were positive in PCR. The real-time PCR targeted beta tubulin gene established in this study could be a sensitive diagnostic tool which is significantly faster than the conventional culture method and should be useful in the clinical settings, in large-scale epidemiological studies and in clinical trials of antifungal therapy. PMID:27071371

  20. Frequency of Hereditary Hemochromatosis (HFE) Gene Mutations in Egyptian Beta Thalassemia Patients and its Relation to Iron Overload

    PubMed Central

    Enein, Azza Aboul; El Dessouky, Nermine A.; Mohamed, Khalda S.; Botros, Shahira K.A.; Abd El Gawad, Mona F.; Hamdy, Mona; Dyaa, Nehal


    AIM: This study aimed to detect the most common HFE gene mutations (C282Y, H63D, and S56C) in Egyptian beta thalassemia major patients and its relation to their iron status. SUBJECTS AND METHODS: The study included 50 beta thalassemia major patients and 30 age and sex matched healthy persons as a control group. Serum ferritin, serum iron and TIBC level were measured. Detection of the three HFE gene mutations (C282Y, H63D and S65C) was done by PCR-RFLP analysis. Confirmation of positive cases for the mutations was done by sequencing. RESULTS: Neither homozygote nor carrier status for the C282Y or S65C alleles was found. The H63D heterozygous state was detected in 5/50 (10%) thalassemic patients and in 1/30 (3.3%) controls with no statistically significant difference between patients and control groups (p = 0.22). Significantly higher levels of the serum ferritin and serum iron in patients with this mutation (p = 001). CONCLUSION: Our results suggest that there is an association between H63D mutation and the severity of iron overload in thalassemic patients. PMID:27335591

  1. Molecular analysis of the Septoria nodorum beta-tubulin gene and characterization of a benomyl-resistance mutation.


    Cooley, R N; Caten, C E


    The complete nucleotide sequence of a benomyl-resistant allele of the Septoria nodorum beta-tubulin gene (tubAR) has been determined including 745 and 1024 nucleotides 5' and 3' to the tubAR coding region, respectively. tubAR encodes a 447 amino acid polypeptide which shows a high degree of homology with other fungal beta-tubulins. The gene contains three introns at codons 4, 12 and 53, uses 48 of the possible 61 sense codons and has a GC content of 59.1% in its coding region. S1 nuclease mapping has identified two transcriptional start sites 80 bp and 83 bp upstream of the translation start, and a transcriptional termination site 192 bp downstream of the stop codon. The two transcriptional start sites lie just 8 bp and 5 bp downstream of a CT motif consisting of 18 pyrimidine nucleotides interrupted by a single adenine. The wild-type allele tubA+ has been cloned using the polymerase chain reaction and the mutation producing the benomyl-resistant phenotype of tubAR mapped to a C to T transition at the first position of codon 6, resulting in a histidine to tyrosine amino acid substitution. PMID:8455567

  2. Cloning and characterization of KNR4, a yeast gene involved in (1,3)-{beta}-glucan synthesis

    SciTech Connect

    Hong, Zhi; Mann, P.; Brown, N.H.


    K9 killer toxin from Hansenula mrakii was used to select a number of resistant mutants from Saccharomyces cerevisiae. Preliminary biochemical and genetic studies showed that some of them acquired structural defects in the cell wall. One of these mutants, the knr4-1 mutant, displays a number of cell wall defects, including osmotic sensitivity; sensitivity to cercosporamide, a known antifungal agent; and resistance to Zymolyase, a (1,3)-{beta}-glucanase. We report here the isolation and analysis of the KNR4 gene. DNA sequence analysis revealed an uninterrupted open reading frame which contains five potential start codons. The longest coding template encodes a protein of 505 amino acids with a calculated molecular mass of 57,044 Da. A data base search revealed 100% identity with a nuclear protein, SMI1p. Disruption of the KNR4 locus does not result in cell death; however, it leads to reduced levels of both (1,3)-{beta}-glucan synthase activity and (1,3)-p-glucan content in the cell wall. The gene was mapped to the right arm of chromosome VII. 70 refs., 8 figs., 1 tab.

  3. Beta-lactamase gene expression in a penicillin-resistant Bacillus anthracis strain.


    Chen, Yahua; Tenover, Fred C; Koehler, Theresa M


    Expression of the bla1 and bla2 genes in an archetypal Bacillus anthracis strain is insufficient for penicillin resistance. In a penicillin-resistant clinical isolate, both genes are highly transcribed, but bla1 is the major contributor to high-level resistance to ampicillin. Differential expression of the bla genes is dependent upon strain background. PMID:15561870

  4. A Polymorphism Within the Promoter of the TGF{beta}1 Gene Is Associated With Radiation Sensitivity Using an Objective Radiologic Endpoint

    SciTech Connect

    Kelsey, Chris R.; Jackson, Lauren; Langdon, Scott; Owzar, Kouros; Hubbs, Jessica; Vujaskovic, Zeljko; Das, Shiva; Marks, Lawrence B.


    Purpose: To evaluate whether single nucleotide polymorphisms (SNPs) in the transforming growth factor-{beta}1 (TGF{beta}1) gene are associated with radiation sensitivity using an objective radiologic endpoint. Methods and Materials: Preradiation therapy and serial postradiation therapy single photon emission computed tomography (SPECT) lung perfusion scans were obtained in patients undergoing treatment for lung cancer. Serial blood samples were obtained to measure circulating levels of TGF{beta}1. Changes in regional perfusion were related to regional radiation dose yielding a patient-specific dose-response curve, reflecting the patient's inherent sensitivity to radiation therapy. Six TGF{beta}1 SNPs (-988, -800, -509, 869, 941, and 1655) were assessed using high-resolution melting assays and DNA sequencing. The association between genotype and slope of the dose-response curve, and genotype and TGF{beta}1 ratio (4-week/preradiation therapy), was analyzed using the Kruskal-Wallis test. Results: 39 white patients with preradiation therapy and {>=}6-month postradiation therapy SPECT scans and blood samples were identified. Increasing slope of the dose-response curve was associated with the C(-509)T SNP (p = 0.035), but not the other analyzed SNPs. This SNP was also associated with higher TGF{beta}1 ratios. Conclusions: This study suggests that a polymorphism within the promoter of the TGF{beta}1 gene is associated with increased radiation sensitivity (defined objectively by dose-dependent changes in SPECT lung perfusion).

  5. Cloning, characterization, and nucleotide sequence of a gene encoding Microbispora bispora BglB, a thermostable beta-glucosidase expressed in Escherichia coli.

    PubMed Central

    Wright, R M; Yablonsky, M D; Shalita, Z P; Goyal, A K; Eveleigh, D E


    Genomic DNA fragments encoding beta-glucosidase activities of the thermophilic actinomycete Microbispora bispora were cloned into Escherichia coli. Transformants expressing beta-glucosidase activity were selected by their ability to hydrolyze the fluorogenic substrate 4-methylumbelliferyl-beta-D-glucoside. Two genes encoding beta-glucosidase activity were isolated and distinguished by restriction analysis, Southern hybridization, and the substrate specificities of the encoded enzymes. One gene, bglB, encoded a beta-glucosidase that was expressed intracellularly in E. coli. It exhibited a molecular mass of approximately 52,000 Da by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (PAGE) and 51,280 Da by nondenaturing gradient PAGE, a pI of 4.6, and temperature and pH optima of 60 degrees C and 6.2, respectively. Cloned BglB showed greater activity against cellobiose than against aryl-beta-D-glucosides and was thermostable, retaining about 70% of its activity after 48 h at 60 degrees C. BglB activity is activated two- to threefold in the presence of 2 to 5% (0.1 to 0.3 M) glucose. The DNA sequence of the 2.2-kb insert carrying bglB has been determined. An open reading frame which codes for a protein of 473 amino acids with a predicted molecular mass of 52,227 Da showed significant homology (40 to 47% identity) with beta-glucosidases from glycosal hydrolase family 1. Images PMID:1482172

  6. Two beta-glycanase genes are clustered in Bacillus polymyxa: molecular cloning, expression, and sequence analysis of genes encoding a xylanase and an endo-beta-(1,3)-(1,4)-glucanase.

    PubMed Central

    Gosalbes, M J; Pérez-González, J A; González, R; Navarro, A


    Two genes, xynD and gluB, encoding a xylanase and an endo-beta-(1,3)-(1,4)-glucanase (lichenase) from Bacillus polymyxa have been cloned and expressed in Escherichia coli and Bacillus subtilis. A sequenced DNA fragment of 4,466 bp contains both genes, which are separated by 155 bp. The xynD and gluB genes encode proteins of 67.8 kDa (XYND) and 27 kDa (GLUB). Two peptides with molecular masses of 62 and 53 kDa appear in cell extracts of E. coli and culture supernatants of B. subtilis clones containing the xynD gene. Both peptides show xylanase activity in zymogram analysis. The XYND enzyme also shows alpha-L-arabinofuranosidase activity. The XYND peptide and the xylanase XYNZ from Clostridium thermocellum (O. Grépinet, M. C. Chebrou, and P. Béguin, J. Bacteriol. 170:4582-4588, 1988) show 64% homology in a stretch of about 280 amino acids. Images FIG. 3 PMID:1938968

  7. Two beta-glycanase genes are clustered in Bacillus polymyxa: molecular cloning, expression, and sequence analysis of genes encoding a xylanase and an endo-beta-(1,3)-(1,4)-glucanase.


    Gosalbes, M J; Pérez-González, J A; González, R; Navarro, A


    Two genes, xynD and gluB, encoding a xylanase and an endo-beta-(1,3)-(1,4)-glucanase (lichenase) from Bacillus polymyxa have been cloned and expressed in Escherichia coli and Bacillus subtilis. A sequenced DNA fragment of 4,466 bp contains both genes, which are separated by 155 bp. The xynD and gluB genes encode proteins of 67.8 kDa (XYND) and 27 kDa (GLUB). Two peptides with molecular masses of 62 and 53 kDa appear in cell extracts of E. coli and culture supernatants of B. subtilis clones containing the xynD gene. Both peptides show xylanase activity in zymogram analysis. The XYND enzyme also shows alpha-L-arabinofuranosidase activity. The XYND peptide and the xylanase XYNZ from Clostridium thermocellum (O. Grépinet, M. C. Chebrou, and P. Béguin, J. Bacteriol. 170:4582-4588, 1988) show 64% homology in a stretch of about 280 amino acids. PMID:1938968

  8. Cloning of the Bacillus subtilis DLG beta-1,4-glucanase gene and its expression in Escherichia coli and B. subtilis.

    PubMed Central

    Robson, L M; Chambliss, G H


    The gene encoding beta-1,4-glucanase in Bacillus subtilis DLG was cloned into both Escherichia coli C600SF8 and B. subtilis PSL1, which does not naturally produce beta-1,4-glucanase, with the shuttle vector pPL1202. This enzyme is capable of degrading both carboxymethyl cellulose and trinitrophenyl carboxymethyl cellulose, but not more crystalline cellulosic substrates (L. M. Robson and G. H. Chambliss, Appl. Environ. Microbiol. 47:1039-1046, 1984). The beta-1,4-glucanase gene was localized to a 2-kilobase (kb) EcoRI-HindIII fragment contained within a 3-kb EcoRI chromosomal DNA fragment of B. subtilis DLG. Recombinant plasmids pLG4000, pLG4001a, pLG4001b, and pLG4002, carrying this 2-kb DNA fragment, were stably maintained in both hosts, and the beta-1,4-glucanase gene was expressed in both. The 3-kb EcoRI fragment apparently contained the beta-1,4-glucanase gene promoter, since transformed strains of B. subtilis PSL1 produced the enzyme in the same temporal fashion as the natural host B. subtilis DLG. B. subtilis DLG produced a 35,200-dalton exocellular beta-1,4-glucanase; intracellular beta-1,4-glucanase was undetectable. E. coli C600SF8 transformants carrying any of the four recombinant plasmids produced two active forms of beta-1,4-glucanase, an intracellular form (51,000 +/- 900 daltons) and a cell-associated form (39,000 +/- 400 daltons). Free exocellular enzyme was negligible. In contrast, B. subtilis PSL1 transformed with recombinant plasmid pLG4001b produced three distinct sizes of active exocellular beta-1,4-glucanase: approximately 36,000, approximately 35,200, and approximately 33,500 daltons. Additionally, B. subtilis PSL1(pLG4001b) transformants contained a small amount (5% or less) of active intracellular beta-1,4-glucanase of three distinct sizes: approximately 50,500, approximately 38,500 and approximately 36,000 daltons. The largest form of beta-1,4-glucanase seen in both transformants may be the primary, unprocessed translation product of the

  9. Structure and mapping of the human thymopoietin (TMPO) gene and relationship of human TMPO {beta} to rat lamin-associated polypeptide 2

    SciTech Connect

    Harris, C.A.; Andryuk, P.J.; Cline, S.W.; Seikierka, J.J.; Goldstein, G.


    Thymopoietins (TMPOs, previously abbreviated TPs) {alpha}(75kDa), {beta}(51 kDa), and {gamma}(39 kDa) are related nuclear proteins expressed in many or all tissues. TMPO {alpha} is present diffusely throughout the nucleus, while TMPOs {beta} and {gamma} are localized to the nuclear membrane. Here we report the cloning and analysis of a single TMPO gene encoding TMPOs {alpha}, {beta}, and {gamma}, which are produced by alternative mRNA splicing, as previously inferred from cDNA sequences. The eight exons of the TMPO gene are spread over {approximately}35 kb. Exon 4, which is spliced into TMPS {alpha} mRNA, contains sequences that encode a putative basic nuclear localization motif. Exon 8, which is spliced into TMPO {beta} and {gamma} mRNAs, encodes a hydrophobic putative membrane-spanning domain that is thought to target TMPOs {beta} and {gamma} to the nuclear membrane. TMPO {Beta} appears to be the human homologue of the recently described rat protein LAP2 (lamina-associated polypeptide 2), which is thought to play an important role in the regulation of nuclear architecture by binding lamin B1 and chromosomes in a manner regulated by phosphorylation during mitosis. The human TMPO gene maps to chromosome band 12q22. 28 refs., 6 figs., 1 tab.

  10. A rare allele combination of the interleukin-1 gene complex is associated with high interleukin-1 beta plasma levels in healthy individuals.


    Hulkkonen, J; Laippala, P; Hurme, M


    Increases in the plasma levels of the inflammatory cytokines can be detected in various infectious and inflammatory diseases, but in healthy individuals these levels are in most cases low or undetectable. There is now increasing evidence that genes of the inflammatory cytokines are polymorphic and the various alleles may differ in their capability to produce the cytokine. We have measured the plasma levels IL-1 beta of 400 healthy blood donors and correlated these to the genotype (biallelelic base exchanges at the position - 889 of the IL-1 alpha gene, and at the position - 511 of the IL-1 beta gene and the pentaallelic VNTR in the second intron of the IL-1Ra gene). The median concentration of IL-1 beta was 5.8 pg/ml (upper and lower quartiles 2.2-13.6). The polymorphisms of the IL-1 beta and IL-1 Ra genes did not have any significant influence on the IL-1 beta levels, but the IL-1 alpha 2.2 homozygotes (32/400 blood donors) had significantly elevated levels (median 7.0 pg/ml, quartiles 2.2-22.4, one-way ANOVA p < 0.008 as compared to the IL-1 alpha 1.1 homozygotes and p < 0.02 as compared to the IL-1 alpha 1.2 heterozygotes). This effect of IL-1 alpha 2.2 homozygosity was more pronounced in donors, who also were carriers of the IL-1 beta allele 2. Thus these data suggest that this allele combination has a regulatory effect on basal IL-1 beta production. PMID:10903804

  11. Expression of a cellular gene cloned in herpes simplex virus: rabbit beta-globin is regulated as an early viral gene in infected fibroblasts.

    PubMed Central

    Smiley, J R; Smibert, C; Everett, R D


    We constructed nondefective herpes simplex virus type 1 recombinants bearing the intact rabbit beta-globin gene inserted into the viral gene for thymidine kinase to study the expression of a cellular gene when it is present in the viral genome during lytic viral infections. The globin promoter was activated to high levels during productive infection of Vero cells, giving rise to properly spliced and processed cytoplasmic globin transcripts. Expression of globin RNA occurred with early kinetics, was not affected by blocking viral DNA replication, and was strongly inhibited by preventing viral immediate-early protein synthesis with cycloheximide. These results support the hypothesis that temporal control of herpes simplex virus early gene expression is accomplished by mechanisms that are not restricted to viral promoters. In addition, these data show that a cellular transcript can be correctly processed and can accumulate to high levels during viral infection; this indicates that the mechanisms of virally induced shutoff of host RNA accumulation and degradation of host mRNAs do not depend on sequence-specific differentiation between host and viral RNAs. These findings also suggest that herpesviruses have considerable potential as high-capacity gene transfer vectors for a variety of applications. Images PMID:3037101

  12. Platypus globin genes and flanking loci suggest a new insertional model for beta-globin evolution in birds and mammals

    PubMed Central

    Patel, Vidushi S; Cooper, Steven JB; Deakin, Janine E; Fulton, Bob; Graves, Tina; Warren, Wesley C; Wilson, Richard K; Graves, Jennifer AM


    Background Vertebrate alpha (α)- and beta (β)-globin gene families exemplify the way in which genomes evolve to produce functional complexity. From tandem duplication of a single globin locus, the α- and β-globin clusters expanded, and then were separated onto different chromosomes. The previous finding of a fossil β-globin gene (ω) in the marsupial α-cluster, however, suggested that duplication of the α-β cluster onto two chromosomes, followed by lineage-specific gene loss and duplication, produced paralogous α- and β-globin clusters in birds and mammals. Here we analyse genomic data from an egg-laying monotreme mammal, the platypus (Ornithorhynchus anatinus), to explore haemoglobin evolution at the stem of the mammalian radiation. Results The platypus α-globin cluster (chromosome 21) contains embryonic and adult α- globin genes, a β-like ω-globin gene, and the GBY globin gene with homology to cytoglobin, arranged as 5'-ζ-ζ'-αD-α3-α2-α1-ω-GBY-3'. The platypus β-globin cluster (chromosome 2) contains single embryonic and adult globin genes arranged as 5'-ε-β-3'. Surprisingly, all of these globin genes were expressed in some adult tissues. Comparison of flanking sequences revealed that all jawed vertebrate α-globin clusters are flanked by MPG-C16orf35 and LUC7L, whereas all bird and mammal β-globin clusters are embedded in olfactory genes. Thus, the mammalian α- and β-globin clusters are orthologous to the bird α- and β-globin clusters respectively. Conclusion We propose that α- and β-globin clusters evolved from an ancient MPG-C16orf35-α-β-GBY-LUC7L arrangement 410 million years ago. A copy of the original β (represented by ω in marsupials and monotremes) was inserted into an array of olfactory genes before the amniote radiation (>315 million years ago), then duplicated and diverged to form orthologous clusters of β-globin genes with different expression profiles in different lineages. PMID:18657265

  13. Shiga toxin and beta-lactamases genes in Escherichia coli phylotypes isolated from carcasses of broiler chickens slaughtered in Iran.


    Bagheri, Mahboube; Ghanbarpour, Reza; Alizade, Hesam


    Two hundred and four Escherichia coli strains were isolated from external and visceral cavity surfaces of 102 slaughtered broiler carcasses. The isolates were screened to determine the phylogenetic background and presence of Shiga toxins (stx1, stx2), intimin (eae) and beta-lactamase (blaTEM, blaSHV) genes. Phylotyping results revealed that the E. coli isolates segregated in four phylogenetic groups A (56.86%), B1 (19.12%), B2 (4.90%) and D (19.12%). PCR assays revealed that 13 isolates (6.37%) from 12 carcasses were positive for eae (12 isolates) and/or stx2 (2) genes. The eae positive isolates belonged to phylogenetic groups A (A0, A1), B1, B2 (B22) and D (D2). Two stx2 positive and seven eae positive isolates were recovered from visceral cavity surface, whereas only 5 eae positive isolates were from the external surface of the carcasses. On the other hand, thirty one E. coli strains isolated from visceral cavity and external surface of 26 carcasses carried the blaTEM (27) and blaSHV (4) genes and belonged to different phylo-groups. This study suggests that broiler carcasses could be considered as an important source of EPEC and STEC pathotypes in southeast of Iran; as well as the examined antibiotic resistance genes, which were carried by some isolates and could be transferred to pathogens through the food chain. PMID:24590116

  14. Computational identification and characterization of conserved miRNAs and their target genes in beet (Beta vulgaris).


    Li, J L; Cui, J; Cheng, D Y


    Highly conserved endogenous non-coding microRNAs (miRNAs) play important roles in plants and animals by silencing genes via destruction or blocking of translation of homologous mRNA. Sugar beet, Beta vulgaris, is one of the most important sugar crops in China, with properties that include wide adaptability and strong tolerance to salinity and impoverished soils. Seedlings of B. vulgaris can grow in soils containing up to 0.6% salt; it is important to understand the molecular mechanisms of salt tolerance to enrich genetic resources for breeding salt-tolerant sugar beets. Here, we report 13 mature miRNAs from 12 families, predicted using an in silico approach from 29,857 expressed sequence tags and 279,223 genome survey sequences. The psRNATarget server predicted 25 target genes for the 13 miRNAs. Most of the target genes appeared to encode transcription factors or were involved in metabolism, signal transduction, stress response, growth, and development. These results improve our understanding of the molecular mechanisms of miRNA in beet and may aid in the development of novel and precise techniques for understanding post-transcriptional gene-silencing mechanisms in response to stress tolerance. PMID:26345842

  15. Use of polymerase chain reaction in the quantitation of mdr-1 gene expression

    SciTech Connect

    Murphy, L.D.; Herzog, C.E.; Rudick, J.B.; Fojo, A.T.; Bates, S.E. )


    The ability of the polymerase chain reaction (PCR) to quantitate expression of mRNA was examined in the present study. The model chosen was expression of the multidrug resistance gene mdr-1/Pgp in two colon carcinoma cell lines which express mdr-1/Pgp at levels comparable to those found in many clinical samples. PCR was utilized to evaluate differences in mdr-1/Pgp expression in the two cell lines after modulation by sodium butyrate. Thus, comparisons were made across a range of mdr-1/Pgp expression as well as comparisons of small differences. The PCR was found to be both sensitive and quantitative. Accurate quantitation requires demonstration of an exponential range which varies among samples. The exponential range can be determined by carrying out the PCR for a fixed number of cycles on serial dilutions of the RNA reverse transcription product, or by performing the reaction with a varying number of cycles on a fixed quantity of cDNA. By quantitation of the difference in PCR product derived from a given amount of RNA from the sodium butyrate treated and untreated cells, the difference in mRNA expression between samples can be determined. Normalization of the results can be achieved by independent amplification of a control gene, such as {beta}{sub 2}-microglobulin, when the latter is also evaluated in the exponential range. Simultaneous amplification of the control and target genes results in lower levels of PCR products due to competition, which varies from sample to sample. The PCR is thus a labor-intensive but sensitive method of quantitating gene expression in small samples of RNA.

  16. Nucleotide sequences of the arb genes, which control beta-glucoside utilization in Erwinia chrysanthemi: comparison with the Escherichia coli bgl operon and evidence for a new beta-glycohydrolase family including enzymes from eubacteria, archeabacteria, and humans.

    PubMed Central

    el Hassouni, M; Henrissat, B; Chippaux, M; Barras, F


    The phytopathogenic bacterium Erwinia chrysanthemi, unlike other members of the family Enterobacteriaceae, is able to metabolize the beta-glucosides, arbutin, and salicin. A previous genetic analysis of the E. chrysanthemi arb genes, which mediate beta-glucoside metabolism, suggested that they were homologous to the Escherichia coli K-12 bgl genes. We have now determined the nucleotide sequence of a 5,065-bp DNA fragment containing three genes, arbG, arbF, and arbB. Deletion analysis, expression in minicell systems, and comparison with sequences of other proteins suggest that arbF and arbB encode a beta-glucoside-specific phosphotransferase system-dependent permease and a phospho-beta-glucosidase, respectively. The ArbF amino acid sequence shares 55% identity with that of the E. coli BglF permease and contains most residues thought to be important for a phosphotransferase. One change, however, was noted, since BglF Arg-625, presumably involved in phosphoryl transfer, was replaced by a Cys residue in ArbF. An analysis of the ArbB sequence led to the definition of a protein family which contained enzymes classified as phospho-beta-glucosidases, phospho-beta-galactosidases, beta-glucosidases, and beta-galactosidases and originating from gram-positive and gram-negative bacteria, archebacteria, and mammals, including humans. An analysis of this family allowed us (i) to speculate on the ways that these enzymes evolved, (ii) to identify a glutamate residue likely to be a key amino acid in the catalytic activity of each protein, and (iii) to predict that domain II of the human lactate-phlorizin hydrolase, which is involved in lactose intolerance, is catalytically nonactive. A comparison between the untranslated regions of the E. chrysanthemi arb cluster and the E. coli bgl operon revealed the conservation of two regions which, in the latter, are known to terminate transcription under noninducing conditions and be the target of the BglG transcriptional antiterminator under

  17. A Single-Nucleotide Polymorphism in ABCC4 Is Associated with Tenofovir-Related Beta2-Microglobulinuria in Thai Patients with HIV-1 Infection

    PubMed Central

    Likanonsakul, Sirirat; Suntisuklappon, Bussakorn; Nitiyanontakij, Ravee; Prasithsirikul, Wisit; Nakayama, Emi E.; Shioda, Tatsuo; Sangsajja, Chariya


    Background In Thailand, the combined generic anti-retroviral drug stavudine/lamivudine/nevirapine (d4T/3TC/NVP) has been used to treat human immunodeficiency virus (HIV)-infected individuals since 2001. Due to relatively frequent adverse effects, d4T gradually has been replaced with tenofovir disoproxil fumarate (TDF). Although the frequency of adverse drug effects with TDF is lower than that with d4T, TDF is known to induce kidney dysfunction, especially in the proximal tubules. It has been reported that renal tubular transporters, including members of the multi-drug resistant (MDR) protein family, are implicated in tenofovir extrusion and may, therefore, confer susceptibility to TDF-induced kidney tubular dysfunction (KTD). We have explored the association between KTD and polymorphisms in genes that encode adenosine triphosphate-binding cassette (ABC)-type MDRs. Methods HIV-infected patients receiving TDF-containing antiretroviral regimens for at least one year were enrolled in the study. The levels of beta2-microglobulin in urine and creatinine (Cr) were measured. Three single-nucleotide polymorphisms, ABCC2 C-24T (rs717620), ABCC2 G1429A (rs2273697), and ABCC4 T4976C (rs1059751), were analyzed using TaqMan SNP genotyping assays. Results A total of 273 HIV-infected patients were recruited. The median number of years of TDF treatment was 5.04 with interquartile range (IQR) of 3.9–6.7. Despite the length of treatment with TDF, 98.5% patients maintained an estimated glomerular filtration rate (eGFR) of >60 mL/min as calculated by the CKD-EPI formula. Fifty-four patients (19.8%) showed beta2-microglobulinuria (median 2636 μg/g Cr with IQR of 1519–13197 μg/g Cr). The allele frequency of ABCC4 T4976C among those 54 patients was 0.602, compared to 0.475 among the 219 remaining patients (p = 0.018). Conclusions Approximately 20% of HIV-infected patients receiving TDF showed beta2-microglobulinuria. The C allele at position 4976 of the ABCC4 gene was associated

  18. Molecular and biochemical characterization of an endo-beta-1,3-glucanase from the pinewood nematode Bursaphelenchus xylophilus acquired by horizontal gene transfer from bacteria.


    Kikuchi, Taisei; Shibuya, Hajime; Jones, John T


    We report the cloning and functional characterization of an endo-beta-1,3-glucanase from the pinewood nematode Bursaphelenchus xylophilus acquired by horizontal gene transfer from bacteria. This is the first gene of this type from any nematode species. We show that a similar cDNA is also present in another closely related species B. mucronatus, but that similar sequences are not present in any other nematode studied to date. The B. xylophilus gene is expressed solely in the oesophageal gland cells of the nematode and the protein is present in the nematode's secretions. The deduced amino acid sequence of the gene is very similar to glycosyl hydrolase family 16 proteins. The recombinant protein, expressed in Escherichia coli, preferentially hydrolysed the beta-1,3-glucan laminarin, and had very low levels of activity on beta-1,3-1,4-glucan, lichenan and barley beta-glucan. Laminarin was degraded in an endoglucanase mode by the enzyme. The optimal temperature and pH for activity of the recombinant enzyme were 65 degrees C and pH 4.9. The protein is probably important in allowing the nematodes to feed on fungi. Sequence comparisons suggest that the gene encoding the endo-beta-1,3-glucanase was acquired by horizontal gene transfer from bacteria. B. xylophilus therefore contains genes that have been acquired by this process from both bacteria and fungi. These findings support the idea that multiple independent horizontal gene transfer events have helped in shaping the evolution of several different life strategies in nematodes. PMID:15727561

  19. [The Trp64Arg polymorphism of beta3-adrenoreceptor gene study in persons with overweight and obesity].


    Baturin, A K; Pogozheva, A V; Sorokina, E Iu; Makurina, O N; Tutel'ian, V A


    The development of obesity is determined by lifestyle and genetic mechanisms. In particular, the polymorphisms in the adrenergic receptor genes (ADRB) have been extensively studied for association with obesity-related phenotypes. ADRB3 is an obvious candidate gene given its involvement in the regulation of lipolysis and thermogenesis. ADRB3 Trp64Arg polymorphism, a missense mutation in the first transmembrane domain of the R3-adrenergic receptor is associated with visceral obesity and insulin resistance in the Pima Indian, French, and Finnish populations. The recent meta-analysis that combined data of 6582 individuals from Japanese populations showed significant association the Arg64 allele with increased BMI. There are tested the polymorphisms in the beta3-Adrenoreceptor (ADRB3) gene in associated with body mass index (BMI), fat mass and biochemical parameters.We have been examined 91 persons from Moscow region with BMI >25 kg/m2. The Trp64Arg polymorphism of ADRB3 genes were genotyped with the use of an allelic discrimination assay. The TaqMan-based real-time PCR method was applied. There have been estimated of anthropometric and biochemicalparameters. The frequencies of the Trp64Trp and Trp64Arggenotypes of ADRB3 gene were 82% and 12%, respectively, the frequencies of mutant allele was 6%. Trp64Arg genotypes of ADRB3 compared to Trp64Trp genotypes had significantly higher body fat percentage (respectively 48,6 +/- 0,96% and 43,8 +/- 1,72%, p<0,05), serum glucose (6,51 +/- 0,18 mmol/l and 5,67 +/- 0,09 mmol/l, p<0,01) and uric acid concentrations (0,46 +/- 0,02 mmol/l and 0,38 +/- 0,01 mmol/l, p<0,05). The test of the ADRB3 gene polymorphisms can be used for the personalization of diet in persons with obesity. PMID:22774474

  20. A nosocomial outbreak of Serratia marcescens producing inducible Amp C-type beta-lactamase enzyme and carrying antimicrobial resistance genes within a class 1 integron.


    Bagattini, M; Crispino, M; Gentile, F; Barretta, E; Schiavone, D; Boccia, M C; Triassi, M; Zarrilli, R


    We investigated an outbreak of Serratia marcescens in the adult intensive care unit of the University Hospital of Napoli. The outbreak involved 13 cases of infection by S. marcescens over a nine-month period and was caused by a single pulsed-field gel electrophoresis clone. The epidemic strain was multiply antibiotic resistant, producing an inducible Amp C-type beta-lactamase enzyme and carrying the trimethoprim-resistance gene and the adenyltransferase gene, which confers resistance to streptomycin and spectinomycin, within a class 1 integron. Antimicrobial therapy with beta-lactams was associated with S. marcescens acquisition in the intensive care unit. PMID:14706268

  1. Molecular Cloning and Sequencing of Hemoglobin-Beta Gene of Channel Catfish, Ictalurus Punctatus Rafinesque

    Technology Transfer Automated Retrieval System (TEKTRAN)

    : Hemoglobin-y gene of channel catfish , lctalurus punctatus, was cloned and sequenced . Total RNA from head kidneys was isolated, reverse transcribed and amplified . The sequence of the channel catfish hemoglobin-y gene consists of 600 nucleotides . Analysis of the nucleotide sequence reveals one o...

  2. Inhibin beta E is upregulated by drug-induced endoplasmic reticulum stress as a transcriptional target gene of ATF4

    SciTech Connect

    Brüning, Ansgar Matsingou, Christina; Brem, German Johannes; Rahmeh, Martina; Mylonas, Ioannis


    Inhibins and activins are gonadal peptide hormones of the transforming growth factor-β super family with important functions in the reproductive system. By contrast, the recently identified inhibin βE subunit, primarily expressed in liver cells, appears to exert functions unrelated to the reproductive system. Previously shown downregulation of inhibin βE in hepatoma cells and anti-proliferative effects of ectopic inhibin βE overexpression indicated growth-regulatory effects of inhibin βE. We observed a selective re-expression of the inhibin βE subunit in HepG2 hepatoblastoma cells, MCF7 breast cancer cells, and HeLa cervical cancer cells under endoplasmic reticulum stress conditions induced by tunicamycin, thapsigargin, and nelfinavir. Analysis of XPB1 splicing and ATF4 activation revealed that inhibin βE re-expression was associated with induction of the endoplasmic reticulum stress reaction by these drugs. Transfection of an ATF4 expression plasmid specifically induced inhibin βE expression in HeLa cells and indicates inhibin βE as a hitherto unidentified target gene of ATF4, a key transcription factor of the endoplasmic reticulum stress response. Therefore, the inhibin βE subunit defines not only a new player but also a possible new marker for drug-induced endoplasmic reticulum stress. -- Highlights: ► Endoplasmic reticulum stress induces inhibin beta E expression. ► Inhibin beta E is regulated by the transcription factor ATF4. ► Inhibin beta E expression can be used as a marker for drug-induced ER stress.

  3. In vivo regulation of the beta-myosin heavy chain gene in soleus muscle of suspended and weight-bearing rats

    NASA Technical Reports Server (NTRS)

    Giger, J. M.; Haddad, F.; Qin, A. X.; Baldwin, K. M.


    In the weight-bearing hindlimb soleus muscle of the rat, approximately 90% of muscle fibers express the beta-myosin heavy chain (beta-MHC) isoform protein. Hindlimb suspension (HS) causes the MHC isoform population to shift from beta toward the fast MHC isoforms. Our aim was to establish a model to test the hypothesis that this shift in expression is transcriptionally regulated through specific cis elements of the beta-MHC promoter. With the use of a direct gene transfer approach, we determined the activity of different length beta-MHC promoter fragments, linked to a firefly luciferase reporter gene, in soleus muscle of control and HS rats. In weight-bearing rats, the relative luciferase activity of the longest beta-promoter fragment (-3500 bp) was threefold higher than the shorter promoter constructs, which suggests that an enhancer sequence is present in the upstream promoter region. After 1 wk of HS, the reporter activities of the -3500-, -914-, and -408-bp promoter constructs were significantly reduced ( approximately 40%), compared with the control muscles. However, using the -215-bp construct, no differences in promoter activity were observed between HS and control muscles, which indicates that the response to HS in the rodent appears to be regulated within the -408 and -215 bp of the promoter.

  4. Expression and secretion of the Candida wickerhamii extracellular beta-glucosidase gene, bglB, in Saccharomyces cerevisiae.


    Skory, C D; Freer, S N; Bothast, R J


    The yeast Candida wickerhamii exports a cell-associated beta-glucosidase that is active against cellobiose and all soluble cellodextrins. Because of its unique ability to tolerate end-product inhibition by glucose, the bglB gene that encodes this enzyme was previously cloned and sequenced in this laboratory. Using several different promoters and constructs, bglB was expressed in the hosts Escherichia coli, Pichia pastoris, and Saccharomyces cerevisiae. Expression was initially performed in E. coli using either the lacZ or tac promoter. This resulted in intracellular expression of the BglB protein with the protein being rapidly fragmented. Secretion and glycosylation of active beta-glucosidase was achieved with several different S. cerevisiae constructs utilizing either the adh1 or the gal1 promoter on 2-micro replicating plasmids. When either the invertase (Suc2) or the BglB secretion signal was used, BglB protein remained associated with the cell wall and appeared to be hyperglycosylated. Expression in P. pastoris was also examined to determine if higher activity and expression could be achieved in a yeast host that usually does not hyperglycosylate. Using the alcohol oxidase promoter in conjunction with either the pho1 or the alpha-factor secretion signal, the recombinant enzyme was successfully secreted and glycosylated in P. pastoris. However, levels of protein expression from the chromosomally integrated vector were insufficient to detect activity. PMID:8929394

  5. Neogenesis and proliferation of {beta}-cells induced by human betacellulin gene transduction via retrograde pancreatic duct injection of an adenovirus vector

    SciTech Connect

    Tokui, Yae . E-mail:; Kozawa, Junji; Yamagata, Kazuya; Zhang, Jun; Ohmoto, Hiroshi; Tochino, Yoshihiro; Okita, Kohei; Iwahashi, Hiromi; Namba, Mitsuyoshi; Shimomura, Iichiro; Miyagawa, Jun-ichiro |


    Betacellulin (BTC) has been shown to have a role in the differentiation and proliferation of {beta}-cells both in vitro and in vivo. We administered a human betacellulin (hBTC) adenovirus vector to male ICR mice via retrograde pancreatic duct injection. As a control, we administered a {beta}-galactosidase adenovirus vector. In the mice, hBTC protein was mainly overexpressed by pancreatic duct cells. On immunohistochemical analysis, we observed features of {beta}-cell neogenesis as newly formed insulin-positive cells in the duct cell lining or islet-like cell clusters (ICCs) closely associated with the ducts. The BrdU labeling index of {beta}-cells was also increased by the betacellulin vector compared with that of control mice. These results indicate that hBTC gene transduction into adult pancreatic duct cells promoted {beta}-cell differentiation (mainly from duct cells) and proliferation of pre-existing {beta}-cells, resulting in an increase of the {beta}-cell mass that improved glucose tolerance in diabetic mice.

  6. Factor-binding element in the human c-myc promoter involved in transcriptional regulation by transforming growth factor. beta. 1 and by the retinoblastoma gene product

    SciTech Connect

    Pietenpol, J.A.; Stein, R.W.; Moses, H.L. ); Muenger, K.; Howley, P.M. )


    Previous studies have shown that transforming growth factor {beta}1 (TGF-{beta}1) inhibition of keratinocyte proliferation involves suppression of c-myc transcription, and indirect evidence has suggested that the retinoblastoma gene product (pRB) may be involved in this process. In this study, transient expression of pRB in skin keratinocytes was shown to repress transcription of the human c-myc promoter region was required for regulation by both TGF-{beta}1 and pRB. These sequences, termed the TGF-{beta} control element (TCE), lie between positions {minus}86 and {minus}63 relative to the P1 transcription start site. Oligonucleotides containing the TCE bound to several nuclear factors in mobility-shift assays using extracts from cells with or without normal pRB. Binding of some factors was inhibited by TGF-{beta}1 treatment of TGF-{beta}-sensitive but not TGF-{beta}-insensitive cells. These data indicate that pRB can suppress c-myc transcription and growth inhibition.

  7. Fusion of platelet-derived growth receptor {beta} to a novel ets-like gene, tel, in chronic myelomonocytic leukemia with t(5;12) chromosomal translocation

    SciTech Connect

    Golub, T.; Barker, G.; Gilliland, D.G.


    Chronic myelomonocytic leukemia (CMML) is a myelodysplastic syndrome characterized by abnormal clonal myeloid proliferation, and by progression to acute myelogenous leukemia (AML). A recently recognized subgroup of CMML has a t(5;12) (q33;p13) balanced translocation. Fluorescence in situ hybridization (FISH) localized the translocation breakpoint near the CSF1 receptor (CSF1R) locus on chromosome 5q. Pulsed-field gel electrophoresis confirmed rearrangements near CSF1R, but involvement of CSF1R itself was excluded. Southern blotting showed a rearrangement within the closely linked PDGF receptor {beta} (PDGFR{beta}) gene. Ribonuclease protection assays localized the translocation breakpoint to nucleotide 1766 in PDGFR{beta} RNA. Anchored PCR was used to identify the chromosome 12 fusion partner, a novel ets-like protein, tel. Tel contains a highly conserved carboxy terminal ets-like DNA-binding domain, and an amino terminal domain with a predicted helix-loop-helix (HLH) secondary structure. The consequence of the t(5;12) translocation is fusion of the tel HLH domain to the PDGFR{beta} transmembrane and tyrosine kinase domains. The tel HLH domain may contribute a dimerization motif which serves to constitutively activate PDGFR{beta} tyrosine kinase activity. The tel-PDGFR{beta} fusion demonstrates the oncogenic potential of PDGFR{beta}, and may provide a paradigm for early events in the pathogenesis of AML.

  8. Identification, cDNA Cloning, and Characterization of Luteinizing Hormone Beta Subunit (lhb) Gene in Catla catla.


    Rather, Mohd Ashraf; Bhat, Irfan Ahmad; Sharma, Rupam


    Reproductive hormones play a significant role in the gonadal development and gametogenesis process of animals. In the present study luteinizing hormone beta, (lhb) subunit gene was cloned and characterized from the brain of Catla catla. The lhb full-length of cDNA sequence is 629 bp which consists of 43bp 5'-UTR (untranslated region) 447bp, ORF(open reading frame) and 139 bp of 3'-UTR respectively. The coding region of lhb gene encoded a peptide of 148 amino acids. The coding sequence of lhb gene consist of a single N-linked glycosylation site (NET) and 12 cysteine knot residues. Phylogenetic analysis of C. catla Lhβ deduced amino acid sequence showed high similarity with Carassius auratus followed by Gobiocypris rarus. 3D structure Lhβ protein comprises of five β-sheets and six coils/loops. The qPCR results revealed lhb mRNA is mainly expressed in the pituitary, ovary while moderate expression was observed in brain and testis. To best our knowledge, this is the first report on the identification, molecular characterization and structural information regarding luteinizing hormone in Indian major carp. PMID:26980432

  9. New Codanin-1 Gene Mutations in a Italian Patient with Congenital Dyserythropoietic Anemia Type I and Heterozygous Beta-Thalassemia.


    D'Alcamo, Elena; Agrigento, V; Pitrolo, L; Sclafani, S; Barone, R; Calvaruso, G; Buffa, V; Maggio, A


    Congenital dyserythropoietic anemia type I is an autosomal recessive disorder associated with macrocytic anemia, ineffective erythropoiesis, iron overloading and characterized by abnormal chromatin ultrastructure in erythroblasts such as internuclear chromatin bridges, spongy heterochromatin and invagination of the nuclear membrane. A 58-year-old Causasian man with chronic hemolytic anemia, heterozygous for β (+) -globin IVS1, nt110 G>A mutation (causing abnormal alpha:beta globin chain ratio) showed clinical, laboratory and hematological features suggesting diagnosis of CDA1. Sequence analysis of CDA-related genes revealed compound heterozygosity for two novel mutations in the CDAN1 gene: a frameshift mutation 3367 del 4 (TTAG) in exon 25 and a missense mutation c.1811 G>T in exon 11 causing an aminoacid change from glycine to valine at codon 565 (G565V). One of the propositus' brothers showed the same gene mutations. As the CDA1 can mimic thalassemia, a frequent misdiagnosis is possible especially in countries where the prevalence of thalassemia is high. A strong clinical suspicion in patients who do not reveal a clear genetic basis for presumed thalassemia may help clinch the correct diagnosis. PMID:27408412

  10. Expression of gibberellin 3 beta-hydroxylase gene in a gravi-response mutant, weeping Japanese flowering cherry

    NASA Technical Reports Server (NTRS)

    Sugano, Mami; Nakagawa, Yuriko; Nyunoya, Hiroshi; Nakamura, Teruko


    Expressions of the gibberellin biosynthesis gene were investigated in a normal upright type and a gravi-response mutant, a weeping type of Japanese flowering cherry (Prunus spachiana), that is unable to support its own weight and elongates downward. A segment of the gibberellin 3 beta-hydroxylase cDNA of Prunus spachiana (Ps3ox), which is responsible for active gibberellin synthesis, was amplified by using real-time RT-PCR. The content of Ps3ox mRNA in the weeping type was much greater than that in the upright type, while the endogenous gibberellin level was much higher in the elongating zone of the weeping type. These results suggest that the amount and distribution of synthesized gibberellin regulate secondary xylem formation, and the unbalanced distribution of gibberellin affects the gravi-response of the Prunus tree.

  11. The sal3(+) gene encodes an importin-beta implicated in the nuclear import of Cdc25 in Schizosaccharomyces pombe.

    PubMed Central

    Chua, Gordon; Lingner, Carol; Frazer, Corey; Young, Paul G


    In Schizosaccharomyces pombe, the nuclear accumulation of Cdc25 peaks in G2 and is necessary for the proper timing of mitotic entry. Here, we identify the sal3(+) gene product as an importin-beta homolog that participates in the nuclear import of Cdc25. Loss of sal3(+) results in a cell cycle delay, failure to undergo G1 arrest under nitrogen-starvation conditions, and mislocalization of Cdc25 to the cytosol. Fusion of an exogenous classical nuclear localization sequence (cNLS) to Cdc25 restores its nuclear accumulation in a sal3 disruptant and suppresses the sal3 mutant phenotypes. In addition, we show that enhanced nuclear localization of Cdc25 at endogenous levels of expression advances the onset of mitosis. These results demonstrate that the nuclear translocation of Cdc25 is important for the timing of mitotic entry and that Sal3 plays an important role in this process. PMID:12399381

  12. Intron-exon organization of the active human protein S gene PS. alpha. and its pseudogene PS. beta. : Duplication and silencing during primate evolution

    SciTech Connect

    Ploos van Amstel, H.; Reitsma, P.H.; van der Logt, C.P.; Bertina, R.M. )


    The human protein S locus on chromosome 3 consists of two protein S genes, PS{alpha} and PS{beta}. Here the authors report the cloning and characterization of both genes. Fifteen exons of the PS{alpha} gene were identified that together code for protein S mRNA as derived from the reported protein S cDNAs. Analysis by primer extension of liver protein S mRNA, however, reveals the presence of two mRNA forms that differ in the length of their 5{prime}-noncoding region. Both transcripts contain a 5{prime}-noncoding region longer than found in the protein S cDNAs. The two products may arise from alternative splicing of an additional intron in this region or from the usage of two start sites for transcription. The intron-exon organization of the PS{alpha} gene fully supports the hypothesis that the protein S gene is the product of an evolutional assembling process in which gene modules coding for structural/functional protein units also found in other coagulation proteins have been put upstream of the ancestral gene of a steroid hormone binding protein. The PS{beta} gene is identified as a pseudogene. It contains a large variety of detrimental aberrations, viz., the absence of exon I, a splice site mutation, three stop codons, and a frame shift mutation. Overall the two genes PS{alpha} and PS{beta} show between their exonic sequences 96.5% homology. Southern analysis of primate DNA showed that the duplication of the ancestral protein S gene has occurred after the branching of the orangutan from the African apes. A nonsense mutation that is present in the pseudogene of man also could be identified in one of the two protein S genes of both chimpanzee and gorilla. This implicates that silencing of one of the two protein S genes must have taken place before the divergence of the three African apes.

  13. Detection of beta2 and major toxin genes by PCR in Clostridium perfringens field isolates of domestic animals suffering from enteritis or enterotoxaemia.


    Sting, Reinhard


    The production of Clostridium (C.) perfringens toxins in the intestine is an important cause of enteritis and enterotoxaemia in livestock. In the present study, the alpha toxin and the genes encoding beta2 and epsilon toxin could be frequently detected by means of phenotypical and PCR examinations in these bacteria. The C. perfringens isolates originated from 1213 field samples taken from diseased or perished livestock located in the north-eastern administrative districts of Baden-Württemberg (Germany) from 2005 to 2008. The beta2 toxin gene of C perfringens was detected in all animal species examined, comprising pigs, the small ruminants sheep and goats, cattle, horses, rabbits, alpacas and lamas, and fallow deer. Among all the animal species included in this study, pigs attracted attention by a high quota of 74.2% (610 of 822) cpb2-positive C. perfringens isolates in comparison to the other animal species tested, revealing a quota of 20.8% (72 of 346). Beta2 toxigenic isolates could be predominantly cultivated from the faeces of young piglets. The beta toxin gene was detected in isolates from piglets and small ruminants only, amounting to 82.5% (33 of 40) in piglets in combination with the cpb2 gene. In this context, cpb2/cpb-positive C. perfringens isolates of piglets could be clearly detected more often in the intestine of perished animals (18 of 158) than in faeces (15 of 629). Furthermore, cpb2-bearing C. perfringens isolates were detected in cattle, horses, rabbits, alpacas and lamas, and fallow deer to a notable degree. The detection of C. perfringens isolates carrying the epsilon toxin gene was restricted to sheep and goats. Of a total of 242 small ruminants that succumbed to sudden death, 71 (29.3%) harboured epsilon toxin-positive C. perfringens isolates in their intestines. These cases clustered seasonally in the second quarter (April, May, and June) of the year. Neither the isolates bearing the beta2 nor beta toxin gene nor those carrying the epsilon

  14. alpha-Amanitin-insensitive transcription of mouse beta major-globin 5'-flanking and structural gene sequences correlates with mRNA expression.

    PubMed Central

    Carlson, D P; Ross, J


    A small proportion of the RNAs of mouse reticulocytes consists of beta major-globin mRNA sequences linked to sequences transcribed from the 5'-flanking region of the beta major-globin gene. These upstream RNAs are polyadenylylated and contain 700-800 nucleotides, and their 5' regions are heterogeneous. RNAs with similar or identical 5' regions are transcribed in cell-free extracts from a circular mouse beta major-globin gene template. Synthesis of most of the upstream RNAs in vitro is not inhibited by low levels (1 microgram/ml) of alpha-amanitin, indicating that they are transcribed by an enzyme(s) different from RNA polymerase II. During culture of mouse erythroleukemia cells with dimethyl sulfoxide, globin mRNA and upstream RNAs accumulate with similar kinetics. In contrast, upstream RNAs are not detected in hemin-treated cells. Images PMID:6595660

  15. Severe Soft Tissue Infection Caused by a Non-Beta-Hemolytic Streptococcus pyogenes Strain Harboring a Premature Stop Mutation in the sagC Gene

    PubMed Central

    Gerlach, Roman G.; Ensser, Armin; Dahesh, Samira; Popp, Isabel; Heeg, Christiane; Bleiziffer, Oliver; Merz, Thomas; Schulz, Theresia; Horch, Raymund E.; Bogdan, Christian; Nizet, Victor; van der Linden, Mark


    We recovered a non-beta-hemolytic Streptococcus pyogenes strain from a severe soft tissue infection. In this isolate, we detected a premature stop codon within the sagC gene of the streptolysin S (SLS) biosynthetic operon. Reintroduction of full-length sagC gene on a plasmid vector restored the beta-hemolytic phenotype to our clinical isolate, indicating that the point mutation in sagC accounted for loss of hemolytic activity. To the best of our knowledge, this is the first report to demonstrate that a severe soft tissue infection can be caused by a non-beta-hemolytic S. pyogenes strain lacking a functional SagC. PMID:23515542

  16. Differential regulation of carnitine palmitoyltransferase-I gene isoforms (CPT-I alpha and CPT-I beta) in the rat heart.


    Cook, G A; Edwards, T L; Jansen, M S; Bahouth, S W; Wilcox, H G; Park, E A


    Carnitine palmitoyltransferase-I (CPT-I) is a major control point for fatty acid oxidation. Two kinetically different isoforms, CPT-I alpha and CPT-I beta, have been identified. Cardiac ventricular myocytes are the only cells known to express both CPT-I isoforms. In this study, we characterized the differential regulation of CPT-I alpha and CPT-I beta expression in the heart. Expression of the CPT-I alpha gene was very high in the fetal heart and declined following birth. CPT-I beta was also highly expressed in fetal myocytes and remained so throughout development. CPT-I alpha mRNA abundance was increased in both the liver and heart of diabetic or fasted rats, but CPT-I beta mRNA levels were not altered in these states. A high fat diet elevated expression of the CPT-I alpha gene in the liver but not in the heart. The fat content of the diet did not affect the expression of CPT-I beta. Cultures of neonatal rat cardiac myocytes were transfected with luciferase reporter genes driven by CPT-I alpha or CPT-I beta promoters. Two regions of the CPT-I alpha promoter, including an upstream region (-1300/-960) and a region in the proximal promoter (-193/-52) contributed equally to basal expression in cardiac myocytes. Basal transcription of CPT-I alpha was dependent on Sp1 sites and a CCAAT box in the proximal promoter. Our data indicate that the CPT-I beta gene is expressed in a tissue specific manner, but that it is not subject to the same developmental or hormonal controls imposed on CPT-I alpha. In addition some aspects of CPT-I alpha expression are confined to the liver. The data presented here thus suggest that two types of differential regulation of CPT-I genes exist: (a) differential control of CPT-I alpha and CPT-I beta gene expression in the heart and (b) differential regulation of CPT-I alpha expression in the heart and liver. PMID:11162136

  17. Molecular cloning of cDNA for the B beta subunit of Xenopus fibrinogen, the product of a coordinately-regulated gene family.


    Bhattacharya, A; Shepard, A R; Moser, D R; Roberts, L R; Holland, L J


    Fibrinogen, the principal blood-clotting protein, is made up of three different subunits synthesized in the liver. In vitro administration of glucocorticoids to liver cells from the frog Xenopus laevis causes a dramatic increase in fibrinogen synthesis. Investigations of molecular mechanisms underlying this hormonal stimulation at the mRNA level require cDNA clones complementary to the mRNAs coding for the three fibrinogen subunits, called A alpha, B beta, and gamma. We describe here the isolation and characterization of cDNA clones for the B beta subunit of Xenopus fibrinogen. cDNA libraries in both plasmid (pBR322) and phage (lambda gt10) cloning vectors were constructed from frog liver mRNA and screened with a rat B beta cDNA. Clones thus isolated hybridized to two Xenopus liver mRNAs 2500 and 1800 bases long, the previously-determined sizes for B beta mRNAs. The identity of the plasmid clone B beta-27 was confirmed by hybridization-selection of complementary mRNA which translated in vitro into the B beta polypeptide, as determined by size and susceptibility to thrombin cleavage. lambda/B beta 10, a clone representing nearly all of the 2500-base B beta mRNA, was isolated from the phage cDNA library. The 3'-end of this clone includes a polyadenylation signal about 20 residues upstream of a stretch of 34 adenosine residues, which probably represents the 3'-poly(A) tail of the messenger RNA. lambda/B beta 10 lacks only 20 nucleotides of full-length B beta mRNA at the 5'-end and there is one major start site of transcription. The 2500-base B beta mRNA has a 700-base extension at the 3'-end that is not present in the 1800-base mRNA. The Xenopus laevis genome contains two or three genes for the B beta fibrinogen subunit. Using the cDNA clone as a probe, B beta mRNA was shown to be induced at least 20-fold by glucocorticoid treatment of purified parenchymal cells of Xenopus liver maintained in primary culture. PMID:2050271

  18. The structures of the human calcium channel {alpha}{sub 1} subunit (CACNL1A2) and {beta} subunit (CACNLB3) genes

    SciTech Connect

    Yamada, Yuichiro; Masuda, Kazuhiro; Li, Qing


    Calcium influx in pancreatic {beta}-cells is regulated mainly by L-type voltage-dependent calcium channels (VDCCs) and triggers insulin secretion. The {alpha}{sub 1} subunit (CACN4) and the {beta} subunit ({beta}{sub 3}) of VDCCs, both of which are expressed in pancreatic islets, are major components for the VDCC activity, and so they may play a critical role in the regulation of insulin secretion. The authors have determined the structures of the human CACN4 (CACNL1A2) and the human {beta}{sub 3} (CACNLB3) genes. The CACNL1A2 gene spans more than 155 kb and has 49 exons. Most of the positions interrupted by introns are well conserved between the CACNL1A2 gene and the previously reported L-type VDCC {alpha}{sub 1} subunit, CACNL1A1, gene. On the other hand, the CACNLB3 gene distributes in {approximately} 8 kb and comprises 13 exons, most of which are located together within {approximately} 5 kb. Comparisons of the genomic sequences of CACNL1A2 with the previously reported cDNA sequences indicate that there are a number of polymorphisms in the human CACNL1A2 gene. In addition, the PCR-SSCP procedure of exon 1 of CACNL1A2 revealed a change from 7 to 8 ATG trinucleotide repeats in a patient with noninsulin-dependent diabetes mellitus (NIDDM), resulting in an addition of methionine at the amino-terminus of CACN4. The determination of the structures of the human CACNL1A2 and CACNLB3 genes should facilitate study of the role of these genes in the development of NIDDM and also other genetic diseases such as long QT syndrome. 39 refs., 3 figs., 3 tabs.


    Technology Transfer Automated Retrieval System (TEKTRAN)

    The cauliflower Or gene is a semi-dominant, single-locus mutation that causes the accumulation of beta-carotene in various tissues of the plant, turning them orange. To elucidate the molecular basis of Or in the regulation of carotenoid accumulation in the plant, we initiated the isolation of Or by...

  20. A gene homologous to beta-type carbonic anhydrase is essential for the growth of Corynebacterium glutamicum under atmospheric conditions.


    Mitsuhashi, S; Ohnishi, J; Hayashi, M; Ikeda, M


    Carbonic anhydrase catalyzes the interconversion of CO(2) and bicarbonate. We focused on this enzyme in the amino acid-producing organism Corynebacterium glutamicum in order to assess the availability of bicarbonate for carboxylation reactions essential to growth and for those required for L-lysine overproduction. A whole-genome sequence revealed two genes encoding putative beta-type and gamma-type carbonic anhydrases in C. glutamicum. These genes encode polypeptides containing zinc ligands strictly conserved in each type of carbonic anhydrase and were designated bca and gca, respectively. Internal deletion of the chromosomal bca gene resulted in a phenotype showing severely reduced growth under atmospheric conditions (0.04% CO(2)) on both complete and minimal media. The growth defect of the Delta bca strain was restored under elevated CO(2) conditions (5% CO(2)). Introduction of the red alga Porphyridium purpureum carbonic anhydrase gene ( pca) could compensate for the bca deletion, allowing normal growth under an atmospheric level of CO(2). In contrast, the Delta gca strain behaved identically to the wild-type strain with respect to growth, irrespective of the CO(2) conditions. Attempts to increase the dosage of bca, gca, and pca in the defined L-lysine-producing strain C. glutamicum AHD-2 led to no discernable effects on growth and production. Northern blot analysis indicated that the bca transcript in strain AHD-2 and another L-lysine producer, C. glutamicum B-6, was present at a much higher level than in the wild-type strain, particularly during exponential growth phases. These results indicate that: (1) the bca product is essential to achieving normal growth under ordinary atmospheric conditions, and this effect is most likely due to the bca product's ability to maintain favorable intracellular bicarbonate/CO(2) levels, and (2) the expression of bca is induced during exponential growth phases and also in the case of L-lysine overproduction, both of which are

  1. Molecular Characterization and Expression Analysis of Adrenergic Receptor Beta 2 (ADRB2) Gene before and after Exercise in the Horse

    PubMed Central

    Cho, Hyun-Woo; Shin, Sangsu; Song, Ki-Duk; Park, Jeong-Woong; Choi, Jae-Young; Lee, Hak-Kyo; Cho, Byung-Wook


    The adrenergic receptor beta 2 (ADRB2) plays a role in various physiological responses of the muscle to exercise, such as contraction and relaxation. Given its important role in muscle function, we investigated the structure of the horse ADRB2 gene and its expression pattern after exercise to determine if it can serve as a putative biomarker for recovery. Evolutionary analyses using synonymous and non-synonymous mutation ratios, were compared with other species (human, chimpanzee, mouse, rat, cow, pig, chicken, dog, and cat), and revealed the occurrence of positive selection in the horse ADRB2 gene. In addition, expression analyses by quantitative polymerase chain reaction exhibited ubiquitous distribution of horse ADRB2 in various tissues including lung, skeletal muscle, kidney, thyroid, appendix, colon, spinal cord and heart, with the highest expression observed in the lung. The expression of ADRB2 in skeletal muscle was significantly up-regulated about four folds 30 minutes post-exercise compared to pre-exercise. The expression level of ADRB2 in leukocytes, which could be collected with convenience compared with other tissues in horse, increased until 60 min after exercise but decreased afterward until 120 min, suggesting the ADRB2 expression levels in leukocytes could be a useful biomarker to check the early recovery status of horse after exercise. In conclusion, we identified horse ADRB2 gene and analyzed expression profiles in various tissues. Additionally, analysis of ADBR2 gene expression in leukocytes could be a useful biomarker useful for evaluation of early recovery status after exercise in racing horses. PMID:25924960

  2. Perturbation of chromatin structure in the region of the adult beta-globin gene in chicken erythrocyte chromatin.


    Caplan, A; Kimura, T; Gould, H; Allan, J


    An EcoRI chromatin fragment containing the adult beta-globin gene and flanking sequences, isolated from chicken erythrocyte nuclei, sediments at a reduced rate relative to bulk chromatin fragments of the same size. We show that the specific retardation cannot be reversed by adding extra linker histones to native chromatin. When the chromatin fragments are unfolded either by removing linker histones or lowering the ionic strength, the difference between globin and bulk chromatin fragments is no longer seen. The refolded chromatin obtained by restoring the linker histones to the depleted chromatin, however, exhibits the original sedimentation difference. This difference is therefore due to a special property of the histone octamers on the active gene that determines the extent of its folding into higher-order structure. That it is not due to the differential binding of linker histones in vitro is shown by measurements of the protein to DNA ratios using CsCl density-gradients. Both before and after selective removal of the linker histones, the globin gene fragment and bulk chromatin fragments exhibit only a marginal difference in buoyant density. In addition, we show that cleavage of the EcoRI fragment by digestion at the 5' and 3' nuclease hypersensitive sites flanking the globin gene liberates a fragment from between these sites that sediments normally. We conclude that the hypersensitive sites per se are responsible for the reduction in sedimentation rate. The non-nucleosomal DNA segments appear to be too long to be incorporated into the chromatin solenoid and thus create spacers between separate solenoidal elements in the chromatin, which can account for its hydrodynamic behaviour. PMID:3586025

  3. Molecular Characterization and Expression Analysis of Adrenergic Receptor Beta 2 (ADRB2) Gene before and after Exercise in the Horse.


    Cho, Hyun-Woo; Shin, Sangsu; Song, Ki-Duk; Park, Jeong-Woong; Choi, Jae-Young; Lee, Hak-Kyo; Cho, Byung-Wook


    The adrenergic receptor beta 2 (ADRB2) plays a role in various physiological responses of the muscle to exercise, such as contraction and relaxation. Given its important role in muscle function, we investigated the structure of the horse ADRB2 gene and its expression pattern after exercise to determine if it can serve as a putative biomarker for recovery. Evolutionary analyses using synonymous and non-synonymous mutation ratios, were compared with other species (human, chimpanzee, mouse, rat, cow, pig, chicken, dog, and cat), and revealed the occurrence of positive selection in the horse ADRB2 gene. In addition, expression analyses by quantitative polymerase chain reaction exhibited ubiquitous distribution of horse ADRB2 in various tissues including lung, skeletal muscle, kidney, thyroid, appendix, colon, spinal cord and heart, with the highest expression observed in the lung. The expression of ADRB2 in skeletal muscle was significantly up-regulated about four folds 30 minutes post-exercise compared to pre-exercise. The expression level of ADRB2 in leukocytes, which could be collected with convenience compared with other tissues in horse, increased until 60 min after exercise but decreased afterward until 120 min, suggesting the ADRB2 expression levels in leukocytes could be a useful biomarker to check the early recovery status of horse after exercise. In conclusion, we identified horse ADRB2 gene and analyzed expression profiles in various tissues. Additionally, analysis of ADBR2 gene expression in leukocytes could be a useful biomarker useful for evaluation of early recovery status after exercise in racing horses. PMID:25924960

  4. [Hemoglobin C -- beta-thalassemia disease and homozygous beta-thalassemia in a black African family (author's transl)].


    Basset, P; Fall, M; Oudart, J L


    The study of a Malian family has allowed to prove existence of two types of beta-thalassemia genes: the beta0 gene which suppresses the synthesis of the beta chain into cis position and the beta+ gene which slows down only partially this synthesis. The difference between this two genes has been possible owing to the hemoglobin C found in this family and induced by the betaC mutated gene. The segregation of the four genes betaA, betaC, beta0 thal, and beta+ thal. has allowed to compare all the possible phenotypes deriving from the combinations by two of these allelic genes. PMID:128735

  5. Association study of schizophrenia and IL-2 receptor {beta} chain gene

    SciTech Connect

    Nimgaonkar, V.L.; Yang, Z.W.; Zhang, X.R.; Brar, J.S.


    A case-control association study was conducted in Caucasian patients with schizophrenia (DSM-III-R, n = 42) and unaffected controls (n = 47) matched for ethnicity and area of residence. Serum interleukin-2 receptor (IL-2R) concentrations, as well as a dinucleotide repeat polymorphism in the IL-2RP chain gene, were examined in both groups. No significant differences in IL-2R concentrations or in the distribution of the polymorphism were noted. This study does not support an association between schizophrenia and the IL-2RP gene locus, contrary to the suggestive evidence from linkage analysis in multicase families. 17 refs., 2 tabs.

  6. Characterization of a Beta vulgaris PGIP defense gene promoter in transgenic plants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polygalacturonase-inhibiting protein (BvPGIP) genes were cloned from a sugar beet breeding line F1016 with increased tolerance to the sugar beet root maggot. Polygalacturonase-inhibiting proteins are cell wall leucine-rich repeat (LRR) proteins with crucial roles in development, pathogen defense an...

  7. Angiogenic gene signature in human pancreatic cancer correlates with TGF-beta and inflammatory transcriptomes.


    Craven, Kelly E; Gore, Jesse; Wilson, Julie L; Korc, Murray


    Pancreatic ductal adenocarcinomas (PDACs) are hypovascular, but overexpress pro-angiogenic factors and exhibit regions of microvasculature. Using RNA-seq data from The Cancer Genome Atlas (TCGA), we previously reported that ~12% of PDACs have an angiogenesis gene signature with increased expression of multiple pro-angiogenic genes. By analyzing the recently expanded TCGA dataset, we now report that this signature is present in ~35% of PDACs but that it is mostly distinct from an angiogenesis signature present in pancreatic neuroendocrine tumors (PNETs). These PDACs exhibit a transcriptome that reflects active TGF-β signaling, and up-regulation of several pro-inflammatory genes, and many members of JAK signaling pathways. Moreover, expression of SMAD4 and HDAC9 correlates with endothelial cell abundance in PDAC tissues. Concomitantly targeting the TGF-β type I receptor (TβRI) kinase with SB505124 and JAK1-2 with ruxolitinib suppresses JAK1 phosphorylation and blocks proliferative cross-talk between human pancreatic cancer cells (PCCs) and human endothelial cells (ECs), and these anti-proliferative effects were mimicked by JAK1 silencing in ECs. By contrast, either inhibitor alone does not suppress their enhanced proliferation in 3D co-cultures. These findings suggest that targeting both TGF-β and JAK1 signaling could be explored therapeutically in the 35% of PDAC patients whose cancers exhibit an angiogenesis gene signature. PMID:26586478

  8. Beta vulgaris L. serine proteinase inhibitor gene expression correlates to insect pest resistance in sugar beet

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Analyzing genes that can be used for improving sugar beet resistance to the sugar beet root maggot (SBRM, Tetanops myopaeformis Roder), one of the most destructive insect pests of sugar beet in North America, was a major goal in our investigation. We report on the expression patterns of a sugar beet...

  9. Angiogenic gene signature in human pancreatic cancer correlates with TGF-beta and inflammatory transcriptomes

    PubMed Central

    Wilson, Julie L.; Korc, Murray


    Pancreatic ductal adenocarcinomas (PDACs) are hypovascular, but overexpress pro-angiogenic factors and exhibit regions of microvasculature. Using RNA-seq data from The Cancer Genome Atlas (TCGA), we previously reported that ∼12% of PDACs have an angiogenesis gene signature with increased expression of multiple pro-angiogenic genes. By analyzing the recently expanded TCGA dataset, we now report that this signature is present in ∼35% of PDACs but that it is mostly distinct from an angiogenesis signature present in pancreatic neuroendocrine tumors (PNETs). These PDACs exhibit a transcriptome that reflects active TGF-β signaling, and up-regulation of several pro-inflammatory genes, and many members of JAK signaling pathways. Moreover, expression of SMAD4 and HDAC9 correlates with endothelial cell abundance in PDAC tissues. Concomitantly targeting the TGF-β type I receptor (TβRI) kinase with SB505124 and JAK1-2 with ruxolitinib suppresses JAK1 phosphorylation and blocks proliferative cross-talk between human pancreatic cancer cells (PCCs) and human endothelial cells (ECs), and these anti-proliferative effects were mimicked by JAK1 silencing in ECs. By contrast, either inhibitor alone does not suppress their enhanced proliferation in 3D co-cultures. These findings suggest that targeting both TGF-β and JAK1 signaling could be explored therapeutically in the 35% of PDAC patients whose cancers exhibit an angiogenesis gene signature. PMID:26586478

  10. Genetic structure and gene flow in Beta vulgaris subspecies maritima along the Atlantic coast of France

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Locating and quantifying genetic variation within crop wild relatives is an ongoing activity of gene banks tasked with ex situ conservation. Without detailed information about the population genetics of a species geography often serves as a reasonable proxy for differentiation. With this in mind, ...

  11. Nr-CAM is a target gene of the beta-catenin/LEF-1 pathway in melanoma and colon cancer and its expression enhances motility and confers tumorigenesis.


    Conacci-Sorrell, Maralice E; Ben-Yedidia, Tamar; Shtutman, Michael; Feinstein, Elena; Einat, Paz; Ben-Ze'ev, Avri


    beta-catenin and plakoglobin (gamma-catenin) are homologous molecules involved in cell adhesion, linking cadherin receptors to the cytoskeleton. beta-catenin is also a key component of the Wnt pathway by being a coactivator of LEF/TCF transcription factors. To identify novel target genes induced by beta-catenin and/or plakoglobin, DNA microarray analysis was carried out with RNA from cells overexpressing either protein. This analysis revealed that Nr-CAM is the gene most extensively induced by both catenins. Overexpression of either beta-catenin or plakoglobin induced Nr-CAM in a variety of cell types and the LEF/TCF binding sites in the Nr-CAM promoter were required for its activation by catenins. Retroviral transduction of Nr-CAM into NIH3T3 cells stimulated cell growth, enhanced motility, induced transformation, and produced rapidly growing tumors in nude mice. Nr-CAM and LEF-1 expression was elevated in human colon cancer tissue and cell lines and in human malignant melanoma cell lines but not in melanocytes or normal colon tissue. Dominant negative LEF-1 decreased Nr-CAM expression and antibodies to Nr-CAM inhibited the motility of B16 melanoma cells. The results indicate that induction of Nr-CAM transcription by beta-catenin or plakoglobin plays a role in melanoma and colon cancer tumorigenesis, probably by promoting cell growth and motility. PMID:12183361

  12. A Worldwide Analysis of Beta-Defensin Copy Number Variation Suggests Recent Selection of a High-Expressing DEFB103 Gene Copy in East Asia

    PubMed Central

    Hardwick, Robert J; Machado, Lee R; Zuccherato, Luciana W; Antolinos, Suzanne; Xue, Yali; Shawa, Nyambura; Gilman, Robert H; Cabrera, Lilia; Berg, Douglas E; Tyler-Smith, Chris; Kelly, Paul; Tarazona-Santos, Eduardo; Hollox, Edward J


    Beta-defensins are a family of multifunctional genes with roles in defense against pathogens, reproduction, and pigmentation. In humans, six beta-defensin genes are clustered in a repeated region which is copy-number variable (CNV) as a block, with a diploid copy number between 1 and 12. The role in host defense makes the evolutionary history of this CNV particularly interesting, because morbidity due to infectious disease is likely to have been an important selective force in human evolution, and to have varied between geographical locations. Here, we show CNV of the beta-defensin region in chimpanzees, and identify a beta-defensin block in the human lineage that contains rapidly evolving noncoding regulatory sequences. We also show that variation at one of these rapidly evolving sequences affects expression levels and cytokine responsiveness of DEFB103, a key inhibitor of influenza virus fusion at the cell surface. A worldwide analysis of beta-defensin CNV in 67 populations shows an unusually high frequency of high-DEFB103-expressing copies in East Asia, the geographical origin of historical and modern influenza epidemics, possibly as a result of selection for increased resistance to influenza in this region. Hum Mutat 32:743–750, 2011. © 2011 Wiley-Liss, Inc. PMID:21387465

  13. DNA methylation profiles in the human genes for tumor necrosis factors alpha and beta in subpopulations of leukocytes and in leukemias.

    PubMed Central

    Kochanek, S; Radbruch, A; Tesch, H; Renz, D; Doerfler, W


    The genomic sequencing technique has been applied to assess the state of methylation in the DNA from human leukocyte subpopulations from healthy individuals and in the DNA from several individuals with myeloid or lymphatic leukemias or non-Hodgkin lymphomas. Leukocyte populations were purified by the high-gradient magnetic cell sorting technique. In the human tumor necrosis factor alpha (TNF-alpha) gene segment between nucleotides 300 and 1150, the specific methylation profile in the DNA from human granulocytes and monocytes is maintained in three cases of myeloid leukemia. In one such case, all 5-methyl-2'-deoxycytidine residues have been replaced by cytidine. In a chronic lymphatic T-cell leukemia, all 5-methyl-2'-deoxycytidine residues have been substituted by cytidine. In normal B lymphocytes, in two cases of chronic lymphatic B-cell leukemias and two cases of non-Hodgkin lymphomas, all 5'-CG-3' sequences in this gene segment are devoid of methylation. In the TNF-beta gene, DNA methylation is decreased in several examples of acute or chronic myeloid leukemias in comparison to normal human granulocytes or monocytes, whose DNA is almost completely methylated between nucleotides 700 and 900. In human T and B lymphocytes, the main producers of TNF-beta, in three instances of chronic lymphatic leukemias and two cases of non-Hodgkin lymphomas, all 5'-CG-3' sequences are unmethylated in this region. The DNA from the human HeLa cell line is highly methylated at all 5'-CG-3' sequences in the TNF-alpha and -beta genes. The TNF-alpha gene is transcribed in the cells of one case of acute myeloid leukemia in which the analyzed region of the TNF-alpha gene is completely unmethylated. The TNF-beta gene is not transcribed in any of the malignant cells tested. Images PMID:2062856

  14. An efficient expression of Human Growth Hormone (hGH) in the milk of transgenic mice using rat {beta}-casein/hGH fusion genes

    SciTech Connect

    Lee, Chul-Sang; Yu, Dae-Yeul; Lee, Kyung-Kwang


    In order to produce human growth hormone (hGH) in the milk of transgenic mice, two expression vectors for hGH differing in their 3{prime} flanking sequences were constructed by placing the genomic sequences of hGH gene under the control of the rat {beta}-casein gene promotor. The 3{prime} flanking sequences of the expression constructs were derived from either the hGH gene (pBCN1GH) or the rat {beta}-casein gene (pBCN2GH). Transgenic lines bearing pBCN1GH expressed hGH more efficiently than those bearing pBCN2GH in the milk (19-5500 {mu}g/mL vs 0.7-2 {mu}g/mL). In particular, one of the BCN1GH lines expressed hGH as much as 5500 {plus_minus} 620 {mu}g/mL. Northern blot analysis showed that the transgene expression was specifically confined to the mammary gland and developmentally regulated like the endogeneous mouse {beta}-casein gene in the mammary gland. However, a low level of nonmammary expression was also detected with more sensitive assay methods. In conclusion, the rat {beta}-casein/hGH fusion gene could direct an efficient production of hGH in a highly tissue- and stage-specific manner in the transgenic mice and the 3{prime} flanking sequences of hGH gene had an important role for the efficient expression. 27 refs., 5 figs., 2 tabs.

  15. [Cloning of gene fragment of estrogen receptor-beta and its expression in mouse embryo].


    Zhang, Zi-Feng; Fan, Shao-Hua; Lu, Jun; Wu, Dong-Mei; Shan, Qun; Hu, Bin; Li, Fei; Zheng, Yuan-Lin


    In order to study the expression and regulation effects of estrogen receptor-beta (ERbeta) in the development of mouse embryo, the primer of ERbeta was designed, the ERbeta fragment was first obtained by RT-PCR and subcloned into plasmids pGEM- 3Z, then the recombinant plasmids were linearized with the restriction enzymes of EcoRand Hind. Using Sp6 and T7 RNA polymerase, the digoxigenin(dig) labeled sense and anti-sense probes were transcriped in vitro, respectively. Then the expression of ERbeta in mouse embryo was examined with the probes by whole-mount in situ hybridization. The results indicated that ERbeta is expressed in the brain, spinal neural tube, genital ridge, pericardium, limb bud and mandibular arch of 10.5 dpc embryo, and is also expressed in the telencephalon, mesencephalon, medulla oblongata, spinal cord and limb bud of 13.5 dpc embryo. These results suggest that ERbeta maybe play a role of regulation in sexual differentiation, primal differentiation of neural tube, further differentiation of three primary cerebral vesicles and spinal cord, generation and differentiation of bone and cartilage of limb bud, development of pericardium and configuration differentiation of mandibular in mouse embryo. PMID:18332005

  16. Expression and sequences of T cell antigen receptor beta-chain genes in the thymus at an early stage after sublethal irradiation

    SciTech Connect

    Yuuki, H.; Yoshikai, Y.; Kishihara, K.; Matsuzaki, G.; Ayukawa, K.; Nomoto, K.


    The sequential appearance of the thymocyte subpopulations and TCR gene messages occurred in the thymus of AKR mice (H-2k, Mlsa) from 7 to 14 days after sublethal irradiation. The thymocytes on day 7 after irradiation were composed of a large number of CD4+CD8+ blast-like cells and a relatively high proportion of CD4-CD8- cells (15 to 25%) but few CD3highCD4+CD8-/CD4-CD8+ cells. Approximately 22% of the CD4-CD8- cells were CD3high and -27% of the CD3highCD4-CD8- cells (-6% of whole CD4-CD8- cells) were F23.1+. The thymocytes on day 7 expressed a large amount of gamma- and delta-chain gene transcripts but reduced levels of alpha- and beta-chain gene transcripts. The V gene repertoire of 18 functional beta-chain cDNA derived from the thymocytes on day 7 was compared with those of 20 functional beta-chain cDNA derived from the thymocytes on day 14 which were composed of a large number of CD3lowCD4+CD8+ small-sized cells and a small number of CD3highCD4+CD8- cells. It is noteworthy that the distribution of V beta genes expressed in the thymocytes on day 7 was much the same as that in the thymocytes on day 14 but significantly different from that in normal BALB/c thymocytes as previously described. Interestingly, neither V beta 8.1 nor V beta 6 genes, which are important for recognition of the product of the Mlsa locus, was detected in these two cDNA libraries. These results suggest that clonal selection of TCR V beta repertoire, irrespective of positive or negative selection, appears to occur at the early stage of T cell differentiation, i.e., on the blast-like CD4+CD8+ thymocytes.

  17. Comparative inter-strain sequence analysis of the putative regulatory region of murine psychostimulant-regulated gene GNB1 (G protein beta 1 subunit gene).


    Kitanaka, Nobue; Kitanaka, Junichi; Walther, Donna; Wang, Xiao-Bing; Uhl, George R


    We isolated a cDNA clone from a murine genomic library of C57BL/6 strain, carrying 13.8 kb of nucleotides including exon 1 of heterotrimeric GTP-binding protein beta 1 subunit gene (genetic symbol, GNB1) and 10.6 kb of the 5' flanking region. Sequence comparison with GNB1 gene locus from 129Sv strain revealed a 0.2% divergence in a 13.2 kb common region between these two strains. The divergence consisted of eight single nucleotide polymorphisms, three insertions and one deletion, with 129Sv used as the reference. The exon 1 and the putative regulation elements, such as cyclic AMP response element, AP1, AP2, Sp1 and nuclear factor-kappa B recognition sites, were perfectly conserved. The expression of GNB1 mRNA was significantly increased in mouse striatum 2 h after single methamphetamine administration with an approximately 150% expression level compared with the basal level. In contrast, no change in the expression level was observed in the cerebral cortex. After the chronic methamphetamine treatment regimen, the expression level of GNB1 mRNA did not change in any brain regions examined. These results suggest (1) that the 5' flanking nucleotide sequence of GNB1 gene was strictly conserved for its possible contribution to the same change in the expression level between the mouse strains in response to psychostimulants and (2) that the initial process of development of behavioral sensitization appeared to occur parallel to the significant increase in the expression level of GNB1 gene in the mouse striatum. PMID:14631649

  18. A new point mutation (C446R) in the thyroid hormone receptor-{beta} gene of a family with resistance to thyroid hormone

    SciTech Connect

    Weiss, R.E.; Chyna, B.; Hayashi, Yoshitaka; Sunthornthepvarakul, T.; Refetoff, S.; Duell, P.B.


    Resistance to thyroid hormone (RTH) is a condition of impaired end-organ responsiveness to thyroid hormone characterized by goiter and elevated thyroid hormone levels with an appropriately normal TSH. RTH has been associated with mutations in the thyroid hormone receptor-{beta} (TR{beta}) gene. The authors report studies carried out in 21 members of a family (F119), 12 of whom exhibited the RTH phenotype. A point mutation was detected in the T{sub 3}-binding domain of the TR{beta} gene. It resulted in replacement of the normal cysteine-446 with an arginine (C446R) that has not been previously reported. The clinical characteristics of this family are similar to those reported in other families with RTH, namely goiter, tachycardia, and learning disabilities. Thyroid function tests are also typical of other subjects with RTH. The mean values ({+-}SD) in untreated affected subjects compared to those in unaffected family members were: free T{sub 4} index, 250 {+-} 21 vs. 108 {+-} 13; total T{sub 3}, 4.3 {+-} 0.4 vs. 2.4 {+-} 0.4 nmol/L; and TSH, 4.5 {+-} 1.1 vs. 2.4 {+-} 1.1 mU/L. DNA samples from 18 family members were screened for the TR{beta} mutation, which results in the loss of a BsmI restriction site, and each of the 11 subjects with abnormal thyroid function tests were heterozygous for the mutant allele. The mutant TR{beta} expressed in Cos-I cells did not bind T{sub 3} (K{sub a} of C446R/wild-type, <0.05). T{sub 3} at a concentration up to 100 nmol/L failed to enhance the transactivation of a reporter gene, and the mutant receptor inhibited the T{sub 3}-mediated transcriptional activation of the wild-type TR{beta}. 17 refs., 3 figs., 1 tab.

  19. Isolation and characterization of a beta-lactamase-inhibitory protein from Streptomyces clavuligerus and cloning and analysis of the corresponding gene.

    PubMed Central

    Doran, J L; Leskiw, B K; Aippersbach, S; Jensen, S E


    Culture filtrates of Streptomyces clavuligerus contain a proteinaceous beta-lactamase inhibitor (BLIP) in addition to a variety of beta-lactam compounds. BLIP was first detected by its ability to inhibit Bactopenase, a penicillinase derived from Bacillus cereus, but it has also been shown to inhibit the plasmid pUC- and chromosomally mediated beta-lactamases of Escherichia coli. BLIP showed no inhibitory effect against Enterobacter cloacae beta-lactamase, and it also showed no activity against an alternative source of B. cereus penicillinase. BLIP was purified to homogeneity, and sodium dodecyl sulfate-polyacrylamide gel electrophoresis gave a size estimate for BLIP of 16,900 to 18,000. The interaction between purified BLIP and the E. coli(pUC) beta-lactamase was investigated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and determined to be noncovalent, with an estimated 1:1 molar stoichiometry. The BLIP gene was isolated on a 13.5-kilobase fragment of S. clavuligerus chromosomal DNA which did not overlap a 40-kilobase region of DNA known to contain genes for beta-lactam antibiotic biosynthesis. The gene encoded a mature protein with a deduced amino acid sequence of 165 residues (calculated molecular weight of 17,523) and also encoded a 36-amino-acid signal sequence. No significant sequence similarity to BLIP was found by pairwise comparisons using various protein and nucleotide sequence data banks or by hybridization experiments, and no BLIP activity was detected in the culture supernatants of other Streptomyces spp. Images PMID:2203736

  20. Searching for Beta-Haemolysin hlb Gene in Staphylococcus pseudintermedius with Species-Specific Primers.


    Kmieciak, Wioletta; Szewczyk, Eligia M; Ciszewski, Marcin


    The paper presents an analysis of 51 Staphylococcus pseudintermedius clinically isolated strains from humans and from animals. Staphylococcus pseudintermedius strains' ability to produce β-haemolysin was evaluated with phenotypic methods (hot-cold effect, reverse CAMP test). In order to determine the hlb gene presence (coding for β-haemolysin) in a genomic DNA, PCR reactions were conducted with two different pairs of primers: one described in the literature for Staphylococcus aureus and recommended for analysing SIG group staphylococci and newly designed one in CLC Main Workbench software. Only reactions with newly designed primers resulted in product amplification, the presence of which was fully compatible with the results of phenotypic β-haemolysin test. Negative results for S. aureus and S. intermedius reference ATCC strains suggest that after further analysis the fragment of hlb gene amplified with primers described in this study might be included in the process of S. pseudintermedius strains identification. PMID:27086303

  1. A screen for identifying genes interacting with armadillo, the Drosophila homolog of beta-catenin.

    PubMed Central

    Greaves, S; Sanson, B; White, P; Vincent, J P


    Drosophila Armadillo is a multifunctional protein implicated in both cell adhesion, as a catenin, and cell signaling, as part of the Wingless signal transduction pathway. We have generated viable fly stocks with alterations in the level of Armadillo available for signaling. Flies from one stock overexpress Armadillo and, as a result, have increased vein material and bristles in the wings. Flies from the other stock have reduced cytoplasmic Armadillo following overexpression of the intracellular domain of DE-cadherin. These flies display a wing-notching phenotype typical of wingless mutations. Both misexpression phenotypes can be dominantly modified by removing one copy of genes known to encode members of the wingless pathway. Here we describe the identification of further mutations that dominantly modify the Armadillo misexpression phenotypes. These mutations are in genes encoding three different functions: establishment and maintenance of adherens junctions, cell cycle control, and Egfr signaling. PMID:10581282

  2. Opposing action of estrogen receptors alpha and beta on cyclin D1 gene expression.


    Liu, Meng-Min; Albanese, Chris; Anderson, Carol M; Hilty, Kristin; Webb, Paul; Uht, Rosalie M; Price, Richard H; Pestell, Richard G; Kushner, Peter J


    Induction of cyclin D1 gene transcription by estrogen receptor alpha (ERalpha) plays an important role in estrogen-mediated proliferation. There is no classical estrogen response element in the cyclin D1 promoter, and induction by ERalpha has been mapped to an alternative response element, a cyclic AMP-response element at -57, with possible participation of an activating protein-1 site at -954. The action of ERbeta at the cyclin D1 promoter is unknown, although evidence suggests that ERbeta may inhibit the proliferative action of ERalpha. We examined the response of cyclin D1 promoter constructs by luciferase assay and the response of the endogenous protein by Western blot in HeLa cells transiently expressing ERalpha, ERalphaK206A (a derivative that is superactive at alternative response elements), or ERbeta. In each case, ER activation at the cyclin D1 promoter is mediated by both the cyclic AMP-response element and the activating protein-1 site, which play partly redundant roles. The activation by ERbeta occurs only with antiestrogens. Estrogens, which activate cyclin D1 gene expression with ERalpha, inhibit expression with ERbeta. Strikingly, the presence of ERbeta completely inhibits cyclin D1 gene activation by estrogen and ERalpha or even by estrogen and the superactive ERalphaK206A. The observation of the opposing action and dominance of ERbeta over ERalpha in activation of cyclin D1 gene expression has implications for the postulated role of ERbeta as a modulator of the proliferative effects of estrogen. PMID:11986316

  3. Cloning and Expression of Beta Subunit Gene of Phycocyanin From Spirulina platensis in Escherichia coli

    PubMed Central

    Shoja, Zahra; Rajabi Memari, Hamid; Roayaei Ardakani, Mohammd


    Background: C-Phycocyanin (C-PC) from blue-green algae such as Spirulina has been reported to have various pharmacological characteristics, including anti-inflammatory and anti-tumor activities. Recombinant β-subunit of C-PC (C-PC/β) is an inhibitor of cell proliferation and an inducer of cancer cell apoptosis. Objectives: Since C-PC/β has a big potential to be used as a promising cancer prevention or therapy agent, the purpose of this study was to clone and express Spirulina platensis cpcB gene in a bacterial expression system. This is a significant step for the production of this compound. Materials and Methods: The cpcB gene was amplified using specific primers and cloned in a bacterial expression vector, namely pET43.1a+. Gene expression of cpcB was analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and the dot blotting technique. Results: The SDS-PAGE analysis and dot blotting confirmed the production of recombinant C-PC/β in the bacterial expression system. Over-expression of cpcB gene was optimized in induction by 1 mM Isopropyl-β-D-Thiogalactoside (IPTG), after four hours of inoculation at 30°C. Conclusions: Over-expression of the synthetic CPC/β protein in the bacterial system (Escherichia coli BL-21) showed that E. coli can be used as a basis for further research to produce this desired protein in large quantities. PMID:26464761

  4. Expression of. beta. -conglycinin gene driven by CaMV /sup 35/S promoter in transgenic plants

    SciTech Connect

    Nakamura, I.; Dube, P.H.; Beachy, R.N.


    ..beta..-conglycinin is a abundant protein stored in protein bodies of soybean seeds. This protein consists of three major subunits, ..cap alpha..' (76 kDa), ..cap alpha.. (72 kDa) and ..beta.. (53 kDa), and accumulates in developing soybean embryos during the mid- to late-maturation stages of seed development. Coding sequence of an ..cap alpha..'-subunit gene was expressed in transgenic petunia plants under control of the promoter from the CaMV (cauliflower mosaic virus) /sup 35/S transcript. Two different types of ..cap alpha..'-protein accumulated in tissues of the transgenic plant; seed-type ..cap alpha..'-protein accumulated only in seeds during mid- to late-maturation stages, while non-seed-type ..cap alpha..'-protein was found in non-seed tissues and in early stages of seed maturation. Seed-type ..cap alpha..'-protein was the same size as soybean ..cap alpha..'-subunit, while non-seed-type ..cap alpha..'-protein was larger by about 4 kDa. Seeds contained approximately 30-fold greater levels of ..cap alpha..'-protein than did non-seed tissues. This is presumably due to differences in protein stability because the amount of ..cap alpha..'-mRNA was equivalent in each of the tissues examined. The ..cap alpha..'-protein in leaves was localized in microsomal membrane fractions. Proteins solubilized from the membranes were sedimented by sucrose gradient centrifugation and analyzed by immuno blot technique. The results suggest that the protein assembles into multimeric forms in leaf membranes, as it does in seed protein bodies.

  5. Requirement of a novel splicing variant of human histone deacetylase 6 for TGF-{beta}1-mediated gene activation

    SciTech Connect

    Zhuang, Yan; Nguyen, Hong T.; Lasky, Joseph A.; Cao, Subing; Li, Cui; Hu, Jiyao; Guo, Xinyue; Burow, Matthew E.; Shan, Bin


    Histone deacetylase 6 (HDAC6) belongs to the family of class IIb HDACs and predominantly deacetylates non-histone proteins in the cytoplasm via the C-terminal deacetylase domain of its two tandem deacetylase domains. HDAC6 modulates fundamental cellular processes via deacetylation of {alpha}-tubulin, cortactin, molecular chaperones, and other peptides. Our previous study indicates that HDAC6 mediates TGF-{beta}1-induced epithelial-mesenchymal transition (EMT) in A549 cells. In the current study, we identify a novel splicing variant of human HDAC6, hHDAC6p114. The hHDAC6p114 mRNA arises from incomplete splicing and encodes a truncated isoform of the hHDAC6p114 protein of 114 kDa when compared to the major isoform hHDAC6p131. The hHDAC6p114 protein lacks the first 152 amino acids from N-terminus in the hHDAC6p131 protein, which harbors a nuclear export signal peptide and 76 amino acids of the N-terminal deacetylase domain. hHDAC6p114 is intact in its deacetylase activity against {alpha}-tubulin. The expression hHDAC6p114 is elevated in a MCF-7 derivative that exhibits an EMT-like phenotype. Moreover, hHDAC6p114 is required for TGF-{beta}1-activated gene expression associated with EMT in A549 cells. Taken together, our results implicate that expression and function of hHDAC6p114 is differentially regulated when compared to hHDAC6p131.

  6. Mapping of the {alpha}{sub 4} subunit gene (GABRA4) to human chromosome 4 defines an {alpha}{sub 2}-{alpha}{sub 4}-{beta}{sub 1}-{gamma}{sub 1} gene cluster: Further evidence that modern GABA{sub a} receptor gene clusters are derived from an ancestral cluster

    SciTech Connect

    McLean, P.J.; Farb, D.H.; Russek, S.J.


    We demonstrated previously that an {alpha}{sub 1}-{beta}{sub 2}-{gamma}{sub 2} gene cluster of the {gamma}-aminobutyric acid (GABA{sub A}) receptor is located on human chromosome 5q34-q35 and that an ancestral {alpha}-{beta}-{gamma} gene cluster probably spawned clusters on chromosomes 4, 5, and 15. Here, we report that the {alpha}{sub 4} gene (GABRA4) maps to human chromosome 4p14-q12, defining a cluster comprising the {alpha}{sub 2}, {alpha}{sub 4}, {beta}{sub 1}, and {gamma}{sub 1} genes. The existence of an {alpha}{sub 2}-{alpha}{sub 4}-{beta}{sub 1}-{gamma}{sub 2} cluster on chromosome 4 and an {alpha}{sub 1}-{alpha}{sub 6}-{beta}{sub 2}-{gamma}{sub 2} cluster on chromosome 5 provides further evidence that the number of ancestral GABA{sub A} receptor subunit genes has been expanded by duplication within an ancestral gene cluster. Moreover, if duplication of the {alpha} gene occurred before duplication of the ancestral gene cluster, then a heretofore undiscovered subtype of a subunit should be located on human chromosome 15q11-q13 within an {alpha}{sub 5}-{alpha}{sub x}-{beta}{sub 3}-{gamma}{sub 3} gene cluster at the locus for Angelman and Prader-Willi syndromes. 34 refs., 6 figs., 1 tab.

  7. Presence of blaPER-1 and blaVEB-1 beta-lactamase genes among isolates of Pseudomonas aeruginosa from South West of Iran.


    Davodian, Elham; Sadeghifard, Nourkhoda; Ghasemian, Abdolmajid; Noorbakhsh, Samileh


    Pseudomonas aeruginosa isolates have acquired resistance to antibiotics such as novel beta-lactams. The aim of this study was to investigate the blaPER-1, blaVEB-1, and blaPSE-1 genes among isolates of P. aeruginosa among intensive care unit (ICU) patients. Sixty-five isolates were collected. The antibiotic susceptibility testing and combined disk tests were performed to detect the isolates producing extended spectrum beta-lactamases (ESBLs) among ceftazidime-resistant isolates. Polymerase chain reaction (PCR) amplification of blaPER-1, blaVEB-1, and blaPSE-1 genes was conducted. Ten (15.3%) isolates were ESBL-positive, of which 40% (n=4) belonged to males and 60% (n=6) were collected from females. Moreover, two and one isolates harbored blaPER-1 and blaVEB-1 genes, respectively. PMID:26944896

  8. Pancreatic desmoid-type fibromatosis with beta-catenin gene mutation-Report of a case and review of the literature.


    Tsukamoto, Yoshitane; Imakita, Masami; Nishitani, Akiko; Ito, Toshikazu; Izukura, Masaaki; Hirota, Seiichi


    We experienced a rare case of pancreatic desmoid-type fibromatosis (DTF) in a 75-year-old Japanese woman. She was asymptomatic but routine examination including ultrasonography revealed a mass in the abdomen. For precise examination, she was referred to the regional hospital. Computed tomography showed that the mass was protruding anteriorly from the left-sided pancreas. Because of the enlargement of the mass lesion, distal pancreatectomy with splenectomy was performed after about 3 months. Macroscopically, the mass was encapsulated and approximately 8cm in diameter. Histological examination revealed that spindle or blunt stellate cells were proliferating in parallel or storiform fashion with myxoid and fibrous background. The tumor cells did not show prominent atypia and mitoses were rarely seen, suggesting that the tumor was low grade or borderline. Immunohistochemistry showed obvious nuclear staining of beta-catenin. Furthermore, analysis of beta-catenin gene revealed that the tumor had a typical missense mutation of threonine to alanine at colon 41 (T41A) in exon 3. These findings confirmed the pathological diagnosis of DTF of the pancreas. To the best of our knowledge, 18 cases of pancreatic DTF have been reported in the English literature and beta-catenin gene mutation had been examined in only one case among them. Thus, our case is the 19th pancreatic DTF and the second case with confirmed beta-catenin gene mutation. PMID:26907785

  9. In vitro effects of mycophenolic acid on survival, function, and gene expression of pancreatic beta-cells.


    Gallo, R; Natale, M; Vendrame, F; Boggi, U; Filipponi, F; Marchetti, P; Laghi Pasini, F; Dotta, F


    Post-transplant diabetes mellitus represents an important complication of prolonged immunosuppressive treatment after solid organ transplantation. The immunosuppressive toxicity, responsible for a persistent impairment of glucose metabolism in pancreatic islet-transplanted patients, is mainly attributed to calcineurin inhibitors and steroids, while other immunosuppressive molecules (azathioprine and mycophenolic acid, MPA) are considered not to have a toxic effect. In the present study, in vitro effects of MPA have been investigated in mouse beta-cell lines (βTC-1 and βTC-6) and in purified human pancreatic islets. βTC-1, βTC-6, and human pancreatic islets were exposed to various concentrations of MPA for different times. Consequently, we evaluated the viability, the induction of apoptosis, the glucose-stimulated insulin secretion, and the expression of β-cell function genes (Isl1, Pax6, Glut-2, glucokinase) and apoptosis-related genes (Bax and Bcl2). βTC-1, βTC-6, and human islets treated, respectively, for 48 and 72 h with 15-30 nM MPA showed altered islet architecture, as compared with control cells. We observed for βTC-1 and βTC-6 almost 70% reduction in cell viability; three to sixfold induction of TUNEL/apoptotic-positive cells quantified by FACS analysis. A twofold increase in apoptotic cells was observed in human islets after MPA exposure associated with strong inhibition of glucose-stimulated insulin secretion. Furthermore, we showed significant down-regulation of gene expression of molecules involved in β-cell function and increase rate between Bax/Bcl2. Our data demonstrate that MPA has an in vitro diabetogenic effect interfering at multiple levels with survival and function of murine and human pancreatic β-cells. PMID:22249339

  10. Association of Transforming Growth Factor Beta-1-509C/T Gene Polymorphism with Ischemic Stroke: A Meta Analysis

    PubMed Central

    Kumar, Pradeep; Kumar, Amit; Srivastava, Mukesh Kumar; Misra, Shubham; Pandit, Awadh Kishor; Prasad, Kameshwar


    Introduction: Transforming Growth Factor-Beta 1 (TGF-β1) is a pleiotropic cytokine with potent anti-inflammatory property, which has been considered as an essential risk factor in the inflammatory process of Ischemic Stroke (IS), by involving in the pathophysiological progression of hypertension, atherosclerosis, and lipid metabolisms. -509C/T TGF-β1 gene polymorphism has been found to be associated with the risk of IS. The aim of this meta-analysis was to provide a relatively comprehensive account of the relation between -509C/T gene polymorphisms of TGF-β1 and susceptibility to IS. Methods: A review of literature for eligible genetic association Studies published before October 20, 2014 was conducted in the PubMed, EMBASE, Google Scholar and Trip database. The strength of association was calculated by pooled odds ratios (ORs) with 95% confidence intervals using RevMan 5.3 software. Heterogeneity was examined using Higgins I-squared, Tau-squared, and Chi-squared tests. Results: A total of 2 studies involving 614 cases and 617 controls were found. The overall estimates did not show any significant relation between TGF-β1-509C/T polymorphism and risk of IS under dominant (CC+CT vs. TT: OR=1.01, 95%CI=0.31 to 3.26; P=0.99), recessive (CC vs. CT+TT: OR=0.94, 95%CI=0.47 to 1.90; P=0.87), and allelic models (T vs. C: OR=1.06, 95%CI=0.55 to 2.04; P=0.86). Conclusion: This meta-analysis showed that TGF-β1-509C/T gene polymorphism has no significant association with the susceptibility of IS. Further well-designed prospective studies with larger sample size are needed to confirm these findings. PMID:27303603

  11. Developmental changes in DNA methylation and covalent histone modifications of chromatin associated with the epsilon-, gamma-, and beta-globin gene promoters in Papio anubis.


    Lavelle, Donald; Vaitkus, Kestis; Hankewych, Maria; Singh, Mahipal; DeSimone, Joseph


    The baboon is a suitable and relevant animal model to study the mechanism of human globin gene switching. This investigation addresses the role of DNA methylation and histone coding in globin gene switching in the baboon, Papio anubis. Bisulfite sequencing and chromatin immunoprecipitation studies were performed in erythroid cells purified from fetuses of varying gestational ages and from adult bone marrow to analyze the manner that changes in DNA methylation of the epsilon-, gamma-, and beta-globin promoters and association of ac-H3, ac-H4, H3-dimeK4, H3-dimeK36, and H3-dimeK79 with the epsilon-, gamma-, and beta-globin promoters occur during development. Changes in DNA methylation of the epsilon- and gamma-globin gene promoters during transitional stages of globin gene switching were consistent with the stochastic model of methylation and a role of DNA methylation in gene silencing. Enrichment of ac-H3, ac-H4, and pol II at the promoters of developmentally active genes was observed, while the pattern of distribution of H3-dimeK4 and H3-dimeK79 suggests that these modifications are found near both currently and formerly active promoters. Enrichment of H3-dimeK36 at the silenced epsilon-globin gene promoter was observed. These studies demonstrate that coordinated epigenetic modifications in the chromatin structure of the beta-like globin gene promoters accompany the highly regulated changes in expression patterns of these genes during development. PMID:16527500

  12. Gene Network Analysis of Metallo Beta Lactamase Family Proteins Indicates the Role of Gene Partners in Antibiotic Resistance and Reveals Important Drug Targets.


    Parimelzaghan, Anitha; Anbarasu, Anand; Ramaiah, Sudha


    Metallo Beta (β) Lactamases (MBL) are metal dependent bacterial enzymes that hydrolyze the β-lactam antibiotics. In recent years, MBL have received considerable attention because it inactivates most of the β-lactam antibiotics. Increase in dissemination of MBL encoding antibiotic resistance genes in pathogenic bacteria often results in unsuccessful treatments. Gene interaction network of MBL provides a complete understanding on the molecular basis of MBL mediated antibiotic resistance. In our present study, we have constructed the MBL network of 37 proteins with 751 functional partners from pathogenic bacterial spp. We found 12 highly interconnecting clusters. Among the 37 MBL proteins considered in the present study, 22 MBL proteins are from B3 subclass, 14 are from B1 subclass and only one is from B2 subclass. Global topological parameters are used to calculate and compare the probability of interactions in MBL proteins. Our results indicate that the proteins associated within the network have a strong influence in antibiotic resistance mechanism. Interestingly, several drug targets are identified from the constructed network. We believe that our results would be helpful for researchers exploring MBL-mediated antibiotic resistant mechanisms. J. Cell. Biochem. 117: 1330-1339, 2016. © 2015 Wiley Periodicals, Inc. PMID:26517410

  13. The search for mutations in the gene for the beta subunit of the cGMP phosphodiesterase (PDEB) in patients with autosomal recessive retinitis pigmentosa

    SciTech Connect

    Riess, O.; Weber, B.; Hayden, M.R. ); Noerremoelle, A. ); Musarella, M.A. )


    The finding of a mutation in the beta subunit of the cyclic GMP (cGMP) phosphodiesterase gene causing retinal degeneration in mice (the Pdeb gene) prompted a search for disease-causing mutations in the human phosphodiesterase gene (PDEB gene) in patients with retinitis pigmentosa. All 22 exons including 196 bp of the 5[prime] region of the PDEB gene have been assessed for mutations by using single-strand conformational polymorphism analysis in 14 patients from 13 unrelated families with autosomal recessive retinitis pigmentosa (ARRP). No disease-causing mutations were found in this group of affected individuals of seven different ancestries. However, a frequent intronic and two exonic polymorphisms (Leu[sup 489][yields]Gln and Gly[sup 842][yields]Gly) were identified. Segregation analysis using these polymorphic sites excludes linkage of ARRP to the PDEB gene in a family with two affected children. 43 refs., 3 figs., 2 tabs.

  14. Commensal Enterobacteriaceae as reservoirs of extended-spectrum beta-lactamases, integrons, and sul genes in Portugal

    PubMed Central

    Machado, Elisabete; Coque, Teresa M.; Cantón, Rafael; Sousa, João C.; Peixe, Luísa


    Bacteria colonizing the human intestine have a relevant role in the spread of antimicrobial resistance. We investigated the faecal carriage of extended-spectrum beta-lactamase (ESBL)-producing Enterobacteriaceae in healthy humans from Portugal and analyzed the distribution of sul genes and class 1 and 2 integrons. Faecal samples (n = 113) were recovered from healthy persons (North/Centre of Portugal, 2001–2004) and plated on MacConkey agar with and without ceftazidime (1 mg/L) or cefotaxime (1 mg/L). Isolates representing different morphotypes/plate and antibiotic susceptibility patterns (n = 201) were selected. Isolates resistant to sulfonamides and/or streptomycin, gentamicin, and trimethoprim were screened (PCR and sequencing) for sul genes (sul1, sul2, sul3) and class 1 and 2 integrons. Presence of